Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Ethical Perspectives on RNA Interference Therapeutics
Ebbesen, Mette; Jensen, Thomas G.; Andersen, Svend; Pedersen, Finn Skou
2008-01-01
RNA interference is a mechanism for controlling normal gene expression which has recently begun to be employed as a potential therapeutic agent for a wide range of disorders, including cancer, infectious diseases and metabolic disorders. Clinical trials with RNA interference have begun. However, challenges such as off-target effects, toxicity and safe delivery methods have to be overcome before RNA interference can be considered as a conventional drug. So, if RNA interference is to be used therapeutically, we should perform a risk-benefit analysis. It is ethically relevant to perform a risk-benefit analysis since ethical obligations about not inflicting harm and promoting good are generally accepted. But the ethical issues in RNA interference therapeutics not only include a risk-benefit analysis, but also considerations about respecting the autonomy of the patient and considerations about justice with regard to the inclusion criteria for participation in clinical trials and health care allocation. RNA interference is considered a new and promising therapeutic approach, but the ethical issues of this method have not been greatly discussed, so this article analyses these issues using the bioethical theory of principles of the American bioethicists, Tom L. Beauchamp and James F. Childress. PMID:18612370
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing
Salton, Maayan; Kasprzak, Wojciech K.; Voss, Ty; Shapiro, Bruce A.; Poulikakos, Poulikos I.; Misteli, Tom
2015-01-01
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signaling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumors. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumor formation and slows growth of vemurafenib-resistant tumors. Our results identify an intronic mutation as a molecular basis for RNA splicing-mediated RAF inhibitor resistance and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma. PMID:25971842
Inhibition of vemurafenib-resistant melanoma by interference with pre-mRNA splicing.
Salton, Maayan; Kasprzak, Wojciech K; Voss, Ty; Shapiro, Bruce A; Poulikakos, Poulikos I; Misteli, Tom
2015-05-14
Mutations in the serine/threonine kinase BRAF are found in more than 60% of melanomas. The most prevalent melanoma mutation is BRAF(V600E), which constitutively activates downstream MAPK signalling. Vemurafenib is a potent RAF kinase inhibitor with remarkable clinical activity in BRAF(V600E)-positive melanoma tumours. However, patients rapidly develop resistance to vemurafenib treatment. One resistance mechanism is the emergence of BRAF alternative splicing isoforms leading to elimination of the RAS-binding domain. Here we identify interference with pre-mRNA splicing as a mechanism to combat vemurafenib resistance. We find that small-molecule pre-mRNA splicing modulators reduce BRAF3-9 production and limit in-vitro cell growth of vemurafenib-resistant cells. In xenograft models, interference with pre-mRNA splicing prevents tumour formation and slows growth of vemurafenib-resistant tumours. Our results identify an intronic mutation as the molecular basis for a RNA splicing-mediated RAF inhibitor resistance mechanism and we identify pre-mRNA splicing interference as a potential therapeutic strategy for drug resistance in BRAF melanoma.
RNA Interference: Biology, Mechanism, and Applications
Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.
2003-01-01
Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of
Prokaryotic Argonautes - variations on the RNA interference theme.
van der Oost, John; Swarts, Daan C; Jore, Matthijs M
2014-04-15
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
Argonaute Proteins and Mechanisms of RNA Interference in Eukaryotes and Prokaryotes.
Olina, A V; Kulbachinskiy, A V; Aravin, A A; Esyunina, D M
2018-05-01
Noncoding RNAs play essential roles in genetic regulation in all organisms. In eukaryotic cells, many small noncoding RNAs act in complex with Argonaute proteins and regulate gene expression by recognizing complementary RNA targets. The complexes of Argonaute proteins with small RNAs also play a key role in silencing of mobile genetic elements and, in some cases, viruses. These processes are collectively called RNA interference. RNA interference is a powerful tool for specific gene silencing in both basic research and therapeutic applications. Argonaute proteins are also found in prokaryotic organisms. Recent studies have shown that prokaryotic Argonautes can also cleave their target nucleic acids, in particular DNA. This activity of prokaryotic Argonautes might potentially be used to edit eukaryotic genomes. However, the molecular mechanisms of small nucleic acid biogenesis and the functions of Argonaute proteins, in particular in bacteria and archaea, remain largely unknown. Here we briefly review available data on the RNA interference processes and Argonaute proteins in eukaryotes and prokaryotes.
RNA therapeutics: Beyond RNA interference and antisense oligonucleotides
Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney
2016-01-01
Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036
Generation of siRNA Nanosheets for Efficient RNA Interference
NASA Astrophysics Data System (ADS)
Kim, Hyejin; Lee, Jae Sung; Lee, Jong Bum
2016-04-01
After the discovery of small interference RNA (siRNA), nanostructured siRNA delivery systems have been introduced to achieve an efficient regulation of the target gene expression. Here we report a new siRNA-generating two dimensional nanostructure in a formation of nanosized sheet. Inspired by tunable mechanical and functional properties of the previously reported RNA membrane, siRNA nanosized sheets (siRNA-NS) with multiple Dicer cleavage sites were prepared. The siRNA-NS has two dimensional structure, providing a large surface area for Dicer to cleave the siRNA-NS for the generation of functional siRNAs. Furthermore, downregulation of the cellular target gene expression was achieved by delivery of siRNA-NS without chemical modification of RNA strands or conjugation to other substances.
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
Interference and Polarized Light.
ERIC Educational Resources Information Center
Charas, Seymour
1988-01-01
Discusses a demonstration of interference phenomena using three sheets of polaroid material, a light source, and a light meter. Describes instructional procedures with mathematical expressions and a diagram. (YP)
Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
RNA virus interference via CRISPR/Cas13a system in plants.
Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy
2018-01-04
CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.
Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-01-01
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-03-03
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.
RNA Interference Therapies for an HIV-1 Functional Cure.
Scarborough, Robert J; Gatignol, Anne
2017-12-27
HIV-1 drug therapies can prevent disease progression but cannot eliminate HIV-1 viruses from an infected individual. While there is hope that elimination of HIV-1 can be achieved, several approaches to reach a functional cure (control of HIV-1 replication in the absence of drug therapy) are also under investigation. One of these approaches is the transplant of HIV-1 resistant cells expressing anti-HIV-1 RNAs, proteins or peptides. Small RNAs that use RNA interference pathways to target HIV-1 replication have emerged as competitive candidates for cell transplant therapy and have been included in all gene combinations that have so far entered clinical trials. Here, we review RNA interference pathways in mammalian cells and the design of therapeutic small RNAs that use these pathways to target pathogenic RNA sequences. Studies that have been performed to identify anti-HIV-1 RNA interference therapeutics are also reviewed and perspectives on their use in combination gene therapy to functionally cure HIV-1 infection are provided.
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.
Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C
2017-01-01
The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems
Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther
2017-01-01
ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
[RNA interference: biogenesis molecular mechanisms and its applications in cervical cancer].
Peralta-Zaragoza, Oscar; Bermúdez-Morales, Víctor Hugo; Madrid-Marina, Vicente
2010-01-01
RNAi (RNA interference) is a natural process by which eukaryotic cells silence gene expression through small interference RNAs (siRNA) which are complementary to messenger RNA (mRNA). In this process, the siRNA that are 21-25 nucleotides long and are known as microRNA (miRNA), either associate with the RNA-induced silencing complex (RISC), which targets and cleaves the complementary mRNAs by the endonucleolytic pathway, or repress the translation. It is also possible to silence exogenous gene expression during viral infections by using DNA templates to transcribe siRNA with properties that are identical to those of bioactive microRNA. Persistent human papillomavirus (HPV) infection is the main etiological agent during cervical cancer development and the HPV E6 and E7 oncogenes, which induce cellular transformation and immortalization, represent strategic targets to be silenced with siRNA. In several in vitro and in vivo studies, it has been demonstrated that the introduction of siRNA directed against the E6 and E7 oncogenes in human tumoral cervical cells transformed by HPV, leads to the efficient silencing of HPV E6 and E7 oncogene expression, which induces the accumulation of the products of the p53 and pRb tumor suppressor genes and activates the mechanism of programmed cell death by apoptosis; thus, the progression of the tumoral growth process may be prevented. The goal of this review is to analyze the microRNA biogenesis process in the silencing of gene expression and to discuss the different protocols for the use of siRNA as a potential gene therapy strategy for the treatment of cervical cancer.
The promises and pitfalls of RNA-interference-based therapeutics
Castanotto, Daniela; Rossi, John J.
2009-01-01
The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Rp-phosphorothioate modifications in RNase P RNA that interfere with tRNA binding.
Hardt, W D; Warnecke, J M; Erdmann, V A; Hartmann, R K
1995-01-01
We have used Rp-phosphorothioate modifications and a binding interference assay to analyse the role of phosphate oxygens in tRNA recognition by Escherichia coli ribonuclease P (RNase P) RNA. Total (100%) Rp-phosphorothioate modification at A, C or G positions of RNase P RNA strongly impaired tRNA binding and pre-tRNA processing, while effects were less pronounced at U positions. Partially modified E. coli RNase P RNAs were separated into tRNA binding and non-binding fractions by gel retardation. Rp-phosphorothioate modifications that interfered with tRNA binding were found 5' of nucleotides A67, G68, U69, C70, C71, G72, A130, A132, A248, A249, G300, A317, A330, A352, C353 and C354. Manganese rescue at positions U69, C70, A130 and A132 identified, for the first time, sites of direct metal ion coordination in RNase P RNA. Most sites of interference are at strongly conserved nucleotides and nine reside within a long-range base-pairing interaction present in all known RNase P RNAs. In contrast to RNase P RNA, 100% Rp-phosphorothioate substitutions in tRNA showed only moderate effects on binding to RNase P RNAs from E. coli, Bacillus subtilis and Chromatium vinosum, suggesting that pro-Rp phosphate oxygens of mature tRNA contribute relatively little to the formation of the tRNA-RNase P RNA complex. Images PMID:7540978
RNA interference: from biology to drugs and therapeutics.
Appasani, Krishnarao
2004-07-01
RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.
2012-01-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J
2012-05-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
Ahn, Jeonghyun; Ko, Ara; Jun, Eun Jung; Won, Minah; Kim, Yoo Kyum; Ju, Eun-Seon
2012-01-01
Antiviral therapeutics are currently unavailable for treatment of coxsackievirus B3, which can cause life-threatening myocarditis. A modified small interfering RNA (siRNA) containing 5′-triphosphate, 3p-siRNA, was shown to induce RNA interference and interferon activation. We aimed to develop a potent antiviral treatment using CVB3-specific 3p-siRNA and to understand its underlying mechanisms. Virus-specific 3p-siRNA was superior to both conventional virus-specific siRNA with an empty hydroxyl group at the 5′ end (OH-siRNA) and nonspecific 3p-siRNA in decreasing viral replication and subsequent cytotoxicity. A single administration of 3p-siRNA dramatically attenuated virus-associated pathological symptoms in mice with no signs of toxicity, and their body weights eventually reached the normal range. Myocardial inflammation and fibrosis were rare, and virus production was greatly reduced. A nonspecific 3p-siRNA showed relatively less protective effect under identical conditions, and a virus-specific OH-siRNA showed no protective effects. We confirmed that virus-specific 3p-siRNA simultaneously activated target-specific gene silencing and type I interferon signaling. We provide a clear proof of concept that coxsackievirus B3-specific 3p-siRNA has 2 distinct modes of action, which significantly enhance antiviral activities with minimal organ damage. This is the first direct demonstration of improved antiviral effects with an immunostimulatory virus-specific siRNA in coxsackievirus myocarditis, and this method could be applied to many virus-related diseases. PMID:22508300
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
Oelmüller, Rolf; Briggs, Winslow R.
1990-01-01
Induction of nitrate reductase activity and mRNA by nitrate and light is prevented if chloroplasts are destroyed by photooxidation in norflurazon-treated squash (Cucurbita maxima L.) cotyledons. The enzyme activity and mRNA can be induced if norflurazon-treated squash seedlings are kept in low-intensity red light, which minimizes photodamage to the plastids. It is concluded that induction of nitrate reductase activity and nitrate reductase mRNA requires intact plastids. If squash seedlings grown in low-intensity red light are transferred to photooxidative white light, nitrate reductase activity accumulates during the first 12 hours after the shift and declines thereafter. Thus photodamage to the plastids and the disappearance of nitrate reductase activity and mRNA are events separable in time, and disappearance of the enzyme activity is a consequence of the damage to the plastids. Images Figure 1 Figure 3 Figure 4 PMID:16667294
Korde, Asawari; Rosselot, Jessica M.; Donze, David
2014-01-01
The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
RNA major groove modifications improve siRNA stability and biological activity
Terrazas, Montserrat; Kool, Eric T.
2009-01-01
RNA 5-methyl and 5-propynyl pyrimidine analogs were substituted into short interfering RNAs (siRNAs) to probe major groove steric effects in the active RNA-induced silencing complex (RISC). Synthetic RNA guide strands containing varied combinations of propynyl and methyl substitution revealed that all C-5 substitutions increased the thermal stability of siRNA duplexes containing them. Cellular gene suppression experiments using luciferase targets in HeLa cells showed that the bulky 5-propynyl modification was detrimental to RNA interference activity, despite its stabilization of the helix. Detrimental effects of this substitution were greatest at the 5′-half of the guide strand, suggesting close steric approach of proteins in the RISC complex with that end of the siRNA/mRNA duplex. However, substitutions with the smaller 5-methyl group resulted in gene silencing activities comparable to or better than that of wild-type siRNA. The major groove modifications also increased the serum stability of siRNAs. PMID:19042976
Silence of the transcripts: RNA interference in medicine.
Barik, Sailen
2005-10-01
Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
Respiratory viral diseases: access to RNA interference therapy
Bitko, Vira; Barik, Sailen
2008-01-01
This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824
The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.
Pham, John W; Sontheimer, Erik J
2005-11-25
Complexes in the Drosophila RNA-induced silencing complex (RISC) assembly pathway can be resolved using native gel electrophoresis, revealing an initiator called R1, an intermediate called R2, and an effector called R3 (now referred to as holo-RISC). Here we show that R1 forms when the Dicer-2/R2D2 heterodimer binds short interfering RNA (siRNA) duplexes. The heterodimer alone can initiate RISC assembly, indicating that other factors are dispensable for initiation. During assembly, R2 requires Argonaute 2 to convert into holo-RISC. This requirement is reminiscent of the RISC-loading complex, which also requires Argonaute 2 for assembly into RISC. We have compared R2 to the RISC-loading complex and show that the two complexes are similar in their sensitivities to ATP and to chemical modifications on siRNA duplexes, indicating that they are likely to be identical. We have examined the requirements for RISC formation and show that the siRNA 5'-termini are repeatedly monitored during RISC assembly, first by the Dcr-2/R2D2 heterodimer and again after R2 formation, before siRNA unwinding. The 2'-position of the 5'-terminal nucleotide also affects RISC assembly, because an siRNA strand bearing a 2'-deoxyribose at this position can inhibit the cognate strand from entering holo-RISC; in contrast, the 2'-deoxyribose-modified strand has enhanced activity in the RNA interference pathway.
Domain motions of Argonaute, the catalytic engine of RNA interference
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-01-01
Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference. PMID:18053142
Domain motions of Argonaute, the catalytic engine of RNA interference.
Ming, Dengming; Wall, Michael E; Sanbonmatsu, Kevin Y
2007-11-30
The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes - an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
An inter-lighting interference cancellation scheme for MISO-VLC systems
NASA Astrophysics Data System (ADS)
Kim, Kyuntak; Lee, Kyujin; Lee, Kyesan
2017-08-01
In this paper, we propose an inter-lighting interference cancellation (ILIC) scheme to reduce the interference between adjacent light-emitting diodes (LEDs) and enhance the transmission capacity of multiple-input-single-output (MISO)-visible light communication (VLC) systems. In indoor environments, multiple LEDs have normally been used as lighting sources, allowing the design of MISO-VLC systems. To enhance the transmission capacity, different data should be simultaneously transmitted from each LED; however, that can lead to interference between adjacent LEDs. In that case, relatively low-received power signals are subjected to large interference because wireless optical systems generally use intensity modulation and direct detection. Thus, only the signal with the highest received power can be detected, while the other received signals cannot be detected. To solve this problem, we propose the ILIC scheme for MISO-VLC systems. The proposed scheme preferentially detects the highest received power signal, and this signal is referred as interference signal by an interference component generator. Then, relatively low-received power signal can be detected by cancelling the interference signal from the total received signals. Therefore, the performance of the proposed scheme can improve the total average bit error rate and throughput of a MISO-VLC system.
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
Cardiovascular RNA interference therapy: the broadening tool and target spectrum.
Poller, Wolfgang; Tank, Juliane; Skurk, Carsten; Gast, Martina
2013-08-16
Understanding of the roles of noncoding RNAs (ncRNAs) within complex organisms has fundamentally changed. It is increasingly possible to use ncRNAs as diagnostic and therapeutic tools in medicine. Regarding disease pathogenesis, it has become evident that confinement to the analysis of protein-coding regions of the human genome is insufficient because ncRNA variants have been associated with important human diseases. Thus, inclusion of noncoding genomic elements in pathogenetic studies and their consideration as therapeutic targets is warranted. We consider aspects of the evolutionary and discovery history of ncRNAs, as far as they are relevant for the identification and selection of ncRNAs with likely therapeutic potential. Novel therapeutic strategies are based on ncRNAs, and we discuss here RNA interference as a highly versatile tool for gene silencing. RNA interference-mediating RNAs are small, but only parts of a far larger spectrum encompassing ncRNAs up to many kilobasepairs in size. We discuss therapeutic options in cardiovascular medicine offered by ncRNAs and key issues to be solved before clinical translation. Convergence of multiple technical advances is highlighted as a prerequisite for the translational progress achieved in recent years. Regarding safety, we review properties of RNA therapeutics, which may immunologically distinguish them from their endogenous counterparts, all of which underwent sophisticated evolutionary adaptation to specific biological contexts. Although our understanding of the noncoding human genome is only fragmentary to date, it is already feasible to develop RNA interference against a rapidly broadening spectrum of therapeutic targets and to translate this to the clinical setting under certain restrictions.
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
Patterns of light interference produced by damaged cuticle cells in human hair.
Gamez-Garcia, Manuel; Lu, Yuan
2007-01-01
Colorful patterns of light interference have been observed to occur in human hair cuticle cells. The light interference phenomenon has been analyzed by optical microscopy. The strong patterns of light interference appeared only in cuticle cells that had been damaged either mechanically or by thermal stresses. Cuticle cells that were not damaged did not produce this phenomenon. The zones of light interference on the hair surface were seen to extend to cuticle sheath areas whose damage was not apparent when analyzed under the Scanning Electron Microscope. The presence of oils and other hydrophobic materials in the hair had a strong effect in the appearance or disappearance of the interference patterns.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...
Exploring Fusarium head blight disease control by RNA interference
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...
Flexible Two-Photon Interference Fringes with Thermal Light.
Cao, De-Zhong; Ren, Cheng; Ni, Jin-Yang; Zhang, Yan; Zhang, Su-Heng; Wang, Kaige
2017-05-16
Flexible interference patterning is an important tool for adaptable measurement precisions. We report on experimental results of controllable two-photon interference fringes with thermal light in an incoherent rotational shearing interferometer. The two incoherent beams in the interferometer are orthogonally polarized, and their wavefront distributions differ only in an angle of rotation. The spacings and directions of the two-photon interference fringes vary with the rotation angle, as illustrated in three cases of two-photon correlation measurements in experiment.
2006-12-01
Defence Research and Recherche et developpement Development Canada pour la defense Canada DEFENCE I I! / DEFENSE Generation of Constructs for DNA... research into specific antiviral strategies. One such strategy is RNA interference. RNA interference involves the targeted silencing of a gene using...of an effective vaccine or therapeutic for VEE, a highly infectious virus, underscores the need for research in this area. In addition, the potential
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
RNA interference-based nanosystems for inflammatory bowel disease therapy
Guo, Jian; Jiang, Xiaojing; Gui, Shuangying
2016-01-01
Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943
Chemical modification: the key to clinical application of RNA interference?
Corey, David R.
2007-01-01
RNA interference provides a potent and specific method for controlling gene expression in human cells. To translate this potential into a broad new family of therapeutics, it is necessary to optimize the efficacy of the RNA-based drugs. As discussed in this Review, it might be possible to achieve this optimization using chemical modifications that improve their in vivo stability, cellular delivery, biodistribution, pharmacokinetics, potency, and specificity. PMID:18060019
Evaluation and control of miRNA-like off-target repression for RNA interference.
Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook
2018-03-01
RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.
Virtual targeting in three-dimensional space with sound and light interference
NASA Astrophysics Data System (ADS)
Chua, Florence B.; DeMarco, Robert M.; Bergen, Michael T.; Short, Kenneth R.; Servatius, Richard J.
2006-05-01
Law enforcement and the military are critically concerned with the targeting and firing accuracy of opponents. Stimuli which impede opponent targeting and firing accuracy can be incorporated into defense systems. An automated virtual firing range was developed to assess human targeting accuracy under conditions of sound and light interference, while avoiding dangers associated with live fire. This system has the ability to quantify sound and light interference effects on targeting and firing accuracy in three dimensions. This was achieved by development of a hardware and software system that presents the subject with a sound or light target, preceded by a sound or light interference. SonyXplod. TM 4-way speakers present sound interference and sound targeting. The Martin ® MiniMAC TM Profile operates as a source of light interference, while a red laser light serves as a target. A tracking system was created to monitor toy gun movement and firing in three-dimensional space. Data are collected via the Ascension ® Flock of Birds TM tracking system and a custom National Instrument ® LabVIEW TM 7.0 program to monitor gun movement and firing. A test protocol examined system parameters. Results confirm that the system enables tracking of virtual shots from a fired simulation gun to determine shot accuracy and location in three dimensions.
Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P
2016-11-15
Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission
Göertz, G. P.; Fros, J. J.; Miesen, P.; Vogels, C. B. F.; van der Bent, M. L.; Geertsema, C.; Koenraadt, C. J. M.; van Oers, M. M.
2016-01-01
ABSTRACT Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5′-3′ exoribonuclease XRN1/Pacman on conserved RNA structures in the 3′ untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo. Two reproducible small-RNA hot spots within the 3′ UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3′ SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. IMPORTANCE Understanding
Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.
Miri-Moghaddam, E; Deezagi, A; Soheili, Z S
2009-12-01
Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT siRNA-treated leukemic cell line.
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
2011-01-01
Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546
Molecular mechanisms influencing efficiency of RNA interference in insects.
Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan
2018-06-21
RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection.
East-Seletsky, Alexandra; O'Connell, Mitchell R; Knight, Spencer C; Burstein, David; Cate, Jamie H D; Tjian, Robert; Doudna, Jennifer A
2016-10-13
Bacterial adaptive immune systems use CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage. Although most prokaryotic adaptive immune systems generally target DNA substrates, type III and VI CRISPR systems direct interference complexes against single-stranded RNA substrates. In type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease (RNase). How this enzyme acquires mature CRISPR RNAs (crRNAs) that are essential for immune surveillance and how it carries out crRNA-mediated RNA cleavage remain unclear. Here we show that bacterial C2c2 possesses a unique RNase activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated single-stranded RNA degradation activity. These dual RNase functions are chemically and mechanistically different from each other and from the crRNA-processing behaviour of the evolutionarily unrelated CRISPR enzyme Cpf1 (ref. 11). The two RNase activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow sensitive detection of cellular transcripts.
RNA Interference for improving the Outcome of Islet Transplantation
Li, Feng; Mahato, Ram I
2010-01-01
Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro
Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M.; Wohlford-Lenane, Christine; Behlke, Mark A.; Davidson, Beverly L.
2013-01-01
Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1–3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl− conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses. PMID:23624792
Two Distinct RNase Activities of CRISPR-C2c2 Enable Guide RNA Processing and RNA Detection
East-Seletsky, Alexandra; O’Connell, Mitchell R.; Knight, Spencer C.; Burstein, David; Cate, Jamie H. D.; Tjian, Robert; Doudna, Jennifer A.
2017-01-01
Bacterial adaptive immune systems employ CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage1,2. Although generally targeted to DNA substrates3–5, the Type III and Type VI CRISPR systems direct interference complexes against single-stranded RNA (ssRNA) substrates6–9. In Type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease9,10. How this enzyme acquires mature CRISPR RNAs (crRNAs) essential for immune surveillance and its mechanism of crRNA-mediated RNA cleavage remain unclear. Here we show that C2c2 possesses a unique ribonuclease activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated ssRNA-degradation activity. These dual ribonuclease functions are chemically and mechanistically different from each other and from the crRNA-processing behavior of the evolutionarily unrelated CRISPR enzyme Cpf111. We show that the two ribonuclease activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow for sensitive cellular transcript detection. PMID:27669025
Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.
2013-01-01
Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014
Whitten, Miranda; Dyson, Paul
2017-03-01
Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans
Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635
Murphy, Katherine A.; Tabuloc, Christine A.; Cervantes, Kevin R.; Chiu, Joanna C.
2016-01-01
RNA interference has had major advances as a developing tool for pest management. In laboratory experiments, double-stranded RNA (dsRNA) is often administered to the insect by genetic modification of the crop, or synthesized in vitro and topically applied to the crop. Here, we engineered genetically modified yeast that express dsRNA targeting y-Tubulin in Drosophila suzukii. Our design takes advantage of the symbiotic interactions between Drosophila, yeast, and fruit crops. Yeast is naturally found growing on the surface of fruit crops, constitutes a major component of the Drosophila microbiome, and is highly attractive to Drosophila. Thus, this naturally attractive yeast biopesticide can deliver dsRNA to an insect pest without the need for genetic crop modification. We demonstrate that this biopesticide decreases larval survivorship, and reduces locomotor activity and reproductive fitness in adults, which are indicative of general health decline. To our knowledge, this is the first study to show that yeast can be used to deliver dsRNA to an insect pest. PMID:26931800
Light-regulated protein and mRNA synthesis in root caps of maize
NASA Technical Reports Server (NTRS)
Feldman, L. J.; Piechulla, B.; Sun, P. S.
1988-01-01
Illumination of maize roots initiates changes in mRNA levels and in the activities of proteins within the root cap. Using Northern analysis we showed a 5-6 fold increase in the levels of three specific mRNAs and a 14-fold increase in plastid mRNA. This increase is rapid, occurring within 30 minutes of illumination. With prolonged periods of darkness following illumination, messages return to levels observed in dark, control caps. For two species of mRNA illumination results in a reduction in message levels. Light-stimulated increases in the levels of specific mRNAs are proportionally greater than are increases in the activities of corresponding proteins. We suggest that the light-stimulated increase in protein activity in root caps may be preceded by and occur as a consequence of enhanced levels of mRNA. Our work suggests that photomorphogenesis in roots could involve changes in the levels of a wide variety of mRNAs within the root cap.
Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita
2015-02-13
The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita
2015-01-01
The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Selective interference with pacemaker activity by electrical dental devices.
Miller, C S; Leonelli, F M; Latham, E
1998-01-01
We sought to determine whether electromagnetic interference with cardiac pacemakers occurs during the operation of contemporary electrical dental equipment. Fourteen electrical dental devices were tested in vitro for their ability to interfere with the function of two Medtronics cardiac pacemakers (one a dual-chamber, bipolar Thera 7942 pacemaker, the other a single-chamber, unipolar Minix 8340 pacemaker). Atrial and ventricular pacemaker output and electrocardiographic activity were monitored by means of telemetry with the use of a Medtronics 9760/90 programmer. Atrial and ventricular pacing were inhibited by electromagnetic interference produced by the electrosurgical unit up to a distance of 10 cm, by the ultrasonic bath cleaner up to 30 cm, and by the magnetorestrictive ultrasonic scalers up to 37.5 cm. In contrast, operation of the amalgamator, electric pulp tester, composite curing light, dental handpieces, electric toothbrush, microwave oven, dental chair and light, ENAC ultrasonic instrument, radiography unit, and sonic scaler did not alter pacing rate or rhythm. These results suggest that certain electrosurgical and ultrasonic instruments may produce deleterious effects in medically fragile patients with cardiac pacemakers.
Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.
Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha
2009-08-01
Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Short hairpin RNA interference therapy for ischemic heart disease.
Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C
2008-09-30
During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by
Aedes aegypti uses RNA interference in defense against Sindbis virus infection.
Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D
2008-03-17
RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.
RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds
Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.
2012-01-01
Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571
RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
Drevytska, T; Gonchar, E; Okhai, I; Lynnyk, O; Mankovska, I; Klionsky, D; Dosenko, V
2018-06-01
The aim of this study was to investigate the molecular mechanisms underlying the protective effects of hypoxia-inducible factor (HIF) signaling pathway activation in cardiomyocytes under anoxia-reoxygenation (A/R) injury. In this study, rat neonatal cardiomyocytes were pretreated with anti-Hif3A/Hif-3α siRNA or HIF-prolyl hydroxylase inhibitor prior to A/R injury. Our results showed that both HIF3A silencing and HIF-prolyl hydroxylase inhibition effectively increased the cell viability during A/R, led to changes in mRNA expression of HIF1-target genes, and reduced the loss of mitochondrial membrane potential (Δψ m ). Furthermore, application of anti-Hif3a siRNA led to an increase in mRNA expression of Epo, Igf1, Slc2a1/Glut-1, and Slc2a4/Glut-4. Similar results were observed with HIF-prolyl hydroxylase inhibition, which additionally upregulated the mRNA expression of Epor, Tert, and Pdk1. Hif3a RNA-interference and application of HIF-prolyl hydroxylase inhibitor during A/R modelling led to an increase of Δψ m on 11.5 and 11.9 mV respectively, compared to the control groups. Thus, Hif3a RNA interference and HIF-prolyl hydroxylase inhibition protect cardiomyocytes against A/R injury via the HIF signaling pathway. Copyright © 2018 Elsevier Inc. All rights reserved.
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
Kim, Jongpal; Kim, Jihoon; Ko, Hyoungho
2015-12-31
To overcome light interference, including a large DC offset and ambient light variation, a robust photoplethysmogram (PPG) readout chip is fabricated using a 0.13-μm complementary metal-oxide-semiconductor (CMOS) process. Against the large DC offset, a saturation detection and current feedback circuit is proposed to compensate for an offset current of up to 30 μA. For robustness against optical path variation, an automatic emitted light compensation method is adopted. To prevent ambient light interference, an alternating sampling and charge redistribution technique is also proposed. In the proposed technique, no additional power is consumed, and only three differential switches and one capacitor are required. The PPG readout channel consumes 26.4 μW and has an input referred current noise of 260 pArms.
Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.
Huang, Mei; Wu, Joseph C
2011-01-01
Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.
Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia
Huang, Mei; Wu, Joseph C.
2011-01-01
Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Jeomoh; Ji, Mi-Hee; Detchprohm, Theeradetch
2014-04-07
We report on the direct patterning of two-dimensional periodic structures in GaN-based light-emitting diodes (LEDs) through laser interference ablation for the fast and reliable fabrication of periodic micro- and nano-structures aimed at enhancing light output. Holes arranged in a two-dimensional hexagonal lattice array having an opening size of 500 nm, depth of 50 nm, and a periodicity of 1 μm were directly formed by three-beam laser interference without photolithography or electron-beam lithography processes. The laser-patterned LEDs exhibit an enhancement in light output power of 20% compared to conventional LEDs having a flat top surface without degradation of electrical and optical properties of themore » top p-GaN layer and the active region, respectively.« less
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Kim, Jongpal; Kim, Jihoon; Ko, Hyoungho
2015-01-01
To overcome light interference, including a large DC offset and ambient light variation, a robust photoplethysmogram (PPG) readout chip is fabricated using a 0.13-μm complementary metal–oxide–semiconductor (CMOS) process. Against the large DC offset, a saturation detection and current feedback circuit is proposed to compensate for an offset current of up to 30 μA. For robustness against optical path variation, an automatic emitted light compensation method is adopted. To prevent ambient light interference, an alternating sampling and charge redistribution technique is also proposed. In the proposed technique, no additional power is consumed, and only three differential switches and one capacitor are required. The PPG readout channel consumes 26.4 μW and has an input referred current noise of 260 pArms. PMID:26729122
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
Interference activity of a minimal Type I CRISPR–Cas system from Shewanella putrefaciens
Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart
2015-01-01
Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)–Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. PMID:26350210
Han, Wei; Zhou, Jingshi; Li, Xiao; Wang, Jianfeng; Li, Junjie; Zhang, Zhuochao; Yang, Zhaoxu; Wang, Desheng; Tao, Kaishan; Dou, Kefeng
2013-11-01
Pig organs are commonly used in xenotransplantation, and α-1,3-galactose has been shown to be the main cause of hyperacute rejection. The development of transgenic pigs that lack α-1,3-galactosyltransferase (GGTA1) has overcome this problem to a certain extent, but transgenic pigs are difficult to maintain, making their usefulness in basic research limited. For this reason, we propose to establish a cell model to study hyperacute rejection. Immortalized primary porcine aortic endothelial cells were transfected with a short hairpin RNA targeted to GGTA1. Cell proliferation, apoptosis, complement C3 activation, and the binding of human immunoglobulins and components of the complement system, including IgM, IgG, C3, and C5b-9, were examined. After RNA interference, GGTA1 was found to be reduced at both the transcript and protein level as assessed by quantitative polymerase chain reaction and flow cytometry, respectively. When cultured in the presence of human serum, the proliferation rate of the transfected cells was higher than that of untransfected cells, and the apoptosis rate was lower. Additionally, activation of C3 and the binding of human immunoglobulins IgM and IgG and complement component C3 and C5b-9 to the transfected cells were lower than in the immortalized group but higher than in untransfected cells. RNA interference of GGTA1 in cultured porcine endothelial cells reduces the reaction of immunoglobulin and complement system with the cells. Therefore, this in vitro cell model could be useful for further study of xenotransplantation. Copyright © 2013 Elsevier Inc. All rights reserved.
RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.
Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy
2018-06-01
Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
RNA Interference in Moths: Mechanisms, Applications, and Progress
Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He
2016-01-01
The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569
Short hairpin RNA interference therapy for ischemic heart disease
Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.
2013-01-01
Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to
RNA interference in the clinic: challenges and future directions
Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.
