Molecular basis and consequences of a deletion in the amelogenin gene, analyzed by capture PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagerstroem-Fermer, M.; Pettersson, U.; Landegren, U.

1993-07-01

A mutation that disrupts the gene for one of the major proteins in tooth enamel has been investigated. The mutation is located in the amelogenin gene and causes X-linked amelogenesis imperfecta, characterized by defective mineralization of tooth enamel. The authors have isolated the breakpoints of a 5-kb deletion in the amelogenin gene on the basis of nucleotide sequence information located upstream of the lesion, using a technique termed capture PCR. The deletion removes five of the seven exons, spanning from the second intron to the last exon. Only the first two codons for the mature protein remain, consistent with themore » relatively severe phenotype of affected individuals in the present family. The mutation appears to have arisen as an illegitimate recombination event since of 11 nucleotide positions immediately surrounding the two breakpoints, 9 are identical. 17 refs., 3 figs., 1 tab.« less

An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

PubMed Central

Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

2015-01-01

Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

Big Spring spinedace and associated fish populations and habitat conditions in Condor Canyon, Meadow Valley Wash, Nevada

USGS Publications Warehouse

Jezorek, Ian G.; Connolly, Patrick J.; Munz, Carrie S.; Dixon, Chris

2011-01-01

Executive Summary: This project was designed to document habitat conditions and populations of native and non-native fish within the 8-kilometer Condor Canyon section of Meadow Valley Wash, Nevada, with an emphasis on Big Spring spinedace (Lepidomeda mollispinis pratensis). Other native fish present were speckled dace (Rhinichthys osculus) and desert sucker (Catostomus clarki). Big Spring spinedace were known to exist only within this drainage and were known to have been extirpated from a portion of their former habitat located downstream of Condor Canyon. Because of this extirpation and the limited distribution of Big Spring spinedace, the U.S. Fish and Wildlife Service listed this species as threatened under the Endangered Species Act in 1985. Prior to our effort, little was known about Big Spring spinedace populations or life histories and habitat associations. In 2008, personnel from the U.S. Geological Survey's Columbia River Research Laboratory began surveys of Meadow Valley Wash in Condor Canyon. Habitat surveys characterized numerous variables within 13 reaches, thermologgers were deployed at 9 locations to record water temperatures, and fish populations were surveyed at 22 individual sites. Additionally, fish were tagged with Passive Integrated Transponder (PIT) tags, which allowed movement and growth information to be collected on individual fish. The movements of tagged fish were monitored with a combination of recapture events and stationary in-stream antennas, which detected tagged fish. Meadow Valley Wash within Condor Canyon was divided by a 12-meter (m) waterfall known as Delmue Falls. About 6,100 m of stream were surveyed downstream of the falls and about 2,200 m of stream were surveyed upstream of the falls. Although about three-quarters of the surveyed stream length was downstream of Delmue Falls, the highest densities and abundance of native fish were upstream of the falls. Big Spring spinedace and desert sucker populations were highest near the upper end of Condor Canyon, where a tributary known as Kill Wash, and several springs, contribute flow and moderate high and low water temperature. Kill Wash and the area around its confluence with Meadow Valley Wash appeared important for spawning of all three native species. Detections of PIT-tagged fish indicated that there were substantial movements to this area during the spring. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. Our surveys included about 700 m of Meadow Valley Wash upstream of Kill Wash. A small falls about 2 m high was about 560 m upstream of Kill Wash. This falls is likely a barrier to upstream fish movement at most flows. Populations of all three native species were found upstream of this small falls. Age-0 fish of all three species were present, indicating successful spawning. The maximum upstream extent of native fish within Meadow Valley Wash was not determined. A population of non-native rainbow trout (Oncorhynchus mykiss) was found within the 2,000 m of stream immediately downstream of Delmue Falls. Non-native crayfish were very common both upstream and downstream of Delmue Falls. We were not able to quantify crayfish populations, but they compose a significant portion of the biomass of aquatic species in Condor Canyon. There were some distinctive habitat features that may have favored native fish upstream of Delmue Falls. Upstream of the falls, water temperatures were moderated by inputs from springs, turbidity was lower, pool habitat was more prevalent, substrate heterogeneity was higher, and there was less fine sediment than

Auxin, the organizer of the hormonal/environmental signals for root hair growth

PubMed Central

Lee, Richard D.-W.; Cho, Hyung-Taeg

2013-01-01

The root hair development is controlled by diverse factors such as fate-determining developmental cues, auxin-related environmental factors, and hormones. In particular, the soil environmental factors are important as they maximize their absorption by modulating root hair development. These environmental factors affect the root hair developmental process by making use of diverse hormones. These hormonal factors interact with each other to modulate root hair development in which auxin appears to form the most intensive networks with the pathways from environmental factors and hormones. Moreover, auxin action for root hair development is genetically located immediately upstream of the root hair-morphogenetic genes. These observations suggest that auxin plays as an organizing node for environmental/hormonal pathways to modulate root hair growth. PMID:24273547

Rivers and reciprocity: perceptions and policy on international watercourses

NASA Astrophysics Data System (ADS)

Tian, Fuqiang

2017-04-01

The paper analyses geopolitical dimensions of the 1997 United Nations Convention on the Law of the NonNavigational Uses of International Watercourses (UNWC) using quantitative data on transboundary flows and qualitative data on basin State location within a watercourse. The UNWC has had a long and difficult history. A tendency for downstream support for, and upstream ambivalence/opposition to, the UNWC is identified. It appears not widely recognized that adverse effects can be caused by any State on other States, regardless of their upstream or downstream location. Thus downstream States consider that their actions cannot harm upstream States, and upstream States consider that the UNWC provides them with greater obligations than downstream States. Clarification of the UNWC with the principle of reciprocal obligations on all States, both upstream and downstream, will remove any ambiguity, correct misperceptions, have clear policy implications for all States, promote UNWC engagement of upstream States, and contribute to long-term global water security.

Distribution and abundance of stream fishes in relation to barriers: implications for monitoring stream recovery after barrier removal

USGS Publications Warehouse

Zydlewski, Joseph D.; Coghlan, Stephen M.; Gardner, C.; Saunders, R.

2011-01-01

Dams are ubiquitous in coastal regions and have altered stream habitats and the distribution and abundance of stream fishes in those habitats by disrupting hydrology, temperature regime and habitat connectivity. Dam removal is a common restoration tool, but often the response of the fish assemblage is not monitored rigorously. Sedgeunkedunk Stream, a small tributary to the Penobscot River (Maine, USA), has been the focus of a restoration effort that includes the removal of two low-head dams. In this study, we quantified fish assemblage metrics along a longitudinal gradient in Sedgeunkedunk Stream and also in a nearby reference stream. By establishing pre-removal baseline conditions and associated variability and the conditions and variability immediately following removal, we can characterize future changes in the system associated with dam removal. Over 2 years prior to dam removal, species richness and abundance in Sedgeunkedunk Stream were highest downstream of the lowest dam, lowest immediately upstream of that dam and intermediate farther upstream; patterns were similar in the reference stream. Although seasonal and annual variation in metrics within each site was substantial, the overall upstream-to-downstream pattern along the stream gradient was remarkably consistent prior to dam removal. Immediately after dam removal, we saw significant decreases in richness and abundance downstream of the former dam site and a corresponding increase in fish abundance upstream of the former dam site. No such changes occurred in reference sites. Our results show that by quantifying baseline conditions in a small stream before restoration, the effects of stream restoration efforts on fish assemblages can be monitored successfully. These data set the stage for the long-term assessment of Sedgeunkedunk Stream and provide a simple methodology for assessment in other restoration projects.

Alternate promoter selection within a human cytomegalovirus immediate-early and early transcription unit (UL119-115) defines true late transcripts containing open reading frames for putative viral glycoproteins.

