Sample records for linear triatomic molecules

  1. Structure and thermodynamics of asymmetric molecules: Application to linear triatomic dipolar molecules

    NASA Astrophysics Data System (ADS)

    Nichols, Albert L., III; Calef, Daniel F.

    A new method to solve the reference HNC equations is developed to treat systems with both asymmetric short-range and long-range interactions. This method is motivated by the work of Patey and co-workers and uses Lado's free-energy minimizing optimization criteria for the reference HNC approximation. The properties of several fluids composed of linear triatomic molecules with various dipole moments or hard-sphere molecules with different-length dipoles are investigated.

  2. Li2O (LiOLi)

    NASA Astrophysics Data System (ADS)

    Guelachvili, G.

    This document is part of Subvolume B `Linear Triatomic Molecules', Part 9, of Volume 20 `Molecular Constants mostly from Infrared Spectroscopy' of Landolt-Börnstein Group II `Molecules and Radicals'.

  3. Site-specific recoil-induced effects on inner-shell photoionization of linear triatomic molecules: N 1 s photoelectron spectra of N2 O

    NASA Astrophysics Data System (ADS)

    Krivosenko, Yu. S.; Pavlychev, A. A.

    2016-11-01

    We investigate hard X-ray ionization of linear triatomic molecules accenting recoil-induced effects on the dynamics of molecular frame. This dynamics is studied within the two-springs and harmonic approximations. The mode-channel relationship connecting the excitations of vibrational, rotational and translational degrees of freedom with the Σ → Σ and Σ → Π photoionization channels is applied to compute the N 1s-1 photoelectron spectra of molecular N2 O for various photon energies. The distinct ionized-site- and molecular-orientation-specific changes in the vibration structure of the 1 s photoelectron lines of terminal and central nitrogen atoms are revealed and discussed.

  4. Time-dependent local-to-normal mode transition in triatomic molecules

    NASA Astrophysics Data System (ADS)

    Cruz, Hans; Bermúdez-Montaña, Marisol; Lemus, Renato

    2018-01-01

    Time-evolution of the vibrational states of two interacting harmonic oscillators in the local mode scheme is presented. A local-to-normal mode transition (LNT) is identified and studied from temporal perspective through time-dependent frequencies of the oscillators. The LNT is established as a polyad-breaking phenomenon from the local standpoint for the stretching degrees of freedom in a triatomic molecule. This study is carried out in the algebraic representation of bosonic operators. The dynamics of the states are determined via the solutions of the corresponding nonlinear Ermakov equation and a local time-dependent polyad is obtained as a tool to identify the LNT. Applications of this formalism to H2O, CO2, O3 and NO2 molecules in the adiabatic, sudden and linear regime are considered.

  5. Table 137. H2 16O (H16OH): Line position and intensity for rotational transitions (060)-(060) in the range 757-934 cm-1

    NASA Astrophysics Data System (ADS)

    Guelachvili, G.; Picqué, N.

    This document is part of Subvolume C 'Non-linear Triatomic Molecules', Part 1 'H2O (HOH)', Part α'H2 16O (H16OH)' of Volume 20 'Molecular Constants Mostly from Infrared Spectroscopy' of Landolt-Börnstein - Group II 'Molecules and Radicals'.

  6. Computer program to simulate Raman scattering

    NASA Technical Reports Server (NTRS)

    Zilles, B.; Carter, R.

    1977-01-01

    A computer program is described for simulating the vibration-rotation and pure rotational spectrum of a combustion system consisting of various diatomic molecules and CO2 as a function of temperature and number density. Two kinds of spectra are generated: a pure rotational spectrum for any mixture of diatomic and linear triatomic molecules, and a vibrational spectrum for diatomic molecules. The program is designed to accept independent rotational and vibrational temperatures for each molecule, as well as number densities.

  7. Structures, Bonding, and Energetics of Potential Triatomic Circumstellar Molecules Containing Group 15 and 16 Elements.

    PubMed

    Turner, Walter E; Agarwal, Jay; Schaefer, Henry F

    2015-12-03

    The recent discovery of PN in the oxygen-rich shell of the supergiant star VY Canis Majoris points to the formation of several triatomic molecules involving oxygen, nitrogen, and phosphorus; these are also intriguing targets for main-group synthetic inorganic chemistry. In this research, high-level ab initio electronic structure computations were conducted on the potential circumstellar molecule OPN and several of its heavier group 15 and 16 congeners (SPN, SePN, TePN, OPP, OPAs, and OPSb). For each congener, four isomers were examined. Optimized geometries were obtained with coupled cluster theory [CCSD(T)] using large Dunning basis sets [aug-cc-pVQZ, aug-cc-pV(Q+d)Z, and aug-cc-pVQZ-PP], and relative energies were determined at the complete basis set limit of CCSDT(Q) from focal point analyses. The linear phosphorus-centered molecules were consistently the lowest in energy of the group 15 congeners by at least 6 kcal mol(-1), resulting from double-triple and single-double bond resonances within the molecule. The linear nitrogen-centered molecules were consistently the lowest in energy of the group 16 congeners by at least 5 kcal mol(-1), due to the electronegative central nitrogen atom encouraging electron delocalization throughout the molecule. For OPN, OPP, and SPN, anharmonic vibrational frequencies and vibrationally corrected rotational constants are predicted; good agreement with available experimental data is observed.

  8. Triatomic Spectral Database

    National Institute of Standards and Technology Data Gateway

    SRD 117 Triatomic Spectral Database (Web, free access)   All of the rotational spectral lines observed and reported in the open literature for 55 triatomic molecules have been tabulated. The isotopic molecular species, assigned quantum numbers, observed frequency, estimated measurement uncertainty and reference are given for each transition reported.

  9. Mass-Related Dynamical Barriers in Triatomic Reactions

    NASA Astrophysics Data System (ADS)

    Yanao, T.; Koon, W. S.; Marsden, J. E.

    2006-06-01

    A methodology is given to determine the effect of different mass distributions for triatomic reactions using the geometry of shape space. Atomic masses are incorporated into the non-Euclidean shape space metric after the separation of rotations. Using the equations of motion in this non-Euclidean shape space, an averaged field of velocity-dependent fictitious forces is determined. This force field, as opposed to the force arising from the potential, dominates branching ratios of isomerization dynamics of a triatomic molecule. This methodology may be useful for qualitative prediction of branching ratios in general triatomic reactions.

  10. Global bending quantum number and the absence of monodromy in the HCN{r_reversible}CNH molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Efstathiou, K.; Sadovskii, D.A.; Joyeux, M.

    We introduce and analyze a model system based on a deformation of a spherical pendulum that can be used to reproduce large amplitude bending vibrations of flexible triatomic molecules with two stable linear equilibria. On the basis of our model and the recent vibrational potential [ J. Chem. Phys. 115, 3706 (2001) ], we analyze the HCN/CNH isomerizing molecule. We find that HCN/CNH has no monodromy and introduce the second global bending quantum number for this system at all energies where the potential is expected to work. We also show that LiNC/LiCN is a qualitatively different system with monodromy.

  11. Strong-field ionization of linear molecules by a bicircular laser field: Symmetry considerations

    NASA Astrophysics Data System (ADS)

    Gazibegović-Busuladžić, A.; Busuladžić, M.; Hasović, E.; Becker, W.; Milošević, D. B.

    2018-04-01

    Using the improved molecular strong-field approximation, we investigate (high-order) above-threshold ionization [(H)ATI] of various linear polyatomic molecules by a two-color laser field of frequencies r ω and s ω (with integer numbers r and s ) having coplanar counter-rotating circularly polarized components (a so-called bicircular field). Reflection and rotational symmetries for molecules aligned in the laser-field polarization plane, analyzed for diatomic homonuclear molecules in Phys. Rev. A 95, 033411 (2017), 10.1103/PhysRevA.95.033411, are now considered for diatomic heteronuclear molecules and symmetric and asymmetric linear triatomic molecules. There are additional rotational symmetries for (H)ATI spectra of symmetric linear molecules compared to (H)ATI spectra of the asymmetric ones. It is shown that these symmetries manifest themselves differently for r +s odd and r +s even. For example, HATI spectra for symmetric molecules with r +s even obey inversion symmetry. For ATI spectra of linear molecules, reflection symmetry appears only for certain molecular orientation angles ±90∘-j r 180∘/(r +s ) (j integer). For symmetric linear molecules, reflection symmetry appears also for the angles -j r 180∘/(r +s ) . For perpendicular orientation of molecules with respect to the laser-field polarization plane, the HATI spectra are very similar to those of the atomic targets, i.e., both spectra are characterized by the same type of the (r +s )-fold symmetry.

  12. On the intramolecular origin of the blue shift of A-H stretching frequencies: triatomic hydrides HAX.

    PubMed

    Karpfen, Alfred; Kryachko, Eugene S

    2009-04-30

    A series of intermolecular complexes formed between the triatomic hydrides HAX and various interaction partners are investigated computationally aiming (1) to demonstrate that either an appearance or nonappearance of a blue shift of the A-H stretching frequency is directly related to the sign of the intramolecular coupling that exists between the two degrees of freedom, the A-H and A-X bond lengths, and (2) to offer the following conjecture: the theoretical protonation of a triatomic neutral molecule HAX at the site X is a simple and rather efficient probe of a red or blue shift that the stretching frequency nu(A-H) undergoes upon complex formation regardless of whether this bond is directly involved in hydrogen bonding or not. In other words, to predict whether this A-H bond is capable to display a blue or red shift of nu(A-H), it suffices to compare the equilibrium structures and vibrational spectra of a given molecule with its protonated counterpart. The two above goals are achieved invoking a series of 11 triatomic molecules: HNO, HSN, HPO, and HPS characterized by a negative intramolecular coupling; HON and HNS as intermediate cases; and HOF, HOCl, HCN, HNC, and HCP with a positive intramolecular coupling. For these purposes, the latter molecules are investigated at the MP2/6-311++G(2p,2d) level in the neutral and protonated HAXH(+) forms as well as their complexes with H(2)O and with the fluoromethanes H(3)CF, H(2)CF(2), and HCF(3).

  13. The Renner effect in triatomic molecules with application to CH+, MgNC and NH2.

    PubMed

    Jensen, Per; Odaka, Tina Erica; Kraemer, W P; Hirano, Tsuneo; Bunker, P R

    2002-03-01

    We have developed a computational procedure, based on the variational method, for the calculation of the rovibronic energies of a triatomic molecule in an electronic state that become degenerate at the linear nuclear configuration. In such an electronic state the coupling caused by the electronic orbital angular momentum is very significant and it is called the Renner effect. We include it, and the effect of spin-orbit coupling, in our program. We have developed the procedure to the point where spectral line intensities can be calculated so that absorption and emission spectra can be simulated. In order to gain insight into the nature of the eigenfunctions, we have introduced and calculated the overall bending probability density function f(p) of the states. By projecting the eigenfunctions onto the Born-Oppenheimer basis, we have determined the probability density functions f+(rho) and f-(rho) associated with the individual Born-Oppenheimer states phi(-)elec and phi(+)elec. At a given temperature the Boltzmann averaged value of the f(p) over all the eigenstates gives the bending probability distribution function F(rho), and this can be related to the result of a Coulomb Explosion Imaging (CEI) experiment. We review our work and apply it to the molecules CH2+, MgNC and NH2, all of which are of astrophysical interest.

  14. Imprints of the Molecular Electronic Structure in the Photoelectron Spectra of Strong-Field Ionized Asymmetric Triatomic Model Molecules

    NASA Astrophysics Data System (ADS)

    Paul, Matthias; Yue, Lun; Gräfe, Stefanie

    2018-06-01

    We examine the circular dichroism in the angular distribution of photoelectrons of triatomic model systems ionized by strong-field ionization. Following our recent work on this effect [Paul, Yue, and Gräfe, J. Mod. Opt. 64, 1104 (2017), 10.1080/09500340.2017.1299883], we demonstrate how the symmetry and electronic structure of the system is imprinted into the photoelectron momentum distribution. We use classical trajectories to reveal the origin of the threefolded pattern in the photoelectron momentum distribution, and show how an asymmetric nuclear configuration of the triatomic system effects the photoelectron spectra.

  15. Mass effects and internal space geometry in triatomic reaction dynamics

    NASA Astrophysics Data System (ADS)

    Yanao, Tomohiro; Koon, Wang S.; Marsden, Jerrold E.

    2006-05-01

    The effect of the distribution of mass in triatomic reaction dynamics is analyzed using the geometry of the associated internal space. Atomic masses are appropriately incorporated into internal coordinates as well as the associated non-Euclidean internal space metric tensor after a separation of the rotational degrees of freedom. Because of the non-Euclidean nature of the metric in the internal space, terms such as connection coefficients arise in the internal equations of motion, which act as velocity-dependent forces in a coordinate chart. By statistically averaging these terms, an effective force field is deduced, which accounts for the statistical tendency of geodesics in the internal space. This force field is shown to play a crucial role in determining mass-related branching ratios of isomerization and dissociation dynamics of a triatomic molecule. The methodology presented can be useful for qualitatively predicting branching ratios in general triatomic reactions, and may be applied to the study of isotope effects.

  16. Triatomic molecules laser-cooled

    NASA Astrophysics Data System (ADS)

    2017-06-01

    Molecules containing three atoms have been laser-cooled to ultracold temperatures for the first time. John Doyle and colleagues at Harvard University in the US used a technique called Sisyphus cooling to chill an ensemble of about a million strontium-monohydroxide molecules to 750 μK.

  17. Relationships between lattice energies of inorganic ionic solids

    NASA Astrophysics Data System (ADS)

    Kaya, Savaş

    2018-06-01

    Lattice energy, which is a measure of the stabilities of inorganic ionic solids, is the energy required to decompose a solid into its constituent independent gaseous ions. In the present work, the relationships between lattice energies of many diatomic and triatomic inorganic ionic solids are revealed and a simple rule that can be used for the prediction of the lattice energies of inorganic ionic solids is introduced. According to this rule, the lattice energy of an AB molecule can be predicted with the help of the lattice energies of AX, BY and XY molecules in agreement with the experimental data. This rule is valid for not only diatomic molecules but also triatomic molecules. The lattice energy equations proposed in this rule provides compatible results with previously published lattice energy equations by Jenkins, Kaya, Born-Lande, Born-Mayer, Kapustinskii and Reddy. For a large set of tested molecules, calculated percent standard deviation values considering experimental data and the results of the equations proposed in this work are in general between %1-2%.

  18. Vibrational excitation and dissociative attachment of a triatomic molecule: CO/sub 2/ in the collinear approximation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, C.F.; Light, J.C.

    1986-02-01

    The effective R-matrix model and the R-matrix propagative method applied earlier to elec- tron--diatomic-molecule scattering are extended to treat dissociative attachment of collinear triatomic molecules. To describe the vibrational excitation and dissociative attachment of CO/sub 2/ in the 4-eV region, the nuclear dynamics is solved on a Wall-Porter potential-energy surface. A hybrid approach is developed in which the L/sup 2/ and R-matrix propagation methods are combined to evaluate the global R matrix. Our calculations show that it is easier to excite the symmetric mode vibrations than the asymmetric mode vibrations. Our results also show that the observed structures in themore » energy dependence of the dissociative attachment cross sections are due to the vibrational states of the negative ion (CO/sub 2/ /sup -/) and not to the vibrational states of the CO fragment.« less

  19. A Triatomic Silicon(0) Cluster Stabilized by a Cyclic Alkyl(amino) Carbene.

    PubMed

    Mondal, Kartik Chandra; Roy, Sudipta; Dittrich, Birger; Andrada, Diego M; Frenking, Gernot; Roesky, Herbert W

    2016-02-24

    Reduction of the neutral carbene tetrachlorosilane adduct (cAAC)SiCl4 (cAAC=cyclic alkyl(amino) carbene :C(CMe2)2 (CH2)N(2,6-iPr2C6H3) with potassium graphite produces stable (cAAC)3Si3, a carbene-stabilized triatomic silicon(0) molecule. The Si-Si bond lengths in (cAAC)3Si3 are 2.399(8), 2.369(8) and 2.398(8) Å, which are in the range of Si-Si single bonds. Each trigonal pyramidal silicon atom of the triangular molecule (cAAC)3Si3 possesses a lone pair of electrons. Its bonding, stability, and electron density distributions were studied by quantum chemical calculations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Ro-vibronic transition intensities for triatomic molecules from the exact kinetic energy operator; electronic spectrum for the C̃ 1B2 ← X̃ 1A1 transition in SO2.

    PubMed

    Zak, Emil J; Tennyson, Jonathan

    2017-09-07

    A procedure for calculating ro-vibronic transition intensities for triatomic molecules within the Born-Oppenheimer approximation is reported. Ro-vibrational energy levels and wavefunctions are obtained with the DVR3D suite, which solves the nuclear motion problem with an exact kinetic energy operator. Absolute transition intensities are calculated both with the Franck-Condon approximation and with a full transition dipole moment surface. The theoretical scheme is tested on C̃  1 B 2  ← X̃  1 A 1 ro-vibronic transitions of SO 2 . Ab initio potential energy and dipole moment surfaces are generated for this purpose. The calculated ro-vibronic transition intensities and cross sections are compared with the available experimental and theoretical data.

  1. The kinetic energy operator for distance-dependent effective nuclear masses: Derivation for a triatomic molecule.

    PubMed

    Khoma, Mykhaylo; Jaquet, Ralph

    2017-09-21

    The kinetic energy operator for triatomic molecules with coordinate or distance-dependent nuclear masses has been derived. By combination of the chain rule method and the analysis of infinitesimal variations of molecular coordinates, a simple and general technique for the construction of the kinetic energy operator has been proposed. The asymptotic properties of the Hamiltonian have been investigated with respect to the ratio of the electron and proton mass. We have demonstrated that an ad hoc introduction of distance (and direction) dependent nuclear masses in Cartesian coordinates preserves the total rotational invariance of the problem. With the help of Wigner rotation functions, an effective Hamiltonian for nuclear motion can be derived. In the derivation, we have focused on the effective trinuclear Hamiltonian. All necessary matrix elements are given in closed analytical form. Preliminary results for the influence of non-adiabaticity on vibrational band origins are presented for H 3 + .

  2. Vibrational excitation of triatomic molecules near the shape resonance region

    NASA Astrophysics Data System (ADS)

    Ishijima, Y.; Ohkawa, M.; Hoshino, M.; Campbell, L.; Brunger, M. J.; Tanaka, H.

    2012-11-01

    In this study we have measured angular distributions of differential cross sections (DCS) for vibrational excitation and superelastic scattering from vibrationally excited N2O. The results are analyzed and interpreted using the angular correlation theory by Read.

  3. Bending wavefunctions for linear molecules

    NASA Astrophysics Data System (ADS)

    Hirano, Tsuneo; Nagashima, Umpei; Jensen, Per

    2018-01-01

    The bending motion of a linear triatomic molecule has two unique characteristics: the bending mode is doubly degenerate and only positive values of the bending angle, expressed by the bond angle supplement ρ bar , can be observed. The double degeneracy requires the wavefunction to be described as a two-dimensional oscillator. In the present work, we first review the conventional expressions based on two, symmetrically equivalent normal coordinates. Then we discuss an alternative expression for the bending wavefunction in terms of two geometrical coordinates, the bond angle supplement ρ bar (= π - τ ⩾ 0 , where τ is the bond angle) and the rotation angle χ (0 ⩽ χ < 2 π) describing rotation of the molecule around the molecular axis. In this formalism, defined for the (ρ bar , χ) polar-coordinate space with volume element ρ bar d ρ bar dχ , the one-dimensional wavefunction resulted through re-normalization for χ has zero amplitude at ρ bar = 0 , and the ro-vibrational average of the bending angle, i.e., the expectation value 〈 ρ bar 〉 , attains a non-zero, positive value for any ro-vibrational state including the vibrational ground state. This conclusion appears to cause some controversy since much conventional spectroscopic wisdom insists on 〈 ρ bar 〉 having the value zero.

  4. Precision measurements and computations of transition energies in rotationally cold triatomic hydrogen ions up to the midvisible spectral range.

    PubMed

    Pavanello, Michele; Adamowicz, Ludwik; Alijah, Alexander; Zobov, Nikolai F; Mizus, Irina I; Polyansky, Oleg L; Tennyson, Jonathan; Szidarovszky, Tamás; Császár, Attila G; Berg, Max; Petrignani, Annemieke; Wolf, Andreas

    2012-01-13

    First-principles computations and experimental measurements of transition energies are carried out for vibrational overtone lines of the triatomic hydrogen ion H(3)(+) corresponding to floppy vibrations high above the barrier to linearity. Action spectroscopy is improved to detect extremely weak visible-light spectral lines on cold trapped H(3)(+) ions. A highly accurate potential surface is obtained from variational calculations using explicitly correlated Gaussian wave function expansions. After nonadiabatic corrections, the floppy H(3)(+) vibrational spectrum is reproduced at the 0.1 cm(-1) level up to 16600 cm(-1).

  5. Selection rules for electric multipole transition of triatomic molecule in scattering experiments

    NASA Astrophysics Data System (ADS)

    Tian, Hong-Chun; Xu, Long-Quan; Zhu, Lin-Fan

    2018-04-01

    Not Available Project supported by the National Key Research and Development Program of China (Grant No. 2017YFA0402300), the National Natural Science Foundation of China (Grant No. U1732133), and the Science Fund from Chinese Academy of Sciences (Grant No. 11320101003).

  6. Underlying theory of a model for the Renner-Teller effect in tetra-atomic molecules: X(2)Πu electronic state of C2H2(+).

    PubMed

    Perić, M; Jerosimić, S; Mitić, M; Milovanović, M; Ranković, R

    2015-05-07

    In the present study, we prove the plausibility of a simple model for the Renner-Teller effect in tetra-atomic molecules with linear equilibrium geometry by ab initio calculations of the electronic energy surfaces and non-adiabatic matrix elements for the X(2)Πu state of C2H2 (+). This phenomenon is considered as a combination of the usual Renner-Teller effect, appearing in triatomic species, and a kind of the Jahn-Teller effect, similar to the original one arising in highly symmetric molecules. Only four parameters (plus the spin-orbit constant, if the spin effects are taken into account), which can be extracted from ab initio calculations carried out at five appropriate (planar) molecular geometries, are sufficient for building up the Hamiltonian matrix whose diagonalization results in the complete low-energy (bending) vibronic spectrum. The main result of the present study is the proof that the diabatization scheme, hidden beneath the apparent simplicity of the model, can safely be carried out, at small-amplitude bending vibrations, without cumbersome computation of non-adiabatic matrix elements at large number of molecular geometries.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhai, Liangjun; Zheng, Yujun, E-mail: yzheng@sdu.edu.cn

    In the present study, the dynamical behaviors of tripartite entanglement of vibrations in triatomic molecules are studied based on the Lie algebraic models of molecules. The dynamical behaviors of tripartite entanglement of the local mode molecule H{sub 2}O and normal mode molecule NO{sub 2} are comparatively studied for different initial states by employing the general concurrence. Our results show that the dynamics of tripartite entanglement are relied on the dynamics of intramolecular energy distribution. The local mode molecule is more suitable to construct the tripartite entangled states. Also, the greater degree of tripartite entanglement can be obtained if the stretchingmore » vibration is first excited. These results shed new light on the understanding of quantum multipartite entanglement of vibrations in the polyatomic molecules.« less

  8. Entropy, energy, and entanglement of localized states in bent triatomic molecules

    NASA Astrophysics Data System (ADS)

    Yuan, Qiang; Hou, Xi-Wen

    2017-05-01

    The dynamics of quantum entropy, energy, and entanglement is studied for various initial states in an important spectroscopic Hamiltonian of bent triatomic molecules H2O, D2O, and H2S. The total quantum correlation is quantified in terms of the mutual information and the entanglement by the concurrence borrowed from the theory of quantum information. The Pauli entropy and the intramolecular energy usually used in the theory of molecules are calculated to establish a possible relationship between both theories. Sections of two quantities among these four quantities are introduced to visualize such relationship. Analytic and numerical simulations demonstrate that if an initial state is taken to be the stretch- or the bend-vibrationally localized state, the mutual information, the Pauli entropy, and the concurrence are dominant-positively correlated while they are dominantly anti-correlated with the interacting energy among three anharmonic vibrational modes. In particular, such correlation is more distinct for the localized state with high excitations in the bending mode. The nice quasi-periodicity of those quantities in D2O molecule reveals that this molecule prepared in the localized state in the stretching or the bending mode can be more appreciated for molecular quantum computation. However, the dynamical correlations of those quantities behave irregularly for the dislocalized states. Moreover, the hierarchy of the mutual information and the Pauli entropy is explicitly proved. Quantum entropy and energy in every vibrational mode are investigated. Thereby, the relation between bipartite and tripartite entanglements is discussed as well. Those are useful for the understanding of quantum correlations in high-dimensional states in polyatomic molecules from quantum information and intramolecular dynamics.

  9. Electronically Metastable Molecules of High Symmetry

    DTIC Science & Technology

    1993-05-01

    that the electronic transition moment 1,o number or of vibrational quantum numbers is more the interloper states is weighted relative to the high-n...17 APPENDICES A Measurement of the Lifetime of Metastable Triatomic Hydrogen ........................... 19 B Spectroscopy and Multichannel Quantum ...has yet been identified that satisfies the three requirements for a novel fuel: low weight , high specific impulse, and long lifetime. However, the

  10. Visualization of Potential Energy Function Using an Isoenergy Approach and 3D Prototyping

    ERIC Educational Resources Information Center

    Teplukhin, Alexander; Babikov, Dmitri

    2015-01-01

    In our three-dimensional world, one can plot, see, and comprehend a function of two variables at most, V(x,y). One cannot plot a function of three or more variables. For this reason, visualization of the potential energy function in its full dimensionality is impossible even for the smallest polyatomic molecules, such as triatomics. This creates…

  11. A global ab initio potential for HCN/HNC, exact vibrational energies, and comparison to experiment

    NASA Technical Reports Server (NTRS)

    Bentley, Joseph A.; Bowman, Joel M.; Gazdy, Bela; Lee, Timothy J.; Dateo, Christopher E.

    1992-01-01

    An ab initio (i.e., from first principles) calculation of vibrational energies of HCN and HNC is reported. The vibrational calculations were done with a new potential derived from a fit to 1124 ab initio electronic energies which were calculated using the highly accurate CCSD(T) coupled-cluster method in conjunction with a large atomic natural orbital basis set. The properties of this potential are presented, and the vibrational calculations are compared to experiment for 54 vibrational transitions, 39 of which are for zero total angular momentum, J = 0, and 15 of which are for J = 1. The level of agreement with experiment is unprecedented for a triatomic with two nonhydrogen atoms, and demonstrates the capability of the latest computational methods to give reliable predictions on a strongly bound triatomic molecule at very high levels of vibrational excitation.

  12. Sympathetic cooling of polyatomic molecules with S-state atoms in a magnetic trap.

    PubMed

    Tscherbul, T V; Yu, H-G; Dalgarno, A

    2011-02-18

    We present a rigorous theoretical study of low-temperature collisions of polyatomic molecular radicals with (1)S(0) atoms in the presence of an external magnetic field. Accurate quantum scattering calculations based on ab initio and scaled interaction potentials show that collision-induced spin relaxation of the prototypical organic molecule CH(2)(X(3)B(1)) (methylene) and nine other triatomic radicals in cold (3)He gas occurs at a slow rate, demonstrating that cryogenic buffer-gas cooling and magnetic trapping of these molecules is feasible with current technology. Our calculations further suggest that it may be possible to create ultracold gases of polyatomic molecules by sympathetic cooling with alkaline-earth atoms in a magnetic trap.

  13. Ab initio ground and excited state potential energy surfaces for NO-Kr complex and dynamics of Kr solids with NO impurity

    NASA Astrophysics Data System (ADS)

    Castro-Palacios, Juan Carlos; Rubayo-Soneira, Jesús; Ishii, Keisaku; Yamashita, Koichi

    2007-04-01

    The intermolecular potentials for the NO(XΠ2)-Kr and NO(AΣ+2)-Kr systems have been calculated using highly accurate ab initio calculations. The spin-restricted coupled cluster method for the ground 1A'2 state [NO(XΠ2)-Kr ] and the multireference singles and doubles configuration interaction method for the excited 2A'2 state [NO(AΣ+2)-Kr], respectively, were used. The potential energy surfaces (PESs) show two linear wells and one that is almost in the perpendicular position. An analytical representation of the PESs has been constructed for the triatomic systems and used to carry out molecular dynamics (MD) simulations of the NO-doped krypton matrix response after excitation of NO. MD results are shown comparatively for three sets of potentials: (1) anisotropic ab initio potentials [NO molecule direction fixed during the dynamics and considered as a point (its center of mass)], (2) isotropic ab initio potentials (isotropic part in a Legendre polynomial expansion of the PESs), and (3) fitted Kr-NO potentials to the spectroscopic data. An important finding of this work is that the anisotropic and isotropic ab initio potentials calculated for the Kr-NO triatomic system are not suitable for describing the dynamics of structural relaxation upon Rydberg excitation of a NO impurity in the crystal. However, the isotropic ab initio potential in the ground state almost overlaps the published experimental potential, being almost independent of the angle asymmetry. This fact is also manifested in the radial distribution function around NO. However, in the case of the excited state the isotropic ab initio potential differs from the fitted potentials, which indicates that the Kr-NO interaction in the matrix is quite different because of the presence of the surrounding Kr atoms acting on the NO molecule. MD simulations for isotropic potentials reasonably reproduce the experimental observables for the femtosecond response and the bubble size but do not match spectroscopic results. A general overall view of the results suggests that, when the Kr-NO interaction takes place inside the matrix, potentials are rather symmetric and less repulsive than those for the triatomic system. pectroscopy, yields a mean absolute deviation of about 5cm-1 over the 22 levels. The dissociation energy with respect to the lowest vibrational energy is calculated within 30cm-1 of the experimental value of 12953±8cm-1. The reported agreement of the theoretical spectrum and dissociation energy with experiment is contingent upon the inclusion of the effects of core-generated electron correlation, spin-orbit coupling, and scalar relativity. The Dunham analysis [Phys. Rev. 41, 721 (1932)] of the spectrum is found to be very accurate. New values are given for the spectroscopic constants.

  14. Current status of free radicals and electronically excited metastable species as high energy propellants

    NASA Technical Reports Server (NTRS)

    Rosen, G.

    1973-01-01

    A survey is presented of free radicals and electronically excited metastable species as high energy propellants for rocket engines. Nascent or atomic forms of diatomic gases are considered free radicals as well as the highly reactive diatomic triatomic molecules that posess unpaired electrons. Manufacturing and storage problems are described, and a review of current experimental work related to the manufacture of atomic hydrogen propellants is presented.

  15. Quasi-relativistic modeltotential approach. Spin-orbit effects on energies and geometries of several di- and tri-atomic molecules

    NASA Astrophysics Data System (ADS)

    Hafner, P.; Habitz, P.; Ishikawa, Y.; Wechsel-Trakowski, E.; Schwarz, W. H. E.

    1981-06-01

    Calculations on ground and valence-excited states of Au +2, Tl 2 and Pb 2, and on the ground states of HgCl 2, PbCl 2 and PbH 2 have teen performed within the Kramers-restricteu self-consistent-field approach using a quasi-relativitistic model-potential hamiltonian. The influence of spin—orbit coupling on molecular orbitals, bond energies and geometries is discussed.

  16. Coherent electron emission beyond Young-type interference from diatomic molecules

    NASA Astrophysics Data System (ADS)

    Agueny, H.; Makhoute, A.; Dubois, A.; Hansen, J. P.

    2016-01-01

    It has been known for more than 15 years that the differential cross section of electrons emitted from diatomic molecules during interaction with energetic charged particles oscillates as a function of electron momentum. The origin of the phenomenon is two-center interference, which naturally relates it back to the Young double-slit experiment. In addition to a characteristic frequency which can be described by lowest-order perturbation theories, the observation and origin of higher-order harmonics of the basic oscillation frequency has been much discussed. Here, we show that high harmonics of the fundamental Young-type oscillation frequency observed in electron spectra in fast ion-molecule collisions can be clearly exposed in numerical solutions of the time-dependent Schrödinger equation within a one-dimensional model. Momentum distribution of the ejected electron is analyzed and shows that the phenomenon emerges when the charged particle beam collides with diatomic molecules with substantial large internuclear distance. Frequency spectra from nonperturbative calculations for electron emission from Rb2+ and Cs2+ exhibit a pronounced high-order oscillation in contrast to similar close-coupling calculations performed on H2 targets. The electron emission from these heavy molecules contains second- and third-order harmonics which are fully reproduced in an analytic model based on the Born series. Extending to triatomic molecular targets displays an increased range of harmonics. This suggests that electron emission spectra from new experiments on heavy diatomic and linear polyatomic molecular targets may provide a unique insight into competing coherent emission mechanisms and their relative strength.

  17. Potential energy surfaces of the low-lying electronic states of the Li + LiCs system

    NASA Astrophysics Data System (ADS)

    Jasik, P.; Kilich, T.; Kozicki, J.; Sienkiewicz, J. E.

    2018-03-01

    Ab initio quantum chemistry calculations are performed for the mixed alkali triatomic system. Global minima of the ground and first excited doublet states of the trimer are found and Born-Oppenheimer potential energy surfaces of the Li atom interacting with the LiCs molecule were calculated for these states. The lithium atom is placed at various distances and bond angles from the lithium-caesium dimer. Three-body nonadditive forces of the Li2Cs molecule in the global minimum are investigated. Dimer-atom interactions are found to be strongly attractive and may be important in the experiments, particularly involving cold alkali polar dimers.

  18. Non-Born-Oppenheimer Spectroscopy of Cyclic Triatomics

    DTIC Science & Technology

    2011-10-11

    n nmnm mn m nm nm nm nm ss n IV E 2/ if,2/1 2/ if, ])2/1()/[( )2/1()/( 2 1 12 22 222 22 2/,,4 23 )3(   Here ZPE ...integer values of m . The perturbation theory expression gives us seven parameters for a non-linear fitting problem: ZPE , 0I , 1I , 2I , 3V , 6V and

  19. A Review of the Properties and Applications of Ozone in Endodontics: An Update

    PubMed Central

    Mohammadi, Zahed; Shalavi, Sousan; Soltani, Mohammad Karim; Asgary, Saeed

    2013-01-01

    Ozone is a triatomic molecule consisting of three oxygen atoms. It is applied to oral tissues in the forms of ozonated water, ozonated olive oil and oxygen/ozone gas. This paper presents a brief review on the chemistry of ozone as well as its medical and dental applications focusing on its use in endodontics. Ozone’s antimicrobial activity, its effect on dentin bonding, toxicity and contra-indications are also reviewed. PMID:23717326

  20. Ab Initio Characterization of Triatomic Bromine Molecules of Potential Interest in Stratospheric Chemistry

    NASA Technical Reports Server (NTRS)

    Lee, Timothy J.

    1995-01-01

    The equilibrium structures, harmonic vibrational frequencies, quadratic force fields, dipole moments, and IR intensities of several triatomic bromine compounds of known or potential importance in stratospheric ozone depletion chemistry have been determined using the CCSD(T) electron correlation method in conjunction with a basis set of triple zeta double polarized (TZ2P) quality. Specifically, the molecules included in the present study are HOBr, HBrO, FOBr, FBrO, BrNO, BrON, Br2O, BrBrO, BrCN, BrNC, ClOBr, ClBrO, and BrClO. Very accurate isomeric energy differences have also been determined at the CCSD(T) level with atomic natural orbital basis sets that include through g-type functions. In most cases, the isomer with a normal neutral Lewis dot structure is the lowest energy form, with the single exception that FBrO is predicted to be 11.1 kcal/mol (0 K) lower in energy than FOBr. In all cases, however, the hypervalent isomer is more stable relative to the isomer with a normal Lewis dot structure as compared to the chlorine analogs. Consistent with this observation, the energy of the last three molecules given above increases in the order ClOBr less than ClBrO less than BrClO. The CCSD(T)/TZ2P geometries and vibrational frequencies are in good agreement with the available experimental data. Heats of formation are determined for all species using a combination of theoretical isomeric, homodesmic, and isodesmic reaction energies. The accuracy of these quantities is ultimately dependent on the reliability of the experimental heat of formation of HOBr.

  1. Ab Initio Characterization of Triatomic Bromine Molecules of Potential Interest in Stratospheric Chemistry

    NASA Technical Reports Server (NTRS)

    Lee. Timothy J.

    1995-01-01

    The equilibrium structures, harmonic vibrational frequencies, quadratic force fields, dipole moments, and IR intensities of several triatomic bromine compounds of known or potential importance in stratospheric ozone depletion chemistry have been determined using the CCSD(T) electron correlation method in conjunction with a basis set of triple zeta double polarized (TZ2P) quality. Specifically, the molecules included in the present study are HOBr, HBrO, FOBr, FBrO, BrNO, BrON, Br2O, BrBrO, BrCN, BrNC, ClOBr, ClBrO, and BrClO. Very accurate isomeric energy differences have also been determined at the CCSD(T) level with atomic natural orbital basis sets that include through g-type functions. In most cases, the isomer with a normal neutral Lewis dot structure is the lowest energy form, with the single exception that FBRO is predicted to be 11.1 kcal/mol (0 K) lower in energy than FOBr. In all cases, however, the hypervalent isomer is more stable relative to the isomer with a normal Lewis dot structure as compared to the chlorine analogs. Consistent with this observation, the energy of the last three molecules given above increases in the order ClOBr less than ClBrO less than BrClO. The CCSD(T)/TZ2P geometries and vibrational frequencies are in good agreement with the available experimental data. Heats of formation are determined for all species using a combination of theoretical isomeric, homodesmic, and isodesmic reaction energies. The accuracy of these quantities is ultimately dependent on the reliability of the experimental heat of formation of HOBr.

  2. Quantum Chemical Study of Rare Gas/Halide Interactions as a Model for High Energy Density Material. 1. Transition Properties in HC1

    DTIC Science & Technology

    1994-11-01

    separation of a stable, negatively charged exciplex such as (ClXe2)- and a self- trapped positive hole (STi) localized on a Xe+ (n = 2-3) molecule. The first...solid to form Xe + HO + 2hv -- Xe÷ (HCI)-, which quickly reacts with another Xe atom to form the more stable tri-atomic exciplex X407. This exciplex ...Transfer Reaction Dynamics in Rare Gas Solids. I. Photodynamics of Localized Xenon Chloride Exciplexes ." Journal of Chemical Physics. vol. 85, p. 5660

  3. Toward the detection of the triatomic negative ion SPN-: Spectroscopy and potential energy surfaces

    NASA Astrophysics Data System (ADS)

    Trabelsi, Tarek; Hochlaf, Majdi; Francisco, Joseph S.

    2018-04-01

    High level theoretical calculations using coupled-cluster theory were performed to provide an accurate description of the electronic structure, spectroscopic properties, and stability of the triatomic negative ion comprising S, N, and P. The adiabatic electron affinities (AEAs) and vertical detachment energies (VDEs) of PNS, SPN, PSN, and cyc-PSN were calculated. The predicted AEA and VDE of the linear SPN isomer are large: 2.24 and 3.04 eV, respectively. The potential energy surfaces (PESs) of the lowest-lying electronic states of the SPN- isomer along the PN and SP bond lengths and bond angle were mapped. A set of spectroscopic parameters for SPN-, PNS-, and PSN- in their electronic ground states is obtained from the 3D PESs to help detect these species in the gas phase. The electronic excited state SPN-(12A″) is predicted to be stable with a long lifetime calculated to be 189.7 μs. The formation of SPN- in its electronic ground state through the bimolecular collision between S- + PN and N + PS- is also discussed.

  4. Efficient method for calculations of ro-vibrational states in triatomic molecules near dissociation threshold: Application to ozone

    NASA Astrophysics Data System (ADS)

    Teplukhin, Alexander; Babikov, Dmitri

    2016-09-01

    A method for calculations of rotational-vibrational states of triatomic molecules up to dissociation threshold (and scattering resonances above it) is devised, that combines hyper-spherical coordinates, sequential diagonalization-truncation procedure, optimized grid DVR, and complex absorbing potential. Efficiency and accuracy of the method and new code are tested by computing the spectrum of ozone up to dissociation threshold, using two different potential energy surfaces. In both cases good agreement with results of previous studies is obtained for the lower energy states localized in the deep (˜10 000 cm-1) covalent well. Upper part of the bound state spectrum, within 600 cm-1 below dissociation threshold, is also computed and is analyzed in detail. It is found that long progressions of symmetric-stretching and bending states (up to 8 and 11 quanta, respectively) survive up to dissociation threshold and even above it, whereas excitations of the asymmetric-stretching overtones couple to the local vibration modes, making assignments difficult. Within 140 cm-1 below dissociation threshold, large-amplitude vibrational states of a floppy complex O⋯O2 are formed over the shallow van der Waals plateau. These are assigned using two local modes: the rocking-motion and the dissociative-motion progressions, up to 6 quanta in each, both with frequency ˜20 cm-1. Many of these plateau states are mixed with states of the covalent well. Interestingly, excitation of the rocking-motion helps keeping these states localized within the plateau region, by raising the effective barrier.

  5. Adsorption of small molecules on the [Zn-Zn]2+ linkage in zeolite. A DFT study of ferrierite

    NASA Astrophysics Data System (ADS)

    Benco, Lubomir

    2017-02-01

    In zeolites monovalent Zn(I) forms a sub-nano particles [Zn-Zn]2+ stabilized in rings of the zeolite framework, which exhibit interesting catalytic properties. This work reports on adsorption properties of [Zn-Zn]2+ particles in zeolite ferrierite investigated for a set of probing diatomic (N2, O2, H2, CO, NO) and triatomic (CO2, N2O, NO2, H2O) molecules using dispersion-corrected DFT. Three [Zn-Zn]2+ sites are compared differing in the location and stability. On all sites molecules form physisorbed clusters with the molecule connected on-top of the Zn-Zn linkage. In physisorbed clusters adsorption induces only slight change of bonding and the geometry of the Zn-Zn linkage. Some molecules can form stable chemisorbed clusters in which the molecule is integrated between two Zn+ cations. The sandwich-like chemisorption causes pronounced changes of bonding and can lead to the transfer of the electron density between two Zn+ cations and to a change of the oxidation state. The knowledge of bonding of small molecules can help understanding of the mechanism of conversion reactions catalyzed by sub-nano [Zn-Zn] particles.

  6. Quantum theory of rotational isomerism and Hill equation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ugulava, A.; Toklikishvili, Z.; Chkhaidze, S.

    2012-06-15

    The process of rotational isomerism of linear triatomic molecules is described by the potential with two different-depth minima and one barrier between them. The corresponding quantum-mechanical equation is represented in the form that is a special case of the Hill equation. It is shown that the Hill-Schroedinger equation has a Klein's quadratic group symmetry which, in its turn, contains three invariant subgroups. The presence of these subgroups makes it possible to create a picture of energy spectrum which depends on a parameter and has many merging and branch points. The parameter-dependent energy spectrum of the Hill-Schroedinger equation, like Mathieu-characteristics, containsmore » branch points from the left and from the right of the demarcation line. However, compared to the Mathieu-characteristics, in the Hill-Schroedinger equation spectrum the 'right' points are moved away even further for some distance that is the bigger, the bigger is the less deep well. The asymptotic wave functions of the Hill-Schroedinger equation for the energy values near the potential minimum contain two isolated sharp peaks indicating a possibility of the presence of two stable isomers. At high energy values near the potential maximum, the height of two peaks decreases, and between them there appear chaotic oscillations. This form of the wave functions corresponds to the process of isomerization.« less

  7. Potential surface for the collinear collision of Ne and H/sub 2//sup +/. [eendoergicity, surface parametrization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hayes, E.F.; Siu, A.K.Q.; Chapman, F.M. Jr.

    1976-09-01

    A potential energy surface for the Ne--H/sub 2//sup +/ reaction has been obtained in the LCAO--MO--SCF approximation. Analysis of the surface indicates that the reaction Ne+H/sub 2//sup +/..-->..NeH/sup +/+H should proceed with an endoergicity of 12 kcal/mole, in agreement with the experimental results of Chupka and Russell. Several procedures for parameterizing a diatomics-in-molecules (DIM) representation of the NeH/sub 2//sup +/ surface are considered. The results show that an accurate representation of the SCF surface can be obtained from the DIM model using a minimum of diatomic and triatomic data. (AIP)

  8. Effect of Coriolis coupling in chemical reaction dynamics.

    PubMed

    Chu, Tian-Shu; Han, Ke-Li

    2008-05-14

    It is essential to evaluate the role of Coriolis coupling effect in molecular reaction dynamics. Here we consider Coriolis coupling effect in quantum reactive scattering calculations in the context of both adiabaticity and nonadiabaticity, with particular emphasis on examining the role of Coriolis coupling effect in reaction dynamics of triatomic molecular systems. We present the results of our own calculations by the time-dependent quantum wave packet approach for H + D2 and F(2P3/2,2P1/2) + H2 as well as for the ion-molecule collisions of He + H2 +, D(-) + H2, H(-) + D2, and D+ + H2, after reviewing in detail other related research efforts on this issue.

  9. Rotational diffusion of a molecular cat

    NASA Astrophysics Data System (ADS)

    Katz-Saporta, Ori; Efrati, Efi

    We show that a simple isolated system can perform rotational random walk on account of internal excitations alone. We consider the classical dynamics of a ''molecular cat'': a triatomic molecule connected by three harmonic springs with non-zero rest lengths, suspended in free space. In this system, much like for falling cats, the angular momentum constraint is non-holonomic allowing for rotations with zero overall angular momentum. The geometric nonlinearities arising from the non-zero rest lengths of the springs suffice to break integrability and lead to chaotic dynamics. The coupling of the non-integrability of the system and its non-holonomic nature results in an angular random walk of the molecule. We study the properties and dynamics of this angular motion analytically and numerically. For low energy excitations the system displays normal-mode-like motion, while for high enough excitation energy we observe regular random-walk. In between, at intermediate energies we observe an angular Lévy-walk type motion associated with a fractional diffusion coefficient interpolating between the two regimes.

  10. The IPEA dilemma in CASPT2† †Electronic supplementary information (ESI) available: Original data (Table S1) and additional comments for the literature survey; note on symmetry (Table S2), geometries (Table S3), data (Tables S4–S6) and comments (Section S2) for calculations on di-/triatomic molecules; results (Tables S7–S25) and comments (Section S3) for calculations on the organic molecular data set. See DOI: 10.1039/c6sc03759c Click here for additional data file.

    PubMed Central

    Zobel, J. Patrick

    2017-01-01

    Multi-configurational second order perturbation theory (CASPT2) has become a very popular method for describing excited-state properties since its development in 1990. To account for systematic errors found in the calculation of dissociation energies, an empirical correction applied to the zeroth-order Hamiltonian, called the IPEA shift, was introduced in 2004. The errors were attributed to an unbalanced description of open-shell versus closed-shell electronic states and is believed to also lead to an underestimation of excitation energies. Here we show that the use of the IPEA shift is not justified and the IPEA should not be used to calculate excited states, at least for organic chromophores. This conclusion is the result of three extensive analyses. Firstly, we survey the literature for excitation energies of organic molecules that have been calculated with the unmodified CASPT2 method. We find that the excitation energies of 356 reference values are negligibly underestimated by 0.02 eV. This value is an order of magnitude smaller than the expected error based on the calculation of dissociation energies. Secondly, we perform benchmark full configuration interaction calculations on 137 states of 13 di- and triatomic molecules and compare the results with CASPT2. Also in this case, the excited states are underestimated by only 0.05 eV. Finally, we perform CASPT2 calculations with different IPEA shift values on 309 excited states of 28 organic small and medium-sized organic chromophores. We demonstrate that the size of the IPEA correction scales with the amount of dynamical correlation energy (and thus with the size of the system), and gets immoderate already for the molecules considered here, leading to an overestimation of the excitation energies. It is also found that the IPEA correction strongly depends on the size of the basis set. The dependency on both the size of the system and of the basis set, contradicts the idea of a universal IPEA shift which is able to compensate for systematic CASPT2 errors in the calculation of excited states. PMID:28572908

  11. Atomic spectral-product representations of molecular electronic structure: metric matrices and atomic-product composition of molecular eigenfunctions.

    PubMed

    Ben-Nun, M; Mills, J D; Hinde, R J; Winstead, C L; Boatz, J A; Gallup, G A; Langhoff, P W

    2009-07-02

    Recent progress is reported in development of ab initio computational methods for the electronic structures of molecules employing the many-electron eigenstates of constituent atoms in spectral-product forms. The approach provides a universal atomic-product description of the electronic structure of matter as an alternative to more commonly employed valence-bond- or molecular-orbital-based representations. The Hamiltonian matrix in this representation is seen to comprise a sum over atomic energies and a pairwise sum over Coulombic interaction terms that depend only on the separations of the individual atomic pairs. Overall electron antisymmetry can be enforced by unitary transformation when appropriate, rather than as a possibly encumbering or unnecessary global constraint. The matrix representative of the antisymmetrizer in the spectral-product basis, which is equivalent to the metric matrix of the corresponding explicitly antisymmetric basis, provides the required transformation to antisymmetric or linearly independent states after Hamiltonian evaluation. Particular attention is focused in the present report on properties of the metric matrix and on the atomic-product compositions of molecular eigenstates as described in the spectral-product representations. Illustrative calculations are reported for simple but prototypically important diatomic (H(2), CH) and triatomic (H(3), CH(2)) molecules employing algorithms and computer codes devised recently for this purpose. This particular implementation of the approach combines Slater-orbital-based one- and two-electron integral evaluations, valence-bond constructions of standard tableau functions and matrices, and transformations to atomic eigenstate-product representations. The calculated metric matrices and corresponding potential energy surfaces obtained in this way elucidate a number of aspects of the spectral-product development, including the nature of closure in the representation, the general redundancy or linear dependence of its explicitly antisymmetrized form, the convergence of the apparently disparate atomic-product and explicitly antisymmetrized atomic-product forms to a common invariant subspace, and the nature of a chemical bonding descriptor provided by the atomic-product compositions of molecular eigenstates. Concluding remarks indicate additional studies in progress and the prognosis for performing atomic spectral-product calculations more generally and efficiently.

  12. Laser control of electronic transitions of wave packet by using quadratically chirped pulses.

    PubMed

    Zou, Shiyang; Kondorskiy, Alexey; Mil'nikov, Gennady; Nakamura, Hiroki

    2005-02-22

    An effective scheme is proposed for the laser control of wave packet dynamics. It is demonstrated that by using specially designed quadratically chirped pulses, fast and nearly complete excitation of wave packet can be achieved without significant distortion of its shape. The parameters of the laser pulse can be estimated analytically from the Zhu-Nakamura theory of nonadiabatic transition. If the wave packet is not too narrow or not too broad, then the scheme is expected to be utilizable for multidimensional systems. The scheme is applicable to various processes such as simple electronic excitation, pump-dump, and selective bond breaking, and it is actually numerically demonstrated to work well by taking diatomic and triatomic molecules (LiH, NaK, H(2)O) as examples.

  13. Laser control of electronic transitions of wave packet by using quadratically chirped pulses

    NASA Astrophysics Data System (ADS)

    Zou, Shiyang; Kondorskiy, Alexey; Mil'nikov, Gennady; Nakamura, Hiroki

    2005-02-01

    An effective scheme is proposed for the laser control of wave packet dynamics. It is demonstrated that by using specially designed quadratically chirped pulses, fast and nearly complete excitation of wave packet can be achieved without significant distortion of its shape. The parameters of the laser pulse can be estimated analytically from the Zhu-Nakamura theory of nonadiabatic transition. If the wave packet is not too narrow or not too broad, then the scheme is expected to be utilizable for multidimensional systems. The scheme is applicable to various processes such as simple electronic excitation, pump-dump, and selective bond breaking, and it is actually numerically demonstrated to work well by taking diatomic and triatomic molecules (LiH, NaK, H2O) as examples.

  14. Penetration of analogues of H2O and CO2 in proteins studied by room temperature phosphorescence of tryptophan.

    PubMed

    Wright, W W; Owen, C S; Vanderkooi, J M

    1992-07-21

    The influence of the protein matrix on the reactivity of external molecules with a species buried within the protein interior is considered in two general ways: (1) there may be structural fluctuations that allow for the diffusive penetration of the small molecules and/or (2) the external molecule may react over a distance. As a means to study the protein matrix, a reactive species within the protein can be formed by exciting tryptophan to the triplet state, and then the reaction of the triplet-state molecule with an external molecule can be monitored by a decrease in phosphorescence. In this work, the quenching ability (i.e., reactivity) was examined for H2S, CS2, and NO2- acting on tryptophan phosphorescence in parvalbumin, azurin, horse liver alcohol dehydrogenase, and alkaline phosphatase. A comparison of charged versus uncharged quenchers (H2S vs SH- and CS2 vs NO2-) reveals that the uncharged molecules are much more effective than charged species in quenching the phosphorescence of fully buried tryptophan, whereas the quenching for exposed tryptophan is relatively independent of the charge of the quencher. This is consistent with the view that uncharged triatomic molecules can penetrate the protein matrix to some extent. The energies of activation of the quenching reaction are low for the charged quenchers and higher for the uncharged CS2. A model is presented in which the quenchability of a buried tryptophan is inversely related to the distance from the surface when diffusion through the protein is the rate-limiting step.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Laboratory Measurements and Astronomical Search of the Hso Radical

    NASA Astrophysics Data System (ADS)

    Cazzoli, Gabriele; Puzzarini, Cristina; Lattanzi, Valerio; Tercero, Belén; Cernicharo, Jose

    2016-06-01

    The sulphur chemistry in space is still quite puzzling although several S-bearing species have been detected in the interstellar medium (ISM) in our local system and outside our galaxy. In particular, we observe very large quantities of sulphur harbouring molecules, especially in high-mass star forming regions, that are in perfect accordance with its solar abundance, while in the cold, dense ISM a much lower abundance is observed compared to its solar one. To have a better understanding of the sulphur chemistry in space, it is crucial to derive the broadest picture of the chemical network involving the formation of sulphur species. In this work we report high-resolution spectra of a simple triatomic S-bearing molecule, the HSO radical, with experiments well into the THz region. Thanks to the spectroscopic results of this work, which provide accurate frequency predictions up to the THz, we have also performed a rigorous search for HSO in space. The main outcomes of our work will be briefly presented, showing in particular the synergy between the laboratory and the observations.

  16. Third-order Douglas-Kroll Relativistic Coupled-Cluster Theory through Connected Single, Double, Triple, and Quadruple Substitutions: Applications to Diatomic and Triatomic Hydrides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hirata, So; Yanai, Takeshi; De Jong, Wibe A.

    Coupled-cluster methods including through and up to the connected single, double, triple, and quadruple substitutions (CCSD, CCSDT, and CCSDTQ) have been automatically derived and implemented for sequential and parallel executions for use in conjunction with a one-component third-order Douglas-Kroll (DK3) approximation for relativistic corrections. A combination of the converging electron-correlation methods, the accurate relativistic reference wave functions, and the use of systematic basis sets tailored to the relativistic approximation has been shown to predict the experimental singlet-triplet separations within 0.02 eV (0.5 kcal/mol) for five triatomic hydrides (CH2, NH2+, SiH2, PH2+, and AsH2+), the experimental bond lengths within 0.002 angstroms,more » rotational constants within 0.02 cm-1, vibration-rotation constants within 0.01 cm-1, centrifugal distortion constants within 2 %, harmonic vibration frequencies within 9 cm-1 (0.4 %), anharmonic vibrational constants within 2 cm-1, and dissociation energies within 0.03 eV (0.8 kcal/mol) for twenty diatomic hydrides (BH, CH, NH, OH, FH, AlH, SiH, PH, SH, ClH, GaH, GeH, AsH, SeH, BrH, InH, SnH, SbH, TeH, and IH) containing main-group elements across the second through fifth periods of the periodic table. In these calculations, spin-orbit effects on dissociation energies, which were assumed to be additive, were estimated from the measured spin-orbit coupling constants of atoms and diatomic molecules, and an electronic energy in the complete-basis-set, complete-electron-correlation limit has been extrapolated by the formula which was in turn based on the exponential-Gaussian extrapolation formula of the basis set dependence.« less

  17. Swelling Mechanisms of UO2 Lattices with Defect Ingrowths

    PubMed Central

    Günay, Seçkin D.

    2015-01-01

    The swelling that occurs in uranium dioxide as a result of radiation-induced defect ingrowth is not fully understood. Experimental and theoretical groups have attempted to explain this phenomenon with various complex theories. In this study, experimental lattice expansion and lattice super saturation were accurately reproduced using a molecular dynamics simulation method. Based on their resemblance to experimental data, the simulation results presented here show that fission induces only oxygen Frenkel pairs while alpha particle irradiation results in both oxygen and uranium Frenkel pair defects. Moreover, in this work, defects are divided into two sub-groups, obstruction type defects and distortion type defects. It is shown that obstruction type Frenkel pairs are responsible for both fission- and alpha-particle-induced lattice swelling. Relative lattice expansion was found to vary linearly with the number of obstruction type uranium Frenkel defects. Additionally, at high concentrations, some of the obstruction type uranium Frenkel pairs formed diatomic and triatomic structures with oxygen ions in their octahedral cages, increasing the slope of the linear dependence. PMID:26244777

  18. Anomalous Centrifugal Distortion in NH_2

    NASA Astrophysics Data System (ADS)

    Martin-Drumel, Marie-Aline; Pirali, Olivier; Coudert, L. H.

    2017-06-01

    The NH2 radical spectrum, first observed by Herzberg and Ramsay, is dominated by a strong Renner-Teller effect giving rise to two electronic states: the bent X ^{2}B_1 ground state and the quasi-linear A ^{2}A_1 excited state. The NH2 radical has been the subject of numerous high-resolution investigations and its electronic and ro-vibrational transitions have been measured. Using synchrotron radiation, new rotational transitions have been recently recorded and a value of the rotational quantum number N as large as 26 could be reached. In the X ^{2}B_1 ground state, the NH2 radical behaves like a triatomic molecule displaying spin-rotation splittings. Due to the lightness of the molecule, a strong coupling between the overall rotation and the bending mode arises whose effects increase with N and lead to the anomalous centrifugal distortion evidenced in the new measurements.^d In this talk the Bending-Rotation approach developed to account for the anomalous centrifugal distortion of the water molecule is modified to include spin-rotation coupling and applied to the fitting of high-resolution data pertaining to the ground electronic state of NH2. A preliminary line position analysis of the available data^{c,d} allowed us to account for 1681 transitions with a unitless standard deviation of 1.2. New transitions could also be assigned in the spectrum recorded by Martin-Drumel et al.^d In the talk, the results obtained with the new theoretical approach will be compared to those retrieved with a Watson-type Hamiltonian and the effects of the vibronic coupling between the ground X ^{2}B_1 and the excited A ^{2}A_1 electronic state will be discussed. Herzberg and Ramsay, J. Chem. Phys. 20 (1952) 347 Dressler and Ramsay, Phil. Trans. R. Soc. A 25 (1959) 553 Hadj Bachir, Huet, Destombes, and Vervloet, J. Molec. Spectrosc. 193 (1999) 326 McKellar, Vervloet, Burkholder, and Howard, J. Molec. Spectrosc. 142 (1990) 319 Morino and Kawaguchi, J. Molec. Spectrosc. 182 (1997) 428 Martin-Drumel, Pirali, and Vervloet, J. Phys. Chem. A 118 (2014) 1331 Coudert, J. Molec. Spectrosc. 165 (1994) 406

  19. Theoretical dissociation energies for ionic molecules

    NASA Technical Reports Server (NTRS)

    Langhoff, S. R.; Bauschlicher, C. W., Jr.; Partridge, H.

    1986-01-01

    Ab initio calculations at the self-consistent-field and singles plus doubles configuration-interaction level are used to determine accurate spectroscopic parameters for most of the alkali and alkaline-earth fluorides, chlorides, oxides, sulfides, hydroxides, and isocyanides. Numerical Hartree-Fock (NHF) calculations are performed on selected systems to ensure that the extended Slater basis sets employed for the diatomic systems are near the Hartree-Fock limit. Extended Gaussian basis sets of at least triple-zeta plus double polarization equality are employed for the triatomic system. With this model, correlation effects are relatively small, but invariably increase the theoretical dissociation energies. The importance of correlating the electrons on both the anion and the metal is discussed. The theoretical dissociation energies are critically compared with the literature to rule out disparate experimental values. Theoretical (sup 2)Pi - (sup 2)Sigma (sup +) energy separations are presented for the alkali oxides and sulfides.

  20. The Effects of Nonzero Total Electron Spin in the X˜3B1State of Methylene CH 2

    NASA Astrophysics Data System (ADS)

    Kozin, Igor N.; Jensen, Per

    1997-06-01

    We report here how we have incorporated the effects of a nonzero total electron spin in the MORBID Hamiltonian and computer program [P. Jensen,J. Mol. Spectrosc.128,478-501 (1988);J. Chem. Soc. Faraday Trans. 284,1315-1340 (1988);in"Methods in Computational Molecular Physics" (S. Wilson and G. H. F. Diercksen, Eds.), Plenum Press, New York, 1992] for calculating the rovibronic energies of a triatomic molecule directly from the potential energy function. The spin-spin and spin-rotation Hamiltonian terms, given in a form depending on the vibrational coordinates, have been expressed in terms of isotope-independent functions and added to the MORBID rotation-vibration Hamiltonian. The eigenvalues of the resulting Hamiltonian are obtained in a variational procedure. This method is tested on the methylene radical CH2in theX˜3B1electronic ground state for which we describe simultaneously the splittings due to electron spin for the isotopomers12CH2,12CD2, and13CH2. For these molecules, experimental data are available, and we compare the results of least-squares fits to these data with predictions fromab initiotheory.

  1. Isotopic exchange processes in cold plasmas of H2/D2 mixtures.

    PubMed

    Jiménez-Redondo, Miguel; Carrasco, Esther; Herrero, Víctor J; Tanarro, Isabel

    2011-05-28

    Isotope exchange in low pressure cold plasmas of H(2)/D(2) mixtures has been investigated by means of mass spectrometric measurements of neutrals and ions, and kinetic model calculations. The measurements, which include also electron temperatures and densities, were performed in a stainless steel hollow cathode reactor for three discharge pressures: 1, 2 and 8 Pa, and for mixture compositions ranging from 100% H(2) to 100% D(2). The data are analyzed in the light of the model calculations, which are in good global agreement with the experiments. Isotope selective effects are found both in the surface recombination and in the gas-phase ionic chemistry. The dissociation of the fuel gas molecules is followed by wall recycling, which regenerates H(2) and D(2) and produces HD. Atomic recombination at the wall is found to proceed through an Eley-Rideal mechanism, with a preference for reaction of the adsorbed atoms with gas phase D atoms. The best fit probabilities for Eley-Rideal abstraction with H and D are: γ(ER H) = 1.5 × 10(-3), γ(ER D) = 2.0 × 10(-3). Concerning ions, at 1 Pa the diatomic species H(2)(+), D(2)(+) and HD(+), formed directly by electron impact, prevail in the distributions, and at 8 Pa, the triatomic ions H(3)(+), H(2)D(+), HD(2)(+) and D(3)(+), produced primarily in reactions of diatomic ions with molecules, dominate the plasma composition. In this higher pressure regime, the formation of the mixed ions H(2)D(+) and HD(2)(+) is favoured in comparison with that of H(3)(+) and D(3)(+), as expected on statistical grounds. The model results predict a very small preference, undetectable within the precision of the measurements, for the generation of triatomic ions with a higher degree of deuteration, which is probably a residual influence at room temperature of the marked zero point energy effects (ZPE), relevant for deuterium fractionation in interstellar space. In contrast, ZPE effects are found to be decisive for the observed distribution of monoatomic ions H(+) and D(+), even at room temperature. The final H(+)/D(+) ratio is determined to a great extent by proton (and deuteron) exchange, which favours the enhancement of H(+) and the concomitant decrease of D(+). This journal is © the Owner Societies 2011

  2. Hg-Xe exciplex formation in mixed Xe/Ar matrices: molecular dynamics and luminescence study.

    PubMed

    Lozada-García, Rolando; Rojas-Lorenzo, Germán; Crépin, Claudine; Ryan, Maryanne; McCaffrey, John G

    2015-03-19

    Luminescence of Hg((3)P1) atoms trapped in mixed Ar/Xe matrices containing a small amount of Xe is reported. Broad emission bands, strongly red-shifted from absorption are recorded which are assigned to strong complexes formed between the excited mercury Hg* and xenon atoms. Molecular dynamics calculations are performed on simulated Xe/Ar samples doped with Hg to follow the behavior of Hg* in the mixed rare gas matrices leading to exciplex formation. The role of Xe atoms in the first solvation shell (SS1) around Hg was investigated in detail, revealing the formation of two kinds of triatomic exciplexes; namely, Xe-Hg*-Xe and Ar-Hg*-Xe. The first species exists only when two xenon atoms are present in SS1 with specific geometries allowing the formation of a linear or quasi-linear exciplex. In the other geometries, or in the presence of only one Xe in SS1, a linear Ar-Hg*-Xe exciplex is formed. The two kinds of exciplexes have different emission bands, the most red-shifted being that involving two Xe atoms, whose emission is very close to that observed in pure Xe matrices. Simulations give a direct access to the analysis of the experimental absorption, emission, and excitation spectra, together with the dynamics of exciplexes formation.

  3. Flue gas adsorption on periodic mesoporous phenylene-silica: a DFT approach.

    PubMed

    Lourenço, Mirtha A O; Ferreira, Paula; Gomes, José R B

    2018-06-20

    Periodic mesoporous organosilicas (PMOs) were suggested as potential adsorbents for CO2/CH4 separation because of their large affinities towards CO2 and low interaction with CH4. Herewith, we present a comprehensive computational study on the binding properties of flue gas species with the pore walls of periodic mesoporous phenylene-silica (Ph-PMO) for understanding the possible impact of other gaseous species in the CO2/CH4 separation. The calculations considered three exchange-correlation functionals (PBE, PBE-D2 and M06-2X) based on the density functional theory and the walls of the periodic mesoporous phenylene-silica were modelled within the cluster model approach. The components of the flue gas considered were the diatomic CO, H2, N2, O2 and NO molecules, the triatomic CO2, H2O, H2S and SO2 species, the tetratomic SO3 and NH3 gases and the pentatomic CH4 molecule. The calculated data demonstrate that the presence of H2O, SO2, NH3, H2S and SO3 is a significant threat to CO2 capture by Ph-PMO and suggest that the Ph-PMO material would present high selectivity for CO2 over CH4, CO, H2 or N2 adsorption. The adsorption behaviour of flue gas components in Ph-PMO can be directly related to the experimental proton affinities, basicities or even the polarizabilities of the gaseous molecules.

  4. Theoretical determination of chemical rate constants using novel time-dependent methods

    NASA Technical Reports Server (NTRS)

    Dateo, Christopher E.

    1994-01-01

    The work completed within the grant period 10/1/91 through 12/31/93 falls primarily in the area of reaction dynamics using both quantum and classical mechanical methodologies. Essentially four projects have been completed and have been or are in preparation of being published. The majority of time was spent in the determination of reaction rate coefficients in the area of hydrocarbon fuel combustion reactions which are relevant to NASA's High Speed Research Program (HSRP). These reaction coefficients are important in the design of novel jet engines with low NOx emissions, which through a series of catalytic reactions contribute to the deterioration of the earth's ozone layer. A second area of research studied concerned the control of chemical reactivity using ultrashort (femtosecond) laser pulses. Recent advances in pulsed-laser technologies have opened up a vast new field to be investigated both experimentally and theoretically. The photodissociation of molecules adsorbed on surfaces using novel time-independent quantum mechanical methods was a third project. And finally, using state-of-the-art, high level ab initio electronic structure methods in conjunction with accurate quantum dynamical methods, the rovibrational energy levels of a triatomic molecule with two nonhydrogen atoms (HCN) were calculated to unprecedented levels of agreement between theory and experiment.