2011-01-01
Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526
DeVincenzo, John P
2009-10-01
A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo
2008-02-05
Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less
A Novel Effect of Scattered-Light Interference in Misted Mirrors
ERIC Educational Resources Information Center
Bridge, N. James
2005-01-01
Interference rings can be observed in mirrors clouded by condensation, even in diffuse lighting. The effect depends on individual droplets acting as point sources by refracting light into the mirror, so producing coherent wave-trains which are reflected and then scattered again by diffraction round the same source droplet. The secondary wave-train…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohan, Kavya; Mondal, Partha Pratim, E-mail: partha@iap.iisc.ernet.in
We experimentally observed nano-channel-like pattern in a light-sheet based interference nanolithography system. The optical system created nano-channel-like patterned illumination. Coherent counter-propagating light sheets are made to interfere at and near geometrical focus along the propagation z-axis. This results in the formation of nano-channel-like pattern (of size ≈ 300 nm and inter-channel periodicity of ≈337.5 nm) inside the sample due to constructive and destructive interference. In addition, the technique has the ability to generate large area patterning using larger light-sheets. Exciting applications are in the broad field of nanotechnology (nano-electronics and nano-fluidics).
Efficacy of a Novel Class of RNA Interference Therapeutic Agents
Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki
2012-01-01
RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145
RNA Interference in Insect Vectors for Plant Viruses.
Kanakala, Surapathrudu; Ghanim, Murad
2016-12-12
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446
Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu
2013-01-01
Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330
Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao
2014-04-01
During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Interference of hepatitis C virus RNA replication by short interfering RNAs
NASA Astrophysics Data System (ADS)
Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.
2003-02-01
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara
2011-01-01
RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198
Interference of conically scattered light in surface plasmon resonance.
Webster, Aaron; Vollmer, Frank
2013-02-01
Surface plasmon polaritons on thin metal films are a well studied phenomena when excited using prism coupled geometries such as the Kretschmann attenuated total reflection configuration. Here we describe a novel interference pattern in the conically scattered light emanating from such a configuration when illuminated by a focused beam. We observe conditions indicating only self-interference of scattered surface plasmon polaritions without any contributions from specular reflection. The spatial evolution of this field is described in the context of Fourier optics and has applications in highly sensitive surface plasmon based biosensing.
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
Interference activity of a minimal Type I CRISPR-Cas system from Shewanella putrefaciens.
Dwarakanath, Srivatsa; Brenzinger, Susanne; Gleditzsch, Daniel; Plagens, André; Klingl, Andreas; Thormann, Kai; Randau, Lennart
2015-10-15
Type I CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas (CRISPR-associated) systems exist in bacterial and archaeal organisms and provide immunity against foreign DNA. The Cas protein content of the DNA interference complexes (termed Cascade) varies between different CRISPR-Cas subtypes. A minimal variant of the Type I-F system was identified in proteobacterial species including Shewanella putrefaciens CN-32. This variant lacks a large subunit (Csy1), Csy2 and Csy3 and contains two unclassified cas genes. The genome of S. putrefaciens CN-32 contains only five Cas proteins (Cas1, Cas3, Cas6f, Cas1821 and Cas1822) and a single CRISPR array with 81 spacers. RNA-Seq analyses revealed the transcription of this array and the maturation of crRNAs (CRISPR RNAs). Interference assays based on plasmid conjugation demonstrated that this CRISPR-Cas system is active in vivo and that activity is dependent on the recognition of the dinucleotide GG PAM (Protospacer Adjacent Motif) sequence and crRNA abundance. The deletion of cas1821 and cas1822 reduced the cellular crRNA pool. Recombinant Cas1821 was shown to form helical filaments bound to RNA molecules, which suggests its role as the Cascade backbone protein. A Cascade complex was isolated which contained multiple Cas1821 copies, Cas1822, Cas6f and mature crRNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
RNA interference for performance enhancement and detection in doping control.
Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario
2011-10-01
RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.
Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi
2018-02-12
Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.
Development of visible light-responsive RNA scissors based on the 10-23 DNAzyme.
Kamiya, Yukiko; Arimura, Yu; Ooi, Hideaki; Kato, Kenjiro; Liang, Xingguo; Asanuma, Hiroyuki
2018-04-22
10-23 DNAzyme is an artificially developed functional oligonucleotide, which can cleave RNA in a sequence-specific manner. In this study, we designed a new photo-driven DNAzyme possessing a photo-responsive DNA overhang complementary to the catalytic core region. The photo-responsive overhang region of the DNAzyme included either azobenzenes (Azos) or 2,6-dimethyl-4-(methylthio)azobenzenes (SDM-Azos) introduced via a D-threoninol linker. When the Azos or SDM-Azos were in the trans form, the photo-responsive DNA overhang hybridized with the DNAzyme, and the RNA cleavage activity was suppressed. Cis isomerization of Azos or SDM-Azos induced by 365 or 400 nm light, respectively, destabilized the duplex between the photo-responsive overhang and the catalytic core, and the DNAzyme recovered RNA cleavage activity. Reversible on and off of the DNAzyme activity was achieved by specific light irradiation. Further, light-dependent on and off of protein expression under the DNAzyme-containing condition was demonstrated. Thus, this photo-driven DNAzyme has potential for application in photo-controlled gene silencing system and a photo-activatable gene expression system. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Special Issue: Gene Therapy with Emphasis on RNA Interference
Lundstrom, Kenneth
2015-01-01
Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Kandeel, Mahmoud; Kitade, Yukio
2013-07-01
RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.
Scavenger receptor mediates systemic RNA interference in ticks.
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.
Scavenger Receptor Mediates Systemic RNA Interference in Ticks
Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo
2011-01-01
RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043
Activity interference and noise annoyance
NASA Astrophysics Data System (ADS)
Hall, F. L.; Taylor, S. M.; Birnie, S. E.
1985-11-01
Debate continues over differences in the dose-response functions used to predict the annoyance at different sources of transportation noise. This debate reflects the lack of an accepted model of noise annoyance in residential communities. In this paper a model is proposed which is focussed on activity interference as a central component mediating the relationship between noise exposure and annoyance. This model represents a departure from earlier models in two important respects. First, single event noise levels (e.g., maximum levels, sound exposure level) constitute the noise exposure variables in place of long-term energy equivalent measures (e.g., 24-hour Leq or Ldn). Second, the relationships within the model are expressed as probabilistic rather than deterministic equations. The model has been tested by using acoustical and social survey data collected at 57 sites in the Toronto region exposed to aircraft, road traffic or train noise. Logit analysis was used to estimate two sets of equations. The first predicts the probability of activity interference as a function of event noise level. Four types of interference are included: indoor speech, outdoor speech, difficulty getting to sleep and awakening. The second set predicts the probability of annoyance as a function of the combination of activity interferences. From the first set of equations, it was possible to estimate a function for indoor speech interference only. In this case, the maximum event level was the strongest predictor. The lack of significant results for the other types of interference is explained by the limitations of the data. The same function predicts indoor speech interference for all three sources—road, rail and aircraft noise. The results for the second set of equations show strong relationships between activity interference and the probability of annoyance. Again, the parameters of the logit equations are similar for the three sources. A trial application of the model predicts a higher
Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J
2011-03-01
Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most
Role of RNA interference in plant improvement
NASA Astrophysics Data System (ADS)
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells
2005-07-01
pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23. My initial studies
How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference
ERIC Educational Resources Information Center
Kuldell, Natalie H.
2006-01-01
It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S
2014-05-16
Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
On future's doorstep: RNA interference and the pharmacopeia of tomorrow.
Gewirtz, Alan M
2007-12-01
Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
Basnet, Sanjay; Kamble, Shripat T
2018-05-01
Bed bugs are one the most troublesome household pests that feed primarily on human blood. RNA interference (RNAi) is currently being pursued as a potential tool for insect population management and has shown efficacy against some phytophagous insects. We evaluated the different techniques to deliver dsRNA specific to bed bug muscle actin (dsactin) into bed bugs. Initially, stability of dsRNA in human blood was studied to evaluate the feasibility of feeding method. Adult bed bugs were injected with dsRNA between last thoracic segment and first abdominal segment on the ventral side, with a dose of 0.2 µg dsactin per insect. In addition to injection, dsactin was mixed in acetone and treated topically in the abdomens of fifth stage nymphs. We found the quick degradation of dsRNA in blood. Injection of dsactin caused significant depletion of actin transcripts and substantial reduction in oviposition and lethality in female adults. Topically treated dsRNA in fifth stage nymphs had no effect on actin mRNA expression and survival. Our results demonstrated that injection is a reliable method of dsRNA delivery into bed bugs while topical treatment was not successful. This research provides an understanding on effective delivery methods of dsRNA into bed bugs for functional genomics research and feasibility of the RNAi based molecules for pest management purposes.
Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.
Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian
2017-10-01
Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.
Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil
2017-03-01
Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.
Virus-Derived Gene Expression and RNA Interference Vector for Grapevine
Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.
2012-01-01
The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
ERIC Educational Resources Information Center
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
Measurement of the configuration of a concave surface by the interference of reflected light
NASA Technical Reports Server (NTRS)
Kumazawa, T.; Sakamoto, T.; Shida, S.
1985-01-01
A method whereby a concave surface is irradiated with coherent light and the resulting interference fringes yield information on the concave surface is described. This method can be applied to a surface which satisfies the following conditions: (1) the concave face has a mirror surface; (2) the profile of the face is expressed by a mathematical function with a point of inflection. In this interferometry, multilight waves reflected from the concave surface interfere and make fringes wherever the reflected light propagates. Interference fringe orders. Photographs of the fringe patterns for a uniformly loaded thin silicon plate clamped at the edge are shown experimentally. The experimental and the theoretical values of the maximum optical path difference show good agreement. This simple method can be applied to obtain accurate information on concave surfaces.
RNA interference as a key to knockdown overexpressed cyclooxygenase-2 gene in tumour cells
Strillacci, A; Griffoni, C; Spisni, E; Manara, M C; Tomasi, V
2006-01-01
Silencing those genes that are overexpressed in cancer and contribute to the survival and progression of tumour cells is the aim of several researches. Cyclooxygenase-2 (COX-2) is one of the most intensively studied genes since it is overexpressed in most tumours, mainly in colon cancer. The use of specific COX-2 inhibitors to treat colon cancer has generated great enthusiasm. Yet, the side effects of some inhibitors emerging during long-term treatment have caused much concern. Genes silencing by RNA interference (RNAi) has led to new directions in the field of experimental oncology. In this study, we detected sequences directed against COX-2 mRNA, that potently downregulate COX-2 gene expression and inhibit phorbol 12-myristate 13-acetate-induced angiogenesis in vitro in a specific, nontoxic manner. Moreover, we found that the insertion of a specific cassette carrying anti-COX-2 short hairpin RNA sequence into a viral vector (pSUPER.retro) greatly increased silencing potency in a colon cancer cell line (HT29) without activating any interferon response. Phenotypically, COX-2 deficient HT29 cells showed a significant impairment of their in vitro malignant behaviour. Thus, the retroviral approach enhancing COX-2 knockdown, mediated by RNAi, proved to be an useful tool to better understand the role of COX-2 in colon cancer. Furthermore, the higher infection efficiency we observed in tumour cells, if compared to normal endothelial cells, may disclose the possibility to specifically treat tumour cells without impairing endothelial COX-2 activity. PMID:16622456
RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L
2009-04-01
RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.
Hassan, Ali
2006-06-01
RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
Effect of occlusal interference on habitual activity of human masseter.
Michelotti, A; Farella, M; Gallo, L M; Veltri, A; Palla, S; Martina, R
2005-07-01
It has been suggested that occlusal interference may increase habitual activity in the jaw muscles and may lead to temporomandibular disorders (TMD). We tested these hypotheses by means of a double-blind randomized crossover experiment carried out on 11 young healthy females. Strips of gold foil were glued either on a selected occlusal contact area (active interference) or on the vestibular surface of the same tooth (dummy interference) and left for 8 days each. Electromyographic masseter activity was recorded in the natural environment by portable recorders under interference-free, dummy-interference, and active-interference conditions. The active occlusal interference caused a significant reduction in the number of activity periods per hour and in their mean amplitude. The EMG activity did not change significantly during the dummy-interference condition. None of the subjects developed signs and/or symptoms of TMD throughout the whole study, and most of them adapted fairly well to the occlusal disturbance.
Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E
2018-05-04
Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E
2010-05-01
The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.
Isothermal folding of a light-up bio-orthogonal RNA origami nanoribbon.
Torelli, Emanuela; Kozyra, Jerzy Wieslaw; Gu, Jing-Ying; Stimming, Ulrich; Piantanida, Luca; Voïtchovsky, Kislon; Krasnogor, Natalio
2018-05-03
RNA presents intringuing roles in many cellular processes and its versatility underpins many different applications in synthetic biology. Nonetheless, RNA origami as a method for nanofabrication is not yet fully explored and the majority of RNA nanostructures are based on natural pre-folded RNA. Here we describe a biologically inert and uniquely addressable RNA origami scaffold that self-assembles into a nanoribbon by seven staple strands. An algorithm is applied to generate a synthetic De Bruijn scaffold sequence that is characterized by the lack of biologically active sites and repetitions larger than a predetermined design parameter. This RNA scaffold and the complementary staples fold in a physiologically compatible isothermal condition. In order to monitor the folding, we designed a new split Broccoli aptamer system. The aptamer is divided into two nonfunctional sequences each of which is integrated into the 5' or 3' end of two staple strands complementary to the RNA scaffold. Using fluorescence measurements and in-gel imaging, we demonstrate that once RNA origami assembly occurs, the split aptamer sequences are brought into close proximity forming the aptamer and turning on the fluorescence. This light-up 'bio-orthogonal' RNA origami provides a prototype that can have potential for in vivo origami applications.
Wannenes, Francesca; Ciafré, Silvia Anna; Niola, Francesco; Frajese, Gaetano; Farace, Maria Giulia
2005-12-01
RNA interference technology is emerging as a very potent tool to obtain a cellular knockdown of a desired gene. In this work we used vector-based RNA interference to inhibit vascular endothelial growth factor (VEGF) expression in prostate cancer in vitro and in vivo. We demonstrated that transduction with a plasmid carrying a small interfering RNA targeting all isoforms of VEGF, dramatically impairs the expression of this growth factor in the human prostate cancer cell line PC3. As a consequence, PC3 cells loose their ability to induce one of the fundamental steps of angiogenesis, namely the formation of a tube-like network in vitro. Most importantly, our "therapeutic" vector is able to impair tumor growth rate and vascularization in vivo. We show that a single injection of naked plasmid in developing neoplastic mass significantly decreases microvessel density in an androgen-refractory prostate xenograft and is able to sustain a long-term slowing down of tumor growth. In conclusion, our results confirm the basic role of VEGF in the angiogenic development of prostate carcinoma, and suggest that the use of our vector-based RNA interference approach to inhibit angiogenesis could be an effective tool in view of future gene therapy applications for prostate cancer.
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F
2018-05-02
Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.
Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo
2012-08-01
A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.
Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua
2015-01-01
Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836
Rand, Tim A.; Ginalski, Krzysztof; Grishin, Nick V.; Wang, Xiaodong
2004-01-01
RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2. PMID:15452342
Rand, Tim A; Ginalski, Krzysztof; Grishin, Nick V; Wang, Xiaodong
2004-10-05
RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2.
RNA targeting with CRISPR-Cas13.
Abudayyeh, Omar O; Gootenberg, Jonathan S; Essletzbichler, Patrick; Han, Shuo; Joung, Julia; Belanto, Joseph J; Verdine, Vanessa; Cox, David B T; Kellner, Max J; Regev, Aviv; Lander, Eric S; Voytas, Daniel F; Ting, Alice Y; Zhang, Feng
2017-10-12
RNA has important and diverse roles in biology, but molecular tools to manipulate and measure it are limited. For example, RNA interference can efficiently knockdown RNAs, but it is prone to off-target effects, and visualizing RNAs typically relies on the introduction of exogenous tags. Here we demonstrate that the class 2 type VI RNA-guided RNA-targeting CRISPR-Cas effector Cas13a (previously known as C2c2) can be engineered for mammalian cell RNA knockdown and binding. After initial screening of 15 orthologues, we identified Cas13a from Leptotrichia wadei (LwaCas13a) as the most effective in an interference assay in Escherichia coli. LwaCas13a can be heterologously expressed in mammalian and plant cells for targeted knockdown of either reporter or endogenous transcripts with comparable levels of knockdown as RNA interference and improved specificity. Catalytically inactive LwaCas13a maintains targeted RNA binding activity, which we leveraged for programmable tracking of transcripts in live cells. Our results establish CRISPR-Cas13a as a flexible platform for studying RNA in mammalian cells and therapeutic development.
USDA-ARS?s Scientific Manuscript database
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...
Light intensity affects RNA silencing of a transgene in Nicotiana benthamiana plants.
Kotakis, Christos; Vrettos, Nicholas; Kotsis, Dimitrios; Tsagris, Mina; Kotzabasis, Kiriakos; Kalantidis, Kriton
2010-10-12
Expression of exogenous sequences in plants is often suppressed through one of the earliest described RNA silencing pathways, sense post-transcriptional gene silencing (S-PTGS). This type of suppression has made significant contributions to our knowledge of the biology of RNA silencing pathways and has important consequences in plant transgenesis applications. Although significant progress has been made in recent years, factors affecting the stability of transgene expression are still not well understood. It has been shown before that the efficiency of RNA silencing in plants is influenced by various environmental factors. Here we report that a major environmental factor, light intensity, significantly affects the induction and systemic spread of S-PTGS. Moreover, we show that photoadaptation to high or low light intensity conditions differentially affects mRNA levels of major components of the RNA silencing machinery. Light intensity is one of the previously unknown factors that affect transgene stability at the post-transcriptional level. Our findings demonstrate an example of how environmental conditions could affect RNA silencing.
The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.
Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin
2013-06-01
Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.
New basic approach to treat non-small cell lung cancer based on RNA-interference.
Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias
2014-03-01
To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
Multifunctional RNA Nanoparticles
2015-01-01
Our recent advancements in RNA nanotechnology introduced novel nanoscaffolds (nanorings); however, the potential of their use for biomedical applications was never fully revealed. As presented here, besides functionalization with multiple different short interfering RNAs for combinatorial RNA interference (e.g., against multiple HIV-1 genes), nanorings also allow simultaneous embedment of assorted RNA aptamers, fluorescent dyes, proteins, as well as recently developed RNA–DNA hybrids aimed to conditionally activate multiple split functionalities inside cells. PMID:25267559
RNA interference tools for the western flower thrips, Frankliniella occidentalis.
Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E
2015-05-01
The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko
2018-01-01
Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.
Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil
2017-01-01
Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Topography and refractometry of nanostructures using spatial light interference microscopy.
Wang, Zhuo; Chun, Ik Su; Li, Xiuling; Ong, Zhun-Yong; Pop, Eric; Millet, Larry; Gillette, Martha; Popescu, Gabriel
2010-01-15
Spatial light interference microscopy (SLIM) is a novel method developed in our laboratory that provides quantitative phase images of transparent structures with a 0.3 nm spatial and 0.03 nm temporal accuracy owing to the white light illumination and its common path interferometric geometry. We exploit these features and demonstrate SLIM's ability to perform topography at a single atomic layer in graphene. Further, using a decoupling procedure that we developed for cylindrical structures, we extract the axially averaged refractive index of semiconductor nanotubes and a neurite of a live hippocampal neuron in culture. We believe that this study will set the basis for novel high-throughput topography and refractometry of man-made and biological nanostructures.
ERIC Educational Resources Information Center
Trefil, James
1983-01-01
Discusses why interference effects cannot be seen with a thick film, starting with a review of the origin of interference patterns in thin films. Considers properties of materials in films, properties of the light source, and the nature of light. (JN)
Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.
Wang, Leo L; Burdick, Jason A
2017-01-01
It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Patra, Saroj Kanta; Adhikari, Sonachand; Pal, Suchandan
2014-06-20
In this paper, we have made a clear differentiation among bandgap, diffraction, interference, and refraction effects in photonic crystal structures (PhCs). For observing bandgap, diffraction, and refraction effects, PhCs are considered on the top p-GaN surface of light emitting diodes (LEDs), whereas for interference effect, hole type PhCs are considered to be embedded within n-GaN layer of LED. From analysis, it is observed that at a particular lattice periodicity, for which bandgap lies within the wavelength of interest shows a significant light extraction due to inhibition of guided mode. Beyond a certain periodicity, diffraction effect starts dominating and light extraction improves further. The interference effect is observed in embedded photonic crystal LEDs, where depth of etching supports constructive interference of outward light waves. We have also shed light on refraction effects exhibited by the PhCs and whether negative refraction properties of PhCs may be useful in case of LED light extraction.
NASA Technical Reports Server (NTRS)
Reichler, S. A.; Balk, J.; Brown, M. E.; Woodruff, K.; Clark, G. B.; Roux, S. J.
2001-01-01
The abundance of plant nucleolin mRNA is regulated during de-etiolation by phytochrome. A close correlation between the mRNA abundance of nucleolin and mitosis has also been previously reported. These results raised the question of whether the effects of light on nucleolin mRNA expression were a consequence of light effects on mitosis. To test this we compared the kinetics of light-mediated increases in cell proliferation with that of light-mediated changes in the abundance of nucleolin mRNA using plumules of dark-grown pea (Pisum sativum) seedlings. These experiments show that S-phase increases 9 h after a red light pulse, followed by M-phase increases in the plumule leaves at 12 h post-irradiation, a time course consistent with separately measured kinetics of red light-induced increases in the expression of cell cycle-regulated genes. These increases in cell cycle-regulated genes are photoreversible, implying that the light-induced increases in cell proliferation are, like nucleolin mRNA expression, regulated via phytochrome. Red light stimulates increases in the mRNA for nucleolin at 6 h post-irradiation, prior to any cell proliferation changes and concurrent with the reported timing of phytochrome-mediated increases of rRNA abundance. After a green light pulse, nucleolin mRNA levels increase without increasing S-phase or M-phase. Studies in animals and yeast indicate that nucleolin plays a significant role in ribosome biosynthesis. Consistent with this function, pea nucleolin can rescue nucleolin deletion mutants of yeast that are defective in rRNA synthesis. Our data show that during de-etiolation, the increased expression of nucleolin mRNA is more directly regulated by light than by mitosis.
DICER-ARGONAUTE2 Complex in Continuous Fluorogenic Assays of RNA Interference Enzymes
Bernard, Mark A.; Wang, Leyu; Tachado, Souvenir D.
2015-01-01
Mechanistic studies of RNA processing in the RNA-Induced Silencing Complex (RISC) have been hindered by lack of methods for continuous monitoring of enzymatic activity. “Quencherless” fluorogenic substrates of RNAi enzymes enable continuous monitoring of enzymatic reactions for detailed kinetics studies. Recombinant RISC enzymes cleave the fluorogenic substrates targeting human thymidylate synthase (TYMS) and hypoxia-inducible factor 1-α subunit (HIF1A). Using fluorogenic dsRNA DICER substrates and fluorogenic siRNA, DICER+ARGONAUTE2 mixtures exhibit synergistic enzymatic activity relative to either enzyme alone, and addition of TRBP does not enhance the apparent activity. Titration of AGO2 and DICER in enzyme assays suggests that AGO2 and DICER form a functional high-affinity complex in equimolar ratio. DICER and DICER+AGO2 exhibit Michaelis-Menten kinetics with DICER substrates. However, AGO2 cannot process the fluorogenic siRNA without DICER enzyme, suggesting that AGO2 cannot self-load siRNA into its active site. The DICER+AGO2 combination processes the fluorogenic siRNA substrate (K m=74 nM) with substrate inhibition kinetics (K i=105 nM), demonstrating experimentally that siRNA binds two different sites that affect Dicing and AGO2-loading reactions in RISC. This result suggests that siRNA (product of DICER) bound in the active site of DICER may undergo direct transfer (as AGO2 substrate) to the active site of AGO2 in the DICER+AGO2 complex. Competitive substrate assays indicate that DICER+AGO2 cleavage of fluorogenic siRNA is specific, since unlabeled siRNA and DICER substrates serve as competing substrates that cause a concentration-dependent decrease in fluorescent rates. Competitive substrate assays of a series of DICER substrates in vitro were correlated with cell-based assays of HIF1A mRNA knockdown (log-log slope=0.29), suggesting that improved DICER substrate designs with 10-fold greater processing by the DICER+AGO2 complex can provide a strong
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
Lu, Xiaoli; Yang, Xi; Huang, Xiaoyan; Huang, Chen; Sun, Huan Huan; Jin, Lihua; Xu, Weifeng; Mao, Haiyan; Guo, Junming; Zhou, Jianqing; Lian, Jiangfang
2013-01-01
Long QT syndrome (LQTS) is a monogenic proarrhythmic disorder that predisposes affected individuals to sudden death from tachyarrhythmia. As an inherited disease, LQTS cannot be completely cured by conventional treatment modalities. Individualized gene therapy is a promising therapeutic approach. The purpose of this study was to investigate the role of small interference RNA (siRNA) on expression of E637K-hERG (human ether-a-go-go-related gene) mutant and whether it can be used to rescue the mutant's dominant-negative suppressive effects on hERG protein channel function. Western blot was performed to select the most sensitive siRNAs to target E637K-hERG mutant knockdown. Confocal laser scanning microscope was performed to monitor cellular localization of wild-type (WT)-hERG and E637K-hERG with or without siRNA. Patch-clamp technique was used to assess the effect of siRNA on the electrophysiologic characteristics of the rapidly activating delayed rectifier K(+) current I(Kr) of the hERG protein channel. siRNA led to a significant decrease in the level of E637K-hERG protein but did not affect the level of WT-hERG protein. WT-hERG localization in cells coexpressing E637K-hERG mutant was restored to the membrane by siRNA. The siRNA-mediated inhibition of E637K-hERG mutant restored the maximum current and tail current amplitudes. Furthermore, siRNA treatment rescued the kinetic properties of WT/E637K-hERG protein channel to a level comparable to that of WT-hERG protein channel. Our findings illustrated that siRNA can effectively inhibit E637K-hERG protein expression and rescue the dominant-negative effect of this mutation by restoring the kinetic properties of hERG protein channel. It has potential clinical implications with regard to the possibility of using siRNA in the treatment of LQTS. Copyright © 2013 Heart Rhythm Society. All rights reserved.
Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G
2016-06-25
To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (P<0.01). (2) The tumor volume was (491± 68) mm(3) and tumor mass was (2.6±0.4) g in Jagged1 interference group, which were significantly lower than that in the blank plasmid group [(842±88) mm(3) and (4.4±0.8) g, respectively] and that in the control group [(851±90) mm(3) and (4.5±0.9) g, respectively; P<0.05], the tumor inhibition rate was 42.2% in Jagged1 interference group, which was significantly higher than that in the blank plasmid group and that in the control group (2.2% and 0, respectively), the differences were
NASA Astrophysics Data System (ADS)
Srivastava, Vishal; Nandy, Sreyankar; Singh Mehta, Dalip
2013-04-01
Topography and tomography of fish cornea is reconstructed using high resolution white light interference microscopy. White light interferograms at different depths were recorded by moving the object axially. For each depth position, five phase shifted interferograms were recorded and analyzed. From the reconstructed phase maps, the corneal topography and hence the refractive index was determined and from amplitude images the cross-sectional image of fish cornea was reconstructed. In the present method, we utilize a nearly common-path interference microscope and wide field illumination and hence do not require any mechanical B-scan. Therefore, the phase stability of the recorded data is improved.
Koralewska, Natalia; Hoffmann, Weronika; Pokornowska, Maria; Milewski, Marek; Lipinska, Andrea; Bienkowska-Szewczyk, Krystyna; Figlerowicz, Marek; Kurzynska-Kokorniak, Anna
2016-01-01
Ribonuclease Dicer plays a pivotal role in RNA interference pathways by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. While details of Dicer regulation by a variety of proteins are being elucidated, less is known about non-protein factors, e.g. RNA molecules, that may influence this enzyme's activity. Therefore, we decided to investigate the question of whether the RNA molecules can function not only as Dicer substrates but also as its regulators. Our previous in vitro studies indicated that the activity of human Dicer can be influenced by short RNA molecules that either bind to Dicer or interact with its substrates, or both. Those studies were carried out with commercial Dicer preparations. Nevertheless, such preparations are usually not homogeneous enough to carry out more detailed RNA-binding studies. Therefore, we have established our own system for the production of human Dicer in insect cells. In this manuscript, we characterize the RNA-binding and RNA-cleavage properties of the obtained preparation. We demonstrate that Dicer can efficiently bind single-stranded RNAs that are longer than ~20-nucleotides. Consequently, we revisit possible scenarios of Dicer regulation by single-stranded RNA species ranging from ~10- to ~60-nucleotides, in the context of their binding to this enzyme. Finally, we show that siRNA/miRNA-sized RNAs may affect miRNA production either by binding to Dicer or by participating in regulatory feedback-loops. Altogether, our studies suggest a broad regulatory role of short RNAs in Dicer functioning.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...
Koh, Hye Ran; Wang, Xinlei; Myong, Sua
2016-08-01
TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.
Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan
2013-01-01
RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha
2015-05-01
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.
Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima
2011-02-01
Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.
Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.
2012-01-01
Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C
2015-01-29
Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi
Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.
2015-01-01
SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455
Zhang, Wanna; Liu, Bing; Lu, Yanhui; Liang, Gemei
2017-04-01
Salivary enzymes of many piercing-sucking insects lead to host plant injury. The salivary enzymes, polygalacturonase (PGs), act in insect feeding. PG family genes have been cloned from the mirid bug Apolygus lucorum, a pest of cotton and other host crops in China. We investigated the function of two PG genes that are highly expressed in A. lucorum nymphs (PG3-4) and adults (PG3-5), using siRNA injection-based RNA interference (RNAi). Accumulation of mRNA encoding both genes and their cognate proteins was significantly reduced (>60%) in experimental compared control green fluorescent protein (GFP) siRNA-treated mirids at 48 h post injection. Injury levels of cotton buds were also significantly reduced after injecting saliva isolated from PG3-4 and PG3-5 siRNA-treated A. lucorum. These results demonstrate that these two PG act in A. lucorum elicitation of plant injury. © 2017 Wiley Periodicals, Inc.
PHOSPHOLIPASE Cβ CONNECTS G PROTEIN SIGNALING WITH RNA INTERFERENCE
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2015-01-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (RISC) (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentration can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. PMID:26746047
Phospholipase Cβ connects G protein signaling with RNA interference.
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2016-05-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentrations can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. Copyright © 2015 Elsevier Ltd. All rights reserved.
Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C
2005-02-22
RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.
Systematic RNA interference reveals that oncogenic KRAS-driven cancers require TBK1
Barbie, David A.; Tamayo, Pablo; Boehm, Jesse S.; Kim, So Young; Moody, Susan E.; Dunn, Ian F.; Schinzel, Anna C.; Sandy, Peter; Meylan, Etienne; Scholl, Claudia; Fröhling, Stefan; Chan, Edmond M.; Sos, Martin L.; Michel, Kathrin; Mermel, Craig; Silver, Serena J.; Weir, Barbara A.; Reiling, Jan H.; Sheng, Qing; Gupta, Piyush B.; Wadlow, Raymond C.; Le, Hanh; Hoersch, Sebastian; Wittner, Ben S.; Ramaswamy, Sridhar; Livingston, David M.; Sabatini, David M.; Meyerson, Matthew; Thomas, Roman K.; Lander, Eric S.; Mesirov, Jill P.; Root, David E.; Gilliland, D. Gary; Jacks, Tyler; Hahn, William C.
2009-01-01
The proto-oncogene KRAS is mutated in a wide array of human cancers, most of which are aggressive and respond poorly to standard therapies. Although the identification of specific oncogenes has led to the development of clinically effective, molecularly targeted therapies in some cases, KRAS has remained refractory to this approach. A complementary strategy for targeting KRAS is to identify gene products that, when inhibited, result in cell death only in the presence of an oncogenic allele1,2. Here we have used systematic RNA interference (RNAi) to detect synthetic lethal partners of oncogenic KRAS and found that the non-canonical IκB kinase, TBK1, was selectively essential in cells that harbor mutant KRAS. Suppression of TBK1 induced apoptosis specifically in human cancer cell lines that depend on oncogenic KRAS expression. In these cells, TBK1 activated NF-κB anti-apoptotic signals involving cREL and BCL-XL that were essential for survival, providing mechanistic insights into this synthetic lethal interaction. These observations identify TBK1 and NF-κB signaling as essential in KRAS mutant tumors and establish a general approach for the rational identification of co-dependent pathways in cancer. PMID:19847166
Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying
2016-01-01
RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174
Structural basis of RNA recognition and activation by innate immune receptor RIG-I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, Fuguo; Ramanathan, Anand; Miller, Matthew T.
Retinoic-acid-inducible gene-I (RIG-I; also known as DDX58) is a cytoplasmic pathogen recognition receptor that recognizes pathogen-associated molecular pattern (PAMP) motifs to differentiate between viral and cellular RNAs. RIG-I is activated by blunt-ended double-stranded (ds)RNA with or without a 5'-triphosphate (ppp), by single-stranded RNA marked by a 5'-ppp and by polyuridine sequences. Upon binding to such PAMP motifs, RIG-I initiates a signalling cascade that induces innate immune defences and inflammatory cytokines to establish an antiviral state. The RIG-I pathway is highly regulated and aberrant signalling leads to apoptosis, altered cell differentiation, inflammation, autoimmune diseases and cancer. The helicase and repressor domainsmore » (RD) of RIG-I recognize dsRNA and 5'-ppp RNA to activate the two amino-terminal caspase recruitment domains (CARDs) for signalling. Here, to understand the synergy between the helicase and the RD for RNA binding, and the contribution of ATP hydrolysis to RIG-I activation, we determined the structure of human RIG-I helicase-RD in complex with dsRNA and an ATP analogue. The helicase-RD organizes into a ring around dsRNA, capping one end, while contacting both strands using previously uncharacterized motifs to recognize dsRNA. Small-angle X-ray scattering, limited proteolysis and differential scanning fluorimetry indicate that RIG-I is in an extended and flexible conformation that compacts upon binding RNA. These results provide a detailed view of the role of helicase in dsRNA recognition, the synergy between the RD and the helicase for RNA binding and the organization of full-length RIG-I bound to dsRNA, and provide evidence of a conformational change upon RNA binding. The RIG-I helicase-RD structure is consistent with dsRNA translocation without unwinding and cooperative binding to RNA. The structure yields unprecedented insight into innate immunity and has a broader impact on other areas of biology, including RNA
Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko
2009-11-01
Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.