PubMed Central

Leatham, M P; Witte, P R; Stinski, M F

1991-01-01

The human cytomegalovirus open reading frames (ORFs) UL119 through UL115 (UL119-115) are located downstream of the immediate-early 1 and 2 transcription units. The promoter upstream of UL119 is active at all times after infection and drives the synthesis of a spliced 3.1-kb mRNA. The viral mRNA initiates in UL119, contains UL119-117 and UL116, and terminates just downstream of UL115. True late transcripts that are detected only after viral DNA synthesis originate from this transcription unit. True late mRNAs of 2.1 kb, containing ORFs UL116 and UL115, and 1.2 kb, containing ORF UL115 only, are synthesized. The true late viral mRNAs are 3' coterminal with the 3.1-kb mRNA. This transcription unit is an example of late promoters nested within an immediate-early-early transcription unit. The gene products of UL119-117, UL116, and UL115 are predicted to be glycoproteins. Efficient expression of the downstream ORFs at late times after infection may be related to alternate promoter usage and downstream cap site selection. Images PMID:1717716

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

Grant management procedure for energy saving TDM-PONs

NASA Astrophysics Data System (ADS)

Alaelddin, Fuad Yousif Mohammed; Newaz, S. H. Shah; AL-Hazemi, Fawaz; Choi, Jun Kyun

2018-01-01

In order to minimize energy consumption in Time Division Multiplexing-Passive Optical Network (TDM-PON), IEEE and ITU-T have mandated sleep mode mechanism for Optical Network Units (ONUs) in the latest TDM-PON standards (e.g. IEEE P1904.1 SIEPON, ITU-T G.sup45). The sleep mode mechanism is a promising mean for maximizing energy saving in an ONU. An ONU in sleep mode flips between sleep and active state depending on the presence or absent of upstream and downstream frames. To ensure Quality of Service (QoS) of upstream frames, the recent TDM-PON standards introduced an early wake-up mechanism, in which an ONU is forced to leave the sleep state on upstream frame arrival. When the Optical Line Terminal (OLT) of a TDM-PON allows early wake-up of its connected ONUs, it allocates gratuitous grants for the sleeping ONUs along with allocating upstream grants for the ONUs in active state. Note that, the gratuitous grants control message sent periodically by the OLT on Inter-Gratuitous grant Interval (IGI) time. After leaving sleep state due to the arrival of upstream frame, the ONU uses its allocated gratuitous grant to send a control message mentioning the amount of upstream bandwidth (upstream grant) required in order to forward the remaining frames in its buffer. However, the existing early wake-up process of ONU can lead to increase the energy consumption of an ONU. It is because of the ONU wakes-up immediately from the sleep state on arrival of the upstream frame, but even so, it needs to wait for forwarding the frame until its allocated gratuitous grant period, resulting in spending energy unnecessarily. In addition, current energy saving solution for TDM-PONs do not provide a clear solution on how to manage different types of grants (e.g. listening grant, upstream transmission grant) within a Dynamic Bandwidth Allocation (DBA) polling cycle. To address this problem, we propose a state-of-art Grant Management Procedure (GMP) in order to maximize energy saving in a TDM-PON with sleep mode enabled ONUs. GMP contributes in defining the location of the different types of grants during a DBA polling cycle. Furthermore, GMP devises a mechanism so as to allow an ONU to predict its assigned gratuitous grant control message arrival time, thereby allowing an ONU to remain its transceiver unit powered off until the arrival period of the next gratuitous grant control message, increasing the energy saving of the ONU. Results show that, with the increment of IGI, the energy saving performance of an ONU with GMP increases noticeably in compare to a conventional ONU (an ONU that does not use GMP) without imposing any additional upstream frame delay.

VIEW OF LOCATION OF CHILDS POWER PLANT (SHOWING POWERHOUSE AND ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

VIEW OF LOCATION OF CHILDS POWER PLANT (SHOWING POWERHOUSE AND TRANSFORMER FRAMEWORK AT LEFT, BELOW POWER LINES AND THE MAINTENANCE AND RESIDENTIAL COMPOUND UPSTREAM TO RIGHT) ALONG VERDE RIVER FROM FS ROAD #502. LOOKING UPSTREAM (WEST-SOUTHWEST) - Childs-Irving Hydroelectric Project, Forest Service Road 708/502, Camp Verde, Yavapai County, AZ

Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

PubMed

Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

2016-01-04

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

Monte Carlo evaluation of magnetically focused proton beams for radiosurgery

NASA Astrophysics Data System (ADS)

McAuley, Grant A.; Heczko, Sarah L.; Nguyen, Theodore T.; Slater, James M.; Slater, Jerry D.; Wroe, Andrew J.

2018-03-01

The purpose of this project is to investigate the advantages in dose distribution and delivery of proton beams focused by a triplet of quadrupole magnets in the context of potential radiosurgery treatments. Monte Carlo simulations were performed using various configurations of three quadrupole magnets located immediately upstream of a water phantom. Magnet parameters were selected to match what can be commercially manufactured as assemblies of rare-earth permanent magnetic materials. Focused unmodulated proton beams with a range of ~10 cm in water were target matched with passive collimated beams (the current beam delivery method for proton radiosurgery) and properties of transverse dose, depth dose and volumetric dose distributions were compared. Magnetically focused beams delivered beam spots of low eccentricity to Bragg peak depth with full widths at the 90% reference dose contour from ~2.5 to 5 mm. When focused initial beam diameters were larger than matching unfocused beams (10 of 11 cases) the focused beams showed 16%–83% larger peak-to-entrance dose ratios and 1.3 to 3.4-fold increases in dose delivery efficiency. Peak-to-entrance and efficiency benefits tended to increase with larger magnet gradients and larger initial diameter focused beams. Finally, it was observed that focusing tended to shift dose in the water phantom volume from the 80%–20% dose range to below 20% of reference dose, compared to unfocused beams. We conclude that focusing proton beams immediately upstream from tissue entry using permanent magnet assemblies can produce beams with larger peak-to-entrance dose ratios and increased dose delivery efficiencies. Such beams could potentially be used in the clinic to irradiate small-field radiosurgical targets with fewer beams, lower entrance dose and shorter treatment times.

Evidence for specularly reflected ions upstream from the quasi-parallel bow shock

NASA Technical Reports Server (NTRS)

Gosling, J. T.; Thomsen, M. F.; Bame, S. J.; Feldman, W. C.; Paschmann, G.; Sckopke, N.

1982-01-01

Ion velocity distributions in the form of bunches of gyrating particles traveling along helical paths have been observed moving sunward immediately upstream from quasi-parallel parts of the earth's bow shock using Los Alamos/Garching instruments on ISEE-1 and -2. These distributions have characteristics which indicate that they are produced by the nearly specular reflection at the shock of a portion of the incident solar wind ions. In particular, the guiding center motion and the gyrospeeds of the gyrating ions are quantitatively consistent with simple geometrical considerations for specular reflection. These considerations reveal that specularly reflected ions can escape upstream when the angle between the upstream magnetic field and the local shock normal is less than 45 deg but not when the angle is greater than 45 deg. These upstream gyrating ions are an important signature of one of the processes by which solar wind streaming energy is dissipated into other forms of energy at the shock.

Channel Incision Driven by Suburbanization: Impacts to Riparian Groundwater Flow and Overbank Flow Frequency

NASA Astrophysics Data System (ADS)

Bowles, C. J.; Lawrence, R. L.; Noll, C.; Hancock, G. S.