  5. Non-adiabatic couplings and dynamics in proton transfer reactions of Hn+ systems: application to H2+H2+→H+H3+ collisions

    PubMed Central

    Sanz-Sanz, Cristina; Aguado, Alfredo; Roncero, Octavio; Naumkin, Fedor

    2016-01-01

    Analytical derivatives and non-adiabatic coupling matrix elements are derived for Hn+ systems (n=3, 4 and 5). The method uses a generalized Hellmann-Feynman theorem applied to a multi-state description based on diatomics-in-molecules (for H3+) or triatomics-in-molecules (for H4+ and H5+) formalisms, corrected with a permutationally invariant many-body term to get high accuracy. The analytical non-adiabatic coupling matrix elements are compared with ab initio calculations performed at multi-reference configuration interaction level. These magnitudes are used to calculate H2(v′=0,j′=0)+H2+(v,j=0) collisions, to determine the effect of electronic transitions using a molecular dynamics method with electronic transitions. Cross sections for several initial vibrational states of H2+ are calculated and compared with the available experimental data, yielding an excellent agreement. The effect of vibrational excitation of H2+ reactant, and its relation with non-adiabatic processes are discussed. Also, the behavior at low collisional energies, in the 1 meV-0.1 eV interval, of interest in astrophysical environments, are discussed in terms of the long range behaviour of the interaction potential which is properly described within the TRIM formalism. PMID:26696058

  6. Research on Spectroscopy, Opacity, and Atmospheres

    NASA Technical Reports Server (NTRS)

    Oliversen, Ronald (Technical Monitor); Kurucz, Robert L.

    2004-01-01

    I propose to continue providing observers with basic data for interpreting spectra from stars, novas, supernovas, clusters, and galaxies. These data will include allowed forbidden line lists both laboratory and computed, for the first five to ten ions of all atoms and for all relevant diatomic molecules. I will eventually expend to all ions of the first thirty elements to treat far UV end X-ray spectra, and for envelope opacities. I also include triatomic molecules providing by other researchers. I have made CDs with Partridge and Schwanke's water data for work on M stars.The luna data also serve as input to my model atmosphere and synthesis programs that generated energy distributions, photometry, limb darkening, and spectra that can be used for planning observations and for fitting observed spectra. The spectrum synthesis programs produce detailed plots with the line identified. Grids of stellar spectra can be used for radial velocity-, rotation-, or abundance templates and for population synthesis. I am fitting spectra of bright stars to test the data and to produce atlases to guide observer. For each star the whole spectrum is computed from the UV to the far IR. The line data, opacities, models, spectra, and programs are freely distributed on CDs and on my web site and represent a unique resource for many NASA programs.

  7. Silicon Oxysulfide, OSiS: Rotational Spectrum, Quantum-Chemical Calculations, and Equilibrium Structure.

    PubMed

    Thorwirth, Sven; Mück, Leonie Anna; Gauss, Jürgen; Tamassia, Filippo; Lattanzi, Valerio; McCarthy, Michael C

    2011-06-02

    Silicon oxysulfide, OSiS, and seven of its minor isotopic species have been characterized for the first time in the gas phase at high spectral resolution by means of Fourier transform microwave spectroscopy. The equilibrium structure of OSiS has been determined from the experimental data using calculated vibration-rotation interaction constants. The structural parameters (rO-Si = 1.5064 Å and rSi-S = 1.9133 Å) are in very good agreement with values from high-level quantum chemical calculations using coupled-cluster techniques together with sophisticated additivity and extrapolation schemes. The bond distances in OSiS are very short in comparison with those in SiO and SiS. This unexpected finding is explained by the partial charges calculated for OSiS via a natural population analysis. The results suggest that electrostatic effects rather than multiple bonding are the key factors in determining bonding in this triatomic molecule. The data presented provide the spectroscopic information needed for radio astronomical searches for OSiS.

  8. Spectroscopic Characterization, Computational Investigation, and Comparisons of ECX – (E = As, P, and N; X = S and O) Anions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hou, Gao-Lei; Chen, Bo; Transue, Wesley J.

    Three newly-synthesized [Na+(221-kryptofix)] salts containing AsCO–, PCO–, and PCS– anions were successfully electrosprayed into the vacuum, and the ECX– (E = As, P; X = O, S) anions were investigated by negative ion photoelectron spectroscopy (NIPES) and high resolution photoelectron imaging spectroscopy. For each ECX– anion, a well-resolved NIPE spectrum was obtained, in which every major peak is split into a doublet. The splittings are attributed to spin-orbit coupling (SOC) in the ECX• radicals. Vibrational progressions in the NIPE spectra of ECX– were assigned to the symmetric and antisymmetric stretching modes in ECX• radicals. The electron affinities (EAs) and SOCmore » splittings of ECX• are determined from the NIPE spectra to be: AsCO•: EA = 2.414 ± 0.002 eV, SOC splitting = 988 cm-1; PCO•: EA = 2.670 ± 0.005 eV, SOC splitting = 175 cm-1; PCS•: EA = 2.850 ± 0.005 eV, SOC splitting = 300 cm-1. Calculations using the B3LYP, CASPT2, and CCSD(T) methods all predict linear geometries for both the anions and neutral radicals. The calculated EAs and SOC splittings for ECX• are in excellent agreement with the experimentally-measured values. The simulated NIPE spectra, based on the calculated Franck-Condon factors, and SOC splittings nicely reproduce all of the observed spectral peaks, thus allowing unambiguous spectral assignments. The finding that PCS has the greatest EA of the three triatomic molecules considered here is counterintuitive based upon electronegativity considerations, but understandable in terms of the HOMO of PCS– having the greatest degree of delocalization onto both terminal atoms.« less

  9. Surface patterning of GaAs under irradiation with very heavy polyatomic Au ions

    NASA Astrophysics Data System (ADS)

    Bischoff, L.; Böttger, R.; Heinig, K.-H.; Facsko, S.; Pilz, W.

    2014-08-01

    Self-organization of surface patterns on GaAs under irradiation with heavy polyatomic Au ions has been observed. The patterns depend on the ion mass, and the substrate temperature as well as the incidence angle of the ions. At room temperature, under normal incidence the surface remains flat, whereas above 200 °C nanodroplets of Ga appear after irradiation with monatomic, biatomic as well as triatomic Au ions of kinetic energies in the range of 10-30 keV per atom. In the intermediate temperature range of 100-200 °C meander- and dot-like patterns form, which are not related to Ga excess. Under oblique ion incidence up to 45° from the surface normal, at room temperature the surface remains flat for mon- and polyatomic Au ions. For bi- and triatomic ions in the range of 60° ≤ α ≤ 70° ripple patterns have been found, which become shingle-like for α ≥ 80°, whereas the surface remains flat for monatomic ions.

  10. The isolation and identification of Trypanosoma cruzi from raccoons in Maryland

    USGS Publications Warehouse

    Walton, B.C.; Bauman, P.M.; Diamond, L.S.; Herman, C.M.

    1958-01-01

    Five raccoons trapped at Patuxent Research Refuge, Laurel, Maryland, were found to have trypanosomes in the blood which were morphologically indistinguishable from Trypanosoma cruzi on stained smears. The organism grew well in culture. It developed and reproduced in Triatoma protracta, T. infestans, T. phyllosoma, and Rhodnius prolixus. Experimental infections were produced in raccoons, opossums, mice, rats, and monkeys by inoculation of blood, culture, and triatome forms. Typical leishmaniform bodies were found in tissue sections of cardiac muscle fibers from naturally and experimentally infected animals. Cross agglutinations carried out with Iiving cultural forms and rabbit antisera demonstrated a close antigenic relationship between the raccoon trypanosome and T. cruzi (Brazil strain). On the basis of (1) morphology, (2) presence of leishmaniform tissue stages, (3) development in triatomes, (4) infectivity to a variety of mammals, (5) culture characteristics, and (6) cross reactions in serological tests, this parasite is considered conspecific with Trypanosoma cruzi (Chagas, 1909), the causative agent of American human trypanosomiasis.

  11. Prospects for P-bearing molecules in cometary atmospheres

    NASA Astrophysics Data System (ADS)

    Boice, Daniel; de Almeida, Amaury

    Phosphorus is a key element in all known forms of life and phosphorus-bearing compounds have been observed in space. Phosphorus is ubiquitous in meteorites, albeit in small quantities, with phosphates being found in stoney meteorites and phosphides have been identified in iron meteorites. It has been detected as part of the dust component in comet Halley but searches for P-bearing species in the gas phase in comets have been unsuccessful. Based of its moderate cosmic abundance (eighteenth most abundant element, [P]/[N] = 4 x 10-3 ) and the positive identification of P-bearing species in the interstellar medium (such as, PN, PC, HCP and PO), we would expect simple molecules, diatomics (like PH, PO, PC, PS), triatomics (like HCP and PH2 ), and possibly other polyatomics (like phosphine PH3 and diphosphine P2 H4 ), to exist in cometary ices, hence released into the gas phase upon ice sublimation. Our fluid dynamics model with chemistry of cometary comae (SUISEI) has been adapted to study this problem. SUISEI produces cometocentric abundances of the coma gas species; velocities of the bulk gas, light atomic and molecular hydrogen with escape, and electrons; gas and electron temperatures; column densities to facilitate comparison with observations; coma energy budget quantities; attenuation of the solar irradiance; and other quantities that can be related readily to observations. We present results from the first quantitative study of phosphorus-bearing molecules in comets to identify likely species containing phosphorus to aid in future searches for this important element in comets, possibly shedding light on issues of comet formation (time and place) and matters of the prebiotic to biotic evolution of life. Acknowledgements. This work was supported by the NSF Planetary Astronomy Program.

  12. Laboratory measurements and astronomical search for the HSO radical★★

    PubMed Central

    Cazzoli, Gabriele; Lattanzi, Valerio; Kirsch, Till; Gauss, Jürgen; Tercero, Belén; Cernicharo, José; Puzzarini, Cristina

    2016-01-01

    Context Despite the fact that many sulfur-bearing molecules, ranging from simple diatomic species up to astronomical complex molecules, have been detected in the interstellar medium, the sulfur chemistry in space is largely unknown and a depletion in the abundance of S-containing species has been observed in the cold, dense interstellar medium (ISM). The chemical form of the missing sulfur has yet to be identified. Aims For these reasons, in view of the fact that there is a large abundance of triatomic species harbouring sulfur, oxygen, and hydrogen, we decided to investigate the HSO radical in the laboratory to try its astronomical detection. Methods High-resolution measurements of the rotational spectrum of the HSO radical were carried out within a frequency range well up into the THz region. Subsequently, a rigorous search for HSO in the two most studied high-mass star-forming regions, Orion KL and Sagittarius (Sgr) B2, and in the cold dark cloud Barnard 1 (B1-b) was performed. Results The frequency coverage and the spectral resolution of our measurements allowed us to improve and extend the existing dataset of spectroscopic parameters, thus enabling accurate frequency predictions up to the THz range. These were used to derive the synthetic spectrum of HSO, by means of the MADEX code, according to the physical parameters of the astronomical source under consideration. For all sources investigated, the lack of HSO lines above the confusion limit of the data is evident. Conclusions The derived upper limit to the abundance of HSO clearly indicates that this molecule does not achieve significant abundances in either the gas phase or in the ice mantles of dust grains. PMID:27721513

  13. Semiclassical Wigner theory of photodissociation in three dimensions: Shedding light on its basis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arbelo-González, W.; CNRS, Institut des Sciences Moléculaires, UMR 5255, 33405 Talence; Université Bordeaux, Institut des Sciences Moléculaires, UMR 5255, 33405 Talence

    2015-04-07

    The semiclassical Wigner theory (SCWT) of photodissociation dynamics, initially proposed by Brown and Heller [J. Chem. Phys. 75, 186 (1981)] in order to describe state distributions in the products of direct collinear photodissociations, was recently extended to realistic three-dimensional triatomic processes of the same type [Arbelo-González et al., Phys. Chem. Chem. Phys. 15, 9994 (2013)]. The resulting approach, which takes into account rotational motions in addition to vibrational and translational ones, was applied to a triatomic-like model of methyl iodide photodissociation and its predictions were found to be in nearly quantitative agreement with rigorous quantum results, but at a muchmore » lower computational cost, making thereby SCWT a potential tool for the study of polyatomic reaction dynamics. Here, we analyse the main reasons for this agreement by means of an elementary model of fragmentation explicitly dealing with the rotational motion only. We show that our formulation of SCWT makes it a semiclassical approximation to an approximate planar quantum treatment of the dynamics, both of sufficient quality for the whole treatment to be satisfying.« less

  14. Intermolecular Coulombic Decay (ICD) Occuring in Triatomic Molecular Dimer

    NASA Astrophysics Data System (ADS)

    Iskandar, Wael; Gatton, Averell; Gaire, Bishwanath; Champenois, Elio; Larsen, Kirk; Shivaram, Niranjan; Moradmand, Ali; Severt, Travis; Williams, Joshua; Slaughter, Daniel; Weber, Thorsten

    2017-04-01

    For over two decades, the production of ICD process has been extensively investigated theoretically and experimentally in different systems bounded by a week force (ex. van-der-Waals or Hydrogen force). Furthermore, the ICD process has been demonstrated a strong implication in biological system (DNA damage and DNA repair mechanism) because of the production of genotoxic low energy electrons during the decay cascade. Studying large complex system such as triatomic molecular dimer may be helpful for further exploration of ``Auger electron driven cancer therapy''. The present experiment investigates the dissociation dynamics happened in collision between a photons and CO2 dimer. We will focus more specifically on the CO2++CO2+ fragmentation channel and the detection in coincidence of the two ionic fragments and the two electrons will be done using a COld Target Recoil Ion Momentum Spectroscopy (COLTRIMS). The measurements of the Kinetic Energy Release of the two fragments and the relative angular distribution of the electrons in the molecular frame reveal that the ICD is the only mechanism responsible for the production of this fragmentation channel.

  15. New Wavenumber Calibration Tables From Heterodyne Frequency Measurements

    PubMed Central

    Maki, Arthur G.; Wells, Joseph S.

    1992-01-01

    This new calibration atlas is based on frequency rather than wavelength calibration techniques for absolute references. Since a limited number of absolute frequency measurements is possible, additional data from alternate methodology are used for difference frequency measurements within each band investigated by the frequency measurements techniques. Data from these complementary techniques include the best Fourier transform measurements available. Included in the text relating to the atlas are a description of the heterodyne frequency measurement techniques and details of the analysis, including the Hamiltonians and least-squares-fitting and calculation. Also included are other relevant considerations such as intensities and lincshape parameters. A 390-entry bibliography which contains all data sources used and a subsequent section on errors conclude the text portion. The primary calibration molecules are the linear triatomics, carbonyl sulfide and nitrous oxide, which cover portions of the infrared spectrum ranging from 488 to 3120 cm−1. Some gaps in the coverage afforded by OCS and N2O are partially covered by NO, CO, and CS2. An additional region from 4000 to 4400 cm−1 is also included. The tabular portion of the atlas is too lengthy to include in an archival journal. Furthermore, different users have different requirements for such an atlas. In an effort to satisfy most users, we have made two different options available. The first is NIST Special Publication 821, which has a spectral map/facing table format. The spectral maps (as well as the facing tables) are calculated from molecular constants derived for the work. A complete list of all of the molecular transitions that went into making the maps is too long (perhaps by a factor of 4 or 5) to include in the facing tables. The second option for those not interested in maps (or perhaps to supplement Special Publication 821) is the complete list (tables-only) which is available in computerized format as NIST Standard Reference Database #39, Wavelength Calibration Tables. PMID:28053441

  16. All-Dimensional H2–CO Potential: Validation with Fully Quantum Second Virial Coefficients

    PubMed Central

    Garberoglio, Giovanni; Jankowski, Piotr; Szalewicz, Krzysztof; Harvey, Allan H.

    2017-01-01

    We use a new high-accuracy all-dimensional potential to compute the cross second virial coefficient B12(T) between molecular hydrogen and carbon monoxide. The path-integral method is used to fully account for quantum effects. Values are calculated from 10 K to 2000 K and the uncertainty of the potential is propagated into uncertainties of B12. Our calculated B12(T) are in excellent agreement with most of the limited experimental data available, but cover a much wider range of temperatures and have lower uncertainties. Similar to recently reported findings from scattering calculations, we find that the reduced-dimensionality potential obtained by averaging over the rovibrational motion of the monomers gives results that are a good approximation to those obtained when flexibility is fully taken into account. Also, the four-dimensional approximation with monomers taken at their vibrationally averaged bond lengths works well. This finding is important, since full-dimensional potentials are difficult to develop even for triatomic monomers and are not currently possible to obtain for larger molecules. Likewise, most types of accurate quantum mechanical calculations, e.g., spectral or scattering, are severely limited in the number of dimensions that can be handled. PMID:28178790

  17. All-dimensional H2-CO potential: Validation with fully quantum second virial coefficients.

    PubMed

    Garberoglio, Giovanni; Jankowski, Piotr; Szalewicz, Krzysztof; Harvey, Allan H

    2017-02-07

    We use a new high-accuracy all-dimensional potential to compute the cross second virial coefficient B 12 (T) between molecular hydrogen and carbon monoxide. The path-integral method is used to fully account for quantum effects. Values are calculated from 10 K to 2000 K and the uncertainty of the potential is propagated into uncertainties of B 12 . Our calculated B 12 (T) are in excellent agreement with most of the limited experimental data available, but cover a much wider range of temperatures and have lower uncertainties. Similar to recently reported findings from scattering calculations, we find that the reduced-dimensionality potential obtained by averaging over the rovibrational motion of the monomers gives results that are a good approximation to those obtained when flexibility is fully taken into account. Also, the four-dimensional approximation with monomers taken at their vibrationally averaged bond lengths works well. This finding is important, since full-dimensional potentials are difficult to develop even for triatomic monomers and are not currently possible to obtain for larger molecules. Likewise, most types of accurate quantum mechanical calculations, e.g., spectral or scattering, are severely limited in the number of dimensions that can be handled.

  18. Dissociation energies of six NO2 isotopologues by laser induced fluorescence spectroscopy and zero point energy of some triatomic molecules.

    PubMed

    Michalski, G; Jost, R; Sugny, D; Joyeux, M; Thiemens, M

    2004-10-15

    We have measured the rotationless photodissociation threshold of six isotopologues of NO2 containing 14N, 15N, 16O, and 18O isotopes using laser induced fluorescence detection and jet cooled NO2 (to avoid rotational congestion). For each isotopologue, the spectrum is very dense below the dissociation energy while fluorescence disappears abruptly above it. The six dissociation energies ranged from 25 128.56 cm(-1) for 14N16O2 to 25 171.80 cm(-1) for 15N18O2. The zero point energy for the NO2 isotopologues was determined from experimental vibrational energies, application of the Dunham expansion, and from canonical perturbation theory using several potential energy surfaces. Using the experimentally determined dissociation energies and the calculated zero point energies of the parent NO2 isotopologue and of the NO product(s) we determined that there is a common De = 26 051.17+/-0.70 cm(-1) using the Born-Oppenheimer approximation. The canonical perturbation theory was then used to calculate the zero point energy of all stable isotopologues of SO2, CO2, and O3, which are compared with previous determinations.

  19. Fit Point-Wise AB Initio Calculation Potential Energies to a Multi-Dimension Long-Range Model

    NASA Astrophysics Data System (ADS)

    Zhai, Yu; Li, Hui; Le Roy, Robert J.

    2016-06-01

    A potential energy surface (PES) is a fundamental tool and source of understanding for theoretical spectroscopy and for dynamical simulations. Making correct assignments for high-resolution rovibrational spectra of floppy polyatomic and van der Waals molecules often relies heavily on predictions generated from a high quality ab initio potential energy surface. Moreover, having an effective analytic model to represent such surfaces can be as important as the ab initio results themselves. For the one-dimensional potentials of diatomic molecules, the most successful such model to date is arguably the ``Morse/Long-Range'' (MLR) function developed by R. J. Le Roy and coworkers. It is very flexible, is everywhere differentiable to all orders. It incorporates correct predicted long-range behaviour, extrapolates sensibly at both large and small distances, and two of its defining parameters are always the physically meaningful well depth {D}_e and equilibrium distance r_e. Extensions of this model, called the Multi-Dimension Morse/Long-Range (MD-MLR) function, linear molecule-linear molecule systems and atom-non-linear molecule system. have been applied successfully to atom-plus-linear molecule, linear molecule-linear molecule and atom-non-linear molecule systems. However, there are several technical challenges faced in modelling the interactions of general molecule-molecule systems, such as the absence of radial minima for some relative alignments, difficulties in fitting short-range potential energies, and challenges in determining relative-orientation dependent long-range coefficients. This talk will illustrate some of these challenges and describe our ongoing work in addressing them. Mol. Phys. 105, 663 (2007); J. Chem. Phys. 131, 204309 (2009); Mol. Phys. 109, 435 (2011). Phys. Chem. Chem. Phys. 10, 4128 (2008); J. Chem. Phys. 130, 144305 (2009) J. Chem. Phys. 132, 214309 (2010) J. Chem. Phys. 140, 214309 (2010)

  20. Linear electric field time-of-flight ion mass spectrometer

    DOEpatents

    Funsten, Herbert O [Los Alamos, NM; Feldman, William C [Los Alamos, NM

    2008-06-10

    A linear electric field ion mass spectrometer having an evacuated enclosure with means for generating a linear electric field located in the evacuated enclosure and means for injecting a sample material into the linear electric field. A source of pulsed ionizing radiation injects ionizing radiation into the linear electric field to ionize atoms or molecules of the sample material, and timing means determine the time elapsed between ionization of atoms or molecules and arrival of an ion out of the ionized atoms or molecules at a predetermined position.

  1. Superradiance Effects in the Linear and Nonlinear Optical Response of Quantum Dot Molecules

    NASA Astrophysics Data System (ADS)

    Sitek, A.; Machnikowski, P.

    2008-11-01

    We calculate the linear optical response from a single quantum dot molecule and the nonlinear, four-wave-mixing response from an inhomogeneously broadened ensemble of such molecules. We show that both optical signals are affected by the coupling-dependent superradiance effect and by optical interference between the two polarizations. As a result, the linear and nonlinear responses are not identical.

  2. Hydrogen scrambling in ethane induced by intense laser fields: statistical analysis of coincidence events.

    PubMed

    Kanya, Reika; Kudou, Tatsuya; Schirmel, Nora; Miura, Shun; Weitzel, Karl-Michael; Hoshina, Kennosuke; Yamanouchi, Kaoru

    2012-05-28

    Two-body Coulomb explosion processes of ethane (CH(3)CH(3)) and its isotopomers (CD(3)CD(3) and CH(3)CD(3)) induced by an intense laser field (800 nm, 1.0 × 10(14) W/cm(2)) with three different pulse durations (40 fs, 80 fs, and 120 fs) are investigated by a coincidence momentum imaging method. On the basis of statistical treatment of the coincidence data, the contributions from false coincidence events are estimated and the relative yields of the decomposition pathways are determined with sufficiently small uncertainties. The branching ratios of the two body decomposition pathways of CH(3)CD(3) from which triatomic hydrogen molecular ions (H(3)(+), H(2)D(+), HD(2)(+), D(3)(+)) are ejected show that protons and deuterons within CH(3)CD(3) are scrambled almost statistically prior to the ejection of a triatomic hydrogen molecular ion. The branching ratios were estimated by statistical Rice-Ramsperger-Kassel-Marcus calculations by assuming a transition state with a hindered-rotation of a diatomic hydrogen moiety. The hydrogen scrambling dynamics followed by the two body decomposition processes are discussed also by using the anisotropies in the ejection directions of the fragment ions and the kinetic energy distribution of the two body decomposition pathways.

  3. New symmetry of the cluster model

    NASA Astrophysics Data System (ADS)

    Gai, Moshe

    2015-10-01

    A new approach to clustering in the frame of the Algebraic Cluster Model (ACM) has been developed. It predicts rotation-vibration structure with rotational band of an oblate equilateral triangular spinning top with a 𝒟3h symmetry characterized by the sequence of states: 0+, 2+, 3-, 4±, 5- with almost degenerate 4+ and 4- (parity doublet) states. Our measurement of the new 22+ and the measured of the new 5- state in 12C fit very well to the predicted (ground state) rotational band structure with the sequence of states: 0+, 2+, 3-, 4±, 5- with almost degenerate 4+ and 4- (parity doublet) states. Such a 𝒟3h symmetry was observed in triatomic molecules, and it is observed in 12C for the first time in nuclear physics. We discuss a classification of other rotation-vibration bands in 12C such as the (0+) Hoyle band and the (1-) bending mode band and suggest measurements in search of the predicted ("missing") states that may shed new light on clustering in 12C and light nuclei. In particular, the observation (or non observation) of the predicted ("missing") states in the Hoyle band will allow us to conclude the geometrical arrangement of the three alpha particles composing the Hoyle state at 7.654 MeV in 12C.

  4. Modeling Photoelectron Spectra of CuO, Cu2O, and CuO2 Anions with Equation-of-Motion Coupled-Cluster Methods: An Adventure in Fock Space.

    PubMed

    Orms, Natalie; Krylov, Anna I

    2018-04-12

    The experimental photoelectron spectra of di- and triatomic copper oxide anions have been reported previously. We present an analysis of the experimental spectra of the CuO - , Cu 2 O - , and CuO 2 - anions using equation-of-motion coupled-cluster (EOM-CC) methods. The open-shell electronic structure of each molecule demands a unique combination of EOM-CC methods to achieve an accurate and balanced representation of the multiconfigurational anionic- and neutral-state manifolds. Analysis of the Dyson orbitals associated with photodetachment from CuO - reveals the strong non-Koopmans character of the CuO states. For the lowest detachment energy, a good agreement between theoretical and experimental values is obtained with CCSD(T) (coupled-cluster with single and double excitations and perturbative account of triple excitations). The (T) correction is particularly important for Cu 2 O - . Use of a relativistic pseudopotential and matching basis set improves the quality of results in most cases. EOM-DIP-CCSD analysis of the low-lying states of CuO 2 - reveals multiple singlet and triplet anionic states near the triplet ground state, adding an extra layer of complexity to the interpretation of the experimental CuO 2 - photoelectron spectrum.

  5. Method and source for producing a high concentration of positively charged molecular hydrogen or deuterium ions

    DOEpatents

    Ehlers, K.W.; Leung, K.N.

    1983-07-26

    One principal object of the present invention is to provide a novel method and apparatus for generating a high concentration of H/sub 2//sup +/ or D/sub 2//sup +/ ions by using a new and improved multicusp ion source. The basic principle in achieving a high percentage of H/sub 2//sup +/ or D/sub 2//sup +/ ions is to extract them from the source as soon as they are produced. Otherwise they will react with background gas molecules to form tri-atomic ions H/sub 3//sup +/ or D/sub 3//sup +/ or be dissociated by electrons. The former reaction H/sub 2//sup +/ + H/sub 2/ ..-->.. H/sub 3//sup +/ + H can have a very short mean free path length lambda. Assuming a background neutral gas density of approximately 3.3 x 10/sup 13/ cm/sup -3/ and a cross-section sigma of approximately 6 x 10/sup -15/ cm/sup 2/, lambda = (n/sub 0/ sigma)/sup -1/ is estimated to be about 5 cm. Thus the distance traversed by the H/sub 2//sup +/ ion before it arrives at the extractor electrode cannot exceed this value. This in turn sets a limit on the length of the source chamber.

  6. Comparative Spectra of Oxygen-Rich Versus Carbon-Rich Circumstellar Shells: VY Canis Majoris and IRC(plus)10216 at 215-285 GHz

    NASA Technical Reports Server (NTRS)

    Tenebaum, E. D.; Dodd, J. L.; Milam, S. N.; Woolf, N. J.; Ziurys, L. M.

    2010-01-01

    A sensitive (1sigma rms at 1 MHz resolution approx.3 mK) 1 mm spectral line survey (214.5-285.5 GHz) of VY Canis Majoris (VY CMa) and IRC +10216 has been conducted to compare the chemistries of oxygen- and carbon-rich circumstellar envelopes. This study was carried out using the Submillimeter Telescope of the Arizona Radio Observatory with a new Atacama Large Millimeter Array type receiver. This survey is the first to chemically characterize an O-rich circumstellar shell at millimeter wavelengths. In VY CMa, 128 emission features were detected arising from 18 different molecules; and in IRC +10216, 720 lines were observed, assigned to 32 different species. The 1 mm spectrum of VY CMa is dominated by SO, and SiS; in IRC +10216, C4H and SiC2 are the most recurrent species. Ten molecules were common to both sources: CO, SiS, SiO, CS, CN, HCN, HNC, NaCl, PN, and HCO(+). Sulfur plays an important role in VY CMa, but saturated/ unsaturated carbon dominates the molecular content of IRC +102.16, producing CH2NH, for example. Although the molecular complexity of IRC +10216 is greater, VY CMa supports a unique "inorganic" chemistry leading to the oxides PO, AlO, and AlOH. Only diatomic and triatomic compounds were observed in VY CMa, while species with four or more atoms are common in IRC +10216, reflecting carbon's ability to form multiple strong bonds, unlike oxygen. In VY CMa, a new water maser (v2 = 2) has been found, as well as vibrationally excited NaCl. Toward IRC +10216, vibrationally excited CCH was detected for the first time.

  7. Comparative Spectra of Oxygen-rich Versus Carbon-rich Circumstellar Shells: VY Canis Majoris and IRC +10216 at 215-285 GHz

    NASA Astrophysics Data System (ADS)

    Tenenbaum, E. D.; Dodd, J. L.; Milam, S. N.; Woolf, N. J.; Ziurys, L. M.

    2010-09-01

    A sensitive (1σ rms at 1 MHz resolution ~3 mK) 1 mm spectral line survey (214.5-285.5 GHz) of VY Canis Majoris (VY CMa) and IRC +10216 has been conducted to compare the chemistries of oxygen- and carbon-rich circumstellar envelopes. This study was carried out using the Submillimeter Telescope of the Arizona Radio Observatory with a new Atacama Large Millimeter Array type receiver. This survey is the first to chemically characterize an O-rich circumstellar shell at millimeter wavelengths. In VY CMa, 128 emission features were detected arising from 18 different molecules; and in IRC +10216, 720 lines were observed, assigned to 32 different species. The 1 mm spectrum of VY CMa is dominated by SO2 and SiS; in IRC +10216, C4H and SiC2 are the most recurrent species. Ten molecules were common to both sources: CO, SiS, SiO, CS, CN, HCN, HNC, NaCl, PN, and HCO+. Sulfur plays an important role in VY CMa, but saturated/unsaturated carbon dominates the molecular content of IRC +10216, producing CH2NH, for example. Although the molecular complexity of IRC +10216 is greater, VY CMa supports a unique "inorganic" chemistry leading to the oxides PO, AlO, and AlOH. Only diatomic and triatomic compounds were observed in VY CMa, while species with four or more atoms are common in IRC +10216, reflecting carbon's ability to form multiple strong bonds, unlike oxygen. In VY CMa, a new water maser (v 2 = 2) has been found, as well as vibrationally excited NaCl. Toward IRC +10216, vibrationally excited CCH was detected for the first time.

  8. Components of the Bond Energy in Polar Diatomic Molecules, Radicals, and Ions Formed by Group-1 and Group-2 Metal Atoms.

    PubMed

    Yu, Haoyu; Truhlar, Donald G

    2015-07-14

    Although many transition metal complexes are known to have high multireference character, the multireference character of main-group closed-shell singlet diatomic molecules like BeF, CaO, and MgO has been less studied. However, many group-1 and group-2 diatomic molecules do have multireference character, and they provide informative systems for studying multireference character because they are simpler than transition metal compounds. The goal of the present work is to understand these multireference systems better so that, ultimately, we can apply what we learn to more complicated multireference systems and to the design of new exchange-correlation functionals for treating multireference systems more adequately. Fourteen main-group diatomic molecules and one triatomic molecule (including radicals, cations, and anions, as well as neutral closed-shell species) have been studied for this article. Eight of these molecules contain a group-1 element, and six contain a group-2 element. Seven of these molecules are multireference systems, and eight of them are single-reference systems. Fifty-three exchange-correlation functionals of 11 types [local spin-density approximation (LSDA), generalized gradient approximation (GGA), nonseparable gradient approximation (NGA), global-hybrid GGA, meta-GGA, meta-NGA, global-hybrid meta GGA, range-separated hybrid GGA, range-separated hybrid meta-GGA, range-separated hybrid meta-NGA, and DFT augmented with molecular mechanics damped dispersion (DFT-D)] and the Hartree-Fock method have been applied to calculate the bond distance, bond dissociation energy (BDE), and dipole moment of these molecules. All of the calculations are converged to a stable solution by allowing the symmetry of the Slater determinant to be broken. A reliable functional should not only predict an accurate BDE but also predict accurate components of the BDE, so each bond dissociation energy has been decomposed into ionization potential (IP) of the electropositive element, electron affinity of the electronegative bonding partner (EA), atomic excitation energy (EE) to prepare the valence states of the interacting partners, and interaction energy (IE) of the valence-prepared states. Adding Hartree-Fock exchange helps to obtain better results for atomic excitation energy, and this leads to improvements in getting the right answer for the right reason. The following functionals are singled out for reasonably good performance on all three of bond distance, BDE, and dipole moment: B97-1, B97-3, MPW1B95, M05, M06, M06-2X, M08-SO, N12-SX, O3LYP, TPSS, τ-HCTHhyb, and GAM; all but two (TPSS and GAM) of these functionals are hybrid functionals.

  9. Quantum monodromy and quantum phase transitions in floppy molecules

    NASA Astrophysics Data System (ADS)

    Larese, Danielle

    2012-10-01

    A simple algebraic Hamiltonian has been used to explore the vibrational and rotational spectra of the skeletal bending modes of HCNO, BrCNO, NCNCS, and other "floppy" (quasi-linear or quasi-bent) molecules. These molecules have large-amplitude, low-energy bending modes and champagne-bottle potential surfaces, making them good candidates for observing quantum phase transitions (QPT). We describe the geometric phase transitions from bent to linear in these and other non-rigid molecules, quantitatively analyzing the spectroscopic signatures of ground state QPT, excited state QPT, and quantum monodromy. The algebraic framework is ideal for this work because of its small calculational effort yet robust results. Although these methods have historically found success with tri-and four-atomic molecules, we now address five-atomic and simple branched molecules such as CH3NCO and GeH3NCO. Extraction of potential functions are completed for several molecules, resulting in predictions of barriers to linearity and equilibrium bond angles.

  10. Line Intensity Measurements in 14N 216O and Their Treatment Using the Effective Dipole Moment Approach . I. The 4300- to 5200-cm -1 Region

    NASA Astrophysics Data System (ADS)

    Daumont, L.; Auwera, J. Vander; Teffo, J.-L.; Perevalov, V. I.; Tashkun, S. A.

    2001-08-01

    This work continues a series of publications devoted to the application of the effective operator approach to the vibrational-rotational treatment of linear triatomic molecules, aiming at the analysis and prediction of their infrared spectra. In that frame work, we have started a large-scale work aiming at the global description of line intensities of cold and hot bands of 14N216O in its ground electronic state in the spectral range above 3600 cm-1. In 14N216O, vibrational interacting levels group in polyads as a result of the relation 2ω1≈4ω2≈ω3 existing between the harmonic frequencies. The polyads are identified by the so-called polyad number P=2V1+V2+4V3. The work described in the present paper concerns bands associated with transitions corresponding to ΔP=7, 8, and 9. The absorption spectra of N2O at room temperature have been recorded at a resolution of 0.007 cm-1 in the range from 4300 to 5200 cm-1 using a Bruker IFS120HR Fourier transform spectrometer. Sample pressure/absorption path length products ranging from 7 to 1753 mbar × m have been used. More than 3000 absolute line intensities have been measured in 66 different bands belonging to the ΔP=7, 8, and 9 series. Dicke narrowing has been observed in the high-pressure spectra. Using wavefunctions previously determined from a global fit of an effective Hamiltonian to about 18,000 line positions (S. A. Tashkun, V. I. Perevalov, and J.-L. Teffo to be published), the experimental intensities measured in this work and by R. A. Toth (J. Mol. Spectrosc.197, 158-187 (1999)) were fitted to 47 parameters of a corresponding effective dipole moment, with residuals very close to the experimental uncertainty. Exa mples are given showing that the modeling reproduces intensities of perturbed lines well.

  11. Fastest Formation Routes of Nanocarbons in Solution Plasma Processes.

    PubMed

    Morishita, Tetsunori; Ueno, Tomonaga; Panomsuwan, Gasidit; Hieda, Junko; Yoshida, Akihito; Bratescu, Maria Antoaneta; Saito, Nagahiro

    2016-11-14

    Although solution-plasma processing enables room-temperature synthesis of nanocarbons, the underlying mechanisms are not well understood. We investigated the routes of solution-plasma-induced nanocarbon formation from hexane, hexadecane, cyclohexane, and benzene. The synthesis rate from benzene was the highest. However, the nanocarbons from linear molecules were more crystalline than those from ring molecules. Linear molecules decomposed into shorter olefins, whereas ring molecules were reconstructed in the plasma. In the saturated ring molecules, C-H dissociation proceeded, followed by conversion into unsaturated ring molecules. However, unsaturated ring molecules were directly polymerized through cation radicals, such as benzene radical cation, and were converted into two- and three-ring molecules at the plasma-solution interface. The nanocarbons from linear molecules were synthesized in plasma from small molecules such as C 2 under heat; the obtained products were the same as those obtained via pyrolysis synthesis. Conversely, the nanocarbons obtained from ring molecules were directly synthesized through an intermediate, such as benzene radical cation, at the interface between plasma and solution, resulting in the same products as those obtained via polymerization. These two different reaction fields provide a reasonable explanation for the fastest synthesis rate observed in the case of benzene.

  12. Fastest Formation Routes of Nanocarbons in Solution Plasma Processes

    PubMed Central

    Morishita, Tetsunori; Ueno, Tomonaga; Panomsuwan, Gasidit; Hieda, Junko; Yoshida, Akihito; Bratescu, Maria Antoaneta; Saito, Nagahiro

    2016-01-01

    Although solution-plasma processing enables room-temperature synthesis of nanocarbons, the underlying mechanisms are not well understood. We investigated the routes of solution-plasma-induced nanocarbon formation from hexane, hexadecane, cyclohexane, and benzene. The synthesis rate from benzene was the highest. However, the nanocarbons from linear molecules were more crystalline than those from ring molecules. Linear molecules decomposed into shorter olefins, whereas ring molecules were reconstructed in the plasma. In the saturated ring molecules, C–H dissociation proceeded, followed by conversion into unsaturated ring molecules. However, unsaturated ring molecules were directly polymerized through cation radicals, such as benzene radical cation, and were converted into two- and three-ring molecules at the plasma–solution interface. The nanocarbons from linear molecules were synthesized in plasma from small molecules such as C2 under heat; the obtained products were the same as those obtained via pyrolysis synthesis. Conversely, the nanocarbons obtained from ring molecules were directly synthesized through an intermediate, such as benzene radical cation, at the interface between plasma and solution, resulting in the same products as those obtained via polymerization. These two different reaction fields provide a reasonable explanation for the fastest synthesis rate observed in the case of benzene. PMID:27841288

  13. Atmospheric Triatomic Molecular Studies.

    DTIC Science & Technology

    1980-11-17

    ADORE.SS(Jf dlII.,.nt tra 05), tivl 15, SECURITY CLA’.SS. (of this rwpofl) __ 1 P7 jl / 15&. DECLASSJFI CAT DJGft*114I1 -J SCmEDULE If- DiSTRIBUT ION...work in Table I are given in Appendix I. I (3) 41 S. - I + t/n LU ) *C14~ & c .) a)Z. W i 0 0 uL a) NCDNN N 0 4-3 0) cl b -4 cu a x of acca Lm %- a

  14. Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal

    NASA Astrophysics Data System (ADS)

    Deymier, P. A.; Runge, K.

    2018-03-01

    A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

  15. An Algebraic Method for Exploring Quantum Monodromy and Quantum Phase Transitions in Non-Rigid Molecules

    NASA Astrophysics Data System (ADS)

    Larese, D.; Iachello, F.

    2011-06-01

    A simple algebraic Hamiltonian has been used to explore the vibrational and rotational spectra of the skeletal bending modes of HCNO, BrCNO, NCNCS, and other ``floppy`` (quasi-linear or quasi-bent) molecules. These molecules have large-amplitude, low-energy bending modes and champagne-bottle potential surfaces, making them good candidates for observing quantum phase transitions (QPT). We describe the geometric phase transitions from bent to linear in these and other non-rigid molecules, quantitatively analysing the spectroscopy signatures of ground state QPT, excited state QPT, and quantum monodromy.The algebraic framework is ideal for this work because of its small calculational effort yet robust results. Although these methods have historically found success with tri- and four-atomic molecules, we now address five-atomic and simple branched molecules such as CH_3NCO and GeH_3NCO. Extraction of potential functions is completed for several molecules, resulting in predictions of barriers to linearity and equilibrium bond angles.

  16. Energetic Diagrams and Structural Properties of Monohaloacetylenes HC≡CX (X = F, Cl, Br).

    PubMed

    Khiri, D; Hochlaf, M; Chambaud, G

    2016-08-04

    Highly correlated electronic wave functions within the Multi Reference Configuration Interaction (MRCI) approach are used to study the stability and the formation processes of the monohaloacetylenes HCCX and monohalovinylidenes C2HX (X = F, Cl, Br) in their electronic ground state. These tetra-atomics can be formed through the reaction of triatomic fragments C2F, C2Cl, and C2Br with a hydrogen atom or of C2H with halogen atoms via barrierless reactions, whereas the reactions between the diatomics [C2 + HX] need to overcome barriers of 1.70, 0.89, and 0.58 eV for X = F, Cl, and Br. It is found that the linear HCCX isomers, in singlet symmetry, are more stable than the singlet C2HX iso-forms by 1.995, 2.083, and 1.958 eV for X = F, Cl, and Br. The very small isomerization barriers from iso to linear forms are calculated 0.067, 0.044, and 0.100 eV for F, Cl, and Br systems. The dissociation energies of the HCCX systems (without ZPE corrections), resulting from the breaking of the CX bond, are calculated to be 5.647, 4.691, and 4.129 eV for X = F, Cl, Br, respectively. At the equilibrium geometry of the X(1)Σ(+) state of HCCX, the vertical excitation energies in singlet and triplet symmetries are all larger than the respective dissociation energies. Stable excited states are found only as (3)A', (3)A″, and (1)A″ monohalovinylidene structures.

  17. Nonadiabatic effects in ultracold molecules via anomalous linear and quadratic Zeeman shifts.

    PubMed

    McGuyer, B H; Osborn, C B; McDonald, M; Reinaudi, G; Skomorowski, W; Moszynski, R; Zelevinsky, T

    2013-12-13

    Anomalously large linear and quadratic Zeeman shifts are measured for weakly bound ultracold 88Sr2 molecules near the intercombination-line asymptote. Nonadiabatic Coriolis coupling and the nature of long-range molecular potentials explain how this effect arises and scales roughly cubically with the size of the molecule. The linear shifts yield nonadiabatic mixing angles of the molecular states. The quadratic shifts are sensitive to nearby opposite f-parity states and exhibit fourth-order corrections, providing a stringent test of a state-of-the-art ab initio model.

  18. Conserved linear dynamics of single-molecule Brownian motion.

    PubMed

    Serag, Maged F; Habuchi, Satoshi

    2017-06-06

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  19. Conserved linear dynamics of single-molecule Brownian motion

    PubMed Central

    Serag, Maged F.; Habuchi, Satoshi

    2017-01-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance. PMID:28585925

  20. Conserved linear dynamics of single-molecule Brownian motion

    NASA Astrophysics Data System (ADS)

    Serag, Maged F.; Habuchi, Satoshi

    2017-06-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  1. Approximate theoretical model for the five electronic states ( Ω = 5/2, 3/2, 3/2, 1/2, 1/2) arising from the ground 3d 9 configuration in nickel halide molecules and for rotational levels of the two Ω = 1/2 states in that manifold

    NASA Astrophysics Data System (ADS)

    Hougen, Jon T.

    2011-05-01

    In the first part of this paper an effective Hamiltonian for a non-rotating diatomic molecule containing only crystal-field and spin-orbit operators is set up to describe the energies of the five spin-orbit components that arise in the ground electronic configuration of the nickel monohalides. The model assumes that bonding in the nickel halides has the approximate form Ni +X -, with an electronic 3d 9 configuration plus closed shells on the Ni + moiety and a closed shell configuration on the X - moiety. From a crystal-field point of view, interactions of the positive d-hole with the cylindrically symmetrical electric charge distribution of the hypothetical NiX - closed-shell core can then be parameterized by three terms in a traditional expansion in spherical harmonics: C0 + C2Y20( θ, ϕ) + C4Y40( θ, ϕ). Interaction of the hole with the magnetic field generated by its own orbital motion can be parameterized by a traditional spin-orbit interaction operator A L · S. The Hamiltonian matrix is set up in a basis set consisting of the 10 Hund's case (a) basis functions | L, Λ; S , Σ> that arise when L = 2 and S = 1/2. Least-squares fits of the observed five spin-orbit components of the three lowest electronic states in NiF and NiCl are then carried out in terms of the four parameters C0, C2, C4, and A which lead to good agreement, except for the two | Ω| = 1/2 states. The large equal and opposite residuals of the | Ω| = 1/2 states can be reduced to values comparable with those for the | Ω| = 3/2 and | Ω| = 5/2 states by fixing A to its value in Ni + and then introducing an empirical correction factor for one off-diagonal orbital matrix element. In the second part of this paper the usual effective Hamiltonian B( J- L- S) 2 for a rotating diatomic molecule is used to derive expressions for the Ω-type doubling parameter p in the two | Ω| = 1/2 states. These expressions show (for certain sign conventions) that the sum of the two p values should be -2 B, but that their difference can vary between -10 B and +10 B. These theoretical results are in good agreement with the two observed p values for both NiF and NiCl. The present formalism should in principle be applicable to NiBr and NiI, and to the halides of palladium, since Pd + has a well isolated 4d 9 electronic ground configuration. Extension to metal halides having d n configurations with n < 9, or to platinum halides may present difficulties, since manifolds from the d n and d n-1s configurations may be heavily mixed, thus requiring "too many" parameters in the electronic part of the problem. Application to linear triatomic molecules may also present problems because of the large number of vibronic perturbations made possible by their four vibrational degrees of freedom.

  2. Quantum mechanical characterization of the He4ICl weakly bound complex.

    PubMed

    Valdés, Álvaro; Prosmiti, Rita

    2013-08-15

    Vibrational calculations are performed for the 12-dimensional He4ICl van der Waals complex using the multiconfiguration time-dependent Hartree (MCTDH) method. The potential energy surface of the cluster is represented as a sum of the triatomic He-ICl ab initio parametrized terms plus the He-He interactions. The topology of the potential presents higher anisotropy compared to the one with a homonuclear dopant, and this is clearly reflected in the structure and energetics of the low-lying conformers of the system. In order to take advantage of the MCTDH method, natural potential fits are employed for the potential energy operator, and also, a mode combination scheme is introduced in order to speed up the computations. Zero-point energy, binding energies, and vibrationally averaged structures of different isomers of the He4ICl cluster are obtained. The present results predict that the (3,1,0) structure, involving three He atoms in the near T-shaped and one He atom in the linear configurations, to be the most stable one in accord with recent experimental findings. Comparisons with previous theoretical and experimental data are presented, and the stability of the high-order conformers is discussed in connection with the multiple minima (global and local) of the underlying potential surface.

  3. Linear Arrangement of Motor Protein on a Mechanically Deposited Fluoropolymer Thin Film

    NASA Astrophysics Data System (ADS)

    Suzuki, Hitoshi; Oiwa, Kazuhiro; Yamada, Akira; Sakakibara, Hitoshi; Nakayama, Haruto; Mashiko, Shinro

    1995-07-01

    Motor protein molecules such as heavy meromyosin (HMM), one of the major components of skeletal muscle, were arranged linearly on a mechanically deposited fluoropolymer thin film substrate in order to regulate the direction of movement generated by the motor protein. The fluoropolymer film consisted of many linear parallel ridges whose heights and widths were 10 to 20 nm and 10 to 100 nm, respectively. The fluoropolymer ridges adsorbed HMM molecules that were applied onto the film. Actin filaments labeled with rhodamine-phalloidin were observed under a fluorescence microscope moving linearly on the HMM-coated ridges. The observation indicates that HMM molecules were aligned on the fluoropolymer ridges while retaining their function. The velocity of actin movement was measured in this system.

  4. Pseudo-conformer models for linear molecules: Joint treatment of spectroscopic, electron diffraction and ab initio data for the C3O2 molecule

    NASA Astrophysics Data System (ADS)

    Tarasov, Yury I.; Kochikov, Igor V.

    2018-06-01

    Dynamic analysis of the molecules with large-amplitude motions (LAM) based on the pseudo-conformer approach has been successfully applied to various molecules. Floppy linear molecules present a special class of molecular structures that possess a pair of conjugate LAM coordinates but allow one-dimensional treatment. In this paper, previously developed treatment for the semirigid molecules is applied to the carbon suboxide molecule. This molecule characterized by the extremely large CCC bending has been thoroughly investigated by spectroscopic and ab initio methods. However, the earlier electron diffraction investigations were performed within a static approach, obtaining thermally averaged parameters. In this paper we apply a procedure aimed at obtaining the short list of self-consistent reference geometry parameters of a molecule, while all thermally averaged parameters are calculated based on reference geometry, relaxation dependencies and quadratic and cubic force constants. We show that such a model satisfactorily describes available electron diffraction evidence with various QC bending potential energy functions when r.m.s. CCC angle is in the interval 151 ± 2°. This leads to a self-consistent molecular model satisfying spectroscopic and GED data. The parameters for linear reference geometry have been defined as re(CO) = 1.161(2) Å and re(CC) = 1.273(2) Å.

  5. Polarization properties of below-threshold harmonics from aligned molecules H2+ in linearly polarized laser fields.

    PubMed

    Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun

    2015-07-13

    We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.

  6. Vibronic coupling simulations for linear and nonlinear optical processes: Simulation results

    NASA Astrophysics Data System (ADS)

    Silverstein, Daniel W.; Jensen, Lasse

    2012-02-01

    A vibronic coupling model based on time-dependent wavepacket approach is applied to simulate linear optical processes, such as one-photon absorbance and resonance Raman scattering, and nonlinear optical processes, such as two-photon absorbance and resonance hyper-Raman scattering, on a series of small molecules. Simulations employing both the long-range corrected approach in density functional theory and coupled cluster are compared and also examined based on available experimental data. Although many of the small molecules are prone to anharmonicity in their potential energy surfaces, the harmonic approach performs adequately. A detailed discussion of the non-Condon effects is illustrated by the molecules presented in this work. Linear and nonlinear Raman scattering simulations allow for the quantification of interference between the Franck-Condon and Herzberg-Teller terms for different molecules.

  7. Graphite grain-size spectrum and molecules from core-collapse supernovae

    NASA Astrophysics Data System (ADS)

    Clayton, Donald D.; Meyer, Bradley S.

    2018-01-01

    Our goal is to compute the abundances of carbon atomic complexes that emerge from the C + O cores of core-collapse supernovae. We utilize our chemical reaction network in which every atomic step of growth employs a quantum-mechanically guided reaction rate. This tool follows step-by-step the growth of linear carbon chain molecules from C atoms in the oxygen-rich C + O cores. We postulate that once linear chain molecules reach a sufficiently large size, they isomerize to ringed molecules, which serve as seeds for graphite grain growth. We demonstrate our technique for merging the molecular reaction network with a parallel program that can follow 1017 steps of C addition onto the rare seed species. Due to radioactivity within the C + O core, abundant ambient oxygen is unable to convert C to CO, except to a limited degree that actually facilitates carbon molecular ejecta. But oxygen severely minimizes the linear-carbon-chain abundances. Despite the tiny abundances of these linear-carbon-chain molecules, they can give rise to a small abundance of ringed-carbon molecules that serve as the nucleations on which graphite grain growth builds. We expand the C + O-core gas adiabatically from 6000 K for 109 s when reactions have essentially stopped. These adiabatic tracks emulate the actual expansions of the supernova cores. Using a standard model of 1056 atoms of C + O core ejecta having O/C = 3, we calculate standard ejection yields of graphite grains of all sizes produced, of the CO molecular abundance, of the abundances of linear-carbon molecules, and of Buckminsterfullerene. None of these except CO was expected from the C + O cores just a few years past.

  8. Hyperspherical nuclear motion of H3 + and D3 + in the electronic triplet state, a 3Sigmau +.

    PubMed

    Ferreira, Tiago Mendes; Alijah, Alexander; Varandas, António J C

    2008-02-07

    The potential energy surface of H(3) (+) in the lowest electronic triplet state, a (3)Sigma(u) (+), shows three equivalent minima at linear nuclear configurations. The vibrational levels of H(3) (+) and D(3) (+) on this surface can therefore be described as superimposed linear molecule states. Owing to such a superposition, each vibrational state characterized by quantum numbers of an isolated linear molecule obtains a one- and a two-dimensional component. The energy splittings between the two components have now been rationalized within a hyperspherical picture. It is shown that nuclear motion along the hyperangle phi mainly accounts for the splittings and provides upper bounds. This hyperspherical motion can be considered an extension of the antisymmetric stretching motion of the individual linear molecule.

  9. An implicit boundary integral method for computing electric potential of macromolecules in solvent

    NASA Astrophysics Data System (ADS)

    Zhong, Yimin; Ren, Kui; Tsai, Richard

    2018-04-01

    A numerical method using implicit surface representations is proposed to solve the linearized Poisson-Boltzmann equation that arises in mathematical models for the electrostatics of molecules in solvent. The proposed method uses an implicit boundary integral formulation to derive a linear system defined on Cartesian nodes in a narrowband surrounding the closed surface that separates the molecule and the solvent. The needed implicit surface is constructed from the given atomic description of the molecules, by a sequence of standard level set algorithms. A fast multipole method is applied to accelerate the solution of the linear system. A few numerical studies involving some standard test cases are presented and compared to other existing results.

  10. Developing Density of Laser-Cooled Neutral Atoms and Molecules in a Linear Magnetic Trap

    NASA Astrophysics Data System (ADS)

    Velasquez, Joe, III; Walstrom, Peter; di Rosa, Michael

    2013-05-01

    In this poster we show that neutral particle injection and accumulation using laser-induced spin flips may be used to form dense ensembles of ultracold magnetic particles, i.e., laser-cooled paramagnetic atoms and molecules. Particles are injected in a field-seeking state, are switched by optical pumping to a field-repelled state, and are stored in the minimum-B trap. The analogous process in high-energy charged-particle accumulator rings is charge-exchange injection using stripper foils. The trap is a linear array of sextupoles capped by solenoids. Particle-tracking calculations and design of our linear accumulator along with related experiments involving 7Li will be presented. We test these concepts first with atoms in preparation for later work with selected molecules. Finally, we present our preliminary results with CaH, our candidate molecule for laser cooling. This project is funded by the LDRD program of Los Alamos National Laboratory.

  11. Comparison of the Single Molecule Dynamics of Linear and Circular DNAs in Planar Extensional Flows

    NASA Astrophysics Data System (ADS)

    Li, Yanfei; Hsiao, Kai-Wen; Brockman, Christopher; Yates, Daniel; McKenna, Gregory; Schroeder, Charles; San Francisco, Michael; Kornfield, Julie; Anderson, Rae

    2015-03-01

    Chain topology has a profound impact on the flow behaviors of single macromolecules. The absence of free ends separates circular polymers from other chain architectures, i.e., linear, star, and branched. In the present work, we study the single chain dynamics of large circular and linear DNA molecules by comparing the relaxation dynamics, steady state coil-stretch transition, and transient molecular individualism behaviors for the two types of macromolecules. To this end, large circular DNA molecules were biologically synthesized and studied in a microfluidic device that has a cross-slot geometry to develop a stagnation point extensional flow. Although the relaxation time of rings scales in the same way as for the linear analog, the circular polymers show quantitatively different behaviors in the steady state extension and qualitatively different behaviors during a transient stretch. The existence of some commonality between these two topologies is proposed. Texas Tech University John R. Bradford Endowment.

  12. Thermodynamic properties and theoretical rocket performance of hydrogen to 100,000 K and 1.01325 x 10 to the 8th power N/sq m

    NASA Technical Reports Server (NTRS)

    Patch, R. W.

    1971-01-01

    The composition and thermodynamic properties were calculated for 100 to 110,000 K and 1.01325 x 10 to the 2nd power to 1.01325 x 10 to the 8th power N/sq m for chemical equilibrium in the Debye-Huckel and ideal-gas approximations. Quantities obtained were the concentrations of hydrogen atoms, protons, free electrons, hydrogen molecules, negative hydrogen ions, hydrogen diatomic molecular ions, and hydrogen triatomic molecular ions, and the enthalpy, entropy, average molecular weight, specific heat at constant pressure, density, and isentropic exponent. Electronically excited states of H and H2 were included. Choked, isentropic, one-dimensional nozzle flow with shifting chemical equilibrium was calculated to the Debye-Huckel and ideal-gas approximations for stagnation temperatures from 2500 to 100,000 K. The mass flow per unit throat area and the sonic flow factor were obtained. The pressure ratio, temperature, velocity, and ideal and vacuum specific impulses at the throat and for pressure ratios as low as 0.000001 downstream were found. For high temperatures at pressures approaching 1.01325 x 10 to the 8th power N/sq m, the ideal-gas approximation was found to be inadequate for calculations of composition, precise thermodynamic properties, and precise nozzle flow. The greatest discrepancy in nozzle flow occurred in the exit temperature, which was as much as 21 percent higher when the Debye-Huckel approximation was used.

  13. Therapeutic relevance of ozone therapy in degenerative diseases: Focus on diabetes and spinal pain.

    PubMed

    Braidy, Nady; Izadi, Morteza; Sureda, Antoni; Jonaidi-Jafari, Nematollah; Banki, Abdolali; Nabavi, Seyed F; Nabavi, Seyed M

    2018-04-01

    Ozone, one of the most important air pollutants, is a triatomic molecule containing three atoms of oxygen that results in an unstable form due to its mesomeric structure. It has been well-known that ozone has potent ability to oxidize organic compounds and can induce respiratory irritation. Although ozone has deleterious effects, many therapeutic effects have also been suggested. Since last few decades, the therapeutic potential of ozone has gained much attention through its strong capacity to induce controlled and moderated oxidative stress when administered in precise therapeutic doses. A plethora of scientific evidence showed that the activation of hypoxia inducible factor-1α (HIF-1a), nuclear factor of activated T-cells (NFAT), nuclear factor-erythroid 2-related factor 2-antioxidant response element (Nrf2-ARE), and activated protein-1 (AP-1) pathways are the main molecular mechanisms underlying the therapeutic effects of ozone therapy. Activation of these molecular pathways leads to up-regulation of endogenous antioxidant systems, activation of immune functions as well as suppression of inflammatory processes, which is important for correcting oxidative stress in diabetes and spinal pain. The present study intended to review critically the available scientific evidence concerning the beneficial properties of ozone therapy for treatment of diabetic complications and spinal pain. It finds benefit for integrating the therapy with ozone into pharmacological procedures, instead of a substitutive or additional option to therapy. © 2017 Wiley Periodicals, Inc.

  14. Linear indices of the "molecular pseudograph's atom adjacency matrix": definition, significance-interpretation, and application to QSAR analysis of flavone derivatives as HIV-1 integrase inhibitors.

    PubMed

    Marrero-Ponce, Yovani

    2004-01-01

    This report describes a new set of molecular descriptors of relevance to QSAR/QSPR studies and drug design, atom linear indices fk(xi). These atomic level chemical descriptors are based on the calculation of linear maps on Rn[fk(xi): Rn--> Rn] in canonical basis. In this context, the kth power of the molecular pseudograph's atom adjacency matrix [Mk(G)] denotes the matrix of fk(xi) with respect to the canonical basis. In addition, a local-fragment (atom-type) formalism was developed. The kth atom-type linear indices are calculated by summing the kth atom linear indices of all atoms of the same atom type in the molecules. Moreover, total (whole-molecule) linear indices are also proposed. This descriptor is a linear functional (linear form) on Rn. That is, the kth total linear indices is a linear map from Rn to the scalar R[ fk(x): Rn --> R]. Thus, the kth total linear indices are calculated by summing the atom linear indices of all atoms in the molecule. The features of the kth total and local linear indices are illustrated by examples of various types of molecular structures, including chain-lengthening, branching, heteroatoms-content, and multiple bonds. Additionally, the linear independence of the local linear indices to other 0D, 1D, 2D, and 3D molecular descriptors is demonstrated by using principal component analysis for 42 very heterogeneous molecules. Much redundancy and overlapping was found among total linear indices and most of the other structural indices presently in use in the QSPR/QSAR practice. On the contrary, the information carried by atom-type linear indices was strikingly different from that codified in most of the 229 0D-3D molecular descriptors used in this study. It is concluded that the local linear indices are an independent indices containing important structural information to be used in QSPR/QSAR and drug design studies. In this sense, atom, atom-type, and total linear indices were used for the prediction of pIC50 values for the cleavage process of a set of flavone derivatives inhibitors of HIV-1 integrase. Quantitative models found are significant from a statistical point of view (R of 0.965, 0.902, and 0.927, respectively) and permit a clear interpretation of the studied properties in terms of the structural features of molecules. A LOO cross-validation procedure revealed that the regression models had a fairly good predictability (q2 of 0.679, 0.543, and 0.721, respectively). The comparison with other approaches reveals good behavior of the method proposed. The approach described in this paper appears to be an excellent alternative or guides for discovery and optimization of new lead compounds.

  15. Control of π-Electron Rotations in Chiral Aromatic Molecules Using Intense Laser Pulses

    NASA Astrophysics Data System (ADS)

    Kanno, Manabu; Kono, Hirohiko; Fujimura, Yuichi

    Our recent theoretical studies on laser-induced π-electron rotations in chiral aromatic molecules are reviewed. π electrons of a chiral aromatic molecule can be rotated along its aromatic ring by a nonhelical, linearly polarized laser pulse. An ansa aromatic molecule with a six-membered ring, 2,5-dichloro[n](3,6) pyrazinophane, which belongs to a planar-chiral molecule group, and its simplified molecule 2,5-dichloropyrazine are taken as model molecules. Electron wavepacket simulations in the frozen-molecular-vibration approximation show that the initial direction of π-electron rotation depends on the polarization direction of a linearly polarized laser pulse applied. Consecutive unidirectional rotation can be achieved by applying a sequence of linearly polarized pump and dump pulses to prevent reverse rotation. Optimal control simulations of π-electron rotation show that another controlling factor for unidirectional rotation is the relative optical phase between the different frequency components of an incident pulse in addition to photon polarization direction. Effects of nonadiabatic coupling between π-electron rotation and molecular vibrations are also presented, where the constraints of the frozen approximation are removed. The angular momentum gradually decays mainly owing to nonadiabatic coupling, while the vibrational amplitudes greatly depend on their rotation direction. This suggests that the direction of π-electron rotation on an attosecond timescale can be identified by detecting femtosecond molecular vibrations.

  16. Translation and integration of numerical atomic orbitals in linear molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heinäsmäki, Sami, E-mail: sami.heinasmaki@gmail.com

    2014-02-14

    We present algorithms for translation and integration of atomic orbitals for LCAO calculations in linear molecules. The method applies to arbitrary radial functions given on a numerical mesh. The algorithms are based on pseudospectral differentiation matrices in two dimensions and the corresponding two-dimensional Gaussian quadratures. As a result, multicenter overlap and Coulomb integrals can be evaluated effectively.

  17. Machine learning prediction for classification of outcomes in local minimisation

    NASA Astrophysics Data System (ADS)

    Das, Ritankar; Wales, David J.

    2017-01-01

    Machine learning schemes are employed to predict which local minimum will result from local energy minimisation of random starting configurations for a triatomic cluster. The input data consists of structural information at one or more of the configurations in optimisation sequences that converge to one of four distinct local minima. The ability to make reliable predictions, in terms of the energy or other properties of interest, could save significant computational resources in sampling procedures that involve systematic geometry optimisation. Results are compared for two energy minimisation schemes, and for neural network and quadratic functions of the inputs.

  18. Nature of bonding and cooperativity in linear DMSO clusters: A DFT, AIM and NCI analysis.

    PubMed

    Venkataramanan, Natarajan Sathiyamoorthy; Suvitha, Ambigapathy

    2018-05-01

    This study aims to cast light on the nature of interactions and cooperativity that exists in linear dimethyl sulfoxide (DMSO) clusters using dispersion corrected density functional theory. In the linear DMSO, DMSO molecules in the middle of the clusters are bound strongly than at the terminal. The plot of the total binding energy of the clusters vs the cluster size and mean polarizabilities vs cluster size shows an excellent linearity demonstrating the presence of cooperativity effect. The computed incremental binding energy of the clusters remains nearly constant, implying that DMSO addition at the terminal site can happen to form an infinite chain. In the linear clusters, two σ-hole at the terminal DMSO molecules were found and the value on it was found to increase with the increase in cluster size. The quantum theory of atoms in molecules topography shows the existence of hydrogen and SO⋯S type in linear tetramer and larger clusters. In the dimer and trimer SO⋯OS type of interaction exists. In 2D non-covalent interactions plot, additional peaks in the regions which contribute to the stabilization of the clusters were observed and it splits in the trimer and intensifies in the larger clusters. In the trimer and larger clusters in addition to the blue patches due to hydrogen bonds, additional, light blue patches were seen between the hydrogen atom of the methyl groups and the sulphur atom of the nearby DMSO molecule. Thus, in addition to the strong H-bonds, strong electrostatic interactions between the sulphur atom and methyl hydrogens exists in the linear clusters. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Vibronic bands in the HOMO-LUMO excitation of linear polyyne molecules

    NASA Astrophysics Data System (ADS)

    Wakabayashi, Tomonari; Wada, Yoriko; Iwahara, Naoya; Sato, Tohru

    2013-04-01

    Hydrogen-capped linear carbon chain molecules, namely polyynes H(C≡C)nH (n>=2), give rise to three excited states in the HOMO-LUMO excitation. Electric dipole transition from the ground state is fully allowed to one of the three excited states, while forbidden for the other two low-lying excited states. In addition to the strong absorption bands in the UV for the allowed transition, the molecules exhibit weak absorption and emission bands in the near UV and visible wavelength regions. The weak features are the vibronic bands in the forbidden transition. In this article, symmetry considerations are presented for the optical transitions in the centrosymmetric linear polyyne molecule. The argument includes Herzberg-Teller expansion for the state mixing induced by nuclear displacements along the normal coordinate of the molecule, intensity borrowing from fully allowed transitions, and inducing vibrational modes excited in the vibronic transition. The vibronic coupling considered here includes off-diagonal matrix elements for second derivatives along the normal coordinate. The vibronic selection rule for the forbidden transition is derived and associated with the transition moment with respect to the molecular axis. Experimental approaches are proposed for the assignment of the observed vibronic bands.

  20. The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

    PubMed

    Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

    2014-12-01

    The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

  1. Study of the In2O3 molecule in the free state and in the crystal

    NASA Astrophysics Data System (ADS)

    Kaplan, Ilya G.; Miranda, Ulises; Trakhtenberg, Leonid I.

    2018-03-01

    The nanomaterials based on the In2O3 molecule are widely used as catalysts and sensors among other applications. In the present study, we discuss the possibility of using nanoclusters of In2O3 as molecular photomotors. A comparative analysis of the electronic structure of the In2O3 molecule in the free state and in the crystal is performed. For the free In2O3 molecule the geometry of its lowest structures, V-shape and linear, was optimised at the CCSD(T) level, which is the most precise computational method applied up to date to study In2O3. Using experimental crystallographic data, we determined the geometry of In2O3 in the crystal. It has a zigzag, not symmetric structure and possesses a dipole moment with magnitude slightly smaller than that of the V-structure of the free molecule (the linear structure due to its symmetry has no dipole moment). According to the Natural Atomic population analysis, the chemical structure of the linear In2O3 can be represented as O = In-O-In = O; the V-shaped molecule has the similar double- and single-bond structure. The construction of nanoclusters from ´bricksʼ of In2O3 with geometry extracted from crystal (or nanoclusters extracted directly from crystal) and their use as photo-driven molecular motors are discussed.