Topography and refractometry of nanostructures using spatial light interference microscopy (SLIM)
Wang, Zhuo; Chun, Ik Su; Li, Xiuling; Ong, Zhun-Yong; Pop, Eric; Millet, Larry; Gillette, Martha; Popescu, Gabriel
2010-01-01
Spatial Light Interference Microscopy (SLIM) is a novel method developed in our laboratory that provides quantitative phase images of transparent structures with 0.3 nm spatial and 0.03 nm temporal accuracy owing to the white light illumination and its common path interferometric geometry. We exploit these features and demonstrate SLIM's ability to perform topography at a single atomic layer in graphene. Further, using a decoupling procedure that we developed for cylindrical structures, we extract the axially-averaged refractive index of semiconductor nanotubes and a neurite of a live hippocampal neuron in culture. We believe that this study will set the basis for novel high-throughput topography and refractometry of man-made and biological nanostructures. PMID:20081970
Use of a white light supercontinuum laser for confocal interference-reflection microscopy
Chiu, L-D; Su, L; Reichelt, S; Amos, WB
2012-01-01
Shortly after its development, the white light supercontinuum laser was applied to confocal scanning microscopy as a more versatile substitute for the multiple monochromatic lasers normally used for the excitation of fluorescence. This light source is now available coupled to commercial confocal fluorescence microscopes. We have evaluated a supercontinuum laser as a source for a different purpose: confocal interferometric imaging of living cells and artificial models by interference reflection. We used light in the range 460–700 nm where this source provides a reasonably flat spectrum, and obtained images free from fringe artefacts caused by the longer coherence length of conventional lasers. We have also obtained images of cytoskeletal detail that is difficult to see with a monochromatic laser. PMID:22432542
O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T
2005-01-01
Background The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. Methods AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Results Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. Conclusion EGFR
INTERFERENCE OF THE RUNNING WAVES AT LIGHT BRIDGES OF A SUNSPOT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Su, J. T.; Priya, T. G.; Yu, S. J.
The observations of chromospheric oscillations of two umbral light bridges (LBs) within a sunspot from NOAA Active Region 12127 are presented. It was found that the running umbral waves with periods of 2.2–2.6 minutes underwent very fast damping before approaching umbral boundaries, while those with higher periods (>2.6 minutes) could propagate outside umbrae. On two sides of each LB adjacent to umbrae, the cross-wavelet spectra displayed that the oscillations on them had a common significant power region with dominant frequencies of 2–6 minutes and phase differences of ∼90°. A counterstream of two running umbral waves in the 2–6 minute frequencymore » range propagated toward the LBs, where they encountered each other and gave rise to constructive or even destructive interference on the LBs. In addition, the velocity and density perturbations on the LBs were found in opposite phases suggesting that the perturbations were caused by the downward propagating waves.« less
Yang, Wenbin; Zhao, Xiaoqing; Liang, Ran; Chen, Da
2017-09-01
To investigate the effects of small RNA interference targeting mammalian target of rapamycin (mTOR) expression on paraquat-induced pulmonary fibrosis in rats. Human embryonic kidney cells HEK-293 were cultured in vitro. The mTOR small interfering RNA (mTOR-siRNA) expression plasmid transfection lentivirus was constructed, and non-specific sequence plasmid with no homology to mTOR gene was set as the control. Seventy-two healthy male Sprague-Dawley (SD) rats were randomly divided into normal saline (NS) control group, paraquat model group, mTOR unrelated sequence group, and mTOR-siRNA group, with 18 rats in each group. Paraquat poisoning animal model was reproduced by intraperitoneally injecting 20% paraquat solution 15 mg/kg, while the NS control group was intraperitoneally injected the same volumes of NS. Rats in the mTOR unrelated sequence group and mTOR-siRNA group were injected 1×10 9 TU/mL lentivirus solution 50 μL into the airway, respectively, while in the NS control group and paraquat model group were injected the same volumes of NS. At 7, 14 and 28 days after treatment, 6 rats in each group were sacrificed respectively for lung tissue, the pathological changes and fibrosis of lung tissues were observed under light microscope. The levels of hydroxyproline (HYP) in lung tissues were determined by alkaline hydrolysis. The mRNA and protein expressions of mTOR in lung tissues were determined by reverse transcription-polymerase chain reaction (RT-PCR) and Western Blot. Under light microscope, there was no obvious pathological changes in the lung tissues in the NS control group, while in the paraquat model group and mTOR unrelated sequence group, lung tissue in rats were damaged, there were a lot of inflammatory cell infiltration, a large number of matrix collagen and fibrous tissues hyperplasia, and gradually increased with time, and it was consistent with paraquat-induced lung tissue fibrosis process. The pathological and fibrotic changes in lung tissue of mTOR-siRNA
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells
Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-01-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.
Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-03-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).
NASA Astrophysics Data System (ADS)
Shaul, Oren; Fanrazi-Kahana, Michal; Meitav, Omri; Pinhasi, Gad A.; Abookasis, David
2018-03-01
Optical properties of biological tissues are valuable diagnostic parameters which can provide necessary information regarding tissue state during disease pathogenesis and therapy. However, different sources of interference, such as temperature changes may modify these properties, introducing confounding factors and artifacts to data, consequently skewing their interpretation and misinforming clinical decision-making. In the current study, we apply spatial light modulation, a type of diffuse reflectance hyperspectral imaging technique, to monitor the variation in optical properties of highly scattering turbid media in the presence varying levels of the following sources of interference: scattering concentration, temperature, and pressure. Spatial near-infrared (NIR) light modulation is a wide-field, non-contact emerging optical imaging platform capable of separating the effects of tissue scattering from those of absorption, thereby accurately estimating both parameters. With this technique, periodic NIR illumination patterns at alternately low and high spatial frequencies, at six discrete wavelengths between 690 to 970 nm, were sequentially projected upon the medium while a CCD camera collects the diffusely reflected light. Data analysis based assumptions is then performed off-line to recover the medium's optical properties. We conducted a series of experiments demonstrating the changes in absorption and reduced scattering coefficients of commercially available fresh milk and chicken breast tissue under different interference conditions. In addition, information on the refractive index was study under increased pressure. This work demonstrates the utility of NIR spatial light modulation to detect varying sources of interference upon the optical properties of biological samples.
Pollari, Maija; Ruotsalainen, Virpi; Rantamäki, Susanne; Tyystjärvi, Esa; Tyystjärvi, Taina
2009-06-01
In cyanobacteria, gene expression is regulated mainly at the level of transcription initiation, which is mediated by the RNA polymerase holoenzyme. The RNA polymerase core is catalytically active, while the sigma factor recognizes promoter sequences. Group 2 sigma factors are similar to the principal sigma factor but are nonessential. Group 2 sigma factors SigB and SigD are structurally the most similar sigma factors in Synechocystis sp. strain PCC 6803. Under standard growth conditions, simultaneous inactivation of sigB and sigD genes did not affect the growth, but the photosynthesis and growth of the DeltasigBD strain were slower than in the control strain at double light intensity. Light-saturated electron transfer rates and the fluorescence and thermoluminescence measurements showed that photosynthetic light reactions are fully functional in the DeltasigBD strain, but absorption and 77 K emission spectra measurements suggest that the light-harvesting system of the DeltasigBD strain does not acclimate normally to higher light intensity. Furthermore, the DeltasigBD strain is more sensitive to photoinhibition under bright light because impaired upregulation of psbA genes leads to insufficient PSII repair.
Biochemical and Structural Studies of RNA Modification and Repair
ERIC Educational Resources Information Center
Chan, Chio Mui
2009-01-01
RNA modification, RNA interference, and RNA repair are important events in the cell. This thesis presents three projects related to these three fields. By using both biochemical and structural methods, we characterized enzymatic activities of pseudouridine synthase TruD, solved the structure of "A. aeolicus" GidA, and reconstituted a novel…
Molecular Mechanisms of RNA-Targeting by Cas13-containing Type VI CRISPR-Cas Systems.
O'Connell, Mitchell
2018-06-22
Prokaryotic adaptive immune systems use CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) and CRISPR associated (Cas) proteins for RNA-guided cleavage of foreign genetic elements. The focus of this review, Type VI CRISPR-Cas systems, include a single protein known as Cas13 (formerly C2c2), that when assembled with a crRNA forms a crRNA-guided RNA-targeting effector complex. Type VI CRISPR-Cas systems can be divided into four subtypes (A-D) based on Cas13 phylogeny. All Cas13 proteins studied to date possess two enzymatically distinct ribonuclease activities that are required for optimal interference. One RNase is responsible for pre-crRNA processing to form mature Type VI interference complexes, while the other RNase activity provided by the two HEPN (Higher Eukaryotes and Prokaryotes Nucleotide-binding) domains, is required for degradation of target RNA during viral interference. In this review, I will compare and contrast what is known about the molecular architecture and behavior of Type VI (A-D) CRISPR-Cas13 interference complexes, how this allows them to carry out their RNA-targeting function, how Type VI accessory proteins are able to modulate Cas13 activity, and how together all of these features have led to the rapid development of a range of RNA-targeting applications. Throughout I will also discuss some of the outstanding questions regarding Cas13's molecular behavior, and its role in bacterial adaptive immunity and RNA-targeting applications. Copyright © 2018. Published by Elsevier Ltd.
Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P
2017-01-01
Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
RNA interference-based therapeutics for inherited long QT syndrome.
Li, Guoliang; Ma, Shuting; Sun, Chaofeng
2015-08-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.
RNA interference-based therapeutics for inherited long QT syndrome
LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG
2015-01-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327
Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.
2009-01-01
Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664
Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.
2014-01-01
RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway. PMID:26550181
Liu, Nan; Li, Ying; Chen, Hui; Wei, Wei; An, Yulin; Zhu, Guangming
2015-01-01
Notch3 plays an important role in differentiation, migration and signal transduction of vascular smooth muscle cells (VSMCs). In this study, we used RNA interference (RNAi) technique to investigate the effect of knocking down the expression of the NOTCH3 gene in VSMCs on the phenotype determination under pathologic status. Real-time PCR and Western Blot experiments verified the expression levels of Notch3 mRNA and protein were reduced more than 40% and 50% in the NOTCH3 siRNA group. When the expression of Notch3 was decreased, the proliferation, apoptosis and immigration of VSMCs were enhanced compared to control groups (P < 0.01). NOTCH3 siRNA VSMCs observed using confocal microscopy showed abnormal nuclear configuration, a disorganized actin filament system, polygonal cell shapes, and decreasing cell sizes. Additionally, knocking down the expression of NOTCH3 may evoke the CASR and FAK expression. In Conclusion, interfering with the expression of NOTCH3 causes VSMCs to exhibit an intermediate phenotype. CaSR and FAK may be involved in the Notch3 signaling pathway.
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.
2016-01-01
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N
2016-02-26
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
Activation of different split functionalities upon re-association of RNA-DNA hybrids
Afonin, Kirill A.; Viard, Mathias; Martins, Angelica N.; Lockett, Stephen J.; Maciag, Anna E.; Freed, Eric O.; Heldman, Eliahu; Jaeger, Luc; Blumenthal, Robert; Shapiro, Bruce A.
2013-01-01
Split-protein systems, an approach that relies on fragmentation of proteins with their further conditional re-association to form functional complexes, are increasingly used for various biomedical applications. This approach offers tight control of the protein functions and improved detection sensitivity. Here we show a similar technique based on a pair of RNA-DNA hybrids that can be generally used for triggering different split functionalities. Individually, each hybrid is inactive but when two cognate hybrids re-associate, different functionalities are triggered inside mammalian cells. As a proof of concept this work is mainly focused on activation of RNA interference; however the release of other functionalities (resonance energy transfer and RNA aptamer) is also shown. Furthermore, in vivo studies demonstrate a significant uptake of the hybrids by tumors together with specific gene silencing. This split-functionality approach presents a new route in the development of “smart” nucleic acids based nanoparticles and switches for various biomedical applications. PMID:23542902
Walker, William B; Allen, Margaret L
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris.
Walker, William B.; Allen, Margaret L.
2010-01-01
Three genes encoding polygalacturonase (PG) have been identified in Lygus lineolaris (Palisot de Beauvois) (Miridae: Hemiptera). Earlier studies showed that the three PG gene transcripts are exclusively expressed in the feeding stages of L. lineolaris. In this report, it is shown that all three transcripts are specifically expressed in salivary glands indicating that PGs are salivary enzymes. Transcriptional profiles of the three PGs were evaluated with respect to diet, comparing live cotton plant material to artificial diet. PG2 transcript levels were consistently lower in cotton-fed insects than those reared on artificial diet. RNA interference was used to knock down expression of PG1 mRNA in adult salivary glands providing the first demonstration of the use of this method in the non-model insect, L. lineolaris. PMID:21062205
USDA-ARS?s Scientific Manuscript database
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.
Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar
2015-01-01
The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.
Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.
Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu
2014-02-04
TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-01-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. PMID:15084750
Construction of siRNA/miRNA expression vectors based on a one-step PCR process
Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin
2009-01-01
Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634
Cancer Theranostics with Near-Infrared Light-Activatable Multimodal Nanoparticles
Melancon, Marites P.; Zhou, Min; Li, Chun
2011-01-01
CONSPECTUS Nanomaterials that interact with light provide a unique opportunity for biophotonic nanomedicine. Multifunctional nanoparticles (NPs) that have strong and tunable surface plasmon resonance absorption in the near-infrared region combined with visibility with multiple imaging modalities (magnetic resonance imaging, nuclear imaging, and photoacoustic imaging) have great potential in image-guided therapies. These novel nanostructures, once introduced, are expected to home to solid tumors via the enhanced permeability and retention effect (a passive targeting mechanism) or via targeting ligands bound to their surfaces (an active targeting mechanism). The primary mode of action for photothermal conducting NPs is to convert photoenergy into heat, causing temperature in the treatment volume to be elevated above the thermal damage threshold, which results in irreversible cell killing. It is now recognized that this process, termed photothermal ablation therapy or PTA, although very effective, is unlikely to kill all tumor cells when used alone. In addition to PTA, photothermal conducting NPs can also efficiently trigger drug release and activate RNA interference. Such a multimodal approach, which permits simultaneous PTA therapy, chemotherapy, and therapeutic RNA interference, should provide an opportunity for complete eradication of residual disease. In this Account, we provide an up-to-date review of the synthesis and characterization, functionalization, and in vitro and in vivo evaluation of NIR light-activatable multifunctional nanostructures used for imaging and therapy, with an emphasis on hollow gold nanospheres, magnetic core–shell gold nanoshells, and semiconductor copper monosulfide NPs. We discuss three types novel drug delivery systems in which hollow gold nanospheres are used to mediate controlled drug release. PMID:21848277
McCAIN, JACK
2004-01-01
Mammalian cells dislike double-stranded RNA. They interpret it as a sign of an intruder, and they can unleash a recently discovered defensive mechanism to deal with the problem – they chop the invader into little pieces and use the remnants, called small interfering RNA, to identify and destroy the invader and its progeny. This process, known as RNA interference, may lend itself to new treatments for a wide range of diseases. RNA interference, however, resembles two therapies studied during the 1990s, antisense and ribozymes, in that the gene-silencing target is messenger RNA (mRNA). Is RNA interference really the Next Big Thing – or just a variation on an older but still intriguing theme? PMID:23372488
Knockdown of Zinc Transporter ZIP5 by RNA Interference Inhibits Esophageal Cancer Growth In Vivo.
Li, Qian; Jin, Jing; Liu, Jianghui; Wang, Liqun; He, Yutong
2016-01-01
We recently found that SLC39A5 (ZIP5), a zinc transporter, is overexpressed in esophageal cancer. Downregulation of ZIP5 inhibited the proliferation, migration, and invasion of the esophageal cancer cell line KYSE170 in vitro. In this study, we found that downregulation of SLC39A5 (ZIP5) by interference resulted in a significant reduction in esophageal cancer tumor volume and weight in vivo. COX2 (cyclooxygenase 2) expression was decreased and E-cadherin expression was increased in the KYSE170K xenografts, which was caused by the downregulation of ZIP5. However, we did not find that the downregulation of ZIP5 caused a change in the relative expressions of cyclin D1, VEGF (vascular endothelial growth factor), MMP9 (matrix metalloprotein 9), and Bcl-2 (B-cell lymphoma/leukmia-2) mRNA or an alteration in the average level of zinc in the peripheral blood and xenografts in vivo. Collectively, these findings indicate that knocking down ZIP5 by small interfering RNA (siRNA) might be a novel treatment strategy for esophageal cancer with ZIP5 overexpression.
The RNA-induced silencing complex: a versatile gene-silencing machine.
Pratt, Ashley J; MacRae, Ian J
2009-07-03
RNA interference is a powerful mechanism of gene silencing that underlies many aspects of eukaryotic biology. On the molecular level, RNA interference is mediated by a family of ribonucleoprotein complexes called RNA-induced silencing complexes (RISCs), which can be programmed to target virtually any nucleic acid sequence for silencing. The ability of RISC to locate target RNAs has been co-opted by evolution many times to generate a broad spectrum of gene-silencing pathways. Here, we review the fundamental biochemical and biophysical properties of RISC that facilitate gene targeting and describe the various mechanisms of gene silencing known to exploit RISC activity.
Development of Light-Activated CRISPR Using Guide RNAs with Photocleavable Protectors.
Jain, Piyush K; Ramanan, Vyas; Schepers, Arnout G; Dalvie, Nisha S; Panda, Apekshya; Fleming, Heather E; Bhatia, Sangeeta N
2016-09-26
The ability to remotely trigger CRISPR/Cas9 activity would enable new strategies to study cellular events with greater precision and complexity. In this work, we have developed a method to photocage the activity of the guide RNA called "CRISPR-plus" (CRISPR-precise light-mediated unveiling of sgRNAs). The photoactivation capability of our CRISPR-plus method is compatible with the simultaneous targeting of multiple DNA sequences and supports numerous modifications that can enable guide RNA labeling for use in imaging and mechanistic investigations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Resonance--Continuum Interference in Light Higgs Boson Production at a Photon Collider
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dixon, Lance J.; Sofianatos, Yorgos; /SLAC /Stanford U., Phys. Dept.
2009-01-06
We study the effect of interference between the Standard Model Higgs boson resonance and the continuum background in the process {gamma}{gamma} {yields} H {yields} b{bar b} at a photon collider. Taking into account virtual gluon exchange between the final-state quarks, we calculate the leading corrections to the height of the resonance for the case of a light (m{sub H} < 160 GeV) Higgs boson. We find that the interference is destructive and around 0.1-0.2% of the peak height, depending on the mass of the Higgs and the scattering angle. This suppression is smaller by an order of magnitude than themore » anticipated experimental accuracy at a photon collider. However, the fractional suppression can be significantly larger if the Higgs coupling to b quarks is increased by physics beyond the Standard Model.« less
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
PsOr1, a potential target for RNA interference-based pest management.
Zhao, Y Y; Liu, F; Yang, G; You, M S
2011-02-01
Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.
2012-01-01
Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894
Meng, Zhu; Song, Mei-Yan; Li, Chuan-Fang; Zhao, Jia-Qi
2017-12-16
remarkably suppressed by NLRP3 KO. Taken together, our study indicated that shRNA interference of NLRP3 inflammasome attenuated myocardial I/R injury via autophagy activation. These findings demonstrated that NLRP3 KO may a promising therapy in myocardial I/R injury. Copyright © 2017 Elsevier Inc. All rights reserved.
Eichhorn, Pieter J. A; Creyghton, Menno P; Wilhelmsen, Kevin; van Dam, Hans; Bernards, René
2007-01-01
Protein Phosphatase type 2A (PP2A) represents a family of holoenzyme complexes with diverse biological activities. Specific holoenzyme complexes are thought to be deregulated during oncogenic transformation and oncogene-induced signaling. Since most studies on the role of this phosphatase family have relied on the use of generic PP2A inhibitors, the contribution of individual PP2A holoenzyme complexes in PP2A-controlled signaling pathways is largely unclear. To gain insight into this, we have constructed a set of shRNA vectors targeting the individual PP2A regulatory subunits for suppression by RNA interference. Here, we identify PR55γ and PR55δ as inhibitors of c-Jun NH2-terminal kinase (JNK) activation by UV irradiation. We show that PR55γ binds c-SRC and modulates the phosphorylation of serine 12 of c-SRC, a residue we demonstrate to be required for JNK activation by c-SRC. We also find that the physical interaction between PR55γ and c-SRC is sensitive to UV irradiation. Our data reveal a novel mechanism of c-SRC regulation whereby in response to stress c-SRC activity is regulated, at least in part, through loss of the interaction with its inhibitor, PR55γ. PMID:18069897
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
Label-free, multi-scale imaging of ex-vivo mouse brain using spatial light interference microscopy
NASA Astrophysics Data System (ADS)
Min, Eunjung; Kandel, Mikhail E.; Ko, Chemyong J.; Popescu, Gabriel; Jung, Woonggyu; Best-Popescu, Catherine
2016-12-01
Brain connectivity spans over broad spatial scales, from nanometers to centimeters. In order to understand the brain at multi-scale, the neural network in wide-field has been visualized in detail by taking advantage of light microscopy. However, the process of staining or addition of fluorescent tags is commonly required, and the image contrast is insufficient for delineation of cytoarchitecture. To overcome this barrier, we use spatial light interference microscopy to investigate brain structure with high-resolution, sub-nanometer pathlength sensitivity without the use of exogenous contrast agents. Combining wide-field imaging and a mosaic algorithm developed in-house, we show the detailed architecture of cells and myelin, within coronal olfactory bulb and cortical sections, and from sagittal sections of the hippocampus and cerebellum. Our technique is well suited to identify laminar characteristics of fiber tract orientation within white matter, e.g. the corpus callosum. To further improve the macro-scale contrast of anatomical structures, and to better differentiate axons and dendrites from cell bodies, we mapped the tissue in terms of its scattering property. Based on our results, we anticipate that spatial light interference microscopy can potentially provide multiscale and multicontrast perspectives of gross and microscopic brain anatomy.
Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui
2015-10-01
The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.
Direct observation of frequency modulated transcription in single cells using light activation
Larson, Daniel R; Fritzsch, Christoph; Sun, Liang; Meng, Xiuhau; Lawrence, David S; Singer, Robert H
2013-01-01
Single-cell analysis has revealed that transcription is dynamic and stochastic, but tools are lacking that can determine the mechanism operating at a single gene. Here we utilize single-molecule observations of RNA in fixed and living cells to develop a single-cell model of steroid-receptor mediated gene activation. We determine that steroids drive mRNA synthesis by frequency modulation of transcription. This digital behavior in single cells gives rise to the well-known analog dose response across the population. To test this model, we developed a light-activation technology to turn on a single steroid-responsive gene and follow dynamic synthesis of RNA from the activated locus. DOI: http://dx.doi.org/10.7554/eLife.00750.001 PMID:24069527
A development optical course based on optical fiber white light interference
NASA Astrophysics Data System (ADS)
Jiang, Haili; Sun, Qiuhua; Zhao, Yancheng; Li, Qingbo
2017-08-01
The Michelson interferometer is a very important instrument in optical part for college physics teaching. But most students only know the instrument itself and don't know how to use it in practical engineering problems. A case about optical fiber white light interference based on engineering practice was introduced in the optical teaching of college physics and then designed a development course of university physical optics part. This system based on low-coherence white light interferometric technology can be used to measure distribution strain or temperature. It also could be used in the case of temperature compensation mode.This teaching design can use the knowledge transfer rule to enable students to apply the basic knowledge in the university physics to the new knowledge domain, which can promote the students' ability of using scientific methods to solve complex engineering problems.
Chen, Q W; Jin, S; Zhang, L; Shen, Q D; Wei, P; Wei, Z M; Wang, S G; Tang, B
2018-06-01
RNA interference (RNAi) is a very effective technique for studying gene function and may be an efficient method for controlling pests. Trehalose-6-phosphate synthase (TPS), which plays a key role in the synthesis of trehalose and insect development, was cloned in Tribolium castaneum (Herbst) (TcTPS) and the putative functions were studied using RNAi via the injection of double-stranded RNA (dsRNA) corresponding to conserved TPS and trehalose-6-phosphate phosphatase domains. Expression analyses show that TcTPS is expressed higher in the fat body, while quantitative real-time polymerase chain reaction results show that the expression of four trehalase isoforms was significantly suppressed by dsTPS injection. Additionally, the expression of six chitin synthesis-related genes, such as hexokinase 2 and glutamine-fructose-6-phosphate aminotransferase, was suppressed at 48 and 72 h post-dsTPS-1 and dsTPS-2 RNA injection, which were two dsTPS fragments that had been designed for two different locations in TcTPS open reading frame, and that trehalose content and trehalase 1 activity decreased significantly at 72 h post-dsRNA injection. Furthermore, T. castaneum injected with dsTPS-1 and dsTPS-2 RNA displayed significantly lower levels of chitin and could not complete the molting process from larvae to pupae, revealing abnormal molting phenotypes. These results demonstrate that silencing TPS gene leads to molting deformities and high mortality rates via regulation of gene expression in the chitin biosynthetic pathway, and may be a promising approach for pest control in the future.
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
Small RNA binding is a common strategy to suppress RNA silencing by several viral suppressors
Lakatos, Lóránt; Csorba, Tibor; Pantaleo, Vitantonio; Chapman, Elisabeth J; Carrington, James C; Liu, Yu-Ping; Dolja, Valerian V; Calvino, Lourdes Fernández; López-Moya, Juan José; Burgyán, József
2006-01-01
RNA silencing is an evolutionarily conserved system that functions as an antiviral mechanism in higher plants and insects. To counteract RNA silencing, viruses express silencing suppressors that interfere with both siRNA- and microRNA-guided silencing pathways. We used comparative in vitro and in vivo approaches to analyse the molecular mechanism of suppression by three well-studied silencing suppressors. We found that silencing suppressors p19, p21 and HC-Pro each inhibit the intermediate step of RNA silencing via binding to siRNAs, although the molecular features required for duplex siRNA binding differ among the three proteins. None of the suppressors affected the activity of preassembled RISC complexes. In contrast, each suppressor uniformly inhibited the siRNA-initiated RISC assembly pathway by preventing RNA silencing initiator complex formation. PMID:16724105
Ben-Moshe, Zohar; Alon, Shahar; Mracek, Philipp; Faigenbloom, Lior; Tovin, Adi; Vatine, Gad D.; Eisenberg, Eli; Foulkes, Nicholas S.; Gothilf, Yoav
2014-01-01
Light constitutes a primary signal whereby endogenous circadian clocks are synchronized (‘entrained’) with the day/night cycle. The molecular mechanisms underlying this vital process are known to require gene activation, yet are incompletely understood. Here, the light-induced transcriptome in the zebrafish central clock organ, the pineal gland, was characterized by messenger RNA (mRNA) sequencing (mRNA-seq) and microarray analyses, resulting in the identification of multiple light-induced mRNAs. Interestingly, a considerable portion of the molecular clock (14 genes) is light-induced in the pineal gland. Four of these genes, encoding the transcription factors dec1, reverbb1, e4bp4-5 and e4bp4-6, differentially affected clock- and light-regulated promoter activation, suggesting that light-input is conveyed to the core clock machinery via diverse mechanisms. Moreover, we show that dec1, as well as the core clock gene per2, is essential for light-entrainment of rhythmic locomotor activity in zebrafish larvae. Additionally, we used microRNA (miRNA) sequencing (miR-seq) and identified pineal-enhanced and light-induced miRNAs. One such miRNA, miR-183, is shown to downregulate e4bp4-6 mRNA through a 3′UTR target site, and importantly, to regulate the rhythmic mRNA levels of aanat2, the key enzyme in melatonin synthesis. Together, this genome-wide approach and functional characterization of light-induced factors indicate a multi-level regulation of the circadian clockwork by light. PMID:24423866
Lorenzo-Morales, Jacob; Kliescikova, Jarmila; Martinez-Carretero, Enrique; De Pablos, Luis Miguel; Profotova, Bronislava; Nohynkova, Eva; Osuna, Antonio; Valladares, Basilio
2008-03-01
Acanthamoeba infections are difficult to treat due to often late diagnosis and the lack of effective and specific therapeutic agents. The most important reason for unsuccessful therapy seems to be the existence of a double-wall cyst stage that is highly resistant to the available treatments, causing reinfections. The major components of the Acanthamoeba cyst wall are acid-resistant proteins and cellulose. The latter has been reported to be the major component of the inner cyst wall. It has been demonstrated previously that glycogen is the main source of free glucose for the synthesis of cellulose in Acanthamoeba, partly as glycogen levels fall during the encystment process. In other lower eukaryotes (e.g., Dictyostelium discoideum), glycogen phosphorylase has been reported to be the main tool used for glycogen breakdown in order to maintain the free glucose levels during the encystment process. Therefore, it was hypothesized that the regulation of the key processes involved in the Acanthamoeba encystment may be similar to the previously reported regulation mechanisms in other lower eukaryotes. The catalytic domain of the glycogen phosphorylase was silenced using RNA interference methods, and the effect of this phenomenon was assessed by light and electron microscopy analyses, calcofluor staining, expression zymogram assays, and Northern and Western blot analyses of both small interfering RNA-treated and control cells. The present report establishes the role of glycogen phosphorylase during the encystment process of Acanthamoeba. Moreover, the obtained results demonstrate that the enzyme is required for cyst wall assembly, mainly for the formation of the cell wall inner layer.
Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang
2014-01-01
Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.
Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima
2012-07-01
Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (P<0.05)]. Western blot results showed that the GFI-1 protein expression level in the GFI-1 siRNA group was also significantly reduced, compared with those of the NC group and vehicle group (P<0.05 for both). From MTT assay data, the absorbance value of NT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (P<0.05); G0/G1: (66.7±3.8)% vs. (53.3±4.5)% and (48.6±3.2)%, respectively, (P<0.05)]. Furthermore, the tumor weight in the GFI-1 siRNA group [(0.37±0.02) g] was significantly lower than those in the NC group [(0.83±0.06) g] and vehicle group [(0.92±0.04) g] (P<0.05). RNA interference targeting GFI-1 inhibits the growth
Bellissimo, Teresa; Masciarelli, Silvia; Poser, Elena; Genovese, Ilaria; Del Rio, Alberto; Colotti, Gianni; Fazi, Francesco
2017-01-01
The development of small-molecule-based target therapy design for human disease and cancer is object of growing attention. Recently, specific microRNA (miRNA) mimicking compounds able to bind the miRNA-binding domain of Argonaute 2 protein (AGO2) to inhibit miRNA loading and its functional activity were described. Computer-aided molecular design techniques and RNA immunoprecipitation represent suitable approaches to identify and experimentally determine if a compound is able to impair the loading of miRNAs on AGO2 protein. Here, we describe these two methodologies that we recently used to select a specific compound able to interfere with the AGO2 functional activity and able to improve the retinoic acid-dependent myeloid differentiation of leukemic cells.
Positive interference in lithium determinations from clot activator in collection container.
Sampson, M; Ruddel, M; Albright, S; Elin, R J
1997-04-01
We describe positive interference with the ion-selective electrode determination of lithium (Lytening 2Z analyzer; Dade) when blood is collected in a 10-mL plain red-top plastic Vacutainer Plus Tube (Becton Dickinson) containing a silica clot activator and silicone surfactant (prod. no. 36-7820). We evaluated both the original tube (blue-labeled) and a new tube formulated to contain less silicone surfactant (striped-labeled). We determined that the interference is from either the silica clot activator or the silicone surfactant used to fix the silica to the tube and is inversely related to the volume of blood in the tube. Long-term intermittent exposure of the Li ion-selective electrode to the silica clot activator or surfactant results in decreased Li values--in terms of both the positive interference by the silica clot activator or surfactant and the actual Li determinations. Moreover, this long-term interference with the Li ion-selective electrode for patient's specimens is undetected by the Dade control material (QCLytes).
Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto
2012-01-01
In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4–OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants. PMID:22764280
Hirose, Fumiaki; Inagaki, Noritoshi; Hanada, Atsushi; Yamaguchi, Shinjiro; Kamiya, Yuji; Miyao, Akio; Hirochika, Hirohiko; Takano, Makoto
2012-09-01
In contrast to a wealth of knowledge about the photoregulation of gibberellin metabolism in dicots, that in monocots remains largely unclear. In this study, we found that a blue light signal triggers reduction of active gibberellin content in rice seedlings with simultaneous repression of two gibberellin 20-oxidase genes (OsGA20ox2 and OsGA20ox4) and acute induction of four gibberellin 2-oxidase genes (OsGA2ox4-OsGA2ox7). For further examination of the regulation of these genes, we established a series of cryptochrome-deficient lines through reverse genetic screening from a Tos17 mutant population and construction of knockdown lines based on an RNA interference technique. By using these lines and phytochrome mutants, we elucidated that cryptochrome 1 (cry1), consisting of two species in rice plants (cry1a and cry1b), is indispensable for robust induction of the GA2ox genes. On the other hand, repression of the GA20ox genes is mediated by phytochromes. In addition, we found that the phytochromes also mediate the repression of a gibberellin 3-oxidase gene (OsGA3ox2) in the light. These results imply that, in rice seedlings, phytochromes mediate the repression of gibberellin biosynthesis capacity, while cry1 mediates the induction of gibberellin inactivation capacity. The cry1 action was demonstrated to be dominant in the reduction of active gibberellin content, but, in rice seedlings, the cumulative effects of these independent actions reduced active gibberellin content in the light. This pathway design in which different types of photoreceptors independently but cooperatively regulate active gibberellin content is unique from the viewpoint of dicot research. This redundancy should provide robustness to the response in rice plants.
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
Chang, Tzuu-Wang; Janardhanan, Pavithra; Mello, Charlene M; Singh, Bal Ram; Cai, Shuowei
2016-09-01
Botulinum neurotoxin (BoNT), a category A agent, is the most toxic molecule known to mankind. The endopeptidase activity of light chain domain of BoNT is the cause for the inhibition of the neurotransmitter release and the flaccid paralysis that leads to lethality in botulism. Currently, antidotes are not available to reverse the flaccid paralysis caused by BoNT. In the present study, a non-radioactive-based systematic evolution of ligands by exponential enrichment (SELEX) process is developed by utilizing surface plasmon resonance to monitor the binding enrichment. Two RNA aptamers have been identified as strong binders against light chain of botulinum neurotoxin type A. These two aptamers showed strong inhibition activity on LCA, with IC50 in nanomolar range. Inhibition kinetic studies reveal mid nanomolar KI and non-competitive nature of their inhibition, suggesting that they have strong potential as antidotes that can reverse the symptom caused by BoNT/A. More importantly, we observed that the 2'-fluorine-pyrimidine-modified RNA aptamers identified here do not change their binding and biological activities. This observation could lead to a cost-effective way for SELEX, by using regular nucleotide during SELEX, and 2'-fluorine-pyrimidine-modified nucleotide for final application to enhance their RNase-resistance.