2005-12-01

Channel incision is a widely observed response to increased flow in urbanized watersheds, but the effects of channel lowering on riparian water tables is not well documented. In a rapidly incising suburban stream in the Virginia Coastal Plain, we hypothesize that stream incision has lowered floodplain water tables and decreased the overbank flow frequency. The monitored stream is a tributary to the James River draining 1.3 km2 of which 15% is impervious cover. Incision has occurred largely through upstream migration of a one meter high knickpoint at a rate of ~1.5 m/yr, primarily during high flow events. We installed 63 wells in six stream-perpendicular transects as well as a cluster of wells around the knickpoint to assess water table elevations beneath the floodplain adjacent to the incising stream. Two transects are located 30 and 50 m upstream of the knickpoint in the unincised floodplain, and the remainder are 5, 30, 70, and 100 m downstream in the incised floodplain. In one transect above and two below, pressure transducers attached to dataloggers provide a high-resolution record of water table changes. Erosion pins were installed and channel cross-sections surveyed to determine streambed stability. Significant differences are observed in bank morphology and groundwater flow above vs. below the knickpoint. Above the knickpoint, the banks are stable, ~3 m wide, and ~0.3 m deep, and widen and deepen slightly toward the knickpoint. The water table is relatively flat and is 0.2-0.4 m below the floodplain surface, and groundwater contours suggest flow is parallel to the stream direction. The water table responds immediately to precipitation events, and rises to the floodplain surface in significant rainfall events. Immediately downstream of the knickpoint, channel width increases by about a meter, and stream depth increases to ~1.5 meters. The water table immediately below the knickpoint possesses a steep gradient, and is up to one meter below the floodplain surface. Groundwater flow is redirected toward the stream. Moving downstream banks continue to widen, and the channel is up to 8 m wide and ~1.3 m deep ~100 m below the current knickpoint position. In the most downstream transects, the water table slopes gently toward the stream and remains ~1 m below the floodplain surface, equivalent to the depth of incision generated by knickpoint passage. Upstream of the knickpoint, overbank flooding occurs frequently, while below the knickpoint the majority of storm flow is contained within the incised channel and occupation of the floodplain is rare. The impact of incision to the riparian water table is dramatic, with a lowered water table and redirection of groundwater flow toward the stream. The incision is driven by suburbanization upstream of this riparian corridor, and has likely reduced the ability of this protected riparian system to improve the water quality of the suburban runoff that passes through it.

The REP2 Repeats of the Genome of Neisseria meningitidis Are Associated with Genes Coordinately Regulated during Bacterial Cell Interaction

PubMed Central

Morelle, Sandrine; Carbonnelle, Etienne; Nassif, Xavier

2003-01-01

Interaction with host cells is essential in meningococcal pathogenesis especially at the blood-brain barrier. This step is likely to involve a common regulatory pathway allowing coordinate regulation of genes necessary for the interaction with endothelial cells. The analysis of the genomic sequence of Neisseria meningitidis Z2491 revealed the presence of many repeats. One of these, designated REP2, contains a −24/−12 type promoter and a ribosome binding site 5 to 13 bp before an ATG. In addition most of these REP2 sequences are located immediately upstream of an ORF. Among these REP2-associated genes are pilC1 and crgA, described as being involved in steps essential for the interaction of N. meningitidis with host cells. Furthermore, the REP2 sequences located upstream of pilC1 and crgA correspond to the previously identified promoters known to be induced during the initial localized adhesion of N. meningitidis with human cells. This characteristic led us to hypothesize that at least some of the REP2-associated genes were upregulated under the same circumstances as pilC1 and crgA. Quantitative PCR in real time demonstrated that the expression of 14 out of 16 REP2-associated genes were upregulated during the initial localized adhesion of N. meningitidis. Taken together, these data suggest that these repeats control a set of genes necessary for the efficient interaction of this pathogen with host cells. Subsequent mutational analysis was performed to address the role of these genes during meningococcus-cell interaction. PMID:12670987

Void/particulate detector

DOEpatents

Claytor, Thomas N.; Karplus, Henry B.

1985-01-01

Voids and particulates are detected in a flowing stream of fluid contained in a pipe by a detector which includes three transducers spaced about the pipe. A first transducer at a first location on the pipe transmits an ultrasonic signal into the stream. A second transducer detects the through-transmission of the signal at a second location and a third transducer at a third location upstream from the first location detects the back-scattering of the signal from any voids or particulates. To differentiate between voids and particulates a fourth transducer is positioned at a fourth location which is also upstream from the first location. The back-scattered signals are normalized with the through-transmission signal to minimize temperature fluctuations.

Designing synthetic RNAs to determine the relevance of structural motifs in picornavirus IRES elements

NASA Astrophysics Data System (ADS)

Fernandez-Chamorro, Javier; Lozano, Gloria; Garcia-Martin, Juan Antonio; Ramajo, Jorge; Dotu, Ivan; Clote, Peter; Martinez-Salas, Encarnacion

2016-04-01

The function of Internal Ribosome Entry Site (IRES) elements is intimately linked to their RNA structure. Viral IRES elements are organized in modular domains consisting of one or more stem-loops that harbor conserved RNA motifs critical for internal initiation of translation. A conserved motif is the pyrimidine-tract located upstream of the functional initiation codon in type I and II picornavirus IRES. By computationally designing synthetic RNAs to fold into a structure that sequesters the polypyrimidine tract in a hairpin, we establish a correlation between predicted inaccessibility of the pyrimidine tract and IRES activity, as determined in both in vitro and in vivo systems. Our data supports the hypothesis that structural sequestration of the pyrimidine-tract within a stable hairpin inactivates IRES activity, since the stronger the stability of the hairpin the higher the inhibition of protein synthesis. Destabilization of the stem-loop immediately upstream of the pyrimidine-tract also decreases IRES activity. Our work introduces a hybrid computational/experimental method to determine the importance of structural motifs for biological function. Specifically, we show the feasibility of using the software RNAiFold to design synthetic RNAs with particular sequence and structural motifs that permit subsequent experimental determination of the importance of such motifs for biological function.

Modeling strategic competition in hydro-thermal electricity generation markets with cascaded reservoir-hydroelectric generation plants

NASA Astrophysics Data System (ADS)

Uluca, Basak

This dissertation aims to achieve two goals. The first is to model the strategic interactions of firms that own cascaded reservoir-hydro plants in oligopolistic and mixed oligopolistic hydrothermal electricity generation markets. Although competition in thermal generation has been extensively modeled since the beginning of deregulation, the literature on competition in hydro generation is still limited; in particular, equilibrium models of oligopoly that study the competitive behavior of firms that own reservoir-hydro plants along the same river in hydrothermal electricity generation markets are still under development. In competitive markets, when the reservoirs are located along the same river, the water released from an upstream reservoir for electricity generation becomes input to the immediate downstream reservoir, which may be owned by a competitor, for current or future use. To capture the strategic interactions among firms with cascaded reservoir-hydro plants, the Upstream-Conjecture approach is proposed. Under the Upstream-Conjecture approach, a firm with an upstream reservoir-hydro plant assumes that firms with downstream reservoir-hydro plants will respond to changes in the upstream firm's water release by adjusting their water release by the same amount. The results of the Upstream Conjecture experiments indicate that firms that own upstream reservoirs in a cascade may have incentive to withhold or limit hydro generation, forcing a reduction in the utilization of the downstream hydro generation plants that are owned by competitors. Introducing competition to hydroelectricity generation markets is challenging and ownership allocation of the previously state-owned cascaded reservoir-hydro plants through privatization can have significant impact on the competitiveness of the generation market. The second goal of the dissertation is to extract empirical guidance about best policy choices for the ownership of the state-owned generation plants, including the cascaded reservoir-hydro plants. Specifically, an equilibrium model of oligopoly, where only private firms compete for electricity supply is proposed. Since some electricity generation markets are better characterized as mixed oligopolies, where the public firm coexists with the private firms for electricity supply, and not as oligopolies, another equilibrium model of mixed oligopoly is proposed. The proposed mixed oligopoly equilibrium model is the first implementation of such market structure in electricity markets. The mathematical models developed in this research are applied to the simplified representation of the Turkish electricity generation market to investigate the impact of various ownership allocation scenarios that may result from the privatization of the state owned generation plants, including the cascaded reservoir-hydro plants, on the competitive market outcomes.

33 CFR 207.275 - McClellan-Kerr Arkansas River navigation system: use, administration, and navigation.

Code of Federal Regulations, 2014 CFR

2014-07-01

.... Vessels arriving at these markers or the mooring cells immediately upstream and downstream of the lock... mooring facilities at the junction of main stem and secondary channels are to provide temporary mooring...

Physical map location of the multicopy genes coding for ammonia monooxygenase and hydroxylamine oxidoreductase in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11.