  2. Simulation of size-exclusion chromatography distribution coefficients of comb-shaped molecules in spherical pores comparison of simulation and experiment.

    PubMed

    Radke, Wolfgang

    2004-03-05

    Simulations of the distribution coefficients of linear polymers and regular combs with various spacings between the arms have been performed. The distribution coefficients were plotted as a function of the number of segments in order to compare the size exclusion chromatography (SEC)-elution behavior of combs relative to linear molecules. By comparing the simulated SEC-calibration curves it is possible to predict the elution behavior of comb-shaped polymers relative to linear ones. In order to compare the results obtained by computer simulations with experimental data, a variety of comb-shaped polymers varying in side chain length, spacing between the side chains and molecular weights of the backbone were analyzed by SEC with light-scattering detection. It was found that the computer simulations could predict the molecular weights of linear molecules having the same retention volume with an accuracy of about 10%, i.e. the error in the molecular weight obtained by calculating the molecular weight of the comb-polymer based on a calibration curve constructed using linear standards and the results of the computer simulations are of the same magnitude as the experimental error of absolute molecular weight determination.

  3. Proton affinities of hydrated molecules

    NASA Astrophysics Data System (ADS)

    Valadbeigi, Younes

    2016-09-01

    Proton affinities (PA) of non-hydrated, M, and hydrated forms, M(H2O)1,2,3, of 20 organic molecules including alcohols, ethers, aldehydes, ketones and amines were calculated by the B3LYP/6-311++G(d,p) method. For homogeneous families, linear correlations were observed between PAs of the M(H2O)1,2,3 and the PAs of the non-hydrated molecules. Also, the absolute values of the hydration enthalpies of the protonated molecules decreased linearly with the PAs. The correlation functions predicted that for an amine with PA < 1100 kJ/mol the PA(M(H2O)) is larger than the corresponding PA, while for an amine with PA > 1100 kJ/mol the PA(M(H2O)) is smaller than the PA.

  4. Packing C60 in Boron Nitride Nanotubes

    NASA Astrophysics Data System (ADS)

    Mickelson, W.; Aloni, S.; Han, Wei-Qiang; Cumings, John; Zettl, A.

    2003-04-01

    We have created insulated C60 nanowire by packing C60 molecules into the interior of insulating boron nitride nanotubes (BNNTs). For small-diameter BNNTs, the wire consists of a linear chain of C60 molecules. With increasing BNNT inner diameter, unusual C60 stacking configurations are obtained (including helical, hollow core, and incommensurate) that are unknown for bulk or thin-film forms of C60. C60 in BNNTs thus presents a model system for studying the properties of dimensionally constrained ``silo'' crystal structures. For the linear-chain case, we have fused the C60 molecules to form a single-walled carbon nanotube inside the insulating BNNT.

  5. Dynamics of a linear magnetic “microswimmer molecule”

    NASA Astrophysics Data System (ADS)

    Babel, S.; Löwen, H.; Menzel, A. M.

    2016-03-01

    In analogy to nanoscopic molecules that are composed of individual atoms, we consider an active “microswimmer molecule”. It is made of three individual magnetic colloidal microswimmers that are connected by harmonic springs and interact hydrodynamically. In the ground state, they form a linear straight molecule. We analyze the relaxation dynamics for perturbations of this straight configuration. As a central result, with increasing self-propulsion, we observe an oscillatory instability in accord with a subcritical Hopf bifurcation scenario. It is accompanied by a corkscrew-like swimming trajectory of increasing radius. Our results can be tested experimentally, using, for instance, magnetic self-propelled Janus particles, supposably linked by DNA molecules.

  6. The Dynamics of Entangled DNA Networks using Single-Molecule Methods

    NASA Astrophysics Data System (ADS)

    Chapman, Cole David

    Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

  7. The characteristics of polyimide photoalignment layer with chalcone derivatives produced by linear polarized UV light

    NASA Astrophysics Data System (ADS)

    Jung, Kyoung Hoon; Hyun, Soon-Young; Song, Dong-Mee; Shin, Dong-Myung

    2003-01-01

    The photoalignment of liquid crystal (LC) molecules located onto polyimide films with chalcone derivatives using linearly polarized UV (LPUV) light is investigated. The LPUV light irradiation generated dimerization products of the chalcones followed by isomerization of the chalcone derivatives. The alignment directions of LC molecules were either homeotropic or planar with respect to plane of polyimide film, depending upon the alkyl chain length attached on the chalcones.

  8. 3' Homologous Free Ends are Required for Stable Joint Molecule Formation by the RecA and Single-Stranded Binding Proteins of Escherichia coli

    NASA Astrophysics Data System (ADS)

    Konforti, Boyana B.; Davis, Ronald W.

    1987-02-01

    The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.

  9. Communication: Visible line intensities of the triatomic hydrogen ion from experiment and theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petrignani, Annemieke; Berg, Max H.; Grussie, Florian

    2014-12-28

    The visible spectrum of H{sub 3}{sup +} is studied using high-sensitivity action spectroscopy in a cryogenic radiofrequency multipole trap. Advances are made to measure the weak ro-vibrational transitions from the lowest rotational states of H{sub 3}{sup +} up to high excitation energies providing visible line intensities and, after normalisation to an infrared calibration line, the corresponding Einstein B coefficients. Ab initio predictions for the Einstein B coefficients are obtained from a highly precise dipole moment surface of H{sub 3}{sup +} and found to be in excellent agreement, even in the region where states have been classified as chaotic.

  10. Shock tube measurements of the optical absorption of triatomic carbon, C3

    NASA Technical Reports Server (NTRS)

    Jones, J. J.

    1977-01-01

    The spectral absorption of C3 has been measured in a shock tube using a test gas mixture of acetylene diluted with argon. The absorption of a pulsed xenon light source was measured by means of eight photomultiplier channels to a spectrograph and an accompanying drum camera. The postshock test gas temperature and pressure were varied over the range 3300-4300 K and 0.36 to 2.13 atmospheres, respectively. The results showed appreciable absorption from C3 for the wavelength range 300 to 540 nanometers. The computed electronic oscillator strength varied from 0.12 to 0.06 as a function of temperature.

  11. Energy Level Alignment at the Interface between Linear-Structured Benzenediamine Molecules and Au(111) Surface

    NASA Astrophysics Data System (ADS)

    Li, Guo; Rangel, Tonatiuh; Liu, Zhenfei; Cooper, Valentino; Neaton, Jeffrey

    Using density functional theory with model self-energy corrections, we calculate the adsorption energetics and geometry, and the energy level alignment of benzenediamine (BDA) molecules adsorbed on Au(111) surfaces. Our calculations show that linear structures of BDA, stabilized via hydrogen bonds between amine groups, are energetically more favorable than monomeric phases. Moreover, our self-energy-corrected calculations of energy level alignment show that the highest occupied molecular orbital energy of the BDA linear structure is deeper relative to the Fermi level relative to the isolated monomer and agrees well with the values measured with photoemission spectroscopy. This work supported by DOE.

  12. High-order harmonic generation of CO and N2 molecules under linearly- and bi circularly-polarized laser pulses by TD-DFT

    NASA Astrophysics Data System (ADS)

    Koushki, A. M.; Sadighi-Bonabi, R.; Mohsen-Nia, M.; Irani, E.

    2018-07-01

    We present a method for high-order harmonics generation of N2 and CO molecules under two-color circularly polarized counter-rotating laser pulses at frequencies of and 2. Pulse envelope in this investigation is sin-squared and the intensity of each laser beam is with ten-optical cycle (o.c.). We show that an isolated pulse with a pulse duration shorter than 20 attosecond from the superposition of several harmonics can be generated. Both two-color linearly- and bicircularly-polarized laser pulses are considered. Our results have also been compared with the outcomes of the previous theoretical works as well as experiment observations. It is found that for CO molecule, the bicircularly-polarized laser pulses are superior and more efficient, and it can generate narrower attosecond pulses than the linearly-polarized pulses. While for N2 molecule, the two-color linearly-polarized pulses are more efficient, and it can generate narrower attosecond pulses than the bicircularly-polarized pulses. Furthermore, in order to demonstrate the origin of red- and blue-shifts in high-harmonic spectra, the effect of pulse duration on the high-order harmonics spectra is investigated. In addition, to obtain imaging on the temporal dependence of the electron densities, the time dependent electron localization function is used. Moreover, in order to study of the quantum trajectory of electrons, time-frequency analysis is utilized.

  13. Anisotropic contribution to the van der Waals and the Casimir-Polder energies for CO2 and CH4 molecules near surfaces and thin films

    NASA Astrophysics Data System (ADS)

    Thiyam, Priyadarshini; Parashar, Prachi; Shajesh, K. V.; Persson, Clas; Schaden, Martin; Brevik, Iver; Parsons, Drew F.; Milton, Kimball A.; Malyi, Oleksandr I.; Boström, Mathias

    2015-11-01

    In order to understand why carbon dioxide (CO2) and methane (CH4) molecules interact differently with surfaces, we investigate the Casimir-Polder energy of a linearly polarizable CO2 molecule and an isotropically polarizable CH4 molecule in front of an atomically thin gold film and an amorphous silica slab. We quantitatively analyze how the anisotropy in the polarizability of the molecule influences the van der Waals contribution to the binding energy of the molecule.

  14. Dissipation dynamics of field-free molecular alignment for symmetric-top molecules: Ethane (C2H6)

    NASA Astrophysics Data System (ADS)

    Zhang, H.; Billard, F.; Yu, X.; Faucher, O.; Lavorel, B.

    2018-03-01

    The field-free molecular alignment of symmetric-top molecules, ethane, induced by intense non-resonant linearly polarized femtosecond laser pulses is investigated experimentally in the presence of collisional relaxation. The dissipation dynamics of field-free molecular alignment are measured by the balanced detection of ultrafast molecular birefringence of ethane gas samples at high pressures. By separating the molecular alignment into the permanent alignment and the transient alignment, the decay time-constants of both components are quantified at the same pressure. It is observed that the permanent alignment always decays slower compared to the transient alignment within the measured pressure range. This demonstrates that the propensity of molecules to conserve the orientation of angular momentum during collisions, previously observed for linear species, is also applicable to symmetric-top molecules. The results of this work provide valuable information for further theoretical understanding of collisional relaxation within nonlinear polyatomic molecules, which are expected to present interesting and nontrivial features due to an extra rotational degree of freedom.

  15. Covariance Matrix Estimation for the Cryo-EM Heterogeneity Problem*

    PubMed Central

    Katsevich, E.; Katsevich, A.; Singer, A.

    2015-01-01

    In cryo-electron microscopy (cryo-EM), a microscope generates a top view of a sample of randomly oriented copies of a molecule. The problem of single particle reconstruction (SPR) from cryo-EM is to use the resulting set of noisy two-dimensional projection images taken at unknown directions to reconstruct the three-dimensional (3D) structure of the molecule. In some situations, the molecule under examination exhibits structural variability, which poses a fundamental challenge in SPR. The heterogeneity problem is the task of mapping the space of conformational states of a molecule. It has been previously suggested that the leading eigenvectors of the covariance matrix of the 3D molecules can be used to solve the heterogeneity problem. Estimating the covariance matrix is challenging, since only projections of the molecules are observed, but not the molecules themselves. In this paper, we formulate a general problem of covariance estimation from noisy projections of samples. This problem has intimate connections with matrix completion problems and high-dimensional principal component analysis. We propose an estimator and prove its consistency. When there are finitely many heterogeneity classes, the spectrum of the estimated covariance matrix reveals the number of classes. The estimator can be found as the solution to a certain linear system. In the cryo-EM case, the linear operator to be inverted, which we term the projection covariance transform, is an important object in covariance estimation for tomographic problems involving structural variation. Inverting it involves applying a filter akin to the ramp filter in tomography. We design a basis in which this linear operator is sparse and thus can be tractably inverted despite its large size. We demonstrate via numerical experiments on synthetic datasets the robustness of our algorithm to high levels of noise. PMID:25699132

  16. Development of Solid-State Nanopore Technology for Life Detection

    NASA Technical Reports Server (NTRS)

    Bywaters, K. B.; Schmidt, H.; Vercoutere, W.; Deamer, D.; Hawkins, A. R.; Quinn, R. C.; Burton, A. S.; Mckay, C. P.

    2017-01-01

    Biomarkers for life on Earth are an important starting point to guide the search for life elsewhere. However, the search for life beyond Earth should incorporate technologies capable of recognizing an array of potential biomarkers beyond what we see on Earth, in order to minimize the risk of false negatives from life detection missions. With this in mind, charged linear polymers may be a universal signature for life, due to their ability to store information while also inherently reducing the tendency of complex tertiary structure formation that significantly inhibit replication. Thus, these molecules are attractive targets for biosignature detection as potential "self-sustaining chemical signatures." Examples of charged linear polymers, or polyelectrolytes, include deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) as well as synthetic polyelectrolytes that could potentially support life, including threose nucleic acid (TNA) and other xenonucleic acids (XNAs). Nanopore analysis is a novel technology that has been developed for singlemolecule sequencing with exquisite single nucleotide resolution which is also well-suited for analysis of polyelectrolyte molecules. Nanopore analysis has the ability to detect repeating sequences of electrical charges in organic linear polymers, and it is not molecule- specific (i.e. it is not restricted to only DNA or RNA). In this sense, it is a better life detection technique than approaches that are based on specific molecules, such as the polymerase chain reaction (PCR), which requires that the molecule being detected be composed of DNA.

  17. Evolution of Linear Mitochondrial Genomes in Medusozoan Cnidarians

    PubMed Central

    Kayal, Ehsan; Bentlage, Bastian; Collins, Allen G.; Pirro, Stacy; Lavrov, Dennis V.

    2012-01-01

    In nearly all animals, mitochondrial DNA (mtDNA) consists of a single circular molecule that encodes several subunits of the protein complexes involved in oxidative phosphorylation as well as part of the machinery for their expression. By contrast, mtDNA in species belonging to Medusozoa (one of the two major lineages in the phylum Cnidaria) comprises one to several linear molecules. Many questions remain on the ubiquity of linear mtDNA in medusozoans and the mechanisms responsible for its evolution, replication, and transcription. To address some of these questions, we determined the sequences of nearly complete linear mtDNA from 24 species representing all four medusozoan classes: Cubozoa, Hydrozoa, Scyphozoa, and Staurozoa. All newly determined medusozoan mitochondrial genomes harbor the 17 genes typical for cnidarians and map as linear molecules with a high degree of gene order conservation relative to the anthozoans. In addition, two open reading frames (ORFs), polB and ORF314, are identified in cubozoan, schyphozoan, staurozoan, and trachyline hydrozoan mtDNA. polB belongs to the B-type DNA polymerase gene family, while the product of ORF314 may act as a terminal protein that binds telomeres. We posit that these two ORFs are remnants of a linear plasmid that invaded the mitochondrial genomes of the last common ancestor of Medusozoa and are responsible for its linearity. Hydroidolinan hydrozoans have lost the two ORFs and instead have duplicated cox1 at each end of their mitochondrial chromosome(s). Fragmentation of mtDNA occurred independently in Cubozoa and Hydridae (Hydrozoa, Hydroidolina). Our broad sampling allows us to reconstruct the evolutionary history of linear mtDNA in medusozoans. PMID:22113796

  18. Chain-Length-Dependent Exciton Dynamics in Linear Oligothiophenes Probed Using Ensemble and Single-Molecule Spectroscopy.

    PubMed

    Kim, Tae-Woo; Kim, Woojae; Park, Kyu Hyung; Kim, Pyosang; Cho, Jae-Won; Shimizu, Hideyuki; Iyoda, Masahiko; Kim, Dongho

    2016-02-04

    Exciton dynamics in π-conjugated molecular systems is highly susceptible to conformational disorder. Using time-resolved and single-molecule spectroscopic techniques, the effect of chain length on the exciton dynamics in a series of linear oligothiophenes, for which the conformational disorder increased with increasing chain length, was investigated. As a result, extraordinary features of the exciton dynamics in longer-chain oligothiophene were revealed. Ultrafast fluorescence depolarization processes were observed due to exciton self-trapping in longer and bent chains. Increase in exciton delocalization during dynamic planarization processes was also observed in the linear oligothiophenes via time-resolved fluorescence spectra but was restricted in L-10T because of its considerable conformational disorder. Exciton delocalization was also unexpectedly observed in a bent chain using single-molecule fluorescence spectroscopy. Such delocalization modulates the fluorescence spectral shape by attenuating the 0-0 peak intensity. Collectively, these results provide significant insights into the exciton dynamics in conjugated polymers.

  19. Experimental Tests of the Algebraic Cluster Model

    NASA Astrophysics Data System (ADS)

    Gai, Moshe

    2018-02-01

    The Algebraic Cluster Model (ACM) of Bijker and Iachello that was proposed already in 2000 has been recently applied to 12C and 16O with much success. We review the current status in 12C with the outstanding observation of the ground state rotational band composed of the spin-parity states of: 0+, 2+, 3-, 4± and 5-. The observation of the 4± parity doublet is a characteristic of (tri-atomic) molecular configuration where the three alpha- particles are arranged in an equilateral triangular configuration of a symmetric spinning top. We discuss future measurement with electron scattering, 12C(e,e’) to test the predicted B(Eλ) of the ACM.

  20. Energy landscapes for a machine learning application to series data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballard, Andrew J.; Stevenson, Jacob D.; Das, Ritankar

    2016-03-28

    Methods developed to explore and characterise potential energy landscapes are applied to the corresponding landscapes obtained from optimisation of a cost function in machine learning. We consider neural network predictions for the outcome of local geometry optimisation in a triatomic cluster, where four distinct local minima exist. The accuracy of the predictions is compared for fits using data from single and multiple points in the series of atomic configurations resulting from local geometry optimisation and for alternative neural networks. The machine learning solution landscapes are visualised using disconnectivity graphs, and signatures in the effective heat capacity are analysed in termsmore » of distributions of local minima and their properties.« less

  1. Laboratory measurements and astronomical search for the HSO radical

    NASA Astrophysics Data System (ADS)

    Cazzoli, Gabriele; Lattanzi, Valerio; Kirsch, Till; Gauss, Jürgen; Tercero, Belén; Cernicharo, José; Puzzarini, Cristina

    2016-06-01

    Context. Despite the fact that many sulfur-bearing molecules, ranging from simple diatomic species up to astronomical complex molecules, have been detected in the interstellar medium, the sulfur chemistry in space is largely unknown and a depletion in the abundance of S-containing species has been observed in the cold, dense interstellar medium. The chemical form of the missing sulfur has yet to be identified. Aims: For these reasons, in view of the fact that there is a large abundance of triatomic species harbouring sulfur, oxygen, and hydrogen, we decided to investigate the HSO radical in the laboratory to try its astronomical detection. Methods: High-resolution measurements of the rotational spectrum of the HSO radical were carried out within a frequency range well up into the THz region. Subsequently, a rigorous search for HSO in the two most studied high-mass star-forming regions, Orion KL and Sagittarius (Sgr) B2, and in the cold dark cloud Barnard 1 (B1-b) was performed. Results: The frequency coverage and the spectral resolution of our measurements allowed us to improve and extend the existing dataset of spectroscopic parameters, thus enabling accurate frequency predictions up to the THz range. These were used to derive the synthetic spectrum of HSO, by means of the MADEX code, according to the physical parameters of the astronomical source under consideration. For all sources investigated, the lack of HSO lines above the confusion limit of the data is evident. Conclusions: The derived upper limit to the abundance of HSO clearly indicates that this molecule does not achieve significant abundances in either the gas phase or in the ice mantles of dust grains. This paper makes use of the following ALMA data: ADS/JAO.ALMA#2011.0.00009.SV. ALMA is a partnership of ESO (representing its member states), NSF (USA), and NINS (Japan) with NRC (Canada), NSC, and ASIAA (Taiwan), and KASI (Republic of Korea), in cooperation with the Republic of Chile. The Joint ALMA Observatory is operated by ESO, AUI/NRAO, and NAOJ. This work is also based on observations carried out with the IRAM 30-m telescope. IRAM is supported by INSU/CNRS (France), MPG (Germany), and IGN (Spain)The laboratory spectroscopic measurements are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/591/A126

  2. FTIR Rotational Spectroscopy.

    ERIC Educational Resources Information Center

    Woods, Ron; Henderson, Giles

    1987-01-01

    Presented are representative examples of the spectra and the analyses for a linear molecule (HC1), a symmetric top molecule (NH3), and an asymmetric top (H2O). Any combination of these projects could be incorporated in a physical chemistry or molecular spectroscopy laboratory. (RH)

  3. Classroom Demonstrations of Polymer Principles Part II. Polymer Formation.

    ERIC Educational Resources Information Center

    Rodriguez, F.; And Others

    1987-01-01

    This is part two in a series on classroom demonstrations of polymer principles. Described is how large molecules can be assembled from subunits (the process of polymerization). Examples chosen include both linear and branched or cross-linked molecules. (RH)

  4. N(2)O in small para-hydrogen clusters: Structures and energetics.

    PubMed

    Zhu, Hua; Xie, Daiqian

    2009-04-30

    We present the minimum-energy structures and energetics of clusters of the linear N(2)O molecule with small numbers of para-hydrogen molecules with pairwise additive potentials. Interaction energies of (p-H(2))-N(2)O and (p-H(2))-(p-H(2)) complexes were calculated by averaging the corresponding full-dimensional potentials over the H(2) angular coordinates. The averaged (p-H(2))-N(2)O potential has three minima corresponding to the T-shaped and the linear (p-H(2))-ONN and (p-H(2))-NNO structures. Optimization of the minimum-energy structures was performed using a Genetic Algorithm. It was found that p-H(2) molecules fill three solvation rings around the N(2)O axis, each of them containing up to five p-H(2) molecules, followed by accumulation of two p-H(2) molecules at the oxygen and nitrogen ends. The first solvation shell is completed at N = 17. The calculated chemical potential oscillates with cluster size up to the completed first solvation shell. These results are consistent with the available experimental measurements. (c) 2009 Wiley Periodicals, Inc.

  5. LIMAO: Cross-platform software for simulating laser-induced alignment and orientation dynamics of linear-, symmetric- and asymmetric tops

    NASA Astrophysics Data System (ADS)

    Szidarovszky, Tamás; Jono, Maho; Yamanouchi, Kaoru

    2018-07-01

    A user-friendly and cross-platform software called Laser-Induced Molecular Alignment and Orientation simulator (LIMAO) has been developed. The program can be used to simulate within the rigid rotor approximation the rotational dynamics of gas phase molecules induced by linearly polarized intense laser fields at a given temperature. The software is implemented in the Java and Mathematica programming languages. The primary aim of LIMAO is to aid experimental scientists in predicting and analyzing experimental data representing laser-induced spatial alignment and orientation of molecules.

  6. Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

    PubMed

    Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

    2006-10-15

    The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

  7. Differential solvation of intrinsically disordered linkers drives the formation of spatially organized droplets in ternary systems of linear multivalent proteins

    NASA Astrophysics Data System (ADS)

    Harmon, Tyler S.; Holehouse, Alex S.; Pappu, Rohit V.

    2018-04-01

    Intracellular biomolecular condensates are membraneless organelles that encompass large numbers of multivalent protein and nucleic acid molecules. The bodies assemble via a combination of liquid–liquid phase separation and gelation. A majority of condensates included multiple components and show multilayered organization as opposed to being well-mixed unitary liquids. Here, we put forward a simple thermodynamic framework to describe the emergence of spatially organized droplets in multicomponent systems comprising of linear multivalent polymers also known as associative polymers. These polymers, which mimic proteins and/or RNA have the architecture of domains or motifs known as stickers that are interspersed by flexible spacers known as linkers. Using a minimalist numerical model for a four-component system, we have identified features of linear multivalent molecules that are necessary and sufficient for generating spatially organized droplets. We show that differences in sequence-specific effective solvation volumes of disordered linkers between interaction domains enable the formation of spatially organized droplets. Molecules with linkers that are preferentially solvated are driven to the interface with the bulk solvent, whereas molecules that have linkers with negligible effective solvation volumes form cores in the core–shell architectures that emerge in the minimalist four-component systems. Our modeling has relevance for understanding the physical determinants of spatially organized membraneless organelles.

  8. High-accuracy calculations of the rotation-vibration spectrum of {{\\rm{H}}}_{3}^{+}

    NASA Astrophysics Data System (ADS)

    Tennyson, Jonathan; Polyansky, Oleg L.; Zobov, Nikolai F.; Alijah, Alexander; Császár, Attila G.

    2017-12-01

    Calculation of the rotation-vibration spectrum of {{{H}}}3+, as well as of its deuterated isotopologues, with near-spectroscopic accuracy requires the development of sophisticated theoretical models, methods, and codes. The present paper reviews the state-of-the-art in these fields. Computation of rovibrational states on a given potential energy surface (PES) has now become standard for triatomic molecules, at least up to intermediate energies, due to developments achieved by the present authors and others. However, highly accurate Born-Oppenheimer energies leading to highly accurate PESs are not accessible even for this two-electron system using conventional electronic structure procedures (e.g. configuration-interaction or coupled-cluster techniques with extrapolation to the complete (atom-centered Gaussian) basis set limit). For this purpose, highly specialized techniques must be used, e.g. those employing explicitly correlated Gaussians and nonlinear parameter optimizations. It has also become evident that a very dense grid of ab initio points is required to obtain reliable representations of the computed points extending from the minimum to the asymptotic limits. Furthermore, adiabatic, relativistic, and quantum electrodynamic correction terms need to be considered to achieve near-spectroscopic accuracy during calculation of the rotation-vibration spectrum of {{{H}}}3+. The remaining and most intractable problem is then the treatment of the effects of non-adiabatic coupling on the rovibrational energies, which, in the worst cases, may lead to corrections on the order of several cm-1. A promising way of handling this difficulty is the further development of effective, motion- or even coordinate-dependent, masses and mass surfaces. Finally, the unresolved challenge of how to describe and elucidate the experimental pre-dissociation spectra of {{{H}}}3+ and its isotopologues is discussed.

  9. Tests of Predictions of the Algebraic Cluster Model: the Triangular D 3h Symmetry of 12C

    NASA Astrophysics Data System (ADS)

    Gai, Moshe

    2016-07-01

    A new theoretical approach to clustering in the frame of the Algebraic Cluster Model (ACM) has been developed. It predicts rotation-vibration structure with rotational band of an oblate equilateral triangular symmetric spinning top with a D 3h symmetry characterized by the sequence of states: 0+, 2+, 3-, 4±, 5- with a degenerate 4+ and 4- (parity doublet) states. Our measured new 2+ 2 in 12C allows the first study of rotation-vibration structure in 12C. The newly measured 5- state and 4- states fit very well the predicted ground state rotational band structure with the predicted sequence of states: 0+, 2+, 3-, 4±, 5- with almost degenerate 4+ and 4- (parity doublet) states. Such a D 3h symmetry is characteristic of triatomic molecules, but it is observed in the ground state rotational band of 12C for the first time in a nucleus. We discuss predictions of the ACM of other rotation-vibration bands in 12 C such as the (0+) Hoyle band and the (1-) bending mode with prediction of (“missing 3- and 4-”) states that may shed new light on clustering in 12C and light nuclei. In particular, the observation (or non observation) of the predicted (“missing”) states in the Hoyle band will allow us to conclude the geometrical arrangement of the three alpha particles composing the Hoyle state at 7.6542 MeV in 12C. We discuss proposed research programs at the Darmstadt S-DALINAC and at the newly constructed ELI-NP facility near Bucharest to test the predictions of the ACM in isotopes of carbon.

  10. Current and Future Tests of the Algebraic Cluster Model of12C

    NASA Astrophysics Data System (ADS)

    Gai, Moshe

    2017-07-01

    A new theoretical approach to clustering in the frame of the Algebraic Cluster Model (ACM) has been developed. It predicts, in12C, rotation-vibration structure with rotational bands of an oblate equilateral triangular symmetric spinning top with a D 3h symmetry characterized by the sequence of states: 0+, 2+, 3-, 4±, 5- with a degenerate 4+ and 4- (parity doublet) states. Our newly measured {2}2+ state in12C allows the first study of rotation-vibration structure in12C. The newly measured 5- state and 4- states fit very well the predicted ground state rotational band structure with the predicted sequence of states: 0+, 2+, 3-, 4±, 5- with almost degenerate 4+ and 4- (parity doublet) states. Such a D 3h symmetry is characteristic of triatomic molecules, but it is observed in the ground state rotational band of12C for the first time in a nucleus. We discuss predictions of the ACM of other rotation-vibration bands in12C such as the (0+) Hoyle band and the (1-) bending mode with prediction of (“missing 3- and 4-”) states that may shed new light on clustering in12C and light nuclei. In particular, the observation (or non observation) of the predicted (“missing”) states in the Hoyle band will allow us to conclude the geometrical arrangement of the three alpha particles composing the Hoyle state at 7.6542 MeV in12C. We discuss proposed research programs at the Darmstadt S- DALINAC and at the newly constructed ELI-NP facility near Bucharest to test the predictions of the ACM in isotopes of carbon.

  11. Experimental and Theoretical Investigation of the Anti-Ferromagnetic Coupling of CrIII Ions through Diamagnetic -O-NbV-O- Bridges.

    PubMed

    Jurić, Marijana; Androš Dubraja, Lidija; Pajić, Damir; Torić, Filip; Zorko, Andrej; Ozarowski, Andrew; Despoja, Vito; Lafargue-Dit-Hauret, William; Rocquefelte, Xavier

    2017-06-19

    The synthesis and properties of a novel hetero-tetranuclear compound [Cr 2 (bpy) 4 (μ-O) 4 Nb 2 (C 2 O 4 ) 4 ]·3H 2 O (1; bpy = 2,2'-bipyridine), investigated by single-crystal X-ray diffraction, magnetization measurements, IR, UV/visible spectroscopy, electron paramagnetic resonance (EPR; X- and Q-bands and high-field), and density functional theory (DFT) calculations, are reported. Crystal structure of 1 (orthorhombic Pcab space group) consists of a square-shaped macrocyclic {Cr 2 (μ-O) 4 Nb 2 } core in which Cr III and Nb V ions are alternately bridged by oxo ions and three uncoordinated water molecules. The intramolecular Cr III ···Cr III distances through the -O-Nb V -O- bridges are 7.410(2) and 7.419(2) Å, while diagonal separation is 5.406(2) Å. The temperature dependence of magnetization M(T) evidences an anti-ferromagnetic ground state, which originates from a magnetic interaction between two Cr III ions of spin 3/2 through two triatomic -O-Nb V -O- diamagnetic bridges. A spin Hamiltonian appropriate for polynuclear isolated magnetic units was used. The best-fitting curve for this model is obtained with the parameters g Cr = 1.992(3), J = -12.77(5) cm -1 , and |D| = 0.17(4) cm -1 . The Cr III ···Cr III dimer model is confirmed by EPR spectra, which exhibit a pronounced change of their shape around the temperature corresponding to the intradimer coupling J. The EPR spectra simulations and DFT calculations reveal the presence of a single-ion anisotropy that is close to being uniaxial, D = -0.31 cm -1 and E = 0.024 cm -1 .

  12. Three-dimensional infinite order sudden quantum theory for indirect photodissociation processes. Application to the photofragment yield spectrum of NOCl in the region of the T1(13A″) ←S0(11A') transition. Fragment rotational distributions and thermal averages

    NASA Astrophysics Data System (ADS)

    Grinberg, Horacio; Freed, Karl F.; Williams, Carl J.

    1997-08-01

    The analytical infinite order sudden (IOS) quantum theory of triatomic photodissociation, developed in paper I, is applied to study the indirect photodissociation of NOCl through a real or virtual intermediate state. The theory uses the IOS approximation for the dynamics in the final dissociative channels and an Airy function approximation for the continuum functions. The transition is taken as polarized in the plane of the molecule; symmetric top wave functions are used for both the initial and intermediate bound states; and simple semiempirical model potentials are employed for each state. The theory provides analytical expressions for the photofragment yield spectrum for producing particular final fragment ro-vibrational states as a function of the photon excitation energy. Computations are made of the photofragment excitation spectrum of NOCl in the region of the T1(13A″)←S0(11A') transition for producing the NO fragment in the vibrational states nNO=0, 1, and 2. The computed spectra for the unexcited nNO==0 and excited nNO=2 states are in reasonable agreement with experiment. However, some discrepancies are observed for the singly excited nNO=1 vibrational state, indicating deficiencies in the semiempirical potential energy surface. Computations for two different orientations of the in-plane transition dipole moment produce very similar excitation spectra. Calculations of fragment rotational distributions are performed for high values of the total angular momentum J, a feature that would be very difficult to perform with close-coupled methods. Computations are also made of the thermally averaged rotational energy distributions to simulate the conditions in actual supersonic jet experiments.

  13. Accurate Quantum Wave Packet Study of the Deep Well D+ + HD Reaction: Product Ro-vibrational State-Resolved Integral and Differential Cross Sections.

    PubMed

    He, Haixiang; Zhu, Weimin; Su, Wenli; Dong, Lihui; Li, Bin

    2018-03-08

    The H + + H 2 reaction and its isotopic variants as the simplest triatomic ion-molecule reactive system have been attracting much interests, however there are few studies on the titled reaction at state-to-state level until recent years. In this work, accurate state-to-state quantum dynamics studies of the titled reaction have been carried out by a reactant Jacobi coordinate-based time-dependent wave packet approach on diabatic potential energy surfaces constructed by Kamisaka et al. Product ro-vibrational state-resolved information has been calculated for collision energies up to 0.2 eV with maximal total angular momentum J = 40. The necessity of including all K-component for accounting the Coriolis coupling for the reaction has been illuminated. Competitions between the two product channels, (D + + HD' → D' + + HD and D + + HD' → H + + DD') were investigated. Total integral cross sections suggest that resonances enhance the reactivity of channel D + + HD'→ H + + DD', however, resonances depress the reactivity of the another channel D + + HD' → D' + + HD. The structures of the differential cross sections are complicated and depend strongly on collision energies of the two channels and also on the product rotational states. All of the product ro-vibrational state-resolved differential cross sections for this reaction do not exhibit rigorous backward-forward symmetry which may indicate that the lifetimes of the intermediate resonance complexes should not be that long. The dynamical observables of this deuterated isotopic reaction are quite different from the reaction of H + + H 2 → H 2 + H + reported previously.

  14. On the efficiency of treating singularities in triatomic variational vibrational computations. The vibrational states of H(+)3 up to dissociation.

    PubMed

    Szidarovszky, Tamás; Császár, Attila G; Czakó, Gábor

    2010-08-01

    Several techniques of varying efficiency are investigated, which treat all singularities present in the triatomic vibrational kinetic energy operator given in orthogonal internal coordinates of the two distances-one angle type. The strategies are based on the use of a direct-product basis built from one-dimensional discrete variable representation (DVR) bases corresponding to the two distances and orthogonal Legendre polynomials, or the corresponding Legendre-DVR basis, corresponding to the angle. The use of Legendre functions ensures the efficient treatment of the angular singularity. Matrix elements of the singular radial operators are calculated employing DVRs using the quadrature approximation as well as special DVRs satisfying the boundary conditions and thus allowing for the use of exact DVR expressions. Potential optimized (PO) radial DVRs, based on one-dimensional Hamiltonians with potentials obtained by fixing or relaxing the two non-active coordinates, are also studied. The numerical calculations employed Hermite-DVR, spherical-oscillator-DVR, and Bessel-DVR bases as the primitive radial functions. A new analytical formula is given for the determination of the matrix elements of the singular radial operator using the Bessel-DVR basis. The usually claimed failure of the quadrature approximation in certain singular integrals is revisited in one and three dimensions. It is shown that as long as no potential optimization is carried out the quadrature approximation works almost as well as the exact DVR expressions. If wave functions with finite amplitude at the boundary are to be computed, the basis sets need to meet the required boundary conditions. The present numerical results also confirm that PO-DVRs should be constructed employing relaxed potentials and PO-DVRs can be useful for optimizing quadrature points for calculations applying large coordinate intervals and describing large-amplitude motions. The utility and efficiency of the different algorithms is demonstrated by the computation of converged near-dissociation vibrational energy levels for the H molecular ion.

  15. Ultracold Molecules in Optical Lattices: Efficient Production and Application to Molecular Clocks

    DTIC Science & Technology

    2015-05-03

    near the intercombination- line threshold were measured for a variety of states, and explained by considering nonadiabatic effects ( Coriolis coupling) in...Moszynski, T. Zelevinsky. Nonadiabatic Effects in Ultracold Molecules via Anomalous Linear and Quadratic Zeeman Shifts, Physical Review Letters, (12...M. McDonald, G. Reinaudi, W. Skomorowski, R. Moszynski, T. Zelevinsky. Measurement of Nonadiabatic Effects in Ultracold Molecules via Anomalous

  16. Field Effect Transistor in Nanoscale

    DTIC Science & Technology

    2017-04-26

    analogues) and BxCyNz (Napathalene analogues with x+y+z=10) molecules using quantum many body approach coupled with kinetic (master) equations...analogues with x +y+z=10) molecules using quantum many body approach coupled with kinetic (master) equations. Interestingly, various types of non-linear...Small molecules (such as benzene), double quantum dots (like GaAs-based QDs) which are coupled weakly to metallic electrodes have shown their

  17. Analysis of branched DNA replication and recombination intermediates from prokaryotic cells by two-dimensional (2D) native-native agarose gel electrophoresis.

    PubMed

    Robinson, Nicholas P

    2013-01-01

    Branched DNA molecules are generated by the essential processes of replication and recombination. Owing to their distinctive extended shapes, these intermediates migrate differently from linear double-stranded DNA under certain electrophoretic conditions. However, these branched species exist in the cell at much low abundance than the bulk linear DNA. Consequently, branched molecules cannot be visualized by conventional electrophoresis and ethidium bromide staining. Two-dimensional native-native agarose electrophoresis has therefore been developed as a method to facilitate the separation and visualization of branched replication and recombination intermediates. A wide variety of studies have employed this technique to examine branched molecules in eukaryotic, archaeal, and bacterial cells, providing valuable insights into how DNA is duplicated and repaired in all three domains of life.

  18. Laser-induced emission spectroscopy of matrix-isolated carbon molecules: Experimental setup and new results on C3

    NASA Astrophysics Data System (ADS)

    Čermák, Ivo; Förderer, Markus; Čermáková, Iva; Kalhofer, Stefan; Stopka-Ebeler, Helmut; Monninger, Gerold; Krätschmer, Wolfgang

    1998-06-01

    We have studied small carbon molecules using a matrix-isolation technique. Our experimental setup is described in detail. The carbon clusters were produced by evaporating graphite and trapping the carbon-vapor molecules in solid argon, where molecular growth could be induced by controlled matrix annealing. To identify the produced molecules, absorption spectroscopy in the ultraviolet (UV)-visible and infrared (IR) spectral ranges was applied. Additional characterization of the excited and ground states of the molecules was obtained from emission and excitation spectra. The molecules were excited by a pulsed dye laser system and the emission spectra were recorded with a high-sensitivity photodiode-array spectrometer. We present our measurements on linear C3. The à 1Πu excited state of linear C3 was populated by the electronic transition à 1Πu←X˜ 1Σg+, and the corresponding excitation spectra of the C3 fluorescence (à 1Πu→X˜ 1Σg+) and phosphorescence (ã 3Πu→X˜ 1Σg+) were studied. Comparison of excitation and absorption spectra yielded information on site effects due to the matrix environment. Emission bands in the fluorescence and phosphorescence spectra up to vibrational energies of 8500 cm-1 could be observed. The radiation lifetime of the à 1Πu excited state of C3 in solid argon was found to be shorter than 10 ns. The phosphorescence transition ã 3Πu→X˜ 1Σg+ decays in about 10 ms and its rise indicates fast vibrational relaxation within the triplet system. Our data support a linear ground state geometry for C3 also in solid argon.

  19. Crystal structure of cis-tetra-aqua-dichlorido-cobalt(II) sulfolane disolvate.

    PubMed

    Boudraa, Mhamed; Bouacida, Sofiane; Bouchareb, Hasna; Merazig, Hocine; Chtoun, El Hossain

    2015-02-01

    In the title compound, [CoCl2(H2O)4]·2C4H8SO2, the Co(II) cation is located on the twofold rotation axis and is coordinated by four water mol-ecules and two adjacent chloride ligands in a slightly distorted octa-hedral coordination environment. The cisoid angles are in the range 83.27 (5)-99.66 (2)°. The three transoid angles deviate significantly from the ideal linear angle. The crystal packing can be described as a linear arrangement of complex units along c formed by bifurcated O-H⋯Cl hydrogen bonds between two water mol-ecules from one complex unit towards one chloride ligand of the neighbouring complex. Two solvent mol-ecules per complex are attached to this infinite chain via O-H⋯O hydrogen bonds in which water mol-ecules act as the hydrogen-bond donor and sulfolane O atoms as the hydrogen-bond acceptor sites.

  20. Measurement of a linear free energy relationship one molecule at a time

    PubMed Central

    Rao, B. V.; Kwon, K.-Y.; Liu, A.; Bartels, L.

    2004-01-01

    A systematic study of the dehydrogenation of substituted thiophenols by controlled charge injection from the tip of a scanning tunneling microscope (STM) reveals a pronounced dependence of the reaction yield on the position and the chemical nature of the substituent. We evaluate the dehydrogenation rate of para-halo-substituted species within a linear free energy relationship, namely the Hammett equation. The resultant ρ value of 1.4 can faithfully predict the reaction rates of molecules that are meta-halo-substituted or para-methyl-substituted. The positive sign of ρ suggests a negatively charged transition state at the core of the STM-induced process, and the magnitude of the ρ value indicates that the presence of the substrate does not preclude substantial substituent effects. The applicability of the Hammett equation to single-molecule chemistry offers facile prediction of the rate of STM-based single-molecule chemistry in a field, which so far has been addressed by focusing on involved quantum-mechanical modeling of its underlying processes. PMID:15601774

  1. Measurement of a linear free energy relationship one molecule at a time.

    PubMed

    Rao, B V; Kwon, K-Y; Liu, A; Bartels, L

    2004-12-28

    A systematic study of the dehydrogenation of substituted thiophenols by controlled charge injection from the tip of a scanning tunneling microscope (STM) reveals a pronounced dependence of the reaction yield on the position and the chemical nature of the substituent. We evaluate the dehydrogenation rate of para-halo-substituted species within a linear free energy relationship, namely the Hammett equation. The resultant rho value of 1.4 can faithfully predict the reaction rates of molecules that are meta-halo-substituted or para-methyl-substituted. The positive sign of rho suggests a negatively charged transition state at the core of the STM-induced process, and the magnitude of the rho value indicates that the presence of the substrate does not preclude substantial substituent effects. The applicability of the Hammett equation to single-molecule chemistry offers facile prediction of the rate of STM-based single-molecule chemistry in a field, which so far has been addressed by focusing on involved quantum-mechanical modeling of its underlying processes.

  2. How does the isomerization rate affect the photoisomerization-induced transport properties of a doped molecular glass-former?

    NASA Astrophysics Data System (ADS)

    Accary, J.-B.; Teboul, V.

    2013-07-01

    We investigate the effect of the isomerization rate f on the microscopic mechanisms at the origin of the massive mass transport found in glass-formers doped with isomerizing azobenzene molecules that result in surface relief gratings formation. To this end we simulate the isomerization of dispersed probe molecules embedded into a molecular host glass-former. The host diffusion coefficient first increases linearly with f and then saturates. The saturated value of the diffusion coefficient and of the viscosity does not depend on f but increases with temperature while the linear response for these transport coefficients depends only slightly on the temperature. We interpret this saturation as arising from the appearance of increasingly soft regions around the probes for high isomerization rates, a result in qualitative agreement with experiments. These two different physical behaviors, linear response and saturation, are reminiscent of the two different unexplained mass transport mechanisms observed for small or large light intensities (for small intensities the molecules move towards the dark regions while for large intensities they move towards the illuminated regions).

  3. Scanning tunneling microscopy of the formation, transformation, and property of oligothiophene self-organizations on graphite and gold surfaces.

    PubMed

    Yang, Zhi-Yong; Zhang, Hui-Min; Yan, Cun-Ji; Li, Shan-Shan; Yan, Hui-Juan; Song, Wei-Guo; Wan, Li-Jun

    2007-03-06

    Two alkyl-substituted dual oligothiophenes, quarterthiophene (4T)-trimethylene (tm)-octithiophene (8T) and 4T-tm-4T, were used to fabricate molecular structures on highly oriented pyrolytic graphite and Au(111) surfaces. The resulted structures were investigated by scanning tunneling microscopy. The 4T-tm-8T and 4T-tm-4T molecules self-organize into long-range ordered structures with linear and/or quasi-hexagonal patterns on highly oriented pyrolytic graphite at ambient temperature. Thermal annealing induced a phase transformation from quasi-hexagonal to linear in 4T-tm-8T adlayer. The molecules adsorbed on Au(111) surface in randomly folded and linear conformation. Based on scanning tunneling microscopy results, the structural models for different self-organizations were proposed. Scanning tunneling spectroscopy measurement showed the electronic property of individual molecules in the patterns. These results are significant in understanding the chemistry of molecular structure, including its formation, transformation, and electronic properties. They also help to fabricate oligothiophene assemblies with desired structures for future molecular devices.

  4. DNA confinement in nanochannels: physics and biological applications

    NASA Astrophysics Data System (ADS)

    Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.

    2012-10-01

    DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

  5. DNA confinement in nanochannels: physics and biological applications.

    PubMed

    Reisner, Walter; Pedersen, Jonas N; Austin, Robert H

    2012-10-01

    DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

  6. Comparison of experimental and theoretical triple differential cross sections for the single ionization of C O2 (1 πg ) by electron impact

    NASA Astrophysics Data System (ADS)

    Ozer, Zehra N.; Ali, Esam; Dogan, Mevlut; Yavuz, Murat; Alwan, Osman; Naja, Adnan; Chuluunbaatar, Ochbadrakh; Joulakian, Boghos B.; Ning, Chuan-Gang; Colgan, James; Madison, Don

    2016-06-01

    Experimental and theoretical triple differential cross sections for intermediate-energy (250 eV) electron-impact single ionization of the CO2 are presented for three fixed projectile scattering angles. Results are presented for ionization of the outermost 1 πg molecular orbital of C O2 in a coplanar asymmetric geometry. The experimental data are compared to predictions from the three-center Coulomb continuum approximation for triatomic targets, and the molecular three-body distorted wave (M3DW) model. It is observed that while both theories are in reasonable qualitative agreement with experiment, the M3DW is in the best overall agreement with experiment.

  7. Vectorization of a classical trajectory code on a floating point systems, Inc. Model 164 attached processor.

    PubMed

    Kraus, Wayne A; Wagner, Albert F

    1986-04-01

    A triatomic classical trajectory code has been modified by extensive vectorization of the algorithms to achieve much improved performance on an FPS 164 attached processor. Extensive timings on both the FPS 164 and a VAX 11/780 with floating point accelerator are presented as a function of the number of trajectories simultaneously run. The timing tests involve a potential energy surface of the LEPS variety and trajectories with 1000 time steps. The results indicate that vectorization results in timing improvements on both the VAX and the FPS. For larger numbers of trajectories run simultaneously, up to a factor of 25 improvement in speed occurs between VAX and FPS vectorized code. Copyright © 1986 John Wiley & Sons, Inc.

  8. Quantum coherent π-electron rotations in a non-planar chiral molecule induced by using a linearly polarized UV laser pulse

    NASA Astrophysics Data System (ADS)

    Mineo, Hirobumi; Fujimura, Yuichi

    2015-06-01

    We propose an ultrafast quantum switching method of π-electron rotations, which are switched among four rotational patterns in a nonplanar chiral aromatic molecule (P)-2,2’- biphenol and perform the sequential switching among four rotational patterns which are performed by the overlapped pump-dump laser pulses. Coherent π-electron dynamics are generated by applying the linearly polarized UV pulse laser to create a pair of coherent quasidegenerated excited states. We also plot the time-dependent π-electron ring current, and discussed ring current transfer between two aromatic rings.

  9. Relativistic properties of a molecule: energy, linear momentum, angular momentum and boost momentum to order 1/c 2

    NASA Astrophysics Data System (ADS)

    Cameron, Robert P.; Cotter, J. P.

    2018-05-01

    We give an explicit and general description of the energy, linear momentum, angular momentum and boost momentum of a molecule to order 1/c 2, where it necessary to take account of kinetic contributions made by the electrons and nuclei as well as electromagnetic contributions made by the intramolecular field. A wealth of interesting subtleties are encountered that are not seen at order 1/c 0, including relativistic Hall shifts, anomalous velocities and hidden momenta. Some of these have well known analogues in solid state physics.

  10. Dynamic fluctuations in single-molecule biophysics experiments. Comment on "Extracting physics of life at the molecular level: A review of single-molecule data analyses" by W. Colomb and S.K. Sarkar

    NASA Astrophysics Data System (ADS)

    Krapf, Diego

    2015-06-01

    Single-molecule biophysics includes the study of isolated molecules and that of individual molecules within living cells. In both cases, dynamic fluctuations at the nanoscale play a critical role. Colomb and Sarkar emphasize how different noise sources affect the analysis of single molecule data [1]. Fluctuations in biomolecular systems arise from two very different mechanisms. On one hand thermal fluctuations are a predominant feature in the behavior of individual molecules. On the other hand, non-Gaussian fluctuations can arise from inter- and intramolecular interactions [2], spatial heterogeneities [3], non-Poisson external perturbations [4] and complex non-linear dynamics in general [5,6].

  11. Mechanical response of collagen molecule under hydrostatic compression.

    PubMed

    Saini, Karanvir; Kumar, Navin

    2015-04-01

    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Adiabatic Field-Free Alignment of Asymmetric Top Molecules with an Optical Centrifuge.

    PubMed

    Korobenko, A; Milner, V

    2016-05-06

    We use an optical centrifuge to align asymmetric top SO_{2} molecules by adiabatically spinning their most polarizable O-O axis. The effective centrifugal potential in the rotating frame confines the sulfur atoms to the plane of the laser-induced rotation, leading to the planar molecular alignment that persists after the molecules are released from the centrifuge. The periodic appearance of the full three-dimensional alignment, typically observed only with linear and symmetric top molecules, is also detected. Together with strong in-plane centrifugal forces, which bend the molecules by up to 10 deg, permanent field-free alignment offers new ways of controlling molecules with laser light.

  13. Molecular structure, supramolecular organization and thermotropic phase behavior of N-acylglycine alkyl esters with matched acyl and alkyl chains.

    PubMed

    Reddy, S Thirupathi; Swamy, Musti J

    2017-11-01

    N-Acylglycines (NAGs), the endogenous single-tailed lipids present in rat brain and other mammalian tissues, play significant roles in cell physiology and exhibit interesting pharmacological properties. In the present study, a homologous series of N-acylglycine alkyl esters (NAGEs) with matched chains were synthesized and characterized. Results of differential scanning calorimetric studies revealed that all NAGEs exhibit a single sharp phase transition and that the transition enthalpy and entropy show a linear dependence on the N-acyl and ester alkyl chain length. The structure of N-myristoylglycine myristyl ester (NMGME), solved by single-crystal X-ray diffraction, showed that the molecule adopts a linear geometry and revealed that the structure of N-myristoyl glycyl moiety in NMGME is identical to that in N-myristoylglycine. The molecules are packed in layers with the polar functional groups of the ester and amide functionalities located at the center of the layer. The crystal packing is stabilized by NH⋯O hydrogen bonds between the amide CO and NH groups of adjacent molecules as well as by CH⋯O hydrogen bonds between the amide carbonyl and the methylene CH adjacent to the ester carbonyl of neighboring molecules as well as between ester carbonyl and methylene group of the glycine moiety of adjacent molecules. Powder X-ray diffraction studies showed a linear dependence of the d-spacings on the acyl chain length, suggesting that all NAGEs adopt a structure similar to the packing exhibited in the crystal lattice of NMGME. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Third-order-harmonic generation in coherently spinning molecules

    NASA Astrophysics Data System (ADS)

    Prost, E.; Zhang, H.; Hertz, E.; Billard, F.; Lavorel, B.; Bejot, P.; Zyss, Joseph; Averbukh, Ilya Sh.; Faucher, O.

    2017-10-01

    The rotational Doppler effect occurs when circularly polarized light interacts with a rotating anisotropic material. It is manifested by the appearance of a spectral shift ensuing from the transfer of angular momentum and energy between radiation and matter. Recently, we reported terahertz-range rotational Doppler shifts produced in third-order nonlinear optical conversion [O. Faucher et al., Phys. Rev. A 94, 051402(R) (2016), 10.1103/PhysRevA.94.051402]. The experiment was performed in an ensemble of coherently spinning molecules prepared by a short laser pulse exhibiting a twisted linear polarization. The present work provides an extensive analysis of the rotational Doppler effect in third-order-harmonic generation from spinning linear molecules. The underlying physics is investigated both experimentally and theoretically. The implication of the rotational Doppler effect in higher-order processes like high-order-harmonic generation is discussed.

  15. Nanopores and nucleic acids: prospects for ultrarapid sequencing

    NASA Technical Reports Server (NTRS)

    Deamer, D. W.; Akeson, M.

    2000-01-01

    DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.

  16. Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes

    PubMed Central

    Simons, Michelle; Szczelkun, Mark D.

    2011-01-01

    The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5′-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can ‘turnover’ in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase–nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed. PMID:21712244

  17. The gas phase structure of transition metal dihydrides

    NASA Astrophysics Data System (ADS)

    Demuynck, Jean; Schaefer, Henry F.

    1980-01-01

    ESR and infrared spectroscopic measurements on matrix isolated MnH2 and CrH2 have recently suggested that these simple molecules may be bent. This result would be the opposite of that found experimentally for the transition metal dihalides MX2, known to be linear. Here the geometrical structure of MnH2 has been investigated by molecular electronic structure theory. A large contracted Gaussian basis set [Mn(14s11p6p/9s8p3d), H(5s1p/3s1p)] was used in conjunction with self-consistent field and configuration interaction methods. These suggest that the 6A1 ground state of MnH2 is linear. Further studies of the 3A1 state (one of several low-lying states) of TiH2 also favor linearity, although this potential energy surface is extremely flat with respect to bending. Thus it appears probable that most MH2 molecules, like the related MX2 family, are linear.

  18. Structural and vibrational characteristics of a non-linear optical material 3-(4-nitrophenyl)-1-(pyridine-3-yl) prop-2-en-1-one probed by quantum chemical computation and spectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Kumar, Ram; Karthick, T.; Tandon, Poonam; Agarwal, Parag; Menezes, Anthoni Praveen; Jayarama, A.

    2018-07-01

    Chalcone and its derivatives are well-known for their high non-linear optical behavior and charge transfer characteristics. The effectiveness of charge transfer via ethylenic group and increase in NLO response of the chalcone upon substitutions are of great interest. The present study focuses the structural, charge transfer and non-linear optical properties of a new chalcone derivative "3-(4-nitrophenyl)-1-(pyridine-3-yl) prop-2-en-1-one" (hereafter abbreviated as 4 NP3AP). To accomplish this task, we have incorporated the experimental FT-IR, FT-Raman and UV-vis spectroscopic studies along with quantum chemical calculations. The frequency assignments of peaks in IR and Raman have been done on the basis of potential energy distribution and the results were compared with the earlier reports on similar kind of molecules. For obtaining the electronic transition details of 4 NP3AP, UV-vis spectrum has been simulated by considering both gaseous and solvent phase using time-dependent density functional theory (TD-DFT). The HOMO-LUMO energy gap, most important factor to be considered for studying charge transfer properties of the molecule has been calculated. The electron density surface map corresponding to the net electrostatic point charges has been generated to obtain the electrophilic and nucleophilic sites. The charge transfer originating from the occupied (donor) and unoccupied (acceptor) molecular orbitals have been analyzed with the help of natural bond orbital theory. Moreover, the estimation of second-hyperpolarizability of the molecule confirms the non-linear optical behavior of the molecule.

  19. Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    NASA Astrophysics Data System (ADS)

    Stasiak, Andrzej

    2016-09-01

    Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

  20. High-harmonic spectroscopy of aligned molecules

    NASA Astrophysics Data System (ADS)

    Yun, Hyeok; Yun, Sang Jae; Lee, Gae Hwang; Nam, Chang Hee

    2017-01-01

    High harmonics emitted from aligned molecules driven by intense femtosecond laser pulses provide the opportunity to explore the structural information of molecules. The field-free molecular alignment technique is an expedient tool for investigating the structural characteristics of linear molecules. The underlying physics of field-free alignment, showing the characteristic revival structure specific to molecular species, is clearly explained from the quantum-phase analysis of molecular rotational states. The anisotropic nature of molecules is shown from the harmonic polarization measurement performed with spatial interferometry. The multi-orbital characteristics of molecules are investigated using high-harmonic spectroscopy, applied to molecules of N2 and CO2. In the latter case the two-dimensional high-harmonic spectroscopy, implemented using a two-color laser field, is applied to distinguish harmonics from different orbitals. Molecular high-harmonic spectroscopy will open a new route to investigate ultrafast dynamics of molecules.

  1. Length-dependent thermal transport in one-dimensional self-assembly of planar π-conjugated molecules

    NASA Astrophysics Data System (ADS)

    Tang, Hao; Xiong, Yucheng; Zu, Fengshuo; Zhao, Yang; Wang, Xiaomeng; Fu, Qiang; Jie, Jiansheng; Yang, Juekuan; Xu, Dongyan

    2016-06-01

    This work reports a thermal transport study in quasi-one-dimensional organic nanostructures self-assembled from conjugated planar molecules via π-π interactions. Thermal resistances of single crystalline copper phthalocyanine (CuPc) and perylenetetracarboxylic diimide (PTCDI) nanoribbons are measured via a suspended thermal bridge method. We experimentally observed the deviation from the linear length dependence for the thermal resistance of single crystalline β-phase CuPc nanoribbons, indicating possible subdiffusion thermal transport. Interestingly, a gradual transition to the linear length dependence is observed with the increase of the lateral dimensions of CuPc nanoribbons. The measured thermal resistance of single crystalline CuPc nanoribbons shows an increasing trend with temperature. However, the trend of temperature dependence of thermal resistance is reversed after electron irradiation, i.e., decreasing with temperature, indicating that the single crystalline CuPc nanoribbons become `amorphous'. Similar behavior is also observed for PTCDI nanoribbons after electron irradiation, proving that the electron beam can induce amorphization of single crystalline self-assembled nanostructures of planar π-conjugated molecules. The measured thermal resistance of the `amorphous' CuPc nanoribbon demonstrates a roughly linear dependence on the nanoribbon length, suggesting that normal diffusion dominates thermal transport.This work reports a thermal transport study in quasi-one-dimensional organic nanostructures self-assembled from conjugated planar molecules via π-π interactions. Thermal resistances of single crystalline copper phthalocyanine (CuPc) and perylenetetracarboxylic diimide (PTCDI) nanoribbons are measured via a suspended thermal bridge method. We experimentally observed the deviation from the linear length dependence for the thermal resistance of single crystalline β-phase CuPc nanoribbons, indicating possible subdiffusion thermal transport. Interestingly, a gradual transition to the linear length dependence is observed with the increase of the lateral dimensions of CuPc nanoribbons. The measured thermal resistance of single crystalline CuPc nanoribbons shows an increasing trend with temperature. However, the trend of temperature dependence of thermal resistance is reversed after electron irradiation, i.e., decreasing with temperature, indicating that the single crystalline CuPc nanoribbons become `amorphous'. Similar behavior is also observed for PTCDI nanoribbons after electron irradiation, proving that the electron beam can induce amorphization of single crystalline self-assembled nanostructures of planar π-conjugated molecules. The measured thermal resistance of the `amorphous' CuPc nanoribbon demonstrates a roughly linear dependence on the nanoribbon length, suggesting that normal diffusion dominates thermal transport. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr09043a

  2. Many-Body Descriptors for Predicting Molecular Properties with Machine Learning: Analysis of Pairwise and Three-Body Interactions in Molecules.

    PubMed

    Pronobis, Wiktor; Tkatchenko, Alexandre; Müller, Klaus-Robert

    2018-06-12

    Machine learning (ML) based prediction of molecular properties across chemical compound space is an important and alternative approach to efficiently estimate the solutions of highly complex many-electron problems in chemistry and physics. Statistical methods represent molecules as descriptors that should encode molecular symmetries and interactions between atoms. Many such descriptors have been proposed; all of them have advantages and limitations. Here, we propose a set of general two-body and three-body interaction descriptors which are invariant to translation, rotation, and atomic indexing. By adapting the successfully used kernel ridge regression methods of machine learning, we evaluate our descriptors on predicting several properties of small organic molecules calculated using density-functional theory. We use two data sets. The GDB-7 set contains 6868 molecules with up to 7 heavy atoms of type CNO. The GDB-9 set is composed of 131722 molecules with up to 9 heavy atoms containing CNO. When trained on 5000 random molecules, our best model achieves an accuracy of 0.8 kcal/mol (on the remaining 1868 molecules of GDB-7) and 1.5 kcal/mol (on the remaining 126722 molecules of GDB-9) respectively. Applying a linear regression model on our novel many-body descriptors performs almost equal to a nonlinear kernelized model. Linear models are readily interpretable: a feature importance ranking measure helps to obtain qualitative and quantitative insights on the importance of two- and three-body molecular interactions for predicting molecular properties computed with quantum-mechanical methods.

  3. Detection of kinetic change points in piece-wise linear single molecule motion

    NASA Astrophysics Data System (ADS)

    Hill, Flynn R.; van Oijen, Antoine M.; Duderstadt, Karl E.

    2018-03-01

    Single-molecule approaches present a powerful way to obtain detailed kinetic information at the molecular level. However, the identification of small rate changes is often hindered by the considerable noise present in such single-molecule kinetic data. We present a general method to detect such kinetic change points in trajectories of motion of processive single molecules having Gaussian noise, with a minimum number of parameters and without the need of an assumed kinetic model beyond piece-wise linearity of motion. Kinetic change points are detected using a likelihood ratio test in which the probability of no change is compared to the probability of a change occurring, given the experimental noise. A predetermined confidence interval minimizes the occurrence of false detections. Applying the method recursively to all sub-regions of a single molecule trajectory ensures that all kinetic change points are located. The algorithm presented allows rigorous and quantitative determination of kinetic change points in noisy single molecule observations without the need for filtering or binning, which reduce temporal resolution and obscure dynamics. The statistical framework for the approach and implementation details are discussed. The detection power of the algorithm is assessed using simulations with both single kinetic changes and multiple kinetic changes that typically arise in observations of single-molecule DNA-replication reactions. Implementations of the algorithm are provided in ImageJ plugin format written in Java and in the Julia language for numeric computing, with accompanying Jupyter Notebooks to allow reproduction of the analysis presented here.

  4. Zero-phonon-line emission of single molecules for applications in quantum information processing

    NASA Astrophysics Data System (ADS)

    Kiraz, Alper; Ehrl, M.; Mustecaplioglu, O. E.; Hellerer, T.; Brauchle, C.; Zumbusch, A.

    2005-07-01

    A single photon source which generates transform limited single photons is highly desirable for applications in quantum optics. Transform limited emission guarantees the indistinguishability of the emitted single photons. This, in turn brings groundbreaking applications in linear optics quantum information processing within an experimental reach. Recently, self-assembled InAs quantum dots and trapped atoms have successfully been demonstrated as such sources for highly indistinguishable single photons. Here, we demonstrate that nearly transform limited zero-phonon-line (ZPL) emission from single molecules can be obtained by using vibronic excitation. Furthermore we report the results of coincidence detection experiments at the output of a Michelson-type interferometer. These experiments reveal Hong-Ou-Mandel correlations as a proof of the indistinguishability of the single photons emitted consecutively from a single molecule. Therefore, single molecules constitute an attractive alternative to single InAs quantum dots and trapped atoms for applications in linear optics quantum information processing. Experiments were performed with a home-built confocal microscope keeping the sample in a superfluid liquid Helium bath at 1.4K. We investigated terrylenediimide (TDI) molecules highly diluted in hexadecane (Shpol'skii matrix). A continuous wave single mode dye laser was used for excitation of vibronic transitions of individual molecules. From the integral fluorescence, the ZPL of single molecules was selected with a spectrally narrow interference filter. The ZPL emission was then sent to a scanning Fabry-Perot interferometer for linewidth measurements or a Michelson-type interferometer for coincidence detection.

  5. DNA of a Human Hepatitis B Virus Candidate

    PubMed Central

    Robinson, William S.; Clayton, David A.; Greenman, Richard L.

    1974-01-01

    Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328

  6. Identification and Characterization of Circular RNAs As a New Class of Putative Biomarkers in Human Blood

    PubMed Central

    Peters, Oliver; Rajewsky, Nikolaus

    2015-01-01

    Covalently closed circular RNA molecules (circRNAs) have recently emerged as a class of RNA isoforms with widespread and tissue specific expression across animals, oftentimes independent of the corresponding linear mRNAs. circRNAs are remarkably stable and sometimes highly expressed molecules. Here, we sequenced RNA in human peripheral whole blood to determine the potential of circRNAs as biomarkers in an easily accessible body fluid. We report the reproducible detection of thousands of circRNAs. Importantly, we observed that hundreds of circRNAs are much higher expressed than corresponding linear mRNAs. Thus, circRNA expression in human blood reveals and quantifies the activity of hundreds of coding genes not accessible by classical mRNA specific assays. Our findings suggest that circRNAs could be used as biomarker molecules in standard clinical blood samples. PMID:26485708

  7. DNA recombination activity in soybean mitochondria.

    PubMed

    Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L

    2006-02-17

    Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.

  8. Theory of attosecond delays in molecular photoionization.

    PubMed

    Baykusheva, Denitsa; Wörner, Hans Jakob

    2017-03-28

    We present a theoretical formalism for the calculation of attosecond delays in molecular photoionization. It is shown how delays relevant to one-photon-ionization, also known as Eisenbud-Wigner-Smith delays, can be obtained from the complex dipole matrix elements provided by molecular quantum scattering theory. These results are used to derive formulae for the delays measured by two-photon attosecond interferometry based on an attosecond pulse train and a dressing femtosecond infrared pulse. These effective delays are first expressed in the molecular frame where maximal information about the molecular photoionization dynamics is available. The effects of averaging over the emission direction of the electron and the molecular orientation are introduced analytically. We illustrate this general formalism for the case of two polyatomic molecules. N 2 O serves as an example of a polar linear molecule characterized by complex photoionization dynamics resulting from the presence of molecular shape resonances. H 2 O illustrates the case of a non-linear molecule with comparably simple photoionization dynamics resulting from a flat continuum. Our theory establishes the foundation for interpreting measurements of the photoionization dynamics of all molecules by attosecond metrology.

  9. Nanoscale Trapping and Squeeze-Out of Confined Alkane Monolayers.

    PubMed

    Gosvami, N N; O'Shea, S J

    2015-12-01

    We present combined force curve and conduction atomic force microscopy (AFM) data for the linear alkanes CnH2n+2 (n = 10, 12, 14, 16) confined between a gold-coated AFM tip and a graphite surface. Solvation layering is observed in the force curves for all liquids, and conduction AFM is used to study in detail the removal of the confined (mono)layer closest to the graphite surface. The squeeze-out behavior of the monolayer can be very different depending upon the temperature. Below the monolayer melting transition temperatures the molecules are in an ordered state on the graphite surface, and fast and complete removal of the confined molecules is observed. However, above the melting transition temperature the molecules are in a disordered state, and even at large applied pressure a few liquid molecules are trapped within the tip-sample contact zone. These findings are similar to a previous study for branched alkanes [ Gosvami Phys. Rev. Lett. 2008, 100, 076101 ], but the observation for the linear alkane homologue series demonstrates clearly the dependence of the squeeze-out and trapping on the state of the confined material.

  10. Prediction of octanol-water partition coefficients of organic compounds by multiple linear regression, partial least squares, and artificial neural network.