Chang, Tzuu-Wang; Janardhanan, Pavithra; Mello, Charlene; Singh, Bal Ram; Cai, Shuowei
2016-01-01
Botulinum neurotoxin (BoNT), a category A agent, is the most toxic molecule known to mankind. The endopeptidase activity of light chain domain of BoNT is the cause for the inhibition of the neurotransmitter release and the flaccid paralysis that leads to lethality in botulism. Currently, antidotes are not available to reverse the flaccid paralysis caused by BoNT. In the present study, a non-radioactive based SELEX process is developed by utilizing surface plasmon resonance to monitor the binding enrichment. Two RNA aptamers have been identified as strong binders against light chain of botulinum neurotoxin type A. These two aptamers showed strong inhibition activity on LCA, with IC50 in nM range. Inhibition kinetic studies reveal mid nanomolar KI and non-competitive nature of their inhibition, suggesting they have strong potential as antidotes that can reverse the symptom caused by BoNT/A. More importantly, we observed that 2′-fluorine-pyrimidines modified RNA aptamers identified here do not change their binding and biological activities. This observation could lead to a cost-effective way for Systematic Evolution of Ligands by EXponential enrichment (SELEX), by using regular nucleotide during SELEX, and 2′-fluorine-pyrimidines modified nucleotide for final application to enhance their RNase-resistance. PMID:27085355
Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de
2014-01-01
The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.
Izzotti, Alberto; Calin, George A.; Steele, Vernon E.; Croce, Carlo M.; De Flora, Silvio
2009-01-01
MicroRNAs provide a formidable tool not only in cancer research but also to investigate physiological mechanisms and to assess the effect of environmental exposures in healthy tissues. Collectively, cigarette smoke and sunlight have been estimated to account for 40% of all human cancers, and not only smoke but also, surprisingly, UV light induced genomic and postgenomic alterations in mouse lung. Here we evaluated by microarray the expression of 484 microRNAs in the lungs of CD-1 mice, including newborns, postweanling males and females, and their dams, either untreated or exposed to environmental cigarette smoke and/or UV-containing light. The results obtained highlighted age-related variations in microRNA profiles, especially during the weanling period, due to perinatal stress and postnatal maturation of the lung. UV light alone did not affect pulmonary microRNAs, whereas smoke produced dramatic changes, mostly in the sense of down-regulation, reflecting both adaptive mechanisms and activation of pathways involved in the pathogenesis of pulmonary diseases. Both gender and age affected smoke-related microRNA dysregulation in mice. The data presented provide supporting evidence that microRNAs play a fundamental role in both physiological and pathological changes occurring in mouse lung.—Izzotti, A., Calin, G. A., Vernon E. St., Croce, G. M., De Flora, S. Relationships of microRNA expression in mouse lung with age and exposure to cigarette smoke and light. PMID:19465468
Neutral Polymeric Micelles for RNA Delivery
Lundy, Brittany B.; Convertine, Anthony; Miteva, Martina; Stayton, Patrick S.
2013-01-01
RNA interference (RNAi) drugs have significant therapeutic potential but delivery systems with appropriate efficacy and toxicity profiles are still needed. Here, we describe a neutral, ampholytic polymeric delivery system based on conjugatable diblock polymer micelles. The diblock copolymer contains a hydrophilic poly[N-(2-hydroxypropyl) methacrylamide-co-N-(2-(pyridin-2- yldisulfanyl)ethyl)methacrylamide) (poly[HPMA-co-PDSMA]) segment to promote aqueous stability and facilitate thiol-disulfide exchange reactions, and a second ampholytic block composed of propyl acrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The poly[(HPMA-co-PDSMA)-b-(PAA-co-DMAEMA-co-BMA)] was synthesized using Reversible Addition-Fragmentation chain Transfer (RAFT) polymerization with an overall molecular weight of 22,000 g/mol and a PDI of 1.88. Dynamic light scattering and fluorescence measurements indicated that the diblock copolymers self-assemble under aqueous conditions to form polymeric micelles with a hydrodynamic radius and critical micelle concentration of 25 nm and 25 μg/mL respectively. Red blood cell hemolysis experiments show that the neutral hydrophilic micelles have potent membrane destabilizing activity at endosomal pH values. Thiolated siRNA targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was directly conjugated to the polymeric micelles via thiol exchange reactions with the pyridal disulfide groups present in the micelle corona. Maximum silencing activity in HeLa cells was observed at a 1:10 molar ratio of siRNA to polymer following a 48 h incubation period. Under these conditions 90 % mRNA knockdown and 65 % and protein knockdown of at 48 h was achieved with negligible toxicity. In contrast the polymeric micelles lacking a pH-responsive endosomalytic segment demonstrated negligible mRNA and protein knockdown under these conditions. The potent mRNA knockdown and excellent biocompatibility of the neutral siRNA conjugates
Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference
Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant
2015-01-01
The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748
Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S
2018-06-19
Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.
A small RNA activates CFA synthase by isoform-specific mRNA stabilization
Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg
2013-01-01
Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5′ end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5′ untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability. PMID:24141880
A small RNA activates CFA synthase by isoform-specific mRNA stabilization.
Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg
2013-11-13
Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.
Stein, Elisabeth A; Pinkert, Sandra; Becher, Peter Moritz; Geisler, Anja; Zeichhardt, Heinz; Klopfleisch, Robert; Poller, Wolfgang; Tschöpe, Carsten; Lassner, Dirk; Fechner, Henry; Kurreck, Jens
2015-02-15
Coxsackievirus B3 (CVB3) is a major heart pathogen against which no therapy exists to date. The potential of a combination treatment consisting of a proteinaceous virus receptor trap and an RNA interference-based component to prevent CVB3-induced myocarditis was investigated. A soluble variant of the extracellular domain of the coxsackievirus-adenovirus receptor (sCAR-Fc) was expressed from an adenoviral vector and 2 short hairpin RNAs (shRdRp2.4) directed against CVB3 were delivered by an adeno-associated virus (AAV) vector. Cell culture experiments revealed additive antiviral activity of the combined application. In a CVB3-induced mouse myocarditis model, both components applied individually significantly reduced inflammation and viral load in the heart. The combination exerted an additive antiviral effect and reduced heart pathology. Hemodynamic measurement revealed that infection with CVB3 resulted in impaired heart function, as illustrated by a drastically reduced cardiac output and impaired contractility and relaxation. Treatment with either sCAR-Fc or shRdRp2.4 significantly improved these parameters. Importantly, the combination of both components led to a further significant improvement of heart function. Combination of sCAR-Fc and shRdRp2.4 exerted additive effects and was significantly more effective than either of the single treatments in inhibiting CVB3-induced myocarditis and preventing cardiac dysfunction. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
RNA interference therapy: a new solution for intracranial atherosclerosis?
Tang, Tao; Wong, Ka-Sing
2014-01-01
Intracranial atherosclerotic stenosis (ICAS) of a major intracranial artery, especially middle cerebral artery (MCA), is reported to be one leading cause of ischemic stroke throughout the world. Compared with other stroke subtypes, ICAS is associated with a higher risk of recurrent stroke despite aggressive medical therapy. Increased understanding of the pathophysiology of ICAS has highlighted several possible targets for therapeutic interventions. Both luminal stenosis and plaque components of ICAS have been found to be associated with ischemic stroke based a post-mortem study. Recent application of high-resolution magnetic resonance imaging (HRMRI) in evaluating ICAS provides new insight into the vascular biology of plaque morphology and component. High signal on T1-weighted fat-suppressed images (HST1) within MCA plaque of HRMRI, highly suggested of fresh or recent intraplaque hemorrhage, has been found to be associated with ipsilateral brain infarction. Thus, the higher prevalence of intraplaque hemorrhage and neovasculature in symptomatic patients with MCA stenosis may provide a potential target for plaque stabilization. We hypothesize that RNA interference (RNAi) therapy delivered by modified nanoparticles may achieve in vivo biomedical imaging and targeted therapy. With the rapid developments in studies about therapeutic and diagnostic nanomaterials, future studies further exploring the molecular biology of atherosclerosis may provide more drug targets for plaque stabilization. PMID:25333054
Conformational changes accompany activation of reovirus RNA-dependent RNA transcription
Mendez, Israel I.; Weiner, Scott G.; She, Yi-Min; Yeager, Mark; Coombs, Kevin M.
2009-01-01
Many critical biologic processes involve dynamic interactions between proteins and nucleic acids. Such dynamic processes are often difficult to delineate by conventional static methods. For example, while a variety of nucleic acid polymerase structures have been determined at atomic resolution, the details of how some multi-protein transcriptase complexes actively produce mRNA, as well as conformational changes associated with activation of such complexes, remain poorly understood. The mammalian reovirus innermost capsid (core) manifests all enzymatic activities necessary to produce mRNA from each of the 10 encased double-stranded RNA genes. We used rapid freezing and electron cryo-microscopy to trap and visualize transcriptionally active reovirus core particles and compared them to inactive core images. Rod-like density centered within actively transcribing core spike channels was attributed to exiting nascent mRNA. Comparative radial density plots of active and inactive core particles identified several structural changes in both internal and external regions of the icosahedral core capsid. Inactive and transcriptionally active cores were partially digested with trypsin and identities of initial tryptic peptides determined by mass spectrometry. Differentially-digested peptides, which also suggest transcription-associated conformational changes, were placed within the known 3-dimensional structures of major core proteins. PMID:18321727
RNA chaperone activity of human La protein is mediated by variant RNA recognition motif.
Naeeni, Amir R; Conte, Maria R; Bayfield, Mark A
2012-02-17
La proteins are conserved factors in eukaryotes that bind and protect the 3' trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3'OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3'OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets.
RNA Chaperone Activity of Human La Protein Is Mediated by Variant RNA Recognition Motif*
Naeeni, Amir R.; Conte, Maria R.; Bayfield, Mark A.
2012-01-01
La proteins are conserved factors in eukaryotes that bind and protect the 3′ trailers of pre-tRNAs from exonuclease digestion via sequence-specific recognition of UUU-3′OH. La has also been hypothesized to assist pre-tRNAs in attaining their native fold through RNA chaperone activity. In addition to binding polymerase III transcripts, human La has also been shown to enhance the translation of several internal ribosome entry sites and upstream ORF-containing mRNA targets, also potentially through RNA chaperone activity. Using in vitro FRET-based assays, we show that human and Schizosaccharomyces pombe La proteins harbor RNA chaperone activity by enhancing RNA strand annealing and strand dissociation. We use various RNA substrates and La mutants to show that UUU-3′OH-dependent La-RNA binding is not required for this function, and we map RNA chaperone activity to its RRM1 motif including a noncanonical α3-helix. We validate the importance of this α3-helix by appending it to the RRM of the unrelated U1A protein and show that this fusion protein acquires significant strand annealing activity. Finally, we show that residues required for La-mediated RNA chaperone activity in vitro are required for La-dependent rescue of tRNA-mediated suppression via a mutated suppressor tRNA in vivo. This work delineates the structural elements required for La-mediated RNA chaperone activity and provides a basis for understanding how La can enhance the folding of its various RNA targets. PMID:22203678
RNA fluorescence with light-up aptamers
NASA Astrophysics Data System (ADS)
Ouellet, Jonathan
2016-06-01
Seeing is not only believing; it also includes understanding. Cellular imaging with GFP in live cells has been transformative in many research fields. Modulation of cellular regulation is tightly regulated and innovative imaging technologies contribute to further understand cellular signaling and physiology. New types of genetically encoded biosensors have been developed over the last decade. They are RNA aptamers that bind with their cognate fluorogen ligands and activate their fluorescence. The emergence and the evolution of these RNA aptamers as well as their conversion into a wide spectrum of applications are examined in a global way.
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
Amorim, Rebeca Padrão; Araújo, Michelle Gasparetti Leão; Valero, Jorge; Lopes-Cendes, Iscia; Pascoal, Vinicius Davila Bitencourt; Malva, João Oliveira; da Silva Fernandes, Maria José
2017-12-01
Cell signaling mediated by P2X7 receptors (P2X7R) has been suggested to be involved in epileptogenesis, via modulation of intracellular calcium levels, excitotoxicity, activation of inflammatory cascades, and cell death, among other mechanisms. These processes have been described to be involved in pilocarpine-induced status epilepticus (SE) and contribute to hyperexcitability, resulting in spontaneous and recurrent seizures. Here, we aimed to investigate the role of P2X7R in epileptogenesis in vivo using RNA interference (RNAi) to inhibit the expression of this receptor. Small interfering RNA (siRNA) targeting P2X7R mRNA was injected into the lateral ventricles (icv) 6 h after SE. Four groups were studied: Saline-Vehicle, Saline-siRNA, Pilo-Vehicle, and Pilo-siRNA. P2X7R was quantified by western blotting and neuronal death assessed by Fluoro-Jade B histochemistry. The hippocampal volume (edema) was determined 48 h following RNAi. Behavioral parameters as latency to the appearance of spontaneous seizures and the number of seizures were determined until 60 days after the SE onset. The Saline-siRNA and Pilo-siRNA groups showed a 43 and 37% reduction, respectively, in P2X7R protein levels compared to respective vehicle groups. Neuroprotection was observed in CA1 and CA3 of the Pilo-siRNA group compared to Pilo-Vehicle. P2X7R silencing in pilocarpine group reversed the increase in the edema detected in the hilus, suprapyramidal dentate gyrus, CA1, and CA3; reduced mortality rate following SE; increased the time to onset of spontaneous seizure; and reduced the number of seizures, when compared to the Pilo-Vehicle group. Therefore, our data highlights the potential of P2X7R as a therapeutic target for the adjunct treatment of epilepsy.
Gu, Xiaojun; Kumar, Sunil; Kim, Eunjin; Kim, Yonggyun
2015-09-01
Juvenile hormone (JH) plays a crucial role in preventing precocious metamorphosis and stimulating reproduction. Thus, its hemolymph titer should be under a tight control. As a negative controller, juvenile hormone esterase (JHE) performs a rapid breakdown of residual JH in the hemolymph during last instar to induce a larval-to-pupal metamorphosis. A whole genome of the diamondback moth (DBM), Plutella xylostella, has been annotated and proposed 11 JHE candidates. Sequence analysis using conserved motifs commonly found in other JHEs proposed a putative JHE (Px004817). Px004817 (64.61 kDa, pI=5.28) exhibited a characteristic JHE expression pattern by showing high peak at the early last instar, at which JHE enzyme activity was also at a maximal level. RNA interference of Px004817 reduced JHE activity and interrupted pupal development with a significant increase of larval period. This study identifies Px004817 as a JHE-like gene of P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.
Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens
2018-01-01
Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.
Dissection of K+ currents in Caenorhabditis elegans muscle cells by genetics and RNA interference
Santi, C. M.; Yuan, A.; Fawcett, G.; Wang, Z.-W.; Butler, A.; Nonet, M. L.; Wei, A.; Rojas, P.; Salkoff, L.
2003-01-01
GFP-promoter experiments have previously shown that at least nine genes encoding potassium channel subunits are expressed in Caenorhabditis elegans muscle. By using genetic, RNA interference, and physiological techniques we revealed the molecular identity of the major components of the outward K+ currents in body wall muscle cells in culture. We found that under physiological conditions, outward current is dominated by the products of only two genes, Shaker (Kv1) and Shal (Kv4), both expressing voltage-dependent potassium channels. Other channels may be held in reserve to respond to particular circumstances. Because GFP-promoter experiments indicated that slo-2 expression is prominent, we created a deletion mutant to identify the SLO-2 current in vivo. In both whole-cell and single-channel modes, in vivo SLO-2 channels were active only when intracellular Ca2+ and Cl- were raised above normal physiological conditions, as occurs during hypoxia. Under such conditions, SLO-2 is the largest outward current, contributing up to 87% of the total current. Other channels are present in muscle, but our results suggest that they are unlikely to contribute a large outward component under physiological conditions. However, they, too, may contribute currents conditional on other factors. Hence, the picture that emerges is of a complex membrane with a small number of household conductances functioning under normal circumstances, but with additional conductances that are activated during unusual circumstances. PMID:14612577
HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.
Vongrad, Valentina; Imig, Jochen; Mohammadi, Pejman; Kishore, Shivendra; Jaskiewicz, Lukasz; Hall, Jonathan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J
2015-01-01
MiRNAs and other small noncoding RNAs (sncRNAs) are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs) have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi) pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM). The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP), which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM) were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs. PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.
Diederichs, Sven; Haber, Daniel A
2007-12-14
MicroRNAs are small endogenous noncoding RNAs involved in posttranscriptional gene regulation. During microRNA biogenesis, Drosha and Dicer process the primary transcript (pri-miRNA) through a precursor hairpin (pre-miRNA) to the mature miRNA. The miRNA is incorporated into the RNA-Induced Silencing Complex (RISC) with Argonaute proteins, the effector molecules in RNA interference (RNAi). Here, we show that all Argonautes elevate mature miRNA expression posttranscriptionally, independent of RNase activity. Also, we identify a role for the RISC slicer Argonaute2 (Ago2) in cleaving the pre-miRNA to an additional processing intermediate, termed Ago2-cleaved precursor miRNA or ac-pre-miRNA. This endogenous, on-pathway intermediate results from cleavage of the pre-miRNA hairpin 12 nucleotides from its 3'-end. By analogy to siRNA processing, Ago2 cleavage may facilitate removal of the nicked passenger strand from RISC after maturation. The multiple roles of Argonautes in the RNAi effector phase and miRNA biogenesis and maturation suggest coordinate regulation of microRNA expression and function.
Interference between light and heavy neutrinos for 0 νββ decay in the left–right symmetric model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmed, Fahim; Neacsu, Andrei; Horoi, Mihai
Neutrinoless double-beta decay is proposed as an important low energy phenomenon that could test beyond the Standard Model physics. There are several potentially competing beyond the Standard Model mechanisms that can induce the process. It thus becomes important to disentangle the different processes. In the present study we consider the interference effect between the light left-handed and heavy right-handed Majorana neutrino exchange mechanisms. The decay rate, and consequently, the phase-space factors for the interference term are derived, based on the left–right symmetric model. The numerical values for the interference phase-space factors for several nuclides are calculated, taking into consideration themore » relativistic Coulomb distortion of the electron wave function and finite-size of the nucleus. As a result, the variation of the interference effect with the Q-value of the process is studied.« less
Interference between light and heavy neutrinos for 0 νββ decay in the left–right symmetric model
Ahmed, Fahim; Neacsu, Andrei; Horoi, Mihai
2017-03-31
Neutrinoless double-beta decay is proposed as an important low energy phenomenon that could test beyond the Standard Model physics. There are several potentially competing beyond the Standard Model mechanisms that can induce the process. It thus becomes important to disentangle the different processes. In the present study we consider the interference effect between the light left-handed and heavy right-handed Majorana neutrino exchange mechanisms. The decay rate, and consequently, the phase-space factors for the interference term are derived, based on the left–right symmetric model. The numerical values for the interference phase-space factors for several nuclides are calculated, taking into consideration themore » relativistic Coulomb distortion of the electron wave function and finite-size of the nucleus. As a result, the variation of the interference effect with the Q-value of the process is studied.« less
Photon statistics as an interference phenomenon.
Mehringer, Thomas; Mährlein, Simon; von Zanthier, Joachim; Agarwal, Girish S
2018-05-15
Interference of light fields, first postulated by Young, is one of the fundamental pillars of physics. Dirac extended this observation to the quantum world by stating that each photon interferes only with itself. A precondition for interference to occur is that no welcher-weg information labels the paths the photon takes; otherwise, the interference vanishes. This remains true, even if two-photon interference is considered, e.g., in the Hong-Ou-Mandel-experiment. Here, the two photons interfere only if they are indistinguishable, e.g., in frequency, momentum, polarization, and time. Less known is the fact that two-photon interference and photon indistinguishability also determine the photon statistics in the overlapping light fields of two independent sources. As a consequence, measuring the photon statistics in the far field of two independent sources reveals the degree of indistinguishability of the emitted photons. In this Letter, we prove this statement in theory using a quantum mechanical treatment. We also demonstrate the outcome experimentally with a simple setup consisting of two statistically independent thermal light sources with adjustable polarizations. We find that the photon statistics vary indeed as a function of the polarization settings, the latter determining the degree of welcher-weg information of the photons emanating from the two sources.
Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang
2016-11-20
To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F
2010-04-08
RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.
Runo, Steven
2011-01-01
RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.
Nayak, D P; Tobita, K; Janda, J M; Davis, A R; De, B K
1978-01-01
A temperature-sensitive group II mutant of influenza virus, ts-52, with a presumed defect in viral RNA synthesis, readily produced von Magnus-type defective interfering virus (DI virus) when passed serially (four times) at high multiplicity in MDBK cells. The defective virus (ts-52 DI virus) had a high hemagglutinin and a low infectivity titer, and strongly interfered with the replication of standard infectious viruses (both ts-52 and wild-type ts+) in co-infected cells. Progeny virus particles produced by co-infection of DI virus and infectious virus were also defective and also had low infectivity, high hemagglutinating activity, and a strong interfering property. Infectious viruses ts+ and ts-52 were indistinguishable from ts-52 DI viruses by sucrose velocity or density gradient analysis. Additionally, these viruses all possessed similar morphology. However, when the RNA of DI viruses was analyzed by use of polyacrylamide gels containing 6 M urea, there was a reduction in the amount of large RNA species (V1 to V4), and a number of new smaller RNA species (D1 to D6) with molecular weights ranging from 2.9 X 10(5) to 1.05 X 10(5) appeared. Since these smaller RNA species (D1 to D6) were absent in some clones of infectious viruses, but were consistently associated with DI viruses and increased during undiluted passages and during co-infection of ts-52 with DI virus, they appeared to be a characteristic of DI viruses. Additionally, the UV target size of interfering activity and infectivity of DI virus indicated that interfering activity was 40 times more resistant to UV irradiation than was infectivity, further implicating small RNA molecules in interference. Our data suggest that the loss of infectivity observed among DI viruses may be due to nonspecific loss of a viral RNA segment(s), and the interfering property of DI viruses may be due to interfering RNA segments (DIRNA, D1 to D6). ts-52 DI virus interfered with the replication of standard virus (ts+) at both
Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin
2012-02-01
Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.
Recording epileptic activity with MEG in a light-weight magnetic shield.
De Tiège, Xavier; Op de Beeck, Marc; Funke, Michael; Legros, Benjamin; Parkkonen, Lauri; Goldman, Serge; Van Bogaert, Patrick
2008-12-01
Ten patients with focal epilepsy were studied with magnetoencephalography (MEG) to determine if a new light-weight magnetically shielded room (lMSR) provides sufficient attenuation of magnetic interference to detect and localize the magnetic correlates of epileptic activity. Interictal MEG epileptic events co-localizing with the presumed location of the epileptogenic zone were found in all patients. MEG measurements performed in the lMSR provide an adequate signal-to-noise ratio for non-invasive localization of epileptic foci.
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
Sun, Zhenfei; Li, Min; Zhou, Ying; Guo, Tongtong; Liu, Yin; Zhang, Hui
2018-01-01
Light and microRNAs (miRNAs) are key external and internal signals for plant development, respectively. However, the relationship between the light signaling and miRNA biogenesis pathways remains unknown. Here we found that miRNA processer proteins DCL1 and HYL1 interact with a basic helix-loop-helix (bHLH) transcription factor, phytochrome-interacting factor 4 (PIF4), which mediates the destabilization of DCL1 during dark-to-red-light transition. PIF4 acts as a transcription factor for some miRNA genes and is necessary for the proper accumulation of miRNAs. DCL1, HYL1, and mature miRNAs play roles in the regulation of plant hypocotyl growth. These results uncovered a previously unknown crosstalk between miRNA biogenesis and red light signaling through the PIF4-dependent regulation of miRNA transcription and processing to affect red-light-directed plant photomorphogenesis. PMID:29522510
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Global effects of the CSR-1 RNA interference pathway on transcriptional landscape
Cecere, Germano; Hoersch, Sebastian; O’Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-01-01
Argonaute proteins and their small RNA co-factors short interfering RNAs (siRNAs) are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) antisense to germline transcripts and associates with chromatin in a siRNA-dependent manner. However, its role in gene expression regulation remains controversial. Here, we used a genome-wide profiling of nascent RNA transcripts to demonstrate that the CSR-1 RNAi pathway promotes sense-oriented Pol II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. Based on these findings, we propose that the CSR-1 pathway has a role in maintaining the directionality of active transcription thereby propagating the distinction between transcriptionally active and silent genomic regions. PMID:24681887
[The possibility for using the phenomenon of polarized light interference in treating amblyopia].
Abramov, V G; Vakurina, A E; Kashchenko, T P; Pargina, N M
1996-01-01
A new method for treating amblyopia is proposed, making use of the phenomenon of polarized light interference. It helps act simultaneously on the brightness, contrast frequency, and color sensitivity in response to patterns. The method was used in the treatment of 36 children. In group 1 (n = 20) it was combined with the traditional methods. Such treatment was more effective than in controls treated routinely. Group 2 consisted of 16 children in whom previous therapy was of no avail. Visual function was improved in 7 of them.
Active acoustic interference elicits echolocation changes in heterospecific bats.
Jones, Te K; Wohlgemuth, Melville J; Conner, William E
2018-06-27
Echolocating bats often forage in the presence of both conspecific and heterospecific individuals who have the potential to produce acoustic interference. Recent studies have shown that at least one bat species, the Brazilian free-tailed bat ( Tadarida brasiliensis ), produces specialized social signals that disrupt the sonar of conspecific competitors. We herein discuss the differences between passive and active jamming signals and test whether heterospecific jamming occurs in species overlapping spatiotemporally as well as whether such interference elicits a jamming avoidance response (JAR). We compare the capture rates of tethered moths and the echolocation parameters of big brown bats ( Eptesicus fuscus ) challenged with the playback of the jamming signal normally produced by Brazilian free-tailed bats and playback of deconstructed versions of this signal. There were no differences in the capture rates of targets with and without the jamming signal although significant changes in both spectral and temporal features of the bats' echolocation were observed. These changes are consistent with improvements of the signal-to-noise ratio in the presence of acoustic interference. Accordingly, we propose to expand the traditional definition of the JAR, stating that echolocation changes in response to interference should decrease similarity between the two signals, to include any change that increases the ability to separate returning echoes from active jamming stimuli originating from conspecific and heterospecific organisms. Flexibility in echolocation is an important characteristic for overcoming various forms of acoustic interference and may serve a purpose in interspecific interactions as well as intraspecific ones. © 2018. Published by The Company of Biologists Ltd.
Huang, Xian-Rong; Peng, Ru-Wen
2010-04-01
Interactions between light and conducting microstructures or nanostructures can result in a variety of novel phenomena, but their underlying mechanisms have not been completely understood. From calculations of surface charge density waves on conducting gratings and by comparing them with classical surface plasmons, we revealed a general yet concrete picture regarding the coupling of light to free electron oscillation on structured conducting surfaces that can lead to oscillating subwavelength charge patterns (i.e., structured surface plasmons). New wavelets emitted from these light sources then destructively interfere to form evanescent waves. This principle, usually combined with other mechanisms, is mainly a geometrical effect that can be universally involved in light scattering from all periodic and non-periodic structures containing free electrons. This picture may provide clear guidelines for developing conductor-based nano-optical devices.
Izzotti, Alberto; Calin, George A; Steele, Vernon E; Croce, Carlo M; De Flora, Silvio
2009-09-01
MicroRNAs provide a formidable tool not only in cancer research but also to investigate physiological mechanisms and to assess the effect of environmental exposures in healthy tissues. Collectively, cigarette smoke and sunlight have been estimated to account for 40% of all human cancers, and not only smoke but also, surprisingly, UV light induced genomic and postgenomic alterations in mouse lung. Here we evaluated by microarray the expression of 484 microRNAs in the lungs of CD-1 mice, including newborns, postweanling males and females, and their dams, either untreated or exposed to environmental cigarette smoke and/or UV-containing light. The results obtained highlighted age-related variations in microRNA profiles, especially during the weanling period, due to perinatal stress and postnatal maturation of the lung. UV light alone did not affect pulmonary microRNAs, whereas smoke produced dramatic changes, mostly in the sense of down-regulation, reflecting both adaptive mechanisms and activation of pathways involved in the pathogenesis of pulmonary diseases. Both gender and age affected smoke-related microRNA dysregulation in mice. The data presented provide supporting evidence that microRNAs play a fundamental role in both physiological and pathological changes occurring in mouse lung.
Liu, Zhongyao; Dong, Xiaoman; Chen, Qianghua; Yin, Chunyong; Xu, Yuxian; Zheng, Yingjun
2004-03-01
A novel transmitted-light differential interference contrast (DIC) system is used for nondestructive measurement of the refractive-index profile (RIP) of an optical fiber. By means of this system the phase of a measured light beam can be modulated with an analyzer, and the phase distribution of a fiber is obtained by calculation of the various interference patterns. The measurement theory and structure and some typical applications of this system are demonstrated. The results of measuring RIPs in graded-index fiber are presented. Both the experimental results and theoretical analysis show that the system takes the advantage of high index resolution and of sufficient measurement accuracy for measuring the refractive index of the optical fiber. The system has strong ability to overcome environmental disturbance because of its common-path design. Moreover, one can use the system to measure the RIP along the fiber axis and acquire an image of the three-dimensional RIP of the fiber.
Li, Bai-Ling; Zhang, Guan-Xin; Hou, Xiao-Lei; Tan, Meng-Wei; Yuan, Yang; Liu, Xiao-Hong; Gong, De-Jun; Huang, Sheng-Dong
2009-03-01
To study the inhibition of angiogenin (ANG) expression in human lung squamous cancer cell strain-A549 through adeno-associated virus (AAV)-mediated RNA-interference, and therefore to observe its effect on the growth of cancer cells and tumor formation. Recombinant AAV expressing H1-promoter-induced small-interference- RNA (siRNA) targeting ANG (AAV-shANG) was constructed, and then transfected into A549 cells. A549 cells and cells transfected with AAV-Null were used as the control groups. The effects of the reduced expression of ANG by RNAi from AAV-shANG on the growth, formation, reproduction, apoptosis, and microvessel-density of the carcinoma were observed. In vitro experiment showed that AAV-shANG was constructed successfully, There was an significant decrease in the expression of ANG protein 72 h after transfection, compared with the normal A459 cells and AAV-Null cells (P < 0.01). Cell cycle analysis showed that the proliferation index (PI) of normal A549 cells, AAV-Null cells and AAVshANG cells were 0.32 +/- 0.29, 0.35 +/- 0.38 and 0.31 +/- 0.43, respectively. There was no statistic difference in the PIs among the 3 groups (P > 0.05). In vivo experiment using thymus-defect mice showed that, there was an remarkable reduction in the mass and volume of tumors in AAV-shANG transfected group, compared to the control groups. Microvessel-density was 9.4 +/- 1.5, 9.8 +/- 2.1 and 5.7 +/- 1.9, respectively in the 3 groups, a statistic difference among the AAV-shANG-transfected group, the normal A549 group and the AAV-Null transfected group. The percentages of apoptotic cells in each group were (7.7 +/- 3.1)%, (8.5 +/- 5.4)%, (17.1 +/- 8.6)%, respectively, the experimental group being higher than those of the control groups. Positive rates of PCNA were (84.8 +/- 9.7)%, (85.8 +/- 9.8)%, and (70.4 +/- 10.1)%, respectively, the AAV-shANG transfected cancer cells showing a lower PCNA index than the control groups. AAV-mediated expression of siRNA could reduce the expression
Controlling quantum interference in phase space with amplitude.
Xue, Yinghong; Li, Tingyu; Kasai, Katsuyuki; Okada-Shudo, Yoshiko; Watanabe, Masayoshi; Zhang, Yun
2017-05-23
We experimentally show a quantum interference in phase space by interrogating photon number probabilities (n = 2, 3, and 4) of a displaced squeezed state, which is generated by an optical parametric amplifier and whose displacement is controlled by amplitude of injected coherent light. It is found that the probabilities exhibit oscillations of interference effect depending upon the amplitude of the controlling light field. This phenomenon is attributed to quantum interference in phase space and indicates the capability of controlling quantum interference using amplitude. This remarkably contrasts with the oscillations of interference effects being usually controlled by relative phase in classical optics.
Goodier, John L; Zhang, Lili; Vetter, Melissa R; Kazazian, Haig H
2007-09-01
LINE-1 retrotransposons constitute one-fifth of human DNA and have helped shape our genome. A full-length L1 encodes a 40-kDa RNA-binding protein (ORF1p) and a 150-kDa protein (ORF2p) with endonuclease and reverse transcriptase activities. ORF1p is distinctive in forming large cytoplasmic foci, which we identified as cytoplasmic stress granules. A phylogenetically conserved central region of the protein is critical for wild-type localization and retrotransposition. Yeast two-hybrid screens revealed several RNA-binding proteins that coimmunoprecipitate with ORF1p and colocalize with ORF1p in foci. Two of these proteins, YB-1 and hnRNPA1, were previously reported in stress granules. We identified additional proteins associated with stress granules, including DNA-binding protein A, 9G8, and plasminogen activator inhibitor RNA-binding protein 1 (PAI-RBP1). PAI-RBP1 is a homolog of VIG, a part of the Drosophila melanogaster RNA-induced silencing complex (RISC). Other RISC components, including Ago2 and FMRP, also colocalize with PAI-RBP1 and ORF1p. We suggest that targeting ORF1p, and possibly the L1 RNP, to stress granules is a mechanism for controlling retrotransposition and its associated genetic and cellular damage.
NASA Astrophysics Data System (ADS)
Deng, Lingling; Zhou, Hongwei; Chen, Shufen; Shi, Hongying; Liu, Bin; Wang, Lianhui; Huang, Wei
2015-02-01
Wide-angle interference (WI) and multi-beam interference (MI) in microcavity are analyzed separately to improve chromaticity and efficiency of the top-emitting white organic light-emitting diodes (TWOLEDs). A classic electromagnetic theory is used to calculate the resonance intensities of WI and MI in top-emitting organic light-emitting diodes (TOLEDs) with influence factors (e.g., electrodes and exciton locations) being considered. The role of WI on the performances of TOLEDs is revealed through using δ-doping technology and comparing blue and red EML positions in top-emitting and bottom-emitting devices. The blue light intensity significantly increases and the chromaticity of TWOLEDs is further improved with the use of enhanced WI (the blue emitting layer moving towards the reflective electrode) in the case of a weak MI. In addition, the effect of the thicknesses of light output layer and carrier transport layers on WI and MI are also investigated. Apart from the microcavity effect, other factors, e.g., carrier balance and carrier recombination regions are considered to obtain TWOLEDs with high efficiency and improved chromaticity near white light equal-energy point.
2010-01-01
Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical
Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung
2018-05-01
The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
RNA Cap Methyltransferase Activity Assay
Trotman, Jackson B.; Schoenberg, Daniel R.