PubMed

Hirota, R; Yamagata, A; Kato, J; Kuroda, A; Ikeda, T; Takiguchi, N; Ohtake, H

2000-02-01

Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB(1) and amoCAB(2)), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)). In this DNA fragment, amoCAB(1) and amoCAB(2) were about 390 kb apart, while hao(1), hao(2), and hao(3) were separated by at least about 100 kb from each other. Interestingly, hao(1) and hao(2) were located relatively close to amoCAB(1) and amoCAB(2), respectively. DNA sequence analysis revealed that hao(1) and hao(2) shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao(3) showed only 30% nucleotide identity in the 160-bp corresponding region.

Physical Map Location of the Multicopy Genes Coding for Ammonia Monooxygenase and Hydroxylamine Oxidoreductase in the Ammonia-Oxidizing Bacterium Nitrosomonas sp. Strain ENI-11

PubMed Central

Hirota, Ryuichi; Yamagata, Akira; Kato, Junichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

2000-01-01

Pulsed-field gel electrophoresis of PmeI digests of the Nitrosomonas sp. strain ENI-11 chromosome produced four bands ranging from 1,200 to 480 kb in size. Southern hybridizations suggested that a 487-kb PmeI fragment contained two copies of the amoCAB genes, coding for ammonia monooxygenase (designated amoCAB1 and amoCAB2), and three copies of the hao gene, coding for hydroxylamine oxidoreductase (hao1, hao2, and hao3). In this DNA fragment, amoCAB1 and amoCAB2 were about 390 kb apart, while hao1, hao2, and hao3 were separated by at least about 100 kb from each other. Interestingly, hao1 and hao2 were located relatively close to amoCAB1 and amoCAB2, respectively. DNA sequence analysis revealed that hao1 and hao2 shared 160 identical nucleotides immediately upstream of each translation initiation codon. However, hao3 showed only 30% nucleotide identity in the 160-bp corresponding region. PMID:10633121

Pea chloroplast tRNA(Lys) (UUU) gene: transcription and analysis of an intron-containing gene.

PubMed

Boyer, S K; Mullet, J E

1988-07-01

The pea chloroplast trnK gene which encodes tRNA(Lys) (UUU) was sequenced. TrnK is located 210 bp upstream from the promoter of psbA and immediately downstream from the 3'-end of rbcL. The gene is transcribed from the same DNA strand as psbA and rbcL. A 2447 bp intron with class II features is located in the trnK anticodon loop. The intron contains a 506 amino acid open reading frame which could encode an RNA maturase. The primary transcript of trnK is 2.9 kb long; its 5'-end was identified as a site of transcription initiation by in vitro transcription experiments. The 5'-terminus is adjacent to DNA sequences previously identified as transcription promoter elements. The most abundant trnK transcript is 2.5 kb long with termini corresponding to the 5' and 3' ends of the trnK exons. Intron specific RNAs were not detected. This suggests that RNA processing which produces tRNA(Lys) leads to rapid degradation of intron sequences.

Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

USGS Publications Warehouse

Fallon, James D.; Yaeger, Christine S.

2009-01-01

Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1.7 percent), ammonia plus organic nitrogen (13 percent), total phosphorus (62 percent), and suspended sediment (11 percent) during the study. All constituents had seasonal peaks in spring and fall. The large loads during the fall resulted from unusually large precipitation and streamflow patterns. This caused the two greatest streamflow peaks at both sites to occur during October (2004 and 2005). In Seguchie Creek, bed-sediment concentrations of five metals and trace elements (arsenic, cadmium, chromium, lead, and zinc) exceeded the Interim Sediment Quality Guidelines (ISQG) set by the Canadian Council of Ministers of the Environment. Bed-sediment samples from the upstream site had more exceedances of ISQGs for metals and trace elements than did samples from the downstream site (seven and two exceedances, respectively). Bed-sediment samples from the downstream site had more exceedances of ISQGs (20 exceedances) for semivolatile organic compounds than did samples from the upstream site (8 exceedances), indicating different sources for organic compounds than for metals and trace elements. Concentrations of 11 semivolatile organic compounds exceeded ISQGs: ancenaphthene, acenaphthylene, anthracene, benzo[a]anthracene, benzo[a]pyrene, chrysene, fluoranthene, fluorene, naphthalene, phenanthrene, and pyrene. In bed-sediment samples collected from three wetlands, concentrations of all six metals exceeded ISQGs: arsenic, cadmium, chromium, copper, lead, and zinc. Concentrations of three semivolatile organic compounds exceeded ISQGs: flouranthene, phenanthrene, and pyrene. Results indicate that areas appearing relatively undisturbed and of high resource value can have degraded quality from previous unknown land use.

Refining the regulatory region upstream of SOX9 associated with 46,XX testicular disorders of Sex Development (DSD).

PubMed

Hyon, Capucine; Chantot-Bastaraud, Sandra; Harbuz, Radu; Bhouri, Rakia; Perrot, Nicolas; Peycelon, Matthieu; Sibony, Mathilde; Rojo, Sandra; Piguel, Xavier; Bilan, Frederic; Gilbert-Dussardier, Brigitte; Kitzis, Alain; McElreavey, Ken; Siffroi, Jean-Pierre; Bashamboo, Anu

2015-08-01

Disorders of Sex Development (DSD) are a heterogeneous group of disorders affecting gonad and/or genito-urinary tract development and usually the endocrine-reproductive system. A genetic diagnosis is made in only around 20% of these cases. The genetic causes of 46,XX-SRY negative testicular DSD as well as ovotesticular DSD are poorly defined. Duplications involving a region located ∼600 kb upstream of SOX9, a key gene in testis development, were reported in several cases of 46,XX DSD. Recent studies have narrowed this region down to a 78 kb interval that is duplicated or deleted respectively in 46,XX or 46,XY DSD. We identified three phenotypically normal patients presenting with azoospermia and 46,XX testicular DSD. Two brothers carried a 83.8 kb duplication located ∼600 kb upstream of SOX9 that overlapped with the previously reported rearrangements. This duplication refines the minimal region associated with 46,XX-SRY negative DSD to a 40.7-41.9 kb element located ∼600 kb upstream of SOX9. Predicted enhancer elements and evolutionary-conserved binding sites for proteins known to be involved in testis determination are located within this region. © 2015 Wiley Periodicals, Inc.

Method and apparatus for capturing carbon dioxide during combustion of carbon containing fuel

DOEpatents

Axelbaum, Richard L.; Kumfer, Benjamin M.; Xia, Fei; Gopan, Akshay; Dhungel, Bhupesh

2018-04-10

A boiler system having a series of boilers. Each boiler includes a shell having an upstream end, a downstream end, and a hollow interior. The boilers also have an oxidizer inlet entering the hollow interior adjacent the upstream end of the shell and a fuel nozzle positioned adjacent the upstream end of the shell for introducing fuel into the hollow interior of the shell. Each boiler includes a flue duct connected to the shell adjacent the downstream end for transporting flue gas from the hollow interior. Oxygen is delivered to the oxidizer inlet of the first boiler in the series. Flue gas from the immediately preceding boiler in the series is delivered through the oxidizer inlet of each boiler subsequent to the first boiler in the series.

Inundation and draining of the Trinity River floodplain associated with extreme precipitation from Hurricane Harvey, east Texas, USA

NASA Astrophysics Data System (ADS)

Hassenruck-Gudipati, H. J.; Goudge, T. A.; Mohrig, D. C.