    PubMed

    Golmohammadi, Hassan

    2009-11-30

    A quantitative structure-property relationship (QSPR) study was performed to develop models those relate the structure of 141 organic compounds to their octanol-water partition coefficients (log P(o/w)). A genetic algorithm was applied as a variable selection tool. Modeling of log P(o/w) of these compounds as a function of theoretically derived descriptors was established by multiple linear regression (MLR), partial least squares (PLS), and artificial neural network (ANN). The best selected descriptors that appear in the models are: atomic charge weighted partial positively charged surface area (PPSA-3), fractional atomic charge weighted partial positive surface area (FPSA-3), minimum atomic partial charge (Qmin), molecular volume (MV), total dipole moment of molecule (mu), maximum antibonding contribution of a molecule orbital in the molecule (MAC), and maximum free valency of a C atom in the molecule (MFV). The result obtained showed the ability of developed artificial neural network to prediction of partition coefficients of organic compounds. Also, the results revealed the superiority of ANN over the MLR and PLS models. Copyright 2009 Wiley Periodicals, Inc.

  11. Acenes, Heteroacenes and Analogous Molecules for Organic Photovoltaic and Field Effect Transistor Applications

    NASA Astrophysics Data System (ADS)

    Granger, Devin Benjamin

    Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and donor molecules for bulk heterojunction organic photovoltaics based on anthrathiophene and benzo[1,2-b:4,5-b']dithiophene central units like literature molecules containing fluorene and dithieno[2,3-b:2',3'-d]silole cores. The synthetic strategies of developing reduced symmetry benzo[1,2-b:4,5-b']dithiophene to study the effect of substitution around the central unit is also described. The optical and electronic properties of the donors and acceptors are described along with the performance and characteristics of devices employing these molecules. The final two data chapters focus on new nitrogen containing polycyclic hydrocarbons containing indolizine and (2.2.2) cyclazine units. The optical, electronic and other physical properties of these molecules are explored, in addition to the synthetic strategies for incorporating the indolizine and cyclazine units. By use of alkylsilylethynyl groups, crystal engineering was investigated for the benzo[2,3-b:5,6-b']diindolizine chromophore described in chapter 4 to target the 2-D "brick-work" packing motif for application in field effect transistor devices. Optical and electronic properties of the cyclazine end-capped acene molecules described in chapter 5 were investigated and described in relation to the base acene molecules. In both cases, density functional theory calculations were conducted to better understand unexpected optical properties of these molecules, which are like the linear acene series despite the non-linear attachment.

  12. A study of the region of massive star formation L379IRS1 in radio lines of methanol and other molecules

    NASA Astrophysics Data System (ADS)

    Kalenskii, S. V.; Shchurov, M. A.

    2016-04-01

    The results of spectral observations of the region of massive star formation L379IRS1 (IRAS18265-1517) are presented. The observations were carried out with the 30-m Pico Veleta radio telescope (Spain) at seven frequencies in the 1-mm, 2-mm, and 3-mm wavelength bands. Lines of 24 molecules were detected, from simple diatomic or triatomic species to complex eight- or nine-atom compounds such as CH3OCHO or CH3OCH3. Rotation diagrams constructed from methanol andmethyl cyanide lines were used to determine the temperature of the quiescent gas in this region, which is about 40-50 K. In addition to this warm gas, there is a hot component that is revealed through high-energy lines of methanol and methyl cyanide, molecular lines arising in hot regions, and the presence of H2O masers and Class II methanol masers at 6.7 GHz, which are also related to hot gas. One of the hot regions is probably a compact hot core, which is located near the southern submillimeter peak and is related to a group of methanol masers at 6.7 GHz. High-excitation lines at other positions may be associated with other hot cores or hot post-shock gas in the lobes of bipolar outflows. The rotation diagrams can be use to determine the column densities and abundances of methanol (10-9) and methyl cyanide (about 10-11) in the quiescent gas. The column densities of A- and E-methanol in L379IRS1 are essentually the same. The column densities of other observedmolecules were calculated assuming that the ratios of the molecular level abundances correspond to a temperature of 40 K. The molecular composition of the quiescent gas is close to that in another region of massive star formation, DR21(OH). The only appreciable difference is that the column density of SO2 in L379IRS1 is at least a factor of 20 lower than the value in DR21(OH). The SO2/CS and SO2/OCS abundance ratios, which can be used as chemical clocks, are lower in L379IRS1 than in DR21(OH), suggesting that L379IRS1 is probably younger than DR21(OH).

  13. Adsorption of methyl green on montmorillonite

    NASA Astrophysics Data System (ADS)

    Margulies, Leon; Rozen, Harel

    1986-03-01

    Adsorption of the dye methyl green (MG) on Na -montmorillonite (Clay) takes place through a cation exchange mechanism. At low and high MG loads, each MG molecule replaces approximately two and one Na + ions, respectively. Interactions between MG and Clay were studied using visible absorption and FTIR spectroscopies, and the orientation of the adsorbed molecules were determined by infrared linear dichroism and X-ray powder diffraction. The dye molecules are preferentially oriented with their plane parallel to the clay surface. The influence of MG load on the adsorption of two additional organic molecules, benzyl benzoate and benzophenone, was also studied.

  14. Structural Design and Photochemical Preparation of Ultrathin Molecular Film Materials

    DTIC Science & Technology

    2006-12-01

    tetracene and pentacene that have great potential as organic semiconducting materials, have been determined. Overall, we have gained to great extend a...layer of linear acenes, molecules such as tetracene and pentacene that have great potential as organic semiconducting materials, have been determined...intermolecular interaction of mono- and multi-layer linear acenes on metal A systematic study of adsorption of linear acenes, from benzene to pentacene , on metal

  15. Potential energy surface and vibrational band origins of the triatomic lithium cation

    NASA Astrophysics Data System (ADS)

    Searles, Debra J.; Dunne, Simon J.; von Nagy-Felsobuki, Ellak I.

    The 104 point CISD Li +3 potential energy surface and its analytical representation is reported. The calculations predict the minimum energy geometry to be an equilateral triangle of side RLiLi = 3.0 Å and of energy - 22.20506 E h. A fifth-order Morse—Dunham type analytical force field is used in the Carney—Porter normal co-ordinate vibrational Hamiltonian, the corresponding eigenvalue problem being solved variationally using a 560 configurational finite-element basis set. The predicted assignment of the vibrational band origins is in accord with that reported for H +3. Moreover, for 6Li +3 and 7Li +3 the lowest i.r. accessible band origin is the overlineν0,1,±1 predicted to be at 243.6 and 226.0 cm -1 respectively.

  16. A scale-bridging modeling approach for anisotropic organic molecules at patterned semiconductor surfaces

    NASA Astrophysics Data System (ADS)

    Kleppmann, Nicola; Klapp, Sabine H. L.

    2015-02-01

    Hybrid systems consisting of organic molecules at inorganic semiconductor surfaces are gaining increasing importance as thin film devices for optoelectronics. The efficiency of such devices strongly depends on the collective behavior of the adsorbed molecules. In the present paper, we propose a novel, coarse-grained model addressing the condensed phases of a representative hybrid system, that is, para-sexiphenyl (6P) at zinc-oxide (ZnO). Within our model, intermolecular interactions are represented via a Gay-Berne potential (describing steric and van-der-Waals interactions) combined with the electrostatic potential between two linear quadrupoles. Similarly, the molecule-substrate interactions include a coupling between a linear molecular quadrupole to the electric field generated by the line charges characterizing ZnO(10-10). To validate our approach, we perform equilibrium Monte Carlo simulations, where the lateral positions are fixed to a 2D lattice, while the rotational degrees of freedom are continuous. We use these simulations to investigate orientational ordering in the condensed state. We reproduce various experimentally observed features such as the alignment of individual molecules with the line charges on the surface, the formation of a standing uniaxial phase with a herringbone structure, as well as the formation of a lying nematic phase.

  17. Energy level alignment of self-assembled linear chains of benzenediamine on Au(111) from first principles

    NASA Astrophysics Data System (ADS)

    Li, Guo; Rangel, Tonatiuh; Liu, Zhen-Fei; Cooper, Valentino R.; Neaton, Jeffrey B.

    2016-03-01

    Using density functional theory (DFT) with a van der Waals density functional, we calculate the adsorption energetics and geometry of benzenediamine (BDA) molecules on Au(111) surfaces. Our results demonstrate that the reported self-assembled linear chain structure of BDA, stabilized via hydrogen bonds between amine groups, is energetically favored over previously studied monomeric phases. Moreover, using a model, which includes nonlocal polarization effects from the substrate and the neighboring molecules and incorporates many-body perturbation theory calculations within the GW approximation, we obtain approximate self-energy corrections to the DFT highest occupied molecular orbital (HOMO) energy associated with BDA adsorbate phases. We find that, independent of coverage, the HOMO energy of the linear chain phase is lower relative to the Fermi energy than that of the monomer phase, and in good agreement with values measured with ultraviolet photoelectron spectroscopy and x-ray photoelectron spectroscopy.

  18. Dynamics of a Room Temperature Ionic Liquid in Supported Ionic Liquid Membranes vs the Bulk Liquid: 2D IR and Polarized IR Pump-Probe Experiments.

    PubMed

    Shin, Jae Yoon; Yamada, Steven A; Fayer, Michael D

    2017-01-11

    Supported ionic liquid membranes (SILMs) are membranes that have ionic liquids impregnated in their pores. SILMs have been proposed for advanced carbon capture materials. Two-dimensional infrared (2D IR) and polarization selective IR pump-probe (PSPP) techniques were used to investigate the dynamics of reorientation and spectral diffusion of the linear triatomic anion, SeCN - , in poly(ether sulfone) (PES) membranes and room-temperature ionic liquid (RTIL), 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EmimNTf 2 ). The dynamics in the bulk EmimNTf 2 were compared to its dynamics in the SILM samples. Two PES membranes, PES200 and PES30, have pores with average sizes, ∼300 nm and ∼100 nm, respectively. Despite the relatively large pore sizes, the measurements reveal that the reorientation of SeCN - and the RTIL structural fluctuations are substantially slower in the SILMs than in the bulk liquid. The complete orientational randomization, slows from 136 ps in the bulk to 513 ps in the PES30. 2D IR measurements yield three time scales for structural spectral diffusion (SSD), that is, the time evolution of the liquid structure. The slowest decay constant increases from 140 ps in the bulk to 504 ps in the PES200 and increases further to 1660 ps in the PES30. The results suggest that changes at the interface propagate out and influence the RTIL structural dynamics even more than a hundred nanometers from the polymer surface. The differences between the IL dynamics in the bulk and in the membranes suggest that studies of bulk RTIL properties may be poor guides to their use in SILMs in carbon capture applications.

  19. Sludge reduction by ozone: Insights and modeling of the dose-response effects.

    PubMed

    Fall, C; Silva-Hernández, B C; Hooijmans, C M; Lopez-Vazquez, C M; Esparza-Soto, M; Lucero-Chávez, M; van Loosdrecht, M C M

    2018-01-15

    Applying ozone to the return flow in an activated sludge (AS) process is a way for reducing the residual solids production. To be able to extend the activated sludge models to the ozone-AS process, adequate prediction of the tri-atoms effects on the particulate COD fractions is needed. In this study, the biomass inactivation, COD mineralization, and solids dissolution were quantified in batch tests and dose-response models were developed as a function of the reacted ozone doses (ROD). Three kinds of model-sludge were used. S1 was a lab-cultivated synthetic sludge with two components (heterotrophs X H and X P ). S2 was a digestate of S1 almost made by the endogenous residues, X P . S3 was from a municipal activated sludge plant. The specific ozone uptake rate (SO 3 UR, mgO 3 /gCOD.h) was determined as a tool for characterizing the reactivity of the sludges. SO 3 UR increased with the X H fraction and decreased with more X P . Biomass inactivation was exponential (e -β.ROD ) as a function of the ROD doses. The percentage of solids reduction was predictable through a linear model (C Miner  + Y sol ROD), with a fixed part due to mineralization (C Miner ) and a variable part from the solubilization process. The parameters of the models, i.e. the inactivation and the dissolution yields (β, 0.008-0.029 (mgO 3 /mgCOD ini ) -1 vs Y sol , 0.5-2.8 mg COD sol /mgO 3 ) varied in magnitude, depending on the intensity of the scavenging reactions and potentially the compactness of the flocs for each sludge. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Diffusion of isolated DNA molecules: dependence on length and topology.

    PubMed

    Robertson, Rae M; Laib, Stephan; Smith, Douglas E

    2006-05-09

    The conformation and dynamics of circular polymers is a subject of considerable theoretical and experimental interest. DNA is an important example because it occurs naturally in different topological states, including linear, relaxed circular, and supercoiled circular forms. A fundamental question is how the diffusion coefficients of isolated polymers scale with molecular length and how they vary for different topologies. Here, diffusion coefficients D for relaxed circular, supercoiled, and linear DNA molecules of length L ranging from approximately 6 to 290 kbp were measured by tracking the Brownian motion of single molecules. A topology-independent scaling law D approximately L(-nu) was observed with nu(L) = 0.571 +/- 0.014, nu(C) = 0.589 +/- 0.018, and nu(S) = 0.571 +/- 0.057 for linear, relaxed circular, and supercoiled DNA, respectively, in good agreement with the scaling exponent of nu congruent with 0.588 predicted by renormalization group theory for polymers with significant excluded volume interactions. Our findings thus provide evidence in support of several theories that predict an effective diameter of DNA much greater than the Debye screening length. In addition, the measured ratio D(Circular)/D(Linear) = 1.32 +/- 0.014 was closer to the value of 1.45 predicted by using renormalization group theory than the value of 1.18 predicted by classical Kirkwood hydrodynamic theory and agreed well with a value of 1.31 predicted when incorporating a recently proposed expression for the radius of gyration of circular polymers into the Zimm model.

  1. Self-assembled nanostructures of linear arylacetylenes and their aza-substituted analogues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Jia-Ju; Department of Physics and Materials Science and Centre of Super Diamond and Advanced Films; Yang, Xiong-Bo

    2016-06-15

    A series of linear phenylene ethynylene molecules have been synthesized, and aza-substitution has been used as a strategy to fine-tune the properties of the molecules. All the compounds exhibited pure blue emission both in solution and solid state, and fluorescence quantum yields as high as 0.66, 0.63 and 0.82 were found in chloroform solutions. The well-defined nanostructures such as quasi-cubes, cubes and rods were fabricated by self-assembly method from these compounds. The photophysical properties and aggregation behavior of self-assembled structures were analyzed in detail. The morphology as well as photophysical properties of these nanostructures have been tuned with selective requirements.

  2. Unraveling secrets of telomeres: one molecule at a time

    PubMed Central

    Lin, Jiangguo; Kaur, Parminder; Countryman, Preston; Opresko, Patricia L.; Wang, Hong

    2016-01-01

    Telomeres play important roles in maintaining the stability of linear chromosomes. Telomere maintenance involves dynamic actions of multiple proteins interacting with long repetitive sequences and complex dynamic DNA structures, such as G-quadruplexes, T-loops and t-circles. Given the heterogeneity and complexity of telomeres, single-molecule approaches are essential to fully understand the structure-function relationships that govern telomere maintenance. In this review, we present a brief overview of the principles of single-molecule imaging and manipulation techniques. We then highlight results obtained from applying these single-molecule techniques for studying structure, dynamics and functions of G-quadruplexes, telomerase, and shelterin proteins. PMID:24569170

  3. Continuous approximation for interaction energy of adamantane encapsulated inside carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Baowan, Duangkamon; Hill, James M.; Bacsa, Wolfgang

    2018-02-01

    The interaction energy for two adjacent adamantane molecules and that of adamantane molecules encapsulated inside carbon nanotubes are investigated considering only dipole-dipole induced interaction. The Lennard-Jones potential and the continuous approximation are utilised to derive analytical expressions for these interaction energies. The equilibrium distance 3.281 Å between two adamantane molecules is determined. The smallest carbon nanotube radius b0 that can encapsulate the adamantane molecule and the radius of the tube bmax that gives the maximum suction energy, linearly depend on the adamantane radius, are calculated. For larger diameter tubes, the off axis position has been calculated, and equilibrium distance between molecule and tube wall is found to be close to the interlayer spacing in graphene.

  4. Monte-Carlo simulations of a coarse-grained model for α-oligothiophenes

    NASA Astrophysics Data System (ADS)

    Almutairi, Amani; Luettmer-Strathmann, Jutta

    The interfacial layer of an organic semiconductor in contact with a metal electrode has important effects on the performance of thin-film devices. However, the structure of this layer is not easy to model. Oligothiophenes are small, π-conjugated molecules with applications in organic electronics that also serve as small-molecule models for polythiophenes. α-hexithiophene (6T) is a six-ring molecule, whose adsorption on noble metal surfaces has been studied extensively (see, e.g., Ref.). In this work, we develop a coarse-grained model for α-oligothiophenes. We describe the molecules as linear chains of bonded, discotic particles with Gay-Berne potential interactions between non-bonded ellipsoids. We perform Monte Carlo simulations to study the structure of isolated and adsorbed molecules

  5. Nanopore analysis of polymers in solution.

    NASA Astrophysics Data System (ADS)

    Deamer, David

    2002-03-01

    Nanopores represent a novel approach for investigating macromolecules in solution. Polymers that have been analyzed by this technique include polyethylene glycol (PEG), certain proteins and nucleic acids. The a-hemolysin pore inserted into lipid bilayers provides continuous non-gated ion current through a pore diameter of approximately 1.5 - 2 nm. Nucleic acid molecules can be driven through the pore by imposing a voltage across the supporting membrane. Single stranded, but not double stranded nucleic acids pass through in strict linear sequence from one end of the molecule to the other. While in the pore, the molecule reduces ionic current, and properties of the ionic current blockade such as duration, mean amplitude and modulations of amplitude provide information about structure and composition of the nucleic acid. For a given molecular species, the duration of the blockade is a function of chain length, and the rate of blockades is linearly related to concentration. More recent studies have shown that the a-hemolysin nanopore can discriminate between synthetic DNA molecules differing by a single base pair or even a single nucleotide. These results indicate that a nanopore may have the resolution required for nucleic acid sequencing applications.

  6. Interplay between Self-Assembled Structures and Energy Level Alignment of Benzenediamine on Au(111) Surfaces

    NASA Astrophysics Data System (ADS)

    Li, Guo; Neaton, Jeffrey

    2015-03-01

    Using van der Waals-corrected density functional theory (DFT) calculations, we study the adsorption of benzene-diamine (BDA) molecules on Au(111) surfaces. We find that at low surface coverage, the adsorbed molecules prefer to stay isolated from each other in a monomer phase, due to the inter-molecular dipole-dipole repulsions. However, when the coverage rises above a critical value of 0.9nm-2, the adsorbed molecules aggregate into linear structures via hydrogen bonding between amine groups, consistent with recent experiments [Haxton, Zhou, Tamblyn, et al, Phys. Rev. Lett. 111, 265701 (2013)]. Moreover, we find that these linear structures at high density considerably reduces the Au work function (relative to a monomer phase). Due to reduced surface polarization effects, we estimate that the resonance energy of the highest occupied molecular orbital of the adsorbed BDA molecule relative to the Au Fermi level is significantly lower than the monomer phase by more than 0.5 eV, consistent with the experimental measurements [DellAngela, Kladnik, and Cossaro, et al., Nano Lett. 10, 2470 (2010)]. This work supported by DOE (the JCAP under Award Number DE-SC000499 and the Molecular Foundry of LBNL), and computational resources provided by NERSC.

  7. Prominent mitochondrial DNA recombination intermediates in human heart muscle.

    PubMed

    Kajander, O A; Karhunen, P J; Holt, I J; Jacobs, H T

    2001-11-01

    Recombination intermediates containing four-way (Holliday) junctions are generated during DNA repair and replication in many systems, including yeast mitochondrial DNA (mtDNA). In contrast, convincing evidence for recombination in mammalian mtDNA is lacking. We have used two-dimensional agarose-gel electrophoresis to analyse non-linear forms of mtDNA in human heart muscle. Replication intermediates from both the coupled and strand-asynchronous mtDNA replication pathways were detected. An additional class of non-linear molecules, with the electrophoretic properties of four-way junctions, was also prominent. These molecules were insensitive to topoisomerase I or RNase H, but were diminished by branch migration or RuvC treatment. Junctional molecules were detected in all regions of the mitochondrial genome, were found in myocardial DNA from young and old adults, but were present at lower levels in skeletal muscle and placenta. We suggest that they could represent intermediates of mtDNA repair, given their prevalence in the oxyradical-rich environment of heart muscle mitochondria.

  8. In silico screening of drug-membrane thermodynamics reveals linear relations between bulk partitioning and the potential of mean force

    NASA Astrophysics Data System (ADS)

    Menichetti, Roberto; Kanekal, Kiran H.; Kremer, Kurt; Bereau, Tristan

    2017-09-01

    The partitioning of small molecules in cell membranes—a key parameter for pharmaceutical applications—typically relies on experimentally available bulk partitioning coefficients. Computer simulations provide a structural resolution of the insertion thermodynamics via the potential of mean force but require significant sampling at the atomistic level. Here, we introduce high-throughput coarse-grained molecular dynamics simulations to screen thermodynamic properties. This application of physics-based models in a large-scale study of small molecules establishes linear relationships between partitioning coefficients and key features of the potential of mean force. This allows us to predict the structure of the insertion from bulk experimental measurements for more than 400 000 compounds. The potential of mean force hereby becomes an easily accessible quantity—already recognized for its high predictability of certain properties, e.g., passive permeation. Further, we demonstrate how coarse graining helps reduce the size of chemical space, enabling a hierarchical approach to screening small molecules.

  9. Chemistry of anthracene-acetylene oligomers XXV: on-surface chirality of a self-assembled molecular network of a fan-blade-shaped anthracene-acetylene macrocycle with a long alkyl chain.

    PubMed

    Tsuya, Takuya; Iritani, Kohei; Tahara, Kazukuni; Tobe, Yoshito; Iwanaga, Tetsuo; Toyota, Shinji

    2015-03-27

    An anthracene cyclic dimer with two different linkers and a dodecyl group was synthesized by means of coupling reactions. The calculated structure had a planar macrocyclic π core and a linear alkyl chain. Scanning tunneling microscopy observations at the 1-phenyloctane/graphite interface revealed that the molecules formed a self-assembled monolayer that consisted of linear striped bright and dark bands. In each domain, the molecular network consisted of either Re or Si molecules that differed in the two-dimensional chirality about the macrocyclic faces, which led to a unique conglomerate-type self-assembly. The molecular packing mode and the conformation of the alkyl chains are discussed in terms of the intermolecular interactions and the interactions between the molecules and the graphite surface with the aid of MM3 simulations of a model system. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Functional helicoidal model of DNA molecule with elastic nonlinearity

    NASA Astrophysics Data System (ADS)

    Tseytlin, Y. M.

    2013-06-01

    We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

  11. Absorption of Deuterium Fluoride Laser Radiation by the Atmosphere

    DTIC Science & Technology

    1976-04-01

    30 lines, and it would have been prohibitively costly in terms of time and money to measure the ab- sorption on all lines. McClatchey, et al.[3...linear molecule (N2O, CO2, CO) Herzberg [5] gives as an approximation 14 ^ Vi ~_ i’: (45) so that (47) qR(T) hcB V. (ln\\ 1.0 For asymmetric...top molecules (H20, 03) Herzberg [5] gives as an approximation (48) so that ABC \\hc; (49) ±-^f) For spherical top molecules (CH4) Herzberg [5

  12. Solution of the Schrodinger Equation for a Diatomic Oscillator Using Linear Algebra: An Undergraduate Computational Experiment

    ERIC Educational Resources Information Center

    Gasyna, Zbigniew L.

    2008-01-01

    Computational experiment is proposed in which a linear algebra method is applied to the solution of the Schrodinger equation for a diatomic oscillator. Calculations of the vibration-rotation spectrum for the HCl molecule are presented and the results show excellent agreement with experimental data. (Contains 1 table and 1 figure.)

  13. Study of gas adsorption on as-produced and modified carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Rawat, Dinesh Singh

    Volumetric adsorption isotherm measurements were used to study the adsorption characteristics of Ethane (C2H6) and Butane (C 4H10) on as-produced single-walled carbon nanotubes. The binding energy of the adsorbed alkane molecule was found to increase with increasing carbon chain length. Two adsorption substeps were obtained for each alkane molecule. However, the size of the high pressure substep was found to be gradually smearing with the increase in size of the adsorbed molecule. This phenomenon is interpreted as size entropy effect for linear molecules. This interpretation was also verified by determining the specific surface area of the substrate using linear molecules of different sizes. Kinetics measurements of alkane adsorption on SWNTs were also conducted and their dependence on the molecular length was determined. Similar adsorption measurements were performed for Argon (Ar) on as-produced single-walled carbon nanotubes and nanotubes that were structurally modified using acid treatment. Enhancement of the sorptive capacity and the presence of two distinct kinetics of gas adsorption verified partial opening of single walled carbon nanotubes as a result of chemical treatment. Mutiwalled carbon nanotubes were exposed to oxygen plasma treatment for varying time periods. Afterwards, adsorption measurements of Methane (CH 4) were conducted on untreated and oxygen plasma treated tubes. The presence of an additional substep, after exposing multiwalled carbon nanotubes to oxygen plasma for varying time periods, suggested progressive cleaning of nanotube surface.

  14. Ab Initio Potential Energy Surfaces and Quantum Dynamics for Polyatomic Bimolecular Reactions.

    PubMed

    Fu, Bina; Zhang, Dong H

    2018-05-08

    There has been great progress in the development of potential energy surfaces (PESs) and quantum dynamics calculations in the gas phase. The establishment of a fitting procedure for highly accurate PESs and new developments in quantum reactive scattering on reliable PESs allow accurate characterization of reaction dynamics beyond triatomic systems. This review will give the recent development in our group in constructing ab initio PESs based on neural networks and the time-dependent wave packet calculations for bimolecular reactions beyond three atoms. Bimolecular reactions of current interest to the community, namely, OH + H 2 , H + H 2 O, OH + CO, H + CH 4 , and Cl + CH 4 , are focused on. Quantum mechanical characterization of these reactions uncovers interesting dynamical phenomena with an unprecedented level of sophistication and has greatly advanced our understanding of polyatomic reaction dynamics.

  15. Experimental and quantum-chemical studies on the three-particle fragmentation of neutral triatomic hydrogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Galster, Ulrich; Baumgartner, Frank; Mueller, Ulrich

    2005-12-15

    Dissociation of well-defined H{sub 3} Rydberg states into three ground state hydrogen atoms reveals characteristic correlation patterns in the center-of-mass motion of the three fragments. We present an extensive experimental dataset of momentum correlation maps for all lower Rydberg states of H{sub 3} and D{sub 3}. In particular the states with principal quantum number n=2 feature simple correlation patterns with regular occurence of mutual affinities. Energetically higher-lying states typically show more complex patterns which are unique for each state. Quantum-chemical calculations on adiabatic potential energy surfaces of H{sub 3} Rydberg states are presented to illuminate the likely origin of thesemore » differences. We discuss the likely dissociation mechanisms and paths which are responsible for the observed continuum correlation.« less

  16. Permutation invariant polynomial neural network approach to fitting potential energy surfaces. II. Four-atom systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Jun; Jiang, Bin; Guo, Hua, E-mail: hguo@unm.edu

    2013-11-28

    A rigorous, general, and simple method to fit global and permutation invariant potential energy surfaces (PESs) using neural networks (NNs) is discussed. This so-called permutation invariant polynomial neural network (PIP-NN) method imposes permutation symmetry by using in its input a set of symmetry functions based on PIPs. For systems with more than three atoms, it is shown that the number of symmetry functions in the input vector needs to be larger than the number of internal coordinates in order to include both the primary and secondary invariant polynomials. This PIP-NN method is successfully demonstrated in three atom-triatomic reactive systems, resultingmore » in full-dimensional global PESs with average errors on the order of meV. These PESs are used in full-dimensional quantum dynamical calculations.« less

  17. Time-resolved resonance fluorescence spectroscopy for study of chemical reactions in laser-induced plasmas.

    PubMed

    Liu, Lei; Deng, Leimin; Fan, Lisha; Huang, Xi; Lu, Yao; Shen, Xiaokang; Jiang, Lan; Silvain, Jean-François; Lu, Yongfeng

    2017-10-30

    Identification of chemical intermediates and study of chemical reaction pathways and mechanisms in laser-induced plasmas are important for laser-ablated applications. Laser-induced breakdown spectroscopy (LIBS), as a promising spectroscopic technique, is efficient for elemental analyses but can only provide limited information about chemical products in laser-induced plasmas. In this work, time-resolved resonance fluorescence spectroscopy was studied as a promising tool for the study of chemical reactions in laser-induced plasmas. Resonance fluorescence excitation of diatomic aluminum monoxide (AlO) and triatomic dialuminum monoxide (Al 2 O) was used to identify these chemical intermediates. Time-resolved fluorescence spectra of AlO and Al 2 O were used to observe the temporal evolution in laser-induced Al plasmas and to study their formation in the Al-O 2 chemistry in air.

  18. Inhaled corticosteroids in children with persistent asthma: effects on growth.

    PubMed

    Zhang, Linjie; Prietsch, Sílvio O M; Ducharme, Francine M

    2014-07-17

    Treatment guidelines for asthma recommend inhaled corticosteroids (ICS) as first-line therapy for children with persistent asthma. Although ICS treatment is generally considered safe in children, the potential systemic adverse effects related to regular use of these drugs have been and continue to be a matter of concern, especially the effects on linear growth. To assess the impact of ICS on the linear growth of children with persistent asthma and to explore potential effect modifiers such as characteristics of available treatments (molecule, dose, length of exposure, inhalation device) and of treated children (age, disease severity, compliance with treatment). We searched the Cochrane Airways Group Specialised Register of trials (CAGR), which is derived from systematic searches of bibliographic databases including CENTRAL, MEDLINE, EMBASE, CINAHL, AMED and PsycINFO; we handsearched respiratory journals and meeting abstracts. We also conducted a search of ClinicalTrials.gov and manufacturers' clinical trial databases to look for potential relevant unpublished studies. The literature search was conducted in January 2014. Parallel-group randomised controlled trials comparing daily use of ICS, delivered by any type of inhalation device for at least three months, versus placebo or non-steroidal drugs in children up to 18 years of age with persistent asthma. Two review authors independently performed study selection, data extraction and assessment of risk of bias in included studies. We conducted meta-analyses using the Cochrane statistical package RevMan 5.2 and Stata version 11.0. We used the random-effects model for meta-analyses. We used mean differences (MDs) and 95% CIs as the metrics for treatment effects. A negative value for MD indicates that ICS have suppressive effects on linear growth compared with controls. We performed a priori planned subgroup analyses to explore potential effect modifiers, such as ICS molecule, daily dose, inhalation device and age of the treated child. We included 25 trials involving 8471 (5128 ICS-treated and 3343 control) children with mild to moderate persistent asthma. Six molecules (beclomethasone dipropionate, budesonide, ciclesonide, flunisolide, fluticasone propionate and mometasone furoate) [corrected] given at low or medium daily doses were used during a period of three months to four to six years. Most trials were blinded and over half of the trials had drop out rates of over 20%.Compared with placebo or non-steroidal drugs, ICS produced a statistically significant reduction in linear growth velocity (14 trials with 5717 participants, MD -0.48 cm/y, 95% CI -0.65 to -0.30, moderate quality evidence) and in the change from baseline in height (15 trials with 3275 participants; MD -0.61 cm/y, 95% CI -0.83 to -0.38, moderate quality evidence) during a one-year treatment period.Subgroup analysis showed a statistically significant group difference between six molecules in the mean reduction of linear growth velocity during one-year treatment (Chi² = 26.1, degrees of freedom (df) = 5, P value < 0.0001). The group difference persisted even when analysis was restricted to the trials using doses equivalent to 200 μg/d hydrofluoroalkane (HFA)-beclomethasone. Subgroup analyses did not show a statistically significant impact of daily dose (low vs medium), inhalation device or participant age on the magnitude of ICS-induced suppression of linear growth velocity during a one-year treatment period. However, head-to-head comparisons are needed to assess the effects of different drug molecules, dose, inhalation device or patient age. No statistically significant difference in linear growth velocity was found between participants treated with ICS and controls during the second year of treatment (five trials with 3174 participants; MD -0.19 cm/y, 95% CI -0.48 to 0.11, P value 0.22). Of two trials that reported linear growth velocity in the third year of treatment, one trial involving 667 participants showed similar growth velocity between the budesonide and placebo groups (5.34 cm/y vs 5.34 cm/y), and another trial involving 1974 participants showed lower growth velocity in the budesonide group compared with the placebo group (MD -0.33 cm/y, 95% CI -0.52 to -0.14, P value 0.0005). Among four trials reporting data on linear growth after treatment cessation, three did not describe statistically significant catch-up growth in the ICS group two to four months after treatment cessation. One trial showed accelerated linear growth velocity in the fluticasone group at 12 months after treatment cessation, but there remained a statistically significant difference of 0.7 cm in height between the fluticasone and placebo groups at the end of the three-year trial.One trial with follow-up into adulthood showed that participants of prepubertal age treated with budesonide 400 μg/d for a mean duration of 4.3 years had a mean reduction of 1.20 cm (95% CI -1.90 to -0.50) in adult height compared with those treated with placebo. Regular use of ICS at low or medium daily doses is associated with a mean reduction of 0.48 cm/y in linear growth velocity and a 0.61-cm change from baseline in height during a one-year treatment period in children with mild to moderate persistent asthma. The effect size of ICS on linear growth velocity appears to be associated more strongly with the ICS molecule than with the device or dose (low to medium dose range). ICS-induced growth suppression seems to be maximal during the first year of therapy and less pronounced in subsequent years of treatment. However, additional studies are needed to better characterise the molecule dependency of growth suppression, particularly with newer molecules (mometasone, ciclesonide), to specify the respective role of molecule, daily dose, inhalation device and patient age on the effect size of ICS, and to define the growth suppression effect of ICS treatment over a period of several years in children with persistent asthma.

  19. Linear alkane polymerization on a gold surface.

    PubMed

    Zhong, Dingyong; Franke, Jörn-Holger; Podiyanachari, Santhosh Kumar; Blömker, Tobias; Zhang, Haiming; Kehr, Gerald; Erker, Gerhard; Fuchs, Harald; Chi, Lifeng

    2011-10-14

    In contrast to the many methods of selectively coupling olefins, few protocols catenate saturated hydrocarbons in a predictable manner. We report here the highly selective carbon-hydrogen (C-H) activation and subsequent dehydrogenative C-C coupling reaction of long-chain (>C(20)) linear alkanes on an anisotropic gold(110) surface, which undergoes an appropriate reconstruction by adsorption of the molecules and subsequent mild annealing, resulting in nanometer-sized channels (1.22 nanometers in width). Owing to the orientational constraint of the reactant molecules in these one-dimensional channels, the reaction takes place exclusively at specific sites (terminal CH(3) or penultimate CH(2) groups) in the chains at intermediate temperatures (420 to 470 kelvin) and selects for aliphatic over aromatic C-H activation.

  20. Control of optical bistability and third-order nonlinearity via tunneling induced quantum interference in triangular quantum dot molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tian, Si-Cong, E-mail: tiansicong@ciomp.ac.cn; Tong, Cun-Zhu, E-mail: tongcz@ciomp.ac.cn; Zhang, Jin-Long

    The optical bistability of a triangular quantum dot molecules embedded inside a unidirectional ring cavity is studied. The type, the threshold and the hysteresis loop of the optical bistability curves can be modified by the tunneling parameters, as well as the probe laser field. The linear and nonlinear susceptibilities of the medium are also studied to interpret the corresponding results. The physical interpretation is that the tunneling can induce the quantum interference, which modifies the linear and the nonlinear response of the medium. As a consequence, the characteristics of the optical bistability are changed. The scheme proposed here can bemore » utilized for optimizing and controlling the optical switching process.« less

  1. Investigation of the linear and second-order nonlinear optical properties of molecular crystals within the local field theory.

    PubMed

    Seidler, Tomasz; Stadnicka, Katarzyna; Champagne, Benoît

    2013-09-21

    In this paper it is shown that modest calculations combining first principles evaluations of the molecular properties with electrostatic interaction schemes to account for the crystal environment effects are reliable for predicting and interpreting the experimentally measured electric linear and second-order nonlinear optical susceptibilities of molecular crystals within the experimental error bars. This is illustrated by considering two molecular crystals, namely: 2-methyl-4-nitroaniline and 4-(N,N-dimethylamino)-3-acetamidonitrobenzene. Three types of surrounding effects should be accounted for (i) the polarization due to the surrounding molecules, described here by static electric fields originating from their electric dipoles or charge distributions, (ii) the intermolecular interactions, which affect the geometry and particularly the molecular conformation, and (iii) the screening of the external electric field by the constitutive molecules. This study further highlights the role of electron correlation on the linear and nonlinear responses of molecular crystals and the challenge of describing frequency dispersion.

  2. A structural diagnostics diagram for metallofullerenes encapsulating metal carbides and nitrides.

    PubMed

    Maki, Sachiko; Nishibori, Eiji; Terauchi, Ikuya; Ishihara, Masayuki; Aoyagi, Shinobu; Sakata, Makoto; Takata, Masaki; Umemoto, Hisashi; Inoue, Takashi; Shinohara, Hisanori

    2013-01-16

    Systematic structural studies of 24 different kinds of endohedral metallofullerenes, M(x)C(2n) (M = La, Y, Sc, Lu, Ti, Eu, Er, Hf, Sc(3)N; 34 ≤ n ≤ 43), as 1:1 cocrystals with solvent toluene molecules have been carried out using synchrotron radiation powder diffraction. Thirteen of the 24 molecular structures, including five metal carbides, one metal nitride endohedral fullerene, and one hollow fullerene, have been determined by a combination of the maximum entropy method and Rietveld refinement of the X-ray diffraction data obtained. We have found that the volume for one fullerene and one toluene molecule depends linearly on the number of carbon atoms in the fullerene cage. Fifteen different kinds of metal carbide endohedral fullerenes have been identified, which can be structurally characterized from the obtained lattice constants using only this linear dependence. The linear dependence found in the present study provides a metallofullerene diagnostics diagram that may have universal importance for structural characterization of the so-called cluster endohedral fullerenes.

  3. Novel linear polymers able to inhibit bacterial quorum sensing.

    PubMed

    Cavaleiro, Eliana; Duarte, Ana Sofia; Esteves, Ana Cristina; Correia, António; Whitcombe, Michael J; Piletska, Elena V; Piletsky, Sergey A; Chianella, Iva

    2015-05-01

    Bacterial phenotypes, such as biofilm formation, antibiotic resistance and virulence expression, are associated with quorum sensing. Quorum sensing is a density-dependent regulatory system of gene expression controlled by specific signal molecules, such as N-acyl homoserine lactones (AHLs), produced and released by bacteria. This study reports the development of linear polymers capable to attenuate quorum sensing by adsorption of AHLs. Linear polymers were synthesized using MMA as backbone monomer and methacrylic acid and itaconic acid as functional monomers. Two different quorum sensing-controlled phenotypes, Vibrio fischeri bioluminescence and Aeromonas hydrophila biofilm formation, were evaluated to test the polymers' efficiency. Results showed that both phenotypes were significantly affected by the polymers, with the itaconic acid-containing material being more effective than the methacrylic acid one. The polymer inhibitory effects were reverted by the addition of lactones, confirming attenuation of quorum sensing through sequestration of signal molecules. The polymers also showed no cytotoxicity when tested using a mammalian cell line. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Comparison of gas-solid chromatography and MM2 force field molecular binding energies for greenhouse gases on a carbonaceous surface.

    PubMed

    Rybolt, Thomas R; Bivona, Kevin T; Thomas, Howard E; O'Dell, Casey M

    2009-10-01

    Gas-solid chromatography was used to determine B(2s) (gas-solid virial coefficient) values for eight molecular adsorbates interacting with a carbon powder (Carbopack B, Supelco). B(2s) values were determined by multiple size variant injections within the temperature range of 313-553 K. The molecular adsorbates included: carbon dioxide (CO(2)); tetrafluoromethane (CF(4)); hexafluoroethane (C(2)F(6)); 1,1-difluoroethane (C(2)H(4)F(2)); 1-chloro-1,1-difluoroethane (C(2)H(3)ClF(2)); dichlorodifluoromethane (CCl(2)F(2)); trichlorofluoromethane (CCl(3)F); and 1,1,1-trichloroethane (C(2)H(3)Cl(3)). Two of these molecules are of special interest because they are "super greenhouse gases". The global warming potential, GWP, for CF(4) is 6500 and for C(2)F(6) is 9200 relative to the reference value of 1 for CO(2). The GWP index considers both radiative blocking and molecular lifetime. For these and other industrial greenhouse gases, adsorptive trapping on a carbonaceous solid, which depends on molecule-surface binding energy, could avoid atmospheric release. The temperature variations of the gas-solid virial coefficients in conjunction with van't Hoff plots were used to find the experimental adsorption energy or binding energy values (E(*)) for each adsorbate. A molecular mechanics based, rough-surface model was used to calculate the molecule-surface binding energy (Ecal(*)) using augmented MM2 parameters. The surface model consisted of parallel graphene layers with two separated nanostructures each containing 17 benzene rings arranged in linear strips. The separation of the parallel nanostructures had been optimized in a prior study to appropriately represent molecule-surface interactions for Carbopack B. Linear regressions of E(*) versus Ecal(*) for the current data set of eight molecules and the same surface model gave E(*)=0.926 Ecal(*) and r(2)=0.956. A combined set of the current and prior Carbopack B adsorbates studied (linear alkanes, branched alkanes, cyclic alkanes, ethers, and halogenated hydrocarbons) gave a data set with 33 molecules and a regression of E(*)=0.991 Ecal(*) and r(2)=0.968. These results indicated a good correlation between the experimental and the MM2 computed molecule-surface binding energies.

  5. Ultraviolet laser spectroscopy of jet-cooled CaNC and SrNC free radicals: Observation of bent excited electronic states

    NASA Astrophysics Data System (ADS)

    Greetham, Gregory M.; Ellis, Andrew M.

    2000-11-01

    New electronic transitions of the CaNC and SrNC free radicals have been identified in the near ultraviolet. For CaNC one new system, labeled the D˜-X˜ transition, was observed in the 31 500-33 400 cm-1 region. Two new transitions were found for SrNC, the D˜-X˜ and Ẽ-X˜ systems spanning 29 100-31 000 and 32 750-34 000 cm-1, respectively. Jet-cooled laser excitation spectra yield complex vibrational structure, much of which is attributed to excitation of the bending vibration. This has been used to infer that the molecule adopts a nonlinear equilibrium geometry in the upper electronic state in all three band systems, in contrast to the linear ground electronic state. This structural change is accounted for by the increased diffuseness of the unpaired electron in the excited states, which favors deviation from linearity. All three new excited states are assigned 2A' symmetry and correlate with 2Σ+ states in the linear molecule limit. Tentative estimates for the barriers to linearity in the D˜ 2A' states of CaNC and SrNC have been determined as ˜700 and ˜1050 cm-1, respectively.

  6. Imaging fluorescence detected linear dichroism of plant cell walls in laser scanning confocal microscope.

    PubMed

    Steinbach, Gábor; Pomozi, István; Zsiros, Ottó; Páy, Anikó; Horváth, Gábor V; Garab, Gyozo

    2008-03-01

    Anisotropy carries important information on the molecular organization of biological samples. Its determination requires a combination of microscopy and polarization spectroscopy tools. The authors constructed differential polarization (DP) attachments to a laser scanning microscope in order to determine physical quantities related to the anisotropic distribution of molecules in microscopic samples; here the authors focus on fluorescence-detected linear dichroism (FDLD). By modulating the linear polarization of the laser beam between two orthogonally polarized states and by using a demodulation circuit, the authors determine the associated transmitted and fluorescence intensity-difference signals, which serve the basis for LD (linear dichroism) and FDLD, respectively. The authors demonstrate on sections of Convallaria majalis root tissue stained with Acridin Orange that while (nonconfocal) LD images remain smeared and weak, FDLD images recorded in confocal mode reveal strong anisotropy of the cell wall. FDLD imaging is suitable for mapping the anisotropic distribution of transition dipoles in 3 dimensions. A mathematical model is proposed to account for the fiber-laminate ultrastructure of the cell wall and for the intercalation of the dye molecules in complex, highly anisotropic architecture. Copyright 2007 International Society for Analytical Cytology.

  7. Multivalency of Sonic hedgehog conjugated to linear polymer chains modulates protein potency.

    PubMed

    Wall, Samuel T; Saha, Krishanu; Ashton, Randolph S; Kam, Kimberly R; Schaffer, David V; Healy, Kevin E

    2008-04-01

    A potently active multivalent form of the protein Sonic hedgehog (Shh) was produced by bioconjugation of a modified recombinant form of Shh to the linear polymers poly(acrylic acid) (pAAc) and hyaluronic acid (HyA) via a two-step reaction exploiting carboimiide and maleimide chemistry. Efficiency of the conjugation was approximately 75% even at stoichiometric ratios of 30 Shh molecules per linear HyA chain (i.e., 30:1 Shh/HyA). Bioactivity of the conjugates was tested via a cellular assay across a range of stoichiometric ratios of Shh molecules to HyA linear chains, which was varied from 0.6:1 Shh/HyA to 22:1 Shh/HyA. Results indicate that low conjugation ratios decrease Shh bioactivity and high ratios increase this activity beyond the potency of monomeric Shh, with approximately equal activity between monomeric soluble Shh and conjugated Shh at 7:1 Shh/HyA. In addition, high-ratio constructs increased angiogenesis determined by the in vivo chick chorioallantoic membrane (CAM) assay. These results are captured by a kinetic model of multiple interactions between the Shh/HyA conjugates and cell surface receptors resulting in higher cell signaling at lower bulk Shh concentrations.

  8. Gas-phase ion-molecule reactions for the identification of the sulfone functionality in protonated analytes in a linear quadrupole ion trap mass spectrometer.

    PubMed

    Tang, Weijuan; Sheng, Huaming; Kong, John Y; Yerabolu, Ravikiran; Zhu, Hanyu; Max, Joann; Zhang, Minli; Kenttämaa, Hilkka I

    2016-06-30

    The oxidation of sulfur atoms is an important biotransformation pathway for many sulfur-containing drugs. In order to rapidly identify the sulfone functionality in drug metabolites, a tandem mass spectrometric method based on ion-molecule reactions was developed. A phosphorus-containing reagent, trimethyl phosphite (TMP), was allowed to react with protonated analytes with various functionalities in a linear quadrupole ion trap mass spectrometer. The reaction products and reaction efficiencies were measured. Only protonated sulfone model compounds were found to react with TMP to form a characteristic [TMP adduct-MeOH] product ion. All other protonated compounds investigated, with functionalities such as sulfoxide, N-oxide, hydroxylamino, keto, carboxylic acid, and aliphatic and aromatic amino, only react with TMP via proton transfer and/or addition. The specificity of the reaction was further demonstrated by using a sulfoxide-containing anti-inflammatory drug, sulindac, as well as its metabolite sulindac sulfone. A method based on functional group-selective ion-molecule reactions in a linear quadrupole ion trap mass spectrometer has been demonstrated for the identification of the sulfone functionality in protonated analytes. A characteristic [TMP adduct-MeOH] product ion was only formed for the protonated sulfone analytes. The applicability of the TMP reagent in identifying sulfone functionalities in drug metabolites was also demonstrated. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  9. The mitochondrial genome of Hydra oligactis (Cnidaria, Hydrozoa) sheds new light on animal mtDNA evolution and cnidarian phylogeny.

    PubMed

    Kayal, Ehsan; Lavrov, Dennis V

    2008-02-29

    The 16,314-nuceotide sequence of the linear mitochondrial DNA (mtDNA) molecule of Hydra oligactis (Cnidaria, Hydrozoa)--the first from the class Hydrozoa--has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs, as is typical for cnidarians. All genes have the same transcriptional orientation and their arrangement in the genome is similar to that of the jellyfish Aurelia aurita. In addition, a partial copy of cox1 is present at one end of the molecule in a transcriptional orientation opposite to the rest of the genes, forming a part of inverted terminal repeat characteristic of linear mtDNA and linear mitochondrial plasmids. The sequence close to at least one end of the molecule contains several homonucleotide runs as well as small inverted repeats that are able to form strong secondary structures and may be involved in mtDNA maintenance and expression. Phylogenetic analysis of mitochondrial genes of H. oligactis and other cnidarians supports the Medusozoa hypothesis but also suggests that Anthozoa may be paraphyletic, with octocorallians more closely related to the Medusozoa than to the Hexacorallia. The latter inference implies that Anthozoa is paraphyletic and that the polyp (rather than a medusa) is the ancestral body type in Cnidaria.

  10. Autonomous replication and addition of telomerelike sequences to DNA microinjected into Paramecium tetraurelia macronuclei.

    PubMed Central

    Gilley, D; Preer, J R; Aufderheide, K J; Polisky, B

    1988-01-01

    Paramecium tetraurelia can be transformed by microinjection of cloned serotype A gene sequences into the macronucleus. Transformants are detected by their ability to express serotype A surface antigen from the injected templates. After injection, the DNA is converted from a supercoiled form to a linear form by cleavage at nonrandom sites. The linear form appears to replicate autonomously as a unit-length molecule and is present in transformants at high copy number. The injected DNA is further processed by the addition of paramecium-type telomeric sequences to the termini of the linear DNA. To examine the fate of injected linear DNA molecules, plasmid pSA14SB DNA containing the A gene was cleaved into two linear pieces, a 14-kilobase (kb) piece containing the A gene and flanking sequences and a 2.2-kb piece consisting of the procaryotic vector. In transformants expressing the A gene, we observed that two linear DNA species were present which correspond to the two species injected. Both species had Paramecium telomerelike sequences added to their termini. For the 2.2-kb DNA, we show that the site of addition of the telomerelike sequences is directly at one terminus and within one nucleotide of the other terminus. These results indicate that injected procaryotic DNA is capable of autonomous replication in Paramecium macronuclei and that telomeric addition in the macronucleus does not require specific recognition sequences. Images PMID:3211128

  11. Construction of trypanosome artificial mini-chromosomes.

    PubMed Central

    Lee, M G; E, Y; Axelrod, N

    1995-01-01

    We report the preparation of two linear constructs which, when transformed into the procyclic form of Trypanosoma brucei, become stably inherited artificial mini-chromosomes. Both of the two constructs, one of 10 kb and the other of 13 kb, contain a T.brucei PARP promoter driving a chloramphenicol acetyltransferase (CAT) gene. In the 10 kb construct the CAT gene is followed by one hygromycin phosphotransferase (Hph) gene, and in the 13 kb construct the CAT gene is followed by three tandemly linked Hph genes. At each end of these linear molecules are telomere repeats and subtelomeric sequences. Electroporation of these linear DNA constructs into the procyclic form of T.brucei generated hygromycin-B resistant cell lines. In these cell lines, the input DNA remained linear and bounded by the telomere ends, but it increased in size. In the cell lines generated by the 10 kb construct, the input DNA increased in size to 20-50 kb. In the cell lines generated by the 13 kb constructs, two sizes of linear DNAs containing the input plasmid were detected: one of 40-50 kb and the other of 150 kb. The increase in size was not the result of in vivo tandem repetitions of the input plasmid, but represented the addition of new sequences. These Hph containing linear DNA molecules were maintained stably in cell lines for at least 20 generations in the absence of drug selection and were subsequently referred to as trypanosome artificial mini-chromosomes, or TACs. Images PMID:8532534

  12. A simple model for electrical charge in globular macromolecules and linear polyelectrolytes in solution

    NASA Astrophysics Data System (ADS)

    Krishnan, M.

    2017-05-01

    We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or rapid, reliable predictions are desired.

  13. Electron Interactions with Non-Linear Polyatomic Molecules and Their Radicals

    DTIC Science & Technology

    1993-12-01

    developed which generates SCE quantities from molecular wave functions. This progress was realized in terms of some actual calculations on some molecules...section 4.A describes the basics of the Partial Differential Equation Theory; section 4.B describes the generalization to a finite element...Information Service (NTIS). At NTIS, it will be available to the general public, including foreign nations. This technical report has been reviewed and

  14. Further Analysis of Boiling Points of Small Molecules, CH[subscript w]F[subscript x]Cl[subscript y]Br[subscript z

    ERIC Educational Resources Information Center

    Beauchamp, Guy

    2005-01-01

    A study to present specific hypothesis that satisfactorily explain the boiling point of a number of molecules, CH[subscript w]F[subscript x]Cl[subscript y]Br[subscript z] having similar structure, and then analyze the model with the help of multiple linear regression (MLR), a data analysis tool. The MLR analysis was useful in selecting the…

  15. Energy-switching potential energy surface for the water molecule revisited: A highly accurate singled-sheeted form.

    PubMed

    Galvão, B R L; Rodrigues, S P J; Varandas, A J C

    2008-07-28

    A global ab initio potential energy surface is proposed for the water molecule by energy-switching/merging a highly accurate isotope-dependent local potential function reported by Polyansky et al. [Science 299, 539 (2003)] with a global form of the many-body expansion type suitably adapted to account explicitly for the dynamical correlation and parametrized from extensive accurate multireference configuration interaction energies extrapolated to the complete basis set limit. The new function mimics also the complicated Sigma/Pi crossing that arises at linear geometries of the water molecule.

  16. Non-detection of HC11N towards TMC-1: constraining the chemistry of large carbon-chain molecules

    NASA Astrophysics Data System (ADS)

    Loomis, Ryan A.; Shingledecker, Christopher N.; Langston, Glen; McGuire, Brett A.; Dollhopf, Niklaus M.; Burkhardt, Andrew M.; Corby, Joanna; Booth, Shawn T.; Carroll, P. Brandon; Turner, Barry; Remijan, Anthony J.

    2016-12-01

    Bell et al. reported the first detection of the cyanopolyyne HC11N towards the cold dark cloud TMC-1; no subsequent detections have been reported towards any source. Additional observations of cyanopolyynes and other carbon-chain molecules towards TMC-1 have shown a log-linear trend between molecule size and column density, and in an effort to further explore the underlying chemical processes driving this trend, we have analysed Green Bank Telescope observations of HC9N and HC11N towards TMC-1. Although we find an HC9N column density consistent with previous values, HC11N is not detected and we derive an upper limit column density significantly below that reported in Bell et al. Using a state-of-the-art chemical model, we have investigated possible explanations of non-linearity in the column density trend. Despite updating the chemical model to better account for ion-dipole interactions, we are not able to explain the non-detection of HC11N, and we interpret this as evidence of previously unknown carbon-chain chemistry. We propose that cyclization reactions may be responsible for the depleted HC11N abundance, and that products of these cyclization reactions should be investigated as candidate interstellar molecules.

  17. Experimental Realization of Efficient, Room Temperature Single-Photon Sources with Definite Circular and Linear Polarizations

    NASA Astrophysics Data System (ADS)

    Boutsidis, Christos

    In this thesis I present experimental demonstrations of room-temperature, single-photon sources with definite linear and circular polarizations. Definite photon polarization increases the efficiency of quantum communication systems. In contrast with cryogenic-temperature single-photon sources based on epitaxial quantum dots requiring expensive MBE and nanofabrication, my method utilizes a mature liquid crystal technology, which I made consistent with single-emitter fluorescence microscopy. The structures I have prepared are planar-aligned cholesteric liquid crystals forming 1-D photonic bandgaps for circularly-polarized light, which were used to achieve definite circularly-polarized fluorescence of single emitters doped in this environment. I also used planar-aligned nematic liquid crystals to align single molecules with linear dipole moments and achieved definite linearly-polarized fluorescence. I used single nanocrystal quantum dots, single nanodiamond color-centers, rare-earth-doped nanocrystals, and single terrylene and DiIC18(3) dye molecules as emitters. For nanocrystal quantum dots I observed circular polarization dissymmetry factors as large as ge = --1.6. In addition, I observed circularly-polarized resonances in the fluorescence of emitters within a cholesteric microcavity, with cavity quality factors of up to Q ˜ 250. I also showed that the fluorescence of DiIC18(3) dye molecules in planar-aligned nematic cells exhibits definite linear polarization, with a degree of polarization of rho = --0.58 +/- 0.03. Distributed Bragg reflectors form another type of microcavity that can be used to realize a single-photon source. I characterized the fluorescence from nanocrystal quantum dots doped in the defect layers of such microcavites, both organic and inorganic. Finally, to demonstrate the single-photon properties of single-emitter-doped cholesteric and nematic liquid crystal structures and distributed Bragg reflector microcavities, I present observations of photon antibunching from emitters doped in each of these structures. These experimental observations include photon antibunching from: nanocrystal quantum dots and nanodiamond color-centers doped in a cholesteric microcavity; terrylene and DiIC 18(3) dye molecules doped in nematic structures, and nanocrystal quantum dots doped in the distributed Bragg reflector microcavity. A value of the zero-time second-order coherence as low as g(2)(0) = 0.001 +/- 0.03 was measured. These results represent an important step forward in the realization of room temperature single-photon sources with definite polarization for secure quantum communication.

  18. Application of the dressed-bound-state molecular strong-field approximation to above-threshold ionization of heteronuclear molecules: NO vs. CO.

    PubMed

    Busuladžić, M; Hasović, E; Becker, W; Milošević, D B

    2012-10-07

    We theoretically investigate high-order above-threshold ionization (HATI) of heteronuclear diatomic molecules applying the molecular strong-field approximation which includes dressing of the molecular bound state. We consider HATI of nitrogen monoxide molecules, which are characterized by the π symmetry of their highest occupied molecular orbital. We show that the HATI spectra of NO exhibit characteristic interference structures. We analyze the differences and similarities of the HATI spectra of NO molecules and the spectra of CO (σ symmetry) and O(2) (π(g) symmetry) molecules. The symmetry properties of the molecular HATI spectra governed by linearly and elliptically polarized fields are considered in detail. The yields of high-energy electrons, contributing to the plateau region of the photoelectron spectra, strongly depend on the employed ellipticity.

  19. Predicting human olfactory perception from chemical features of odor molecules.

    PubMed

    Keller, Andreas; Gerkin, Richard C; Guan, Yuanfang; Dhurandhar, Amit; Turu, Gabor; Szalai, Bence; Mainland, Joel D; Ihara, Yusuke; Yu, Chung Wen; Wolfinger, Russ; Vens, Celine; Schietgat, Leander; De Grave, Kurt; Norel, Raquel; Stolovitzky, Gustavo; Cecchi, Guillermo A; Vosshall, Leslie B; Meyer, Pablo

    2017-02-24

    It is still not possible to predict whether a given molecule will have a perceived odor or what olfactory percept it will produce. We therefore organized the crowd-sourced DREAM Olfaction Prediction Challenge. Using a large olfactory psychophysical data set, teams developed machine-learning algorithms to predict sensory attributes of molecules based on their chemoinformatic features. The resulting models accurately predicted odor intensity and pleasantness and also successfully predicted 8 among 19 rated semantic descriptors ("garlic," "fish," "sweet," "fruit," "burnt," "spices," "flower," and "sour"). Regularized linear models performed nearly as well as random forest-based ones, with a predictive accuracy that closely approaches a key theoretical limit. These models help to predict the perceptual qualities of virtually any molecule with high accuracy and also reverse-engineer the smell of a molecule. Copyright © 2017, American Association for the Advancement of Science.

  20. Testing a new analytical approach for determination of vibrational transition moment directions in low symmetry planar molecules: 1-D- and 2-D-naphthalene.

    PubMed

    Rogojerov, Marin; Keresztury, Gábor; Kamenova-Nacheva, Mariana; Sundius, Tom

    2012-12-01

    A new analytical approach for improving the precision in determination of vibrational transition moment directions of low symmetry molecules (lacking orthogonal axes) is discussed in this paper. The target molecules are partially uniaxially oriented in nematic liquid crystalline solvent and are studied by IR absorption spectroscopy using polarized light. The fundamental problem addressed is that IR linear dichroism measurements of low symmetry molecules alone cannot provide sufficient information on molecular orientation and transition moment directions. It is shown that computational prediction of these quantities can supply relevant complementary data, helping to reveal the hidden information content and achieve a more meaningful and more precise interpretation of the measured dichroic ratios. The combined experimental and theoretical/computational method proposed by us recently for determination of the average orientation of molecules with C(s) symmetry has now been replaced by a more precise analytical approach. The new method introduced and discussed in full detail here uses a mathematically evaluated angle between two vibrational transition moment vectors as a reference. The discussion also deals with error analysis and estimation of uncertainties of the orientational parameters. The proposed procedure has been tested in an analysis of the infrared linear dichroism (IR-LD) spectra of 1-D- and 2-D-naphthalene complemented with DFT calculations using the scaled quantum mechanical force field (SQM FF) method. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Enhancement of ultracold molecule formation by local control in the nanosecond regime

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carini, J. L.; Kallush, S.; Kosloff, R.

    2015-02-01

    We describe quantum simulations of ultracold 87Rb 2 molecule formation using photoassociation (PA) with nanosecond-time-scale pulses of frequency chirped light. In particular, we compare the case of a linear chirp to one where the frequency evolution is optimized by local control (LC) of the phase, and find that LC can provide a significant enhancement. The resulting optimal frequency evolution corresponds to a rapid jump from the PA absorption resonance to a downward transition to a bound level of the lowest triplet state. We also consider the case of two frequencies and investigate interference effects. The assumed chirp parameters should bemore » achievable with nanosecond pulse shaping techniques and are predicted to provide a significant enhancement over recent experiments with linear chirps.« less

  2. Towards a universal method for calculating hydration free energies: a 3D reference interaction site model with partial molar volume correction.

    PubMed

    Palmer, David S; Frolov, Andrey I; Ratkova, Ekaterina L; Fedorov, Maxim V

    2010-12-15

    We report a simple universal method to systematically improve the accuracy of hydration free energies calculated using an integral equation theory of molecular liquids, the 3D reference interaction site model. A strong linear correlation is observed between the difference of the experimental and (uncorrected) calculated hydration free energies and the calculated partial molar volume for a data set of 185 neutral organic molecules from different chemical classes. By using the partial molar volume as a linear empirical correction to the calculated hydration free energy, we obtain predictions of hydration free energies in excellent agreement with experiment (R = 0.94, σ = 0.99 kcal mol (- 1) for a test set of 120 organic molecules).

  3. Method for determining surface properties of microparticles

    DOEpatents

    Eisenthal, Kenneth B.

    2000-01-01

    Second harmonic generation (SHG), sum frequency generation (SFG) and difference frequency generation (DFG) can be used for surface analysis or characterization of microparticles having a non-metallic surface feature. The microparticles can be centrosymmetric or such that non-metallic molecules of interest are centrosymmetrically distributed inside and outside the microparticles but not at the surface of the microparticles where the asymmetry aligns the molecules. The signal is quadratic in incident laser intensity or proportional to the product of two incident laser intensities for SFG, it is sharply peaked at the second harmonic wavelength, quadratic in the density of molecules adsorbed onto the microparticle surface, and linear in microparticles density. In medical or pharmacological applications, molecules of interest may be of drugs or toxins, for example.

  4. Symmetry of Carrier-Envelope Phase Difference Effects in Strong-Field, Few-Cycle Ionization of Atoms and Molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martiny, Christian Per Juul; Madsen, Lars Bojer

    2006-09-01

    In few-cycle pulses, the exact value of the carrier-envelope phase difference (CEPD) has a pronounced influence on the ionization dynamics of atoms and molecules. We show that, for atoms in circularly polarized light, a change in the CEPD is mapped uniquely to an overall rotation of the system, and results for arbitrary CEPD are obtained by rotation of the results from a single calculation with fixed CEPD. For molecules, this is true only for linear molecules aligned parallel with the propagation direction of the field. The effects of CEPD are classified as geometric or nongeometric. The observations are exemplified bymore » strong-field calculations on hydrogen.« less

  5. Controlling drug efficiency by encapsulation into carbon nanotubes: A theoretical study of the antitumor Cisplatin and the anti-HIV TIBO molecules

    NASA Astrophysics Data System (ADS)

    Bessrour, R.; Belmiloud, Y.; Hosni, Z.; Tangour, B.

    2012-06-01

    From the beginning of last century, Paul Ehrlich, a specialist in the immune system and the Nobel Prize (1908) had raised the possibility of "magic bullets" can directly address, in an organism, drugs in a particular area of the body, sparing all other parts of side effects. Carbon nanotubes (CNTs) have particular property to cross cell membranes easily. In an effort to optimize the use of CNT as drug nanocarriers, we divided our study into two parts. In the first, our concern was to find the minimum diameter of a single wall CNT can encapsulate an anticancer drug that iscisplatin without altering its geometry in order conserve its therapeutic power. Behavior of one and two Cisplatin(Cp) molecules confined in capped and opened single-walled carbon nanotubes (CNTs) is studied by means of ab-initio calculations. Single molecule binding energies clearly exhibit encapsulation dependence on tube diameters that range from 6.26 Å to 12.04 Å. A weak stabilization energy of the Cp@(11,0) equal to -70 kcal.mol-1 has been obtained corresponding to a CNT's diameter of 8.5Å. We noticed that Cisplatin molecule changes shape when encapsulated into CNTs' whose diameters are less than 7.6 Å. In the presence of a second Cisplatin molecule in the (10,0) CNT, preferred position stays parallel to CNT's axis leading to a linear density of roughly 1588 molecules/μm of CNT's length corresponding to a linear density of 7.9 10-19 g/μm. The 195Pt chemical shift tensors are calculated using GIAO method. NMR calculations reveal that Platinum chemical shift is sensitive to CNT's diameter and is linearly correlated to confinement energy. 195Pt chemical shift measurement may be a direct method to access to the diameter of the encapsulating CNT's and to control the amount of drug molecule transported by this CNT. In the second part, the opposite has been sought is to say how the use of nanotubes with different diameters can control the change in a geometry of an anti-HIV drug that is TIBO molecule to bypass the mutation of the virus which wiped out its therapeutic effect. This work deals with the butterfly conformation control of the anti-HIV TIBO molecule confined into carbon nanotubes (CNT). This theoretical study concerns the variation of some pertinent conformation descriptors such as butterfly angle, wingspan, volume, dipole moment, solvation energy and confinement energy versus carbon nanotube diameters. Obtained results show that it is possible to describe the configurations of actual drugs as 8-Cl or 9-Cl TIBO as the parent molecule TIBO encapsulated in an adequate CNT. Our approach indicates that drug confinement inside CNTs may be a promising way to use a same drug in order to fellow HIV virus mutations.

  6. Linear- and angular-shaped naphthodithiophenes: selective synthesis, properties, and application to organic field-effect transistors.

    PubMed

    Shinamura, Shoji; Osaka, Itaru; Miyazaki, Eigo; Nakao, Akiko; Yamagishi, Masakazu; Takeya, Jun; Takimiya, Kazuo

    2011-04-06

    A straightforward synthetic approach that exploits linear- and angular-shaped naphthodithiophenes (NDTs) being potential as new core structures for organic semiconductors is described. The newly established synthetic procedure involves two important steps; one is the chemoselective Sonogashira coupling reaction on the trifluoromethanesulfonyloxy site over the bromine site enabling selective formation of o-bromoethynylbenzene substructures on the naphthalene core, and the other is a facile ring closing reaction of fused-thiophene rings from the o-bromoethynylbenzene substructures. As a result, three isomeric NDTs, naphtho[2,3-b:6,7-b']dithiophene, naphtho[2,3-b:7,6-b']dithiophenes, and naphtho[2,1-b:6,5-b']dithiophene, are selectively synthesized. Electrochemical and optical measurements of the parent NDTs indicated that the shape of the molecules plays an important role in determining the electronic structure of the compounds; the linear-shaped NDTs formally isoelectronic with naphthacene have lower oxidation potentials and more red-shifted absorption bands than those of the angular-shaped NDTs isoelectronic with chrysene. On the contrary, the performance of the thin-film-based field-effect transistors (FETs) using the dioctyl or diphenyl derivatives were much influenced by the symmetry of the molecules; centrosymmetric derivatives tend to give higher mobility (up to 1.5 cm(2) V(-1) s(-1)) than axisymmetric ones (∼0.06 cm(2) V(-1) s(-1)), implying that the intermolecular orbital overlap in the solid state is influenced by the symmetry of the molecules. These results indicate that the present NDT cores, in particular the linear-shaped, centrosymmetric naphtho[2,3-b:6,7-b']dithiophene, are promising building blocks for the development of organic semiconducting materials. © 2011 American Chemical Society

  7. Circular RNA: New Regulatory Molecules.

    PubMed

    Belousova, E A; Filipenko, M L; Kushlinskii, N E

    2018-04-01

    Circular RNA are a family of covalently closed circular RNA molecules, formed from pre-mRNA of coding genes by means of splicing (canonical and alternative noncanonical splicing). Maturation of circular RNA is regulated by cis- and trans-elements. Complete list of biological functions of these RNA is not yet compiled; however, their capacity to interact with specific microRNA and play a role of a depot attracts the greatest interest. This property makes circular RNA active regulatory transcription factors. Circular RNA have many advantages over their linear analogs: synthesis of these molecules is conservative, they are universal, characterized by clearly determined specificity, and are resistant to exonucleases. In addition, the level of their expression is often higher than that of their linear forms. It should be noted that expression of circular RNA is tissue-specific. Moreover, some correlations between changes in the repertoire and intensity of expression of circular RNA and the development of some pathologies have been detected. Circular RNA have certain advantages and can serve as new biomarkers for the diagnosis, prognosis, and evaluation of response to therapy.