2018-01-01
Methyltransferases that methylate the guanine-N7 position of the mRNA 5′ cap structure are ubiquitous among eukaryotes and commonly encoded by viruses. Here we provide a detailed protocol for the biochemical analysis of RNA cap methyltransferase activity of biological samples. This assay involves incubation of cap-methyltransferase-containing samples with a [32P]G-capped RNA substrate and S-adenosylmethionine (SAM) to produce RNAs with N7-methylated caps. The extent of cap methylation is then determined by P1 nuclease digestion, thin-layer chromatography (TLC), and phosphorimaging. The protocol described here includes additional steps for generating the [32P]G-capped RNA substrate and for preparing nuclear and cytoplasmic extracts from mammalian cells. This assay is also applicable to analyzing the cap methyltransferase activity of other biological samples, including recombinant protein preparations and fractions from analytical separations and immunoprecipitation/pulldown experiments. PMID:29644259
Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-04-01
Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.
Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-01-01
Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493
Dan Cullen
2004-01-01
In contrast to DNA, messenger RNA (mRNA) in complex substrata is rarely analyzed, in large part because labile RNA molecules are difficult to purify. Nucleic acid extractions from fungi that colonize soil are particularly difficult and plagued by humic substances that interfere with Taq polymerase (Tebbe and Vahjen 1993 and references therein). Magnetic capture...
Tian, Yi; Jiang, Yanan; Shang, Yanpeng; Zhang, Yu-Peng; Geng, Chen-Fan; Wang, Li-Qiang; Chang, Ya-Qing
2017-06-01
The lysozyme gene was silenced using RNA interference (RNAi) to analyze the function of lysozyme in sea cucumber under salt stress. The interfering efficiency of four lysozyme RNAi oligos ranged from 0.55 to 0.70. From the four oligos, p-miR-L245 was used for further interfering experiments because it had the best silencing efficiency. Peristomial film injection of p-miR-L245 (10 μg) was used for further interfering experiments. The lowest gene expression, determined by RT-PCR assay, in muscle, coelomic fluid, and parapodium occurred 48 h after p-miR-L245 injection, while that of body wall and tube foot was 96 h and 24 h, respectively. Lysozyme activity in muscle and body wall was significantly lower than the controls. The lowest lysozyme activity in muscle, body wall and parapodium, was found at 48, 72, and 48 h, respectively, which was consistent with the transcription expression of lysozyme. The lowest point of lysozyme activity was at 96 h in coelomic fluid and tube foot, which was laid behind lysozyme expression in transcription level. The expression profile of the lysozyme transcription level and lysozyme activity in the body wall and tube foot increased at 12 h after p-miR-L245 injection before the interference effect appeared. NKA gene expression was expressed at a high level in the positive control (PC) and negative control (NC) groups at 12, 24, and 48 h, while NKA was expressed at low levels in the lysozyme RNAi injection group at 12 and 24 h. The level of NKA gene expression recovered to the level of the PC and NC group at 48, 72, and 96 h after the lysozyme RNAi injection. NKCC1 gene expression was high in the PC and NC groups at 96 h, while the NKCC1 was expressed at a low level 96 h after lysozyme RNAi injection. The results suggest that lysozyme decay involves NKA and NKCC1 gene expression under salinity 18 psμ. The K + and Cl - concentration after lysozyme RNAi injection was lower than in the PC and NC group. Copyright © 2017
Brettmann, Erin A; Shaik, Jahangheer S; Zangger, Haroun; Lye, Lon-Fye; Kuhlmann, F Matthew; Akopyants, Natalia S; Oschwald, Dayna M; Owens, Katherine L; Hickerson, Suzanne M; Ronet, Catherine; Fasel, Nicolas; Beverley, Stephen M
2016-10-25
Many Leishmania (Viannia) parasites harbor the double-stranded RNA virus Leishmania RNA virus 1 (LRV1), which has been associated with increased disease severity in animal models and humans and with drug treatment failures in humans. Remarkably, LRV1 survives in the presence of an active RNAi pathway, which in many organisms controls RNA viruses. We found significant levels (0.4 to 2.5%) of small RNAs derived from LRV1 in both Leishmania braziliensis and Leishmania guyanensis, mapping across both strands and with properties consistent with Dicer-mediated cleavage of the dsRNA genome. LRV1 lacks cis- or trans-acting RNAi inhibitory activities, suggesting that virus retention must be maintained by a balance between RNAi activity and LRV1 replication. To tilt this balance toward elimination, we targeted LRV1 using long-hairpin/stem-loop constructs similar to those effective against chromosomal genes. LRV1 was completely eliminated, at high efficiency, accompanied by a massive overproduction of LRV1-specific siRNAs, representing as much as 87% of the total. For both L. braziliensis and L. guyanensis, RNAi-derived LRV1-negative lines were no longer able to induce a Toll-like receptor 3-dependent hyperinflammatory cytokine response in infected macrophages. We demonstrate in vitro a role for LRV1 in virulence of L. braziliensis, the Leishmania species responsible for the vast majority of mucocutaneous leishmaniasis cases. These findings establish a targeted method for elimination of LRV1, and potentially of other Leishmania viruses, which will facilitate mechanistic dissection of the role of LRV1-mediated virulence. Moreover, our data establish a third paradigm for RNAi-viral relationships in evolution: one of balance rather than elimination.
MiRAR-miRNA Activity Reporter for Living Cells.
Turk, Matthew A; Chung, Christina Z; Manni, Emad; Zukowski, Stephanie A; Engineer, Anish; Badakhshi, Yasaman; Bi, Yumin; Heinemann, Ilka U
2018-06-19
microRNA (miRNA) activity and regulation are of increasing interest as new therapeutic targets. Traditional approaches to assess miRNA levels in cells rely on RNA sequencing or quantitative PCR. While useful, these approaches are based on RNA extraction and cannot be applied in real-time to observe miRNA activity with single-cell resolution. We developed a green fluorescence protein (GFP)-based reporter system that allows for a direct, real-time readout of changes in miRNA activity in live cells. The miRNA activity reporter (MiRAR) consists of GFP fused to a 3′ untranslated region containing specific miRNA binding sites, resulting in miRNA activity-dependent GFP expression. Using qPCR, we verified the inverse relationship of GFP fluorescence and miRNA levels. We demonstrated that this novel optogenetic reporter system quantifies cellular levels of the tumor suppressor miRNA let-7 in real-time in single Human embryonic kidney 293 (HEK 293) cells. Our data shows that the MiRAR can be applied to detect changes in miRNA levels upon disruption of miRNA degradation pathways. We further show that the reporter could be adapted to monitor another disease-relevant miRNA, miR-122. With trivial modifications, this approach could be applied across the miRNome for quantification of many specific miRNA in cell cultures, tissues, or transgenic animal models.
Activation mechanism of a noncanonical RNA-dependent RNA polymerase.
Garriga, Damià; Navarro, Aitor; Querol-Audí, Jordi; Abaitua, Fernando; Rodríguez, José F; Verdaguer, Núria
2007-12-18
Two lineages of viral RNA-dependent RNA polymerases (RDRPs) differing in the organization (canonical vs. noncanonical) of the palm subdomain have been identified. Phylogenetic analyses indicate that both lineages diverged at a very early stage of the evolution of the enzyme [Gorbalenya AE, Pringle FM, Zeddam JL, Luke BT, Cameron CE, Kalmakoff J, Hanzlik TN, Gordon KH, Ward VK (2002) J Mol Biol 324:47-62]. Here, we report the x-ray structure of a noncanonical birnaviral RDRP, named VP1, in its free form, bound to Mg(2+) ions, and bound to a peptide representing the polymerase-binding motif of the regulatory viral protein VP3. The structure of VP1 reveals that the noncanonical connectivity of the palm subdomain maintains the geometry of the catalytic residues found in canonical polymerases but results in a partial blocking of the active site cavity. The VP1-VP3 peptide complex shows a mode of polymerase activation in which VP3 binding promotes a conformational change that removes the steric blockade of the VP1 active site, facilitating the accommodation of the template and incoming nucleotides for catalysis. The striking structural similarities between birnavirus (dsRNA) and the positive-stranded RNA picornavirus and calicivirus RDRPs provide evidence supporting the existence of functional and evolutionary relationships between these two virus groups.
relA-dependent RNA polymerase activity in Escherichia coli.
Ryals, J; Bremer, H
1982-01-01
Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501
Kelly, Shannan; Yamamoto, Hideki
2008-01-01
Purpose We previously reported the differential expression and translation of mRNA and protein in dark- and light-adapted octopus retinas, which may result from cytoplasmic polyadenylation element (CPE)–dependent mRNA masking and unmasking. Here we investigate the presence of CPEs in α-tubulin and S-crystallin mRNA and report the identification of cytoplasmic polyadenylation element binding protein (CPEB) in light- and dark-adapted octopus retinas. Methods 3’-RACE and sequencing were used to isolate and analyze the 3’-UTRs of α-tubulin and S-crystallin mRNA. Total retinal protein isolated from light- and dark-adapted octopus retinas was subjected to western blot analysis followed by CPEB antibody detection, PEP-171 inhibition of CPEB, and dephosphorylation of CPEB. Results The following CPE-like sequence was detected in the 3’-UTR of isolated long S-crystallin mRNA variants: UUUAACA. No CPE or CPE-like sequences were detected in the 3’-UTRs of α-tubulin mRNA or of the short S-crystallin mRNA variants. Western blot analysis detected CPEB as two putative bands migrating between 60-80 kDa, while a third band migrated below 30 kDa in dark- and light-adapted retinas. Conclusions The detection of CPEB and the identification of the putative CPE-like sequences in the S-crystallin 3’-UTR suggest that CPEB may be involved in the activation of masked S-crystallin mRNA, but not in the regulation of α-tubulin mRNA, resulting in increased S-crystallin protein synthesis in dark-adapted octopus retinas. PMID:18682811
Zhou, Zhi-Yuan; Ding, Dong-Sheng; Jiang, Yun-Kun; Li, Yan; Shi, Shuai; Wang, Xi-Shi; Shi, Bao-Sen
2014-08-25
Light with helical phase structures, carrying quantized orbital angular momentum (OAM), has many applications in both classical and quantum optics, such as high-capacity optical communications and quantum information processing. Frequency conversion is a basic technique to expand the frequency range of the fundamental light. The frequency conversion of OAM-carrying light gives rise to new physics and applications such as up-conversion detection of images and generation of high dimensional OAM entanglements. Quasi-phase matching (QPM) nonlinear crystals are good candidates for frequency conversion, particularly due to their high-valued effective nonlinear coefficients and no walk-off effect. Here we report the first experimental second-harmonic generation (SHG) of an OAM-carried light with a QPM crystal, where a UV light with OAM of 100 ℏ is generated. OAM conservation is verified using a specially designed interferometer. With a pump beam carrying an OAM superposition of opposite sign, we observe interesting interference phenomena in the SHG light; specifically, a photonics gear-like structure is obtained that gives direct evidence of OAM conservation, which will be very useful for ultra-sensitive angular measurements. Besides, we also develop a theory to reveal the underlying physics of the phenomena. The methods and theoretical analysis shown here are also applicable to other frequency conversion processes, such as sum frequency generation and difference-frequency generation, and may also be generalized to the quantum regime for single photons.
Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.
Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H
2016-06-17
In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.
Optics and Light Activities for Teachers of all Grade Levels from Easily Obtainable Supplies
NASA Astrophysics Data System (ADS)
Lindgren, Richard; Hendricks, Curtis; Lucatorto, Lynn; McNeilus, Thomas; Thornton, Stephen
2010-02-01
Several hands-on activities in light and optics covering selected topics will be discussed in the context of home labs and how such activities can be incorporated into a distance-learning or online web-based course utilizing the latest communication technologies and the Internet. The presentation will focus on activities that can be constructed from easy to obtain supplies as well as a commercially available kit that we are having made available. Activities for teachers at the elementary level will focus on understanding light rays, shadows, and reflection from plane surfaces; at the middle school level will focus on curved mirrors and lenses, dispersion, and drawing ray diagrams; at the high school level will focus on Snell's law, the lens equation, wave interference, polarization, Young's experiment, and diffraction. A distance-learning, web-based course based on these home labs will be described. )
Patil, Basavaprabhu L; Fauquet, Claude M
2015-06-01
RNA silencing is a sequence-specific post-transcriptional gene inactivation mechanism that operates in diverse organisms and that can extend beyond its site of initiation, owing to the movement of the silencing signal, called non-autonomous gene silencing. Previous studies have shown that several factors manifest the movement of the silencing signal, such as the size (21 or 24 nucleotides) of the secondary small interfering RNA (siRNA) produced, the steady-state concentration of siRNAs and their cognate messenger RNA (mRNA) or a change in the sink-source status of plant parts affecting phloem translocation. Our study shows that both light intensity and temperature have a significant impact on the systemic movement of the silencing signal in transient agroinfiltration studies in Nicotiana benthamiana. At higher light intensities (≥ 450 μE/m(2)/s) and higher temperatures (≥ 30 °C), gene silencing was localized to leaf tissue that was infiltrated, without any systemic spread. Interestingly, in these light and temperature conditions (≥ 450 μE/m(2) /s and ≥ 30 °C), the N. benthamiana plants showed recovery from the viral symptoms. However, the reduced systemic silencing and reduced viral symptom severity at higher light intensities were caused by a change in the sink-source status of the plant, ultimately affecting the phloem translocation of small RNAs or the viral genome. In contrast, at lower light intensities (<300 μE/m(2)/s) with a constant temperature of 25 °C, there was strong systemic movement of the silencing signal in the N. benthamiana plants and reduced recovery from virus infections. The accumulation of gene-specific siRNAs was reduced at higher temperature as a result of a reduction in the accumulation of transcript on transient agroinfiltration of RNA interference (RNAi) constructs, mostly because of poor T-DNA transfer activity of Agrobacterium, possibly also accompanied by reduced phloem translocation. © 2014 BSPP AND JOHN WILEY & SONS
NASA Astrophysics Data System (ADS)
Bi, Yiming; Tang, Liang; Shan, Peng; Xie, Qiong; Hu, Yong; Peng, Silong; Tan, Jie; Li, Changwen
2014-08-01
Interference such as baseline drift and light scattering can degrade the model predictability in multivariate analysis of near-infrared (NIR) spectra. Usually interference can be represented by an additive and a multiplicative factor. In order to eliminate these interferences, correction parameters are needed to be estimated from spectra. However, the spectra are often mixed of physical light scattering effects and chemical light absorbance effects, making it difficult for parameter estimation. Herein, a novel algorithm was proposed to find a spectral region automatically that the interesting chemical absorbance and noise are low, that is, finding an interference dominant region (IDR). Based on the definition of IDR, a two-step method was proposed to find the optimal IDR and the corresponding correction parameters estimated from IDR. Finally, the correction was performed to the full spectral range using previously obtained parameters for the calibration set and test set, respectively. The method can be applied to multi target systems with one IDR suitable for all targeted analytes. Tested on two benchmark data sets of near-infrared spectra, the performance of the proposed method provided considerable improvement compared with full spectral estimation methods and comparable with other state-of-art methods.
Brand, Christine; Burkhardt, Eva; Schaeffel, Frank; Choi, Jeong Won; Feldkaemper, Marita Pauline
2005-04-28
To analyze mRNA expression changes of Egr-1, VIP, and Shh under different light and treatment conditions in mice. The mRNA expression levels of the three genes and additionally the Egr-1 protein expression were compared in form deprived eyes and eyes with normal vision. Moreover, the influence of dark to light and light to dark transitions and of changes in retinal illumination on mRNA levels was investigated. Form deprivation of mice was induced by fitting frosted diffusers over one eye and an attentuation matched neutral density (ND) filter over the other eye. To measure the effects of retinal illumination changes on mRNA expression, animals were bilaterally fitted with different ND filters. Semiquantitative real-time RT-PCR was used to measure the mRNA levels and immunohistochemistry was applied to localize and detect Egr-1 protein. The expression levels of both Egr-1 mRNA and protein were reduced in form deprived eyes compared to their fellow eyes after 30 min and 1 h, respectively. Egr-1 mRNA was strikingly upregulated both after dark to light and light to dark transitions, whereas minor changes in retinal illumination by covering the eyes with neutral density filters did not alter Egr-1 mRNA expression. In mice, the mRNA levels of VIP and Shh were not affected by form deprivation, but they were found to be regulated depending on the time of day. Both Egr-1 mRNA and protein expression levels were strongly regulated by light, especially by transitions between light and darkness. Image contrast may exert an additional influence on mRNA and protein expression of Egr-1, particularly in the cells in the ganglion cell layer and in bipolar cells.
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will
Regulating gene expression in human leukemia cells using light-activated oligodeoxynucleotides
Tang, XinJing; Swaminathan, Jyothishmathi; Gewirtz, Alan M.; Dmochowski, Ivan J.
2008-01-01
Light-activated antisense oligodeoxynucleotides (asODNs) were developed to control the degradation of target mRNA in living cells by RNase H. A 20-mer asODN previously shown to target c-myb, a hematopoietic transcription factor, was covalently attached via a photocleavable linker (PL) to partially complementary 20-mer sense strands (sODNs). In the ‘caged’ state, the sODN blocked hybridization of the asODN to c-myb mRNA. Six asODN-PL-sODN conjugates, C1-C6, were synthesized. C5, with twelve complementary bases, gave the largest decrease in melting temperature (Tm) upon UV irradiation (ΔTm = −29°C). The most thermally stable conjugate, C6 (Tm = 84°C), gave the lowest background RNase H activity, with just 8.6% degradation of an RNA 40-mer after 1 h incubation. In biochemical assays with C6, RNA digestion increased 10-fold 10 min after UV irradiation. Finally, phosphorothioated analogs S-C5 and S-C6 were synthesized to test activity in cultured K562 (human leukemia) cells. No knockdown of c-myb mRNA or protein was observed with intact S-C5 or S-C6, whereas more than half of c-myb mRNA was degraded 24 h after photoactivation. Two-fold photomodulation of c-MYB protein levels was also observed with S-C5. However, no photomodulation of c-MYB protein levels was observed with S-C6, perhaps due to the greater stability of this duplex. PMID:18056083
NASA Astrophysics Data System (ADS)
Nollen, Ellen A. A.; Garcia, Susana M.; van Haaften, Gijs; Kim, Soojin; Chavez, Alejandro; Morimoto, Richard I.; Plasterk, Ronald H. A.
2004-04-01
Protein misfolding and the formation of aggregates are increasingly recognized components of the pathology of human genetic disease and hallmarks of many neurodegenerative disorders. As exemplified by polyglutamine diseases, the propensity for protein misfolding is associated with the length of polyglutamine expansions and age-dependent changes in protein-folding homeostasis, suggesting a critical role for a protein homeostatic buffer. To identify the complement of protein factors that protects cells against the formation of protein aggregates, we tested transgenic Caenorhabditis elegans strains expressing polyglutamine expansion yellow fluorescent protein fusion proteins at the threshold length associated with the age-dependent appearance of protein aggregation. We used genome-wide RNA interference to identify genes that, when suppressed, resulted in the premature appearance of protein aggregates. Our screen identified 186 genes corresponding to five principal classes of polyglutamine regulators: genes involved in RNA metabolism, protein synthesis, protein folding, and protein degradation; and those involved in protein trafficking. We propose that each of these classes represents a molecular machine collectively comprising the protein homeostatic buffer that responds to the expression of damaged proteins to prevent their misfolding and aggregation. protein misfolding | neurodegenerative diseases
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
The role of Cas8 in type I CRISPR interference.
Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L
2015-05-05
CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.
Wei, Jie; Jones, Jeffrey; Kang, Jing; Card, Ananda; Krimm, Michael; Hancock, Paula; Pei, Yi; Ason, Brandon; Payson, Elmer; Dubinina, Natalya; Cancilla, Mark; Stroh, Mark; Burchard, Julja; Sachs, Alan B; Hochman, Jerome H; Flanagan, W Michael; Kuklin, Nelly A
2011-06-01
Deeper knowledge of pharmacokinetic and pharmacodynamic (PK/PD) concepts for RNA therapeutics is important to streamline the drug development process and for rigorous selection of best performing drug candidates. Here we characterized the PK/PD relationship for small interfering RNAs (siRNAs) targeting luciferase by examining siRNA concentration in plasma and liver, the temporal RNA-induced silencing complex binding profiles, mRNA reduction, and protein inhibition measured by noninvasive bioluminescent imaging. A dose-dependent and time-related decrease in bioluminescence was detected over 25 days after a single treatment of a lipid nanoparticle-formulated siRNA targeting luciferase messenger RNA. A direct relationship was observed between the degree of in vivo mRNA and protein reduction and the Argonaute2 (Ago2)-bound siRNA fraction but not with the total amount of siRNA found in the liver, suggesting that the Ago2-siRNA complex is the key determinant of target inhibition. These observations were confirmed for an additional siRNA that targets endogenously expressed Sjögren syndrome antigen B (Ssb) mRNA, indicating that our observations are not limited to a transgenic mouse system. Our data provide detailed information of the temporal regulation of siRNA liver delivery, Ago2 loading, mRNA reduction, and protein inhibition that are essential for the rapid and cost-effective clinical development of siRNAs therapeutics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Deng, Lingling; Zhou, Hongwei; Chen, Shufen, E-mail: iamsfchen@njupt.edu.cn
Wide-angle interference (WI) and multi-beam interference (MI) in microcavity are analyzed separately to improve chromaticity and efficiency of the top-emitting white organic light-emitting diodes (TWOLEDs). A classic electromagnetic theory is used to calculate the resonance intensities of WI and MI in top-emitting organic light-emitting diodes (TOLEDs) with influence factors (e.g., electrodes and exciton locations) being considered. The role of WI on the performances of TOLEDs is revealed through using δ-doping technology and comparing blue and red EML positions in top-emitting and bottom-emitting devices. The blue light intensity significantly increases and the chromaticity of TWOLEDs is further improved with the usemore » of enhanced WI (the blue emitting layer moving towards the reflective electrode) in the case of a weak MI. In addition, the effect of the thicknesses of light output layer and carrier transport layers on WI and MI are also investigated. Apart from the microcavity effect, other factors, e.g., carrier balance and carrier recombination regions are considered to obtain TWOLEDs with high efficiency and improved chromaticity near white light equal-energy point.« less
Wiegand, Sandra; Dietrich, Sascha; Hertel, Robert; Bongaerts, Johannes; Evers, Stefan; Volland, Sonja; Daniel, Rolf; Liesegang, Heiko
2013-10-01
The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains.
Young's double-slit interference with two-color biphotons.
Zhang, De-Jian; Wu, Shuang; Li, Hong-Guo; Wang, Hai-Bo; Xiong, Jun; Wang, Kaige
2017-12-12
In classical optics, Young's double-slit experiment with colored coherent light gives rise to individual interference fringes for each light frequency, referring to single-photon interference. However, two-photon double-slit interference has been widely studied only for wavelength-degenerate biphoton, known as subwavelength quantum lithography. In this work, we report double-slit interference experiments with two-color biphoton. Different from the degenerate case, the experimental results depend on the measurement methods. From a two-axis coincidence measurement pattern we can extract complete interference information about two colors. The conceptual model provides an intuitional picture of the in-phase and out-of-phase photon correlations and a complete quantum understanding about the which-path information of two colored photons.
Design of siRNA Therapeutics from the Molecular Scale
Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick
2013-01-01
While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875
Tavladoraki, Paraskevi; Kloppstech, Klaus; Argyroudi-Akoyunoglou, Joan
1989-01-01
The mRNA coding for light-harvesting complex of PSII (LHC-II) apoprotein is present in etiolated bean (Phaseolus vulgaris L.) leaves; its level is low in 5-day-old leaves, increases about 3 to 4 times in 9- to 13-day-old leaves, and decreases thereafter. A red light pulse induces an increase in LHC-II mRNA level, which is reversed by far red light, in all ages of the etiolated tissue tested. The phytochrome-controlled initial increase of LHC-II mRNA level is higher in 9- and 13-day-old than in 5- and 17-day-old bean leaves. The amount of LHC-II mRNA, accumulated in the dark after a red light pulse, oscillates rhythmically with a period of about 24 hours. This rhythm is also observed in continuous white light and in the dark following exposure to continuous white light, and persists for at least 70 hours. A second red light pulse, applied 36 hours after initiation of the rhythm, induces a phase-shift, which is prevented by far red light immediately following the second red light pulse. A persistent, but gradually reduced, far red reversibility of the red light-induced increase in LHC-II mRNA level is observed. In contrast, far red reversibility of the red light-induced clock setting is only observed when far red follows immediately the red light. It is concluded that (a) the light-induced LHC-II mRNA accumulation follows an endogenous, circadian rhythm, for the appearance of which a red light pulse is sufficient, (b) the circadian oscillator is under phytochrome control, and (c) a stable Pfr form, which exists for several hours, is responsible for sustaining LHC-II gene transcription. Images Figure 1 Figure 2 Figure 8 PMID:16666825
The rough endoplasmatic reticulum is a central nucleation site of siRNA-mediated RNA silencing
Stalder, Lukas; Heusermann, Wolf; Sokol, Lena; Trojer, Dominic; Wirz, Joel; Hean, Justin; Fritzsche, Anja; Aeschimann, Florian; Pfanzagl, Vera; Basselet, Pascal; Weiler, Jan; Hintersteiner, Martin; Morrissey, David V; Meisner-Kober, Nicole C
2013-01-01
Despite progress in mechanistic understanding of the RNA interference (RNAi) pathways, the subcellular sites of RNA silencing remain under debate. Here we show that loading of lipid-transfected siRNAs and endogenous microRNAs (miRNA) into RISC (RNA-induced silencing complexes), encounter of the target mRNA, and Ago2-mediated mRNA slicing in mammalian cells are nucleated at the rough endoplasmic reticulum (rER). Although the major RNAi pathway proteins are found in most subcellular compartments, the miRNA- and siRNA-loaded Ago2 populations co-sediment almost exclusively with the rER membranes, together with the RISC loading complex (RLC) factors Dicer, TAR RNA binding protein (TRBP) and protein activator of the interferon-induced protein kinase (PACT). Fractionation and membrane co-immune precipitations further confirm that siRNA-loaded Ago2 physically associates with the cytosolic side of the rER membrane. Additionally, RLC-associated double-stranded siRNA, diagnostic of RISC loading, and RISC-mediated mRNA cleavage products exclusively co-sediment with rER. Finally, we identify TRBP and PACT as key factors anchoring RISC to ER membranes in an RNA-independent manner. Together, our findings demonstrate that the outer rER membrane is a central nucleation site of siRNA-mediated RNA silencing. PMID:23511973
The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Henstrand, John M.; McCue, Kent F.; Brink, Kent; Handa, Avtar K.; Herrmann, Klaus M.; Conn, Eric E.
1992-01-01
Light and fungal elicitor induce mRNA encoding 3-deoxy-d-arabino-heptulosonate 7-phosphate (DAHP) synthase in suspension cultured cells of parsley (Petroselinum crispum L.). The kinetics and dose response of mRNA accumulation were similar for DAHP synthase and phenylalanine ammonia-lyase (PAL). Six micrograms of elicitor from Phytophthora megasperma f. glycinia gave a detectable induction within 1 hour. Induction of DAHP synthase and PAL mRNAs by light was transient, reaching maximal levels at 4 hours and returning to pretreatment levels after 24 hours. Our data suggest that either light or fungal elicitor transcriptionally activate DAHP synthase. A coordinate regulation for key enzymes in the synthesis of primary and secondary metabolites is indicated. ImagesFigure 1 PMID:16668708
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.
Gonzalez-Alegre, Pedro
2007-04-01
RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.
Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands.
Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E
2013-04-01
Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.
2008-05-06
The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens,more » respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.« less
Smyth, Redmond P; Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe; von Kleist, Max; Marquet, Roland
2018-05-18
Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5' region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5' PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production.
[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].
Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye
2013-01-01
To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis
Vives-Adrian, Laia; Lujan, Celia; Oliva, Baldo; van der Linden, Lonneke; Selisko, Barbara; Coutard, Bruno; Canard, Bruno; van Kuppeveld, Frank J. M.
2014-01-01
ABSTRACT Encephalomyocarditis virus (EMCV) is a member of the Cardiovirus genus within the large Picornaviridae family, which includes a number of important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for viral genome replication. In this study, we report the X-ray structures of two different crystal forms of the EMCV RdRp determined at 2.8- and 2.15-Å resolution. The in vitro elongation and VPg uridylylation activities of the purified enzyme have also been demonstrated. Although the overall structure of EMCV 3Dpol is shown to be similar to that of the known RdRps of other members of the Picornaviridae family, structural comparisons show a large reorganization of the active-site cavity in one of the crystal forms. The rearrangement affects mainly motif A, where the conserved residue Asp240, involved in ribonucleoside triphosphate (rNTP) selection, and its neighbor residue, Phe239, move about 10 Å from their expected positions within the ribose binding pocket toward the entrance of the rNTP tunnel. This altered conformation of motif A is stabilized by a cation-π interaction established between the aromatic ring of Phe239 and the side chain of Lys56 within the finger domain. Other contacts, involving Phe239 and different residues of motif F, are also observed. The movement of motif A is connected with important conformational changes in the finger region flanked by residues 54 to 63, harboring Lys56, and in the polymerase N terminus. The structures determined in this work provide essential information for studies on the cardiovirus RNA replication process and may have important implications for the development of new antivirals targeting the altered conformation of motif A. IMPORTANCE The Picornaviridae family is one of the largest virus families known, including many important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for picornavirus genome replication and a validated
Vives-Adrian, Laia; Lujan, Celia; Oliva, Baldo; van der Linden, Lonneke; Selisko, Barbara; Coutard, Bruno; Canard, Bruno; van Kuppeveld, Frank J M; Ferrer-Orta, Cristina; Verdaguer, Núria
2014-05-01
Encephalomyocarditis virus (EMCV) is a member of the Cardiovirus genus within the large Picornaviridae family, which includes a number of important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for viral genome replication. In this study, we report the X-ray structures of two different crystal forms of the EMCV RdRp determined at 2.8- and 2.15-Å resolution. The in vitro elongation and VPg uridylylation activities of the purified enzyme have also been demonstrated. Although the overall structure of EMCV 3Dpol is shown to be similar to that of the known RdRps of other members of the Picornaviridae family, structural comparisons show a large reorganization of the active-site cavity in one of the crystal forms. The rearrangement affects mainly motif A, where the conserved residue Asp240, involved in ribonucleoside triphosphate (rNTP) selection, and its neighbor residue, Phe239, move about 10 Å from their expected positions within the ribose binding pocket toward the entrance of the rNTP tunnel. This altered conformation of motif A is stabilized by a cation-π interaction established between the aromatic ring of Phe239 and the side chain of Lys56 within the finger domain. Other contacts, involving Phe239 and different residues of motif F, are also observed. The movement of motif A is connected with important conformational changes in the finger region flanked by residues 54 to 63, harboring Lys56, and in the polymerase N terminus. The structures determined in this work provide essential information for studies on the cardiovirus RNA replication process and may have important implications for the development of new antivirals targeting the altered conformation of motif A. The Picornaviridae family is one of the largest virus families known, including many important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for picornavirus genome replication and a validated target for the
Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim
2018-06-12
During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.
Identification of phosphates involved in catalysis by the ribozyme RNase P RNA.
Harris, M E; Pace, N R
1995-01-01
The RNA subunit of ribonuclease P (RNase P RNA) is a catalytic RNA that cleaves precursor tRNAs to generate mature tRNA 5' ends. Little is known concerning the identity and arrangement of functional groups that constitute the active site of this ribozyme. We have used an RNase P RNA-substrate conjugate that undergoes rapid, accurate, and efficient self-cleavage in vitro to probe, by phosphorothioate modification-interference, functional groups required for catalysis. We identify four phosphate oxygens where substitution by sulfur significantly reduces the catalytic rate (50-200-fold). Interference at one site was partially rescued in the presence of manganese, suggesting a direct involvement in binding divalent metal ion cofactors required for catalysis. All sites are located in conserved sequence and secondary structure, and positioned adjacent to the substrate phosphate in a tertiary structure model of the ribozyme-substrate complex. The spatial arrangement of phosphorothioate-sensitive sites in RNase P RNA was found to resemble the distribution of analogous positions in the secondary and potential tertiary structures of other large catalytic RNAs. PMID:7585250
Breast cancer diagnosis using spatial light interference microscopy
NASA Astrophysics Data System (ADS)
Majeed, Hassaan; Kandel, Mikhail E.; Han, Kevin; Luo, Zelun; Macias, Virgilia; Tangella, Krishnarao; Balla, Andre; Popescu, Gabriel
2015-11-01
The standard practice in histopathology of breast cancers is to examine a hematoxylin and eosin (H&E) stained tissue biopsy under a microscope to diagnose whether a lesion is benign or malignant. This determination is made based on a manual, qualitative inspection, making it subject to investigator bias and resulting in low throughput. Hence, a quantitative, label-free, and high-throughput diagnosis method is highly desirable. We present here preliminary results showing the potential of quantitative phase imaging for breast cancer screening and help with differential diagnosis. We generated phase maps of unstained breast tissue biopsies using spatial light interference microscopy (SLIM). As a first step toward quantitative diagnosis based on SLIM, we carried out a qualitative evaluation of our label-free images. These images were shown to two pathologists who classified each case as either benign or malignant. This diagnosis was then compared against the diagnosis of the two pathologists on corresponding H&E stained tissue images and the number of agreements were counted. The agreement between SLIM and H&E based diagnosis was 88% for the first pathologist and 87% for the second. Our results demonstrate the potential and promise of SLIM for quantitative, label-free, and high-throughput diagnosis.
Hu, Sarah K; Campbell, Victoria; Connell, Paige; Gellene, Alyssa G; Liu, Zhenfeng; Terrado, Ramon; Caron, David A
2016-04-01
Microbial eukaryotes fulfill key ecological positions in marine food webs. Molecular approaches that connect protistan diversity and biogeography to their diverse metabolisms will greatly improve our understanding of marine ecosystem function. The majority of molecular-based studies to date use 18S rRNA gene sequencing to characterize natural microbial assemblages, but this approach does not necessarily discriminate between active and non-active cells. We incorporated RNA sequencing into standard 18S rRNA gene sequence surveys with the purpose of assessing those members of the protistan community contributing to biogeochemical cycling (active organisms), using the ratio of cDNA (reverse transcribed from total RNA) to 18S rRNA gene sequences within major protistan taxonomic groups. Trophically important phytoplankton, such as diatoms and chlorophytes exhibited seasonal trends in relative activity. Additionally, both radiolaria and ciliates displayed previously unreported high relative activities below the euphotic zone. This study sheds new light on the relative metabolic activity of specific protistan groups and how microbial communities respond to changing environmental conditions. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Delivery of RNA interference therapeutics using polycation-based nanoparticles.
Howard, Kenneth Alan
2009-07-25
RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.
Light-Driven Nano-oscillators for Label-Free Single-Molecule Monitoring of MicroRNA.