2017-12-01

Rivers swelled up beyond their historic high-water marks due to precipitation from Hurricane Harvey. We used Harvey-induced flooding to investigate the flow connectivity between the coastal Trinity River and its floodplain by measuring water depth and velocity, as well as sediment-transporting conditions on the natural levee that separates the two. River discharge within the study area peaked at a historic high of 3600 cubic meters per second on September 1, 2017. The levees on two river bends were investigated on September 3 and 4 in order to characterize the hydraulic connectivity between the channel and its floodplain during the early falling limb of this flood. On September 3, a river bend located approximately 28km upstream of the river mouth was visited. Water was overtopping the levee crest at this location, 30m away from the levee crest. This overland flow only experienced about a threefold reduction in average velocity to 0.16 m/s (in 2.2 m of water) 600m away from the levee crest. On September 4, a river bend approximately 59km upstream of the river mouth was investigated. Even though the river stage was at the National Weather Service major flood stage, the levee crest separating the river and floodplain was emergent. Regardless of this local disconnect between the river and its floodplain, substantial and variable drainage velocities were measured depending on drainage patterns controlled by local topography. Velocities measured in shallow water immediately adjacent to the emergent levee were low (< 0.05 m/s in 0.2 m of water). The highest drainage velocity ( 0.18 m/s in 1.7 m of water) associated with the upstream river-bend was measured at 750m from the channel and was similar in magnitude to those recorded for the distal inundating overland flow a day before on the downstream river-bend. Results from this work highlight the maintenance of high flow velocities across the distal floodplain even during its drainage phase. The transport of sediment, detrital organics, and solutes will be explored within the context of these overland flow velocities.

A pause site for RNA polymerase II is associated with termination of transcription.

PubMed Central

Enriquez-Harris, P; Levitt, N; Briggs, D; Proudfoot, N J

1991-01-01

Termination of transcription by RNA polymerase II has been postulated to involve a pausing process. We have identified such a pause signal, 350 bp into the 3' flanking region of the human alpha 2 globin gene at a position where termination is thought to occur. We show that this pause signal enhances the utilization of an upstream poly(A) site which is otherwise out-competed by a stronger downstream poly(A) site. We also demonstrate that the pause site rescues a poly(A) site that is inactive due to its location within an intron. Using nuclear run-on analysis we show that elongating RNA polymerase II molecules accumulate over this pause signal. Furthermore we show that when the pause site is positioned immediately downstream of a strong poly(A) signal, significant levels of transcription termination take place. Images PMID:2050120

Spectral radiance measurements and calculated soot concentrations along the length of an experimental combustor

NASA Technical Reports Server (NTRS)

Norgren, C. T.; Ingebo, R. D.

1976-01-01

Radiometric data were obtained over a range of parametric test conditions at three positions along the length of an experimental combustor segment corresponding to the primary, intermediate, and dilution zones. The concentration of soot entrained in the combustion gases was calculated by a technique using spectral radiance measurements. Tests were conducted primarily with Jet A fuel, although limited data were taken with two fuels having higher aromatic content, diesel oil number 2 and a blend of 40 percent tetralin in Jet A fuel. Radiometric observation of the combustion gases indicated that the maximum total radiance peaked at the intermediate zone, which was located immediately upstream of the dilution holes. Soot concentrations calculated from optical measurements in the dilution zone compared favorably with those obtained by in situ gas sampling at the exhaust. The total radiance increased with the higher aromatic content fuels.

Insulators form gene loops by interacting with promoters in Drosophila.

PubMed

Erokhin, Maksim; Davydova, Anna; Kyrchanova, Olga; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya

2011-09-01

Chromatin insulators are regulatory elements involved in the modulation of enhancer-promoter communication. The 1A2 and Wari insulators are located immediately downstream of the Drosophila yellow and white genes, respectively. Using an assay based on the yeast GAL4 activator, we have found that both insulators are able to interact with their target promoters in transgenic lines, forming gene loops. The existence of an insulator-promoter loop is confirmed by the fact that insulator proteins could be detected on the promoter only in the presence of an insulator in the transgene. The upstream promoter regions, which are required for long-distance stimulation by enhancers, are not essential for promoter-insulator interactions. Both insulators support basal activity of the yellow and white promoters in eyes. Thus, the ability of insulators to interact with promoters might play an important role in the regulation of basal gene transcription.

Hydrological threats to riparian wetlands of international importance - a global quantitative and qualitative analysis

NASA Astrophysics Data System (ADS)

Schneider, Christof; Flörke, Martina; De Stefano, Lucia; Petersen-Perlman, Jacob D.

2017-06-01

Riparian wetlands have been disappearing at an accelerating rate. Their ecological integrity as well as their vital ecosystem services for humankind depend on regular patterns of inundation and drying provided by natural flow regimes. However, river hydrology has been altered worldwide. Dams cause less variable flow regimes and water abstractions decrease the amount of flow so that ecologically important flood pulses are often reduced. Given growing population pressure and projected climate change, immediate action is required. However, the implementation of counteractive measures is often a complex task. This study develops a screening tool for assessing hydrological threats to riparian wetlands on global scales. The approach is exemplified on 93 Ramsar sites, many of which are located in transboundary basins. First, the WaterGAP3 hydrological modeling framework is used to quantitatively compare current and future modified flow regimes to reference flow conditions. In our simulations current water resource management seriously impairs riparian wetland inundation at 29 % of the analyzed sites. A further 8 % experience significantly reduced flood pulses. In the future, eastern Europe, western Asia, as well as central South America could be hotspots of further flow modifications due to climate change. Second, a qualitative analysis of the 93 sites determined potential impact on overbank flows resulting from planned or proposed dam construction projects. They take place in one-third of the upstream areas and are likely to impair especially wetlands located in South America, Asia, and the Balkan Peninsula. Third, based on the existing legal/institutional framework and water resource availability upstream, further qualitative analysis evaluated the capacity to preserve overbank flows given future streamflow changes due to dam construction and climate change. Results indicate hotspots of vulnerability exist, especially in northern Africa and the Persian Gulf.

Suppression of HPV-16 late L1 5′-splice site SD3632 by binding of hnRNP D proteins and hnRNP A2/B1 to upstream AUAGUA RNA motifs

PubMed Central

Li, Xiaoze; Johansson, Cecilia; Glahder, Jacob; Mossberg, Ann-Kristin; Schwartz, Stefan

2013-01-01

Human papillomavirus type 16 (HPV-16) 5′-splice site SD3632 is used exclusively to produce late L1 mRNAs. We identified a 34-nt splicing inhibitory element located immediately upstream of HPV-16 late 5′-splice site SD3632. Two AUAGUA motifs located in these 34 nt inhibited SD3632. Two nucleotide substitutions in each of the HPV-16 specific AUAGUA motifs alleviated splicing inhibition and induced late L1 mRNA production from episomal forms of the HPV-16 genome in primary human keratinocytes. The AUAGUA motifs bind specifically not only to the heterogeneous nuclear RNP (hnRNP) D family of RNA-binding proteins including hnRNP D/AUF, hnRNP DL and hnRNP AB but also to hnRNP A2/B1. Knock-down of these proteins induced HPV-16 late L1 mRNA expression, and overexpression of hnRNP A2/B1, hnRNP AB, hnRNP DL and the two hnRNP D isoforms hnRNP D37 and hnRNP D40 further suppressed L1 mRNA expression. This inhibition may allow HPV-16 to hide from the immune system and establish long-term persistent infections with enhanced risk at progressing to cancer. There is an inverse correlation between expression of hnRNP D proteins and hnRNP A2/B1 and HPV-16 L1 production in the cervical epithelium, as well as in cervical cancer, supporting the conclusion that hnRNP D proteins and A2/B1 inhibit HPV-16 L1 mRNA production. PMID:24013563

Gas turbine engine with recirculating bleed

NASA Technical Reports Server (NTRS)

Adamson, A. P. (Inventor)

1978-01-01

Carbon monoxide and unburned hydrocarbon emissions in a gas turbine engine are reduced by bleeding hot air from the engine cycle and introducing it back into the engine upstream of the bleed location and upstream of the combustor inlet. As this hot inlet air is recycled, the combustor inlet temperature rises rapidly at a constant engine thrust level. In most combustors, this will reduce carbon monoxide and unburned hydrocarbon emissions significantly. The preferred locations for hot air extraction are at the compressor discharge or from within the turbine, whereas the preferred reentry location is at the compressor inlet.