  8. Dynamical discrete/continuum linear response shells theory of solvation: convergence test for NH4+ and OH- ions in water solution using DFT and DFTB methods.

    PubMed

    de Lima, Guilherme Ferreira; Duarte, Hélio Anderson; Pliego, Josefredo R

    2010-12-09

    A new dynamical discrete/continuum solvation model was tested for NH(4)(+) and OH(-) ions in water solvent. The method is similar to continuum solvation models in a sense that the linear response approximation is used. However, different from pure continuum models, explicit solvent molecules are included in the inner shell, which allows adequate treatment of specific solute-solvent interactions present in the first solvation shell, the main drawback of continuum models. Molecular dynamics calculations coupled with SCC-DFTB method are used to generate the configurations of the solute in a box with 64 water molecules, while the interaction energies are calculated at the DFT level. We have tested the convergence of the method using a variable number of explicit water molecules and it was found that even a small number of waters (as low as 14) are able to produce converged values. Our results also point out that the Born model, often used for long-range correction, is not reliable and our method should be applied for more accurate calculations.

  9. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlapmore » matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.« less

  10. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings.

    PubMed

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas; Neugebauer, Johannes

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Ångstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.

  11. FAST TRACK COMMUNICATION: Conformation dependence of molecular conductance: chemistry versus geometry

    NASA Astrophysics Data System (ADS)

    Finch, Christopher M.; Sirichantaropass, Skon; Bailey, Steven W.; Grace, Iain M.; García-Suárez, Víctor M.; Lambert, Colin J.

    2008-01-01

    Recent experiments by Venkataraman et al (2006 Nature 442 904) on a series of molecular wires with varying chemical compositions revealed a linear dependence of the conductance on cos2 θ, where θ is the angle of twist between neighbouring aromatic rings. To investigate whether or not this dependence has a more general applicability, we present a first-principles theoretical study of the transport properties of this family of molecules as a function of the chemical composition, conformation and the contact atom and geometry. If the Fermi energy EF lies within the HOMO-LUMO (highest occupied molecular orbital-lowest unoccupied molecular orbital) gap, then we reproduce the above experimental results. More generally, however, if EF is located within either the LUMO or the HOMO states, the presence of resonances destroys the linear dependence of the conductance on cos2 θ and gives rise to non-monotonic behaviour associated with the level structure of the different molecules. Our results suggest that the above experiments provide a novel method for extracting spectroscopic information about molecules contacted to electrodes.

  12. The inherent dynamics of a molecular liquid: geodesic pathways through the potential energy landscape of a liquid of linear molecules.

    PubMed

    Jacobson, Daniel; Stratt, Richard M

    2014-05-07

    Because the geodesic pathways that a liquid follows through its potential energy landscape govern its slow, diffusive motion, we suggest that these pathways are logical candidates for the title of a liquid's "inherent dynamics." Like their namesake "inherent structures," these objects are simply features of the system's potential energy surface and thus provide views of the system's structural evolution unobstructed by thermal kinetic energy. This paper shows how these geodesic pathways can be computed for a liquid of linear molecules, allowing us to see precisely how such molecular liquids mix rotational and translational degrees of freedom into their dynamics. The ratio of translational to rotational components of the geodesic path lengths, for example, is significantly larger than would be expected on equipartition grounds, with a value that scales with the molecular aspect ratio. These and other features of the geodesics are consistent with a picture in which molecular reorientation adiabatically follows translation-molecules largely thread their way through narrow channels available in the potential energy landscape.

  13. The inherent dynamics of a molecular liquid: Geodesic pathways through the potential energy landscape of a liquid of linear molecules

    NASA Astrophysics Data System (ADS)

    Jacobson, Daniel; Stratt, Richard M.

    2014-05-01

    Because the geodesic pathways that a liquid follows through its potential energy landscape govern its slow, diffusive motion, we suggest that these pathways are logical candidates for the title of a liquid's "inherent dynamics." Like their namesake "inherent structures," these objects are simply features of the system's potential energy surface and thus provide views of the system's structural evolution unobstructed by thermal kinetic energy. This paper shows how these geodesic pathways can be computed for a liquid of linear molecules, allowing us to see precisely how such molecular liquids mix rotational and translational degrees of freedom into their dynamics. The ratio of translational to rotational components of the geodesic path lengths, for example, is significantly larger than would be expected on equipartition grounds, with a value that scales with the molecular aspect ratio. These and other features of the geodesics are consistent with a picture in which molecular reorientation adiabatically follows translation—molecules largely thread their way through narrow channels available in the potential energy landscape.

  14. Anharmonic Infrared Spectroscopy through the Fourier Transform of Time Correlation Function Formalism in ONETEP.

    PubMed

    Vitale, Valerio; Dziedzic, Jacek; Dubois, Simon M-M; Fangohr, Hans; Skylaris, Chris-Kriton

    2015-07-14

    Density functional theory molecular dynamics (DFT-MD) provides an efficient framework for accurately computing several types of spectra. The major benefit of DFT-MD approaches lies in the ability to naturally take into account the effects of temperature and anharmonicity, without having to introduce any ad hoc or a posteriori corrections. Consequently, computational spectroscopy based on DFT-MD approaches plays a pivotal role in the understanding and assignment of experimental peaks and bands at finite temperature, particularly in the case of floppy molecules. Linear-scaling DFT methods can be used to study large and complex systems, such as peptides, DNA strands, amorphous solids, and molecules in solution. Here, we present the implementation of DFT-MD IR spectroscopy in the ONETEP linear-scaling code. In addition, two methods for partitioning the dipole moment within the ONETEP framework are presented. Dipole moment partitioning allows us to compute spectra of molecules in solution, which fully include the effects of the solvent, while at the same time removing the solvent contribution from the spectra.

  15. Adsorption of polar organic molecules on sediments: Case-study on Callovian-Oxfordian claystone.

    PubMed

    Rasamimanana, S; Lefèvre, G; Dagnelie, R V H

    2017-08-01

    The release and transport of anthropogenic organic matter through the geosphere is often an environmental criterion of safety. Sedimentary rocks are widely studied in this context as geological barriers for waste management. It is the case of Callovian-Oxfordian claystone (COx), for which several studies report adsorption of anthropogenic organic molecules. In this study, we evaluated and reviewed adsorption data of polar organic molecules on COx claystone. Experiments were performed on raw claystone, decarbonated and clay fractions. Adsorption isotherms were measured with adsorbates of various polarities: adipate, benzoate, ortho-phthalate, succinate, gluconate, oxalate, EDTA, citrate. A significant adsorption was observed for multidentate polycarboxylic acids as evidenced with phthalate, succinate, oxalate, gluconate, EDTA and citrate (R d  = 1.53, 3.52, 8.4, 8.8, 12.4, 54.7 L kg -1 respectively). Multiple linear regression were performed as a statistical analysis to determine the predictors from these adsorption data. A linear correlation between adsorption data (R d ) and dipole moment (μ) of adsorbates was evidenced (R 2  = 0.91). Molecules with a high dipole moment, μ(D) > 2.5, displayed a significant adsorption, R d ≫1 L kg -1 . A qualitative correlation can be easily estimated using the water/octanol partition coefficient, P ow , of adsorbates (R 2  = 0.77). In this case, two opposite trends were distinguished for polar and apolar molecules. The use of organic carbon content in sediments is relevant for predicting adsorption of apolar compounds, log (P ow )>+1. The oxides/clays contents may be relevant regarding polar molecules, log ( apparent P ow )<-1. The proposed scheme offers a general methodology for investigation of geo-barriers towards heterogeneous organic plumes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Recent advances in electronic structure theory and their influence on the accuracy of ab initio potential energy surfaces

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Langhoff, Stephen R.; Taylor, Peter R.

    1989-01-01

    Recent advances in electronic structure theory and the availability of high speed vector processors have substantially increased the accuracy of ab initio potential energy surfaces. The recently developed atomic natural orbital approach for basis set contraction has reduced both the basis set incompleteness and superposition errors in molecular calculations. Furthermore, full CI calculations can often be used to calibrate a CASSCF/MRCI approach that quantitatively accounts for the valence correlation energy. These computational advances also provide a vehicle for systematically improving the calculations and for estimating the residual error in the calculations. Calculations on selected diatomic and triatomic systems will be used to illustrate the accuracy that currently can be achieved for molecular systems. In particular, the F + H2 yields HF + H potential energy hypersurface is used to illustrate the impact of these computational advances on the calculation of potential energy surfaces.

  17. Recent advances in electronic structure theory and their influence on the accuracy of ab initio potential energy surfaces

    NASA Technical Reports Server (NTRS)

    Bauschlicher, Charles W., Jr.; Langhoff, Stephen R.; Taylor, Peter R.

    1988-01-01

    Recent advances in electronic structure theory and the availability of high speed vector processors have substantially increased the accuracy of ab initio potential energy surfaces. The recently developed atomic natural orbital approach for basis set contraction has reduced both the basis set incompleteness and superposition errors in molecular calculations. Furthermore, full CI calculations can often be used to calibrate a CASSCF/MRCI approach that quantitatively accounts for the valence correlation energy. These computational advances also provide a vehicle for systematically improving the calculations and for estimating the residual error in the calculations. Calculations on selected diatomic and triatomic systems will be used to illustrate the accuracy that currently can be achieved for molecular systems. In particular, the F+H2 yields HF+H potential energy hypersurface is used to illustrate the impact of these computational advances on the calculation of potential energy surfaces.

  18. Transferable Pseudo-Classical Electrons for Aufbau of Atomic Ions

    PubMed Central

    Ekesan, Solen; Kale, Seyit; Herzfeld, Judith

    2014-01-01

    Generalizing the LEWIS reactive force field from electron pairs to single electrons, we present LEWIS• in which explicit valence electrons interact with each other and with nuclear cores via pairwise interactions. The valence electrons are independently mobile particles, following classical equations of motion according to potentials modified from Coulombic as required to capture quantum characteristics. As proof of principle, the aufbau of atomic ions is described for diverse main group elements from the first three rows of the periodic table, using a single potential for interactions between electrons of like spin and another for electrons of unlike spin. The electrons of each spin are found to distribute themselves in a fashion akin to the major lobes of the hybrid atomic orbitals, suggesting a pointillist description of the electron density. The broader validity of the LEWIS• force field is illustrated by predicting the vibrational frequencies of diatomic and triatomic hydrogen species. PMID:24752384

  19. Transferable pseudoclassical electrons for aufbau of atomic ions.

    PubMed

    Ekesan, Solen; Kale, Seyit; Herzfeld, Judith

    2014-06-05

    Generalizing the LEWIS reactive force field from electron pairs to single electrons, we present LEWIS• in which explicit valence electrons interact with each other and with nuclear cores via pairwise interactions. The valence electrons are independently mobile particles, following classical equations of motion according to potentials modified from Coulombic as required to capture quantum characteristics. As proof of principle, the aufbau of atomic ions is described for diverse main group elements from the first three rows of the periodic table, using a single potential for interactions between electrons of like spin and another for electrons of unlike spin. The electrons of each spin are found to distribute themselves in a fashion akin to the major lobes of the hybrid atomic orbitals, suggesting a pointillist description of the electron density. The broader validity of the LEWIS• force field is illustrated by predicting the vibrational frequencies of diatomic and triatomic hydrogen species. Copyright © 2014 Wiley Periodicals, Inc.

  20. Light-induced noncentrosymmetry in acceptor-donor-substituted azobenzene solutions

    NASA Astrophysics Data System (ADS)

    Zhao, Jiang; Si, Jinhai; Wang, Yougui; Ye, Peixian; Fu, Xingfa; Qiu, Ling; Shen, Yuquan

    1995-10-01

    Light-induced noncentrosymmetry was achieved experimentally in acceptor-donor-substituted azobenzene solutions and observed by phase-matched nondegenerate six-wave mixing. The microscopic origin of the induced noncentrosymmetry was found to be orientational hole burning, which was distinguished directly with net orientation of molecules by experimental observations. The decay time of the induced noncentrosymmetry depended on the rotational orientation time of the sample's molecule, which varied linearly with the viscosity of the solvent.

  1. EDITORIAL: 18th European Conference on Dynamics of Molecular Systems 18th European Conference on Dynamics of Molecular Systems

    NASA Astrophysics Data System (ADS)

    Varandas, A. J. C.

    2011-08-01

    This special section of Comments on Atomic, Molecular and Optical Physics (CAMOP) in Physica Scripta collects some of the papers that have been presented at the 18th European Conference on Dynamics of Molecular Systems MOLEC 2010 held in September 2010 in Curia, Portugal, as part of a series of biennial MOLEC conferences. This started in 1976 in Trento, Italy, and has continued, visiting 17 cities in 11 countries, namely Denmark, The Netherlands, Israel, France, Italy, Germany, Czech Republic, Spain, United Kingdom, Turkey and Russia. Following the MOLEC tradition, the scientific programme of the Curia meeting focused on experimental and theoretical studies of molecular interactions, collision dynamics, spectroscopy, and related fields. It included invited speakers from 22 countries, who were asked to summarize the problems reported in their presentations with the objective of revealing the current thinking of leading researchers in atomic, molecular and optical physics. It is hoped that their authoritative contributions presented in this CAMOP special section will also appeal to non-specialists through their clear and broad introductions to the field as well as references to the accessible literature. This CAMOP special section comprises ten contributions, which cover theoretical studies on the electronic structure of molecules and clusters as well as dynamics of elastic, inelastic and reactive encounters between atoms, molecules, ions, clusters and surfaces. Specifically, it includes electronic structure calculations using the traditional coupled-cluster method (Barreto et al 028111), the electron-attached equation-of-motion coupled cluster method (Hansen et al 028110), the diffusion Monte Carlo method (López-Durán et al 028107) and the path-integral Monte Carlo method (Barragán et al 028109). The contributions on molecular dynamics include on-the-fly quasi-classical trajectories on a five-atom molecule (Yu 028104), quantum reaction dynamics on triatomics (Bovino et al 028103, and Hankel et al 028102) and statistical reaction dynamics using a model based on the long-range interaction potential (McCarroll 028106). A contribution on gas-surface interactions is also included (Sahoo et al 028105) as well as first-principles ab initio calculations to explore the hydrogen-graphene interaction (Irving et al 028108). These articles reflect the recent progress made in this field and constructively build on work described in the previous three MOLEC special sections of CAMOP published in Physica Scripta. I thank, on behalf of the scientific organizing committee of MOLEC, all the authors who contributed and Physica Scripta for providing a platform for the publication of this special section dedicated to MOLEC 2010. A special thanks goes to the CAMOP Editor, Harold Linarz, for the excellent guidance in handling the editorial work. I hope that the articles catalyze the attention of the readers towards the topics covered and contribute in attracting them to attend MOLEC 2012 in Oxford, UK.

  2. PCR-based detection of a rare linear DNA in cell culture.

    PubMed

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  3. PCR-based detection of a rare linear DNA in cell culture

    PubMed Central

    2002-01-01

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials. PMID:12734566

  4. Vibrational spectroscopic and non-linear optical activity studies on nicotinanilide : A DFT approach

    NASA Astrophysics Data System (ADS)

    Premkumar, S.; Jawahar, A.; Mathavan, T.; Dhas, M. Kumara; Benial, A. Milton Franklin

    2015-06-01

    The molecular structure of nicotinanilide was optimized by the DFT/B3LYP method with cc-pVTZ basis set using Gaussian 09 program. The first order hyperpolarizability of the molecule was calculated, which exhibits the higher nonlinear optical activity. The natural bond orbital analysis confirms the presence of intramolecular charge transfer and the hydrogen bonding interaction, which leads to the higher nonlinear optical activity of the molecule. The Frontier molecular orbitals analysis of the molecule shows that the delocalization of electron density occurs within the molecule. The lower energy gap indicates that the hydrogen bond formation between the charged species. The vibrational frequencies were calculated and assigned on the basis of potential energy distribution calculation using the VEDA 4.0 program and the corresponding vibrational spectra were simulated. Hence, the nicotinanilide molecule can be a good candidate for second-order NLO material.

  5. Interaction between perylene-derivated molecules observed by low temperature scanning tunneling microscopy

    NASA Astrophysics Data System (ADS)

    Vernisse, Loranne; Guillermet, Olivier; Gourdon, André; Coratger, Roland

    2018-03-01

    Derivative perylene molecules deposited on Ag(111) and on NaCl(001) ultrathin layers have been investigated using low temperature STM and NC-AFM. When the metallic substrate is held at ambient temperature during evaporation, the molecules form characteristic trimers on the Ag(111) surface and interact through their polar groups. Close to the steps, the molecules form linear structures and seems to stand side by side. On the other hand, after deposition on a substrate cooled at liquid helium temperature, single molecules are observed both on metal and on NaCl. On the ultrathin insulator layers, the STM images present characteristic contrasts related to the molecular orbitals which favors the localization of aldehyde groups. In this case, the lateral molecular interactions may induce the formation of small assemblies in which the electronic levels are slightly shifted. A possible interpretation of this phenomenon is to take into account polar interactions and charge transfer between neighboring molecules.

  6. Viscous properties of isotropic fluids composed of linear molecules: departure from the classical Navier-Stokes theory in nano-confined geometries.

    PubMed

    Hansen, J S; Daivis, Peter J; Todd, B D

    2009-10-01

    In this paper we present equilibrium molecular-dynamics results for the shear, rotational, and spin viscosities for fluids composed of linear molecules. The density dependence of the shear viscosity follows a stretched exponential function, whereas the rotational viscosity and the spin viscosities show approximately power-law dependencies. The frequency-dependent shear and spin viscosities are also studied. It is found that viscoelastic behavior is first manifested in the shear viscosity and that the real part of the spin viscosities features a maximum for nonzero frequency. The calculated transport coefficients are used together with the extended Navier-Stokes equations to investigate the effect of the coupling between the intrinsic angular momentum and linear momentum for highly confined fluids. Both steady and oscillatory flows are studied. It is shown, for example, that the fluid flow rate for Poiseuille flow is reduced by up to 10% in a 2 nm channel for a buta-triene fluid at density 236 kg m(-3) and temperature 306 K. The coupling effect may, therefore, become very important for nanofluidic applications.

  7. Spectroscopic investigations using density functional theory on 2-methoxy- 4(phenyliminomethyl)phenol: A non linear optical material

    NASA Astrophysics Data System (ADS)

    Hijas, K. M.; Madan Kumar, S.; Byrappa, K.; Geethakrishnan, T.; Jeyaram, S.; Nagalakshmi, R.

    2018-03-01

    Single crystals of 2-methoxy-4(phenyliminomethyl)phenol were grown from ethanol by slow evaporation solution growth technique. Single crystal X-ray diffraction experiment reveals the crystallization in orthorhombic system having non-centrosymmetric space group C2221. Geometrical optimization by density functional theory method was carried out using Gaussian program and compared with experimental results. Detailed experimental and theoretical vibrational analyses were carried out and the results were correlated to find close agreement. Thermal analyses show the material is thermally stable with a melting point of 159 °C. Natural bond orbital analysis was carried out to explain charge transfer interactions through hydrogen bonding. Relatively smaller HOMO-LUMO band gap favors the non linear optical activity of the molecule. Natural population analysis and molecular electrostatic potential calculations visualize the charge distribution in an isolated molecule. Calculated first-order molecular hyperpolarizability and preliminary second harmonic generation test carried out using Kurtz-Perry technique establish 2-methoxy-4(phenyliminomethyl)phenol crystal as a good non linear optical material. Z-scan proposes the material for reverse saturable absorption.

  8. Structure of Irreversibly Adsorbed Star Polymers

    NASA Astrophysics Data System (ADS)

    Akgun, Bulent; Aykan, Meryem Seyma; Canavar, Seda; Satija, Sushil K.; Uhrig, David; Hong, Kunlun

    Formation of irreversibly adsorbed polymer chains on solid substrates have a huge impact on the wetting, glass transition, aging and polymer chain mobility in thin films. In recent years there has been many reports on the formation, kinetics and dynamics of these layers formed by linear homopolymers. Recent studies showed that by varying the number of polymer arms and arm molecular weight one can tune the glass transition temperature of thin polymer films. Using polymer architecture as a tool, the behavior of thin films can be tuned between the behavior of linear chains and soft colloids. We have studied the effect of polymer chain architecture on the structure of dead layer using X-ray reflectivity (XR) and atomic force microscopy. Layer thicknesses and densities of flattened and loosely adsorbed chains has been measured for linear, 4-arm, and 8-arm star polymers with identical total molecular weight as a function of substrate surface energy, annealing temperature and annealing time. Star polymers have been synthesized using anionic polymerization. XR measurements showed that 8-arm star PS molecules form the densest and the thickest dead layers among these three molecules.

  9. Valence electronic properties of porphyrin derivatives.

    PubMed

    Stenuit, G; Castellarin-Cudia, C; Plekan, O; Feyer, V; Prince, K C; Goldoni, A; Umari, P

    2010-09-28

    We present a combined experimental and theoretical investigation of the valence electronic structure of porphyrin-derived molecules. The valence photoemission spectra of the free-base tetraphenylporphyrin and of the octaethylporphyrin molecule were measured using synchrotron radiation and compared with theoretical spectra calculated using the GW method and the density-functional method within the generalized gradient approximation. Only the GW results could reproduce the experimental data. We found that the contribution to the orbital energies due to electronic correlations has the same linear behavior in both molecules, with larger deviations in the vicinity of the HOMO level. This shows the importance of adequate treatment of electronic correlations in these organic systems.

  10. Evaluation of synthetic linear motor-molecule actuation energetics

    PubMed Central

    Brough, Branden; Northrop, Brian H.; Schmidt, Jacob J.; Tseng, Hsian-Rong; Houk, Kendall N.; Stoddart, J. Fraser; Ho, Chih-Ming

    2006-01-01

    By applying atomic force microscope (AFM)-based force spectroscopy together with computational modeling in the form of molecular force-field simulations, we have determined quantitatively the actuation energetics of a synthetic motor-molecule. This multidisciplinary approach was performed on specifically designed, bistable, redox-controllable [2]rotaxanes to probe the steric and electrostatic interactions that dictate their mechanical switching at the single-molecule level. The fusion of experimental force spectroscopy and theoretical computational modeling has revealed that the repulsive electrostatic interaction, which is responsible for the molecular actuation, is as high as 65 kcal·mol−1, a result that is supported by ab initio calculations. PMID:16735470

  11. Watching cellular machinery in action, one molecule at a time.

    PubMed

    Monachino, Enrico; Spenkelink, Lisanne M; van Oijen, Antoine M

    2017-01-02

    Single-molecule manipulation and imaging techniques have become important elements of the biologist's toolkit to gain mechanistic insights into cellular processes. By removing ensemble averaging, single-molecule methods provide unique access to the dynamic behavior of biomolecules. Recently, the use of these approaches has expanded to the study of complex multiprotein systems and has enabled detailed characterization of the behavior of individual molecules inside living cells. In this review, we provide an overview of the various force- and fluorescence-based single-molecule methods with applications both in vitro and in vivo, highlighting these advances by describing their applications in studies on cytoskeletal motors and DNA replication. We also discuss how single-molecule approaches have increased our understanding of the dynamic behavior of complex multiprotein systems. These methods have shown that the behavior of multicomponent protein complexes is highly stochastic and less linear and deterministic than previously thought. Further development of single-molecule tools will help to elucidate the molecular dynamics of these complex systems both inside the cell and in solutions with purified components. © 2017 Monachino et al.

  12. Visualization of DNA molecules in time during electrophoresis

    NASA Technical Reports Server (NTRS)

    Lubega, Seth

    1991-01-01

    For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

  13. Spin-orbit-coupled Bose-Einstein condensates of rotating polar molecules

    NASA Astrophysics Data System (ADS)

    Deng, Y.; You, L.; Yi, S.

    2018-05-01

    An experimental proposal for realizing spin-orbit (SO) coupling of pseudospin 1 in the ground manifold 1Σ (υ =0 ) of (bosonic) bialkali polar molecules is presented. The three spin components are composed of the ground rotational state and two substates from the first excited rotational level. Using hyperfine resolved Raman processes through two select excited states resonantly coupled by a microwave, an effective coupling between the spin tensor and linear momentum is realized. The properties of Bose-Einstein condensates for such SO-coupled molecules exhibiting dipolar interactions are further explored. In addition to the SO-coupling-induced stripe structures, the singly and doubly quantized vortex phases are found to appear, implicating exciting opportunities for exploring novel quantum physics using SO-coupled rotating polar molecules with dipolar interactions.

  14. A linear biopolymer in the vicinity of the triple point. The homopolymer case.

    PubMed

    Frank-Kamenetskii, M D; Chogovadze, G I

    1984-06-01

    This is a theoretical study of a situation where each residue of a linear biopolymer may adopt one of three conformational states. Such a situation exists in the case of DNA, since it may be in helical A, B, . . ., Z forms as well as the melted state. In the vicinity of the triple point in the phrase diagram three states, e.g. the A form, the B form and the denatured state, co-exist within a given molecule. We present an exact analytical solution of the simplest homopolymer model. Theory predicts that the presence of two helical states in one molecule should affect the helix-coil transition in two ways. The melting temperature experiences an upward shift and the melting range width is increased, by a factor of square root of two as a maximum.

  15. Design and Application of a High-Temperature Linear Ion Trap Reactor

    NASA Astrophysics Data System (ADS)

    Jiang, Li-Xue; Liu, Qing-Yu; Li, Xiao-Na; He, Sheng-Gui

    2018-01-01

    A high-temperature linear ion trap reactor with hexapole design was homemade to study ion-molecule reactions at variable temperatures. The highest temperature for the trapped ions is up to 773 K, which is much higher than those in available reports. The reaction between V2O6 - cluster anions and CO at different temperatures was investigated to evaluate the performance of this reactor. The apparent activation energy was determined to be 0.10 ± 0.02 eV, which is consistent with the barrier of 0.12 eV calculated by density functional theory. This indicates that the current experimental apparatus is prospective to study ion-molecule reactions at variable temperatures, and more kinetic details can be obtained to have a better understanding of chemical reactions that have overall barriers. [Figure not available: see fulltext.

  16. Vanishing-Overhead Linear-Scaling Random Phase Approximation by Cholesky Decomposition and an Attenuated Coulomb-Metric.

    PubMed

    Luenser, Arne; Schurkus, Henry F; Ochsenfeld, Christian

    2017-04-11

    A reformulation of the random phase approximation within the resolution-of-the-identity (RI) scheme is presented, that is competitive to canonical molecular orbital RI-RPA already for small- to medium-sized molecules. For electronically sparse systems drastic speedups due to the reduced scaling behavior compared to the molecular orbital formulation are demonstrated. Our reformulation is based on two ideas, which are independently useful: First, a Cholesky decomposition of density matrices that reduces the scaling with basis set size for a fixed-size molecule by one order, leading to massive performance improvements. Second, replacement of the overlap RI metric used in the original AO-RPA by an attenuated Coulomb metric. Accuracy is significantly improved compared to the overlap metric, while locality and sparsity of the integrals are retained, as is the effective linear scaling behavior.

  17. Crystal structure of zwitterionic bisimidazolium sulfonates

    NASA Astrophysics Data System (ADS)

    Kohmoto, Shigeo; Okuyama, Shinpei; Yokota, Nobuyuki; Takahashi, Masahiro; Kishikawa, Keiki; Masu, Hyuma; Azumaya, Isao

    2012-05-01

    Crystal structures of three zwitterionic bisimidazolium salts 1-3 in which imidazolium sulfonate moieties were connected with aromatic linkers, p-xylylene, 4,4'-dimethylenebiphenyl, and phenylene, respectively, were examined. The latter two were obtained as hydrates. An S-shaped molecular structure in which the sulfonate moiety was placed on the imidazolium ring was observed for 1. A helical array of hydrated water molecules was obtained for 2 while a linear array of hydrated water molecules was observed for 3.

  18. Theoretical analysis of degradation mechanisms in the formation of morphogen gradients

    NASA Astrophysics Data System (ADS)

    Bozorgui, Behnaz; Teimouri, Hamid; Kolomeisky, Anatoly B.

    2015-07-01

    Fundamental biological processes of development of tissues and organs in multicellular organisms are governed by various signaling molecules, which are called morphogens. It is known that spatial and temporal variations in the concentration profiles of signaling molecules, which are frequently referred as morphogen gradients, lead to a cell differentiation via activating specific genes in a concentration-dependent manner. It is widely accepted that the establishment of the morphogen gradients involves multiple biochemical reactions and diffusion processes. One of the critical elements in the formation of morphogen gradients is a degradation of signaling molecules. We develop a new theoretical approach that provides a comprehensive description of the degradation mechanisms. It is based on the idea that the degradation works as an effective potential that drives the signaling molecules away from the source region. Utilizing the method of first-passage processes, the dynamics of the formation of morphogen gradients for various degradation mechanisms is explicitly evaluated. It is found that linear degradation processes lead to a dynamic behavior specified by times to form the morphogen gradients that depend linearly on the distance from the source. This is because the effective potential due to the degradation is quite strong. At the same time, nonlinear degradation mechanisms yield a quadratic scaling in the morphogen gradients formation times since the effective potentials are much weaker. Physical-chemical explanations of these phenomena are presented.

  19. Tunable SERS signals of Rhodamine B molecules on Fe3O4@Au nanocomposite substrates controlled by magnetic field

    NASA Astrophysics Data System (ADS)

    Song, Hao; Fang, Rui Yang; Li, Ling

    2018-02-01

    In this work, we experimentally synthesized the Fe3O4@Au nanocomposites and used them as surface-enhanced Raman scattering (SERS) substrates. The Fe3O4@Au nanocomposites retained the metallic plasmon resonant effect and possessed the magnetic field controllable characteristics. The Raman spectra of Rhodamine B (RhB) probe molecules were studied under different external magnetic field. The magnitude of external magnetic field varied from 0 Gs to 700 Gs (1 Gs = 10-4 T) with intervals of 100 Gs. When the magnetic field magnitude increased, the Raman intensity of RhB probe molecules at 1356 cm-1 increased linearly. The slope of the linear fitting curves for the Raman intensity and area were 0.118/Gs and 3.700/Gs. The Raman enhancement could raise up to 7 times for RhB probe molecules when the magnetic field magnitude increased to 700 Gs. After removing the external magnetic field, the Raman peaks returned to its original intensity in several minutes. Under the external magnetic field, the Fe3O4@Au nanocomposites were concentrated, leading to the increase number of SERS "hot spots" and the surface Au density. The results show that the magnetic field controlled Fe3O4@Au nanocomposites can realize the enhanced and controllable SERS effect, which can be used in the reversible optical sensing and bio-medical applications.

  20. Charge-transfer complexes of 2,3-dichloro-5,6-dicyano-1,4-benzoquinone with amino molecules in polar solvents

    NASA Astrophysics Data System (ADS)

    Berto, Silvia; Chiavazza, Enrico; Ribotta, Valentina; Daniele, Pier Giuseppe; Barolo, Claudia; Giacomino, Agnese; Vione, Davide; Malandrino, Mery

    2015-10-01

    The charge-transfer complexes have scientific relevance because this type of molecular interaction is at the basis of the activity of pharmacological compounds and because the absorption bands of the complexes can be used for the quantification of electron donor molecules. This work aims to assess the stability of the charge-transfer complexes between the electron acceptor 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) and two drugs, procaine and atenolol, in acetonitrile and ethanol. The stability of DDQ in solution and the time required to obtain the maximum complex formation were evaluated. The stoichiometry and the stability of the complexes were determined, respectively, by Job's plot method and by the elaboration of UV-vis titrations data. The latter task was carried out by using the non-linear global analysis approach to determine the equilibrium constants. This approach to data elaboration allowed us to overcome the disadvantages of the classical linear-regression method, to obtain reliable values of the association constants and to calculate the entire spectra of the complexes. NMR spectra were recorded to identify the portion of the donor molecule that was involved in the interaction. The data support the participation of the aliphatic amino groups in complex formation and exclude the involvement of the aromatic amine present in the procaine molecule.

  1. The mitochondrial genome of the pathogenic yeast Candida subhashii: GC-rich linear DNA with a protein covalently attached to the 5′ termini

    PubMed Central

    Fricova, Dominika; Valach, Matus; Farkas, Zoltan; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Nosek, Jozef

    2010-01-01

    As a part of our initiative aimed at a large-scale comparative analysis of fungal mitochondrial genomes, we determined the complete DNA sequence of the mitochondrial genome of the yeast Candida subhashii and found that it exhibits a number of peculiar features. First, the mitochondrial genome is represented by linear dsDNA molecules of uniform length (29 795 bp), with an unusually high content of guanine and cytosine residues (52.7 %). Second, the coding sequences lack introns; thus, the genome has a relatively compact organization. Third, the termini of the linear molecules consist of long inverted repeats and seem to contain a protein covalently bound to terminal nucleotides at the 5′ ends. This architecture resembles the telomeres in a number of linear viral and plasmid DNA genomes classified as invertrons, in which the terminal proteins serve as specific primers for the initiation of DNA synthesis. Finally, although the mitochondrial genome of C. subhashii contains essentially the same set of genes as other closely related pathogenic Candida species, we identified additional ORFs encoding two homologues of the family B protein-priming DNA polymerases and an unknown protein. The terminal structures and the genes for DNA polymerases are reminiscent of linear mitochondrial plasmids, indicating that this genome architecture might have emerged from fortuitous recombination between an ancestral, presumably circular, mitochondrial genome and an invertron-like element. PMID:20395267

  2. Determination and importance of temperature dependence of retention coefficient (RPHPLC) in QSAR model of nitrazepams' partition coefficient in bile acid micelles.

    PubMed

    Posa, Mihalj; Pilipović, Ana; Lalić, Mladena; Popović, Jovan

    2011-02-15

    Linear dependence between temperature (t) and retention coefficient (k, reversed phase HPLC) of bile acids is obtained. Parameters (a, intercept and b, slope) of the linear function k=f(t) highly correlate with bile acids' structures. Investigated bile acids form linear congeneric groups on a principal component (calculated from k=f(t)) score plot that are in accordance with conformations of the hydroxyl and oxo groups in a bile acid steroid skeleton. Partition coefficient (K(p)) of nitrazepam in bile acids' micelles is investigated. Nitrazepam molecules incorporated in micelles show modified bioavailability (depo effect, higher permeability, etc.). Using multiple linear regression method QSAR models of nitrazepams' partition coefficient, K(p) are derived on the temperatures of 25°C and 37°C. For deriving linear regression models on both temperatures experimentally obtained lipophilicity parameters are included (PC1 from data k=f(t)) and in silico descriptors of the shape of a molecule while on the higher temperature molecular polarisation is introduced. This indicates the fact that the incorporation mechanism of nitrazepam in BA micelles changes on the higher temperatures. QSAR models are derived using partial least squares method as well. Experimental parameters k=f(t) are shown to be significant predictive variables. Both QSAR models are validated using cross validation and internal validation method. PLS models have slightly higher predictive capability than MLR models. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Chemical structure-nonlinear optical property relationships for a series of two-photon absorbing fluorene molecules

    NASA Astrophysics Data System (ADS)

    Hales, Joel Mccajah

    This dissertation reports on the investigation of two-photon absorption (2PA) in a series of fluorenyl molecules. Several current and emerging technologies exploit this optical nonlinearity including two-photon fluorescence imaging, three-dimensional microfabrication, site-specific photodynamic cancer therapy and biological caging studies. The two key features of this nonlinearity which make it an ideal candidate for the above applications are its quadratic dependence on the incident irradiance and the improved penetration into absorbing media that it affords. As a consequence of the burgeoning field which exploits 2PA, it is a goal to find materials that exhibit strong two-photon absorbing capabilities. Organic materials are promising candidates for 2PA applications because their material properties can be tailored through molecular engineering thereby facilitating optimization of their nonlinear optical properties. Fluorene derivatives are particularly interesting since they possess high photochemical stability for organic molecules and are generally strongly fluorescent. By systematically altering the structural properties in a series of fluorenyl molecules, we have determined how these changes affect their two-photon absorbing capabilities. This was accomplished through characterization of both the strength and location of their 2PA spectra. In order to ensure the validity of these results, three separate nonlinear characterization techniques were employed: two-photon fluorescence spectroscopy, white-light continuum pump-probe spectroscopy, and the Z-scan technique. In addition, full linear spectroscopic characterization was performed on these molecules along with supplementary quantum chemical calculations to obtain certain molecular properties that might impact the nonlinearity. Different designs in chemical architecture allowed investigation of the effects of symmetry, solvism, donor-acceptor strengths, conjugation length, and multi-branched geometries on the two-photon absorbing properties of these molecules. In addition, the means to enhance 2PA via intermediate state resonances was investigated. To provide plausible explanations for the experimentally observed trends, a conceptually simple three level model was employed. The subsequent correlations found between chemical structure and the linear and nonlinear optical properties of these molecules provided definitive conclusions on how to properly optimize their two-photon absorbing capabilities. The resulting large nonlinearities found in these molecules have already shown promise in a variety of the aforementioned applications.

  4. Development of a reference material of a single DNA molecule for the quality control of PCR testing.

    PubMed

    Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

    2014-09-02

    We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

  5. Singlet fission in linear chains of molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ambrosio, Francesco, E-mail: F.Ambrosio@warwick.ac.uk, E-mail: A.Troisi@warwick.ac.uk; Troisi, Alessandro, E-mail: F.Ambrosio@warwick.ac.uk, E-mail: A.Troisi@warwick.ac.uk

    2014-11-28

    We develop a model configuration interaction Hamiltonian to study the electronic structure of a chain of molecules undergoing singlet fission. We first consider models for dimer and trimer and then we use a matrix partitioning technique to build models of arbitrary size able to describe the relevant electronic structure for singlet fission in linear aggregates. We find that the multi-excitonic state (ME) is stabilized at short inter-monomer distance and the extent of this stabilization depends upon the size of orbital coupling between neighboring monomers. We also find that the coupling between ME states located on different molecules is extremely smallmore » leading to bandwidths in the order of ∼10 meV. This observation suggests that multi-exciton states are extremely localized by electron-phonon coupling and that singlet fission involves the transition between a relatively delocalized Frenkel exciton and a strongly localized multi-exciton state. We adopt the methodology commonly used to study non-radiative transitions to describe the singlet fission dynamics in these aggregates and we discuss the limit of validity of the approach. The results indicate that the phenomenology of singlet fission in molecular crystals is different in many important ways from what is observed in isolated dimers.« less

  6. Quantitative nanoimmunosensor based on dark-field illumination with enhanced sensitivity and on-off switching using scattering signals.

    PubMed

    Lee, Seungah; Nan, He; Yu, Hyunung; Kang, Seong Ho

    2016-05-15

    A nanoimmunosensor based on wavelength-dependent dark-field illumination with enhanced sensitivity was used to detect a disease-related protein molecule at zeptomolar (zM) concentrations. The assay platform of 100-nm gold nanospots could be selectively acquired using the wavelength-dependence of enhanced scattering signals from antibody-conjugated plasmonic silver nanoparticles (NPs) with on-off switching using optical filters. Detection of human thyroid-stimulating hormone (hTSH) at a sensitivity of 100 zM, which corresponds to 1-2 molecules per gold spot, was possible within a linear range of 100 zM-100 fM (R=0.9968). A significantly enhanced sensitivity (~4-fold) was achieved with enhanced dark-field illumination compared to using a total internal reflection fluorescence immunosensor. Immunoreactions were confirmed via optical axial-slicing based on the spectral characteristics of two plasmonic NPs. This method of using wavelength-dependent dark-field illumination had an enhanced sensitivity and a wide, linear dynamic range of 100 zM-100 fM, and was an effective tool for quantitatively detecting a single molecule on a nanobiochip for molecular diagnostics. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. A theoretical perspective of the nature of hydrogen-bond types - the atoms in molecules approach

    NASA Astrophysics Data System (ADS)

    Vijaya Pandiyan, B.; Kolandaivel, P.; Deepa, P.

    2014-06-01

    Hydrogen bonds and their strength were analysed based on their X-H proton-donor bond properties and the parameters of the H-Y distance (Y proton acceptor). Strong, moderate and weak interactions in hydrogen-bond types were verified through the proton affinities of bases (PA), deprotanation enthalpies of acids (DPE) and the chemical shift (σ). The aromaticity and anti-aromaticity were analysed by means of the NICS (0) (nucleus-independent chemical shift), NICS (1) and ΔNICS (0), ΔNICS (1) of hydrogen-bonded molecules. The strength of a hydrogen bond depends on the capacity of hydrogen atom engrossing into the electronegative acceptor atom. The correlation between the above parameters and their relations were discussed through curve fitting. Bader's theory of atoms in molecules has been applied to estimate the occurrence of hydrogen bonds through eight criteria reported by Popelier et al. The lengths and potential energy shifts have been found to have a strong negative linear correlation, whereas the lengths and Laplacian shifts have a strong positive linear correlation. This study illustrates the common factors responsible for strong, moderate and weak interactions in hydrogen-bond types.

  8. Optical detection of glucose and glycated hemoglobin using etched fiber Bragg gratings coated with functionalized reduced graphene oxide.

    PubMed

    Sridevi, S; Vasu, K S; Sampath, S; Asokan, S; Sood, A K

    2016-07-01

    An enhanced optical detection of D-glucose and glycated hemoglobin (HbA1c ) has been established in this study using etched fiber Bragg gratings (eFBG) coated with aminophenylboronic acid (APBA)-functionalized reduced graphene oxide (RGO). The read out, namely the shift in Bragg wavelength (ΔλB ) is highly sensitive to changes that occur due to the adsorption of glucose (or HbA1c ) molecules on the eFBG sensor coated with APBA-RGO complex through a five-membered cyclic ester bond formation between glucose and APBA molecules. A limit of detection of 1 nM is achieved with a linear range of detection from 1 nM to 10 mM in the case of D-glucose detection experiments. For HbA1c , a linear range of detection varying from 86 nM to 0.23 mM is achieved. The observation of only 4 pm (picometer) change in ΔλB even for the 10 mM lactose solution confirms the specificity of the APBA-RGO complex coated eFBG sensors to glucose molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Efficient parallel linear scaling construction of the density matrix for Born-Oppenheimer molecular dynamics.

    PubMed

    Mniszewski, S M; Cawkwell, M J; Wall, M E; Mohd-Yusof, J; Bock, N; Germann, T C; Niklasson, A M N

    2015-10-13

    We present an algorithm for the calculation of the density matrix that for insulators scales linearly with system size and parallelizes efficiently on multicore, shared memory platforms with small and controllable numerical errors. The algorithm is based on an implementation of the second-order spectral projection (SP2) algorithm [ Niklasson, A. M. N. Phys. Rev. B 2002 , 66 , 155115 ] in sparse matrix algebra with the ELLPACK-R data format. We illustrate the performance of the algorithm within self-consistent tight binding theory by total energy calculations of gas phase poly(ethylene) molecules and periodic liquid water systems containing up to 15,000 atoms on up to 16 CPU cores. We consider algorithm-specific performance aspects, such as local vs nonlocal memory access and the degree of matrix sparsity. Comparisons to sparse matrix algebra implementations using off-the-shelf libraries on multicore CPUs, graphics processing units (GPUs), and the Intel many integrated core (MIC) architecture are also presented. The accuracy and stability of the algorithm are illustrated with long duration Born-Oppenheimer molecular dynamics simulations of 1000 water molecules and a 303 atom Trp cage protein solvated by 2682 water molecules.

  10. Identifying the Molecular Origin of Global Warming

    NASA Technical Reports Server (NTRS)

    Bera, Partha P.; Francisco, Joseph S.; Lee, Timothy J.

    2009-01-01

    We have investigated the physical characteristics of greenhouse gases (GHGs) to assess which properties are most important in determining the efficiency of a GHG. Chlorofluorcarbons (CFCs), hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), nitrogen fluorides, and various other known atmospheric trace molecules have been included in this study. Compounds containing the halogens F or Cl have in common very polar X-F or X-Cl bonds, particularly the X-F bonds. It is shown that as more F atoms bond to the same central atom, the bond dipoles become larger as a result of the central atom becoming more positive. This leads to a linear increase in the total or integrated XF bond dipole derivatives for the molecule, which leads to a non-linear (quadratic) increase in infrared (IR) intensity. Moreover, virtually all of the X-F bond stretches occur in the atmospheric IR window as opposed to X-H stretches, which do not occur in the atmospheric window. It is concluded that molecules possessing several F atoms will always have a large radiative forcing parameter in the calculation of their global warming potential. Some of the implications for global warming and climate change are discussed.

  11. Dispersion interactions with linear scaling DFT: a study of planar molecules on charged polar surfaces

    NASA Astrophysics Data System (ADS)

    Andrinopoulos, Lampros; Hine, Nicholas; Haynes, Peter; Mostofi, Arash

    2010-03-01

    The placement of organic molecules such as CuPc (copper phthalocyanine) on wurtzite ZnO (zinc oxide) charged surfaces has been proposed as a way of creating photovoltaic solar cellsfootnotetextG.D. Sharma et al., Solar Energy Materials & Solar Cells 90, 933 (2006) ; optimising their performance may be aided by computational simulation. Electronic structure calculations provide high accuracy at modest computational cost but two challenges are encountered for such layered systems. First, the system size is at or beyond the limit of traditional cubic-scaling Density Functional Theory (DFT). Second, traditional exchange-correlation functionals do not account for van der Waals (vdW) interactions, crucial for determining the structure of weakly bonded systems. We present an implementation of recently developed approachesfootnotetextP.L. Silvestrelli, P.R.L. 100, 102 (2008) to include vdW in DFT within ONETEPfootnotetextC.-K. Skylaris, P.D. Haynes, A.A. Mostofi and M.C. Payne, J.C.P. 122, 084119 (2005) , a linear-scaling package for performing DFT calculations using a basis of localised functions. We have applied this methodology to simple planar organic molecules, such as benzene and pentacene, on ZnO surfaces.

  12. Room temperature structures and odd even behaviour of a homologous series of anhydrous lithium n-alkanoates

    NASA Astrophysics Data System (ADS)

    White, Nicole A. S.; Ellis, Henry A.

    2008-10-01

    The molecular structures of a homologous series of lithium n-alkanoates have been determined at room temperature using infrared spectroscopy, polarizing light microscopy and X-ray powder diffraction in conjunction with density and melting point measurements. For all the compounds investigated, asymmetric ionic metal-carboxylate coordination is proposed, with the molecules located within a triclinic crystal system with P1¯ space group. The molecules are nearly all of similar structure and are arranged within lamellar layers with four molecules per unit cell. The hydrocarbon chains, in nearly all trans conformation, are arranged tail-to-tail and tilted at an average angle of 55 ο to the planes containing lithium ions. The unit cell parameters such as sides: b and c increase linearly with increasing chain length whilst side a shows a linear decrease. Furthermore, the measured densities and melting points show odd-even behaviour, suggesting differences in molecular packing between odd and even chain length homologues. Geometric models are proposed to explain molecular orientation within a lamella and odd-even behaviour, involving the influence of terminal groups on the packing geometry of hydrocarbon chains within the lattice.

  13. Experimental observation and determination of the laser-induced frequency shift of hyperfine levels of ultracold polar molecules

    NASA Astrophysics Data System (ADS)

    Liu, Wenliang; Wang, Xiaofeng; Wu, Jizhou; Su, Xingliang; Wang, Shen; Sovkov, Vladimir B.; Ma, Jie; Xiao, Liantuan; Jia, Suotang

    2017-08-01

    We report on the experimental observation and quantitative determination of the laser-induced frequency shift (LIFS) of the ultracold polar molecules formed by photoassociation (PA). The experiments are performed by detecting a series of double PA spectra with a molecular hyperfine structure, which are induced by two PA lasers with a precise and adjustable frequency reference. We find that the LIFS of the molecular hyperfine levels shows a linear dependence on PA laser intensity.

  14. Electrically controllable photonic molecule laser.

    PubMed

    Fasching, G; Deutsch, Ch; Benz, A; Andrews, A M; Klang, P; Zobl, R; Schrenk, W; Strasser, G; Ragulis, P; Tamosiūnas, V; Unterrainer, K

    2009-10-26

    We have studied the coherent intercavity coupling of the evanescent fields of two microdisk terahertz quantum-cascade lasers. The electrically controllable optical coupling of the single-mode operating lasers has been observed for cavity spacings up to 30 mum. The strongest coupled photonic molecule with 2 mum intercavity spacing allows to conditionally switch the optical emission by the electrical modulation of only one microdisk. The lasing threshold characteristics demonstrate the linear dependence of the gain of a quantum-cascade laser on the applied electric field.

  15. Self-assembly of heterogeneous supramolecular structures with uniaxial anisotropy.

    PubMed

    Ruiz-Osés, M; Gonzalez-Lakunza, N; Silanes, I; Gourdon, A; Arnau, A; Ortega, J E

    2006-12-28

    Uniaxial anisotropy in two-dimensional self-assembled supramolecular structures is achieved by the coadsorption of two different linear molecules with complementary amine and imide functionalization. The two-dimensional monolayer is defined by a one-dimensional stack of binary chains, which can be forced to line up along steps in vicinal surfaces. The competing driving forces in the self-organization process are discussed in light of the structures observed during single molecule adsorption and coadsorption on flat and vicinal surfaces and the corresponding theoretical calculations.

  16. Communication: Finding destructive interference features in molecular transport junctions.

    PubMed

    Reuter, Matthew G; Hansen, Thorsten

    2014-11-14

    Associating molecular structure with quantum interference features in electrode-molecule-electrode transport junctions has been difficult because existing guidelines for understanding interferences only apply to conjugated hydrocarbons. Herein we use linear algebra and the Landauer-Büttiker theory for electron transport to derive a general rule for predicting the existence and locations of interference features. Our analysis illustrates that interferences can be directly determined from the molecular Hamiltonian and the molecule-electrode couplings, and we demonstrate its utility with several examples.

  17. Nonlinear vs. linear biasing in Trp-cage folding simulations

    NASA Astrophysics Data System (ADS)

    Spiwok, Vojtěch; Oborský, Pavel; Pazúriková, Jana; Křenek, Aleš; Králová, Blanka

    2015-03-01

    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energy minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.

  18. Nonlinear vs. linear biasing in Trp-cage folding simulations.

    PubMed

    Spiwok, Vojtěch; Oborský, Pavel; Pazúriková, Jana; Křenek, Aleš; Králová, Blanka

    2015-03-21

    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energy minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.

  19. Dynamics of osmosis in a porous medium.

    PubMed

    Cardoso, Silvana S S; Cartwright, Julyan H E

    2014-11-01

    We derive from kinetic theory, fluid mechanics and thermodynamics the minimal continuum-level equations governing the flow of a binary, non-electrolytic mixture in an isotropic porous medium with osmotic effects. For dilute mixtures, these equations are linear and in this limit provide a theoretical basis for the widely used semi-empirical relations of Kedem & Katchalsky (Kedem & Katchalsky 1958 Biochim. Biophys. Acta 27, 229-246 (doi:10.1016/0006-3002(58)90330-5), which have hitherto been validated experimentally but not theoretically. The above linearity between the fluxes and the driving forces breaks down for concentrated or non-ideal mixtures, for which our equations go beyond the Kedem-Katchalsky formulation. We show that the heretofore empirical solute permeability coefficient reflects the momentum transfer between the solute molecules that are rejected at a pore entrance and the solvent molecules entering the pore space; it can be related to the inefficiency of a Maxwellian demi-demon.

  20. Tailoring magnetic nanoparticle for transformers application.

    PubMed

    Morais, P C; Silva, A S; Leite, E S; Garg, V K; Oliveira, A C; Viali, W R; Sartoratto, P P C

    2010-02-01

    In this study photoacoustic spectroscopy was used to investigate the effect of dilution of an oil-based magnetic fluid sample on the magnetic nanoparticle surface-coating. Changes of the photoacoustic signal intensity on the band-L region (640 to 830 nm) upon dilution of the stock magnetic fluid sample were discussed in terms of molecular surface desorption. The model proposed here assumes that the driving force taking the molecules out from the nanoparticle surface into the bulk solvent is the gradient of osmotic pressure. This gradient of osmotic pressure is established between the nanoparticle surface and the bulk suspension. It is further assumed that the photoacoustic signal intensity (area under the photoacoustic spectra) scales linearly with the number of coating molecules (surface grafting) at the nanoparticle surface. This model picture provides a non-linear analytical description for the reduction of the surface grafting coefficient upon dilution, which was successfully-used to curve-fit the photoacoustic experimental data.

  1. Life Before RNA

    NASA Astrophysics Data System (ADS)

    Sowerby, Stephen J.; Petersen, George B.

    2002-08-01

    The hypothesis that life originated and evolved from linear informational molecules capable of facilitating their own catalytic replication is deeply entrenched. However, widespread acceptance of this paradigm seems oblivious to a lack of direct experimental support. Here, we outline the fundamental objections to the de novo appearance of linear, self-replicating polymers and examine an alternative hypothesis of template-directed coding of peptide catalysts by adsorbed purine bases. The bases (which encode biological information in modern nucleic acids) spontaneously self-organize into two-dimensional molecular solids adsorbed to the uncharged surfaces of crystalline minerals; their molecular arrangement is specified by hydrogen bonding rules between adjacent molecules and can possess the aperiodic complexity to encode putative protobiological information. The persistence of such information through self-reproduction, together with the capacity of adsorbed bases to exhibit enantiomorphism and effect amino acid discrimination, would seem to provide the necessary machinery for a primitive genetic coding mechanism.

  2. The hydrodeoxygenation of bioderived furans into alkanes.

    PubMed

    Sutton, Andrew D; Waldie, Fraser D; Wu, Ruilian; Schlaf, Marcel; Silks, Louis A Pete; Gordon, John C

    2013-05-01

    The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.

  3. The hydrodeoxygenation of bioderived furans into alkanes

    NASA Astrophysics Data System (ADS)

    Sutton, Andrew D.; Waldie, Fraser D.; Wu, Ruilian; Schlaf, Marcel; ‘Pete' Silks, Louis A.; Gordon, John C.

    2013-05-01

    The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.

  4. Hyperfine frequencies of {sup 87}Rb and {sup 133}Cs atoms in Xe gas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McGuyer, B. H.; Xia, T.; Jau, Y.-Y.

    2011-09-15

    The microwave resonant frequencies of ground-state {sup 87}Rb and {sup 133}Cs atoms in Xe buffer gas are shown to have a relatively large nonlinear dependence on the Xe pressure, presumably because of RbXe or CsXe van der Waals molecules. The nonlinear shifts for Xe are opposite in sign to the previously measured shifts for Ar and Kr, even though all three gases have negative linear shifts. The Xe data show striking discrepancies with the previous theory for nonlinear shifts. Most of this discrepancy is eliminated by accounting for the spin-rotation interaction, {gamma}N{center_dot}S, in addition to the hyperfine-shift interaction, {delta} Amore » I{center_dot}S, in the molecules. To the limit of our experimental accuracy, the shifts of {sup 87}Rb and {sup 133}Cs in He, Ne, and N{sub 2} were linear with pressure.« less

  5. Enhancement of Chiroptical Signals by Circular Differential Mie Scattering of Nanoparticles.

    PubMed

    Yoo, SeokJae; Park, Q-Han

    2015-09-25

    We enhance the weak optical signals of small chiral molecules via circular differential Mie scattering (CDMS) of nanoparticles immersed in them. CDMS is the preferential Mie scattering of left- and right-handed circularly polarized light by nanoparticles whose sizes are about the same as the wavelength of light. Solving the Mie scattering theory for chiral media, we find that the CDMS signal of the particle is linearly proportional to the chirality parameter κ of the molecules. This linear amplitude enhancement by CDMS of the particle holds, even for large particles, which have a retardation effect. We also demonstrate that the CDMS of a nanoparticle is sensitive to changes of molecular concentration, and that the nanoparticle can be utilized as a chiroptical biosensor detecting the concentration of analyte. We expect that the enhancement of molecular chiroptical signals by CDMS will pave the way for novel chiroptical spectroscopy using nanostructures.

  6. Establishing linear solvation energy relationships between VOCs and monolayer-protected gold nanoclusters using quartz crystal microbalance.

    PubMed

    Li, Chi-Lin; Lu, Chia-Jung

    2009-08-15

    Linear solvation energy relationships (LSERs) have been recognized as a useful model for investigating the chemical forces behind the partition coefficients between vapor molecules and absorbents. This study is the first to determine the solvation properties of monolayer-protected gold nanoclusters (MPCs) with different surface ligands. The ratio of partition coefficients/MPC density (K/rho) of 18 volatile organic compounds (VOCs) for four different MPCs obtained through quartz crystal microbalance (QCM) experiments were used for the LSER model calculations. LSER modeling results indicate that all MPC surfaces showed a statistically significant (p<0.05) preference to hydrogen-bond acidic molecules. Through dipole-dipole attraction, 4-methoxythiophenol-capped MPCs can also interact with polar organics (s=1.04). Showing a unique preference for the hydrogen bond basicity of vapors (b=1.11), 2-benzothiazolethiol-capped MPCs provide evidence of an intra-molecular, proton-shift mechanism on surface of nano-gold.

  7. Linear free-energy relationships between a single gas-phase ab initio equilibrium bond length and experimental pKa values in aqueous solution.

    PubMed

    Alkorta, Ibon; Popelier, Paul L A

    2015-02-02

    Remarkably simple yet effective linear free energy relationships were discovered between a single ab initio computed bond length in the gas phase and experimental pKa values in aqueous solution. The formation of these relationships is driven by chemical features such as functional groups, meta/para substitution and tautomerism. The high structural content of the ab initio bond length makes a given data set essentially divide itself into high correlation subsets (HCSs). Surprisingly, all molecules in a given high correlation subset share the same conformation in the gas phase. Here we show that accurate pKa values can be predicted from such HCSs. This is achieved within an accuracy of 0.2 pKa units for 5 drug molecules. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Differentiation of regioisomeric aromatic ketocarboxylic acids by atmospheric pressure chemical ionization CAD tandem mass spectrometry in a linear quadrupole ion trap mass spectrometer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Amundson, Lucas M.; Owen, Ben C.; Gallardo, Vanessa A.

    2011-01-01

    Positive-mode atmospheric pressure chemical ionization tandem mass spectrometry (APCI-MS n ) was tested for the differentiation of regioisomeric aromatic ketocarboxylic acids. Each analyte forms exclusively an abundant protonated molecule upon ionization via positive-mode APCI in a commercial linear quadrupole ion trap (LQIT) mass spectrometer. Energy-resolved collision-activated dissociation (CAD) experiments carried out on the protonated analytes revealed fragmentation patterns that varied based on the location of the functional groups. Unambiguous differentiation between the regioisomers was achieved in each case by observing different fragmentation patterns, different relative abundances of ion-molecule reaction products, or different relative abundances of fragment ions formed at differentmore » collision energies. The mechanisms of some of the reactions were examined by H/D exchange reactions and molecular orbital calculations.« less

  9. Interpreting linear support vector machine models with heat map molecule coloring

    PubMed Central

    2011-01-01

    Background Model-based virtual screening plays an important role in the early drug discovery stage. The outcomes of high-throughput screenings are a valuable source for machine learning algorithms to infer such models. Besides a strong performance, the interpretability of a machine learning model is a desired property to guide the optimization of a compound in later drug discovery stages. Linear support vector machines showed to have a convincing performance on large-scale data sets. The goal of this study is to present a heat map molecule coloring technique to interpret linear support vector machine models. Based on the weights of a linear model, the visualization approach colors each atom and bond of a compound according to its importance for activity. Results We evaluated our approach on a toxicity data set, a chromosome aberration data set, and the maximum unbiased validation data sets. The experiments show that our method sensibly visualizes structure-property and structure-activity relationships of a linear support vector machine model. The coloring of ligands in the binding pocket of several crystal structures of a maximum unbiased validation data set target indicates that our approach assists to determine the correct ligand orientation in the binding pocket. Additionally, the heat map coloring enables the identification of substructures important for the binding of an inhibitor. Conclusions In combination with heat map coloring, linear support vector machine models can help to guide the modification of a compound in later stages of drug discovery. Particularly substructures identified as important by our method might be a starting point for optimization of a lead compound. The heat map coloring should be considered as complementary to structure based modeling approaches. As such, it helps to get a better understanding of the binding mode of an inhibitor. PMID:21439031

  10. Spectroscopic properties of Arx-Zn and Arx-Ag+ (x = 1,2) van der Waals complexes

    NASA Astrophysics Data System (ADS)

    Oyedepo, Gbenga A.; Peterson, Charles; Schoendorff, George; Wilson, Angela K.

    2013-03-01

    Potential energy curves have been constructed using coupled cluster with singles, doubles, and perturbative triple excitations (CCSD(T)) in combination with all-electron and pseudopotential-based multiply augmented correlation consistent basis sets [m-aug-cc-pV(n + d)Z; m = singly, doubly, triply, n = D,T,Q,5]. The effect of basis set superposition error on the spectroscopic properties of Ar-Zn, Ar2-Zn, Ar-Ag+, and Ar2-Ag+ van der Waals complexes was examined. The diffuse functions of the doubly and triply augmented basis sets have been constructed using the even-tempered expansion. The a posteriori counterpoise scheme of Boys and Bernardi and its generalized variant by Valiron and Mayer has been utilized to correct for basis set superposition error (BSSE) in the calculated spectroscopic properties for diatomic and triatomic species. It is found that even at the extrapolated complete basis set limit for the energetic properties, the pseudopotential-based calculations still suffer from significant BSSE effects unlike the all-electron basis sets. This indicates that the quality of the approximations used in the design of pseudopotentials could have major impact on a seemingly valence-exclusive effect like BSSE. We confirm the experimentally determined equilibrium internuclear distance (re), binding energy (De), harmonic vibrational frequency (ωe), and C1Π ← X1Σ transition energy for ArZn and also predict the spectroscopic properties for the low-lying excited states of linear Ar2-Zn (X1Σg, 3Πg, 1Πg), Ar-Ag+ (X1Σ, 3Σ, 3Π, 3Δ, 1Σ, 1Π, 1Δ), and Ar2-Ag+ (X1Σg, 3Σg, 3Πg, 3Δg, 1Σg, 1Πg, 1Δg) complexes, using the CCSD(T) and MR-CISD + Q methods, to aid in their experimental characterizations.

  11. Insight of endo-1,4-xylanase II from Trichoderma reesei: conserved water-mediated H-bond and ion pairs interactions.

    PubMed

    Vijayakumar, Balakrishnan; Velmurugan, Devadasan

    2013-12-01

    Endo-1,4-Xylanase II is an enzyme which degrades the linear polysaccharide beta-1,4-xylan into xylose. This enzyme shows highest enzyme activity around 55 °C, even without being stabilized by the disulphide bridges. A set of nine high resolution crystal structures of Xylanase II (1.11-1.80 Å) from Trichoderma reesei were selected and analyzed in order to identify the invariant water molecules, ion pairs and water-mediated ionic interactions. The crystal structure (PDB-id: 2DFB) solved at highest resolution (1.11 Å) was chosen as the reference and the remaining structures were treated as mobile molecules. These structures were then superimposed with the reference molecule to observe the invariant water molecules using 3-dimensional structural superposition server. A total of 37 water molecules were identified to be invariant molecules in all the crystal structures, of which 26 invariant molecules have hydrogen bond interactions with the back bone of residues and 21 invariant water molecules have interactions with side chain residues. The structural and functional roles of these water molecules and ion pairs have been discussed. The results show that the invariant water molecules and ion pairs may be involved in maintaining the structural architecture, dynamics and function of the Endo-1,4-Xylanase II.

  12. Widespread Presence of Glycolaldehyde and Ethylene Glycol around Sagittarius B2

    NASA Astrophysics Data System (ADS)

    Li, Juan; Shen, Zhiqiang; Wang, Junzhi; Chen, Xi; Li, Di; Wu, Yajun; Dong, Jian; Zhao, Rongbing; Gou, Wei; Wang, Jinqing; Li, Shanghuo; Wang, Bingru; Zheng, Xingwu

    2017-11-01

    We report the detection of widespread CH2OHCHO and HOCH2CH2OH emission in Galactic center giant molecular cloud Sagittarius B2 using the Shanghai Tianma 65 m Radio Telescope. Our observations show for the first time that the spatial distribution of these two important prebiotic molecules extends over 15 arcmin, corresponding to a linear size of approximately 36 pc. These two molecules are not just distributed in or near the hot cores. The abundance of these two molecules seems to decrease from the cold outer region to the central region associated with star formation activity. Results presented here suggest that these two molecules are likely to form through a low temperature process. Recent theoretical and experimental studies demonstrated that prebiotic molecules can be efficiently formed in icy grain mantles through several pathways. However, these complex ice features cannot be directly observed, and most constraints on the ice compositions come from millimeter observations of desorbed ice chemistry products. These results, combined with laboratory studies, strongly support the existence of abundant prebiotic molecules in ices.

  13. DFT computational analysis of piracetam

    NASA Astrophysics Data System (ADS)

    Rajesh, P.; Gunasekaran, S.; Seshadri, S.; Gnanasambandan, T.

    2014-11-01

    Density functional theory calculation with B3LYP using 6-31G(d,p) and 6-31++G(d,p) basis set have been used to determine ground state molecular geometries. The first order hyperpolarizability (β0) and related properties (β, α0 and Δα) of piracetam is calculated using B3LYP/6-31G(d,p) method on the finite-field approach. The stability of molecule has been analyzed by using NBO/NLMO analysis. The calculation of first hyperpolarizability shows that the molecule is an attractive molecule for future applications in non-linear optics. Molecular electrostatic potential (MEP) at a point in the space around a molecule gives an indication of the net electrostatic effect produced at that point by the total charge distribution of the molecule. The calculated HOMO and LUMO energies show that charge transfer occurs within these molecules. Mulliken population analysis on atomic charge is also calculated. Because of vibrational analysis, the thermodynamic properties of the title compound at different temperatures have been calculated. Finally, the UV-Vis spectra and electronic absorption properties are explained and illustrated from the frontier molecular orbitals.

  14. Quantitation of protein orientation in flow-oriented unilamellar liposomes by linear dichroism

    NASA Astrophysics Data System (ADS)

    Rajendra, Jascindra; Damianoglou, Angeliki; Hicks, Matthew; Booth, Paula; Rodger, P. Mark; Rodger, Alison

    2006-07-01

    The linear dichroism of the visible wavelength transitions of retinal have been used to analyse linear dichroism spectra to determine the orientation of aromatic and peptide structural motifs of Bacteriorhodopsin incorporated into unilamellar soy bean liposomes. The results are consistent with the available X-ray data. This proves that visible light absorbing chromophores can be used to analyse linear dichroism data to give the orientation of membrane proteins in membrane mimicking environments. The work has been extended by screening a wide range of hydrophobic molecules with high extinction coefficients in transitions above 300 nm to find molecules that could be used as independent probes of liposome orientation for experiments involving proteins incorporated into liposomes. Three probes were found to have potential for future work: bis-(1,3-dibutylbarbituric acid)pentamethine oxonol (DiBAC 4), retinol and rhodamine B. All three can be used to determine the orientation of the porphyrin of cytochrome c, the aromatic residues of gramicidin and the helices of both proteins. The orientation parameter, S, for the liposomes varied from batch to batch of unilamellar liposomes prepared by extruding through a 100 nm membrane. The value and variation in S was 0.030 ± 0.010. Repeat experiments with the same batch of liposomes showed less variation. Film LD data were measured for DiBAC 4 and rhodamine B to determine the polarisations of their long wavelength transitions.