Chen, Zixuan; Peng, Yujiao; Cao, Yue; Wang, Hui; Zhang, Jian-Rong; Chen, Hong-Yuan; Zhu, Jun-Jie
2018-06-13
Here, we present a mapping tool based on individual light-driven nano-oscillators for label-free single-molecule monitoring of microRNA. This design uses microRNA as a single-molecule damper for nano-oscillators by forming a rigid dual-strand structure in the gap between nano-oscillators and the immobilized surface. The ultrasensitive detection is attributed to comparable dimensions of the gap and microRNA. A developed surface plasmon-coupled scattering imaging technology enables us to directly measure the real-time gap distance vibration of multiple nano-oscillators with high accuracy and fast dynamics. High-level and low-level states of the oscillation amplitude indicate melting and hybridization statuses of microRNA. Lifetimes of two states reveal that the hybridization rate of microRNA is determined by the three-dimensional diffusion. This imaging technique contributes application potentials in a single-molecule detection and nanomechanics study.
Mimicry technology: suppressing small RNA activity in plants.
Rubio-Somoza, Ignacio; Manavella, Pablo Andrés
2011-01-01
Small RNA suppression constitutes one of the major difficulties for a full molecular characterization of their specific roles in plants. Taking advantage of the latest insights into the new post-biogenesis layer of regulation in microRNA (miRNA) activity, it is possible to overcome the above-mentioned limitation (Nat Genet 39:1033-1037, 2007). We engineered the IPS1 non-coding RNA to bear a complementary sequence to a given miRNA family, resulting in specific sequestration of RISC complexes. MIMIC technology allows for the constitutive release of all of the potential targets of a miRNA family as well as tissue-specific and inducible suppression of its activity.
Makeyev, Eugene V; Bamford, Dennis H
2002-12-01
Recent genetic data suggest that proteins homologous to a plant RNA-dependent RNA polymerase (RdRP) play a central role in posttranscriptional gene silencing (PTGS) in many organisms. We show here that purified recombinant protein QDE-1, a genetic component of PTGS ("quelling") in the fungus Neurospora crassa, possesses RNA polymerase activity in vitro. The full-length enzyme and its enzymatically active C-terminal fragment perform two different reactions on single-stranded RNA templates, synthesizing either extensive RNA chains that form template-length duplexes or approximately 9-21-mer complementary RNA oligonucleotides scattered along the entire template. QDE-1 supports both de novo and primer-dependent initiation mechanisms. These results suggest that several distinct activities of cell-encoded RdRPs can be employed for efficient PTGS in vivo.
Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles
NASA Astrophysics Data System (ADS)
Huschka, Ryan
Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on
Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.
2013-01-01
The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Polarized Light Corridor Demonstrations.
ERIC Educational Resources Information Center
Davies, G. R.
1990-01-01
Eleven demonstrations of light polarization are presented. Each includes a brief description of the apparatus and the effect demonstrated. Illustrated are strain patterns, reflection, scattering, the Faraday Effect, interference, double refraction, the polarizing microscope, and optical activity. (CW)
Chávez-Hernández, Elva C.; Alejandri-Ramírez, Naholi D.; Juárez-González, Vasti T.; Dinkova, Tzvetanka D.
2015-01-01
Maize somatic embryogenesis (SE) is induced from the immature zygotic embryo in darkness and under the appropriate hormones' levels. Small RNA expression is reprogrammed and certain miRNAs become particularly enriched during induction while others, characteristic to the zygotic embryo, decrease. To explore the impact of different environmental cues on miRNA regulation in maize SE, we tested specific miRNA abundance and their target gene expression in response to photoperiod and hormone depletion for two different maize cultivars (VS-535 and H-565). The expression levels of miR156, miR159, miR164, miR168, miR397, miR398, miR408, miR528, and some predicted targets (SBP23, GA-MYB, CUC2, AGO1c, LAC2, SOD9, GR1, SOD1A, PLC) were examined upon staged hormone depletion in the presence of light photoperiod or darkness. Almost all examined miRNA, except miR159, increased upon hormone depletion, regardless photoperiod absence/presence. miR528, miR408, and miR398 changed the most. On the other hand, expression of miRNA target genes was strongly regulated by the photoperiod exposure. Stress-related miRNA targets showed greater differences between cultivars than development-related targets. miRNA/target inverse relationship was more frequently observed in darkness than light. Interestingly, miR528, but not miR159, miR168 or miR398, was located on polyribosome fractions suggesting a role for this miRNA at the level of translation. Overall our results demonstrate that hormone depletion exerts a great influence on specific miRNA expression during plant regeneration independently of light. However, their targets are additionally influenced by the presence of photoperiod. The reproducibility or differences observed for particular miRNA-target regulation between two different highly embryogenic genotypes provide clues for conserved miRNA roles within the SE process. PMID:26257760
dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.
Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L
2008-12-26
Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.
Applications of the diffraction and interference of light and electronic waves
NASA Astrophysics Data System (ADS)
Bahrim, Cristian; Lanning, Robert
2010-10-01
As part of a NSF sponsored program, called STAIRSTEP, at Lamar University we work on improving the basic knowledge of our physics majors in topics with broader impact in various areas of science and engineering [1]. The purpose is to facilitate a deeper understanding of some fundamental concepts in the field of optics through hands-on experience [2]. We choose to study the interference/diffraction of light and matter waves, because of its fundamental importance in physics with many applications. We target multiple goals in our field of study such as to understand the formation of electronic waves (wave packets) and their interaction with atoms in crystals (electron diffraction); the Fourier analysis of light with applications in spectroscopy, etc. We can show that a crystal lattice Fourier transforms the sinusoidal waves associated to free electrons fired toward the crystal. Our studies led to a simple and instructive recipe for discovering the arrangement of atoms in crystals from the analysis of the diffraction patterns produced by radiation or by electrons transmitted through crystals. [1] Doerschuk P. et al., 39th ASEE/IEEE Frontiers in Education Conference, San Antonio 2009, M3F-1. [2] Bahrim C, Innovation 2006 -- World Innovations in Engineering Education and Research, Chapter 17, iNEER Innovation Series, ISBN 0-9741252-5-3.
Kenesi, Erzsébet; Lózsa, Rita
2017-01-01
Abstract In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. PMID:28499009
Topography and refractometry of sperm cells using spatial light interference microscopy
NASA Astrophysics Data System (ADS)
Liu, Lina; Kandel, Mikhail E.; Rubessa, Marcello; Schreiber, Sierra; Wheeler, Mathew B.; Popescu, Gabriel
2018-02-01
Characterization of spermatozoon viability is a common test in treating infertility. Recently, it has been shown that label-free, phase-sensitive imaging can provide a valuable alternative for this type of assay. We employ spatial light interference microscopy (SLIM) to perform high-accuracy single-cell phase imaging and decouple the average thickness and refractive index information for the population. This procedure was enabled by quantitative-phase imaging cells on media of two different refractive indices and using a numerical tool to remove the curvature from the cell tails. This way, we achieved ensemble averaging of topography and refractometry of 100 cells in each of the two groups. The results show that the thickness profile of the cell tail goes down to 150 nm and the refractive index can reach values of 1.6 close to the head.
Trans-activation of the Tetrahymena group I intron ribozyme via a non-native RNA-RNA interaction.
Ikawa, Y; Shiraishi, H; Inoue, T
1999-01-01
The peripheral P2.1 domain of the Tetrahymena group I intron ribozyme has been shown to be non-essential for splicing. We found, however, that separately prepared P2.1 RNA efficiently accelerates the 3' splice-site-specific hydrolysis reaction of a mutant ribozyme lacking both P2.1 and its upstream region in trans. We report here the unusual properties of this trans-activation. Compensatory mutational analysis revealed that non-native long-range base-pairings between the loop region of P2.1 RNA and L5c region of the mutant ribozyme are needed for the activation in spite of the fact that P2.1 forms base-pairings with P9.1 in the Tetrahymena ribozyme. The trans -activation depends on the non-native RNA-RNA interaction together with the higher order structure of P2.1 RNA. This activation is unique among the known trans-activations that utilize native tertiary interactions or RNA chaperons. PMID:10075996
Bitko, Vira; Musiyenko, Alla; Bayfield, Mark A; Maraia, Richard J; Barik, Sailen
2008-08-01
The La antigen (SS-B) associates with a wide variety of cellular and viral RNAs to affect gene expression in multiple systems. We show that La is the major cellular protein found to be associated with the abundant 44-nucleotide viral leader RNA (leRNA) early after infection with respiratory syncytial virus (RSV), a nonsegmented negative-strand RNA virus. Consistent with this, La redistributes from the nucleus to the cytoplasm in RSV-infected cells. Upon RNA interference knockdown of La, leRNA is redirected to associate with the RNA-binding protein RIG-I, a known activator of interferon (IFN) gene expression, and this is accompanied by the early induction of IFN mRNA. These results suggest that La shields leRNA from RIG-I, abrogating the early viral activation of type I IFN. We mapped the leRNA binding function to RNA recognition motif 1 of La and showed that while wild-type La greatly enhanced RSV growth, a La mutant defective in RSV leRNA binding also did not support RSV growth. Comparative studies of RSV and Sendai virus and the use of IFN-negative Vero cells indicated that La supports the growth of nonsegmented negative-strand RNA viruses by both IFN suppression and a potentially novel IFN-independent mechanism.
Fallahi, Maryam; Keyhanmanesh, Rana; Khamaneh, Amir Mahdi; Ebrahimi Saadatlou, Mohammad Ali; Saadat, Saeideh; Ebrahimi, Hadi
2016-01-01
Objective: In previous studies the therapeutic effects of Nigella sativa have been demonstrated on asthmatic animals. In the present study, the preventive effect of single dose of alpha-hederin, its active constituent, has been evaluated on lung inflammation and some inflammatory mediators in lungs of ovalbumin sensitized rat in order to elicit its mechanism. Materials and Methods: Forty rats were randomly grouped in 4 groups; control (C), sensitized (S), sensitized pretreated groups with thymoquinone (3 mg/kg i.p., S+TQ) and alpha-hederin (0.02 mg/kg i.p., S+AH). Levels of IL-13 mRNA and miRNA-126 in lung tissue and its pathological changes in each group were assessed. Results: Elevated levels of miRNA-126, IL-13 mRNA and pathological changes were observed in the sensitized group compared to the control group (p<0.001 to p<0.05). All of these factors were significantly reduced in S+TQ and S+AH groups in comparison to S group (p<0.001 to p<0.05). Although alpha-hederin decreased the levels of miRNA-126, IL-13 mRNA and pathological changes in comparison with thymoquinone, the results were statistically not significant. Conclusion: The results suggested that alpha-hederin had preventive effect on sensitized rats like thymoquinone. It may intervene in miRNA-126 expression, which consequently could interfere with IL-13 secretion pathway leading to a reduction in inflammatory responses. PMID:27247924
Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin
2006-04-01
Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.
Modulating drug resistance by targeting BCRP/ABCG2 using retrovirus-mediated RNA interference.
Xie, Ni; Mou, Lisha; Yuan, Jianhui; Liu, Wenlan; Deng, Tingting; Li, Zigang; Jing, Yi; Jin, Yi; Hu, Zhangli
2014-01-01
The BCRP/ABCG2 transporter, which mediates drug resistance in many types of cells, depends on energy provided by ATP hydrolysis. Here, a retrovirus encoding a shRNA targeting the ATP-binding domain of this protein was used to screen for highly efficient agents that could reverse drug resistance and improve cell sensitivity to drugs, thus laying the foundation for further studies and applications. To target the ATP-binding domain of BCRP/ABCG2, pLenti6/BCRPsi shRNA recombinant retroviruses, with 20 bp target sequences starting from the 270th, 745th and 939th bps of the 6th exon, were constructed and packaged. The pLenti6/BCRPsi retroviruses (V-BCRPi) that conferred significant knockdown effects were screened using a drug-sensitivity experiment and flow cytometry. The human choriocarcinoma cell line JAR, which highly expresses endogenous BCRP/ABCG2, was injected under the dorsal skin of a hairless mouse to initiate a JAR cytoma. After injecting V-BCRPi-infected JAR tumor cells into the dorsal skin of hairless mice, BCRP/ABCG2 expression in the tumor tissue was determined using immunohistochemistry, fluorescent quantitative RT-PCR and Western blot analyses. After intraperitoneal injection of BCRP/ABCG2-tolerant 5-FU, the tumor volume, weight change, and apoptosis rate of the tumor tissue were determined using in situ hybridization. V-BCRPi increased the sensitivity of the tumor histiocytes to 5-FU and improved the cell apoptosis-promoting effects of 5-FU in the tumor. The goal of the in vivo and in vitro studies was to screen for an RNA interference recombinant retrovirus capable of stably targeting the ATP-binding domain of BCRP/ABCG2 (V-BCRPi) to inhibit its function. A new method to improve the chemo-sensitivity of breast cancer and other tumor cells was discovered, and this method could be used for gene therapy and functional studies of malignant tumors.
Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs
2015-01-01
Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637
Guo, Can-Jie; Xiao, Xiao; Sheng, Li; Chen, Lili; Zhong, Wei; Li, Hai; Hua, Jing; Ma, Xiong
2017-01-01
To analyze the long noncoding (lncRNA)-mRNA expression network and potential roles in rat hepatic stellate cells (HSCs) during activation. LncRNA expression was analyzed in quiescent and culture-activated HSCs by RNA sequencing, and differentially expressed lncRNAs verified by quantitative reverse transcription polymerase chain reaction (qRT-PCR) were subjected to bioinformatics analysis. In vivo analyses of differential lncRNA-mRNA expression were performed on a rat model of liver fibrosis. We identified upregulation of 12 lncRNAs and 155 mRNAs and downregulation of 12 lncRNAs and 374 mRNAs in activated HSCs. Additionally, we identified the differential expression of upregulated lncRNAs (NONRATT012636.2, NONRATT016788.2, and NONRATT021402.2) and downregulated lncRNAs (NONRATT007863.2, NONRATT019720.2, and NONRATT024061.2) in activated HSCs relative to levels observed in quiescent HSCs, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses showed that changes in lncRNAs associated with HSC activation revealed 11 significantly enriched pathways according to their predicted targets. Moreover, based on the predicted co-expression network, the relative dynamic levels of NONRATT013819.2 and lysyl oxidase (Lox) were compared during HSC activation both in vitro and in vivo. Our results confirmed the upregulation of lncRNA NONRATT013819.2 and Lox mRNA associated with the extracellular matrix (ECM)-related signaling pathway in HSCs and fibrotic livers. Our results detailing a dysregulated lncRNA-mRNA network might provide new treatment strategies for hepatic fibrosis based on findings indicating potentially critical roles for NONRATT013819.2 and Lox in ECM remodeling during HSC activation. © 2017 The Author(s). Published by S. Karger AG, Basel.
Biomimetic RNA-silencing nanocomplexes: overcoming multidrug resistance in cancer cells.
Wang, Zhongliang; Wang, Zhe; Liu, Dingbin; Yan, Xuefeng; Wang, Fu; Niu, Gang; Yang, Min; Chen, Xiaoyuan
2014-02-10
RNA interference (RNAi) is an RNA-dependent gene silencing approach controlled by an RNA-induced silencing complex (RISC). Herein, we present a synthetic RISC-mimic nanocomplex, which can actively cleave its target RNA in a sequence-specific manner. With high enzymatic stability and efficient self-delivery to target cells, the designed nanocomplex can selectively and potently induce gene silencing without cytokine activation. These nanocomplexes, which target multidrug resistance, are not only able to bypass the P-glycoprotein (Pgp) transporter, due to their nano-size effect, but also effectively suppress Pgp expression, thus resulting in successful restoration of drug sensitivity of OVCAR8/ADR cells to Pgp-transportable cytotoxic agents. This nanocomplex approach has the potential for both functional genomics and cancer therapy. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Singh Mehta, Dalip; Srivastava, Vishal
2012-11-01
We report quantitative phase imaging of human red blood cells (RBCs) using phase-shifting interference microscopy. Five phase-shifted white light interferograms are recorded using colour charge coupled device camera. White light interferograms were decomposed into red, green, and blue colour components. The phase-shifted interferograms of each colour were then processed by phase-shifting analysis and phase maps for red, green, and blue colours were reconstructed. Wavelength dependent refractive index profiles of RBCs were computed from the single set of white light interferogram. The present technique has great potential for non-invasive determination of refractive index variation and morphological features of cells and tissues.
Dhamrait, Sukhbir S; Maubaret, Cecilia; Pedersen-Bjergaard, Ulrik; Brull, David J; Gohlke, Peter; Payne, John R; World, Michael; Thorsteinsson, Birger; Humphries, Steve E; Montgomery, Hugh E
2016-01-01
Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin-converting enzyme (ACE) is the central component of endocrine and local tissue renin-angiotensin systems (RAS), which also regulate diverse aspects of whole-body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations ( healthy young UK men and Scandinavian diabetic patients ) serum ACE (sACE) activity was significantly higher amongst UCP3-55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold ( P < 0·01) whilst increasing ACE expression within a physiological range (<1·8-fold at 48 h; P < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role.
Suppression of sun interference in the star sensor baffling stray light by total internal reflection
NASA Astrophysics Data System (ADS)
Kawano, Hiroyuki; Shimoji, Haruhiko; Yoshikawa, Shoji; Miyatake, Katsumasa; Hama, Kazumori; Nakamura, Shuji
2005-09-01
We have developed a star sensor as an experimental device onboard the SERVIS-1 satellite launched in October 2003. The in-orbit data have verified its fundamental performance. One of the advantages of our star sensor is that the baffle has a small length of 120 mm instead of 182 mm in the conventional two-stage baffle design. The key concepts for light shielding are total internal reflection phenomena inside a nearly half sphere (NHS) lens and scattering light control by gloss black paint. However, undesirable background noise by the sun outside of the field of view (FOV) was observed in the corner of the FOV in the orbital experiment. Ray trace simulations revealed that slight scattering light on the specular baffle wall entered the NHS lens and reached the corner of the image sensor through the multi-reflection path inside the lens. It was found that the stray light path can be shielded effectively if the diameter of the aperture under the NHS lens was reduced. We redesigned the baffle and evaluated the light shielding ability with our sun interference test facility on the ground, and confirmed that the stray light was reduced below the acceptable level. As a result, the light shielding technique which we have proposed was proved to be effective for a small-size baffle. The redesigned star sensor is planned to be installed as a main attitude sensor for the SERVIS-2 satellite scheduled to be launched in February 2008.
Rosenbury, Christopher; Gu, Yalong; Gbur, Greg
2012-04-01
A previously derived condition for the complete destructive interference of partially coherent light emerging from a trio of pinholes in an opaque screen is generalized to the case when the coherence properties of the field are asymmetric. It is shown by example that the interference condition is necessary, but not sufficient, and that the existence of complete destructive interference also depends on the intensity of light emerging from the pinholes and the system geometry; more general conditions for such interference are derived. The phase of the wave field exhibits both phase singularities and correlation singularities, and a number of nonintuitive situations in which complete destructive interference occurs are described and explained.
Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.
2010-01-01
The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014
Topography and refractometry of sperm cells using spatial light interference microscopy.
Liu, Lina; Kandel, Mikhail E; Rubessa, Marcello; Schreiber, Sierra; Wheeler, Mathew B; Popescu, Gabriel
2018-02-01
Characterization of spermatozoon viability is a common test in treating infertility. Recently, it has been shown that label-free, phase-sensitive imaging can provide a valuable alternative for this type of assay. We employ spatial light interference microscopy (SLIM) to perform high-accuracy single-cell phase imaging and decouple the average thickness and refractive index information for the population. This procedure was enabled by quantitative-phase imaging cells on media of two different refractive indices and using a numerical tool to remove the curvature from the cell tails. This way, we achieved ensemble averaging of topography and refractometry of 100 cells in each of the two groups. The results show that the thickness profile of the cell tail goes down to 150 nm and the refractive index can reach values of 1.6 close to the head. (2018) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE).
Quantum interference in plasmonic circuits.
Heeres, Reinier W; Kouwenhoven, Leo P; Zwiller, Valery
2013-10-01
Surface plasmon polaritons (plasmons) are a combination of light and a collective oscillation of the free electron plasma at metal/dielectric interfaces. This interaction allows subwavelength confinement of light beyond the diffraction limit inherent to dielectric structures. As a result, the intensity of the electromagnetic field is enhanced, with the possibility to increase the strength of the optical interactions between waveguides, light sources and detectors. Plasmons maintain non-classical photon statistics and preserve entanglement upon transmission through thin, patterned metallic films or weakly confining waveguides. For quantum applications, it is essential that plasmons behave as indistinguishable quantum particles. Here we report on a quantum interference experiment in a nanoscale plasmonic circuit consisting of an on-chip plasmon beamsplitter with integrated superconducting single-photon detectors to allow efficient single plasmon detection. We demonstrate a quantum-mechanical interaction between pairs of indistinguishable surface plasmons by observing Hong-Ou-Mandel (HOM) interference, a hallmark non-classical interference effect that is the basis of linear optics-based quantum computation. Our work shows that it is feasible to shrink quantum optical experiments to the nanoscale and offers a promising route towards subwavelength quantum optical networks.
Interference Fit Life Factors for Roller Bearings
NASA Technical Reports Server (NTRS)
Oswald, Fred B.; Zaretsky, Erwin V.; Poplawski, Joseph V.
2008-01-01
The effect of hoop stresses in reducing cylindrical roller bearing fatigue life was determined for various classes of inner ring interference fit. Calculations were performed for up to seven interference fit classes for each of ten bearing sizes. Each fit was taken at tightest, average and loosest values within the fit class for RBEC-5 tolerance, thus requiring 486 separate analyses. The hoop stresses were superimposed on the Hertzian principal stresses created by the applied radial load to calculate roller bearing fatigue life. The method was developed through a series of equations to calculate the life reduction for cylindrical roller bearings based on interference fit. All calculated lives are for zero initial bearing internal clearance. Any reduction in bearing clearance due to interference fit was compensated by increasing the initial (unmounted) clearance. Results are presented as tables and charts of life factors for bearings with light, moderate and heavy loads and interference fits ranging from extremely light to extremely heavy and for bearing accuracy class RBEC 5 (ISO class 5). Interference fits on the inner bearing ring of a cylindrical roller bearing can significantly reduce bearing fatigue life. In general, life factors are smaller (lower life) for bearings running under light load where the unfactored life is highest. The various bearing series within a particular bore size had almost identical interference fit life factors for a particular fit. The tightest fit at the high end of the RBEC-5 tolerance band defined in ANSI/ABMA shaft fit tables produces a life factor of approximately 0.40 for an inner-race maximum Hertz stress of 1200 MPa (175 ksi) and a life factor of 0.60 for an inner-race maximum Hertz stress of 2200 MPa (320 ksi). Interference fits also impact the maximum Hertz stress-life relation.
Riley, Rachel S; Dang, Megan N; Billingsley, Margaret M; Abraham, Baxter; Gundlach, Lars; Day, Emily S
2018-06-13
The ability to regulate intracellular gene expression with exogenous nucleic acids such as small interfering RNAs (siRNAs) has substantial potential to improve the study and treatment of disease. However, most transfection agents and nanoparticle-based carriers that are used for the intracellular delivery of nucleic acids cannot distinguish between diseased and healthy cells, which may cause them to yield unintended widespread gene regulation. An ideal delivery system would only silence targeted proteins in diseased tissue in response to an external stimulus. To enable spatiotemporal control over gene silencing, researchers have begun to develop nucleic acid-nanoparticle conjugates that keep their nucleic acid cargo inactive until it is released from the nanoparticle on-demand by externally applied near-infrared laser light. This strategy can overcome several limitations of other nucleic acid delivery systems, but the mechanisms by which these platforms operate remain ill understood. Here, we perform a detailed investigation of the mechanisms by which silica core/gold shell nanoshells (NSs) release conjugated siRNA upon excitation with either pulsed or continuous wave (CW) near-infrared (NIR) light, with the goal of providing insight into how these nanoconjugates can enable on-demand gene regulation. We demonstrate that siRNA release from NSs upon pulsed laser irradiation is a temperature-independent process that is substantially more efficient than siRNA release triggered by CW irradiation. Contrary to literature, which suggests that only pulsed irradiation releases siRNA duplexes, we found that both modes of irradiation release a mixture of siRNA duplexes and single-stranded oligonucleotides, but that pulsed irradiation results in a higher percentage of released duplexes. To demonstrate that the siRNA released from NSs upon pulsed irradiation remains functional, we evaluated the use of NSs coated with green fluorescent protein (GFP)-targeted siRNA (siGFP-NS) for
NASA Astrophysics Data System (ADS)
Mehta, Dalip Singh; Sharma, Anuradha; Dubey, Vishesh; Singh, Veena; Ahmad, Azeem
2016-03-01
We present a single-shot white light interference microscopy for the quantitative phase imaging (QPI) of biological cells and tissues. A common path white light interference microscope is developed and colorful white light interferogram is recorded by three-chip color CCD camera. The recorded white light interferogram is decomposed into the red, green and blue color wavelength component interferograms and processed it to find out the RI for different color wavelengths. The decomposed interferograms are analyzed using local model fitting (LMF)" algorithm developed for reconstructing the phase map from single interferogram. LMF is slightly off-axis interferometric QPI method which is a single-shot method that employs only a single image, so it is fast and accurate. The present method is very useful for dynamic process where path-length changes at millisecond level. From the single interferogram a wavelength-dependent quantitative phase imaging of human red blood cells (RBCs) are reconstructed and refractive index is determined. The LMF algorithm is simple to implement and is efficient in computation. The results are compared with the conventional phase shifting interferometry and Hilbert transform techniques.
Allen, Thomas E.; Heidmann, Stefan; Reed, RoseMary; Myler, Peter J.; Göringer, H. Ulrich; Stuart, Kenneth D.
1998-01-01
RNA editing in Trypanosoma brucei mitochondria produces mature mRNAs by a series of enzyme-catalyzed reactions that specifically insert or delete uridylates in association with a macromolecular complex. Using a mitochondrial fraction enriched for in vitro RNA editing activity, we produced several monoclonal antibodies that are specific for a 21-kDa guide RNA (gRNA) binding protein initially identified by UV cross-linking. Immunofluorescence studies localize the protein to the mitochondrion, with a preference for the kinetoplast. The antibodies cause a supershift of previously identified gRNA-specific ribonucleoprotein complexes and immunoprecipitate in vitro RNA editing activities that insert and delete uridylates. The immunoprecipitated material also contains gRNA-specific endoribonuclease, terminal uridylyltransferase, and RNA ligase activities as well as gRNA and both edited and unedited mRNA. The immunoprecipitate contains numerous proteins, of which the 21-kDa protein, a 90-kDa protein, and novel 55- and 16-kDa proteins can be UV cross-linked to gRNA. These studies indicate that the 21-kDa protein associates with the ribonucleoprotein complex (or complexes) that catalyze RNA editing. PMID:9742118
Hydroxychloroquine-conjugated gold nanoparticles for improved siRNA activity.
Perche, F; Yi, Y; Hespel, L; Mi, P; Dirisala, A; Cabral, H; Miyata, K; Kataoka, K
2016-06-01
Current technology of siRNA delivery relies on pharmaceutical dosage forms to route maximal doses of siRNA to the tumor. However, this rationale does not address intracellular bottlenecks governing silencing activity. Here, we tested the impact of hydroxychloroquine conjugation on the intracellular fate and silencing activity of siRNA conjugated PEGylated gold nanoparticles. Addition of hydroxychloroquine improved endosomal escape and increased siRNA guide strand distribution to the RNA induced silencing complex (RISC), both crucial obstacles to the potency of siRNA. This modification significantly improved gene downregulation in cellulo. Altogether, our data suggest the benefit of this modification for the design of improved siRNA delivery systems. Copyright © 2016 Elsevier Ltd. All rights reserved.
Vumbaca, Frank; Phoenix, Kathryn N.; Rodriguez-Pinto, Daniel; Han, David K.; Claffey, Kevin P.
2008-01-01
Vascular endothelial growth factor (VEGF) is a key angiogenic factor expressed under restricted nutrient and oxygen conditions in most solid tumors. The expression of VEGF under hypoxic conditions requires transcription through activated hypoxia-inducible factor 1 (HIF-1), increased mRNA stability, and facilitated translation. This study identified double-stranded RNA-binding protein 76/NF90 (DRBP76/NF90), a specific isoform of the DRBP family, as a VEGF mRNA-binding protein which plays a key role in VEGF mRNA stability and protein synthesis under hypoxia. The DRBP76/NF90 protein binds to a human VEGF 3′ untranslated mRNA stability element. RNA interference targeting the DRBP76/NF90 isoform limited hypoxia-inducible VEGF mRNA and protein expression with no change in HIF-1-dependent transcriptional activity. Stable repression of DRBP76/NF90 in MDA-MB-435 breast cancer cells demonstrated reduced polysome-associated VEGF mRNA levels under hypoxic conditions and reduced mRNA stability. Transient overexpression of the DRBP76/NF90 protein increased both VEGF mRNA and protein levels synthesized under normoxic and hypoxic conditions. Cells with stable repression of the DRBP76/NF90 isoform showed reduced tumorigenic and angiogenic potential in an orthotopic breast tumor model. These data demonstrate that the DRBP76/NF90 isoform facilitates VEGF expression by promoting VEGF mRNA loading onto polysomes and translation under hypoxic conditions, thus promoting breast cancer growth and angiogenesis in vivo. PMID:18039850
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nam, Ki Hyun; Haitjema, Charles; Liu, Xueqi
Clustered regularly interspaced short palindromic repeats (CRISPRs), together with an operon of CRISPR-associated (Cas) proteins, form an RNA-based prokaryotic immune system against exogenous genetic elements. Cas5 family proteins are found in several type I CRISPR-Cas systems. Here, we report the molecular function of subtype I-C/Dvulg Cas5d from Bacillus halodurans. We show that Cas5d cleaves pre-crRNA into unit length by recognizing both the hairpin structure and the 3 single stranded sequence in the CRISPR repeat region. Cas5d structure reveals a ferredoxin domain-based architecture and a catalytic triad formed by Y46, K116, and H117 residues. We further show that after pre-crRNA processing,more » Cas5d assembles with crRNA, Csd1, and Csd2 proteins to form a multi-sub-unit interference complex similar to Escherichia coli Cascade (CRISPR-associated complex for antiviral defense) in architecture. Our results suggest that formation of a crRNA-presenting Cascade-like complex is likely a common theme among type I CRISPR subtypes.« less
Smith, Maureen R; Jousset, Anne-Caroline; Despons, Laurence; Laumond, Géraldine; Decoville, Thomas; Cattenoz, Pierre; Moog, Christiane; Jossinet, Fabrice; Mougel, Marylène; Paillart, Jean-Christophe
2018-01-01
Abstract Non-coding RNA regulatory elements are important for viral replication, making them promising targets for therapeutic intervention. However, regulatory RNA is challenging to detect and characterise using classical structure-function assays. Here, we present in cell Mutational Interference Mapping Experiment (in cell MIME) as a way to define RNA regulatory landscapes at single nucleotide resolution under native conditions. In cell MIME is based on (i) random mutation of an RNA target, (ii) expression of mutated RNA in cells, (iii) physical separation of RNA into functional and non-functional populations, and (iv) high-throughput sequencing to identify mutations affecting function. We used in cell MIME to define RNA elements within the 5′ region of the HIV-1 genomic RNA (gRNA) that are important for viral replication in cells. We identified three distinct RNA motifs controlling intracellular gRNA production, and two distinct motifs required for gRNA packaging into virions. Our analysis reveals the 73AAUAAA78 polyadenylation motif within the 5′ PolyA domain as a dual regulator of gRNA production and gRNA packaging, and demonstrates that a functional polyadenylation signal is required for viral packaging even though it negatively affects gRNA production. PMID:29514260
Quantitative assessment of neural outgrowth using spatial light interference microscopy
NASA Astrophysics Data System (ADS)
Lee, Young Jae; Cintora, Pati; Arikkath, Jyothi; Akinsola, Olaoluwa; Kandel, Mikhail; Popescu, Gabriel; Best-Popescu, Catherine
2017-06-01
Optimal growth as well as branching of axons and dendrites is critical for the nervous system function. Neuritic length, arborization, and growth rate determine the innervation properties of neurons and define each cell's computational capability. Thus, to investigate the nervous system function, we need to develop methods and instrumentation techniques capable of quantifying various aspects of neural network formation: neuron process extension, retraction, stability, and branching. During the last three decades, fluorescence microscopy has yielded enormous advances in our understanding of neurobiology. While fluorescent markers provide valuable specificity to imaging, photobleaching, and photoxicity often limit the duration of the investigation. Here, we used spatial light interference microscopy (SLIM) to measure quantitatively neurite outgrowth as a function of cell confluence. Because it is label-free and nondestructive, SLIM allows for long-term investigation over many hours. We found that neurons exhibit a higher growth rate of neurite length in low-confluence versus medium- and high-confluence conditions. We believe this methodology will aid investigators in performing unbiased, nondestructive analysis of morphometric neuronal parameters.
Divided attention interferes with fulfilling activity-based intentions.
Brewer, Gene A; Ball, B Hunter; Knight, Justin B; Dewitt, Michael R; Marsh, Richard L
2011-09-01
Two experiments were conducted to examine the effects of divided attention on activity-based prospective memory. After establishing a goal to fulfill an intention upon completion of an ongoing activity, successful completion of the intention generally suffered when attention was being devoted to an additional task (Experiment 1). Forming an implementation intention at encoding ameliorated the negative effects of divided attention (Experiment 2). The results from the present experiments demonstrate that activity-based prospective memory is susceptible to distraction and that implementing encoding strategies that enhance prospective memory performance can reduce this interference. The current work raises interesting questions about the similarities and differences between event- and activity-based prospective memories. Published by Elsevier B.V.
Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin
2018-06-08
Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.