A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

PubMed Central

León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

2013-01-01

Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

PubMed Central

Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

2007-01-01

Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

Noise generated by flow through large butterfly valves

NASA Technical Reports Server (NTRS)

Huff, Ronald G.

1987-01-01

A large butterfly valve (1.37 m diam) was acoustically tested to measure the noise generated and propagating in both the upstream and downstream directions. The experimental investigation used wall mounted pressure transducers to measure the fluctuating component of the pipe static pressure upstream and downstream of the valve. Microphones upstream of the pipe inlet and located in a plenum were used to measure the noise radiated from the valve in the upstream direction. Comparison of the wall pressure downstream of the valve to a prediction were made. Reasonable agreement was obtained with the valve operating at a choked condition. The noise upstream of the valve is 30 dB less than that measured downstream.

Organizational differences between cytoplasmic male sterile and male fertile Brassica mitochondrial genomes are confined to a single transposed locus.

PubMed Central

L'Homme, Y; Brown, G G

1993-01-01

Comparison of the physical maps of male fertile (cam) and male sterile (pol) mitochondrial genomes of Brassica napus indicates that structural differences between the two mtDNAs are confined to a region immediately upstream of the atp6 gene. Relative to cam mtDNA, pol mtDNA possesses a 4.5 kb segment at this locus that includes a chimeric gene that is cotranscribed with atp6 and lacks an approximately 1kb region located upstream of the cam atp6 gene. The 4.5 kb pol segment is present and similarly organized in the mitochondrial genome of the common nap B.napus cytoplasm; however, the nap and pol DNA regions flanking this segment are different and the nap sequences are not expressed. The 4.5 kb CMS-associated pol segment has thus apparently undergone transposition during the evolution of the nap and pol cytoplasms and has been lost in the cam genome subsequent to the pol-cam divergence. This 4.5 kb segment comprises the single DNA region that is expressed differently in fertile, pol CMS and fertility restored pol cytoplasm plants. The finding that this locus is part of the single mtDNA region organized differently in the fertile and male sterile mitochondrial genomes provides strong support for the view that it specifies the pol CMS trait. Images PMID:8388101

Accuracy of Phase-Contrast Velocity Mapping Proximal and Distal to Stent Artifact During Cardiac Magnetic Resonance Imaging.

PubMed

Avitabile, Catherine M; Harris, Matthew A; Doddasomayajula, Ravi S; Chopski, Steven G; Gillespie, Matthew J; Dori, Yoav; Glatz, Andrew C; Fogel, Mark A; Whitehead, Kevin K

2018-06-15

Little data are available on the accuracy of phase-contrast magnetic resonance imaging (PC-MRI) velocity mapping in the vicinity of intravascular metal stents other than nitinol stents. Therefore, we sought to determine this accuracy using in vitro experiments. An in vitro flow phantom was used with 3 stent types: (1) 316L stainless steel, (2) nitinol self-expanding, and (3) platinum-iridium. Steady and pulsatile flow was delivered with a magnetic resonance imaging-compatible pump (CardioFlow 5000, Shelley Medical, London, Ontario, Canada). Flows were measured using a transit time flow meter (ME13PXN, Transonic, Inc, Ithaca, New York). Mean flows ranged from 0.5 to 7 L/min. For each condition, 5 PC-MRI acquisitions were made: within the stent, immediately adjacent to both edges of the stent artifact, and 1 cm upstream and downstream of the artifact. Mean PC-MRI flows were calculated by segmenting the tube lumen using clinical software (ARGUS, Siemens, Inc, Erlangen, Germany). PC-MRI and flow meter flows were compared by location and stent type using linear regression, Bland-Altman, and intraclass correlation (ICC). PC-MRI flows within the stent artifact were inaccurate for all stents studied, generally underestimating flow meter-measured flow. Agreement between PC-MRI and flow meter-measured flows was excellent for all stent types, both immediately adjacent to and 1 cm away from the edge of the stent artifact. Agreement was highest for the platinum-iridium stent (R = 0.999, ICC = 0.999) and lowest for the nitinol stent (R = 0.993, ICC = 0.987). In conclusion, PC-MRI flows are highly accurate just upstream and downstream of a variety of clinically used stents, supporting its use to directly measure flows in stented vessels. Copyright © 2018 Elsevier Inc. All rights reserved.

Chemical data and lead isotopic compositions of geochemical baseline samples from streambed sediments and smelter slag, lead isotopic compositions in fluvial tailings, and dendrochronology results from the Boulder River watershed, Jefferson County, Montana

USGS Publications Warehouse

Unruh, Daniel M.; Fey, David L.; Church, Stan E.

2000-01-01

IntroductionAs a part of the U.S. Geological Survey Abandoned Mine Lands Initiative, metal-mining related wastes in the Boulder River study area in northern Jefferson County, Montana, have been evaluated for their environmental effects. The study area includes a 24-km segment of the Boulder River in and around Basin, Montana and three principal tributaries to the Boulder River: Basin Creek, Cataract Creek, and High Ore Creek. Mine and prospect waste dumps and mill wastes are located throughout the drainage basins of these tributaries and in the Boulder River. Mine-waste material has been transported into and down streams, where it has mixed with and become incorporated into the streambed sediments. In some localities, mine waste material was placed directly in stream channels and was transported downstream forming fluvial tailings deposits along the stream banks. Water quality and aquatic habitat have been affected by trace-element-contaminated sediment that moves from mine wastes into and down streams during snowmelt and storm runoff events within the Boulder River watershed.Present-day trace element concentrations in the streambed sediments and fluvial tailings have been extensively studied. However, in order to accurately evaluate the impact of mining on the stream environments, it is also necessary to evaluate the pre-mining trace-element concentrations in the streambed sediments. Three types of samples have been collected for estimation of pre-mining concentrations: 1) streambed sediment samples from the Boulder River and its tributaries located upstream from historical mining activity, 2) stream terrace deposits located both upstream and downstream of the major tributaries along the Boulder River, and 3) cores through sediment in overbank deposits, in abandoned stream channels, or beneath fluvial tailings deposits. In this report, we present geochemical data for six stream-terrace samples and twelve sediment-core samples and lead isotopic data for six terrace and thirteen core samples. Sample localities are in table 1 and figures 1 and 2, and site and sample descriptions are in table 2.Geochemical data have been presented for cores through fluvial tailings on High Ore Creek, on upper Basin Creek, and on Jack Creek and Uncle Sam Gulch. Geochemical and lead isotopic data for modern streambed-sediment samples have been presented by Fey and others.Lead isotopic determinations in bed sediments have been shown to be an effective tool for evaluating the contributions from various sources to the metals in bed sediments. However, in order to make these calculations, the lead isotopic compositions of the contaminant sources must also be known. Consequently, we have determined the lead isotopic compositions of five streambed-sediment samples heavily contaminated with fluvial mine waste immediately downstream from large mines in the Boulder River watershed in order to determine the lead isotopic signatures of the contaminants. Summary geochemical data for the contaminants are presented here and geochemical data for the streambed-sediment samples are given by Fey and others.Downstream from the Katie mill site and Jib tailings, fluvial deposits of mill tailings are present on a 10-m by 50-m bar in the Boulder River below the confluence with Basin Creek. The source of these tailings is not known, but fluvial tailings are also present immediately downstream from the Katie mill site, which is immediately upstream from the confluence with Basin Creek. Nine cores of fluvial tailings from this bar were analyzed.Dendrochronology samples were taken at several stream terrace localities to provide age control on the stream terrace deposits. Trees growing on the surfaces of stream terraces provide a minimum age for the terrace deposits, although floods subsequent to the trees' growth could have deposited post-mining overbank deposits around the trees. Historical data were also used to provide estimates of minimum ages of cultural features and to bracket the age of events.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

Air-Induced Drag Reduction at High Reynolds Numbers: Velocity and Void Fraction Profiles

NASA Astrophysics Data System (ADS)

Elbing, Brian; Mäkiharju, Simo; Wiggins, Andrew; Dowling, David; Perlin, Marc; Ceccio, Steven

2010-11-01

The injection of air into a turbulent boundary layer forming over a flat plate can reduce the skin friction. With sufficient volumetric fluxes an air layer can separate the solid surface from the flowing liquid, which can produce drag reduction in excess of 80%. Several large scale experiments have been conducted at the US Navy's Large Cavitation Channel on a 12.9 m long flat plate model investigating bubble drag reduction (BDR), air layer drag reduction (ALDR) and the transition between BDR and ALDR. The most recent experiment acquired phase velocities and void fraction profiles at three downstream locations (3.6, 5.9 and 10.6 m downstream from the model leading edge) for a single flow speed (˜6.4 m/s). The profiles were acquired with a combination of electrode point probes, time-of-flight sensors, Pitot tubes and an LDV system. Additional diagnostics included skin-friction sensors and flow-field image visualization. During this experiment the inlet flow was perturbed with vortex generators immediately upstream of the injection location to assess the robustness of the air layer. From these, and prior measurements, computational models can be refined to help assess the viability of ALDR for full-scale ship applications.