  15. Every Mass or Mass Group When Created Will have No Motion, Linear, Rotational or Vibratory Motion, Singly or in Some Combination, Which May Be Later Modified by External Forces--A Natural Law

    NASA Astrophysics Data System (ADS)

    Brekke, Stewart

    2010-03-01

    Every mass or mass group, from atoms and molecules to stars and galaxies,has no motion, is vibrating, rotating,or moving linearly, singularly or in some combination. When created, the excess energy of creation will generate a vibration, rotation and/or linear motion besides the mass or mass group. Curvilinear or orbital motion is linear motion in an external force field. External forces, such as photon, molecular or stellar collisions may over time modify the inital rotational, vibratory or linear motions of the mass of mass group. The energy equation for each mass or mass group is E=mc^2 + 1/2mv^2 + 1/2I2̂+ 1/2kx0^2 + WG+ WE+ WM.

  16. Lubricating and waxy esters, I. Synthesis, crystallization, and melt behavior of linear monoesters.

    PubMed

    Bouzidi, Laziz; Li, Shaojun; Di Biase, Steve; Rizvi, Syed Q; Narine, Suresh S

    2012-01-01

    Four pure jojoba wax-like esters (JLEs), having carbon chain length of 36, 40 (two isomers) and 44, were prepared by Steglish esterification of fatty acids (or acid chlorides) with fatty alcohols at room temperature. Calorimetric and diffraction data was used to elucidate the phase behavior of the esters. The primary thermal parameters (crystallization and melting temperatures) obtained from the DSC of the symmetrical molecules correspond well with the carbon numbers of the JLEs. However, the data also suggests that carbon number is not the only factor since the symmetry of the molecule also plays a significant role in the phase behavior. Overall, the JLEs show very little polymorphic activity at the experimental conditions used, suggesting that they are likely to transform the same way during melting as well as crystallization, a characteristic which may be useful in designing new waxes and lubricants. The XRD data clearly show that the solid phase in all samples consists of a mixture of a β-phase and a β'-phase; fully distinguishable by their characteristic diffraction peaks. Subtle differences between the subcell patterns and phase development of the samples were observed. Different layering of the samples was also observed, understandably because of the chain length differences between the compounds. The long spacings were perfectly linearly proportional to the number of carbon atoms. The length of the ester layers with n carbon atoms can be calculated by a formula similar to that used for the layers in linear alkane molecules. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  17. From single molecule to single tubules

    NASA Astrophysics Data System (ADS)

    Guo, Chin-Lin

    2012-02-01

    Biological systems often make decisions upon conformational changes and assembly of single molecules. In vivo, epithelial cells (such as the mammary gland cells) can respond to extracellular matrix (ECM) molecules, type I collagen (COL), and switch their morphology from a lobular lumen (100-200 micron) to a tubular lumen (1mm-1cm). However, how cells make such a morphogenetic decision through interactions with each other and with COL is unclear. Using a temporal control of cell-ECM interaction, we find that epithelial cells, in response to a fine-tuned percentage of type I collagen (COL) in ECM, develop various linear patterns. Remarkably, these patterns allow cells to self-assemble into a tubule of length ˜ 1cm and diameter ˜ 400 micron in the liquid phase (i.e., scaffold-free conditions). In contrast with conventional thought, the linear patterns arise through bi-directional transmission of traction force, but not through diffusible biochemical factors secreted by cells. In turn, the transmission of force evokes a long-range (˜ 600 micron) intercellular mechanical interaction. A feedback effect is encountered when the mechanical interaction modifies cell positioning and COL alignment. Micro-patterning experiments further reveal that such a feedback is a novel cell-number-dependent, rich-get-richer process, which allows cells to integrate mechanical interactions into long-range (> 1mm) linear coordination. Our results suggest a mechanism cells can use to form and coordinate long-range tubular patterns, independent of those controlled by diffusible biochemical factors, and provide a new strategy to engineer/regenerate epithelial organs using scaffold-free self-assembly methods.

  18. Erythrocyte interactions - Comparison of the aggregation power of polymer molecules used in medicine - Not only size does matter.

    PubMed

    Jovtchev, S; Alexandrov, S; Hristova-Avakumova, N; Miteva, S; Traikov, L; Gerasimova, D; Stoeff, S

    2016-01-01

    Different colloids are used as a part of solutions for fluid resuscitation and organ preservation: hydroxyethyl starches (HES), dextran (Dx), polyethylene glycols (PEG), polyvinyl pyrrolidone (PVP). Some of the problems associated with their application are addressed to alteration in erythrocyte (ERY) rheology. We intended to estimate in vitro and compare the aggregation power (AP) of these molecules related to ERY interactions. Washed human ERY are used during the study. The zeta sedimentation technique is used to quantify the cell aggregation. Zeta sedimentation ratio (ZSR) based indices (AI) are calculated. The hydrodynamic radius (Rh) of the polymer molecules is determined using viscometry. For all polymers tested a linear range in the relationship AI - concentration was found. The slope of the calculated line was interpreted as measure of the molecule's AP. The following ranking was obtained: PEG >PVP >DX >HES. Within the same chemical type of polymer, increasing Rh of the molecules leads to elevated AI. Comparison of the AP of molecules with similar Rh reveals a significant dependence on their chemical nature. Our results show that molecule's AP is significantly dependent on their chemical nature - i.e. not only molecular size does matter.

  19. Molecular electronics--resonant transport through single molecules.

    PubMed

    Lörtscher, Emanuel; Riel, Heike

    2010-01-01

    The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.

  20. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    NASA Astrophysics Data System (ADS)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  1. A Computational Study of the Rheology and Structure of Surfactant Covered Droplets

    NASA Astrophysics Data System (ADS)

    Maia, Joao; Boromand, Arman; Jamali, Safa

    2015-11-01

    The use of different types of surface-active agents is ubiquitous practice in different industrial applications ranging from cosmetic and food industries to polymeric nano-composite and blends. This allows stable multiphasic systems like foams and emulsions to be produced. Stability and shelf-life of those products are directly determined by the efficiency of the surfactant molecules. Although the effect of molecular configuration of the surface-active molecules on the planar interfaces has been studied both experimentally and computationally, it remains challenging to track the efficiency and effectiveness of different surfactant molecules on curved interfaces. In this study we address this gap by using Dissipative Particle Dynamics, to study the effectiveness and efficiency of different surfactant molecules (linear vs. branched) on a curved interface in equilibrium and far from equilibrium. In particular, we are interested to relate interfacial properties of the surface covered droplets and its dynamics to the molecular configuration of the surface active molecules under equilibrium and far from equilibrium condition.

  2. Hydrogen-bonded complexes between dimethyl sulfoxide and monoprotic acids: molecular properties and IR spectroscopy.

    PubMed

    Belarmino, Márcia K D L; Cruz, Vanessa F; Lima, Nathália B D

    2014-11-01

    MP2/6-31++G(d,p) and DFT B3LYP/6-31++G(d,p) calculations were performed of the structure, binding energies, and vibrational modes of complexes between dimethyl sulfoxide (DMSO) as a proton acceptor and monoprotic linear acids HX (X = F, Cl, CN) as well as monoprotic carboxylic acids HOOCR (R = -H, -CH3, -C6H5) in 1:1 and 1:2 stoichiometric ratios. The results show that two different structures are possible in the 1:2 ratio: in the first, the DMSO molecule interacts with both acid molecules (leading to a "Y" structure); in the second, the DMSO interacts with only one monoprotic acid. The second structure shows a lower stability per hydrogen bond. The spontaneities of the reactions to form the 1:1 and 1:2 complexes are greatly influenced by the X group of the linear acid. With the exception of HCN, all the reactions are spontaneous. In the 1:2 complexes with Y structure, we observed that the hydrogen atoms of the linear acid are coupled in symmetric and asymmetric modes, while this type of coupling is absent from the other 1:2 complexes.

  3. Antibacterial Synthetic Peptides Derived from Bovine Lactoferricin Exhibit Cytotoxic Effect against MDA-MB-468 and MDA-MB-231 Breast Cancer Cell Lines.

    PubMed

    Vargas Casanova, Yerly; Rodríguez Guerra, Jorge Antonio; Umaña Pérez, Yadi Adriana; Leal Castro, Aura Lucía; Almanzar Reina, Giovanni; García Castañeda, Javier Eduardo; Rivera Monroy, Zuly Jenny

    2017-09-29

    Linear, dimeric, tetrameric, and cyclic peptides derived from lactoferricin B, containing the RRWQWR motif, were designed, synthesized, purified, and characterized using RP-HPLC chromatography and MALDI-TOF mass spectrometry. The antibacterial activity of the designed peptides against E. coli (ATCC 11775 and 25922) and their cytotoxic effect against MDA-MB-468 and MDA-MB-231 breast cancer cell lines were evaluated. Dimeric and tetrameric peptides showed higher antibacterial activity in both bacteria strains than linear peptides. The dimeric peptide (RRWQWR)₂K-Ahx exhibited the highest antibacterial activity against the tested bacterial strains. Furthermore, the peptides with high antibacterial activity exhibited significant cytotoxic effect against the tested breast cancer cell lines. This cytotoxic effect was fast and dependent on the peptide concentration. The tetrameric molecule containing RRWQWR motif has an optimal cytotoxic effect at a concentration of 22 µM. The evaluated dimeric and tetrameric peptides could be considered as candidates for developing new therapeutic agents against breast cancer. Polyvalence of linear sequences could be considered as a novel and versatile strategy for obtaining molecules with high anticancer activity.

  4. Radiative Enhancement of Linear and Third-Order Vibrational Excitations by an Array of Infrared Plasmonic Antennas.

    PubMed

    Gandman, Andrey; Mackin, Robert T; Cohn, Bar; Rubtsov, Igor V; Chuntonov, Lev

    2018-05-22

    Infrared gold antennas localize enhanced near fields close to the metal surface, when excited at the frequency of their plasmon resonance, and amplify vibrational signals from the nearby molecules. We study the dependence of the signal enhancement on the thickness of a polymer film containing vibrational chromophores, deposited on the antenna array, using linear (FTIR) and third-order femtosecond vibrational spectroscopy (transient absorption and 2DIR). Our results show that for a film thickness beyond only a few nanometers the near-field interaction is not sufficient to account for the magnitude of the observed signal, which nevertheless has a clear Fano line shape, suggesting a radiative origin of the molecule-plasmon interaction. The mutual radiative damping of plasmonic and molecular transitions leads to the spectroscopic signal of a molecular vibrational excitation to be enhanced by up to a factor of 50 in the case of linear spectroscopy and over 2000 in the case of third-order spectroscopy. A qualitative explanation for the observed effect is given by the extended coupled oscillators model, which takes into account both near-field and radiative interactions between the plasmonic and molecular transitions.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perera, Aurélien; Mazighi, Redha

    Computer simulation studies of aqueous dimethyl sulfoxyde (DMSO) mixtures show micro-heterogeneous structures, just like aqueous alcohol mixtures. However, there is a marked difference in the aggregate structure of water between the two types of systems. While water molecules form multiconnected globular clusters in alcohols, we report herein that the typical water aggregates in aqueous DMSO mixtures are linear, favouring a 2 hydrogen bond structure per water molecule, and for all DMSO mole fractions ranging from 0.1 to 0.9. This linear-aggregate structure produces a particular signature in the water site-site structure factors, in the form of a pre-peak at k ≈more » 0.2–0.8 Å{sup −1}, depending on DMSO concentration. This pre-peak is either absent in other aqueous mixtures, such as aqueous methanol mixtures, or very difficult to see through computer simulations, such as in aqueous-t-butanol mixtures. This difference in the topology of the aggregates explains why the Kirkwood-Buff integrals of aqueous-DMSO mixture look nearly ideal, in contrast with those of aqueous alcohol mixtures, suggesting a connection between the shape of the water aggregates, its fluctuations, and the concentration fluctuations. In order to further study this discrepancy between aqueous DMSO and aqueous alcohol mixture, two models of pseudo-DMSO are introduced, where the size of the sulfur atom is increased by a factor 1.6 and 1.7, respectively, hence increasing the hydrophobicity of the molecule. The study shows that these mixtures become closer to the emulsion type seen in aqueous alcohol mixtures, with more globular clustering of the water molecules, long range domain oscillations in the water-water correlations and increased water-water Kirkwood-Buff integrals. It demonstrates that the local ordering of the water molecules is influenced by the nature of the solute molecules, with very different consequences for structural properties and related thermodynamic quantities. This study illustrates the unique plasticity of water in presence of different types of solutes.« less

  6. Structural characterization of alpha-terminal group of natural rubber. 2. Decomposition of branch-points by phospholipase and chemical treatments.

    PubMed

    Tarachiwin, Lucksanaporn; Sakdapipanich, Jitladda; Ute, Koichi; Kitayama, Tatsuki; Tanaka, Yasuyuki

    2005-01-01

    The treatment of deproteinized natural rubber (DPNR) latex with phospholipases A(2), B, C, and D decreased significantly the long-chain fatty acid ester contents in DPNR and also the molecular weight and Higgins' k' constant, except for phospholipase D treatment. This indicates the presence of phospholipid molecules in NR, which combine rubber molecules together. Transesterification of DPNR resulted in the decomposition of the functional group at the terminal chain-end (alpha-terminal), including phospholipids and formed linear rubber molecules. The addition of small amounts of ethanol into the DPNR solution reduced the molecular weight and shifted the molecular weight distribution (MWD) comparable to that of transesterified DPNR (TE-DPNR). The addition of diammonium hydrogen phosphate into DPNR-latex in order to remove Mg2+ ions yielded a slight decrease in molecular weight and a slight shift in MWD. The phospholipids are expected to link with mono- and diphosphate groups at the alpha-terminal by hydrogen bonding and/or ionic linkages. The decrease in the molecular weight and Huggins' k' constant of DPNR demonstrates the formation of linear molecules after decomposition of branch-points by this treatment, showing that phospholipids participate in the branching formation of NR. The branch-points formed at the alpha-terminus are postulated to originate predominantly by the association of phospholipids via micelle formation of long-chain fatty acid esters and hydrogen bonding between polar headgroups of phospholipids.

  7. Excited-state potential-energy surfaces of metal-adsorbed organic molecules from linear expansion Δ-self-consistent field density-functional theory (ΔSCF-DFT).

    PubMed

    Maurer, Reinhard J; Reuter, Karsten

    2013-07-07

    Accurate and efficient simulation of excited state properties is an important and much aspired cornerstone in the study of adsorbate dynamics on metal surfaces. To this end, the recently proposed linear expansion Δ-self-consistent field method by Gavnholt et al. [Phys. Rev. B 78, 075441 (2008)] presents an efficient alternative to time consuming quasi-particle calculations. In this method, the standard Kohn-Sham equations of density-functional theory are solved with the constraint of a non-equilibrium occupation in a region of Hilbert-space resembling gas-phase orbitals of the adsorbate. In this work, we discuss the applicability of this method for the excited-state dynamics of metal-surface mounted organic adsorbates, specifically in the context of molecular switching. We present necessary advancements to allow for a consistent quality description of excited-state potential-energy surfaces (PESs), and illustrate the concept with the application to Azobenzene adsorbed on Ag(111) and Au(111) surfaces. We find that the explicit inclusion of substrate electronic states modifies the topologies of intra-molecular excited-state PESs of the molecule due to image charge and hybridization effects. While the molecule in gas phase shows a clear energetic separation of resonances that induce isomerization and backreaction, the surface-adsorbed molecule does not. The concomitant possibly simultaneous induction of both processes would lead to a significantly reduced switching efficiency of such a mechanism.

  8. Aligned 1-D nanorods of a π-gelator exhibit molecular orientation and excitation energy transport different from entangled fiber networks.

    PubMed

    Sakakibara, Keita; Chithra, Parayalil; Das, Bidisa; Mori, Taizo; Akada, Misaho; Labuta, Jan; Tsuruoka, Tohru; Maji, Subrata; Furumi, Seiichi; Shrestha, Lok Kumar; Hill, Jonathan P; Acharya, Somobrata; Ariga, Katsuhiko; Ajayaghosh, Ayyappanpillai

    2014-06-18

    Linear π-gelators self-assemble into entangled fibers in which the molecules are arranged perpendicular to the fiber long axis. However, orientation of gelator molecules in a direction parallel to the long axes of the one-dimensional (1-D) structures remains challenging. Herein we demonstrate that, at the air-water interface, an oligo(p-phenylenevinylene)-derived π-gelator forms aligned nanorods of 340 ± 120 nm length and 34 ± 5 nm width, in which the gelator molecules are reoriented parallel to the long axis of the rods. The orientation change of the molecules results in distinct excited-state properties upon local photoexcitation, as evidenced by near-field scanning optical microscopy. A detailed understanding of the mechanism by which excitation energy migrates through these 1-D molecular assemblies might help in the design of supramolecular structures with improved charge-transport properties.

  9. Influence of intrinsic decoherence on tripartite entanglement and bipartite fidelity of polar molecules in pendular states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Jia-Xing; Hu, Yuan; Jin, Yu

    An array of ultracold polar molecules trapped in an external electric field is regarded as a promising carrier of quantum information. Under the action of this field, molecules are compelled to undergo pendular oscillations by the Stark effect. Particular attention has been paid to the influence of intrinsic decoherence on the model of linear polar molecular pendular states, thereby we evaluate the tripartite entanglement with negativity, as well as fidelity of bipartite quantum systems for input and output signals using electric dipole moments of polar molecules as qubits. According to this study, we consider three typical initial states for bothmore » systems, respectively, and investigate the temporal evolution with variable values of the external field intensity, the intrinsic decoherence factor, and the dipole-dipole interaction. Thus, we demonstrate the sound selection of these three main parameters to obtain the best entanglement degree and fidelity.« less

  10. Theoretical study of electron transport along self-assembled graphitic nanowires

    NASA Astrophysics Data System (ADS)

    Paulsson, Magnus; Stafström, Sven

    2000-11-01

    Electron transport through stacks of polyaromatic hydrocarbons is studied theoretically using the Landauer formalism. The polyaromatic hydrocarbons can be synthesized in many different sizes and can form molecular stacks with a varying number of molecules and with a rather strong π-overlap along the stack. This allows for a large flexibility in the nanostructure of these materials and makes it possible to study the variation in the conductance with a number of different factors: a near-linear increase in the conductance as a function of the number of atoms in the individual molecule is observed. Furthermore, the conductance drops exponentially with the number of molecules in the stacks, from which it follows that an increase in the intermolecular hopping results in an increase in the conductance which is proportional to the intermolecular hopping to the power of 2(N-1), where N is the number of molecules in the stack.

  11. Improving the first hyperpolarizability of anthracene through interaction with HX molecules (Xdbnd F, Cl, Br): A theoretical study

    NASA Astrophysics Data System (ADS)

    Abdolmaleki, Ahmad; Dadsetani, Mehrdad; Zabardasti, Abedin

    2018-05-01

    The variations in nonlinear optical activity (NLO) of anthracene (C14H10) was investigated via intermolecular interactions between C14H10 and HX molecules (Xdbnd F, Cl and Br) using B3LYP-D3 method at 6-311++G(d,p) basis set. The stabilization of those complexes was investigated via vibrational analysis, quantum theory of atoms in molecules, molecular electrostatic potential, natural bond orbitals and symmetry-adapted perturbation theory (SAPT) analysis. Furthermore, the optical spectra and the first hyperpolarizabilities of C14H10⋯HX complexes were computed. The adsorption of hydrogen halide through C14H10⋯HX complex formation, didn't change much the linear optical activities of C14H10 molecule, but the magnitude of the first hyperpolarizability of the C14H10⋯HX complexes to be as much as that of urea.

  12. Influence of intrinsic decoherence on tripartite entanglement and bipartite fidelity of polar molecules in pendular states.

    PubMed

    Han, Jia-Xing; Hu, Yuan; Jin, Yu; Zhang, Guo-Feng

    2016-04-07

    An array of ultracold polar molecules trapped in an external electric field is regarded as a promising carrier of quantum information. Under the action of this field, molecules are compelled to undergo pendular oscillations by the Stark effect. Particular attention has been paid to the influence of intrinsic decoherence on the model of linear polar molecular pendular states, thereby we evaluate the tripartite entanglement with negativity, as well as fidelity of bipartite quantum systems for input and output signals using electric dipole moments of polar molecules as qubits. According to this study, we consider three typical initial states for both systems, respectively, and investigate the temporal evolution with variable values of the external field intensity, the intrinsic decoherence factor, and the dipole-dipole interaction. Thus, we demonstrate the sound selection of these three main parameters to obtain the best entanglement degree and fidelity.

  13. Synthesis and spectral characterization of hydrazone derivative of furfural using experimental and DFT methods.

    PubMed

    Babu, N Ramesh; Subashchandrabose, S; Ali Padusha, M Syed; Saleem, H; Erdoğdu, Y

    2014-01-01

    The Spectral Characterization of (E)-1-(Furan-2-yl) methylene)-2-(1-phenylvinyl) hydrazine (FMPVH) were carried out by using FT-IR, FT-Raman and UV-Vis., Spectrometry. The B3LYP/6-311++G(d,p) level of optimization has been performed on the title compound. The conformational analysis was performed for this molecule, in which the cis and trans conformers were studied for spectral characterization. The recorded spectral results were compared with calculated results. The optimized bond parameters of FMPVH molecule was compared with X-ray diffraction data of related molecule. To study the intra-molecular charge transfers within the molecule the Lewis (bonding) and Non-Lewis (anti-bonding) structural calculation was performed. The Non-linear optical behavior of the title compound was measured using first order hyperpolarizability calculation. The atomic charges were calculated and analyzed. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Ferroelectric nanotraps for polar molecules

    NASA Astrophysics Data System (ADS)

    Dutta, Omjyoti; Giedke, G.

    2018-02-01

    We propose and analyze an electrostatic-optical nanoscale trap for cold diatomic polar molecules. The main ingredient of our proposal is a square array of ferroelectric nanorods with alternating polarization. We show that, in contrast to electrostatic traps using the linear Stark effect, a quadratic Stark potential supports long-lived trapped states. The molecules are kept at a fixed height from the nanorods by a standing-wave optical dipole trap. For the molecules and materials considered, we find nanotraps with trap frequency up to 1 MHz, ground-state width ˜20 nm with lattice periodicity of ˜200 nm . Analyzing the loss mechanisms due to nonadiabaticity, surface-induced radiative transitions, and laser-induced transitions, we show the existence of trapped states with lifetime ˜1 s , competitive with current traps created via optical mechanisms. As an application we extend our discussion to a one-dimensional (1D) array of nanotraps to simulate a long-range spin Hamiltonian in our structure.

  15. Measurement of the orientation of buffer-gas-cooled, electrostatically-guided ammonia molecules

    NASA Astrophysics Data System (ADS)

    Steer, Edward W.; Petralia, Lorenzo S.; Western, Colin M.; Heazlewood, Brianna R.; Softley, Timothy P.

    2017-02-01

    The extent to which the spatial orientation of internally and translationally cold ammonia molecules can be controlled as molecules pass out of a quadrupole guide and through different electric field regions is examined. Ammonia molecules are collisionally cooled in a buffer gas cell, and are subsequently guided by a three-bend electrostatic quadrupole into a detection chamber. The orientation of ammonia molecules is probed using (2 + 1) resonance-enhanced multiphoton ionisation (REMPI), with the laser polarisation axis aligned both parallel and perpendicular to the time-of-flight axis. Even with the presence of a near-zero field region, the ammonia REMPI spectra indicate some retention of orientation. Monte Carlo simulations propagating the time-dependent Schrödinger equation in a full basis set including the hyperfine interaction enable the orientation of ammonia molecules to be calculated - with respect to both the local field direction and a space-fixed axis - as the molecules pass through different electric field regions. The simulations indicate that the orientation of ∼95% of ammonia molecules in JK =11 could be achieved with the application of a small bias voltage (17 V) to the mesh separating the quadrupole and detection regions. Following the recent combination of the buffer gas cell and quadrupole guide apparatus with a linear Paul ion trap, this result could enable one to examine the influence of molecular orientation on ion-molecule reaction dynamics and kinetics.

  16. Efficient hybrid-symbolic methods for quantum mechanical calculations

    NASA Astrophysics Data System (ADS)

    Scott, T. C.; Zhang, Wenxing

    2015-06-01

    We present hybrid symbolic-numerical tools to generate optimized numerical code for rapid prototyping and fast numerical computation starting from a computer algebra system (CAS) and tailored to any given quantum mechanical problem. Although a major focus concerns the quantum chemistry methods of H. Nakatsuji which has yielded successful and very accurate eigensolutions for small atoms and molecules, the tools are general and may be applied to any basis set calculation with a variational principle applied to its linear and non-linear parameters.

  17. International Conference on Quantum Chemical Calculations of NMR and EPR Parameters Held in Castle Smolenice, Slovak Republic on September 14-18 1998

    DTIC Science & Technology

    1998-10-21

    site. The electric-field- induced linear shift is also observed in the hyperfine splitting of nuclear quadrupole resonance ( NQR ) spectrum of a nucleus...located at a noncentrosymmetric site in a molecule or in crystal lattice. Thus, the linear electric field effect on the ESR and NQR hyperfine splitting...the electric field effects on ESR and NQR hyperfine couplings. Theoretical methods to calculate the electric field effects within Hartree-Fock

  18. Linear Scaling Density Functional Calculations with Gaussian Orbitals

    NASA Technical Reports Server (NTRS)

    Scuseria, Gustavo E.

    1999-01-01

    Recent advances in linear scaling algorithms that circumvent the computational bottlenecks of large-scale electronic structure simulations make it possible to carry out density functional calculations with Gaussian orbitals on molecules containing more than 1000 atoms and 15000 basis functions using current workstations and personal computers. This paper discusses the recent theoretical developments that have led to these advances and demonstrates in a series of benchmark calculations the present capabilities of state-of-the-art computational quantum chemistry programs for the prediction of molecular structure and properties.

  19. Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

    PubMed

    Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

    2013-01-01

    We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

  20. Langevin and Fokker-Planck analyses of inhibited molecular passing processes controlling transport and reactivity in nanoporous materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Chi-Jen; Ackerman, David M.; Slowing, Igor I.

    2014-07-14

    Inhibited passing of reactant and product molecules within the linear pores of nanoporous catalytic materials strongly reduces reactivity. The dependence of the passing propensity P on pore radius R is analyzed utilizing Langevin dynamics to account for solvent effects. We find that P~(R-R c) σ, where passing is sterically blocked for R≤R c, with σ below the transition state theory value. Deeper insight comes from analysis of the corresponding high-dimensional Fokker-Planck equation, which facilitates an effective small-P approximation, and dimensional reduction enabling utilization of conformal mapping ideas. We analyze passing for spherical molecules and also assess the effect of rotationalmore » degrees of freedom for elongated molecules.« less

  1. QSAR study of curcumine derivatives as HIV-1 integrase inhibitors.

    PubMed

    Gupta, Pawan; Sharma, Anju; Garg, Prabha; Roy, Nilanjan

    2013-03-01

    A QSAR study was performed on curcumine derivatives as HIV-1 integrase inhibitors using multiple linear regression. The statistically significant model was developed with squared correlation coefficients (r(2)) 0.891 and cross validated r(2) (r(2) cv) 0.825. The developed model revealed that electronic, shape, size, geometry, substitution's information and hydrophilicity were important atomic properties for determining the inhibitory activity of these molecules. The model was also tested successfully for external validation (r(2) pred = 0.849) as well as Tropsha's test for model predictability. Furthermore, the domain analysis was carried out to evaluate the prediction reliability of external set molecules. The model was statistically robust and had good predictive power which can be successfully utilized for screening of new molecules.

  2. Effect of multi-dimensional ultraviolet light exposure on the growth of pentacene film and application to organic field-effect transistors.

    PubMed

    Bae, Jin-Hyuk; Lee, Sin-Doo; Choi, Jong Sun; Park, Jaehoon

    2012-05-01

    We report on the multi-dimensional alignment of pentacene molecules on a poly(methyl methacrylate)-based photosensitive polymer (PMMA-polymer) and its effect on the electrical performance of the pentacene-based field-effect transistor (FET). Pentacene molecules are shown to be preferentially aligned on the linearly polarized ultraviolet (LPUV)-exposed PMMA-polymer layer, which is contrast to an isotropic alignment on the bare PMMA-polymer layer. Multi-dimensional alignment of pentacene molecules in the film could be achieved by adjusting the direction of LPUV exposed to the PMMA-polymer. The control of pentacene molecular alignment is found to be promising for the field-effect mobility enhancement in the pentacene FET.

  3. [Degradation of p-nitrophenol by high voltage pulsed discharge and ozone processes].

    PubMed

    Pan, Li-li; Yan, Guo-qi; Zheng, Fei-yan; Liang, Guo-wei; Fu, Jian-jun

    2005-11-01

    The vigorous oxidation by ozone and the high energy by pulsed discharge are utilized to degrade the big hazardous molecules. And these big hazardous molecules become small and less hazardous by this process in order to improve the biodegradability. When pH value is 8-9, the concentration of p-nitrophenol solution can be degraded by 96.8% and the degradation efficiency of TOC is 38.6% by ozone and pulsed discharge treatment for 30 mins. The comparison results show that the combination treatment efficiency is higher than the separate, so the combination of ozone and pulsed discharge has high synergism. It is approved that the phenyl degradation efficiency is high and the degradation efficiency of linear molecules is relative low.

  4. Patterning nanowire and micro-nanoparticle array on micropillar-structured surface: Experiment and modeling.

    PubMed

    Lin, Chung Hsun; Guan, Jingjiao; Chau, Shiu Wu; Chen, Shia Chung; Lee, L James

    2010-08-04

    DNA molecules in a solution can be immobilized and stretched into a highly ordered array on a solid surface containing micropillars by molecular combing technique. However, the mechanism of this process is not well understood. In this study, we demonstrated the generation of DNA nanostrand array with linear, zigzag, and fork-zigzag patterns and the microfluidic processes are modeled based on a deforming body-fitted grid approach. The simulation results provide insights for explaining the stretching, immobilizing, and patterning of DNA molecules observed in the experiments.

  5. Single ricin detection by atomic force microscopy chemomechanical mapping

    NASA Astrophysics Data System (ADS)

    Chen, Guojun; Zhou, Jianfeng; Park, Bosoon; Xu, Bingqian

    2009-07-01

    The authors report on a study of detecting ricin molecules immobilized on chemically modified Au (111) surface by chemomechanically mapping the molecular interactions with a chemically modified atomic force microscopy (AFM) tip. AFM images resolved the different fold-up conformations of single ricin molecule as well as their intramolecule structure of A- and B-chains. AFM force spectroscopy study of the interaction indicates that the unbinding force has a linear relation with the logarithmic force loading rate, which agrees well with calculations using one-barrier bond dissociation model.

  6. Solitons in a nonlinear model of spin transport in helical molecules

    NASA Astrophysics Data System (ADS)

    Albares, P.; Díaz, E.; Cerveró, Jose M.; Domínguez-Adame, F.; Diez, E.; Estévez, P. G.

    2018-02-01

    We study an effective integrable nonlinear model describing an electron moving along the axis of a deformable helical molecule. The helical conformation of dipoles in the molecular backbone induces an unconventional Rashba-like interaction that couples the electron spin with its linear momentum. In addition, a focusing nonlinearity arises from the electron-lattice interaction, enabling the formation of a variety of stable solitons such as bright solitons, breathers, and rogue waves. A thorough study of the soliton solutions for both focusing and defocusing nonlinear interaction is presented and discussed.

  7. Nonlinear thermoelectric transport in single-molecule junctions: the effect of electron-phonon interactions.

    PubMed

    Zimbovskaya, Natalya A

    2016-07-27

    In this paper, we theoretically analyze steady-state thermoelectric transport through a single-molecule junction with a vibrating bridge. The thermally induced charge current in the system is explored using a nonequilibrium Green function formalism. We study the combined effects of Coulomb interactions between charge carriers on the bridge and electron-phonon interactions on the thermocurrent beyond the linear response regime. It is shown that electron-vibron interactions may significantly affect both the magnitude and the direction of the thermocurrent, and vibrational signatures may appear.

  8. Insights into the Electronic Structure of Ozone and Sulfur Dioxide from Generalized Valence Bond Theory: Addition of Hydrogen Atoms.

    PubMed

    Lindquist, Beth A; Takeshita, Tyler Y; Dunning, Thom H

    2016-05-05

    Ozone (O3) and sulfur dioxide (SO2) are valence isoelectronic species, yet their properties and reactivities differ dramatically. In particular, O3 is highly reactive, whereas SO2 is chemically relatively stable. In this paper, we investigate serial addition of hydrogen atoms to both the terminal atoms of O3 and SO2 and to the central atom of these species. It is well-known that the terminal atoms of O3 are much more amenable to bond formation than those of SO2. We show that the differences in the electronic structure of the π systems in the parent triatomic species account for the differences in the addition of hydrogen atoms to the terminal atoms of O3 and SO2. Further, we find that the π system in SO2, which is a recoupled pair bond dyad, facilitates the addition of hydrogen atoms to the sulfur atom, resulting in stable HSO2 and H2SO2 species.

  9. Computer simulation of surface and film processes

    NASA Technical Reports Server (NTRS)

    Tiller, W. A.; Halicioglu, M. T.

    1984-01-01

    All the investigations which were performed employed in one way or another a computer simulation technique based on atomistic level considerations. In general, three types of simulation methods were used for modeling systems with discrete particles that interact via well defined potential functions: molecular dynamics (a general method for solving the classical equations of motion of a model system); Monte Carlo (the use of Markov chain ensemble averaging technique to model equilibrium properties of a system); and molecular statics (provides properties of a system at T = 0 K). The effects of three-body forces on the vibrational frequencies of triatomic cluster were investigated. The multilayer relaxation phenomena for low index planes of an fcc crystal was analyzed also as a function of the three-body interactions. Various surface properties for Si and SiC system were calculated. Results obtained from static simulation calculations for slip formation were presented. The more elaborate molecular dynamics calculations on the propagation of cracks in two-dimensional systems were outlined.

  10. A MATLAB-based finite-element visualization of quantum reactive scattering. I. Collinear atom-diatom reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warehime, Mick; Alexander, Millard H., E-mail: mha@umd.edu

    We restate the application of the finite element method to collinear triatomic reactive scattering dynamics with a novel treatment of the scattering boundary conditions. The method provides directly the reactive scattering wave function and, subsequently, the probability current density field. Visualizing these quantities provides additional insight into the quantum dynamics of simple chemical reactions beyond simplistic one-dimensional models. Application is made here to a symmetric reaction (H+H{sub 2}), a heavy-light-light reaction (F+H{sub 2}), and a heavy-light-heavy reaction (F+HCl). To accompany this article, we have written a MATLAB code which is fast, simple enough to be accessible to a wide audience,more » as well as generally applicable to any problem that can be mapped onto a collinear atom-diatom reaction. The code and user's manual are available for download from http://www2.chem.umd.edu/groups/alexander/FEM.« less

  11. Iron and molecular opacities and the evolution of Population I stars

    NASA Technical Reports Server (NTRS)

    Stothers, Richard B.; Chin, Chao-Wen

    1993-01-01

    Effects of recent opacity revisions on the evolution of Population I stars are explored over the range 1.5-60 solar masses. Opacity parameters considered include the angular momentum coupling scheme for iron, the relative iron abundance, the total metal abundance, and diatomic and triatomic molecular sources. Only the total metal abundance exerts an important control over the evolutionary tracks. Blue loops on the H-R diagram during core helium burning can be very sensitive to opacity, but only insofar as the simple formation or suppression of a blue loop is concerned. The blue loops are most robust for stellar masses around 10 solar masses. We confirm, from a comparison of stellar models with observational data, that the total metal abundance is close to solar and that convective core overshooting is likely to be very slight. The new models predict the existence of an iron convection zone in the envelope and a great widening of the main-sequence band in the H-R diagram at luminosities brighter than 100,000 solar luminosities.

  12. Determination of the rare-earth elements in geological materials by inductively coupled plasma mass spectrometry

    USGS Publications Warehouse

    Lichte, F.E.; Meier, A.L.; Crock, J.G.

    1987-01-01

    A method of analysis of geological materials for the determination of the rare-earth elements using the Inductively coupled plasma mass spectrometric technique (ICP-MS) has been developed. Instrumental parameters and factors affecting analytical results have been first studied and then optimized. Samples are analyzed directly following an acid digestion, without the need for separation or preconcentration with limits of detection of 2-11 ng/g, precision of ?? 2.5% relative standard deviation, and accuracy comparable to inductively coupled plasma emission spectrometry and instrumental neutron activation analysis. A commercially available ICP-MS instrument is used with modifications to the sample introduction system, torch, and sampler orifice to reduce the effects of high salt content of sample solutions prepared from geologic materials. Corrections for isobaric interferences from oxide ions and other diatomic and triatomic ions are made mathematically. Special internal standard procedures are used to compensate for drift in metahmetal oxide ratios and sensitivity. Reference standard values are used to verify the accuracy and utility of the method.

  13. [Triatoma vandae sp.n. of the oliveirai complex from the State of Mato Grosso, Brazil (Hemiptera: Reduviidae: Triatominae)].

    PubMed

    Carcavallo, Rodolfo U; Jurberg, José; Rocha, Dayse da Silva; Galvao, Cleber; Noireau, François; Lent, Herman

    2002-07-01

    There are several specific complexes belonging to the genus Triatoma Laporte, 1832, which are generally associated to specific geographic areas. Recent publications have linked the oliveirai complex to ecosystems of Mato Grosso, which are also present in other Brazilian states and even in other bordering countries as eastern Paraguay. The study of the abundant material collected during the last years allowed the description of several new species of the oliveirai complex: T. jurbergi Carcavallo, Galvão Lent, 1998; T. baratai Carcavallo Jurberg, 2000 and T. klugi Carcavallo, Jurberg, Lent Galvão, 2001. Another new species belonging to the same complex is described here as T. vandae sp.n. It originates from the state of Mato Grosso, and has been reared in the insectary of the Laboratório Nacional e Internacional de Referência em Taxonomia de Triatomíneos, Departamento de Entomologia, Instituto Oswaldo Cruz-Fiocruz, Rio de Janeiro.

  14. Linear dichroism of DNA: Characterization of the orientation distribution function caused by hydrodynamic shear

    DOE PAGES

    Sutherland, John C.

    2017-04-15

    Linear dichroism provides information on the orientation of chromophores part of, or bound to, an orientable molecule such as DNA. For molecular alignment induced by hydrodynamic shear, the principal axes orthogonal to the direction of alignment are not equivalent. Thus, the magnitude of the flow-induced change in absorption for light polarized parallel to the direction of flow can be more than a factor of two greater than the corresponding change for light polarized perpendicular to both that direction and the shear axis. The ratio of the two flow-induced changes in absorption, the dichroic increment ratio, is characterized using the orthogonalmore » orientation model, which assumes that each absorbing unit is aligned parallel to one of the principal axes of the apparatus. The absorption of the alienable molecules is characterized by components parallel and perpendicular to the orientable axis of the molecule. The dichroic increment ratio indicates that for the alignment of DNA in rectangular flow cells, average alignment is not uniaxial, but for higher shear, as produced in a Couette cell, it can be. The results from the simple model are identical to tensor models for typical experimental configuration. Approaches for measuring the dichroic increment ratio with modern dichrometers are further discussed.« less

  15. Effect of molecular topology on the transport properties of dendrimers in dilute solution at Θ temperature: A Brownian dynamics study

    NASA Astrophysics Data System (ADS)

    Bosko, Jaroslaw T.; Ravi Prakash, J.

    2008-01-01

    Structure and transport properties of dendrimers in dilute solution are studied with the aid of Brownian dynamics simulations. To investigate the effect of molecular topology on the properties, linear chain, star, and dendrimer molecules of comparable molecular weights are studied. A bead-spring chain model with finitely extensible springs and fluctuating hydrodynamic interactions is used to represent polymer molecules under Θ conditions. Structural properties as well as the diffusivity and zero-shear-rate intrinsic viscosity of polymers with varied degrees of branching are analyzed. Results for the free-draining case are compared to and found in very good agreement with the Rouse model predictions. Translational diffusivity is evaluated and the difference between the short-time and long-time behavior due to dynamic correlations is observed. Incorporation of hydrodynamic interactions is found to be sufficient to reproduce the maximum in the intrinsic viscosity versus molecular weight observed experimentally for dendrimers. Results of the nonequilibrium Brownian dynamics simulations of dendrimers and linear chain polymers subjected to a planar shear flow in a wide range of strain rates are also reported. The flow-induced molecular deformation of molecules is found to decrease hydrodynamic interactions and lead to the appearance of shear thickening. Further, branching is found to suppress flow-induced molecular alignment and deformation.

  16. Linear dichroism of DNA: Characterization of the orientation distribution function caused by hydrodynamic shear

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sutherland, John C.

    Linear dichroism provides information on the orientation of chromophores part of, or bound to, an orientable molecule such as DNA. For molecular alignment induced by hydrodynamic shear, the principal axes orthogonal to the direction of alignment are not equivalent. Thus, the magnitude of the flow-induced change in absorption for light polarized parallel to the direction of flow can be more than a factor of two greater than the corresponding change for light polarized perpendicular to both that direction and the shear axis. The ratio of the two flow-induced changes in absorption, the dichroic increment ratio, is characterized using the orthogonalmore » orientation model, which assumes that each absorbing unit is aligned parallel to one of the principal axes of the apparatus. The absorption of the alienable molecules is characterized by components parallel and perpendicular to the orientable axis of the molecule. The dichroic increment ratio indicates that for the alignment of DNA in rectangular flow cells, average alignment is not uniaxial, but for higher shear, as produced in a Couette cell, it can be. The results from the simple model are identical to tensor models for typical experimental configuration. Approaches for measuring the dichroic increment ratio with modern dichrometers are further discussed.« less

  17. Active transport improves the precision of linear long distance molecular signalling

    NASA Astrophysics Data System (ADS)

    Godec, Aljaž; Metzler, Ralf

    2016-09-01

    Molecular signalling in living cells occurs at low copy numbers and is thereby inherently limited by the noise imposed by thermal diffusion. The precision at which biochemical receptors can count signalling molecules is intimately related to the noise correlation time. In addition to passive thermal diffusion, messenger RNA and vesicle-engulfed signalling molecules can transiently bind to molecular motors and are actively transported across biological cells. Active transport is most beneficial when trafficking occurs over large distances, for instance up to the order of 1 metre in neurons. Here we explain how intermittent active transport allows for faster equilibration upon a change in concentration triggered by biochemical stimuli. Moreover, we show how intermittent active excursions induce qualitative changes in the noise in effectively one-dimensional systems such as dendrites. Thereby they allow for significantly improved signalling precision in the sense of a smaller relative deviation in the concentration read-out by the receptor. On the basis of linear response theory we derive the exact mean field precision limit for counting actively transported molecules. We explain how intermittent active excursions disrupt the recurrence in the molecular motion, thereby facilitating improved signalling accuracy. Our results provide a deeper understanding of how recurrence affects molecular signalling precision in biological cells and novel medical-diagnostic devices.

  18. Linear dichroism of DNA: Characterization of the orientation distribution function caused by hydrodynamic shear.

    PubMed

    Sutherland, John C

    2017-04-15

    Linear dichroism provides information on the orientation of chromophores part of, or bound to, an orientable molecule such as DNA. For molecular alignment induced by hydrodynamic shear, the principal axes orthogonal to the direction of alignment are not equivalent. Thus, the magnitude of the flow-induced change in absorption for light polarized parallel to the direction of flow can be more than a factor of two greater than the corresponding change for light polarized perpendicular to both that direction and the shear axis. The ratio of the two flow-induced changes in absorption, the dichroic increment ratio, is characterized using the orthogonal orientation model, which assumes that each absorbing unit is aligned parallel to one of the principal axes of the apparatus. The absorption of the alienable molecules is characterized by components parallel and perpendicular to the orientable axis of the molecule. The dichroic increment ratio indicates that for the alignment of DNA in rectangular flow cells, average alignment is not uniaxial, but for higher shear, as produced in a Couette cell, it can be. The results from the simple model are identical to tensor models for typical experimental configurations. Approaches for measuring the dichroic increment ratio with modern dichrometers are discussed. Copyright © 2017. Published by Elsevier Inc.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santos, O. L.; Fonseca, T. L., E-mail: tertius@ufg.br; Sabino, J. R.

    We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller–Plessetmore » perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal.« less

  20. MultiDK: A Multiple Descriptor Multiple Kernel Approach for Molecular Discovery and Its Application to Organic Flow Battery Electrolytes.

    PubMed

    Kim, Sungjin; Jinich, Adrián; Aspuru-Guzik, Alán

    2017-04-24

    We propose a multiple descriptor multiple kernel (MultiDK) method for efficient molecular discovery using machine learning. We show that the MultiDK method improves both the speed and accuracy of molecular property prediction. We apply the method to the discovery of electrolyte molecules for aqueous redox flow batteries. Using multiple-type-as opposed to single-type-descriptors, we obtain more relevant features for machine learning. Following the principle of "wisdom of the crowds", the combination of multiple-type descriptors significantly boosts prediction performance. Moreover, by employing multiple kernels-more than one kernel function for a set of the input descriptors-MultiDK exploits nonlinear relations between molecular structure and properties better than a linear regression approach. The multiple kernels consist of a Tanimoto similarity kernel and a linear kernel for a set of binary descriptors and a set of nonbinary descriptors, respectively. Using MultiDK, we achieve an average performance of r 2 = 0.92 with a test set of molecules for solubility prediction. We also extend MultiDK to predict pH-dependent solubility and apply it to a set of quinone molecules with different ionizable functional groups to assess their performance as flow battery electrolytes.

  1. The Other Double Helix--The Fascinating Chemistry of Starch

    NASA Astrophysics Data System (ADS)

    Hancock, Robert D.; Tarbet, Bryon J.

    2000-08-01

    Current textbooks deal only briefly with the chemistry of starch. A short review with 21 references is presented, describing the structure of starch and indicating the double helix structure of A-type and B-type starch. The structure of the starch granule is examined, pointing out the existence of growth rings of alternating crystalline and noncrystalline starch, with growing amylopectin molecules extending from the hilum (point of origin) to the surface of the starch granule. The swelling of starch granules in water, above the gelatinization temperature of about 60 °C, is discussed. The process of gelatinization involves unraveling of the starch helix and a manyfold increase in volume of the starch granule as water is imbibed and bound to the unraveled starch polymer by hydrogen bonding. Baking bread or pastries causes unraveling of the starch helix, and the process by which these products become stale corresponds primarily to the re-forming of the starch helix. The importance of this phenomenon in food science is discussed. The absorption of nonpolar linear molecules such as I2, or linear nonpolar portions of molecules such as n-butanol or fats and phospholipids, by the C-type helix of starch is examined. The way in which starch is structurally modified to retard staling is discussed in relation to food technology.

  2. The synthesis and properties of linear A-π-D-π-A type organic small molecule containing diketopyrrolopyrrole terminal units.

    PubMed

    Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia

    2017-08-05

    A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP) 2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP) 2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP 2 Ph 2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800nm). DPP 2 Ph 2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP 2 Ph 2 with PC 61 BM and the K sv value was found to be as high as 2.13×10 4 M -1 . Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP) 2 is the prospective candidate as donor material for organic photovoltaic material. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Explicitly-correlated Gaussian geminals in electronic structure calculations

    NASA Astrophysics Data System (ADS)

    Szalewicz, Krzysztof; Jeziorski, Bogumił

    2010-11-01

    Explicitly correlated functions have been used since 1929, but initially only for two-electron systems. In 1960, Boys and Singer showed that if the correlating factor is of Gaussian form, many-electron integrals can be computed for general molecules. The capability of explicitly correlated Gaussian (ECG) functions to accurately describe many-electron atoms and molecules was demonstrated only in the early 1980s when Monkhorst, Zabolitzky and the present authors cast the many-body perturbation theory (MBPT) and coupled cluster (CC) equations as a system of integro-differential equations and developed techniques of solving these equations with two-electron ECG functions (Gaussian-type geminals, GTG). This work brought a new accuracy standard to MBPT/CC calculations. In 1985, Kutzelnigg suggested that the linear r 12 correlating factor can also be employed if n-electron integrals, n > 2, are factorised with the resolution of identity. Later, this factor was replaced by more general functions f (r 12), most often by ? , usually represented as linear combinations of Gaussian functions which makes the resulting approach (called F12) a special case of the original GTG expansion. The current state-of-art is that, for few-electron molecules, ECGs provide more accurate results than any other basis available, but for larger systems the F12 approach is the method of choice, giving significant improvements over orbital calculations.

  4. Nonlinear vs. linear biasing in Trp-cage folding simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spiwok, Vojtěch, E-mail: spiwokv@vscht.cz; Oborský, Pavel; Králová, Blanka

    2015-03-21

    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energymore » minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.« less

  5. Probing the non-linear transient response of a carbon nanotube mechanical oscillator

    NASA Astrophysics Data System (ADS)

    Willick, Kyle; Tang, Xiaowu Shirley; Baugh, Jonathan

    2017-11-01

    Carbon nanotube (CNT) electromechanical resonators have demonstrated unprecedented sensitivities for detecting small masses and forces. The detection speed in a cryogenic setup is usually limited by the CNT contact resistance and parasitic capacitance of cabling. We report the use of a cold heterojunction bipolar transistor amplifying circuit near the device to measure the mechanical amplitude at microsecond timescales. A Coulomb rectification scheme, in which the probe signal is at much lower frequency than the mechanical drive signal, allows investigation of the strongly non-linear regime. The behaviour of transients in both the linear and non-linear regimes is observed and modeled by including Duffing and non-linear damping terms in a harmonic oscillator equation. We show that the non-linear regime can result in faster mechanical response times, on the order of 10 μs for the device and circuit presented, potentially enabling the magnetic moments of single molecules to be measured within their spin relaxation and dephasing timescales.

  6. Prediction of non-linear pharmacokinetics in humans of an antibody-drug conjugate (ADC) when evaluation of higher doses in animals is limited by tolerability: Case study with an anti-CD33 ADC.

    PubMed

    Figueroa, Isabel; Leipold, Doug; Leong, Steve; Zheng, Bing; Triguero-Carrasco, Montserrat; Fourie-O'Donohue, Aimee; Kozak, Katherine R; Xu, Keyang; Schutten, Melissa; Wang, Hong; Polson, Andrew G; Kamath, Amrita V

    2018-05-14

    For antibody-drug conjugates (ADCs) that carry a cytotoxic drug, doses that can be administered in preclinical studies are typically limited by tolerability, leading to a narrow dose range that can be tested. For molecules with non-linear pharmacokinetics (PK), this limited dose range may be insufficient to fully characterize the PK of the ADC and limits translation to humans. Mathematical PK models are frequently used for molecule selection during preclinical drug development and for translational predictions to guide clinical study design. Here, we present a practical approach that uses limited PK and receptor occupancy (RO) data of the corresponding unconjugated antibody to predict ADC PK when conjugation does not alter the non-specific clearance or the antibody-target interaction. We used a 2-compartment model incorporating non-specific and specific (target mediated) clearances, where the latter is a function of RO, to describe the PK of anti-CD33 ADC with dose-limiting neutropenia in cynomolgus monkeys. We tested our model by comparing PK predictions based on the unconjugated antibody to observed ADC PK data that was not utilized for model development. Prospective prediction of human PK was performed by incorporating in vitro binding affinity differences between species for varying levels of CD33 target expression. Additionally, this approach was used to predict human PK of other previously tested anti-CD33 molecules with published clinical data. The findings showed that, for a cytotoxic ADC with non-linear PK and limited preclinical PK data, incorporating RO in the PK model and using data from the corresponding unconjugated antibody at higher doses allowed the identification of parameters to characterize monkey PK and enabled human PK predictions.

  7. Crosstalk between reticular adherens junctions and platelet endothelial cell adhesion molecule-1 regulates endothelial barrier function.

    PubMed

    Fernández-Martín, Laura; Marcos-Ramiro, Beatriz; Bigarella, Carolina L; Graupera, Mariona; Cain, Robert J; Reglero-Real, Natalia; Jiménez, Anaïs; Cernuda-Morollón, Eva; Correas, Isabel; Cox, Susan; Ridley, Anne J; Millán, Jaime

    2012-08-01

    Endothelial cells provide a barrier between the blood and tissues, which is reduced during inflammation to allow selective passage of molecules and cells. Adherens junctions (AJ) play a central role in regulating this barrier. We aim to investigate the role of a distinctive 3-dimensional reticular network of AJ found in the endothelium. In endothelial AJ, vascular endothelial-cadherin recruits the cytoplasmic proteins β-catenin and p120-catenin. β-catenin binds to α-catenin, which links AJ to actin filaments. AJ are usually described as linear structures along the actin-rich intercellular contacts. Here, we show that these AJ components can also be organized in reticular domains that contain low levels of actin. Reticular AJ are localized in areas where neighboring cells overlap and encompass the cell adhesion receptor platelet endothelial cell adhesion molecule-1 (PECAM-1). Superresolution microscopy revealed that PECAM-1 forms discrete structures distinct from and distributed along AJ, within the voids of reticular domains. Inflammatory tumor necrosis factor-α increases permeability by mechanisms that are independent of actomyosin-mediated tension and remain incompletely understood. Reticular AJ, but not actin-rich linear AJ, were disorganized by tumor necrosis factor-α. This correlated with PECAM-1 dispersal from cell borders. PECAM-1 inhibition with blocking antibodies or small interfering RNA specifically disrupted reticular AJ, leaving linear AJ intact. This disruption recapitulated typical tumor necrosis factor-α-induced alterations of barrier function, including increased β-catenin phosphorylation, without altering the actomyosin cytoskeleton. We propose that reticular AJ act coordinately with PECAM-1 to maintain endothelial barrier function in regions of low actomyosin-mediated tension. Selective disruption of reticular AJ contributes to permeability increase in response to tumor necrosis factor-α.

  8. Studies on the retention mechanism of solutes in hydrophilic interaction chromatography using stoichiometric displacement theory I. The linear relationship of lgk' vs. lg[H2O].

    PubMed

    Wang, Fei; Yang, Fan; Tian, Yang; Liu, Jiawei; Shen, Jiwei; Bai, Quan

    2018-01-01

    A stoichiometric displacement model for retention (SDM-R) of small solutes and proteins based on hydrophilic interaction chromatography (HILIC) was presented. A linear equation that related the logarithm of the capacity factor of the solute to the logarithm of the concentration of water in the mobile phase was derived. The stoichiometric displacement parameters, Z (the number of water molecules required to displace a solute from ligands) and lgI (containing a number of constants that relate to the affinity of solute to the ligands) could be obtained from the slope and the intercept of the linear plots of lgk' vs. lg[H 2 O]. The retention behaviors and retention mechanism of 15 kinds of small solutes and 6 kinds of proteins on 5 kinds HILIC columns with different ligands were investigated with SDM-R in typical range of water concentration in mobile phase. A good linear relationship between lgk' and lg[H 2 O] demonstrated that the most rational retention mechanism of solute in HILIC was a stoichiometric displacement process between solute and solvent molecules with water as displacing agents, which was not only valid for small solutes, but also could be used to explain the retention mechanism of biopolymers in HILIC. Comparing with the partition and adsorption models in HILIC, SDM-R was superior to them. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Linear and branched alkyl-esters and amides of gallic acid and other (mono-, di- and tri-) hydroxy benzoyl derivatives as promising anti-HCV inhibitors.

    PubMed

    Rivero-Buceta, Eva; Carrero, Paula; Doyagüez, Elisa G; Madrona, Andrés; Quesada, Ernesto; Camarasa, María José; Peréz-Pérez, María Jesús; Leyssen, Pieter; Paeshuyse, Jan; Balzarini, Jan; Neyts, Johan; San-Félix, Ana

    2015-03-06

    Linear and branched compounds that contain two, three or five units of galloyl (3,4,5-trihydroxybenzoyl) or its isomer 2,3,4-trihydroxybenzoyl, as well as other mono- or dihydroxybenzoyl moieties have been synthesized. These molecules have been evaluated for their in vitro inhibitory effects against a wide panel of viruses showing preferential activity against HIV and HCV. Our structure-activity relationship studies demonstrated that the 2,3,4-trihydroxybenzoyl moiety provides better antiviral activities than the galloyl (3,4,5-trihydroxybenzoyl) moiety that is present in natural green tea catechins. This observation can be of interest for the further rational exploration of compounds with anti-HCV/HIV properties. The most notable finding with respect to HIV is that the tripodal compounds 43 and 45, with three 2,3,4-trihydroxybenzoyl moieties, showed higher activities than linear compounds with only one or two. With respect to HCV, the linear compounds, 52 and 41, containing a 12 polymethylene chain and two 2,3 di- or 2,3,4 tri-hydroxybenzoyl groups respectively at the ends of the molecule showed good antiviral efficiency. Furthermore, the anti-HCV activity of both compounds was observed at concentrations well below the cytotoxicity threshold. A representative member of these compounds, 41, showed that the anti-HCV activity was largely independent of the genetic make-up of the HCV subgenomic replicon and cell lines used. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. Effects of nanorod structure and conformation of fatty acid self-assembled layers on superhydrophobicity of zinc oxide surface.

    PubMed

    Badre, Chantal; Dubot, P; Lincot, Daniel; Pauporte, Thierry; Turmine, Mireille

    2007-12-15

    Superhydrophobic surfaces have been prepared from nanostructured zinc oxide layers by a treatment with fatty acid molecules. The layers are electrochemically deposited from an oxygenated aqueous zinc chloride solution. The effects of the layer's structure, from a dense film to that of a nanorod array, as well as that of the properties of the fatty acid molecules based on C18 chains are described. A contact angle (CA) as high as 167 degrees is obtained with the nanorod structure and the linear saturated molecule (stearic acid). Lower values are found with molecules having an unsaturated bond on C9, in particular with a cis conformation (140 degrees ). These results, supplemented by infrared spectroscopy, indicate an enhancement of the sensitivity to the properties of the fatty acid molecules (conformation, flexibility, saturated or not) when moving from the flat surface to the nanostructured surface. This is attributed to a specific influence of the structure of the tops of the rods and lateral wall properties on the adsorption and organization of the molecules. CA measurements show a very good stability of the surface in time if stored in an environment protected from UV radiations.

  11. DFT computational analysis of piracetam.

    PubMed

    Rajesh, P; Gunasekaran, S; Seshadri, S; Gnanasambandan, T

    2014-11-11

    Density functional theory calculation with B3LYP using 6-31G(d,p) and 6-31++G(d,p) basis set have been used to determine ground state molecular geometries. The first order hyperpolarizability (β0) and related properties (β, α0 and Δα) of piracetam is calculated using B3LYP/6-31G(d,p) method on the finite-field approach. The stability of molecule has been analyzed by using NBO/NLMO analysis. The calculation of first hyperpolarizability shows that the molecule is an attractive molecule for future applications in non-linear optics. Molecular electrostatic potential (MEP) at a point in the space around a molecule gives an indication of the net electrostatic effect produced at that point by the total charge distribution of the molecule. The calculated HOMO and LUMO energies show that charge transfer occurs within these molecules. Mulliken population analysis on atomic charge is also calculated. Because of vibrational analysis, the thermodynamic properties of the title compound at different temperatures have been calculated. Finally, the UV-Vis spectra and electronic absorption properties are explained and illustrated from the frontier molecular orbitals. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Motor-motor interactions in ensembles of muscle myosin: using theory to connect single molecule to ensemble measurements

    NASA Astrophysics Data System (ADS)

    Walcott, Sam

    2013-03-01

    Interactions between the proteins actin and myosin drive muscle contraction. Properties of a single myosin interacting with an actin filament are largely known, but a trillion myosins work together in muscle. We are interested in how single-molecule properties relate to ensemble function. Myosin's reaction rates depend on force, so ensemble models keep track of both molecular state and force on each molecule. These models make subtle predictions, e.g. that myosin, when part of an ensemble, moves actin faster than when isolated. This acceleration arises because forces between molecules speed reaction kinetics. Experiments support this prediction and allow parameter estimates. A model based on this analysis describes experiments from single molecule to ensemble. In vivo, actin is regulated by proteins that, when present, cause the binding of one myosin to speed the binding of its neighbors; binding becomes cooperative. Although such interactions preclude the mean field approximation, a set of linear ODEs describes these ensembles under simplified experimental conditions. In these experiments cooperativity is strong, with the binding of one molecule affecting ten neighbors on either side. We progress toward a description of myosin ensembles under physiological conditions.

  13. Bond-based linear indices of the non-stochastic and stochastic edge-adjacency matrix. 1. Theory and modeling of ChemPhys properties of organic molecules.

    PubMed

    Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo

    2010-11-01

    Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity/diversity analysis and drug discovery protocols.

  14. Predicting the nonlinear optical response in the resonant region from the linear characterization: a self-consistent theory for the first-, second-, and third-order (non)linear optical response

    NASA Astrophysics Data System (ADS)

    Pérez-Moreno, Javier; Clays, Koen; Kuzyk, Mark G.

    2010-08-01

    We introduce a self-consistent theory for the description of the optical linear and nonlinear response of molecules that is based strictly on the results of the experimental characterization. We show how the Thomas-Kuhn sum-rules can be used to eliminate the dependence of the nonlinear response on parameters that are not directly measurable. Our approach leads to the successful modeling of the dispersion of the nonlinear response of complex molecular structures with different geometries (dipolar and octupolar), and can be used as a guide towards the modeling in terms of fundamental physical parameters.

  15. Structural characterization, spectroscopic signatures, nonlinear optical response, and antioxidant property of 4-benzyloxybenzaldehyde and its binding activity with microtubule-associated tau protein

    NASA Astrophysics Data System (ADS)

    Anbu, V.; Vijayalakshmi, K. A.; Karthick, T.; Tandon, Poonam; Narayana, B.

    2017-09-01

    In the proposed work, the non-linear optical response, spectroscopic signature and binding activity of 4-Benzyloxybenzaldehyde (4BB) has been investigated. In order to find the vibrational contribution of functional groups in mixed or coupled modes in the experimental FT-IR and FT-Raman spectra, the potential energy distribution (PED) based on the internal coordinates have been computed. Since the molecule exists in the form of dimer in solid state, the electronic structure of dimer has been proposed in order to explain the intermolecular hydrogen bonding interactions via aldehyde group. The experimental and simulated powder X-ray diffraction data was compared and the miller indices which define the crystallographic planes in the crystal lattices were identified. Optical transmittance and absorbance measurement were taken at ambient temperature in order to investigate the transparency and optical band gap. For screening the material for nonlinear applications, theoretical second order hyperpolarizability studies were performed and compared with the standard reference urea. To validate the theoretical results, powder second harmonic generation (SHG) studies were carried out using Kurtz and Perry technique. The results show that the molecule studied in this work exhibit considerable non-linear optical (NLO) response. In addition to the characterization and NLO studies, we also claimed based on the experimental and theoretical data that the molecule shows antioxidant property and inhibition capability. Since the title molecule shows significant binding with Tau protein that helps to stabilize microtubules in the nervous system, the molecular docking investigation was performed to find the inhibition constant, binding affinity and active binding residues.

  16. Pre-biotic molecules in shocks: the case of L1157

    NASA Astrophysics Data System (ADS)

    Mendoza, Edgar; Lefloch, Bertrand; López-Sepulcre, Ana; Ceccarelli, Cecilia; Codella, Claudio; Boechat-Roberty, Heloisa M.; Bachiller, Rafael

    2015-08-01

    Interstellar molecules with a peptide link -NH-C(=O)-, like formamide (NH2CHO) and isocyanic acid (HNCO) are notably interesting for their potential role in pre-biotic chemistry. For first time, we report the detection of both molecules towards the protostellar shock L1157-B1 and L1157-B2, with the IRAM 30m telescope. Analysis of the line profiles shows that the emission arises from the outflow cavities associated with B1 and B2. From a simple rotational diagram analysis, molecular abundance of ≈ (0.4-1.1)×10-8 and (3.3-8.8)×10-8 are derived for NH2CHO and HNCO, respectively. The shock regions B1 and B2 appear to be among the richest Galactic sources of HNCO and NH2CHO molecules. We have observed a narrow linear correlation between their abundances, suggesting that the two species are chemically related. Comparison with astrochemical models favours molecule formation on ice grain mantles, with NH2CHO generated from hydrogenation of HNCO.

  17. High precision optical spectroscopy and quantum state selected photodissociation of ultracold 88Sr2 molecules in an optical lattice

    NASA Astrophysics Data System (ADS)

    McDonald, Mickey

    2017-04-01

    Over the past several decades, rapid progress has been made toward the accurate characterization and control of atoms, epitomized by the ever-increasing accuracy and precision of optical atomic lattice clocks. Extending this progress to molecules will have exciting implications for chemistry, condensed matter physics, and precision tests of physics beyond the Standard Model. My thesis describes work performed over the past six years to establish the state of the art in manipulation and quantum control of ultracold molecules. We describe a thorough set of measurements characterizing the rovibrational structure of weakly bound 88Sr2 molecules from several different perspectives, including determinations of binding energies; linear, quadratic, and higher order Zeeman shifts; transition strengths between bound states; and lifetimes of narrow subradiant states. Finally, we discuss measurements of photofragment angular distributions produced by photodissociation of molecules in single quantum states, leading to an exploration of quantum-state-resolved ultracold chemistry. The images of exploding photofragments produced in these studies exhibit dramatic interference effects and strongly violate semiclassical predictions, instead requiring a fully quantum mechanical description.

  18. Interacting dark resonances with plasmonic meta-molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jha, Pankaj K.; Mrejen, Michael; Kim, Jeongmin

    2014-09-15

    Dark state physics has led to a variety of remarkable phenomena in atomic physics, quantum optics, and information theory. Here, we investigate interacting dark resonance type physics in multi-layered plasmonic meta-molecules. We theoretically demonstrate that these plasmonic meta-molecules exhibit sub-natural spectral response, analogous to conventional atomic four-level configuration, by manipulating the evanescent coupling between the bright and dark elements (plasmonic atoms). Using cascaded coupling, we show nearly 4-fold reduction in linewidth of the hybridized resonance compared to a resonantly excited single bright plasmonic atom with same absorbance. In addition, we engineered the geometry of the meta-molecules to realize efficient intramolecularmore » excitation transfer with nearly 80%, on resonant excitation, of the total absorption being localized at the second dark plasmonic atom. An analytical description of the spectral response of the structure is presented with full electrodynamics simulations to corroborate our results. Such multilayered meta-molecules can bring a new dimension to higher quality factor plasmonic resonance, efficient excitation transfer, wavelength demultiplexing, and enhanced non-linearity at nanoscale.« less

  19. Observation of rotational revivals for iodine molecules in helium droplets using a near-adiabatic laser pulse

    NASA Astrophysics Data System (ADS)

    Shepperson, Benjamin; Chatterley, Adam S.; Christiansen, Lars; Søndergaard, Anders A.; Stapelfeldt, Henrik

    2018-01-01

    A 160-ps near-Gaussian, linearly polarized laser pulse is used to align iodine (I2) molecules embedded in helium nanodroplets. The rise time of the laser pulse is sufficiently long and smooth that the alignment, characterized by , behaves adiabatically during the pulse turnon. However, after the laser pulse has turned off stays above 0.50 and a recurrence structure occurs ˜650 ps later. Measurements on isolated (I2) molecules with identical laser pulses are used to identify, through analysis of the observed half- and full-rotational revivals, that the nonadiabatic postpulse alignment dynamics results from a mild truncation of the trailing edge of the laser pulse. This truncation establishes a well-defined starting time for coherent rotation, which leads to the revival structures observed both for isolated molecules and molecules in He droplets. In the latter case the time-dependent trace recorded here is compared to that obtained previously for a 450-fs alignment pulse. It is found that the observed revivals are very similar.