Hand-Held Color Meters Based on Interference Filters
NASA Technical Reports Server (NTRS)
Snyder, G. Jeffrey; Fleurial, Jean-Pierre; Caillat, Thierry; Chen, Gang; Yang, Rong Gui
2004-01-01
Small, inexpensive, hand-held optoelectronic color-measuring devices based on metal-film/dielectric-film interference filters are undergoing development. These color meters could be suitable for use in a variety of applications in which there are requirements to quantify or match colors for aesthetic purposes but there is no need for the high spectral resolution of scientific-grade spectrometers. Such applications typically occur in the paint, printing, and cosmetic industries, for example. The figure schematically depicts a color meter of this type being used to measure the color of a sample in terms of the spectrum of light reflected from the sample. Light from a white source (for example, a white light-emitting diode) passes through a collimating lens to the sample. Another lens collects some of the light reflected from the sample and focuses the light onto the input end of optical fiber. Light emerging from the output end of the optical fiber illuminates an array of photodetectors covered with metal/dielectric-film interference filters like those described in Metal/Dielectric-film Interference Color Filters (NPO-20217), NASA Tech Briefs, Vol. 23, No. 2 (February 1999), page 70. Typically, these are wide-band-pass filters, as shown at the bottom of the figure. The photodetector array need not be of any particular design: it could be something as simple as an assembly containing several photodiodes or something as elaborate as an active-pixel sensor or other imaging device. What is essential is that each of the photodetectors or each of several groups of photodetectors is covered with a metal/dielectric-film filter of a different color. In most applications, it would be desirable to have at least three different filters, each for a spectral band that contains one of the three primary additive red, green, and blue colors. In some applications, it may be necessary to have more than three different color filters in order to characterize subtle differences in color
Baumschlager, Armin; Aoki, Stephanie K; Khammash, Mustafa
2017-11-17
Light has emerged as a control input for biological systems due to its precise spatiotemporal resolution. The limited toolset for light control in bacteria motivated us to develop a light-inducible transcription system that is independent from cellular regulation through the use of an orthogonal RNA polymerase. Here, we present our engineered blue light-responsive T7 RNA polymerases (Opto-T7RNAPs) that show properties such as low leakiness of gene expression in the dark state, high expression strength when induced with blue light, and an inducible range of more than 300-fold. Following optimization of the system to reduce expression variability, we created a variant that returns to the inactive dark state within minutes once the blue light is turned off. This allows for precise dynamic control of gene expression, which is a key aspect for most applications using optogenetic regulation. The regulators, which only require blue light from ordinary light-emitting diodes for induction, were developed and tested in the bacterium Escherichia coli, which is a crucial cell factory for biotechnology due to its fast and inexpensive cultivation and well understood physiology and genetics. Opto-T7RNAP, with minor alterations, should be extendable to other bacterial species as well as eukaryotes such as mammalian cells and yeast in which the T7 RNA polymerase and the light-inducible Vivid regulator have been shown to be functional. We anticipate that our approach will expand the applicability of using light as an inducer for gene expression independent from cellular regulation and allow for a more reliable dynamic control of synthetic and natural gene networks.
Active fungi amidst a marine subsurface RNA paleome
NASA Astrophysics Data System (ADS)
Orsi, W.; Biddle, J.; Edgcomb, V.
2012-12-01
The deep marine subsurface is a vast habitat for microbial life where cells may live on geologic timescales. Since extracellular DNA in sediments may be preserved on long timescales, ribosomal RNA (rRNA) is suggested to be a proxy for the active fraction of a microbial community in the subsurface. During an investigation of eukaryotic 18S rRNA signatures by amplicon pyrosequencing, metazoan, plant, and diatom rRNA signatures were recovered from marine sediments up to 2.7 million years old, suggesting that rRNA may be much more stable than previously considered in the marine subsurface. This finding confirms the concept of a paleome, extending it to include rRNA. Within the same dataset, unique profiles of fungi were found across a range of marine subsurface provinces exhibiting statistically significant correlations with total organic carbon (TOC), sulfide, and dissolved inorganic carbon (DIC). Sequences from metazoans, plants and diatoms showed different correlation patterns, consistent with a depth-controlled paleome. The fungal correlations with geochemistry allow the inference that some fungi are active and adapted for survival in the marine subsurface. A metatranscriptomic analysis of fungal derived mRNA confirms that fungi are metabolically active and utilize a range of organic and inorganic substrates in the marine subsurface.
A versatile assay for RNA-binding proteins in living cells
Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo
2014-01-01
RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470
A media player causes clinically significant telemetry interference with implantable loop recorders.
Thaker, Jay P; Patel, Mehul B; Shah, Ashok J; Liepa, Valdis V; Jongnarangsin, Krit; Thakur, Ranjan K
2009-03-01
The implantable loop recorder is a useful diagnostic tool for intermittent cardiovascular symptoms because it can automatically record arrhythmias as well as a patient-triggered ECG. Media players have been shown to cause telemetry interference with pacemakers. Telemetry interference may be important in patients with implantable loop recorders because capturing a patient-triggered ECG requires a telemetry link between a hand-held activator and the implanted device. The purpose of this study was to determine if a media player causes interference with implantable loop recorders. Fourteen patients with implantable loop recorders underwent evaluation for interference with a 15 GB third generation iPod (Apple, Inc.) media player. All patients had the Reveal Plus (Medtronic, Inc.) implantable loop recorder. We tested for telemetry interference on the programmer by first establishing a telemetry link with the loop recorder and then, the media player was placed next to it, first turned off and then, on. We evaluated for telemetry interference between the activator and the implanted device by placing the activator over the device (normal use) and the media player next to it, first turned off and then, on. We made 5 attempts to capture a patient-triggered ECG by depressing the activator switch 5 times while the media player was off or on. Telemetry interference on the programmer screen, consisting of either high frequency spikes or blanking of the ECG channel was seen in all patients. Telemetry interference with the activator resulted in failure to capture an event in 7 patients. In one of these patients, a green indicator light on the activator suggested that a patient-triggered event was captured, but loop recorder interrogation did not show a captured event. In the remaining 7 patients, an event was captured and appropriately recognized by the device at least 1 out of 5 times. A media player playing in close proximity to an implanted loop recorder may interfere with
Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt
2017-07-27
In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Guo, Ling; Wang, Zhen; Anderson, Courtney M; Doolittle, Emerald; Kernag, Siobhan; Cotta, Claudiu V; Ondrejka, Sarah L; Ma, Xiao-Jun; Cook, James R
2018-03-01
The assessment of B-cell clonality is a critical component of the evaluation of suspected lymphoproliferative disorders, but analysis from formalin-fixed, paraffin-embedded tissues can be challenging if fresh tissue is not available for flow cytometry. Immunohistochemical and conventional bright field in situ hybridization stains for kappa and lambda are effective for evaluation of plasma cells but are often insufficiently sensitive to detect the much lower abundance of light chains present in B-cells. We describe an ultrasensitive RNA in situ hybridization assay that has been adapted for use on an automated immunohistochemistry platform and compare results with flow cytometry in 203 consecutive tissues and 104 consecutive bone marrows. Overall, in 203 tissue biopsies, RNA in situ hybridization identified light chain-restricted B-cells in 85 (42%) vs 58 (29%) by flow cytometry. Within 83 B-cell non-Hodgkin lymphomas, RNA in situ hybridization identified restricted B-cells in 74 (89%) vs 56 (67%) by flow cytometry. B-cell clonality could be evaluated in only 23/104 (22%) bone marrow cases owing to poor RNA preservation, but evaluable cases showed 91% concordance with flow cytometry. RNA in situ hybridization allowed for recognition of biclonal/composite lymphomas not identified by flow cytometry and highlighted unexpected findings, such as coexpression of kappa and lambda RNA in 2 cases and the presence of lambda light chain RNA in a T lymphoblastic lymphoma. Automated RNA in situ hybridization showed excellent interobserver reproducibility for manual evaluation (average K=0.92), and an automated image analysis system showed high concordance (97%) with manual evaluation. Automated RNA in situ hybridization staining, which can be adopted on commonly utilized immunohistochemistry instruments, allows for the interpretation of clonality in the context of the morphological features in formalin-fixed, paraffin-embedded tissues with a clinical sensitivity similar or
Guo, Ling; Wang, Zhen; Anderson, Courtney M.; Doolittle, Emerald; Kernag, Siobhan; Cotta, Claudiu V.; Ondrejka, Sarah L.; Ma, Xiao-Jun; Cook, James R.
2017-01-01
The assessment of B-cell clonality is a critical component of the evaluation of suspected lymphoproliferative disorders, but analysis from formalin fixed paraffin embedded tissues can be challenging if fresh tissue is not available for flow cytometry. Immunohistochemical and conventional bright field in situ hybridization stains for kappa and lambda are effective for evaluation of plasma cells, but are often insufficiently sensitive to detect the much lower abundance of light chains present in B cells. We describe an ultrasensitive RNA in situ hybridization assay which has been adapted for use on an automated immunohistochemistry platform and compare results with flow cytometry in 203 consecutive tissues and 104 consecutive bone marrows. Overall, in 203 tissue biopsies, RNA in situ hybridization identified light chain restricted B-cells in 85 (42%) vs. 58 (29%) by flow cytometry. Within 83 B-cell non-Hodgkin lymphomas, RNA in situ hybridization identified a restricted B-cells in 74 (89%) vs. 56 (67%) by flow cytometry. B-cell clonality could be evaluated in only 23/104 (22%) bone marrow cases due to poor RNA preservation, but evaluable cases showed 91% concordance with flow cytometry. RNA in situ hybridization allowed for recognition of biclonal/composite lymphomas not identified by flow cytometry, and highlighted unexpected findings, such as coexpression of kappa and lambda RNA in 2 cases and the presence of lambda light chain RNA in a T lymphoblastic lymphoma. Automated RNA in situ hybridization showed excellent interobserver reproducibility for manual evaluation (average K=0.92), and an automated image analysis system showed high concordance (97%) with manual evaluation. Automated RNA in situ hybridization staining, which can be adopted on commonly utilized immunohistochemistry instruments, allows for the interpretation of clonality in the context of the morphologic features in formalin fixed, paraffin embedded tissues with a clinical sensitivity similar or
Suppression of Bedbug’s Reproduction by RNA Interference of Vitellogenin
Moriyama, Minoru; Hosokawa, Takahiro; Tanahashi, Masahiko; Nikoh, Naruo; Fukatsu, Takema
2016-01-01
Recent resurgence of the bedbug Cimex lectularius is a global problem on the public health. On account of the worldwide rise of insecticide-resistant bedbug populations, exploration of new approaches to the bedbug control and management is anticipated. In this context, gene silencing by RNA interference (RNAi) has been considered for its potential application to pest control and management, because RNAi enables specific suppression of target genes and thus flexible selection of target traits to be disrupted. In this study, in an attempt to develop a control strategy targeting reproduction of the bedbug, we investigated RNAi-mediated gene silencing of vitellogenin (Vg), a major yolk protein precursor essential for oogenesis. From the bedbug transcriptomes, we identified a typical Vg gene and a truncated Vg gene, which were designated as ClVg and ClVg-like, respectively. ClVg gene was highly expressed mainly in the fat body of adult females, which was more than 100 times higher than the expression level of ClVg-like gene, indicating that ClVg gene is the primary functional Vg gene in the bedbug. RNAi-mediated suppression of ClVg gene expression in adult females resulted in drastically reduced egg production, atrophied ovaries, and inflated abdomen due to hypertrophied fat bodies. These phenotypic consequences are expected not only to suppress the bedbug reproduction directly but also to deteriorate its feeding and survival indirectly via behavioral modifications. These results suggest the potential of ClVg gene as a promising target for RNAi-based population management of the bedbug. PMID:27096422
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.
2008-01-01
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934
Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A
2017-02-01
Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.
Interference-Fit Life Factors for Roller Bearings
NASA Technical Reports Server (NTRS)
Oswald, Fred B.; Zaretsky, Erwin V.; Poplawski, Joseph V.
2009-01-01
The effect of hoop stresses in reducing cylindrical roller bearing fatigue life was determined for various classes of inner-ring interference fit. Calculations were performed for up to 7 fit classes for each of 10 bearing sizes. The hoop stresses were superimposed on the Hertzian principal stresses created by the applied radial load to calculate roller bearing fatigue life. A method was developed through a series of equations to calculate the life reduction for cylindrical roller bearings. All calculated lives are for zero initial internal clearance. Any reduction in bearing clearance due to interference fit would be compensated by increasing the initial (unmounted) clearance. Results are presented as tables and charts of life factors for bearings with light, moderate, and heavy loads and interference fits ranging from extremely light to extremely heavy for bearing accuracy class RBEC-5 (ISO class 5). Interference fits on the inner ring of a cylindrical roller bearing can significantly reduce bearing fatigue life. In general, life factors are smaller (lower life) for bearings running under light load where the unfactored life is highest. The various bearing series within a particular bore size had almost identical interference-fit life factors for a particular fit. The tightest fit at the high end of the tolerance band produces a life factor of approximately 0.40 for an inner-race maximum Hertz stress of 1200 MPa (175 ksi) and a life factor of 0.60 for an inner-race maximum Hertz stress of 2200 MPa (320 ksi). Interference fits also impact the maximum Hertz stress-life relation.
Modulation of RNA function by aminoglycoside antibiotics.
Schroeder, R; Waldsich, C; Wank, H
2000-01-04
One of the most important families of antibiotics are the aminoglycosides, including drugs such as neomycin B, paromomycin, gentamicin and streptomycin. With the discovery of the catalytic potential of RNA, these antibiotics became very popular due to their RNA-binding capacity. They serve for the analysis of RNA function as well as for the study of RNA as a potential therapeutic target. Improvements in RNA structure determination recently provided first insights into the decoding site of the ribosome at high resolution and how aminoglycosides might induce misreading of the genetic code. In addition to inhibiting prokaryotic translation, aminoglycosides inhibit several catalytic RNAs such as self-splicing group I introns, RNase P and small ribozymes in vitro. Furthermore, these antibiotics interfere with human immunodeficiency virus (HIV) replication by disrupting essential RNA-protein contacts. Most exciting is the potential of many RNA-binding antibiotics to stimulate RNA activities, conceiving small-molecule partners for the hypothesis of an ancient RNA world. SELEX (systematic evolution of ligands by exponential enrichment) has been used in this evolutionary game leading to small synthetic RNAs, whose NMR structures gave valuable information on how aminoglycosides interact with RNA, which could possibly be used in applied science.
Gradient light interference microscopy (GLIM) for imaging thick specimens (Conference Presentation)
NASA Astrophysics Data System (ADS)
Nguyen, Tan H.; Kandel, Mikhail E.; Popescu, Gabriel
2016-03-01
Compared to the Phase Contrast, Differential Interference Contrast (DIC) has been known to give higher depth sectioning as well as a halo-free images when investigating transparent specimens. Thanks to relying on generating two slightly shifted replicas with a small amount of shift, within the coherence area, DIC is able to operate with very low coherence light. More importantly, the method is able to work with very large numerical aperture of the illumination, which offer comparable sectioning capability to bright field microscopy. However, DIC is still a qualitative method, which limits potential applications of the technique. In this paper, we introduce a method that extends the capability of DIC by combining it with a phase shifting module to extract the phase gradient information. A theoretical model of the image formation is developed and the possibility of integrating the gradient function is analyzed.. Our method is benchmarked on imaging embryos during their 7-day development, HeLa cells during mitosis, and control samples.
Negative-strand RNA viruses: the plant-infecting counterparts.
Kormelink, Richard; Garcia, Maria Laura; Goodin, Michael; Sasaya, Takahide; Haenni, Anne-Lise
2011-12-01
While a large number of negative-strand (-)RNA viruses infect animals and humans, a relative small number have plants as their primary host. Some of these have been classified within families together with animal/human infecting viruses due to similarities in particle morphology and genome organization, while others have just recently been/or are still classified in floating genera. In most cases, at least two striking differences can still be discerned between the animal/human-infecting viruses and their plant-infecting counterparts which for the latter relate to their adaptation to plants as hosts. The first one is the capacity to modify plasmodesmata to facilitate systemic spread of infectious viral entities throughout the plant host. The second one is the capacity to counteract RNA interference (RNAi, also referred to as RNA silencing), the innate antiviral defence system of plants and insects. In this review an overview will be presented on the negative-strand RNA plant viruses classified within the families Bunyaviridae, Rhabdoviridae, Ophioviridae and floating genera Tenuivirus and Varicosavirus. Genetic differences with the animal-infecting counterparts and their evolutionary descendants will be described in light of the above processes. Copyright © 2011 Elsevier B.V. All rights reserved.
Structure of yeast Argonaute with guide RNA
Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.
2012-01-01
The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195
New insights into siRNA amplification and RNAi
Zhang, Chi; Ruvkun, Gary
2012-01-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672
New insights into siRNA amplification and RNAi.
Zhang, Chi; Ruvkun, Gary
2012-08-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.
RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.
Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M
2018-06-01
The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.
RNA interference: Applications and advances in insect toxicology and insect pest management.
Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan
2015-05-01
Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.
New Type of BACE1 siRNA Delivery to Cells
Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz
2014-01-01
Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230
Brawley, Elizabeth C
2009-01-01
Good lighting is perhaps the most important and least understood element in designing healthcare environments. Both physically and mentally challenged individuals become more vulnerable and dependent on their environment to compensate for sensory impairments, including dimming eyesight, which interferes to some degree with daily activities as well as social and leisure activities - the things that provide emotional and social well-being. Too few building designs today result in lighting that meets the needs of these individuals, regardless of age. Typical lighting in most care environments is inadequate to meet lighting needs affecting both vision and the photobiological (non-visual) needs of synchronization of circadian rhythm, which impacts sleep and depression. Well-designed lighting is one of the most important design elements that will support an individual's ability to perform normal daily activities and decrease the level of disability associated with these impairments. Daylight contains the spectrum to which the circadian clock is most sensitive and provides higher light levels during the day. Easily accessible outdoor gardens encourage individuals outside, providing the necessary regular exposure to direct bright light that sunlight provides. The combination good interior lighting and regular daylight exposure contributes to regaining and maintaining an active and fulfilling lifestyle - greatly improving quality of life.
RNA "traffic lights": an analytical tool to monitor siRNA integrity.
Holzhauser, Carolin; Liebl, Renate; Goepferich, Achim; Wagenknecht, Hans-Achim; Breunig, Miriam
2013-05-17
The combination of thiazole orange and thiazole red as an internal energy transfer-based fluorophore pair in oligonucleotides provides an outstanding analytical tool to follow DNA/RNA hybridization through a distinct fluorescence color change from red to green. Herein, we demonstrate that this concept can be applied to small interfering RNA (siRNA) to monitor RNA integrity in living cells in real time with a remarkable dynamic range and excellent contrast ratios in cellular media. Furthermore, we show that our siRNA-sensors still possess their gene silencing function toward the knockdown of enhanced green fluorescent protein in CHO-K1 cells.
Constrained Bayesian Active Learning of Interference Channels in Cognitive Radio Networks
NASA Astrophysics Data System (ADS)
Tsakmalis, Anestis; Chatzinotas, Symeon; Ottersten, Bjorn
2018-02-01
In this paper, a sequential probing method for interference constraint learning is proposed to allow a centralized Cognitive Radio Network (CRN) accessing the frequency band of a Primary User (PU) in an underlay cognitive scenario with a designed PU protection specification. The main idea is that the CRN probes the PU and subsequently eavesdrops the reverse PU link to acquire the binary ACK/NACK packet. This feedback indicates whether the probing-induced interference is harmful or not and can be used to learn the PU interference constraint. The cognitive part of this sequential probing process is the selection of the power levels of the Secondary Users (SUs) which aims to learn the PU interference constraint with a minimum number of probing attempts while setting a limit on the number of harmful probing-induced interference events or equivalently of NACK packet observations over a time window. This constrained design problem is studied within the Active Learning (AL) framework and an optimal solution is derived and implemented with a sophisticated, accurate and fast Bayesian Learning method, the Expectation Propagation (EP). The performance of this solution is also demonstrated through numerical simulations and compared with modified versions of AL techniques we developed in earlier work.
van Haaften, Gijs; Vastenhouw, Nadine L.; Nollen, Ellen A. A.; Plasterk, Ronald H. A.; Tijsterman, Marcel
2004-01-01
Here, we describe a systematic search for synthetic gene interactions in a multicellular organism, the nematode Caenorhabditis elegans. We established a high-throughput method to determine synthetic gene interactions by genome-wide RNA interference and identified genes that are required to protect the germ line against DNA double-strand breaks. Besides known DNA-repair proteins such as the C. elegans orthologs of TopBP1, RPA2, and RAD51, eight genes previously unassociated with a double-strand-break response were identified. Knockdown of these genes increased sensitivity to ionizing radiation and camptothecin and resulted in increased chromosomal nondisjunction. All genes have human orthologs that may play a role in human carcinogenesis. PMID:15326288
Dhamrait, Sukhbir S; Maubaret, Cecilia; Pedersen-Bjergaard, Ulrik; Brull, David J; Gohlke, Peter; Payne, John R; World, Michael; Thorsteinsson, Birger; Humphries, Steve E; Montgomery, Hugh E
2016-07-01
Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin-converting enzyme (ACE) is the central component of endocrine and local tissue renin-angiotensin systems (RAS), which also regulate diverse aspects of whole-body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations (healthy young UK men and Scandinavian diabetic patients) serum ACE (sACE) activity was significantly higher amongst UCP3-55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold (P < 0·01) whilst increasing ACE expression within a physiological range (<1·8-fold at 48 h; P < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role. © 2016 The Authors. BioEssays published by WILEY Periodicals, Inc.
Maubaret, Cecilia; Pedersen‐Bjergaard, Ulrik; Brull, David J.; Gohlke, Peter; Payne, John R.; World, Michael; Thorsteinsson, Birger; Humphries, Steve E.; Montgomery, Hugh E.
2015-01-01
Uncoupling proteins (UCPs) regulate mitochondrial function, and thus cellular metabolism. Angiotensin‐converting enzyme (ACE) is the central component of endocrine and local tissue renin–angiotensin systems (RAS), which also regulate diverse aspects of whole‐body metabolism and mitochondrial function (partly through altering mitochondrial UCP expression). We show that ACE expression also appears to be regulated by mitochondrial UCPs. In genetic analysis of two unrelated populations (healthy young UK men and Scandinavian diabetic patients) serum ACE (sACE) activity was significantly higher amongst UCP3‐55C (rather than T) and UCP2 I (rather than D) allele carriers. RNA interference against UCP2 in human umbilical vein endothelial cells reduced UCP2 mRNA sixfold (P < 0·01) whilst increasing ACE expression within a physiological range (<1·8‐fold at 48 h; P < 0·01). Our findings suggest novel hypotheses. Firstly, cellular feedback regulation may occur between UCPs and ACE. Secondly, cellular UCP regulation of sACE suggests a novel means of crosstalk between (and mutual regulation of) cellular and endocrine metabolism. This might partly explain the reduced risk of developing diabetes and metabolic syndrome with RAS antagonists and offer insight into the origins of cardiovascular disease in which UCPs and ACE both play a role. PMID:27347560
Burgess, Gregory C; Braver, Todd S
2010-09-20
A critical aspect of executive control is the ability to limit the adverse effects of interference. Previous studies have shown activation of left ventrolateral prefrontal cortex after the onset of interference, suggesting that interference may be resolved in a reactive manner. However, we suggest that interference control may also operate in a proactive manner to prevent effects of interference. The current study investigated the temporal dynamics of interference control by varying two factors - interference expectancy and fluid intelligence (gF) - that could influence whether interference control operates proactively versus reactively. A modified version of the recent negatives task was utilized. Interference expectancy was manipulated across task blocks by changing the proportion of recent negative (interference) trials versus recent positive (facilitation) trials. Furthermore, we explored whether gF affected the tendency to utilize specific interference control mechanisms. When interference expectancy was low, activity in lateral prefrontal cortex replicated prior results showing a reactive control pattern (i.e., interference-sensitivity during probe period). In contrast, when interference expectancy was high, bilateral prefrontal cortex activation was more indicative of proactive control mechanisms (interference-related effects prior to the probe period). Additional results suggested that the proactive control pattern was more evident in high gF individuals, whereas the reactive control pattern was more evident in low gF individuals. The results suggest the presence of two neural mechanisms of interference control, with the differential expression of these mechanisms modulated by both experimental (e.g., expectancy effects) and individual difference (e.g., gF) factors.
Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes.
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Wang, Yanli; Gao, Xin; Huang, Xuhui
2017-09-01
At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.
Spectrally resolved laser interference microscopy
NASA Astrophysics Data System (ADS)
Butola, Ankit; Ahmad, Azeem; Dubey, Vishesh; Senthilkumaran, P.; Singh Mehta, Dalip
2018-07-01
We developed a new quantitative phase microscopy technique, namely, spectrally resolved laser interference microscopy (SR-LIM), with which it is possible to quantify multi-spectral phase information related to biological specimens without color crosstalk using a color CCD camera. It is a single shot technique where sequential switched on/off of red, green, and blue (RGB) wavelength light sources are not required. The method is implemented using a three-wavelength interference microscope and a customized compact grating based imaging spectrometer fitted at the output port. The results of the USAF resolution chart while employing three different light sources, namely, a halogen lamp, light emitting diodes, and lasers, are discussed and compared. The broadband light sources like the halogen lamp and light emitting diodes lead to stretching in the spectrally decomposed images, whereas it is not observed in the case of narrow-band light sources, i.e. lasers. The proposed technique is further successfully employed for single-shot quantitative phase imaging of human red blood cells at three wavelengths simultaneously without color crosstalk. Using the present technique, one can also use a monochrome camera, even though the experiments are performed using multi-color light sources. Finally, SR-LIM is not only limited to RGB wavelengths, it can be further extended to red, near infra-red, and infra-red wavelengths, which are suitable for various biological applications.
Solana, Jordi; Kao, Damian; Mihaylova, Yuliana; Jaber-Hijazi, Farah; Malla, Sunir; Wilson, Ray; Aboobaker, Aziz
2012-01-01
Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology.
Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M
2004-10-27
Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.
Smith, Justin D; Suresh, Sundari; Schlecht, Ulrich; Wu, Manhong; Wagih, Omar; Peltz, Gary; Davis, Ronald W; Steinmetz, Lars M; Parts, Leopold; St Onge, Robert P
2016-03-08
Genome-scale CRISPR interference (CRISPRi) has been used in human cell lines; however, the features of effective guide RNAs (gRNAs) in different organisms have not been well characterized. Here, we define rules that determine gRNA effectiveness for transcriptional repression in Saccharomyces cerevisiae. We create an inducible single plasmid CRISPRi system for gene repression in yeast, and use it to analyze fitness effects of gRNAs under 18 small molecule treatments. Our approach correctly identifies previously described chemical-genetic interactions, as well as a new mechanism of suppressing fluconazole toxicity by repression of the ERG25 gene. Assessment of multiple target loci across treatments using gRNA libraries allows us to determine generalizable features associated with gRNA efficacy. Guides that target regions with low nucleosome occupancy and high chromatin accessibility are clearly more effective. We also find that the best region to target gRNAs is between the transcription start site (TSS) and 200 bp upstream of the TSS. Finally, unlike nuclease-proficient Cas9 in human cells, the specificity of truncated gRNAs (18 nt of complementarity to the target) is not clearly superior to full-length gRNAs (20 nt of complementarity), as truncated gRNAs are generally less potent against both mismatched and perfectly matched targets. Our results establish a powerful functional and chemical genomics screening method and provide guidelines for designing effective gRNAs, which consider chromatin state and position relative to the target gene TSS. These findings will enable effective library design and genome-wide programmable gene repression in many genetic backgrounds.
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound
McTiernan, Charles F.; Chen, Xucai; Klein, Edwin C.; Villanueva, Flordeliza S.
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease. PMID:27471848
Cardiac Gene Expression Knockdown Using Small Inhibitory RNA-Loaded Microbubbles and Ultrasound.
Kopechek, Jonathan A; Carson, Andrew R; McTiernan, Charles F; Chen, Xucai; Klein, Edwin C; Villanueva, Flordeliza S
2016-01-01
RNA interference has potential therapeutic value for cardiac disease, but targeted delivery of interfering RNA is a challenge. Custom designed microbubbles, in conjunction with ultrasound, can deliver small inhibitory RNA to target tissues in vivo. The efficacy of cardiac RNA interference using a microbubble-ultrasound theranostic platform has not been demonstrated in vivo. Therefore, our objective was to test the hypothesis that custom designed microbubbles and ultrasound can mediate effective delivery of small inhibitory RNA to the heart. Microbubble and ultrasound mediated cardiac RNA interference was tested in transgenic mice displaying cardiac-restricted luciferase expression. Luciferase expression was assayed in select tissues of untreated mice (n = 14). Mice received intravenous infusion of cationic microbubbles bearing small inhibitory RNA directed against luciferase (n = 9) or control RNA (n = 8) during intermittent cardiac-directed ultrasound at mechanical index of 1.6. Simultaneous echocardiography in a separate group of mice (n = 3) confirmed microbubble destruction and replenishment during treatment. Three days post treatment, cardiac luciferase messenger RNA and protein levels were significantly lower in ultrasound-treated mice receiving microbubbles loaded with small inhibitory RNA directed against luciferase compared to mice receiving microbubbles bearing control RNA (23±7% and 33±7% of control mice, p<0.01 and p = 0.03, respectively). Passive cavitation detection focused on the heart confirmed that insonification resulted in inertial cavitation. In conclusion, small inhibitory RNA-loaded microbubbles and ultrasound directed at the heart significantly reduced the expression of a reporter gene. Ultrasound-targeted destruction of RNA-loaded microbubbles may be an effective image-guided strategy for therapeutic RNA interference in cardiac disease.
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
RNA helicase A is not required for RISC activity.
Liang, Xue-Hai; Crooke, Stanley T
2013-10-01
It has been shown that siRNAs can compete with each other or with endogenous miRNAs for RISC components. This competition may complicate the interpretations of phenotypes observed through siRNA-mediated knockdown of genes, especially those genes implicated in the RISC pathway. In this study, we re-examined the function of RNA helicase A (RHA), which has been previously proposed to function in RISC loading based on siRNA-mediated knockdown studies. Here we show that reduced RISC activity or loading of siRNAs was observed only in cells depleted of RHA using siRNA, but not using RNaseH-dependent antisense oligonucleotides (ASOs), suggesting that the impaired RISC function stems from the competition between pre-existing and newly transfected siRNAs, but not from reduction of the RHA protein. This view is further supported by the findings that cells depleted of a control protein, NCL1, using siRNA, but not ASO, exhibited similar defects on the loading and activity of a subsequently transfected siRNA. Transfection of RHA or NCL1 siRNAs, but not ASOs, reduced the levels of endogenous miRNAs, suggesting a competition mechanism. As a positive control, we showed that reduction of MOV10 by either siRNA or ASO decreased siRNA activity, confirming its role in RISC function. Together, our results indicate that RHA is not required for RISC activity or loading, and suggest that proper controls are required when using siRNAs to functionalize genes to avoid competition effects. © 2013. Published by Elsevier B.V. All rights reserved.
Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy
2011-02-01
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.
Global RNA association with the transcriptionally active chromosome of chloroplasts.
Lehniger, Marie-Kristin; Finster, Sabrina; Melonek, Joanna; Oetke, Svenja; Krupinska, Karin; Schmitz-Linneweber, Christian
2017-10-01
Processed chloroplast RNAs are co-enriched with preparations of the chloroplast transcriptionally active chromosome. Chloroplast genomes are organized as a polyploid DNA-protein structure called the nucleoid. Transcriptionally active chloroplast DNA together with tightly bound protein factors can be purified by gel filtration as a functional entity called the transcriptionally active chromosome (TAC). Previous proteomics analyses of nucleoids and of TACs demonstrated a considerable overlap in protein composition including RNA binding proteins. Therefore the RNA content of TAC preparations from Nicotiana tabacum was determined using whole genome tiling arrays. A large number of chloroplast RNAs was found to be associated with the TAC. The pattern of RNAs attached to the TAC consists of RNAs produced by different chloroplast RNA polymerases and differs from the pattern of RNA found in input controls. An analysis of RNA splicing and RNA editing of selected RNA species demonstrated that TAC-associated RNAs are processed to a similar extent as the RNA in input controls. Thus, TAC fractions contain a specific subset of the processed chloroplast transcriptome.
Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D
2018-06-01
The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
Xie, Xiangyang; Yang, Yanfang; Lin, Wen; Liu, Hui; Liu, Hong; Yang, Yang; Chen, Ying; Fu, Xudong; Deng, Jianping
2015-12-01
Due to the absence of effective in vivo delivery systems, the employment of small interference RNA (siRNA) in the clinic has been hindered. In this paper, a new siRNA targeting system for EphA2-positive tumors was developed, based on ultrasound-sensitive nanobubbles (NBs) and cell-permeable peptides (CPPs). Here, a CPP-siRNA conjugate (CPP-siRNA) was entrapped in an ephrin mimetic peptide (YSA peptide)-modified NB (CPP-siRNA/YSA-NB) and the penetration of the CPP-siRNA was temporally masked; local ultrasound stimulation triggered the release of CPP-siRNA from the NBs and activated its penetration. Subsequent research demonstrated that the CPP-siRNA/YSA-NBs had particle sizes of approximately 200 nm and a siRNA entrapment efficiency of more than 85%. The in vitro release results showed that over 90% of the encapsulated CPP-siRNA released from the NBs in the presence of ultrasound, while less than 1.5% of that (30 min) released without ultrasound. Cell experiments showed a the higher CPP-siRNA cellular uptake of CPP-siRNA/YSA-NB among the various formulations in human breast adenocarcinoma cells (MCF-7, EphA2 positive cells). Additionally, after systemic administration in mice, CPP-siRNA/YSA-NB accumulated in the tumor, augmented c-Myc silencing and delayed tumor progression. In conclusion, the application of CPP-siRNA/YSA-NB with ultrasound may provide a strategy for the selective and efficient delivery of siRNA. Copyright © 2015 Elsevier B.V. All rights reserved.
SUMOylation of TARBP2 regulates miRNA/siRNA efficiency
Chen, Cheng; Zhu, Changhong; Huang, Jian; Zhao, Xian; Deng, Rong; Zhang, Hailong; Dou, Jinzhuo; Chen, Qin; Xu, Ming; Yuan, Haihua; Wang, Yanli; Yu, Jianxiu
2015-01-01
Small RNA-induced gene silencing is essential for post-transcriptional regulation of gene expression; however, it remains unclear how miRNA/siRNA efficiency is regulated. Here we show that TARBP2 is SUMOylated at K52, which can be enhanced by its phosphorylation. This modification can stabilize TARBP2 via repressing its K48-linked ubiquitination. We find that TARBP2 SUMOylation does not influence the overall production of mature miRNAs, but it regulates miRNA/siRNA efficiency. SUMOylated TARBP2 recruits Ago2 to constitute the RNA-induced silencing complex (RISC)-loading complex (RLC), and simultaneously promotes more pre-miRNAs to load into the RLC. Consequently, Ago2 is stabilized and miRNAs/siRNAs bound by TARBP2/Dicer is effectively transferred to Ago2. Thus, these processes lead to the formation of the effective RISC for RNA interference (RNAi). Collectively, our data suggest that SUMOylation of TARBP2 is required for regulating miRNA/siRNA efficiency, which is a general mechanism of miRNA/siRNA regulation. PMID:26582366
Expanded RNA-binding activities of mammalian Argonaute 2
Tan, Grace S.; Garchow, Barry G.; Liu, Xuhang; Yeung, Jennifer; Morris, John P.; Cuellar, Trinna L.; McManus, Michael T.; Kiriakidou, Marianthi
2009-01-01
Mammalian Argonaute 2 (Ago2) protein associates with microRNAs (miRNAs) or small interfering RNAs (siRNAs) forming RNA-induced silencing complexes (RISCs/miRNPs). In the present work, we characterize the RNA-binding and nucleolytic activity of recombinant mouse Ago2. Our studies show that recombinant mouse Ago2 binds efficiently to miRNAs forming active RISC. Surprisingly, we find that recombinant mouse Ago2 forms active RISC using pre-miRNAs or long unstructured single stranded RNAs as guides. Furthermore, we demonstrate that, in vivo, endogenous human Ago2 binds directly to pre-miRNAs independently of Dicer, and that Ago2:pre-miRNA complexes are found both in the cytoplasm and in the nucleus of human cells. PMID:19808937
Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A
2017-02-01
RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.