18. View of Tombigbee River Bridge facing east showing upstream ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

18. View of Tombigbee River Bridge facing east showing upstream side of bridge opposite broken railing located on the downstream side. Fallen power pole and telephone cable is shown in the center of the photograph. - Tombigbee River Bridge, Spanning Tombigbee River at State Highway 182, Columbus, Lowndes County, MS

Performance of Pylons Upstream of a Cavity-Based Flameholder in Non-Reacting Supersonic Flow (Postprint)

DTIC Science & Technology

2006-10-01

examine the flow field at an axial location of 0.75 inches. Measurements are performed using a pitot , cone-static probe and total temperature probe ...is the injection port, and the origin of the transverse direction (y/d = 0.0) is the upstream lip of the cavity. In each figure, the bow shock ...originates just upstream of the injection port and tends to be the strongest shock feature. In the baseline configurations, the bow shock initially

Performance of Pylons Upstream of a Cavity-Based Flameholder in Non-Reacting Supersonic Flow (Postprint)

DTIC Science & Technology

2006-07-01

location of 0.75 inches. Measurements are performed using a pitot , cone-static probe and total temperature probe with similar test meshes. All probes are...the transverse direction (y/d = 0.0) is the upstream lip of the cavity. In each figure, the bow shock originates just upstream of the injection port...and tends to be the strongest shock feature. In the baseline configurations, the bow shock initially penetrates perpendicular to the main flow due to

40 CFR 60.455 - Reporting and recordkeeping requirements.

Code of Federal Regulations, 2010 CFR

2010-07-01

... upstream and downstream of the catalyst bed), and (iv) A description of the method used to establish the... temperature recorded immediately before the catalyst bed is more than 28 °C (50 °F) below the average... the average temperature difference across the catalyst bed is less than 80 percent of the average...

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a baseline of fish from refer...

USING REGIONAL EXPOSURE CRITERIA AND UPSTREAM REFERENCE DATA TO CHARACTERIZE SPATIAL AND TEMPORAL EXPOSURES TO CHEMICAL CONTAMINANTS

EPA Science Inventory

Analyses of biomarkers in fish were used to evaluate exposures among locations and across time. Two types of references were used for comparison, an upstream reference sample remote from known point sources and regional exposure criteria derived from a basline of fish from refere...

Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

PubMed Central

Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

2011-01-01

Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

Control of boundary layer transition location and plate vibration in the presence of an external acoustic field

NASA Technical Reports Server (NTRS)

Maestrello, L.; Grosveld, F. W.

1991-01-01

The experiment is aimed at controlling the boundary layer transition location and the plate vibration when excited by a flow and an upstream sound source. Sound has been found to affect the flow at the leading edge and the response of a flexible plate in a boundary layer. Because the sound induces early transition, the panel vibration is acoustically coupled to the turbulent boundary layer by the upstream radiation. Localized surface heating at the leading edge delays the transition location downstream of the flexible plate. The response of the plate excited by a turbulent boundary layer (without sound) shows that the plate is forced to vibrate at different frequencies and with different amplitudes as the flow velocity changes indicating that the plate is driven by the convective waves of the boundary layer. The acoustic disturbances induced by the upstream sound dominate the response of the plate when the boundary layer is either turbulent or laminar. Active vibration control was used to reduce the sound induced displacement amplitude of the plate.

Concentrated energy addition for active drag reduction in hypersonic flow regime

NASA Astrophysics Data System (ADS)

Ashwin Ganesh, M.; John, Bibin

2018-01-01

Numerical optimization of hypersonic drag reduction technique based on concentrated energy addition is presented in this study. A reduction in wave drag is realized through concentrated energy addition in the hypersonic flowfield upstream of the blunt body. For the exhaustive optimization presented in this study, an in-house high precision inviscid flow solver has been developed. Studies focused on the identification of "optimum energy addition location" have revealed the existence of multiple minimum drag points. The wave drag coefficient is observed to drop from 0.85 to 0.45 when 50 Watts of energy is added to an energy bubble of 1 mm radius located at 74.7 mm upstream of the stagnation point. A direct proportionality has been identified between energy bubble size and wave drag coefficient. Dependence of drag coefficient on the upstream added energy magnitude is also revealed. Of the observed multiple minimum drag points, the energy deposition point (EDP) that offers minimum wave drag just after a sharp drop in drag is proposed as the most optimum energy addition location.

Sedimentary structures formed under water surface waves: examples from a sediment-laden flash flood observed by remote camer

NASA Astrophysics Data System (ADS)

Froude, Melanie; Alexander, Jan; Cole, Paul; Barclay, Jenni

2014-05-01

On 13-14 October 2012, Tropical Storm Rafael triggered sediment-laden flash floods in the Belham Valley on Montserrat, West Indies. Rainfall was continuous for ~38 hours and intensity peaked at 48 mm/hr. Flow was strongly unsteady, turbulent with sediment concentrations varying up to hyperconcentrated. Time-lapse images captured at >1 frame per second by remote camera overlooking a surveyed valley section show the development of trains of water surface waves at multiple channel locations during different flow stages. Waves grew and diminished in height and remained stationary or migrated upstream. Trains of waves persisted for <5 minutes, until a single wave broke, sometimes initiating the breaking of adjacent waves within the train. Channel-wide surges (bores) propagating downstream with distinct turbulent flow fronts, were observed at irregular intervals during and up to 7 hours after peak stage. These bores are mechanically similar to breaking front tidal bores and arid flood bores, and resulted in a sudden increase in flow depth and velocity. When a bore front came into close proximity (within ~10 m) upstream of a train of water surface waves, the waves appeared to break simultaneously generating a localised surge of water upstream, that was covered by the bore travelling downstream. Those trains in which waves did not break during the passage of a bore temporarily reduced in height. In both cases, water surface waves reformed immediately after the surge in the same location. Deposits from the event, were examined in <4 m deep trenches ~0.5 km downstream of the remote camera. These contained laterally extensive lenticular and sheet-like units comprised of varying admixtures of sand and gravel that are attributed to antidunes, and associated transitions from upper-stage-plane-beds. Some of the structures are organised within concave upward sequences which contain downflow shifts between foreset and backset laminae; interpreted as trough fills from chute-and-pools or water surface wave breaking. At least 90% of the deposit is interpreted upper flow regime origin. The sequence, geometry and lamina-scale texture of the sedimentary structures will be discussed with reference to remote camera images of rapidly varying, unsteady and pulsatory flow behaviour.

Turbine-Driven Pipe-Cleaning Brush

NASA Technical Reports Server (NTRS)

Werlink, Rudy J.; Rowell, David E.

1994-01-01

Simple pipe-cleaning device includes small turbine wheel axially connected, by standoff, to circular brush. Turbine wheel turns on hub bearing attached to end of upstream cable. Turbine-and-brush assembly inserted in pipe with cable trailing upstream and brush facing downstream. Water or cleaning solution pumped through pipe. Cable held at upstream end, so it holds turbine and brush in pipe at location to be cleaned. Flow in pipe turns turbine, which turns wheel, producing desired cleaning action. In addition to brushing action, device provides even mixing of cleaning solution in pipe.