  20. Quantitative Pointwise Estimate of the Solution of the Linearized Boltzmann Equation

    NASA Astrophysics Data System (ADS)

    Lin, Yu-Chu; Wang, Haitao; Wu, Kung-Chien

    2018-04-01

    We study the quantitative pointwise behavior of the solutions of the linearized Boltzmann equation for hard potentials, Maxwellian molecules and soft potentials, with Grad's angular cutoff assumption. More precisely, for solutions inside the finite Mach number region (time like region), we obtain the pointwise fluid structure for hard potentials and Maxwellian molecules, and optimal time decay in the fluid part and sub-exponential time decay in the non-fluid part for soft potentials. For solutions outside the finite Mach number region (space like region), we obtain sub-exponential decay in the space variable. The singular wave estimate, regularization estimate and refined weighted energy estimate play important roles in this paper. Our results extend the classical results of Liu and Yu (Commun Pure Appl Math 57:1543-1608, 2004), (Bull Inst Math Acad Sin 1:1-78, 2006), (Bull Inst Math Acad Sin 6:151-243, 2011) and Lee et al. (Commun Math Phys 269:17-37, 2007) to hard and soft potentials by imposing suitable exponential velocity weight on the initial condition.

  1. Protein gradients in single cells induced by their coupling to "morphogen"-like diffusion

    NASA Astrophysics Data System (ADS)

    Nandi, Saroj Kumar; Safran, Sam A.

    2018-05-01

    One of the many ways cells transmit information within their volume is through steady spatial gradients of different proteins. However, the mechanism through which proteins without any sources or sinks form such single-cell gradients is not yet fully understood. One of the models for such gradient formation, based on differential diffusion, is limited to proteins with large ratios of their diffusion constants or to specific protein-large molecule interactions. We introduce a novel mechanism for gradient formation via the coupling of the proteins within a single cell with a molecule, that we call a "pronogen," whose action is similar to that of morphogens in multi-cell assemblies; the pronogen is produced with a fixed flux at one side of the cell. This coupling results in an effectively non-linear diffusion degradation model for the pronogen dynamics within the cell, which leads to a steady-state gradient of the protein concentration. We use stability analysis to show that these gradients are linearly stable with respect to perturbations.

  2. Quantitative Pointwise Estimate of the Solution of the Linearized Boltzmann Equation

    NASA Astrophysics Data System (ADS)

    Lin, Yu-Chu; Wang, Haitao; Wu, Kung-Chien

    2018-06-01

    We study the quantitative pointwise behavior of the solutions of the linearized Boltzmann equation for hard potentials, Maxwellian molecules and soft potentials, with Grad's angular cutoff assumption. More precisely, for solutions inside the finite Mach number region (time like region), we obtain the pointwise fluid structure for hard potentials and Maxwellian molecules, and optimal time decay in the fluid part and sub-exponential time decay in the non-fluid part for soft potentials. For solutions outside the finite Mach number region (space like region), we obtain sub-exponential decay in the space variable. The singular wave estimate, regularization estimate and refined weighted energy estimate play important roles in this paper. Our results extend the classical results of Liu and Yu (Commun Pure Appl Math 57:1543-1608, 2004), (Bull Inst Math Acad Sin 1:1-78, 2006), (Bull Inst Math Acad Sin 6:151-243, 2011) and Lee et al. (Commun Math Phys 269:17-37, 2007) to hard and soft potentials by imposing suitable exponential velocity weight on the initial condition.

  3. Rotational spectra in the ν2 vibrationally excited states of MgNC

    NASA Astrophysics Data System (ADS)

    Kagi, E.; Kawaguchi, K.; Takano, S.; Hirano, T.

    1996-01-01

    The pure rotational spectra of MgNC in the ν2 (bending) vibrationally excited states were observed in the 310-380 GHz region to study the linearity of the molecule. The observed 90 spectral lines were assigned to the transitions in the v2=1-5 states and analyzed to determine a set of molecular constants in each state. The bending vibrational frequency was estimated to be 86 cm-1 from the l-type doubling constant of the v2=1 state. The interval of the Φ and Π states in v2=3 was determined to be 29.2280(24) cm-1, giving the anharmonicity constant xll=3.8611(9) cm-1 with one standard deviation in parentheses, which indicates that the molecule has a linear form. However, somewhat peculiar properties were recognized in dependence of the observed l-type resonance and vibration-rotation constants on the v2 vibrational quantum number, suggesting an effect of anharmonicity.

  4. FRET two-hybrid assay by linearly fitting FRET efficiency to concentration ratio between acceptor and donor

    NASA Astrophysics Data System (ADS)

    Du, Mengyan; Yang, Fangfang; Mai, Zihao; Qu, Wenfeng; Lin, Fangrui; Wei, Lichun; Chen, Tongsheng

    2018-04-01

    We here introduce a fluorescence resonance energy transfer (FRET) two-hybrid assay method to measure the maximal donor(D)- and acceptor(A)-centric FRET efficiency (ED,max and EA,max) of the D-A complex and its stoichiometry by linearly fitting the donor-centric FRET efficiency (ED) to the acceptor-to-donor concentration ratio (RC) and acceptor-centric FRET efficiency (EA) to 1/RC, respectively. We performed this method on a wide-field fluorescence microscope for living HepG2 cells co-expressing FRET tandem constructs and free donor/acceptor and obtained correct ED, EA, and stoichiometry values of those tandem constructs. Evaluation on the binding of Bad with Bcl-XL in Hela cells showed that Bad interacted strongly with Bcl-XL to form a Bad-Bcl-XL complex on mitochondria, and one Bad interacted mainly with one Bcl-XL molecule in healthy cells, while with multiple (maybe 2) Bcl-XL molecules in apoptotic cells.

  5. Random walk on a leash: a simple single-molecule diffusion model for surface-tethered redox molecules with flexible linkers.

    PubMed

    Huang, Kuan-Chun; White, Ryan J

    2013-08-28

    We develop a random walk model to simulate the Brownian motion and the electrochemical response of a single molecule confined to an electrode surface via a flexible molecular tether. We use our simple model, which requires no prior knowledge of the physics of the molecular tether, to predict and better understand the voltammetric response of surface-confined redox molecules when motion of the redox molecule becomes important. The single molecule is confined to a hemispherical volume with a maximum radius determined by the flexible molecular tether (5-20 nm) and is allowed to undergo true three-dimensional diffusion. Distance- and potential-dependent electron transfer probabilities are evaluated throughout the simulations to generate cyclic voltammograms of the model system. We find that at sufficiently slow cyclic voltammetric scan rates the electrochemical reaction behaves like an adsorbed redox molecule with no mass transfer limitation; thus, the peak current is proportional to the scan rate. Conversely, at faster scan rates the diffusional motion of the molecule limits the simulated peak current, which exhibits a linear dependence on the square root of the scan rate. The switch between these two limiting regimes occurs when the diffusion layer thickness, (2Dt)(1/2), is ~10 times the tether length. Finally, we find that our model predicts the voltammetric behavior of a redox-active methylene blue tethered to an electrode surface via short flexible single-stranded, polythymine DNAs, allowing the estimation of diffusion coefficients for the end-tethered molecule.

  6. Strain effect on the adsorption, diffusion, and molecular dissociation of hydrogen on Mg (0001) surface

    NASA Astrophysics Data System (ADS)

    Lei, Huaping; Wang, Caizhuang; Yao, Yongxin; Wang, Yangang; Hupalo, Myron; McDougall, Dan; Tringides, Michael; Ho, Kaiming

    2013-12-01

    The adsorption, diffusion, and molecular dissociation of hydrogen on the biaxially strained Mg (0001) surface have been systematically investigated by the first principle calculations based on density functional theory. When the strain changes from the compressive to tensile state, the adsorption energy of H atom linearly increases while its diffusion barrier linearly decreases oppositely. The dissociation barrier of H2 molecule linearly reduces in the tensile strain region. Through the chemical bonding analysis including the charge density difference, the projected density of states and the Mulliken population, the mechanism of the strain effect on the adsorption of H atom and the dissociation of H2 molecule has been elucidated by an s-p charge transfer model. With the reduction of the orbital overlap between the surface Mg atoms upon the lattice expansion, the charge transfers from p to s states of Mg atoms, which enhances the hybridization of H s and Mg s orbitals. Therefore, the bonding interaction of H with Mg surface is strengthened and then the atomic diffusion and molecular dissociation barriers of hydrogen decrease accordingly. Our works will be helpful to understand and to estimate the influence of the lattice deformation on the performance of Mg-containing hydrogen storage materials.

  7. Confocal fluorescence detected linear dichroism imaging of isolated human amyloid fibrils. Role of supercoiling.

    PubMed

    Steinbach, Gábor; Pomozi, István; Jánosa, Dávid Péter; Makovitzky, Josef; Garab, Gyozo

    2011-05-01

    Amyloids are highly organized insoluble protein aggregates that are associated with a large variety of degenerative diseases. In this work, we investigated the anisotropic architecture of isolated human amyloid samples stained with Congo Red. This was performed by fluorescence detected linear dichroism (FDLD) imaging in a laser scanning confocal microscope that was equipped with a differential polarization attachment using high frequency modulation of the polarization state of the laser beam and a demodulation circuit. Two- and three-dimensional FDLD images of amyloids provided information on the orientation of the electric transition dipoles of the intercalated Congo Red molecules with unprecedented precision and spatial resolution. We show that, in accordance with linear dichroism imaging (Jin et al. Proc Natl Acad Sci USA 100:15294, 2003), amyloids exhibit strong anisotropy with preferential orientation of the dye molecules along the fibrils; estimations on the orientation angle, of around 45°, are given using a model calculation which takes into account the helical organization of the filaments and fibrils. Our data also show that FDLD images display large inhomogeneities, high local values with alternating signs and, in some regions, well identifiable µm-sized periodicities. These features of the anisotropic architecture are accounted for by supercoiling of helically organized amyloid fibrils. © Springer Science+Business Media, LLC 2010

  8. Optical properties of cyanine dyes in nanotubes of chrysotile asbestos

    NASA Astrophysics Data System (ADS)

    Starovoytov, Anton A.; Vartanyan, Tigran A.; Belotitskii, Vladimir I.; Kumzerov, Yuri A.; Sysoeva, Anna A.

    2017-08-01

    Optical properties of cyanine dye molecules incorporated in nanotubes of natural chrysotile asbestos are studied. The absorption and fluorescence spectra of dye in asbestos have the similar shapes as in the ethanol solution, apart from small blue shift of the maxima. The Stokes shift in asbestos is smaller than in the ethanol solution. The fluorescence decay times of the dyes in asbestos nanotubes are found to be larger than that in the case of thin films of the same dyes formed on the transparent dielectric supports. This observation is rationalized in terms of the stereoisomerization hindrance in the excited electronic state of dye molecules. At the same time linear dichroism and fluorescence anisotropy observed in the experiment indicate that the embedded dye molecules are well-isolated monomer oriented predominantly along asbestos nanotubes.

  9. Relative importance of multiple scattering by air molecules and aerosols in forming the atmospheric path radiance in the visible and near-infrared parts of the spectrum.

    PubMed

    Antoine, D; Morel, A

    1998-04-20

    Single and multiple scattering by molecules or by atmospheric aerosols only (homogeneous scattering), and heterogeneous scattering by aerosols and molecules, are recorded in Monte Carlo simulations. It is shown that heterogeneous scattering (1) always contributes significantly to the path reflectance (rho(path)), (2) is realized at the expense of homogeneous scattering, (3) decreases when aerosols are absorbing, and (4) introduces deviations in the spectral dependencies of reflectances compared with the Rayleigh exponent and the aerosol angstrom exponent. The ratio of rho(path) to the Rayleigh reflectance for an aerosol-free atmosphere is linearly related to the aerosol optical thickness. This result provides a basis for a new scheme for atmospheric correction of remotely sensed ocean color observations.

  10. Experimental and theoretical (FT-IR, FT-Raman, UV-vis, NMR) spectroscopic analysis and first order hyperpolarizability studies of non-linear optical material: (2E)-3-[4-(methylsulfanyl) phenyl]-1-(4-nitrophenyl) prop-2-en-1-one using density functional theory.

    PubMed

    Kumar, Amit; Deval, Vipin; Tandon, Poonam; Gupta, Archana; Deepak D'silva, E

    2014-09-15

    A combined experimental and theoretical investigation on FT-IR, FT-Raman, NMR, UV-vis spectra of a chalcone derivative (2E)-3-[4-(methylsulfanyl) phenyl]-1-(4-nitrophenyl) prop-2-en-1-one (4N4MSP) has been reported. 4N4MSP has two planar rings connected through conjugated double bond and it provides a necessary configuration to show non-linear optical (NLO) response. The molecular structure, fundamental vibrational frequencies and intensity of the vibrational bands are interpreted with the aid of structure optimizations and normal coordinate force field calculations based on density functional theory (DFT) with B3LYP functional and 6-311++G(d,p) basis set combination. The analysis of the fundamental modes was made with the help of potential energy distribution (PED). Molecular electrostatic potential (MEP) surface was plotted over the geometry primarily for predicting sites and relative reactivities towards electrophilic and nucleophilic attack. The delocalization of electron density of various constituents of the molecule has been discussed with the aid of NBO analysis. The electronic properties, such as excitation energies, oscillator strength, wavelengths, HOMO and LUMO energies, were calculated by time-dependent density functional theory (TD-DFT) and the results complement the experimental findings. The recorded and calculated 1H chemical shifts in gas phase and MeOD solution are gathered for reliable calculations of magnetic properties. Thermodynamic properties like heat capacity (C°p,m), entropy (S°m), enthalpy (H°m) have been calculated for the molecule at the different temperatures. Based on the finite-field approach, the non-linear optical (NLO) parameters such as dipole moment, mean polarizability, anisotropy of polarizability and first order hyperpolarizability of 4N4MSP molecule are calculated. The predicted first hyperpolarizability shows that the molecule has a reasonably good nonlinear optical (NLO) behavior. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Turbulent drag reduction and degradation of DNA.

    PubMed

    Choi, H J; Lim, S T; Lai, Pik-Yin; Chan, C K

    2002-08-19

    Turbulent drag reduction induced by lambda-DNA is studied. The double-stranded DNA is found to be a good drag reducer when compared with the other normal linear polymers. However, this drag reducing power disappears when the DNA denatures to form two single-strand molecules. Mechanical degradation of DNA is also different from that of the normal linear-chain polymers: DNA is always cut in half by the turbulence. Our results suggest that the mechanism for turbulent degradation of DNA is different from that of the normal flexible long-chain polymers.

  12. Quantum Mechanical Calculations of Monoxides of Silicon Carbide Molecules

    DTIC Science & Technology

    2003-03-01

    Data for CO Final Energy Charge Mult Basis Set (hart) EA (eV) ZPE (hart) EA (eV) w/ ZPE 0 1 DVZ -112.6850703739 2.02121 -1 2 DVZ...Energy Charge Mult Basis Set (hart) EA (eV) ZPE (hart) EA (eV) w/ ZPE 0 1 DVZ -363.7341927429 0.617643 -1 2 DVZ -363.7114852831 0 3 DVZ...Input Geometry Output Geometry Basis Set Final Energy (hart) EA (eV) ZPE (hart) EA (eV) w/ ZPE -1 2 O-C-Si Linear O-C-Si Linear DZV -401.5363

  13. Ordered and disordered dynamics in monolayers of rolling particles.

    PubMed

    Kim, Byungsoo; Putkaradze, Vakhtang

    2010-12-10

    We consider the ordered and disordered dynamics for monolayers of rolling self-interacting particles modeling water molecules. The rolling constraint represents a simplified model of a strong, but rapidly decaying bond with the surface. We show the existence and nonlinear stability of ordered lattice states, as well as disturbance propagation through and chaotic vibrations of these states. We study the dynamics of disordered gas states and show that there is a surprising and universal linear connection between distributions of angular and linear velocity, allowing definition of temperature.

  14. The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

    NASA Astrophysics Data System (ADS)

    Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

    1990-05-01

    There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

  15. Time-dependent density functional theory description of total photoabsorption cross sections

    NASA Astrophysics Data System (ADS)

    Tenorio, Bruno Nunes Cabral; Nascimento, Marco Antonio Chaer; Rocha, Alexandre Braga

    2018-02-01

    The time-dependent version of the density functional theory (TDDFT) has been used to calculate the total photoabsorption cross section of a number of molecules, namely, benzene, pyridine, furan, pyrrole, thiophene, phenol, naphthalene, and anthracene. The discrete electronic pseudo-spectra, obtained in a L2 basis set calculation were used in an analytic continuation procedure to obtain the photoabsorption cross sections. The ammonia molecule was chosen as a model system to compare the results obtained with TDDFT to those obtained with the linear response coupled cluster approach in order to make a link with our previous work and establish benchmarks.

  16. Theoretical investigation of the weak interaction between graphene and alcohol solvents

    NASA Astrophysics Data System (ADS)

    Wang, Haining; Chen, Sian; Lu, Shanfu; Xiang, Yan

    2017-05-01

    The dispersion of graphene in five different alcohol solvents was investigated by evaluating the binding energy between graphene and alcohol molecules using DFT-D method. The calculation showed the most stable binding energy appeared at the distance of ∼3.5 Å between graphene and alcohol molecules and increased linearly as changing the alcohol from methanol to 1-pentanol. The weak interaction was further graphically illustrated using the reduced density gradient method. The theoretical study revealed alcohols with more carbon atoms could be a good starting point for screening suitable solvents for graphene dispersion.

  17. Interfacial solvation thermodynamics

    NASA Astrophysics Data System (ADS)

    Ben-Amotz, Dor

    2016-10-01

    Previous studies have reached conflicting conclusions regarding the interplay of cavity formation, polarizability, desolvation, and surface capillary waves in driving the interfacial adsorptions of ions and molecules at air-water interfaces. Here we revisit these questions by combining exact potential distribution results with linear response theory and other physically motivated approximations. The results highlight both exact and approximate compensation relations pertaining to direct (solute-solvent) and indirect (solvent-solvent) contributions to adsorption thermodynamics, of relevance to solvation at air-water interfaces, as well as a broader class of processes linked to the mean force potential between ions, molecules, nanoparticles, proteins, and biological assemblies.

  18. Enhancing thermoelectric properties through a three-terminal benzene molecule

    NASA Astrophysics Data System (ADS)

    Sartipi, Z.; Vahedi, J.

    2018-05-01

    The thermoelectric transport through a benzene molecule with three metallic terminals is discussed. Using general local and non-local transport coefficients, we investigated different conductance and thermopower coefficients within the linear response regime. Based on the Onsager coefficients which depend on the number of terminal efficiencies, efficiency at maximum power is also studied. In the three-terminal setup with tuning temperature differences, a great enhancement of the figure of merit is observed. Results also show that the third terminal model can be useful in improving the efficiency at maximum output power compared to the two-terminal model.

  19. Cellulase activities in biomass conversion: measurement methods and comparison.

    PubMed

    Dashtban, Mehdi; Maki, Miranda; Leung, Kam Tin; Mao, Canquan; Qin, Wensheng

    2010-12-01

    Cellulose, the major constituent of all plant materials and the most abundant organic molecule on the Earth, is a linear biopolymer of glucose molecules, connected by β-1,4-glycosidic bonds. Enzymatic hydrolysis of cellulose requires mixtures of hydrolytic enzymes including endoglucanases, exoglucanases (cellobiohydrolases), and β-glucosidases acting in a synergistic manner. In biopolymer hydrolysis studies, enzyme assay is an indispensable part. The most commonly used assays for the individual enzymes as well as total cellulase activity measurements, including their advantages and limitations, are summarized in this review article. In addition, some novel approaches recently used for enzyme assays are summarized.

  20. Thermally induced charge current through long molecules

    NASA Astrophysics Data System (ADS)

    Zimbovskaya, Natalya A.; Nitzan, Abraham

    2018-01-01

    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  1. Efficient Algorithms for Estimating the Absorption Spectrum within Linear Response TDDFT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brabec, Jiri; Lin, Lin; Shao, Meiyue

    We present two iterative algorithms for approximating the absorption spectrum of molecules within linear response of time-dependent density functional theory (TDDFT) framework. These methods do not attempt to compute eigenvalues or eigenvectors of the linear response matrix. They are designed to approximate the absorption spectrum as a function directly. They take advantage of the special structure of the linear response matrix. Neither method requires the linear response matrix to be constructed explicitly. They only require a procedure that performs the multiplication of the linear response matrix with a vector. These methods can also be easily modified to efficiently estimate themore » density of states (DOS) of the linear response matrix without computing the eigenvalues of this matrix. We show by computational experiments that the methods proposed in this paper can be much more efficient than methods that are based on the exact diagonalization of the linear response matrix. We show that they can also be more efficient than real-time TDDFT simulations. We compare the pros and cons of these methods in terms of their accuracy as well as their computational and storage cost.« less

  2. Study of confinement and sliding friction of fluids using sum frequency generation spectroscopy

    NASA Astrophysics Data System (ADS)

    Nanjundiah, Kumar

    2007-12-01

    Friction and wear are important technologically. Tires on wet roads, windshield wipers and human joints are examples where nanometer-thick liquids are confined between flexible-rigid contact interfaces. Fundamental understanding of the structure of these liquids can assist in the design of products such as artificial joints and lubricants for Micro-electromechanical systems [MEMS]. Prior force measurements have suggested an increase in apparent viscosity of confined liquid and sometimes solid-like responses. But, these have not given the state of molecules under confinement. In the present study, we have used a surface sensitive, non-linear optical technique (infrared-visible sum frequency generation spectroscopy [SFG]) to investigate molecular structure at hidden interfaces. SFG can identify chemical groups, concentration and orientation of molecules at an interface. A friction cell was developed to study sliding of a smooth elastomeric lens against a sapphire surface. Experiments were done with dry sliding as well as lubricated sliding in the presence of linear alkane liquids. SFG spectra at the alkane/sapphire interface revealed ordering of the confined alkane molecules. These were more ordered than alkane liquid, but less ordered than alkane crystal. Cooling of the confined alkane below its melting temperature [TM] led to molecular orientation that was different from that of bulk crystal next to a sapphire surface. Molecules were oriented with their symmetry axis parallel to the surface normal. In addition, the melting temperature [Tconf] under confinement for a series of linear alkanes (n =15--27) showed a surprising trend. Intermediate molecular weights showed melting point depression. The T conf values suggested that melting started at the alkane/sapphire interface. In another investigation, confinement of water between an elastomeric PDMS lens and sapphire was studied. SFG spectra at the sapphire/water/PDMS interface revealed a heterogeneous morphology. The presence of peaks related to PDMS, as well as water, suggested water puddles in the contact area and the sapphire surface had a layer of bound water. This heterogeneity picture provides insight into high friction and stick-slip behavior found in boundary lubrication. For the first time, a broadband SFG system has been coupled with a friction cell to study dynamics and molecular changes at an interface during sliding; sliding of confined alkane between sapphire and PDMS was investigated. A series of SFG spectra were taken while the confined alkane contact spot moved in and out of the laser beam. Even though the experiments were done 15°C above melting temperature, the spectra showed ordering of alkane molecules, similar to that of the confined crystal at the leading and trailing edge. The results suggest that a large portion of the resistance to sliding may come from ordering of molecules at the lens front.

  3. In Situ Detection of Organic Molecules on the Martian Surface With the Mars Organic Molecule Analyzer (MOMA) on Exomars 2018

    NASA Technical Reports Server (NTRS)

    Li, Xiang; Brinckerhoff, William B.; Pinnick, Veronica T; van Amerom, Friso H. W.; Danell, Ryan M.; Arevalo, Ricardo D., Jr.; Getty, Stephanie; Mahaffy, Paul R.

    2015-01-01

    The Mars Organic Molecule Analyzer (MOMA) investigation on the 2018 ExoMars rover will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from radiative and oxidative degradation. The MOMA instrument is centered around a miniaturized linear ion trap (LIT) that facilitates two modes of operation: i) pyrolysisgas chromatography mass spectrometry (pyrGC-MS); and, ii) laser desorptionionization mass spectrometry (LDI-MS) at ambient Mars pressures. The LIT also enables the structural characterization of complex molecules via complementary analytical capabilities, such as multi-frequency waveforms (i.e., SWIFT) and tandem mass spectrometry (MSMS). When combined with the complement of instruments in the rovers Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds.

  4. Synthesis of RNA oligomers on heterogeneous templates

    NASA Technical Reports Server (NTRS)

    Ertem, G.; Ferris, J. P.

    1996-01-01

    The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.

  5. A new scale of electronegativity based on electrophilicity index.

    PubMed

    Noorizadeh, Siamak; Shakerzadeh, Ehsan

    2008-04-17

    By calculating the energies of neutral and different ionic forms (M2+, M+, M, M-, and M2-) of 32 elements (using B3LYP/6-311++G** level of theory) and taking energy (E) to be a Morse-like function of the number of electrons (N), the electrophilicity values (omega) are calculated for these atoms. The obtained electrophilicities show a good linearity with some commonly used electronegativity scales such as Pauling and Allred-Rochow. Using these electrophilicities, the ionicities of some diatomic molecules are calculated, which are in good agreement with the experimental data. Therefore, these electrophilicities are introduced as a new scale for atomic electronegativity, chi(omega)0. The same procedure is also performed for some simple polyatomic molecules. It is shown that the new scale successfully obeys Sanderson's electronegativity equalization principle and for those molecules which have the same number of atoms, the ratio of the change in electronegativity during the formation of a molecule from its elements to the molecular electronegativity (Delta chi/chi omega) is the same.

  6. Photoexcitation circular dichroism in chiral molecules

    NASA Astrophysics Data System (ADS)

    Beaulieu, S.; Comby, A.; Descamps, D.; Fabre, B.; Garcia, G. A.; Géneaux, R.; Harvey, A. G.; Légaré, F.; Mašín, Z.; Nahon, L.; Ordonez, A. F.; Petit, S.; Pons, B.; Mairesse, Y.; Smirnova, O.; Blanchet, V.

    2018-05-01

    Chiral effects appear in a wide variety of natural phenomena and are of fundamental importance in science, from particle physics to metamaterials. The standard technique of chiral discrimination—photoabsorption circular dichroism—relies on the magnetic properties of a chiral medium and yields an extremely weak chiral response. Here, we propose and demonstrate an orders of magnitude more sensitive type of circular dichroism in neutral molecules: photoexcitation circular dichroism. This technique does not rely on weak magnetic effects, but takes advantage of the coherent helical motion of bound electrons excited by ultrashort circularly polarized light. It results in an ultrafast chiral response and the efficient excitation of a macroscopic chiral density in an initially isotropic ensemble of randomly oriented chiral molecules. We probe this excitation using linearly polarized laser pulses, without the aid of further chiral interactions. Our time-resolved study of vibronic chiral dynamics opens a way to the efficient initiation, control and monitoring of chiral chemical change in neutral molecules at the level of electrons.

  7. Elasticity and Stability of Clathrate Hydrate: Role of Guest Molecule Motions.

    PubMed

    Jia, Jihui; Liang, Yunfeng; Tsuji, Takeshi; Murata, Sumihiko; Matsuoka, Toshifumi

    2017-05-02

    Molecular dynamic simulations were performed to determine the elastic constants of carbon dioxide (CO 2 ) and methane (CH 4 ) hydrates at one hundred pressure-temperature data points, respectively. The conditions represent marine sediments and permafrost zones where gas hydrates occur. The shear modulus and Young's modulus of the CO 2 hydrate increase anomalously with increasing temperature, whereas those of the CH 4 hydrate decrease regularly with increase in temperature. We ascribe this anomaly to the kinetic behavior of the linear CO 2 molecule, especially those in the small cages. The cavity space of the cage limits free rotational motion of the CO 2 molecule at low temperature. With increase in temperature, the CO 2 molecule can rotate easily, and enhance the stability and rigidity of the CO 2 hydrate. Our work provides a key database for the elastic properties of gas hydrates, and molecular insights into stability changes of CO 2 hydrate from high temperature of ~5 °C to low decomposition temperature of ~-150 °C.

  8. Biomolecular Force Field Parameterization via Atoms-in-Molecule Electron Density Partitioning.

    PubMed

    Cole, Daniel J; Vilseck, Jonah Z; Tirado-Rives, Julian; Payne, Mike C; Jorgensen, William L

    2016-05-10

    Molecular mechanics force fields, which are commonly used in biomolecular modeling and computer-aided drug design, typically treat nonbonded interactions using a limited library of empirical parameters that are developed for small molecules. This approach does not account for polarization in larger molecules or proteins, and the parametrization process is labor-intensive. Using linear-scaling density functional theory and atoms-in-molecule electron density partitioning, environment-specific charges and Lennard-Jones parameters are derived directly from quantum mechanical calculations for use in biomolecular modeling of organic and biomolecular systems. The proposed methods significantly reduce the number of empirical parameters needed to construct molecular mechanics force fields, naturally include polarization effects in charge and Lennard-Jones parameters, and scale well to systems comprised of thousands of atoms, including proteins. The feasibility and benefits of this approach are demonstrated by computing free energies of hydration, properties of pure liquids, and the relative binding free energies of indole and benzofuran to the L99A mutant of T4 lysozyme.

  9. Threading dynamics of a polymer through parallel pores: Potential applications to DNA size separation

    NASA Astrophysics Data System (ADS)

    Åkerman, Björn

    1997-04-01

    DNA orientation measurements by linear dichroism (LD) spectroscopy and single molecule imaging by fluorescence microscopy are used to investigate the effect of DNA size (71-740 kilo base pairs) and field strength E (1-5.9 V/cm) on the conformation dynamics during the field-driven threading of DNA molecules through a set of parallel pores in agarose gels, with average pore radii between 380 Å and 1400 Å. Locally relaxed but globally oriented DNA molecules are subjected to a perpendicular field, and the observed LD time profile is compared with a recent theory for the threading [D. Long and J.-L. Viovy, Phys. Rev. E 53, 803 (1996)] which assumes the same initial state. As predicted the DNA is driven by the ends into a U-form, leading to an overshoot in the LD. The overshoot-time scales as E-(1.2-1.4) as predicted, but grows more slowly with DNA size than the predicted linear dependence. For long molecules loops form initially in the threading process but are finally consumed by the ends, and the process of transfer of DNA segments, from the loops to the arms of the U, leads to a shoulder in the LD as predicted. The critical size below which loops do not form (as indicated by the LD shoulder being absent) is between 71 and 105 kbp (0.5% agarose, 5.9 V/cm), and considerably larger than predicted because in the initial state the DNA molecules are housed in gel cavities with effective pore sizes about four times larger than the average pore size. From the data, the separation of DNA by exploiting the threading dynamics in pulsed fields [D. Long et al., CR Acad. Sci. Paris, Ser. IIb 321, 239 (1995)] is shown to be feasible in principle in an agarose-based system.

  10. Linear Ion Traps in Space: The Mars Organic Molecule Analyzer (MOMA) Instrument and Beyond

    NASA Astrophysics Data System (ADS)

    Arevalo, Ricardo; Brinckerhoff, William; Mahaffy, Paul; van Amerom, Friso; Danell, Ryan; Pinnick, Veronica; Li, Xiang; Hovmand, Lars; Getty, Stephanie; Grubisic, Andrej; Goesmann, Fred; Cottin, Hervé

    2015-11-01

    Historically, quadrupole mass spectrometer (QMS) instruments have been used to explore a wide survey of planetary targets in our solar system, from Venus (Pioneer Venus) to Saturn (Cassini-Huygens). However, linear ion trap (LIT) mass spectrometers have found a niche as smaller, versatile alternatives to traditional quadrupole analyzers.The core astrobiological experiment of ESA’s ExoMars Program is the Mars Organic Molecule Analyzer (MOMA) onboard the ExoMars 2018 rover. The MOMA instrument is centered on a linear (or 2-D) ion trap mass spectrometer. As opposed to 3-D traps, LIT-based instruments accommodate two symmetrical ion injection pathways, enabling two complementary ion sources to be used. In the case of MOMA, these two analytical approaches are laser desorption mass spectrometry (LDMS) at Mars ambient pressures, and traditional gas chromatography mass spectrometry (GCMS). The LIT analyzer employed by MOMA also offers: higher ion capacity compared to a 3-D trap of the same volume; redundant detection subassemblies for extended lifetime; and, a link to heritage QMS designs and assembly logistics. The MOMA engineering test unit (ETU) has demonstrated the detection of organics in the presence of wt.%-levels of perchlorate, effective ion enhancement via stored waveform inverse Fourier transform (SWIFT), and derivation of structural information through tandem mass spectrometry (MS/MS).A more progressive linear ion trap mass spectrometer (LITMS), funded by the NASA ROSES MatISSE Program, is being developed at NASA GSFC and promises to augment the capabilities of the MOMA instrument by way of: an expanded mass range (i.e., 20 - 2000 Da); detection of both positive and negative ions; spatially resolved (<1 mm) characterization of individual rock core layers; and, evolved gas analysis and GCMS with pyrolysis up to 1300° C (enabling breakdown of refractory phases). The Advanced Resolution Organic Molecule Analyzer (AROMA) instrument, being developed through NASA PICASSO and ESA Research and Development Programs, combines a highly capable LIT front end (a la LITMS) with a high-resolution OrbitrapTM (a la CosmOrbitrap) mass analyzer to enable disambiguation of complex molecular signals in organic-rich targets.

  11. Linear Lepidopteran ambidensovirus 1 sequences drive random integration of a reporter gene in transfected Spodoptera frugiperda cells.

    PubMed

    Rizk, Francine; Laverdure, Sylvain; d'Alençon, Emmanuelle; Bossin, Hervé; Dupressoir, Thierry

    2018-01-01

    The Lepidopteran ambidensovirus 1 isolated from Junonia coenia (hereafter JcDV) is an invertebrate parvovirus considered as a viral transduction vector as well as a potential tool for the biological control of insect pests. Previous works showed that JcDV-based circular plasmids experimentally integrate into insect cells genomic DNA. In order to approach the natural conditions of infection and possible integration, we generated linear JcDV- gfp based molecules which were transfected into non permissive Spodoptera frugiperda ( Sf9 ) cultured cells. Cells were monitored for the expression of green fluorescent protein (GFP) and DNA was analyzed for integration of transduced viral sequences. Non-structural protein modulation of the VP-gene cassette promoter activity was additionally assayed. We show that linear JcDV-derived molecules are capable of long term genomic integration and sustained transgene expression in Sf9 cells. As expected, only the deletion of both inverted terminal repeats (ITR) or the polyadenylation signals of NS and VP genes dramatically impairs the global transduction/expression efficiency. However, all the integrated viral sequences we characterized appear "scrambled" whatever the viral content of the transfected vector. Despite a strong GFP expression, we were unable to recover any full sequence of the original constructs and found rearranged viral and non-viral sequences as well. Cellular flanking sequences were identified as non-coding ones. On the other hand, the kinetics of GFP expression over time led us to investigate the apparent down-regulation by non-structural proteins of the VP-gene cassette promoter. Altogether, our results show that JcDV-derived sequences included in linear DNA molecules are able to drive efficiently the integration and expression of a foreign gene into the genome of insect cells, whatever their composition, provided that at least one ITR is present. However, the transfected sequences were extensively rearranged with cellular DNA during or after random integration in the host cell genome. Lastly, the non-structural proteins seem to participate in the regulation of p9 promoter activity rather than to the integration of viral sequences.

  12. Fast and accurate predictions of covalent bonds in chemical space.

    PubMed

    Chang, K Y Samuel; Fias, Stijn; Ramakrishnan, Raghunathan; von Lilienfeld, O Anatole

    2016-05-07

    We assess the predictive accuracy of perturbation theory based estimates of changes in covalent bonding due to linear alchemical interpolations among molecules. We have investigated σ bonding to hydrogen, as well as σ and π bonding between main-group elements, occurring in small sets of iso-valence-electronic molecules with elements drawn from second to fourth rows in the p-block of the periodic table. Numerical evidence suggests that first order Taylor expansions of covalent bonding potentials can achieve high accuracy if (i) the alchemical interpolation is vertical (fixed geometry), (ii) it involves elements from the third and fourth rows of the periodic table, and (iii) an optimal reference geometry is used. This leads to near linear changes in the bonding potential, resulting in analytical predictions with chemical accuracy (∼1 kcal/mol). Second order estimates deteriorate the prediction. If initial and final molecules differ not only in composition but also in geometry, all estimates become substantially worse, with second order being slightly more accurate than first order. The independent particle approximation based second order perturbation theory performs poorly when compared to the coupled perturbed or finite difference approach. Taylor series expansions up to fourth order of the potential energy curve of highly symmetric systems indicate a finite radius of convergence, as illustrated for the alchemical stretching of H2 (+). Results are presented for (i) covalent bonds to hydrogen in 12 molecules with 8 valence electrons (CH4, NH3, H2O, HF, SiH4, PH3, H2S, HCl, GeH4, AsH3, H2Se, HBr); (ii) main-group single bonds in 9 molecules with 14 valence electrons (CH3F, CH3Cl, CH3Br, SiH3F, SiH3Cl, SiH3Br, GeH3F, GeH3Cl, GeH3Br); (iii) main-group double bonds in 9 molecules with 12 valence electrons (CH2O, CH2S, CH2Se, SiH2O, SiH2S, SiH2Se, GeH2O, GeH2S, GeH2Se); (iv) main-group triple bonds in 9 molecules with 10 valence electrons (HCN, HCP, HCAs, HSiN, HSiP, HSiAs, HGeN, HGeP, HGeAs); and (v) H2 (+) single bond with 1 electron.

  13. Viscoelastic properties of dendrimers in the melt from nonequlibrium molecular dynamics

    NASA Astrophysics Data System (ADS)

    Bosko, Jaroslaw T.; Todd, B. D.; Sadus, Richard J.

    2004-12-01

    The viscoelastic properties of dendrimers of generation 1-4 are studied using nonequilibrium molecular dynamics. Flow properties of dendrimer melts under shear are compared to systems composed of linear chain polymers of the same molecular weight, and the influence of molecular architecture is discussed. Rheological material properties, such as the shear viscosity and normal stress coefficients, are calculated and compared for both systems. We also calculate and compare the microscopic properties of both linear chain and dendrimer molecules, such as their molecular alignment, order parameters and rotational velocities. We find that the highly symmetric shape of dendrimers and their highly constrained geometry allows for substantial differences in their material properties compared to traditional linear polymers of equivalent molecular weight.

  14. Microwave-field-driven acoustic modes in DNA.

    PubMed Central

    Edwards, G S; Davis, C C; Saffer, J D; Swicord, M L

    1985-01-01

    The direct coupling of a microwave field to selected DNA molecules is demonstrated using standard dielectrometry. The absorption is resonant with a typical lifetime of 300 ps. Such a long lifetime is unexpected for DNA in aqueous solution at room temperature. Resonant absorption at fundamental and harmonic frequencies for both supercoiled circular and linear DNA agrees with an acoustic mode model. Our associated acoustic velocities for linear DNA are very close to the acoustic velocity of the longitudinal acoustic mode independently observed on DNA fibers using Brillouin spectroscopy. The difference in acoustic velocities for supercoiled circular and linear DNA is discussed in terms of solvent shielding of the nonbonded potentials in DNA. Images FIGURE 5 FIGURE 6 FIGURE 7 PMID:3893557

  15. HYDROLYSIS OF HALOACETONITRILES: LINEAR FREE ENERGY RELATIONSHIP, KINETICS AND PRODUCTS. (R825362)

    EPA Science Inventory

    Abstract

    The hydrolysis rates of mono-, di- and trihaloacetonitriles were studied in aqueous buffer solutions at different pH. The stability of haloacetonitriles decreases and the hydrolysis rate increases with increasing pH and number of halogen atoms in the molecule:...

  16. Linear Dichroism Characteristics of Ethidium and Proflavine Supercoiled DNA Complexes

    DTIC Science & Technology

    1990-01-01

    of Ethidium-and Proflavine -Supercoi led DNA Complexes CHARLES E. SWENBERG, 1 SUSAN E. CARBERRV, 2 * and NICHOLAS E. GEACINTOV’ SRadliationl Biochenitr...drug were stained with EB, photographed under uv light, molecules, EB and proflavine (PF) (Figure 1), and the bands were quantitated by densitometry

  17. The association of serum choline with linear growth failure in young children from rural Malawi

    USDA-ARS?s Scientific Manuscript database

    Choline is an essential nutrient for cell structure, cell signaling, neurotransmission, lipid transport, and bone formation. Choline can be irreversibly converted to betaine, a major source of methyl groups. Trimethylene N-oxide (TMAO), a proatherogenic molecule, is produced from the metabolism of d...

  18. Tandem repeats of the 5' non-transcribed spacer of Tetrahymena rDNA function as high copy number autonomous replicons in the macronucleus but do not prevent rRNA gene dosage regulation.

    PubMed Central

    Pan, W J; Blackburn, E H

    1995-01-01

    The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211

  19. Preferential interactions of trehalose, L-arginine.HCl and sodium chloride with therapeutically relevant IgG1 monoclonal antibodies.

    PubMed

    Sudrik, Chaitanya; Cloutier, Theresa; Pham, Phuong; Samra, Hardeep S; Trout, Bernhardt L

    2017-10-01

    Preferential interactions of weakly interacting formulation excipients govern their effect on the equilibrium and kinetics of several reactions of protein molecules in solution. Using vapor pressure osmometry, we characterized the preferential interactions of commonly used excipients trehalose, L-arginine.HCl and NaCl with three therapeutically-relevant, IgG1 monoclonal antibodies that have similar size and shape, but differ in their surface hydrophobicity and net charge. We further characterized the effect of these excipients on the reversible self-association, aggregation and viscosity behavior of these antibody molecules. We report that trehalose, L-arginine.HCl and NaCl are all excluded from the surface of the three IgG1 monoclonal antibodies, and that the exclusion behavior is linearly related to the excipient molality in the case of trehalose and NaCl, whereas a non-linear behavior is observed for L-arginine.HCl. Interestingly, we find that the magnitude of trehalose exclusion depends upon the nature of the protein surface. Such behavior is not observed in case of NaCl and L-arginine.HCl as they are excluded to the same extent from the surface of all three antibody molecules tested in this study. Analysis of data presented in this study provides further insight into the mechanisms governing excipient-mediated stabilization of mAb formulations.

  20. Computational method for analysis of polyethylene biodegradation

    NASA Astrophysics Data System (ADS)

    Watanabe, Masaji; Kawai, Fusako; Shibata, Masaru; Yokoyama, Shigeo; Sudate, Yasuhiro

    2003-12-01

    In a previous study concerning the biodegradation of polyethylene, we proposed a mathematical model based on two primary factors: the direct consumption or absorption of small molecules and the successive weight loss of large molecules due to β-oxidation. Our model is an initial value problem consisting of a differential equation whose independent variable is time. Its unknown variable represents the total weight of all the polyethylene molecules that belong to a molecular-weight class specified by a parameter. In this paper, we describe a numerical technique to introduce experimental results into analysis of our model. We first establish its mathematical foundation in order to guarantee its validity, by showing that the initial value problem associated with the differential equation has a unique solution. Our computational technique is based on a linear system of differential equations derived from the original problem. We introduce some numerical results to illustrate our technique as a practical application of the linear approximation. In particular, we show how to solve the inverse problem to determine the consumption rate and the β-oxidation rate numerically, and illustrate our numerical technique by analyzing the GPC patterns of polyethylene wax obtained before and after 5 weeks cultivation of a fungus, Aspergillus sp. AK-3. A numerical simulation based on these degradation rates confirms that the primary factors of the polyethylene biodegradation posed in modeling are indeed appropriate.

  1. Electric-field-driven electron-transfer in mixed-valence molecules.

    PubMed

    Blair, Enrique P; Corcelli, Steven A; Lent, Craig S

    2016-07-07

    Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate the electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.

  2. Modified atomic force microscope applied to the measurement of elastic modulus for a single peptide molecule

    NASA Astrophysics Data System (ADS)

    Ptak, Arkadiusz; Takeda, Seiji; Nakamura, Chikashi; Miyake, Jun; Kageshima, Masami; Jarvis, Suzanne P.; Tokumoto, Hiroshi

    2001-09-01

    A modified atomic force microscopy (AFM) system, based on a force modulation technique, has been used to find an approximate value for the elastic modulus of a single peptide molecule directly from a mechanical test. For this purpose a self-assembled monolayer built from two kinds of peptides, reactive (able to anchor to the AFM tip) and nonreactive, was synthesized. In a typical experiment a single C3K30C (C=cysteine, K=lysine) peptide molecule was stretched between a Au(111) substrate and the gold-coated tip of an AFM cantilever to which it was attached via gold-sulfur bonds. The amplitude of the cantilever oscillations, due to an external force applied via a magnetic particle to the cantilever, was recorded by a lock-in amplifier and recalculated into stiffness of the stretched molecule. A longitudinal Young's modulus for the α-helix of a single peptide molecule and for the elongated state of this molecule has been estimated. The obtained values; 1.2±0.3 and 50±15 GPa, for the peptide α-helix and elongated peptide backbone, respectively, seem to be reasonable comparing them to the Young's modulus of protein crystals and linear organic polymers. We believe this research opens up a means by which scientists can perform quantitative studies of the elastic properties of single molecule, especially of biologically important polymers like peptides or DNA.

  3. Concentration-related response potentiometric titrations to study the interaction of small molecules with large biomolecules.

    PubMed

    Hamidi-Asl, Ezat; Daems, Devin; De Wael, Karolien; Van Camp, Guy; Nagels, Luc J

    2014-12-16

    In the present paper, the utility of a special potentiometric titration approach for recognition and calculation of biomolecule/small-molecule interactions is reported. This approach is fast, sensitive, reproducible, and inexpensive in comparison to the other methods for the determination of the association constant values (Ka) and the interaction energies (ΔG). The potentiometric titration measurement is based on the use of a classical polymeric membrane indicator electrode in a solution of the small-molecule ligand. The biomolecule is used as a titrant. The potential is measured versus a reference electrode and transformed into a concentration-related signal over the entire concentration interval, also at low concentrations, where the millivolt (y-axis) versus log canalyte (x-axis) potentiometric calibration curve is not linear. In the procedure, Ka is calculated for the interaction of cocaine with a cocaine binding aptamer and with an anticocaine antibody. To study the selectivity and cross-reactivity, other oligonucleotides and aptamers are tested, as well as other small ligand molecules such as tetrakis(4-chlorophenyl)borate, metergoline, lidocaine, and bromhexine. The calculated Ka compared favorably to the value reported in the literature using surface plasmon resonance. The potentiometric titration approach called "concentration-related response potentiometry" is used to study molecular interaction for seven macromolecular target molecules and four small-molecule ligands.

  4. Signal-enhancer molecules encapsulated liposome as a valuable sensing and amplification platform combining the aptasensor for ultrasensitive ECL immunoassay.

    PubMed

    Mao, Li; Yuan, Ruo; Chai, Yaqin; Zhuo, Ying; Xiang, Yun

    2011-06-15

    An innovatory ECL immunoassay strategy was proposed to detect the newly developing heart failure biomarker N-terminal pro-brain natriuretic peptide (NT-proBNP). Firstly, this strategy used small molecules encapsulated liposome as immune label to construct a sandwich immune sensing platform for NT-proBNP. Then the ECL aptasensor was prepared to collect and detect the small molecules released from the liposome. Finally, based on the ECL signal changes caused by the small molecules, the ECL signal indirectly reflected the level of NT-proBNP antigen. In this experiment, the cocaine was chosen as the proper small molecule that can act as signal-enhancer to enhance the ECL of Ru(bpy)(3)(2+). The cocaine-encapsulated liposomes were successfully characterized by TEM. The quantificational calculation proved the ∼5.3×10(3) cocaine molecules per liposome enough to perform the assignment of signal amplification. The cocaine-binding ECL aptasensor further promoted the work aimed at amplifying signal. The performance of NT-proBNP assay by the proposed strategy exhibited high sensitivity and high specificities with a linear relationship over 0.01-500 ng mL(-1) range, and a detection limit down to 0.77 pg mL(-1). Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Synthesis and Combined Experimental and Theoretical Characterization of Dihydro-tetraaza-acenes

    PubMed Central

    2018-01-01

    We present a combined experimental and theoretical study of electronic and optical properties of dihydro-tetraaza-acenes (DHTAn). Using solvent-free condensation, we are able to synthesize not only DHTA5 but also the longer DHTA6 and DHTA7 molecules. We then investigate their gas-phase electronic structures by means of ab initio density functional calculations employing an optimally tuned range-separated hybrid functional. By comparing with the parent linear oligoacenes (nA) and based on computed ionization potentials and electron affinities, we predict DHTAn molecules to be more stable than acenes of the same length, where we expect DHTAn molecules to be persistent at least up to n = 7 rings. We further exploit the analogy with nA by analyzing the entire intramolecular π-band structure of the DHTAn molecules. This clearly reveals that the additional two electrons donated by the dihydropyrazine group are delocalized over the entire molecule and contribute to its π-electron system. As a consequence, the symmetry of the frontier orbitals of DHTAn differs from that of the parent nA molecule. This also affects the UV–vis absorption spectra which have been measured for DHTA5, 6, and 7 dissolved in dimethyl sulfoxide and analyzed by means of excited state calculations within a time-dependent density functional theory framework. PMID:29623149

  6. Linear nicking endonuclease-mediated strand-displacement DNA amplification.

    PubMed

    Joneja, Aric; Huang, Xiaohua

    2011-07-01

    We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand-displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to 5000 nucleotides can be linearly amplified using a nicking endonuclease with 7-bp recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length is linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Linear nicking endonuclease-mediated strand displacement DNA amplification

    PubMed Central

    Joneja, Aric; Huang, Xiaohua

    2011-01-01

    We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to five thousand nucleotides can be linearly amplified using a nicking endonuclease with seven base-pair recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length are linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. PMID:21342654

  8. Symmetry in circularly polarized molecular high-order harmonic generation with intense bicircular laser pulses

    NASA Astrophysics Data System (ADS)

    Yuan, Kai-Jun; Bandrauk, André D.

    2018-02-01

    We present symmetry effects of laser fields and molecular geometries in circularly polarized high-order harmonic generation by bichromatic counter-rotating circularly polarized laser pulses. Simulations are performed on oriented molecules by numerically solving time-dependent Schrödinger equations. We discuss how electron recollision trajectories by the orthogonal laser field polarizations influence the harmonic polarization by using a time-frequency analysis of harmonics. It is found that orientation-dependent asymmetric ionization in linear molecules due to Coulomb potentials gives rise to a dependence of the polarization on the harmonic frequency. Effects of Coriolis forces are also presented on harmonic generation. Electron recollision trajectories illustrate the effects of the relative symmetry of the field and the molecule, thus paving a method for circularly polarized attosecond pulse generation and molecular orbital imaging in more complex systems.

  9. Submillimeter Remote Sensing of Planetary and Cometary Atmospheres and LRO/LCROSS Observations of the Moon

    NASA Technical Reports Server (NTRS)

    Chin, Gordon

    2011-01-01

    Submillimeter remote sensing of planetary and cometary atmospheres have been proposed for Venus and Mars while MIRO on Rosetta will observe the coma of Comet 67P/Churyumov - Cierasimenko in December 2015, UARS and AURA MLS have observed millimeter and submillimeter molecule emissions in the Earth's stratosphere for many decades, Observations of submillimeter wave molecular emissions provide a wealth of information not obtainable by alternative techniques. Submillimeter line emissions exhibit linear temperature dependence, insensitivity to aerosol scattering, extinction, and have separated transitions with well determined line-shapes. These observations have high sensitivities to trace chemical species and can; 1) Fully resolve the line profiles of molecules with high resolution, 2) Provide deterministic retrievals of species abundance, temperature, and pressure, and 3) Measure Doppler shifts of detected molecules for wind velocities.

  10. Determination of structure parameters in strong-field tunneling ionization theory of molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao Songfeng; Jin Cheng; College of Physics and Electronic Engineering, Northwest Normal University, Lanzhou, Gansu 730070

    2010-03-15

    In the strong field molecular tunneling ionization theory of Tong et al. [Phys. Rev. A 66, 033402 (2002)], the ionization rate depends on the asymptotic wave function of the molecular orbital from which the electron is removed. The orbital wave functions obtained from standard quantum chemistry packages in general are not good enough in the asymptotic region. Here we construct a one-electron model potential for several linear molecules using density functional theory. We show that the asymptotic wave function can be improved with an iteration method and after one iteration accurate asymptotic wave functions and structure parameters are determined. Withmore » the new parameters we examine the alignment-dependent tunneling ionization probabilities for several molecules and compare with other calculations and with recent measurements, including ionization from inner molecular orbitals.« less

  11. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  12. Time-dependent analysis of the mixed-field orientation of molecules without rotational symmetry

    NASA Astrophysics Data System (ADS)

    Thesing, Linda V.; Küpper, Jochen; González-Férez, Rosario

    2017-06-01

    We present a theoretical study of the mixed-field orientation of molecules without rotational symmetry. The time-dependent one-dimensional and three-dimensional orientation of a thermal ensemble of 6-chloropyridazine-3-carbonitrile molecules in combined linearly or elliptically polarized laser fields and tilted dc electric fields is computed. The results are in good agreement with recent experimental results of one-dimensional orientation for weak dc electric fields [J. L. Hansen, J. Chem. Phys. 139, 234313 (2013)]. Moreover, they predict that using elliptically polarized laser fields or strong dc fields, three-dimensional orientation is obtained. The field-dressed dynamics of excited rotational states is characterized by highly non-adiabatic effects. We analyze the sources of these non-adiabatic effects and investigate their impact on the mixed-field orientation for different field configurations in mixed-field-orientation experiments.

  13. Improved pKa Prediction of Substituted Alcohols, Phenols, and Hydroperoxides in Aqueous Medium Using Density Functional Theory and a Cluster-Continuum Solvation Model.

    PubMed

    Thapa, Bishnu; Schlegel, H Bernhard

    2017-06-22

    Acid dissociation constants (pK a 's) are key physicochemical properties that are needed to understand the structure and reactivity of molecules in solution. Theoretical pK a 's have been calculated for a set of 72 organic compounds with -OH and -OOH groups (48 with known experimental pK a 's). This test set includes 17 aliphatic alcohols, 25 substituted phenols, and 30 hydroperoxides. Calculations in aqueous medium have been carried out with SMD implicit solvation and three hybrid DFT functionals (B3LYP, ωB97XD, and M06-2X) with two basis sets (6-31+G(d,p) and 6-311++G(d,p)). The effect of explicit water molecules on calculated pK a 's was assessed by including up to three water molecules. pK a 's calculated with only SMD implicit solvation are found to have average errors greater than 6 pK a units. Including one explicit water reduces the error by about 3 pK a units, but the error is still far from chemical accuracy. With B3LYP/6-311++G(d,p) and three explicit water molecules in SMD solvation, the mean signed error and standard deviation are only -0.02 ± 0.55; a linear fit with zero intercept has a slope of 1.005 and R 2 = 0.97. Thus, this level of theory can be used to calculate pK a 's directly without the need for linear correlations or thermodynamic cycles. Estimated pK a values are reported for 24 hydroperoxides that have not yet been determined experimentally.

  14. Linear Discriminant Analysis for the in Silico Discovery of Mechanism-Based Reversible Covalent Inhibitors of a Serine Protease: Application of Hydration Thermodynamics Analysis and Semi-empirical Molecular Orbital Calculation.

    PubMed

    Masuda, Yosuke; Yoshida, Tomoki; Yamaotsu, Noriyuki; Hirono, Shuichi

    2018-01-01

    We recently reported that the Gibbs free energy of hydrolytic water molecules (ΔG wat ) in acyl-trypsin intermediates calculated by hydration thermodynamics analysis could be a useful metric for estimating the catalytic rate constants (k cat ) of mechanism-based reversible covalent inhibitors. For thorough evaluation, the proposed method was tested with an increased number of covalent ligands that have no corresponding crystal structures. After modeling acyl-trypsin intermediate structures using flexible molecular superposition, ΔG wat values were calculated according to the proposed method. The orbital energies of antibonding π* molecular orbitals (MOs) of carbonyl C=O in covalently modified catalytic serine (E orb ) were also calculated by semi-empirical MO calculations. Then, linear discriminant analysis (LDA) was performed to build a model that can discriminate covalent inhibitor candidates from substrate-like ligands using ΔG wat and E orb . The model was built using a training set (10 compounds) and then validated by a test set (4 compounds). As a result, the training set and test set ligands were perfectly discriminated by the model. Hydrolysis was slower when (1) the hydrolytic water molecule has lower ΔG wat ; (2) the covalent ligand presents higher E orb (higher reaction barrier). Results also showed that the entropic term of hydrolytic water molecule (-TΔS wat ) could be used for estimating k cat and for covalent inhibitor optimization; when the rotational freedom of the hydrolytic water molecule is limited, the chance for favorable interaction with the electrophilic acyl group would also be limited. The method proposed in this study would be useful for screening and optimizing the mechanism-based reversible covalent inhibitors.

  15. Single-molecule force spectroscopy study of interactions between angiotensin II type 1 receptor and different biased ligands in living cells.

    PubMed

    Li, Wenhui; Xu, Jiachao; Kou, Xiaolong; Zhao, Rong; Zhou, Wei; Fang, Xiaohong

    2018-05-01

    Angiotensin II type 1 receptor (AT1R), a typical G protein-coupled receptor, plays a key role in regulating many cardiovascular functions. Different ligands can bind with AT1R to selectively activate either G protein (Gq) or β-arrestin (β-arr) pathway, or both pathways, but the molecular mechanism is not clear yet. In this work, we used, for the first time, atomic force microscopy-based single molecule force spectroscopy (SMFS) to study the interactions of AT1R with three types of ligands, balanced ligand, Gq-biased ligand, and β-arr-biased ligand, in living cells. The results revealed their difference in binding force and binding stability. The complex of the Gq-biased ligand-AT1R overcame two energy barriers with an intermediate state during dissociation, whereas that of β-arr-biased ligand-AT1R complex overcame one energy barrier. This indicated that AT1R had different ligand-binding conformational substates and underwent different structural changes to activate downstream signaling pathways with variable agonist efficacies. Quantitative analysis of AT1R-ligand binding in living cells at the single-molecule level offers a new tool to study the molecular mechanism of AT1R biased activation. Graphical Abstract Single-molecule force measurement on the living cell expressing AT1R-eGFP with a ligand modified AFM tip (left), the dynamic force spectra of β-arrestin biased ligands-AT1R (middle), and Gq-biased ligands-AT1R (right). The complexes of β-arr-biased ligand-AT1R overcame one energy barrier, with one linear region in the spectra, whereas the Gq-biased ligand-AT1R complexes overcame two energy barriers with two linear regions.

  16. Do dihydroxymagnesium carboxylates form Grignard-type reagents? A theoretical investigation on decarboxylative fragmentation.

    PubMed

    Ruf, Alexander; Kanawati, Basem; Schmitt-Kopplin, Philippe

    2018-03-27

    Dihydroxymagnesium carboxylates [(OH) 2 MgO 2 CR] were probed for decarboxylation on a theoretical level, by utilizing both Møller-Plesset perturbation theory (MP2) and density functional theory (B3LYP-DFT) computations. This study is connected to the question of whether this recently introduced, astrobiologically relevant chemical class may form Grignard-type reagent molecules. To extract trends for a broad molecular mass range, different linear alkyl chain lengths between C 4 and C 11 were computed. The forward energy barrier for decarboxylation reactions increases linearly as a function of the ligand's chain length. Decarboxylation-type fragmentations of these organomagnesium compounds seem to be improbable in non-catalytic, low energetic environments. A high forward energy barrier (E MP2  > 55 kcal mol -1 ) towards a described transition state restricts the release of CO 2 . Nevertheless, we propose the release of CO 2 on a theoretical level, as been revealed via an intramolecular nucleophilic attack mechanism. Once the challenging transition state for decarboxylation is overcome, a stable Mg-C bond is formed. These mechanistic insights were gained by help of natural bond orbital analysis. The Cα atom (first carbon atom in the ligand chain attached to the carboxyl group) is thought to prefer binding towards the electrophilic magnesium coordination center, rather than towards the electrophilic CO 2 -carbon atom. Additionally, the putatively formed Grignard-type OH-bearing product molecules possess a more polarized Mg-C bond in comparison to RMgCl species. Therefore, carbanion formation from OH-bearing Grignard-type molecules is made feasible for triggering C-C bond formation reactions. Graphical abstract This study asks whether recently introduced, astrobiologically dihydroxymagnesium carboxylates form Grignard-type reagent molecules via decarboxylative fragmentation.

  17. Investigation of Mechanisms of Viscoelastic Behavior of Collagen Molecule

    PubMed Central

    Ghodsi, Hossein; Darvish, Kurosh

    2015-01-01

    Unique mechanical properties of collagen molecule make it one of the most important and abundant proteins in animals. Many tissues such as connective tissues rely on these properties to function properly. In the past decade, molecular dynamics (MD) simulations have been used extensively to study the mechanical behavior of molecules. For collagen, MD simulations were primarily used to determine its elastic properties. In this study, constant force steered MD simulations were used to perform creep tests on collagen molecule segments. The mechanical behavior of the segments, with lengths of approximately 20 (1X), 38 (2X), 74 (4X), and 290 nm (16X), was characterized using a quasi-linear model to describe the observed viscoelastic responses. To investigate the mechanisms of the viscoelastic behavior, hydrogen bonds (H-bonds) rupture/formation time history of the segments were analyzed and it was shown that the formation growth rate of H-bonds in the system is correlated with the creep growth rate of the segment ( β = 2.41 βH). In addition, a linear relationship between H-bonds formation growth rate and the length of the segment was quantified. Based on these findings, a general viscoelastic model was developed and verified where, using the smallest segment as a building block, the viscoelastic properties of larger segments could be predicted. In addition, the effect of temperature control methods on the mechanical properties were studied, and it was shown that application of Langevin Dynamics had adverse effect on these properties while the Lowe-Anderson method was shown to be more appropriate for this application. This study provides information that is essential for multi-scale modeling of collagen fibrils using a bottom-up approach. PMID:26256473

  18. Investigation of mechanisms of viscoelastic behavior of collagen molecule.

    PubMed

    Ghodsi, Hossein; Darvish, Kurosh

    2015-11-01

    Unique mechanical properties of collagen molecule make it one of the most important and abundant proteins in animals. Many tissues such as connective tissues rely on these properties to function properly. In the past decade, molecular dynamics (MD) simulations have been used extensively to study the mechanical behavior of molecules. For collagen, MD simulations were primarily used to determine its elastic properties. In this study, constant force steered MD simulations were used to perform creep tests on collagen molecule segments. The mechanical behavior of the segments, with lengths of approximately 20 (1X), 38 (2X), 74 (4X), and 290 nm (16X), was characterized using a quasi-linear model to describe the observed viscoelastic responses. To investigate the mechanisms of the viscoelastic behavior, hydrogen bonds (H-bonds) rupture/formation time history of the segments were analyzed and it was shown that the formation growth rate of H-bonds in the system is correlated with the creep growth rate of the segment (β=2.41βH). In addition, a linear relationship between H-bonds formation growth rate and the length of the segment was quantified. Based on these findings, a general viscoelastic model was developed and verified here, using the smallest segment as a building block, the viscoelastic properties of larger segments could be predicted. In addition, the effect of temperature control methods on the mechanical properties were studied, and it was shown that application of Langevin Dynamics had adverse effect on these properties while the Lowe-Anderson method was shown to be more appropriate for this application. This study provides information that is essential for multi-scale modeling of collagen fibrils using a bottom-up approach. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Size-independent neural networks based first-principles method for accurate prediction of heat of formation of fuels

    NASA Astrophysics Data System (ADS)

    Yang, GuanYa; Wu, Jiang; Chen, ShuGuang; Zhou, WeiJun; Sun, Jian; Chen, GuanHua

    2018-06-01

    Neural network-based first-principles method for predicting heat of formation (HOF) was previously demonstrated to be able to achieve chemical accuracy in a broad spectrum of target molecules [L. H. Hu et al., J. Chem. Phys. 119, 11501 (2003)]. However, its accuracy deteriorates with the increase in molecular size. A closer inspection reveals a systematic correlation between the prediction error and the molecular size, which appears correctable by further statistical analysis, calling for a more sophisticated machine learning algorithm. Despite the apparent difference between simple and complex molecules, all the essential physical information is already present in a carefully selected set of small molecule representatives. A model that can capture the fundamental physics would be able to predict large and complex molecules from information extracted only from a small molecules database. To this end, a size-independent, multi-step multi-variable linear regression-neural network-B3LYP method is developed in this work, which successfully improves the overall prediction accuracy by training with smaller molecules only. And in particular, the calculation errors for larger molecules are drastically reduced to the same magnitudes as those of the smaller molecules. Specifically, the method is based on a 164-molecule database that consists of molecules made of hydrogen and carbon elements. 4 molecular descriptors were selected to encode molecule's characteristics, among which raw HOF calculated from B3LYP and the molecular size are also included. Upon the size-independent machine learning correction, the mean absolute deviation (MAD) of the B3LYP/6-311+G(3df,2p)-calculated HOF is reduced from 16.58 to 1.43 kcal/mol and from 17.33 to 1.69 kcal/mol for the training and testing sets (small molecules), respectively. Furthermore, the MAD of the testing set (large molecules) is reduced from 28.75 to 1.67 kcal/mol.

  20. Topological events in single molecules of E. coli DNA confined in nanochannels

    PubMed Central

    Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

    2015-01-01

    We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

  1. From synthesis to function via iterative assembly of N-methyliminodiacetic acid boronate building blocks.

    PubMed

    Li, Junqi; Grillo, Anthony S; Burke, Martin D

    2015-08-18

    The study and optimization of small molecule function is often impeded by the time-intensive and specialist-dependent process that is typically used to make such compounds. In contrast, general and automated platforms have been developed for making peptides, oligonucleotides, and increasingly oligosaccharides, where synthesis is simplified to iterative applications of the same reactions. Inspired by the way natural products are biosynthesized via the iterative assembly of a defined set of building blocks, we developed a platform for small molecule synthesis involving the iterative coupling of haloboronic acids protected as the corresponding N-methyliminodiacetic acid (MIDA) boronates. Here we summarize our efforts thus far to develop this platform into a generalized and automated approach for small molecule synthesis. We and others have employed this approach to access many polyene-based compounds, including the polyene motifs found in >75% of all polyene natural products. This platform further allowed us to derivatize amphotericin B, the powerful and resistance-evasive but also highly toxic last line of defense in treating systemic fungal infections, and thereby understand its mechanism of action. This synthesis-enabled mechanistic understanding has led us to develop less toxic derivatives currently under evaluation as improved antifungal agents. To access more Csp(3)-containing small molecules, we gained a stereocontrolled entry into chiral, non-racemic α-boryl aldehydes through the discovery of a chiral derivative of MIDA. These α-boryl aldehydes are versatile intermediates for the synthesis of many Csp(3) boronate building blocks that are otherwise difficult to access. In addition, we demonstrated the utility of these types of building blocks in accessing pharmaceutically relevant targets via an iterative Csp(3) cross-coupling cycle. We have further expanded the scope of the platform to include stereochemically complex macrocyclic and polycyclic molecules using a linear-to-cyclized strategy, in which Csp(3) boronate building blocks are iteratively assembled into linear precursors that are then cyclized into the cyclic frameworks found in many natural products and natural product-like structures. Enabled by the serendipitous discovery of a catch-and-release protocol for generally purifying MIDA boronate intermediates, the platform has been automated. The synthesis of 14 distinct classes of small molecules, including pharmaceuticals, materials components, and polycyclic natural products, has been achieved using this new synthesis machine. It is anticipated that the scope of small molecules accessible by this platform will continue to expand via further developments in building block synthesis, Csp(3) cross-coupling methodologies, and cyclization strategies. Achieving these goals will enable the more generalized synthesis of small molecules and thereby help shift the rate-limiting step in small molecule science from synthesis to function.

  2. Salting effects on protein components in aqueous NaCl and urea solutions: toward understanding of urea-induced protein denaturation.

    PubMed

    Li, Weifeng; Zhou, Ruhong; Mu, Yuguang

    2012-02-02

    The mechanism of urea-induced protein denaturation is explored through studying the salting effect of urea on 14 amino acid side chain analogues, and N-methylacetamide (NMA) which mimics the protein backbone. The solvation free energies of the 15 molecules were calculated in pure water, aqueous urea, and NaCl solutions. Our results show that NaCl displays strong capability to salt out all 15 molecules, while urea facilitates the solvation (salting-in) of all the 15 molecules on the other hand. The salting effect is found to be largely enthalpy-driven for both NaCl and urea. Our observations can explain the higher stability of protein's secondary and tertiary structures in typical salt solutions than that in pure water. Meanwhile, urea's capability to better solvate protein backbone and side-chain components can be extrapolated to explain protein's denaturation in aqueous urea solution. Urea salts in molecules through direct binding to solute surface, and the strength is linearly dependent on the number of heavy atoms of solute molecules. The van der Waals interactions are found to be the dominant force, which challenges a hydrogen-bonding-driven mechanism proposed previously.