Pompey, Justine M; Foda, Bardees; Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.
Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway. PMID:26230096
Zhang, Huiyong; Zhao, Xin; Li, Jigang; Cai, Huaqing; Deng, Xing Wang; Li, Lei
2014-01-01
Light and copper are important environmental determinants of plant growth and development. Despite the wealth of knowledge on both light and copper signaling, the molecular mechanisms that integrate the two pathways remain poorly understood. Here, we use Arabidopsis thaliana to demonstrate an interaction between SQUAMOSA PROMOTER BINDING PROTEIN-LIKE7 (SPL7) and ELONGATED HYPOCOTYL5 (HY5), which mediate copper and light signaling, respectively. Through whole-genome chromatin immunoprecipitation and RNA sequencing analyses, we elucidated the SPL7 regulon and compared it with that of HY5. We found that the two transcription factors coregulate many genes, including those involved in anthocyanin accumulation and photosynthesis. Moreover, SPL7 and HY5 act coordinately to transcriptionally regulate MIR408, which results in differential expression of microRNA408 (miR408) and its target genes in response to changing light and copper conditions. We demonstrate that this regulation is tied to copper allocation to the chloroplast and plastocyanin levels. Finally, we found that constitutively activated miR408 rescues the distinct developmental defects of the hy5, spl7, and hy5 spl7 mutants. These findings revealed the existence of crosstalk between light and copper, mediated by a HY5-SPL7 network. Furthermore, integration of transcriptional and posttranscriptional regulation is critical for governing proper metabolism and development in response to combined copper and light signaling. PMID:25516599
Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin
2016-07-08
Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.
Analysis of Tyman green detection system based on polarization interference
NASA Astrophysics Data System (ADS)
Huang, Yaolin; Wang, Min; Shao, Xiaoping; Kou, Yuanfeng
2018-02-01
The optical surface deviation of the lens can directly affect the quality of the optical system.In order to effectively and accurately detect the surface shape, an optical surface on-line detection system based on polarization interference technology is designed and developed. The system is based on Tyman-Green interference optical path, join the polarization interference measuring technology. Based on the theoretical derivation of the optical path and the ZEMAX software simulation, the experimental optical path is constructed. The parallel light is used to detect the concave lens. The parallel light is used as the light source, the size of the polarization splitting prism, detection radius of curvature, the relations between and among the size of the lens aperture, a detection range is given.
He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi
2009-02-01
The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight
Structurally complex and highly active RNA ligases derived from random RNA sequences
NASA Technical Reports Server (NTRS)
Ekland, E. H.; Szostak, J. W.; Bartel, D. P.
1995-01-01
Seven families of RNA ligases, previously isolated from random RNA sequences, fall into three classes on the basis of secondary structure and regiospecificity of ligation. Two of the three classes of ribozymes have been engineered to act as true enzymes, catalyzing the multiple-turnover transformation of substrates into products. The most complex of these ribozymes has a minimal catalytic domain of 93 nucleotides. An optimized version of this ribozyme has a kcat exceeding one per second, a value far greater than that of most natural RNA catalysts and approaching that of comparable protein enzymes. The fact that such a large and complex ligase emerged from a very limited sampling of sequence space implies the existence of a large number of distinct RNA structures of equivalent complexity and activity.
RNA interference of GhPEPC2 enhanced seed oil accumulation and salt tolerance in Upland cotton.
Zhao, Yanpeng; Huang, Yi; Wang, Yumei; Cui, Yupeng; Liu, Zhengjie; Hua, Jinping
2018-06-01
Phosphoenolpyruvate carboxylase (PEPCase) mainly produces oxaloacetic acid for tricarboxylic acid (TCA) cycle. Here we reported that GhPEPC2 silencing with PEPC2-RNAi vector could regulate oil and protein accumulation in cottonseeds. In GhPEPC2 transgenic plants, PEPCase activities in immature embryos were significantly reduced, and the oil content in seed kernel was increased 7.3 percentages, whereas total proteins decreased 5.65 percentages. Compared to wild type, agronomical traits of transgenic plant were obviously unaffected. Furthermore, gene expression profile of GhPEPC2 transgenic seeds were investigated using RNA-seq, most lipid synthesis related genes were up-regulated, but amino acid metabolic related genes were down-regulated. In addition, the GhPEPC2 transgenic cotton seedlings were stressed using sodium salts at seedling stage, and the salt tolerance was significantly enhanced. Our observations of GhPEPC2 in cotton would shade light on understanding the regulation of oil content, protein accumulation and salt tolerance enhancement in other plants. Copyright © 2018 Elsevier B.V. All rights reserved.
Misinterpreting the therapeutic effects of small interfering RNA caused by immune stimulation.
Robbins, Marjorie; Judge, Adam; Ambegia, Ellen; Choi, Catherine; Yaworski, Ed; Palmer, Lorne; McClintock, Kevin; MacLachlan, Ian
2008-10-01
Activation of innate immunity has direct effects in modulating viral replication, tumor growth, angiogenesis, and inflammatory and other immunological processes. It is now established that unmodified siRNA can activate this innate immune response and therefore there is real potential for siRNA to elicit nonspecific therapeutic effects in a wide range of disease models. Here we demonstrate that in a murine model of influenza infection, the antiviral activity of siRNA is due primarily to immune stimulation elicited by the active siRNA duplexes and is not the result of therapeutic RNA interference (RNAi) as previously reported. We show that the misinterpretation stems from the use of a particular control green fluorescent protein (GFP) siRNA that we identify as having unusually low immunostimulatory activity compared with the active anti-influenza siRNA. Curiously, this GFP siRNA has served as a negative control for a surprising number of groups reporting therapeutic effects of siRNA. The inert immunologic profile of the GFP sequence was unique among a broad panel of published siRNAs, all of which could elicit significant interferon induction from primary immune cells. This panel included eight active siRNAs against viral, angiogenic, and oncologic targets, the reported therapeutic efficacy of which was based on comparison with the nonimmunostimulatory GFP siRNA. These results emphasize the need for researchers to anticipate, monitor, and adequately control for siRNA-mediated immune stimulation and calls into question the interpretation of numerous published reports of therapeutic RNAi in vivo. The use of chemically modified siRNA with minimal immunostimulatory capacity will help to delineate more accurately the mechanism of action underlying such studies.
van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D; Arnold, Jamie J; Cameron, Craig E; Verdaguer, Nuria; Neyts, Johan; van Kuppeveld, Frank J M
2015-03-01
The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the
van der Linden, Lonneke; Vives-Adrián, Laia; Selisko, Barbara; Ferrer-Orta, Cristina; Liu, Xinran; Lanke, Kjerstin; Ulferts, Rachel; De Palma, Armando M.; Tanchis, Federica; Goris, Nesya; Lefebvre, David; De Clercq, Kris; Leyssen, Pieter; Lacroix, Céline; Pürstinger, Gerhard; Coutard, Bruno; Canard, Bruno; Boehr, David D.; Arnold, Jamie J.; Cameron, Craig E.; Verdaguer, Nuria
2015-01-01
The genus Enterovirus of the family Picornaviridae contains many important human pathogens (e.g., poliovirus, coxsackievirus, rhinovirus, and enterovirus 71) for which no antiviral drugs are available. The viral RNA-dependent RNA polymerase is an attractive target for antiviral therapy. Nucleoside-based inhibitors have broad-spectrum activity but often exhibit off-target effects. Most non-nucleoside inhibitors (NNIs) target surface cavities, which are structurally more flexible than the nucleotide-binding pocket, and hence have a more narrow spectrum of activity and are more prone to resistance development. Here, we report a novel NNI, GPC-N114 (2,2'-[(4-chloro-1,2-phenylene)bis(oxy)]bis(5-nitro-benzonitrile)) with broad-spectrum activity against enteroviruses and cardioviruses (another genus in the picornavirus family). Surprisingly, coxsackievirus B3 (CVB3) and poliovirus displayed a high genetic barrier to resistance against GPC-N114. By contrast, EMCV, a cardiovirus, rapidly acquired resistance due to mutations in 3Dpol. In vitro polymerase activity assays showed that GPC-N114 i) inhibited the elongation activity of recombinant CVB3 and EMCV 3Dpol, (ii) had reduced activity against EMCV 3Dpol with the resistance mutations, and (iii) was most efficient in inhibiting 3Dpol when added before the RNA template-primer duplex. Elucidation of a crystal structure of the inhibitor bound to CVB3 3Dpol confirmed the RNA-binding channel as the target for GPC-N114. Docking studies of the compound into the crystal structures of the compound-resistant EMCV 3Dpol mutants suggested that the resistant phenotype is due to subtle changes that interfere with the binding of GPC-N114 but not of the RNA template-primer. In conclusion, this study presents the first NNI that targets the RNA template channel of the picornavirus polymerase and identifies a new pocket that can be used for the design of broad-spectrum inhibitors. Moreover, this study provides important new insight into the
Zhang, Wen; Chen, Jieliang; Wu, Min; Zhang, Xiaonan; Zhang, Min; Yue, Lei; Li, Yaming; Liu, Jiangxia; Li, Baocun; Shen, Fang; Wang, Yang; Bai, Lu; Protzer, Ulrike; Levrero, Massimo; Yuan, Zhenghong
2017-08-01
Chronic hepatitis B virus (HBV) infection remains a major health problem worldwide. The covalently closed circular DNA (cccDNA) minichromosome, which serves as the template for the transcription of viral RNAs, plays a key role in viral persistence. While accumulating evidence suggests that cccDNA transcription is regulated by epigenetic machinery, particularly the acetylation of cccDNA-bound histone 3 (H3) and H4, the potential contributions of histone methylation and related host factors remain obscure. Here, by screening a series of methyltransferases and demethylases, we identified protein arginine methyltransferase 5 (PRMT5) as an effective restrictor of HBV transcription and replication. In cell culture-based models for HBV infection and in liver tissues of patients with chronic HBV infection, we found that symmetric dimethylation of arginine 3 on H4 on cccDNA was a repressive marker of cccDNA transcription and was regulated by PRMT5 depending on its methyltransferase domain. Moreover, PRMT5-triggered symmetric dimethylation of arginine 3 on H4 on the cccDNA minichromosome involved an interaction with the HBV core protein and the Brg1-based human SWI/SNF chromatin remodeler, which resulted in down-regulation of the binding of RNA polymerase II to cccDNA. In addition to the inhibitory effect on cccDNA transcription, PRMT5 inhibited HBV core particle DNA production independently of its methyltransferase activity. Further study revealed that PRMT5 interfered with pregenomic RNA encapsidation by preventing its interaction with viral polymerase protein through binding to the reverse transcriptase-ribonuclease H region of polymerase, which is crucial for the polymerase-pregenomic RNA interaction. PRMT5 restricts HBV replication through a two-part mechanism including epigenetic suppression of cccDNA transcription and interference with pregenomic RNA encapsidation; these findings improve the understanding of epigenetic regulation of HBV transcription and host
Structural architecture of the human long non-coding RNA, steroid receptor RNA activator
Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.
2012-01-01
While functional roles of several long non-coding RNAs (lncRNAs) have been determined, the molecular mechanisms are not well understood. Here, we report the first experimentally derived secondary structure of a human lncRNA, the steroid receptor RNA activator (SRA), 0.87 kB in size. The SRA RNA is a non-coding RNA that coactivates several human sex hormone receptors and is strongly associated with breast cancer. Coding isoforms of SRA are also expressed to produce proteins, making the SRA gene a unique bifunctional system. Our experimental findings (SHAPE, in-line, DMS and RNase V1 probing) reveal that this lncRNA has a complex structural organization, consisting of four domains, with a variety of secondary structure elements. We examine the coevolution of the SRA gene at the RNA structure and protein structure levels using comparative sequence analysis across vertebrates. Rapid evolutionary stabilization of RNA structure, combined with frame-disrupting mutations in conserved regions, suggests that evolutionary pressure preserves the RNA structural core rather than its translational product. We perform similar experiments on alternatively spliced SRA isoforms to assess their structural features. PMID:22362738
Xu, Min; Xu, Guiping; Yang, Yang
2016-01-01
Understanding how the nature of interference might influence the recruitments of the neural systems is considered as the key to understanding cognitive control. Although, interference processing in the emotional domain has recently attracted great interest, the question of whether there are separable neural patterns for emotional and non-emotional interference processing remains open. Here, we performed an activation likelihood estimation meta-analysis of 78 neuroimaging experiments, and examined common and distinct neural systems for emotional and non-emotional interference processing. We examined brain activation in three domains of interference processing: emotional verbal interference in the face-word conflict task, non-emotional verbal interference in the color-word Stroop task, and non-emotional spatial interference in the Simon, SRC and Flanker tasks. Our results show that the dorsal anterior cingulate cortex (ACC) was recruited for both emotional and non-emotional interference. In addition, the right anterior insula, presupplementary motor area (pre-SMA), and right inferior frontal gyrus (IFG) were activated by interference processing across both emotional and non-emotional domains. In light of these results, we propose that the anterior insular cortex may serve to integrate information from different dimensions and work together with the dorsal ACC to detect and monitor conflicts, whereas pre-SMA and right IFG may be recruited to inhibit inappropriate responses. In contrast, the dorsolateral prefrontal cortex (DLPFC) and posterior parietal cortex (PPC) showed different degrees of activation and distinct lateralization patterns for different processing domains, which suggests that these regions may implement cognitive control based on the specific task requirements. PMID:27895564
High-Throughput RNA Interference Screening: Tricks of the Trade
Nebane, N. Miranda; Coric, Tatjana; Whig, Kanupriya; McKellip, Sara; Woods, LaKeisha; Sosa, Melinda; Sheppard, Russell; Rasmussen, Lynn; Bjornsti, Mary-Ann; White, E. Lucile
2016-01-01
The process of validating an assay for high-throughput screening (HTS) involves identifying sources of variability and developing procedures that minimize the variability at each step in the protocol. The goal is to produce a robust and reproducible assay with good metrics. In all good cell-based assays, this means coefficient of variation (CV) values of less than 10% and a signal window of fivefold or greater. HTS assays are usually evaluated using Z′ factor, which incorporates both standard deviation and signal window. A Z′ factor value of 0.5 or higher is acceptable for HTS. We used a standard HTS validation procedure in developing small interfering RNA (siRNA) screening technology at the HTS center at Southern Research. Initially, our assay performance was similar to published screens, with CV values greater than 10% and Z′ factor values of 0.51 ± 0.16 (average ± standard deviation). After optimizing the siRNA assay, we got CV values averaging 7.2% and a robust Z′ factor value of 0.78 ± 0.06 (average ± standard deviation). We present an overview of the problems encountered in developing this whole-genome siRNA screening program at Southern Research and how equipment optimization led to improved data quality. PMID:23616418
Brüning, Anika; Hölker, Franz; Franke, Steffen; Kleiner, Wibke; Kloas, Werner
2018-02-01
In this study we investigated the influence of artificial light at night (ALAN) of different intensities (0, 1, 10, 100 lx) and different colours (blue, green, red) on the daily melatonin rhythm and mRNA expression of gonadotropins in roach Rutilus rutilus, a ubiquitous cyprinid, which occur in standing and moderately flowing freshwater habitats of central Europe. Melatonin concentrations were significantly lowered under nocturnal white light already at 1 lx. Low intensity blue, green and red ALAN lowered the melatonin levels significantly in comparison to a dark control. We conclude that ALAN can disturb melatonin rhythms in roach at very low intensities and at different wavelengths and thus light pollution in urban waters has the potential to impact biological rhythms in fish. However, mRNA expression of gonadotropins was not affected by ALAN during the period of the experiments. Thus, suspected implications of ALAN on reproduction of roach could not be substantiated.
DsRNA as a stimulator of cell pacemaker activity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Airapetyan, S.N.; Zakharyan, R.A.; Rychkov, G.E.
1986-03-01
The authors study the action of double-stranded RNAs (dsRNA) on the characteristics of neuron pacemaker activity which permits prediction of the character of action of dsRNA on the pacemaker activity of cells and organs, and takes the investigators closer to an understanding of the membrane mechanisms underlying the action of dsRNA on the cell. The methods for isolating and fractionating dsRNA from yeasts and the intracellular recording of the electrical activity of the snail giant neuron have been described by the authors earlier. The authors determined the dependence of Ca/sup 2 +/ entry upon dsRNA concentration using the isotope /supmore » 45/Ca. Preweighed ganglia were incubated five each for an hour in 2 ml Ringer's solution containing dsRNA and 5 microliters /sup 45/CaCl/sub 2/ of 12.5 mCi activity. After incubation, the ganglia were rinsed three times for 8 min each time in normal Ringers solution. The washed ganglia were dissolved for one day in KOH. The amount of isotope entering was counted using Brav's scintillator and an RGT counter tuned to the /sup 45/Ca isotope. The physiological saline used for the isolated ganglion contained 85 mmole NaCl, 4 mmole KCl, 8 mmole CaCl/sub 2/, 10 mmole MgCl/sub 2/, 10 mmole Tris-HCl, and 5 mmole glucose.« less
Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics
Hong, Cheol Am; Nam, Yoon Sung
2014-01-01
Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170
Xiang, Ming; Grove, Julian; Giannakidou, Anastasia
2013-01-01
Previous psycholinguistics studies have shown that when forming a long distance dependency in online processing, the parser sometimes accepts a sentence even though the required grammatical constraints are only partially met. A mechanistic account of how such errors arise sheds light on both the underlying linguistic representations involved and the processing mechanisms that put such representations together. In the current study, we contrast the negative polarity items (NPI) interference effect, as shown by the acceptance of an ungrammatical sentence like "The bills that democratic senators have voted for will ever become law," with the well-known phenomenon of agreement attraction ("The key to the cabinets are … "). On the surface, these two types of errors look alike and thereby can be explained as being driven by the same source: similarity based memory interference. However, we argue that the linguistic representations involved in NPI licensing are substantially different from those of subject-verb agreement, and therefore the interference effects in each domain potentially arise from distinct sources. In particular, we show that NPI interference at least partially arises from pragmatic inferences. In a self-paced reading study with an acceptability judgment task, we showed NPI interference was modulated by participants' general pragmatic communicative skills, as quantified by the Autism-Spectrum Quotient (AQ, Baron-Cohen et al., 2001), especially in offline tasks. Participants with more autistic traits were actually less prone to the NPI interference effect than those with fewer autistic traits. This result contrasted with agreement attraction conditions, which were not influenced by individual pragmatic skill differences. We also show that different NPI licensors seem to have distinct interference profiles. We discuss two kinds of interference effects for NPI licensing: memory-retrieval based and pragmatically triggered.
Xiang, Ming; Grove, Julian; Giannakidou, Anastasia
2013-01-01
Previous psycholinguistics studies have shown that when forming a long distance dependency in online processing, the parser sometimes accepts a sentence even though the required grammatical constraints are only partially met. A mechanistic account of how such errors arise sheds light on both the underlying linguistic representations involved and the processing mechanisms that put such representations together. In the current study, we contrast the negative polarity items (NPI) interference effect, as shown by the acceptance of an ungrammatical sentence like “The bills that democratic senators have voted for will ever become law,” with the well-known phenomenon of agreement attraction (“The key to the cabinets are … ”). On the surface, these two types of errors look alike and thereby can be explained as being driven by the same source: similarity based memory interference. However, we argue that the linguistic representations involved in NPI licensing are substantially different from those of subject-verb agreement, and therefore the interference effects in each domain potentially arise from distinct sources. In particular, we show that NPI interference at least partially arises from pragmatic inferences. In a self-paced reading study with an acceptability judgment task, we showed NPI interference was modulated by participants' general pragmatic communicative skills, as quantified by the Autism-Spectrum Quotient (AQ, Baron-Cohen et al., 2001), especially in offline tasks. Participants with more autistic traits were actually less prone to the NPI interference effect than those with fewer autistic traits. This result contrasted with agreement attraction conditions, which were not influenced by individual pragmatic skill differences. We also show that different NPI licensors seem to have distinct interference profiles. We discuss two kinds of interference effects for NPI licensing: memory-retrieval based and pragmatically triggered. PMID:24109468
Recombinant DHX33 Protein Possesses Dual DNA/RNA Helicase Activity.
Wang, Xingshun; Ge, Wei; Zhang, Yandong
2018-06-13
RNA helicase DHX33 has been shown to participate in a variety of cellular activities, including ribosome biogenesis, protein translation, and gene transcription. We and others further discovered that DHX33 is strongly expressed in several types of human cancers and plays important roles in promoting cancer cell proliferation. To better understand the molecular mechanism for DHX33 in exerting its biological functions, we purified recombinant DHX33 and performed biochemical studies in vitro. DHX33 protein was found to have ATPase activity that is dependent on DNA or RNA duplexes. The ATPase activity of DHX33 is coupled with its RNA/DNA unwinding activity. If a key residue in the ATP binding site were mutated, the mutant DHX33 could not unwind DNA/RNA duplexes. Furthermore, a deletion mutant of a RKK motif previously identified to be involved in ribosome DNA binding could still unwind DNA duplexes, albeit with reduced efficiency. In summary, our study reveals that purified DHX33 protein possesses unwinding activity toward DNA and RNA duplexes.
Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K
1999-01-01
We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070
Chen, Y; Redinbaugh, M G; Michel, A P
2015-06-01
Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Zhichao; Wu, Shuang; Liu, Bo, E-mail: lbo@tongji.edu.cn
2015-06-15
Soft-X-ray interference lithography is utilized in combination with atomic layer deposition to prepare photonic crystal structures on the surface of Bi{sub 4}Ge{sub 3}O{sub 12} (BGO) scintillator in order to extract the light otherwise trapped in the internal of scintillator due to total internal reflection. An enhancement with wavelength- and emergence angle-integration by 95.1% has been achieved. This method is advantageous to fabricate photonic crystal structures with large-area and high-index-contrast which enable a high-efficient coupling of evanescent field and the photonic crystal structures. Generally, the method demonstrated in this work is also suitable for many other light emitting devices where amore » large-area is required in the practical applications.« less
Common ground: small RNA programming and chromatin modifications.
Lejeune, Erwan; Allshire, Robin C
2011-06-01
Epigenetic mechanisms regulate genome structure and expression profiles in eukaryotes. RNA interference (RNAi) and other small RNA-based chromatin-modifying activities can act to reset the epigenetic landscape at defined chromatin domains. Centromeric heterochromatin assembly is a RNAi-dependent process in the fission yeast Schizosaccharomyces pombe, and provides a paradigm for detailed examination of such epigenetic processes. Here we review recent progress in understanding the mechanisms that underpin RNAi-mediated heterochromatin formation in S. pombe. We discuss recent analyses of the events that trigger RNAi and manipulations which uncouple RNAi and chromatin modification. Finally we provide an overview of similar molecular machineries across species where related small RNA pathways appear to drive the epigenetic reprogramming in germ cells and/or during early development in metazoans. Copyright © 2011 Elsevier Ltd. All rights reserved.
Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly
2015-01-01
Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3’untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3’ UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3’UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3’UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3’ UTRs. Additionally, the inhibition of packaging in-trans with inhibitory
Fajardo, Teodoro; Sung, Po-Yu; Roy, Polly
2015-12-01
Bluetongue virus (BTV) causes hemorrhagic disease in economically important livestock. The BTV genome is organized into ten discrete double-stranded RNA molecules (S1-S10) which have been suggested to follow a sequential packaging pathway from smallest to largest segment during virus capsid assembly. To substantiate and extend these studies, we have investigated the RNA sorting and packaging mechanisms with a new experimental approach using inhibitory oligonucleotides. Putative packaging signals present in the 3'untranslated regions of BTV segments were targeted by a number of nuclease resistant oligoribonucleotides (ORNs) and their effects on virus replication in cell culture were assessed. ORNs complementary to the 3' UTR of BTV RNAs significantly inhibited virus replication without affecting protein synthesis. Same ORNs were found to inhibit complex formation when added to a novel RNA-RNA interaction assay which measured the formation of supramolecular complexes between and among different RNA segments. ORNs targeting the 3'UTR of BTV segment 10, the smallest RNA segment, were shown to be the most potent and deletions or substitution mutations of the targeted sequences diminished the RNA complexes and abolished the recovery of viable viruses using reverse genetics. Cell-free capsid assembly/RNA packaging assay also confirmed that the inhibitory ORNs could interfere with RNA packaging and further substitution mutations within the putative RNA packaging sequence have identified the recognition sequence concerned. Exchange of 3'UTR between segments have further demonstrated that RNA recognition was segment specific, most likely acting as part of the secondary structure of the entire genomic segment. Our data confirm that genome packaging in this segmented dsRNA virus occurs via the formation of supramolecular complexes formed by the interaction of specific sequences located in the 3' UTRs. Additionally, the inhibition of packaging in-trans with inhibitory ORNs
Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo
2017-04-01
RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role
Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G
2010-04-01
Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for
Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing
2016-01-01
Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .
An Experimental Study of Interference between Receptive and Productive Processes Involving Speech
ERIC Educational Resources Information Center
Goldman-Eisler, Frieda; Cohen, Michele
1975-01-01
Reports an experiment designed to throw light on the interference between the reception and production of speech by controlling the level of interference between decoding and encoding, using hesitancy as an indicator of interference. This proved effective in spotting the levels at which interference takes place. (Author/RM)
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.
Pulk, Arto; Maiväli, Ulo; Remme, Jaanus
2006-05-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association
Pulk, Arto; Maiväli, Ülo; Remme, Jaanus
2006-01-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933
2007-02-05
lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme
Gandhi, Nishant S.; Tekade, Rakesh K.; Chougule, Mahavir B.
2014-01-01
Chemotherapeutic agents have certain limitations when it comes to treating cancer, the most important being severe side effects along with multidrug resistance developed against them. Tumor cells exhibits drug resistance due to activation of various cellular level processes viz. activation of drug efflux pumps, anti-apoptotic defense mechanisms etc. Currently, RNA interference (RNAi) based therapeutic approaches are under vibrant scrutinization to seek cancer cure. Especially small interfering RNA (siRNA) and micro RNA (miRNA), are able to knock down the carcinogenic genes by targeting the mRNA expression, which underlies the uniqueness of this therapeutic approach. Recent research focus in the regime of cancer therapy involves the engagement of targeted delivery of siRNA/miRNA in combinations with other therapeutic agents (such as gene, DNA or chemotherapeutic drug) for targeting permeability glycoprotein (P-gp), Multidrug resistant protein 1(MRP-1), B-cell lymphoma (BCL-2) and other targets that are mainly responsible for resistance in cancer therapy. RNAi-chemotherapeutic drug combinations have also been found to be effective against different molecular targets as well and can increase the sensitization of cancer cells to therapy several folds. However, due to stability issues associated with siRNA/miRNA suitable protective carrier is needed and nanotechnology based approaches have been widely explored to overcome these drawbacks. Furthermore, it has been univocally advocated that the co-delivery of siRNA/miRNA with other chemodrugs significantly enhances their capability to overcome cancer resistance compared to naked counterparts. The objective of this article is to review recent nanocarrier based approaches adopted for the delivery of siRNA/miRNA combinations with other anticancer agents (siRNA/miRNA/pDNA/chemodrugs) to treat cancer. PMID:25204288
Gandhi, Nishant S; Tekade, Rakesh K; Chougule, Mahavir B
2014-11-28
Chemotherapeutic agents have certain limitations when it comes to treating cancer, the most important being severe side effects along with multidrug resistance developed against them. Tumor cells exhibit drug resistance due to activation of various cellular level processes viz. activation of drug efflux pumps, anti-apoptotic defense mechanisms, etc. Currently, RNA interference (RNAi) based therapeutic approaches are under vibrant scrutinization to seek cancer cure. Especially small interfering RNA (siRNA) and micro RNA (miRNA), are able to knock down the carcinogenic genes by targeting the mRNA expression, which underlies the uniqueness of this therapeutic approach. Recent research focus in the regime of cancer therapy involves the engagement of targeted delivery of siRNA/miRNA in combinations with other therapeutic agents (such as gene, DNA or chemotherapeutic drug) for targeting permeability glycoprotein (P-gp), multidrug resistant protein 1 (MRP-1), B-cell lymphoma (BCL-2) and other targets that are mainly responsible for resistance in cancer therapy. RNAi-chemotherapeutic drug combinations have also been found to be effective against different molecular targets as well and can increase the sensitization of cancer cells to therapy several folds. However, due to stability issues associated with siRNA/miRNA suitable protective carrier is needed and nanotechnology based approaches have been widely explored to overcome these drawbacks. Furthermore, it has been univocally advocated that the co-delivery of siRNA/miRNA with other chemodrugs significantly enhances their capability to overcome cancer resistance compared to naked counterparts. The objective of this article is to review recent nanocarrier based approaches adopted for the delivery of siRNA/miRNA combinations with other anticancer agents (siRNA/miRNA/pDNA/chemodrugs) to treat cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor
2016-01-01
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2016-07-12
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.
Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W
2004-01-01
We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.
Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil
2017-11-01
The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin
Understanding interference experiments with polarized light through photon trajectories
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sanz, A.S.; Davidovic, M.; Bozic, M.
2010-04-15
Bohmian mechanics allows to visualize and understand the quantum-mechanical behavior of massive particles in terms of trajectories. As shown by Bialynicki-Birula, Electromagnetism also admits a hydrodynamical formulation when the existence of a wave function for photons (properly defined) is assumed. This formulation thus provides an alternative interpretation of optical phenomena in terms of photon trajectories, whose flow yields a pictorial view of the evolution of the electromagnetic energy density in configuration space. This trajectory-based theoretical framework is considered here to study and analyze the outcome from Young-type diffraction experiments within the context of the Arago-Fresnel laws. More specifically, photon trajectoriesmore » in the region behind the two slits are obtained in the case where the slits are illuminated by a polarized monochromatic plane wave. Expressions to determine electromagnetic energy flow lines and photon trajectories within this scenario are provided, as well as a procedure to compute them in the particular case of gratings totally transparent inside the slits and completely absorbing outside them. As is shown, the electromagnetic energy flow lines obtained allow to monitor at each point of space the behavior of the electromagnetic energy flow and, therefore, to evaluate the effects caused on it by the presence (right behind each slit) of polarizers with the same or different polarization axes. This leads to a trajectory-based picture of the Arago-Fresnel laws for the interference of polarized light.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Witkin, E M
1961-12-01
Post treatment with basic dyes, in concentrations that retard cell division, was found to influence the tnduction of mutations to prototrophy by UV light in a tyrosine-requirtng strain of E.Coli. Pyronin, which is unique among the dyes in tts selective affinity for RNA, was found to duplicate the effects of chloramphenicol or amino acfd deprtvatfon in causfng the rapid and irreversible loss of potential prototrophs (mutation frequency decline, or MFD). Acriflavtne, methyl green. crystal violet, methylene blue, and toluidine blue, all of which are known to combine with DNA, delay or retard the occurrence of MFD under conditions of aminomore » acid deprivation. When acriflavine is removed from its combination with cellular components by the addition of an excess of sodium deoxyrtbonucleate, MFD begins promptly. The same basic dyes that delay MFD were also found to interfere with the fixation of mutations (MF) in an amino acid- enriched medium, and to cause marked enhancement of the mutagenic potency of low doses of UV light. While showing no independent mutagenic activity for unirradiated bacteria, all the dyes except pyronin increased the yield of induced mutations signtficantly when added to the enriched medium upon which trradiated bacteria were incubated.These results were interpreted as evidence that UV light initiates mutagenesis by producing unstable changas directly in genic DNA. MFD is interpreted as a repair process, blocked by the machinery of RNA and protein synthesis and by the presence of certain basic dyes.« less
Nano-cone optical fiber array sensors for MiRNA profiling
NASA Astrophysics Data System (ADS)
Wang, Yunshan; Senapati, Satyajyoti; Stoddart, Paul; Howard, Scott; Chang, Hsueh-Chia
2013-09-01
Up/down regulation of microRNA panels has been correlated to cardiovascular diseases and cancer. Frequent miRNA profiling at home can hence allow early cancer diagnosis and home-use chronic disease monitoring, thus reducing both mortality rate and healthcare cost. However, lifetime of miRNAs is less than 1 hour without preservation and their concentrations range from pM to mM. Despite rapid progress in the last decade, modern nucleic acid analysis methods still do not allow personalized miRNA profiling---Real-time PCR and DNA micro-array both require elaborate miRNA preservation steps and expensive equipment and nano pore sensors cannot selectively quantify a large panel with a large dynamic range. We report a novel and low-cost optical fiber sensing platform, which has the potential to profile a panel of miRNA with simple LED light sources and detectors. The individual tips of an optical imaging fiber bundle (mm in diameter with 7000 fiber cores) were etched into cones with 10 nm radius of curvature and coated with Au. FRET (Forster Resonant Energy Transfer) hairpin oligo probes, with the loop complementary to a specific miRNA that can release the hairpin, were functionalized onto the conic tips. Exciting light in the optical fiber waveguide is optimally coupled to surface plasmonics on the gold surface, which then converges to the conic tips with two orders of magnitude enhancement in intensity. Unlike nanoparticle plasmonics, tip plasmonics can be excited over a large band width and hence the plasmonic enhanced fluorescence signal of the FRET reporter is also focused towards the tip--- and is further enhanced with the periodic resonant grid of the fiber array which gives rise to pronounced standing wave interference patterns. Multiplexing is realized by functionalizing different probes onto one fiber bundle using a photoactivation process.
Thin-film thickness measurement method based on the reflection interference spectrum
NASA Astrophysics Data System (ADS)
Jiang, Li Na; Feng, Gao; Shu, Zhang
2012-09-01
A method is introduced to measure the thin-film thickness, refractive index and other optical constants. When a beam of white light shines on the surface of the sample film, the reflected lights of the upper and the lower surface of the thin-film will interfere with each other and reflectivity of the film will fluctuate with light wavelength. The reflection interference spectrum is analyzed with software according to the database, while the thickness and refractive index of the thin-film is measured.