  3. How to probe transverse magnetic anisotropy of a single-molecule magnet by electronic transport?

    NASA Astrophysics Data System (ADS)

    Misiorny, M.; Burzuri, E.; Gaudenzi, R.; Park, K.; Leijnse, M.; Wegewijs, M.; Paaske, J.; Cornia, A.; van der Zant, H.

    We propose an approach for in-situ determination of the transverse magnetic anisotropy (TMA) of an individual molecule by electronic transport measurements, see Phys. Rev. B 91, 035442 (2015). We study a Fe4 single-molecule magnet (SMM) captured in a gateable junction, a unique tool for addressing the spin in different redox states of a molecule. We show that, due to mixing of the spin eigenstates of the SMM, the TMA significantly manifests itself in transport. We predict and experimentally observe the pronounced intensity modulation of the Coulomb peak amplitude with the magnetic field in the linear-response transport regime, from which the TMA parameter E can be estimated. Importantly, the method proposed here does not rely on the small induced tunnelling effects and, hence, works well at temperatures and electron tunnel broadenings by far exceeding the tunnel splittings and even E itself. We deduce that the TMA for a single Fe4 molecule captured in a junction is substantially larger than the bulk value. Work supported by the Polish Ministry of Science and Education as `Iuventus Plus' project (IP2014 030973) in years 2015-2016.

  4. Methylbenzenes on graphene

    NASA Astrophysics Data System (ADS)

    Borck, Øyvind; Schröder, Elsebeth

    2017-10-01

    We present a theory study of the physisorption of the series of methylbenzenes (toluene, xylene and mesitylene), as well as benzene, on graphene. The aim is two fold: we provide data that will be used as input to larger-scale methods like molecular-dynamics simulations, and at the same time we enhance the basic understanding of graphene used as a material for sensors and as an idealized model for the carbon in active carbon filters. The molecules are studied in a number of positions and orientations relative to graphene, using density functional theory with the van der Waals functional vdW-DF. The molecules are adsorbed fractional coverage. We focus on the vdW-DF1 and vdW-DF-cx functionals, and find that the binding energy of the molecules on graphene grows linearly with the number of methyl groups, at the rate of 0.09 eV (vdW-DF1) to 0.11 eV (vdW-DF-cx) per added methyl group. We further find that the orientation of the methyl groups of the molecules relative to graphene is at least as important as the lateral position of the whole molecule on graphene.

  5. Fluorescence Imaging of Two-Photon Linear Dichroism: Cholesterol Depletion Disrupts Molecular Orientation in Cell Membranes

    PubMed Central

    Benninger, Richard K. P.; Önfelt, Björn; Neil, Mark A. A.; Davis, Daniel M.; French, Paul M. W.

    2005-01-01

    The plasma membrane of cells is an ordered environment, giving rise to anisotropic orientation and restricted motion of molecules and proteins residing in the membrane. At the same time as being an organized matrix of defined structure, the cell membrane is heterogeneous and dynamic. Here we present a method where we use fluorescence imaging of linear dichroism to measure the orientation of molecules relative to the cell membrane. By detecting linear dichroism as well as fluorescence anisotropy, the orientation parameters are separated from dynamic properties such as rotational diffusion and homo energy transfer (energy migration). The sensitivity of the technique is enhanced by using two-photon excitation for higher photo-selection compared to single photon excitation. We show here that we can accurately image lipid organization in whole cell membranes and in delicate structures such as membrane nanotubes connecting two cells. The speed of our wide-field imaging system makes it possible to image changes in orientation and anisotropy occurring on a subsecond timescale. This is demonstrated by time-lapse studies showing that cholesterol depletion rapidly disrupts the orientation of a fluorophore located within the hydrophobic region of the cell membrane but not of a surface bound probe. This is consistent with cholesterol having an important role in stabilizing and ordering the lipid tails within the plasma membrane. PMID:15520272

  6. Replication intermediates of the linear mitochondrial DNA of Candida parapsilosis suggest a common recombination based mechanism for yeast mitochondria.

    PubMed

    Gerhold, Joachim M; Sedman, Tiina; Visacka, Katarina; Slezakova, Judita; Tomaska, Lubomir; Nosek, Jozef; Sedman, Juhan

    2014-08-15

    Variation in the topology of mitochondrial DNA (mtDNA) in eukaryotes evokes the question if differently structured DNAs are replicated by a common mechanism. RNA-primed DNA synthesis has been established as a mechanism for replicating the circular animal/mammalian mtDNA. In yeasts, circular mtDNA molecules were assumed to be templates for rolling circle DNA-replication. We recently showed that in Candida albicans, which has circular mapping mtDNA, recombination driven replication is a major mechanism for replicating a complex branched mtDNA network. Careful analyses of C. albicans-mtDNA did not reveal detectable amounts of circular DNA molecules. In the present study we addressed the question of how the unit sized linear mtDNA of Candida parapsilosis terminating at both ends with arrays of tandem repeats (mitochondrial telomeres) is replicated. Originally, we expected to find replication intermediates diagnostic of canonical bi-directional replication initiation at the centrally located bi-directional promoter region. However, we found that the linear mtDNA of Candida parapsilosis also employs recombination for replication initiation. The most striking findings were that the mitochondrial telomeres appear to be hot spots for recombination driven replication, and that stable RNA:DNA hybrids, with a potential role in mtDNA replication, are also present in the mtDNA preparations. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Replication Intermediates of the Linear Mitochondrial DNA of Candida parapsilosis Suggest a Common Recombination Based Mechanism for Yeast Mitochondria*

    PubMed Central

    Gerhold, Joachim M.; Sedman, Tiina; Visacka, Katarina; Slezakova, Judita; Tomaska, Lubomir; Nosek, Jozef; Sedman, Juhan

    2014-01-01

    Variation in the topology of mitochondrial DNA (mtDNA) in eukaryotes evokes the question if differently structured DNAs are replicated by a common mechanism. RNA-primed DNA synthesis has been established as a mechanism for replicating the circular animal/mammalian mtDNA. In yeasts, circular mtDNA molecules were assumed to be templates for rolling circle DNA-replication. We recently showed that in Candida albicans, which has circular mapping mtDNA, recombination driven replication is a major mechanism for replicating a complex branched mtDNA network. Careful analyses of C. albicans-mtDNA did not reveal detectable amounts of circular DNA molecules. In the present study we addressed the question of how the unit sized linear mtDNA of Candida parapsilosis terminating at both ends with arrays of tandem repeats (mitochondrial telomeres) is replicated. Originally, we expected to find replication intermediates diagnostic of canonical bi-directional replication initiation at the centrally located bi-directional promoter region. However, we found that the linear mtDNA of Candida parapsilosis also employs recombination for replication initiation. The most striking findings were that the mitochondrial telomeres appear to be hot spots for recombination driven replication, and that stable RNA:DNA hybrids, with a potential role in mtDNA replication, are also present in the mtDNA preparations. PMID:24951592

  8. Exciton confinement in organic dendrimer quantum wells for opto-electronic applications

    NASA Astrophysics Data System (ADS)

    Lupton, J. M.; Samuel, I. D. W.; Burn, P. L.; Mukamel, S.

    2002-01-01

    Organic dendrimers are a fascinating new class of materials for opto-electronic applications. We present coupled electronic oscillator calculations on novel nanoscale conjugated dendrimers for use in organic light-emitting diodes. Strong confinement of excitations at the center of the dendrimers is observed, which accounts for the dependence of intermolecular interactions and charge transport on the degree of branching of the dendrimer. The calculated absorption spectra are in excellent agreement with the measured data and show that benzene rings are shared between excitations on the linear segments of the hyperbranched molecules. The coupled electronic oscillator approach is ideally suited to treat large dendritic molecules.

  9. Photoionization cross section by Stieltjes imaging applied to coupled cluster Lanczos pseudo-spectra

    NASA Astrophysics Data System (ADS)

    Cukras, Janusz; Coriani, Sonia; Decleva, Piero; Christiansen, Ove; Norman, Patrick

    2013-09-01

    A recently implemented asymmetric Lanczos algorithm for computing (complex) linear response functions within the coupled cluster singles (CCS), coupled cluster singles and iterative approximate doubles (CC2), and coupled cluster singles and doubles (CCSD) is coupled to a Stieltjes imaging technique in order to describe the photoionization cross section of atoms and molecules, in the spirit of a similar procedure recently proposed by Averbukh and co-workers within the Algebraic Diagrammatic Construction approach. Pilot results are reported for the atoms He, Ne, and Ar and for the molecules H2, H2O, NH3, HF, CO, and CO2.

  10. Photoionization cross section by Stieltjes imaging applied to coupled cluster Lanczos pseudo-spectra.

    PubMed

    Cukras, Janusz; Coriani, Sonia; Decleva, Piero; Christiansen, Ove; Norman, Patrick

    2013-09-07

    A recently implemented asymmetric Lanczos algorithm for computing (complex) linear response functions within the coupled cluster singles (CCS), coupled cluster singles and iterative approximate doubles (CC2), and coupled cluster singles and doubles (CCSD) is coupled to a Stieltjes imaging technique in order to describe the photoionization cross section of atoms and molecules, in the spirit of a similar procedure recently proposed by Averbukh and co-workers within the Algebraic Diagrammatic Construction approach. Pilot results are reported for the atoms He, Ne, and Ar and for the molecules H2, H2O, NH3, HF, CO, and CO2.

  11. Coagulation of linear carbon molecules into nanoparticles: a molecular dynamics study

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Yasutaka; Wakabayashi, Tomonari

    2004-04-01

    Using molecular dynamics (MD) simulations, the coagulation of carbon chain molecules that occurs on the subliming surface of a carbon-containing rare-gas matrix is investigated. Intermolecular connections with dangling bonds enhance the sublimation of the matrix and that results in the emission of a layer of nested carbon chains into vacuum at a velocity about 100 m/s. The following conversion from carbon sp- to more stable sp 2-type bonds heats up the carbon material above 3000 K. During this process, the nested carbon layer self-anneals via a graphitic mono-layer into a conjunct array of particles with a dimension about 10 nm.

  12. Competing Thermodynamic and Dynamic Factors Select Molecular Assemblies on a Gold Surface

    NASA Astrophysics Data System (ADS)

    Haxton, Thomas K.; Zhou, Hui; Tamblyn, Isaac; Eom, Daejin; Hu, Zonghai; Neaton, Jeffrey B.; Heinz, Tony F.; Whitelam, Stephen

    2013-12-01

    Controlling the self-assembly of surface-adsorbed molecules into nanostructures requires understanding physical mechanisms that act across multiple length and time scales. By combining scanning tunneling microscopy with hierarchical ab initio and statistical mechanical modeling of 1,4-substituted benzenediamine (BDA) molecules adsorbed on a gold (111) surface, we demonstrate that apparently simple nanostructures are selected by a subtle competition of thermodynamics and dynamics. Of the collection of possible BDA nanostructures mechanically stabilized by hydrogen bonding, the interplay of intermolecular forces, surface modulation, and assembly dynamics select at low temperature a particular subset: low free energy oriented linear chains of monomers and high free energy branched chains.

  13. A computational study of the TiO2 molecule

    NASA Technical Reports Server (NTRS)

    Ramana, M. V.; Phillips, D. H.

    1988-01-01

    A computational investigation of the ground 1A1 and lowest energy B2 states of the titanium dioxide molecule has been carried out. The treatment utilized SCF calculations in an extended basis followed by a CI treatment for each geometry. The ground state geometry agrees well with experiment, while the agreement between the computed vibrational frequency nu1 and the experimental value for a matrix isolated TiO2 is less satisfactory. Population analysis for the ground state indicates less than one excess electron on each oxygen atom. The first excited state has a linear geometry and the singlet and triplet are essentially degenerate.

  14. A series of fluorene-based two-photon absorbing molecules: synthesis, linear and nonlinear characterization, and bioimaging

    PubMed Central

    Andrade, Carolina D.; Yanez, Ciceron O.; Rodriguez, Luis; Belfield, Kevin D.

    2010-01-01

    The synthesis, structural, and photophysical characterization of a series of new fluorescent donor–acceptor and acceptor-acceptor molecules, based on the fluorenyl ring system, with two-photon absorbing properties is described. These new compounds exhibited large Stokes shifts, high fluorescent quantum yields, and, significantly, high two-photon absorption cross sections, making them well suited for two-photon fluorescence microscopy (2PFM) imaging. Confocal and two-photon fluorescence microscopy imaging of COS-7 and HCT 116 cells incubated with probe I showed endosomal selectivity, demonstrating the potential of this class of fluorescent probes in multiphoton fluorescence microscopy. PMID:20481596

  15. Laboratory measurements of the millimeter-wave spectra of calcium isocyanide

    NASA Astrophysics Data System (ADS)

    Steimle, Timothy C.; Saito, Shuji; Takano, Shuro

    1993-06-01

    The ground state of CaNC is presently characterized by mm-wave spectroscopy, using a standard Hamiltonian linear molecule model to analyze the spectrum. The resulting spectroscopic parameters were used to predict the transition frequencies and Einstein A-coefficients, which should make possible a quantitative astrophysical search for CaNC.

  16. Guaiacol hydrodeoxygenation mechanism on Pt(111): Insights from density functional theory and linear free energy relations

    USDA-ARS?s Scientific Manuscript database

    In this study density functional theory (DFT) was used to study the adsorption of guaiacol and its initial hydrodeoxygenation (HDO) reactions on Pt(111). Previously reported Brønsted–Evans–Polanyi (BEP) correlations for small open chain molecules are found to be inadequate in estimating the reaction...

  17. A Simple Demonstration of Atomic and Molecular Orbitals Using Circular Magnets

    ERIC Educational Resources Information Center

    Chakraborty, Maharudra; Mukhopadhyay, Subrata; Das, Ranendu Sekhar

    2014-01-01

    A quite simple and inexpensive technique is described here to represent the approximate shapes of atomic orbitals and the molecular orbitals formed by them following the principles of the linear combination of atomic orbitals (LCAO) method. Molecular orbitals of a few simple molecules can also be pictorially represented. Instructors can employ the…

  18. Aflatoxin B1 Detection Using a Highly-Sensitive Molecularly-Imprinted Electrochemical Sensor Based on an Electropolymerized Metal Organic Framework

    PubMed Central

    Jiang, Mengjuan; Braiek, Mohamed; Florea, Anca; Chrouda, Amani; Farre, Carole; Bonhomme, Anne; Bessueille, Francois; Vocanson, Francis; Zhang, Aidong; Jaffrezic-Renault, Nicole

    2015-01-01

    A sensitive electrochemical molecularly-imprinted sensor was developed for the detection of aflatoxin B1 (AFB1), by electropolymerization of p-aminothiophenol-functionalized gold nanoparticles in the presence of AFB1 as a template molecule. The extraction of the template leads to the formation of cavities that are able to specifically recognize and bind AFB1 through π-π interactions between AFB1 molecules and aniline moities. The performance of the developed sensor for the detection of AFB1 was investigated by linear sweep voltammetry using a hexacyanoferrate/hexacyanoferrite solution as a redox probe, the electron transfer rate increasing when the concentration of AFB1 increases, due to a p-doping effect. The molecularly-imprinted sensor exhibits a broad linear range, between 3.2 fM and 3.2 µM, and a quantification limit of 3 fM. Compared to the non-imprinted sensor, the imprinting factor was found to be 10. Selectivity studies were also performed towards the binding of other aflatoxins and ochratoxin A, proving good selectivity. PMID:26371042

  19. Multidimensional biochemical information processing of dynamical patterns

    NASA Astrophysics Data System (ADS)

    Hasegawa, Yoshihiko

    2018-02-01

    Cells receive signaling molecules by receptors and relay information via sensory networks so that they can respond properly depending on the type of signal. Recent studies have shown that cells can extract multidimensional information from dynamical concentration patterns of signaling molecules. We herein study how biochemical systems can process multidimensional information embedded in dynamical patterns. We model the decoding networks by linear response functions, and optimize the functions with the calculus of variations to maximize the mutual information between patterns and output. We find that, when the noise intensity is lower, decoders with different linear response functions, i.e., distinct decoders, can extract much information. However, when the noise intensity is higher, distinct decoders do not provide the maximum amount of information. This indicates that, when transmitting information by dynamical patterns, embedding information in multiple patterns is not optimal when the noise intensity is very large. Furthermore, we explore the biochemical implementations of these decoders using control theory and demonstrate that these decoders can be implemented biochemically through the modification of cascade-type networks, which are prevalent in actual signaling pathways.

  20. Detailed solvent, structural, quantum chemical study and antimicrobial activity of isatin Schiff base

    NASA Astrophysics Data System (ADS)

    Brkić, Dominik R.; Božić, Aleksandra R.; Marinković, Aleksandar D.; Milčić, Miloš K.; Prlainović, Nevena Ž.; Assaleh, Fathi H.; Cvijetić, Ilija N.; Nikolić, Jasmina B.; Drmanić, Saša Ž.

    2018-05-01

    The ratios of E/Z isomers of sixteen synthesized 1,3-dihydro-3-(substituted phenylimino)-2H-indol-2-one were studied using experimental and theoretical methodology. Linear solvation energy relationships (LSER) rationalized solvent influence of the solvent-solute interactions on the UV-Vis absorption maxima shifts (νmax) of both geometrical isomers using the Kamlet-Taft equation. Linear free energy relationships (LFER) in the form of single substituent parameter equation (SSP) was used to analyze substituent effect on pKa, NMR chemical shifts and νmax values. Electron charge density was obtained by the use of Quantum Theory of Atoms in Molecules, i.e. Bader's analysis. The substituent and solvent effect on intramolecular charge transfer (ICT) were interpreted with the aid of time-dependent density functional (TD-DFT) method. Additionally, the results of TD-DFT calculations quantified the efficiency of ICT from the calculated charge-transfer distance (DCT) and amount of transferred charge (QCT). The antimicrobial activity was evaluated using broth microdilution method. 3D QSAR modeling was used to demonstrate the influence of substituents effect as well as molecule geometry on antimicrobial activity.

  1. Perspective: THz-driven nuclear dynamics from solids to molecules

    PubMed Central

    Hamm, Peter; Meuwly, Markus; Johnson, Steve L.; Beaud, Paul; Staub, Urs

    2017-01-01

    Recent years have seen dramatic developments in the technology of intense pulsed light sources in the THz frequency range. Since many dipole-active excitations in solids and molecules also lie in this range, there is now a tremendous potential to use these light sources to study linear and nonlinear dynamics in such systems. While several experimental investigations of THz-driven dynamics in solid-state systems have demonstrated a variety of interesting linear and nonlinear phenomena, comparatively few efforts have been made to drive analogous dynamics in molecular systems. In the present Perspective article, we discuss the similarities and differences between THz-driven dynamics in solid-state and molecular systems on both conceptual and practical levels. We also discuss the experimental parameters needed for these types of experiments and thereby provide design criteria for a further development of this new research branch. Finally, we present a few recent examples to illustrate the rich physics that may be learned from nonlinear THz excitations of phonons in solids as well as inter-molecular vibrations in liquid and gas-phase systems. PMID:29308420

  2. Use of synthetic analogues in confirmation of structure of the peptide antibiotics Maltacines

    NASA Astrophysics Data System (ADS)

    Hagelin, Gunnar; Indrevoll, Bård; Hoeg-Jensen, Thomas

    2007-12-01

    Maltacines comprise a family of cyclic peptide lactone antibiotics produced by a strain of Bacillus subtilis. The previously proposed amino acid sequences of the linear ring-opened molecules show similarity to the lipopeptide antibiotic Fengycin IX that is also produced by a strain of B. subtilisE There were some discrepancies in the Maltacin data that could not be explained. To address this and gain more information into the structure of the linear ring-opened Maltacines, the two members D1c, E1b and Fengycin IX acid were synthesised and their MS2, MS3 and MS4 spectra compared. The similarity of the product ion spectra of Maltacin and Fengycin IX acid revealed that proline occupies an internal position in Maltacin. This finding led to revision of the interpretation of the amino acid sequences of the Maltacines. The proposed new structures of the Maltacines shows that the cyclic part of the molecules is the same as in Fengycin IX acid and Fengycin XII acid, but they have unique N-terminal sequences not found in Fengycins, and thus represent novel lipopeptide antibiotics.

  3. Perspective: THz-driven nuclear dynamics from solids to molecules.

    PubMed

    Hamm, Peter; Meuwly, Markus; Johnson, Steve L; Beaud, Paul; Staub, Urs

    2017-11-01

    Recent years have seen dramatic developments in the technology of intense pulsed light sources in the THz frequency range. Since many dipole-active excitations in solids and molecules also lie in this range, there is now a tremendous potential to use these light sources to study linear and nonlinear dynamics in such systems. While several experimental investigations of THz-driven dynamics in solid-state systems have demonstrated a variety of interesting linear and nonlinear phenomena, comparatively few efforts have been made to drive analogous dynamics in molecular systems. In the present Perspective article, we discuss the similarities and differences between THz-driven dynamics in solid-state and molecular systems on both conceptual and practical levels. We also discuss the experimental parameters needed for these types of experiments and thereby provide design criteria for a further development of this new research branch. Finally, we present a few recent examples to illustrate the rich physics that may be learned from nonlinear THz excitations of phonons in solids as well as inter-molecular vibrations in liquid and gas-phase systems.

  4. Comparison study for multiple ionization of carbonyl sulfide by linearly and circularly polarized intense femtosecond laser fields using Coulomb explosion imaging

    NASA Astrophysics Data System (ADS)

    Ma, Pan; Wang, Chuncheng; Luo, Sizuo; Yu, Xitao; Li, Xiaokai; Wang, Zhenzhen; Hu, Wenhui; Yu, Jiaqi; Yang, Yizhang; Tian, Xu; Cui, Zhonghua; Ding, Dajun

    2018-05-01

    We studied the relative yields and dissociation dynamics for two- and three-body Coulomb explosion (CE) channels from highly charged carbonyl sulfide molecules in intense laser fields using the CE imaging technique. The electron recollision contributions are evaluated by comparing the relative yields for the multiple ionization process in linearly polarized and circularly polarized (LP and CP) laser fields. The nonsequential multiple ionization is only confirmed for the charge states of 2 to 4 because the energy for further ionization from the inner orbital is much larger than the maximum recollision energy, 3.2U p . The novel deviations of kinetic energy releases distributions between LP and CP pulses are observed for the charge states higher than 4. It can be attributed to the stronger molecular bending in highly charged states before three-body CE with CP light, in which the bending wave packet is initialed by the triple or quartic ionization and spread along their potential curves. Compared to LP light, CP light ionizes a larger fraction of bending molecules in the polarization plane.

  5. Field-free orientation of diatomic molecule via the linearly polarized resonant pulses

    NASA Astrophysics Data System (ADS)

    Li, Su-Yu; Guo, Fu-Ming; Wang, Jun; Yang, Yu-Jun; Jin, Ming-Xing

    2015-10-01

    We propose a scheme to coherently control the field-free orientation of NO molecule whose rotational temperature is above 0 K. It is found that the maximum molecular orientation is affected by two factors: one is the sum of the population of M = 0 rotational states and the other is their distribution, however, their distribution plays a much more significant role in molecular orientation than the sum of their population. By adopting a series of linearly polarized pulses resonant with the rotational states, the distribution of M = 0 rotational states is well rearranged. Though the number of pulses used is small, a relatively high orientation degree can be obtained. This scheme provides a promising approach to the achievement of a good orientation effect. Project supported by the National Basic Research Program of China (Grant No. 2013CB922200), the National Natural Science Foundation of China (Grant Nos. 11034003, 11474129, 11274141, and 11304116), the Research Fund for the Doctoral Program of Higher Education of China (Grant No. 20130061110021), and the Graduate Innovation Fund of Jilin University (Grant No. 2015091).

  6. Multidimensional biochemical information processing of dynamical patterns.

    PubMed

    Hasegawa, Yoshihiko

    2018-02-01

    Cells receive signaling molecules by receptors and relay information via sensory networks so that they can respond properly depending on the type of signal. Recent studies have shown that cells can extract multidimensional information from dynamical concentration patterns of signaling molecules. We herein study how biochemical systems can process multidimensional information embedded in dynamical patterns. We model the decoding networks by linear response functions, and optimize the functions with the calculus of variations to maximize the mutual information between patterns and output. We find that, when the noise intensity is lower, decoders with different linear response functions, i.e., distinct decoders, can extract much information. However, when the noise intensity is higher, distinct decoders do not provide the maximum amount of information. This indicates that, when transmitting information by dynamical patterns, embedding information in multiple patterns is not optimal when the noise intensity is very large. Furthermore, we explore the biochemical implementations of these decoders using control theory and demonstrate that these decoders can be implemented biochemically through the modification of cascade-type networks, which are prevalent in actual signaling pathways.

  7. Designed topology and site-selective metal composition in tetranuclear [MM'...M'M] linear complexes.

    PubMed

    Barrios, Leoní A; Aguilà, David; Roubeau, Olivier; Gamez, Patrick; Ribas-Ariño, Jordi; Teat, Simon J; Aromí, Guillem

    2009-10-26

    The ligand 1,3-bis[3-oxo-3-(2-hydroxyphenyl)propionyl]benzene (H(4)L), designed to align transition metals into tetranuclear linear molecules, reacts with M(II) salts (M=Ni, Co, Cu) to yield complexes with the expected [MMMM] topology. The novel complexes [Co(4)L(2)(py)(6)] (2; py=pyridine) and [Na(py)(2)][Cu(4)L(2)(py)(4)](ClO(4)) (3) have been crystallographically characterised. The metal sites in complexes 2 and 3, together with previously characterised [Ni(4)L(2)(py)(6)] (1), favour different coordination geometries. These have been exploited for the deliberate synthesis of the heterometallic complex [Cu(2)Ni(2)L(2)(py)(6)] (4). Complexes 1, 2, 3 and 4 exhibit antiferromagnetic interactions between pairs of metals within each cluster, leading to S=0 spin ground states, except for the latter cluster, which features two quasi-independent S=1/2 moieties within the molecule. Complex 4 gathers the structural and physical conditions, thus allowing it to be considered as prototype of a two-qbit quantum gate.

  8. Computation of Thermally Perfect Properties of Oblique Shock Waves

    NASA Technical Reports Server (NTRS)

    Tatum, Kenneth E.

    1996-01-01

    A set of compressible flow relations describing flow properties across oblique shock waves, derived for a thermally perfect, calorically imperfect gas, is applied within the existing thermally perfect gas (TPG) computer code. The relations are based upon a value of cp expressed as a polynomial function of temperature. The updated code produces tables of compressible flow properties of oblique shock waves, as well as the original properties of normal shock waves and basic isentropic flow, in a format similar to the tables for normal shock waves found in NACA Rep. 1135. The code results are validated in both the calorically perfect and the calorically imperfect, thermally perfect temperature regimes through comparisons with the theoretical methods of NACA Rep. 1135, and with a state-of-the-art computational fluid dynamics code. The advantages of the TPG code for oblique shock wave calculations, as well as for the properties of isentropic flow and normal shock waves, are its ease of use, and its applicability to any type of gas (monatomic, diatomic, triatomic, polyatomic, or any specified mixture thereof).

  9. Electron-impact dissociative excitation and ionization of N{sub 2}D{sup +}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fogle, M.; Bahati, E. M.; Bannister, M. E.

    Absolute cross sections for electron-impact dissociation of N{sub 2}D{sup +} producing N{sub 2}{sup +}, ND{sup +}, and N{sup +} ion fragments were measured in the 5- to 100-eV range using a crossed electron-ion beams technique. In the 5- to 20-eV region, in which dissociative excitation (DE) is the principal contributing mechanism, N{sub 2}{sup +} production dominates. The N{sub 2}{sup +} + D dissociation channel shows a large resonant-like structure in the DE cross section, as observed previously in electron impact dissociation of triatomic dihydride species [M. Fogle, E. M. Bahati, M. E. Bannister, S. H. M. Deng, C. R. Vane,more » R. D. Thomas, and V. Zhaunerchyk, Phys. Rev. A 82, 042720 (2010)]. In the dissociative ionization (DI) region, 20- to 100-eV, N{sub 2}{sup +}, ND{sup +}, and N{sup +} ion fragment production are comparable. The observance of the ND{sup +} and N{sup +} ion fragments indicate breaking of the N - N bond along certain dissociation channels.« less

  10. Highly accurate potential energy surface for the He-H2 dimer

    NASA Astrophysics Data System (ADS)

    Bakr, Brandon W.; Smith, Daniel G. A.; Patkowski, Konrad

    2013-10-01

    A new highly accurate interaction potential is constructed for the He-H2 van der Waals complex. This potential is fitted to 1900 ab initio energies computed at the very large-basis coupled-cluster level and augmented by corrections for higher-order excitations (up to full configuration interaction level) and the diagonal Born-Oppenheimer correction. At the vibrationally averaged H-H bond length of 1.448736 bohrs, the well depth of our potential, 15.870 ± 0.065 K, is nearly 1 K larger than the most accurate previous studies have indicated. In addition to constructing our own three-dimensional potential in the van der Waals region, we present a reparameterization of the Boothroyd-Martin-Peterson potential surface [A. I. Boothroyd, P. G. Martin, and M. R. Peterson, J. Chem. Phys. 119, 3187 (2003)] that is suitable for all configurations of the triatomic system. Finally, we use the newly developed potentials to compute the properties of the lone bound states of 4He-H2 and 3He-H2 and the interaction second virial coefficient of the hydrogen-helium mixture.

  11. The optical absorption of triatomic carbon C3 for the wavelength range 260 to 560 nm

    NASA Technical Reports Server (NTRS)

    Jones, J. J.

    1978-01-01

    The spectral absorption properties of C3 have been measured in a shock tube containing a test gas mixture of acetylene diluted with argon. The absorption of a pulsed xenon light source was measured by means of eight photomultiplier channels to a spectrograph and an accompanying drum camera. The postshock test gas temperature and pressure were varied over the range 3240 to 4300 K and 37 to 229 kPa, respectively. The results showed appreciable absorption by C3 for the wavelength range 300 to 540 nm. The various reported measurements of the heat of formation of C3 which are available in the open literature were reviewed, and a value of 198 kcal/mol is recommended. This value, along with best available values for other species, was used to calculate the number density of C3 for the conditions of the present experiments in order to compute absorption cross section or electronic oscillator strength. The computed electronic oscillator strength varied from a high of 0.062 at 3300 K to a low of 0.036 at 3900 K.

  12. Influence of an O2 background gas on the composition and kinetic energies of species in laser induced La0.4Ca0.6MnO3 plasmas

    NASA Astrophysics Data System (ADS)

    Chen, Jikun; Stender, Dieter; Bator, Matthias; Schneider, Christof W.; Lippert, Thomas; Wokaun, Alexander

    2013-08-01

    Oxygen is one of the most commonly used background gases for pulsed laser deposition of oxide thin films. In this work the properties of a 308 nm laser-induced La0.4Ca0.6MnO3 plasma were analyzed using a quadrupole mass spectrometer combined with an energy analyzer, to investigate the interaction between the various plasma species and the background gas. The composition and kinetic energies of the plasma species were compared in vacuum and an O2 background gas at different pressures. It has been observed that the O2 background gas decreases the kinetic energy of the positively charged atomic plasma species. In addition, the interaction with the O2 background gas causes the generation of positive diatomic oxide species of LaO+, CaO+ and MnO+. The amount of negatively charged diatomic or tri-atomic oxide species decreases in the O2 background compared to vacuum, while the amount of O2- increases strongly.

  13. Indomethacin induced gastropathy in CD18, intercellular adhesion molecule 1, or P-selectin deficient mice

    PubMed Central

    Morise, Z; Granger, D; Fuseler, J; Anderson, D; Grisham, M

    1999-01-01

    BACKGROUND—Neutrophil-endothelial cell interactions are thought to play a critical role in the pathophysiology of non-steroidal anti-inflammatory drug (NSAID) induced gastropathy.
AIMS—To optimise a mouse model of NSAID induced gastropathy and to evaluate the importance of adhesion molecules using adhesion molecule deficient mice.
METHODS—Gastropathy was induced in C57BL/6 mice or their adhesion molecule deficient counterparts via oral administration of indomethacin (20 mg/kg). Lesion scores, mucosal permeability, and histopathology were used to assess gastric mucosal injury.
RESULTS—Intragastric administration of indomethacin induced linear haemorrhagic mucosal lesions, primarily in the corpus of the stomach that were first observed at six hours. These lesions continued to develop over the next six hours with maximal lesion scores and mucosal permeabilities at 12 hours. When indomethacin was administered to mice deficient in CD18, intercellular adhesion molecule 1 (ICAM-1), or P-selectin, there were significant decreases in lesion scores compared with their C57BL/6 controls. In addition, mucosal permeabilities were found to be significantly lower in CD18 or ICAM-1 deficient mice observed at 12 hours.
CONCLUSION—Certain leucocyte and endothelial cell adhesion molecules are important determinants for full expression of indomethacin induced gastropathy. It is proposed that this modification of the mouse model may be useful for the investigation of other pathophysiological mechanisms of NSAID induced gastropathy.


Keywords: indomethacin; gastropathy; cyclooxygenase; intercellular adhesion molecule; VCAM; vascular cell adhesion molecule; P-selectin PMID:10486359

  14. Empirical correlation between hydrophobic free energy and aqueous cavity surface area

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reynolds, J.A.; Gilbert, D.B.; Tanford, C.

    1974-08-01

    The unitary free energy of transfer of a hydrocarbon molecule from a hydrocarbon solvent to an aqueous medium is a measure of the hydrophobic interaction in the aqueous medium. We have reexamined available data on this phenomenon and have confirmed that the free energy for saturated hydrocarbons is proportional to the surface area of the cavity created by the solute in the aqueous solution, with the same proportionality constant for linear, branched, and cyclic hydrocarbon molecules. The numerical value of the proportionality constant is uncertain because absolute and self-consistent area measurements are not available. We estimate that it falls betweenmore » 20 and 25 cal/mole per Angstrom/sup 2/ at 25/sup 0/ (for areas measured at the distance of closest approach of water molecules), which is significantly less than the figure of 33 cal/mole per Angstrom/sup 2/ that has been assigned to the same parameter by Hermann.« less

  15. Adsorption and Dissociation of Molecular Oxygen on the (0001) Surface of Double Hexagonal Close Packed Americium

    NASA Astrophysics Data System (ADS)

    Dholabhai, Pratik; Atta-Fynn, Raymond; Ray, Asok

    2008-03-01

    Oxygen molecule adsorption on (0001) surface of double hexagonal packed americium has been studied in detail within the framework of density functional theory using a full-potential all-electron linearized augmented plane wave plus local orbitals method. The most stable configuration corresponded to molecular dissociation with the oxygen atoms occupying neighboring three-fold hollow h3 sites. Chemisorption energies and adsorption geometries for the adsorbed species, and change in work functions, magnetic moments, partial charges inside muffin-tins, difference charge density distributions and density of states for the bare Am slab and the Am slab after adsorption of the oxygen molecule will be discussed. The effects of chemisorption on Am 5f electron localization-delocalization in the vicinity of the Fermi level and the reaction barrier calculation for the dissociation of oxygen molecule to the most stable h3 sites will be discussed.

  16. DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale

    PubMed Central

    Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.

    2015-01-01

    Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731

  17. Can correlations among receptors affect the information about the stimulus?

    NASA Astrophysics Data System (ADS)

    Singh, Vijay; Tchernookov, Martin; Nemenman, Ilya

    2014-03-01

    In the context of neural information processing, it has been observed that, compared to the case of independent receptors, correlated receptors can often carry more information about the stimulus. We explore similar ideas in the context of molecular information processing, analyzing a cell with receptors whose activity is intrinsically negatively correlated because they compete for the same ligand molecules. We show analytically that, in case the involved biochemical interactions are linear, the information between the number of molecules captured by the receptors and the ligand concentration does not depend on correlations among the receptors. For a nonlinear kinetic network, correlations similarly do not change the amount of information for observation times much shorter or much longer than the characteristic time scale of ligand molecule binding and unbinding. However, at intermediate times, correlations can increase the amount of available information. This work has been supported by the James S McDonnell foundation.

  18. Current-voltage characteristics of double stranded versus single stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

    2004-03-01

    Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

  19. Data mining for materials design: A computational study of single molecule magnet

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dam, Hieu Chi; Faculty of Physics, Vietnam National University, 334 Nguyen Trai, Hanoi; Pham, Tien Lam

    2014-01-28

    We develop a method that combines data mining and first principles calculation to guide the designing of distorted cubane Mn{sup 4+} Mn {sub 3}{sup 3+} single molecule magnets. The essential idea of the method is a process consisting of sparse regressions and cross-validation for analyzing calculated data of the materials. The method allows us to demonstrate that the exchange coupling between Mn{sup 4+} and Mn{sup 3+} ions can be predicted from the electronegativities of constituent ligands and the structural features of the molecule by a linear regression model with high accuracy. The relations between the structural features and magnetic propertiesmore » of the materials are quantitatively and consistently evaluated and presented by a graph. We also discuss the properties of the materials and guide the material design basing on the obtained results.« less

  20. Spin effects in transport through single-molecule magnets in the sequential and cotunneling regimes

    NASA Astrophysics Data System (ADS)

    Misiorny, Maciej; Weymann, Ireneusz; Barnaś, Józef

    2009-06-01

    We analyze the stationary spin-dependent transport through a single-molecule magnet weakly coupled to external ferromagnetic leads. Using the real-time diagrammatic technique, we calculate the sequential and cotunneling contributions to current, tunnel magnetoresistance, and Fano factor in both linear and nonlinear response regimes. We show that the effects of cotunneling are predominantly visible in the blockade regime and lead to enhancement of tunnel magnetoresistance (TMR) above the Julliere value, which is accompanied with super-Poissonian shot noise due to bunching of inelastic cotunneling processes through different virtual spin states of the molecule. The effects of external magnetic field and the role of type and strength of exchange interaction between the LUMO level and the molecule’s spin are also considered. When the exchange coupling is ferromagnetic, we find an enhanced TMR, while in the case of antiferromagnetic coupling we predict a large negative TMR effect.

  1. Structural evidence for the partially oxidized dipyrromethene and dipyrromethanone forms of the cofactor of porphobilinogen deaminase: structures of the Bacillus megaterium enzyme at near-atomic resolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Azim, N.; Deery, E.; Warren, M. J.

    The enzyme porphobilinogen deaminase (PBGD; hydroxymethylbilane synthase; EC 2.5.1.61) catalyses a key early step in the biosynthesis of tetrapyrroles in which four molecules of the monopyrrole porphobilinogen are condensed to form a linear tetrapyrrole. Two near-atomic resolution structures of PBGD from B. megaterium are reported that demonstrate the time-dependent accumulation of partially oxidized forms of the cofactor, including one that possesses a tetrahedral C atom in the terminal pyrrole ring. The enzyme porphobilinogen deaminase (PBGD; hydroxymethylbilane synthase; EC 2.5.1.61) catalyses an early step of the tetrapyrrole-biosynthesis pathway in which four molecules of the monopyrrole porphobilinogen are condensed to form amore » linear tetrapyrrole. The enzyme possesses a dipyrromethane cofactor, which is covalently linked by a thioether bridge to an invariant cysteine residue (Cys241 in the Bacillus megaterium enzyme). The cofactor is extended during the reaction by the sequential addition of the four substrate molecules, which are released as a linear tetrapyrrole product. Expression in Escherichia coli of a His-tagged form of B. megaterium PBGD has permitted the X-ray analysis of the enzyme from this species at high resolution, showing that the cofactor becomes progressively oxidized to the dipyrromethene and dipyrromethanone forms. In previously solved PBGD structures, the oxidized cofactor is in the dipyromethenone form, in which both pyrrole rings are approximately coplanar. In contrast, the oxidized cofactor in the B. megaterium enzyme appears to be in the dipyrromethanone form, in which the C atom at the bridging α-position of the outer pyrrole ring is very clearly in a tetrahedral configuration. It is suggested that the pink colour of the freshly purified protein is owing to the presence of the dipyrromethene form of the cofactor which, in the structure reported here, adopts the same conformation as the fully reduced dipyrromethane form.« less

  2. Electric-field-driven electron-transfer in mixed-valence molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blair, Enrique P., E-mail: enrique-blair@baylor.edu; Corcelli, Steven A., E-mail: scorcell@nd.edu; Lent, Craig S., E-mail: lent@nd.edu

    2016-07-07

    Molecular quantum-dot cellular automata is a computing paradigm in which digital information is encoded by the charge configuration of a mixed-valence molecule. General-purpose computing can be achieved by arranging these compounds on a substrate and exploiting intermolecular Coulombic coupling. The operation of such a device relies on nonequilibrium electron transfer (ET), whereby the time-varying electric field of one molecule induces an ET event in a neighboring molecule. The magnitude of the electric fields can be quite large because of close spatial proximity, and the induced ET rate is a measure of the nonequilibrium response of the molecule. We calculate themore » electric-field-driven ET rate for a model mixed-valence compound. The mixed-valence molecule is regarded as a two-state electronic system coupled to a molecular vibrational mode, which is, in turn, coupled to a thermal environment. Both the electronic and vibrational degrees-of-freedom are treated quantum mechanically, and the dissipative vibrational-bath interaction is modeled with the Lindblad equation. This approach captures both tunneling and nonadiabatic dynamics. Relationships between microscopic molecular properties and the driven ET rate are explored for two time-dependent applied fields: an abruptly switched field and a linearly ramped field. In both cases, the driven ET rate is only weakly temperature dependent. When the model is applied using parameters appropriate to a specific mixed-valence molecule, diferrocenylacetylene, terahertz-range ET transfer rates are predicted.« less

  3. Phase behavior of diblock copolymer/star-shaped polymer thin film mixtures.

    PubMed

    Zhao, Junnan; Sakellariou, Georgios; Green, Peter F

    2016-05-07

    We investigated the phase behavior of thin film, thickness h≈ 100 nm, mixtures of a polystyrene-b-poly(2-vinylpyridine) (PS-b-P2VP) diblock copolymer with star-shaped polystyrene (SPS) molecules of varying functionalities f, where 4 ≤f≤ 64, and molecular weights per arm Marm. The miscibility of the system and the surface composition varied appreciably with Marm and f. For large values of Marm, regardless of f, the miscibility of the system was qualitatively similar to that of linear chain PS/PS-b-P2VP mixtures - the copolymer chains aggregate to form micelles, each composed of an inner P2VP core and PS corona, which preferentially segregate to the free surface. On the other hand, for large f and small Marm, SPS molecules preferentially resided at the free surface. Moreover, blends containing SPS molecules with the highest values of f and lowest values of Marm were phase separated. These observations are rationalized in terms of competing entropic interactions and the dependence of the surface tension of the star-shaped molecules on Marm and f.

  4. Single-molecule analysis of DNA uncoiling by a type II topoisomerase

    NASA Astrophysics Data System (ADS)

    Strick, Terence R.; Croquette, Vincent; Bensimon, David

    2000-04-01

    Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

  5. Coverage dependent molecular assembly of anthraquinone on Au(111)

    NASA Astrophysics Data System (ADS)

    DeLoach, Andrew S.; Conrad, Brad R.; Einstein, T. L.; Dougherty, Daniel B.

    2017-11-01

    A scanning tunneling microscopy study of anthraquinone (AQ) on the Au(111) surface shows that the molecules self-assemble into several structures depending on the local surface coverage. At high coverages, a close-packed saturated monolayer is observed, while at low coverages, mobile surface molecules coexist with stable chiral hexamer clusters. At intermediate coverages, a disordered 2D porous network interlinking close-packed islands is observed in contrast to the giant honeycomb networks observed for the same molecule on Cu(111). This difference verifies the predicted extreme sensitivity [J. Wyrick et al., Nano Lett. 11, 2944 (2011)] of the pore network to small changes in the surface electronic structure. Quantitative analysis of the 2D pore network reveals that the areas of the vacancy islands are distributed log-normally. Log-normal distributions are typically associated with the product of random variables (multiplicative noise), and we propose that the distribution of pore sizes for AQ on Au(111) originates from random linear rate constants for molecules to either desorb from the surface or detach from the region of a nucleated pore.

  6. Coverage dependent molecular assembly of anthraquinone on Au(111).

    PubMed

    DeLoach, Andrew S; Conrad, Brad R; Einstein, T L; Dougherty, Daniel B

    2017-11-14

    A scanning tunneling microscopy study of anthraquinone (AQ) on the Au(111) surface shows that the molecules self-assemble into several structures depending on the local surface coverage. At high coverages, a close-packed saturated monolayer is observed, while at low coverages, mobile surface molecules coexist with stable chiral hexamer clusters. At intermediate coverages, a disordered 2D porous network interlinking close-packed islands is observed in contrast to the giant honeycomb networks observed for the same molecule on Cu(111). This difference verifies the predicted extreme sensitivity [J. Wyrick et al., Nano Lett. 11, 2944 (2011)] of the pore network to small changes in the surface electronic structure. Quantitative analysis of the 2D pore network reveals that the areas of the vacancy islands are distributed log-normally. Log-normal distributions are typically associated with the product of random variables (multiplicative noise), and we propose that the distribution of pore sizes for AQ on Au(111) originates from random linear rate constants for molecules to either desorb from the surface or detach from the region of a nucleated pore.

  7. Adsorbing H₂S onto a single graphene sheet: A possible gas sensor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reshak, A. H., E-mail: maalidph@yahoo.co.uk; Center of Excellence Geopolymer and Green Technology, School of Material Engineering, University Malaysia Perlis, 01007 Kangar, Perlis; Auluck, S.

    2014-09-14

    The electronic structure of pristine graphene sheet and the resulting structure of adsorbing a single molecule of H₂S on pristine graphene in three different sites (bridge, top, and hollow) are studied using the full potential linearized augmented plane wave method. Our calculations show that the adsorption of H₂S molecule on the bridge site opens up a small direct energy gap of about 0.1 eV at symmetry point M, while adsorption of H₂S on top site opens a gap of 0.3 eV around the symmetry point K. We find that adsorbed H₂S onto the hollow site of pristine graphene sheet causesmore » to push the conduction band minimum and the valence band maximum towards Fermi level resulting in a metallic behavior. Comparing the angular momentum decomposition of the atoms projected electronic density of states of pristine graphene sheet with that of H₂S–graphene for three different cases, we find a significant influence of the location of the H₂S molecule on the electronic properties especially the strong hybridization between H₂S molecule and graphene sheet.« less

  8. Spectroscopic and kinetic studies of photochemical reaction of magnesium tetraphenylporphyrin with oxygen.

    PubMed

    Zhang, Jianbin; Zhang, Pengyan; Zhang, Zhengfu; Wei, Xionghui

    2009-05-07

    Magnesium tetraphenylporphyrin (MgTPP) was synthesized from meso-tetraphenylporphyrin (H(2)TPP) in N,N-dimethylformamide (DMF). The photochemical properties of MgTPP in the presence of oxygen were investigated in dichloromethane (CH(2)Cl(2)) by conventional fluorescence, UV-vis, (1)H NMR, MALDI-TOF-MS, FTIR, and XPS spectroscopic techniques. Spectral analyses showed that under irradiation, MgTPP molecules reacted with O(2) molecules, and a stable 1:1 adduct was produced. During the photochemical reaction process, one oxygen molecule was bound to the pyrrolenine nitrogens in the MgTPP molecule, and the characteristic N-O bonds were identified using the FTIR and XPS techniques. The kinetics of the photochemical reaction of MgTPP with O(2) has been studied in an oxygen-saturated solution. Under irradiation conditions, the experimental rate follows a pseudo-first-order reaction for MgTPP, having a half-life from 40 to 130 min under various irradiation intensities. The kinetic rate constant of photochemical reaction of MgTPP with O(2) showed a linear dependence.

  9. Low-temperature matrix effects on orientational motion of Methyl radical trapped in gas solids: Angular tunneling vs. libration

    NASA Astrophysics Data System (ADS)

    Dmitriev, Yurij A.; Zelenetckii, Ilia A.; Benetis, Nikolas P.

    2018-05-01

    EPR investigation of the lineshape of matrix -isolated methyl radical, CH3, spectra recorded in solid N2O and CO2 was carried out. Reversible temperature-dependent line width anisotropy was observed in both matrices. This effect is a fingerprint of the extra-slow radical rotation about the in-plane C2 axes. The rotation was found to be anisotropic and closely correlated to the orientational dynamics of the matrix molecules. It was suggested that a recently discovered "hoping precession" effect of matrix molecules in solid CO2 is a common feature of matrices of the linear molecules CO, N2O, and CO2. A new low-temperature matrix effect, referred to as "libration trap", was proposed which accounts for the changing CH3 reorientational motion about the radical C3-axis from rotation to libration. Temperature dependence of the intensity of the EPR satellites produced by these nonrotating-but librating methyls was presented. This allowed for a rough estimation of the rotation hindering potential due to correlation mismatch between the radical and the nearest matrix molecules' librations.

  10. Computational molecular spectroscopy of X ˜ 2 Π NCS: Electronic properties and ro-vibrationally averaged structure

    NASA Astrophysics Data System (ADS)

    Hirano, Tsuneo; Nagashima, Umpei; Jensen, Per

    2018-04-01

    For NCS in the X ˜ 2 Π electronic ground state, three-dimensional potential energy surfaces (3D PESs) have been calculated ab initio at the core-valence, full-valence MR-SDCI+Q/[aug-cc-pCVQZ (N, C, S)] level of theory. The ab initio 3D PESs are employed in second-order-perturbation-theory and DVR3D calculations to obtain various molecular constants and ro-vibrationally averaged structures. The 3D PESs show that the X ˜ 2 Π NCS has its potential minimum at a linear configuration, and hence it is a "linear molecule." The equilibrium structure has re (N-C) = 1.1778 Å, re (C-S) = 1.6335 Å, and ∠e (N-C-S) = 180°. The ro-vibrationally averaged structure, determined as expectation values over DVR3D wavefunctions, has 〈 r (N-C)〉0 = 1.1836 Å, 〈 r (C-S)〉0 = 1.6356 Å, and 〈 ∠ (N-C-S)〉0 = 172.5°. Using these expectation values as the initial guess, a bent r0 structure having an 〈 ∠ (N-C-S)〉0 of 172.2° is deduced from the experimentally reported B0 values for NC32S and NC34S. Our previous prediction that a linear molecule, in any ro-vibrational state including the ro-vibrational ground state, is to be "observed" as being bent on ro-vibrational average, has been confirmed here theoretically through the expectation value for the bond-angle deviation from linearity, 〈 ρ bar 〉 , and experimentally through the interpretation of the experimentally derived rotational-constant values.

  11. Coupling density functional theory to polarizable force fields for efficient and accurate Hamiltonian molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Schwörer, Magnus; Breitenfeld, Benedikt; Tröster, Philipp; Bauer, Sebastian; Lorenzen, Konstantin; Tavan, Paul; Mathias, Gerald

    2013-06-01

    Hybrid molecular dynamics (MD) simulations, in which the forces acting on the atoms are calculated by grid-based density functional theory (DFT) for a solute molecule and by a polarizable molecular mechanics (PMM) force field for a large solvent environment composed of several 103-105 molecules, pose a challenge. A corresponding computational approach should guarantee energy conservation, exclude artificial distortions of the electron density at the interface between the DFT and PMM fragments, and should treat the long-range electrostatic interactions within the hybrid simulation system in a linearly scaling fashion. Here we describe a corresponding Hamiltonian DFT/(P)MM implementation, which accounts for inducible atomic dipoles of a PMM environment in a joint DFT/PMM self-consistency iteration. The long-range parts of the electrostatics are treated by hierarchically nested fast multipole expansions up to a maximum distance dictated by the minimum image convention of toroidal boundary conditions and, beyond that distance, by a reaction field approach such that the computation scales linearly with the number of PMM atoms. Short-range over-polarization artifacts are excluded by using Gaussian inducible dipoles throughout the system and Gaussian partial charges in the PMM region close to the DFT fragment. The Hamiltonian character, the stability, and efficiency of the implementation are investigated by hybrid DFT/PMM-MD simulations treating one molecule of the water dimer and of bulk water by DFT and the respective remainder by PMM.

  12. Optical control of ground-state atomic orbital alignment: Cl(2P3/2) atoms from HCl(v=2,J=1) photodissociation.

    PubMed

    Sofikitis, Dimitris; Rubio-Lago, Luis; Martin, Marion R; Ankeny Brown, Davida J; Bartlett, Nathaniel C-M; Alexander, Andrew J; Zare, Richard N; Rakitzis, T Peter

    2007-10-14

    H(35)Cl(v=0,J=0) molecules in a supersonic expansion were excited to the H(35)Cl(v=2,J=1,M=0) state with linearly polarized laser pulses at about 1.7 microm. These rotationally aligned J=1 molecules were then selectively photodissociated with a linearly polarized laser pulse at 220 nm after a time delay, and the velocity-dependent alignment of the (35)Cl((2)P(32)) photofragments was measured using 2+1 REMPI and time-of-flight mass spectrometry. The (35)Cl((2)P(32)) atoms are aligned by two mechanisms: (1) the time-dependent transfer of rotational polarization of the H(35)Cl(v=2,J=1,M=0) molecule to the (35)Cl((2)P(32)) nuclear spin [which is conserved during the photodissociation and thus contributes to the total (35)Cl((2)P(32)) photofragment atomic polarization] and (2) the alignment of the (35)Cl((2)P(32)) electronic polarization resulting from the photoexcitation and dissociation process. The total alignment of the (35)Cl((2)P(32)) photofragments from these two mechanisms was found to vary as a function of time delay between the excitation and the photolysis laser pulses, in agreement with theoretical predictions. We show that the alignment of the ground-state (35)Cl((2)P(32)) atoms, with respect to the photodissociation recoil direction, can be controlled optically. Potential applications include the study of alignment-dependent collision effects.

  13. Linear solvation energy relationship of the limiting partition coefficient of organic solutes between water and activated carbon

    USGS Publications Warehouse

    Luehrs, Dean C.; Hickey, James P.; Nilsen, Peter E.; Godbole, K.A.; Rogers, Tony N.

    1995-01-01

    A linear solvation energy relationship has been found for 353 values of the limiting adsorption coefficients of diverse chemicals:  log K = −0.37 + 0.0341Vi − 1.07β + D + 0.65P with R = 0.951, s = 0.51, n = 353, and F = 818.0, where Vi is the intrinsic molar volume; β is a measure of the hydrogen bond acceptor strength of the solute; D is an index parameter for the research group which includes the effects of the different types of carbon used, the temperature, and the length of time allowed for the adsorption equilibrium to be established; and P is an index parameter for the flatness of the molecule. P is defined to be unity if there is an aromatic system in the molecule or if there is a double bond or series of conjugated double bonds with no more that one non-hydrogen atom beyond the double bond and zero otherwise. A slightly better fit is obtained if the two-thirds power of Vi is used as a measure of the surface area in place of the volume term:  log K = −1.75 + 0.227V2/3 − 1.10β + D + 0.60P with R = 0.954, s = 0.49, n = 353, and F = 895.39. This is the first quantitative measure of the effect of the shape of the molecule on its tendency to be adsorbed on activated carbon.

  14. Synthesis and crystal structure of catena-bis(nicotinamide)aqua({mu}-phthalato)copper(II) hemihydrate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sadikov, G. G., E-mail: sadgg@igic.ras.ru; Koksharova, T. V.; Antsyshkina, A. S.

    2008-07-15

    The copper(II) phthalate complex with nicotinamide [CuL{sub 2}({mu}-Pht)(H{sub 2}O)] . 0.5H{sub 2}O(I) (where L is nicotinamide and Pht{sup 2-} is an anion of phthalic acid) is synthesized and investigated using IR spectroscopy and X-ray diffraction. The crystals of compound I are monoclinic, a = 13.368(2) A, b = 7.891(3) A, c = 20.480(2) A, {beta} = 108.69(2){sup o}, Z = 4, and space group P2{sub 1}/c. The structural units of crystal I are linear chains formed by bridging phthalate anions and crystallization water molecules. The copper atom is coordinated by two pyridine nitrogen atoms of two nicotinamide ligands (Cu-N, 2.001more » and 2.045 A), two oxygen atoms of different phthalate anions (Cu-O, 1.964 and 2.235 A), and the oxygen atom of the H{sub 2} O molecule (Cu-O, 2.014 A). The coordination polyhedron of the copper atom is completed to an elongated (4 + 1 + 1) tetragonal bipyramid by the second (chelating) oxygen atom of the carboxyl group (Cu-O, 2.587 A), which is one of the anions of phthalic acid. The linear polymer molecules are joined into complex macromolecular dimers with the closest internal contacts of the specific type. The macromolecular dimers are the main supramolecular ensembles of the crystal structure.« less

  15. Analytic Morse/long-range potential energy surfaces and "adiabatic-hindered-rotor" treatment for a symmetric top-linear molecule dimer: A case study of CH3F-H2

    NASA Astrophysics Data System (ADS)

    Zhang, Xiao-Long; Ma, Yong-Tao; Zhai, Yu; Li, Hui

    2018-03-01

    A first effective six-dimensional ab initio potential energy surface (PES) for CH3F-H2 which explicitly includes the intramolecular Q3 stretching normal mode of the CH3F monomer is presented. The electronic structure computations have been carried out at the explicitly correlated coupled cluster level of theory [CCSD(T)-F12a] with an augmented correlation-consistent triple zeta basis set. Five-dimensional analytical intermolecular PESs for ν3(CH3F) = 0 and 1 are then obtained by fitting the vibrationally averaged potentials to the Morse/Long-Range (MLR) potential function form. The MLR function form is applied to the nonlinear molecule-linear molecule case for the first time. These fits to 25 015 points have root-mean-square deviations of 0.74 cm-1 and 0.082 cm-1 for interaction energies less than 0.0 cm-1. Using the adiabatic hindered-rotor approximation, three-dimensional PESs for CH3F-paraH2 are generated from the 5D PESs over all possible orientations of the hydrogen monomer. The infrared and microwave spectra for CH3F-paraH2 dimer are predicted for the first time. These analytic PESs can be used for modeling the dynamical behavior in CH3F-(H2)N clusters, including the possible appearance of microscopic superfluidity.

  16. A Single-Level Tunnel Model to Account for Electrical Transport through Single Molecule- and Self-Assembled Monolayer-based Junctions

    PubMed Central

    Garrigues, Alvar R.; Yuan, Li; Wang, Lejia; Mucciolo, Eduardo R.; Thompon, Damien; del Barco, Enrique; Nijhuis, Christian A.

    2016-01-01

    We present a theoretical analysis aimed at understanding electrical conduction in molecular tunnel junctions. We focus on discussing the validity of coherent versus incoherent theoretical formulations for single-level tunneling to explain experimental results obtained under a wide range of experimental conditions, including measurements in individual molecules connecting the leads of electromigrated single-electron transistors and junctions of self-assembled monolayers (SAM) of molecules sandwiched between two macroscopic contacts. We show that the restriction of transport through a single level in solid state junctions (no solvent) makes coherent and incoherent tunneling formalisms indistinguishable when only one level participates in transport. Similar to Marcus relaxation processes in wet electrochemistry, the thermal broadening of the Fermi distribution describing the electronic occupation energies in the electrodes accounts for the exponential dependence of the tunneling current on temperature. We demonstrate that a single-level tunnel model satisfactorily explains experimental results obtained in three different molecular junctions (both single-molecule and SAM-based) formed by ferrocene-based molecules. Among other things, we use the model to map the electrostatic potential profile in EGaIn-based SAM junctions in which the ferrocene unit is placed at different positions within the molecule, and we find that electrical screening gives rise to a strongly non-linear profile across the junction. PMID:27216489

  17. Near-membrane electric field calcium ion dehydration.

    PubMed

    Barger, James P; Dillon, Patrick F

    2016-12-01

    The dehydration of ion-water complexes prior to ion channel transit has focused on channel protein-mediated dissociation of water. Ion dehydration by the membrane electric field has not previously been considered. Near membrane electric fields have previously been shown to cause the disassociation of non-covalently bound small molecule-small molecule, small molecule-protein, and protein-protein complexes. It is well known that cosmotropic, structure making ions such as calcium and sodium significantly bind multiple water ions in solution. It is also known that these ions are often not hydrated as they pass through membrane ion channels. Using capillary electrophoresis, the range of electric fields needed to strip water molecules from calcium ions has been measured. Ion migration velocity is a linear function of the electric field. At low electric fields, the migration rate of calcium ion was shown to be linearly related to the applied electric field. Using a form of the Stoke's equation applicable to ion migration, the hydrated calcium radius was found to be 0.334nm, corresponding to a water hydration shell of 5.09 water molecules. At higher electric fields, the slope of the calcium migration velocity as a function of the electric field increased, which was modeled as a decrease in the radius of the migrating ion as the water was removed. Using a tanh function to model the transition of the ion from a hydrated to a stripped state, the transition had a midpoint at 446V/cm, and was 88% complete at 587V/cm with a correlation coefficient of 0.9996. The migration velocity of the stripped calcium ion was found to be a function of both the decrease in radius and an increase in the effective, electronic viscosity of the dipole medium through which the dehydrated ion moved. The size of the electric field needed to dehydrate calcium occurs 6-7nm from the cell membrane. Calcium ions within this distance from the membrane will be devoid of water molecules when they reach the calcium selective channel pore entrances, all known to be approximately 1-2nm from the membrane. No matter what the calcium pore structure, calcium ions reaching the channel entrance will be devoid of a water shell. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Highly efficient implementation of pseudospectral time-dependent density-functional theory for the calculation of excitation energies of large molecules.

    PubMed

    Cao, Yixiang; Hughes, Thomas; Giesen, Dave; Halls, Mathew D; Goldberg, Alexander; Vadicherla, Tati Reddy; Sastry, Madhavi; Patel, Bhargav; Sherman, Woody; Weisman, Andrew L; Friesner, Richard A

    2016-06-15

    We have developed and implemented pseudospectral time-dependent density-functional theory (TDDFT) in the quantum mechanics package Jaguar to calculate restricted singlet and restricted triplet, as well as unrestricted excitation energies with either full linear response (FLR) or the Tamm-Dancoff approximation (TDA) with the pseudospectral length scales, pseudospectral atomic corrections, and pseudospectral multigrid strategy included in the implementations to improve the chemical accuracy and to speed the pseudospectral calculations. The calculations based on pseudospectral time-dependent density-functional theory with full linear response (PS-FLR-TDDFT) and within the Tamm-Dancoff approximation (PS-TDA-TDDFT) for G2 set molecules using B3LYP/6-31G*(*) show mean and maximum absolute deviations of 0.0015 eV and 0.0081 eV, 0.0007 eV and 0.0064 eV, 0.0004 eV and 0.0022 eV for restricted singlet excitation energies, restricted triplet excitation energies, and unrestricted excitation energies, respectively; compared with the results calculated from the conventional spectral method. The application of PS-FLR-TDDFT to OLED molecules and organic dyes, as well as the comparisons for results calculated from PS-FLR-TDDFT and best estimations demonstrate that the accuracy of both PS-FLR-TDDFT and PS-TDA-TDDFT. Calculations for a set of medium-sized molecules, including Cn fullerenes and nanotubes, using the B3LYP functional and 6-31G(**) basis set show PS-TDA-TDDFT provides 19- to 34-fold speedups for Cn fullerenes with 450-1470 basis functions, 11- to 32-fold speedups for nanotubes with 660-3180 basis functions, and 9- to 16-fold speedups for organic molecules with 540-1340 basis functions compared to fully analytic calculations without sacrificing chemical accuracy. The calculations on a set of larger molecules, including the antibiotic drug Ramoplanin, the 46-residue crambin protein, fullerenes up to C540 and nanotubes up to 14×(6,6), using the B3LYP functional and 6-31G(**) basis set with up to 8100 basis functions show that PS-FLR-TDDFT CPU time scales as N(2.05) with the number of basis functions. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Linearized-moment analysis of the temperature jump and temperature defect in the Knudsen layer of a rarefied gas.

    PubMed

    Gu, Xiao-Jun; Emerson, David R

    2014-06-01

    Understanding the thermal behavior of a rarefied gas remains a fundamental problem. In the present study, we investigate the predictive capabilities of the regularized 13 and 26 moment equations. In this paper, we consider low-speed problems with small gradients, and to simplify the analysis, a linearized set of moment equations is derived to explore a classic temperature problem. Analytical solutions obtained for the linearized 26 moment equations are compared with available kinetic models and can reliably capture all qualitative trends for the temperature-jump coefficient and the associated temperature defect in the thermal Knudsen layer. In contrast, the linearized 13 moment equations lack the necessary physics to capture these effects and consistently underpredict kinetic theory. The deviation from kinetic theory for the 13 moment equations increases significantly for specular reflection of gas molecules, whereas the 26 moment equations compare well with results from kinetic theory. To improve engineering analyses, expressions for the effective thermal conductivity and Prandtl number in the Knudsen layer are derived with the linearized 26 moment equations.

  20. Formation of C3 and C2 in Cometary Comae

    NASA Astrophysics Data System (ADS)

    Hölscher, Alexander

    2015-03-01

    Comets are remnants from the Solar System formation. They reside at large distances from the Sun and are believed to store deep freeze imprints of the chemical and physical conditions at the time the Solar System formed. The main ice component of a comet is H2O followed by CO and CO2 with additional small amounts of molecules with varying complexity. Comets also contain large amounts of dust. If a comet approaches the Sun the ices begin to sublimate giving rise to the cometary coma. The molecules producing the coma can be observed in the infrared, the radio wavelength range and at optical wavelengths. To constrain the formation of the Solar System, models require knowledge of the composition for a statistically significant number of comets. This favors optical observations of e.g. C3 (tricarbon) and C2 (dicarbon) since these species allow observations even of relatively faint comets and do not require space missions (infrared observations). However, one has to link these observed photodissociation product species (daughter species) to the molecules that originally sublimated from the comet nucleus surface, i.e. the so-called parent molecules, as e.g. C2H2 (acetylene) for C2. However, for C3 no parent molecules have been identified so far. This thesis investigates the formation of C3 and C2 radicals in cometary comae due to photodissociation of observed and in the literature proposed hydrocarbon parent molecules. For this purpose a one-dimensional multi-fluid coma chemistry model has been improved and applied. This work added new photo reactions to the model, updated the hydrocarbon photo rate coefficients and quantified their uncertainty. A sensitivity analysis has been carried out to determine the reactions whose uncertainty most affect the model output uncertainty. Special attention should be paid to these so-called key reactions in future laboratory experiments and quantum chemical computations to reduce the model output uncertainty more effectively. This will allow to better constrain which parent molecules are responsible for the observational C3 and C2 column densities. Based on observations of the four sample comets C/2001 Q4 (NEAT), C/2002 T7 (LINEAR), 9P (Tempel 1) and C/1995 O1 (Hale-Bopp), this work investigates which combination of the following proposed parent molecules C4H2 (diacetylene), CH2C2H2 (allene), CH3C2H (propyne), C2H4 (ethene) and observed parent molecules C2H2 and HC3N (cyanoacetylene) can best reproduce the observational C3 and C2 column densities in cometary comae, taking into account the uncertainties in photodissociation rate coefficients. It was found that the investigated photodissociation rate coefficients have large uncertainties and also a significant effect on the C3 and C2 model column densities. The responsible key reactions were determined with the sensitivity analysis. The important result of this thesis is that one can reasonably well reproduce the observations of comets with the improved model at rh = 1.00 AU (NEAT) and rh = 3.78 AU (Hale-Bopp), within the photodissociation uncertainties using realistic parent molecule production rate ratios and by various combinations of the investigated parent molecules. To confirm the agreement (NEAT, Hale-Bopp) and to clearify remaining discrepancies (LINEAR, Tempel 1) between model and observations requires additional observations of parent and daughter molecules in the coma of comets as well as in situ measurements of cometary ices (Rosetta).zeige weniger

Top