The LINEs and SINEs of Entamoeba histolytica: comparative analysis and genomic distribution.

PubMed

Bakre, Abhijeet A; Rawal, Kamal; Ramaswamy, Ram; Bhattacharya, Alok; Bhattacharya, Sudha

2005-07-01

Autonomous non-long terminal repeat retrotransposons are commonly referred to as long interspersed elements (LINEs). Short non-autonomous elements that borrow the LINE machinery are called SINES. The Entamoeba histolytica genome contains three classes of LINEs and SINEs. Together the EhLINEs/SINEs account for about 6% of the genome. The recognizable functional domains in all three EhLINEs included reverse transcriptase and endonuclease. A novel feature was the presence of two types of members-some with a single long ORF (less frequent) and some with two ORFs (more frequent) in both EhLINE1 and 2. The two ORFs were generated by conserved changes leading to stop codon. Computational analysis of the immediate flanking sequences for each element showed that they inserted in AT-rich sequences, with a preponderance of Ts in the upstream site. The elements were very frequently located close to protein-coding genes and other EhLINEs/SINEs. The possible influence of these elements on expression of neighboring genes needs to be determined.

Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

PubMed

Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

2008-09-15

Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Interaction between riverbed condition and characteristics of debris flow in Ichino-sawa subwatershed of Ohya-kuzure landslide, Japan

NASA Astrophysics Data System (ADS)

Tsunetaka, Haruka; Hotta, Norifumi; Imaizumi, Fumitoshi; Hayakawa, Yuichi S.; Yumen, Noriki

2015-04-01

Large-scale sediment movements, such as a deep-seated landslide, not only induce immediate sediment disasters but also produce a large amount of unstable sediment upstream. Most of the unstable sediment residing in the upstream area is discharged as debris flow. Hence, after the occurrence of large-scale sediment movement, debris flows have a long-term effect on the watershed regime. However, the characteristics of debris flow in upstream areas are not well understood, due to the topographic and grain-size conditions that are more complicated than the downstream area. This study was performed to reveal the relationship between such a riverbed condition and the characteristics of debris flow by field observations. The study site was Ichinosawa-subwatershed in the Ohya-kuzure basin, Shizuoka Prefecture, Japan. The basin experienced a deep-seated landslide about 300 years ago and is currently actively yielding sediment with a clear annual cycle. During the winter season, sediment is deposited on the valley bottom by freeze-thaw and weathering. In the summer season, the deposited sediment is discharged incrementally by debris flows related to storm events. Topographical survey and grain-size analysis were performed several times between November 2011 and November 2014. High-resolution digital elevation models (10 cm) were created from the results of a topographical survey using a terrestrial laser scanner. A grain-size analysis was conducted in the upper, middle, and lower parts of the study site. Debris flow occurrences were also monitored in the same period by a sensor-triggered video camera and interval camera. Rainfall was observed during the summer season for comparison with debris flow occurrence. Several debris flows of different magnitudes were observed during the study period. Although heavy rainfall events altered the bed inclination, the thickness of deposited sediment, and the grain-size distribution, more significant changes were detected after the debris flow. While the initial grain-size distribution in early spring was roughly identical across the study site, the subsequent changes in the grain-size distribution differed according to location. The source, transport and deposition areas of the debris flows differed among rainfall events, resulting in different transitions in topographic conditions at different locations. Furthermore, surges of debris flow not only induced erosion-deposited sediment but also suspended and deposited sediment in the same area during one typhoon event. A comparison of the results indicated that, in addition to the conditions of the triggering rainfall, topographic and grain-size conditions affected the debris flow occurrence and magnitude. These interactions also showed that the magnitude and form of the succeeding debris flow could be dominant, depending on changing riverbed condition by past debris flows in upstream areas.

High-time resolution measurements of upstream magnetic field and plasma conditions during flux transfer events at the Earth's dayside magnetopause

NASA Technical Reports Server (NTRS)

Jacob, Jamey D.; Carrell, Cynthia

1993-01-01

We present preliminary results of a study of upstream magnetic field and plasma conditions measured by IRM during flux transfer events observed at the Earth's magnetopause by CCE. This study was designed to determine the importance of various upstream factors in the formation of bipolar magnetic field signatures called flux transfer events (FTEs). Six FTE encounters were examined. In three cases, the two satellites were on similar magnetic field lines. Preliminary investigation showed that fluctuations occurred in the Bz component of the interplanetary magnetic field (IMF) resulting in a southward field preceding the FTE in all three of these cases. In two of these cases, the changes were characterized by a distinct rotation from a strong southward to a strong northward field. There were also accompanying changes in the dynamic and thermal pressure in the solar wind immediately before the FTE was encountered. Examination of the 3D plasma distributions showed that these pulses were due to the addition of energetic upstreaming foreshock particles. There were no consistent changes in either Bz or the plasma pressure at IRM for the three events when the satellites were not connected by the IMF.

76 FR 72986 - Options Price Reporting Authority; Notice of Filing and Immediate Effectiveness of Proposed...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-28

... uncontrolled retransmission of OPRA market data-- that is, as a transmission of OPRA data in respect of which... Vendor,'' since it is ``downstream'' in the dissemination of the OPRA market data from the ``upstream'' Vendor that is sending the data to it. A Vendor that receives a datafeed directly from OPRA's data...

Environmental Security in Botswana

DTIC Science & Technology

2011-10-01

concerns are vital to state survival. Upstream diversions of river water, poaching of wildlife or uncontrolled immigration can destroy ecosystems that would...gratefully accepted. Executing its first mission in October, 1987 the BDF immediately made positive impacts and dramatically reduced poaching ...experience large scale, organized cross-border poaching which overwhelmed the Botswana Department of Wildlife and National Parks. By 1987 the situation

Freshwater mussels in an urban watershed: Impacts of anthropogenic inputs and habitat alterations on populations.

PubMed

Gillis, Patricia L; McInnis, Rodney; Salerno, Joseph; de Solla, Shane R; Servos, Mark R; Leonard, Erin M

2017-01-01

The substantial increase in urbanization worldwide has resulted in higher emissions of wastewater to riverine systems near urban centers, which often impairs aquatic populations and communities. This study examined the effect of urbanization on freshwater mussel populations, including Species at Risk in two rivers receiving wastewater. The influence of anthropogenic activities was assessed in a watershed in the Laurentian Great Lakes basin, one that historically supported one of the most diverse mussel faunas in Canada. In the Grand River (ON), four sites along a 60km reach spanning from an upstream reference site to an urban-impacted downstream area were examined. In the Speed River, mussel populations at six sites along a 10km reach, selected to bracket specific anthropogenic inputs and structures were assessed. A semi-quantitative visual search method revealed that catch per unit effort in the Grand River declined by >60% from the upstream reference site to the area downstream of an urban center. The size (length) frequency distribution of the most abundant species, Lasmigona costata, was significantly (p≤0.008) different upstream of the majority of urban inputs (45-130mm) compared to downstream of the cities (85-115mm). In the Speed River, impoundments and wastewater treatment plants (WWTP) reduced both the diversity and catch per effort. Most striking were 84 and 95% changes in the number of mussels found on either side of two impoundments, and a 98% drop in mussels immediately downstream of a WWTP outfall. These population level effects of decreased abundance and underrepresentation of smaller mussels downstream of the urban area correspond to previously documented impacts at the biochemical and whole organism level of biological organization in wild mussels at this location. Our results demonstrate that poor water quality and physical barriers in urban environments continue to impair susceptible populations and communities of aquatic animals. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Mean velocities and Reynolds stresses upstream of a simulated wing-fuselage juncture

NASA Technical Reports Server (NTRS)

Mcmahon, H.; Hubbartt, J.; Kubendran, L. R.

1983-01-01

Values of three mean velocity components and six turbulence stresses measured in a turbulent shear layer upstream of a simulated wing-fuselage juncture and immediately downstream of the start of the juncture are presented nd discussed. Two single-sensor hot-wire probes were used in the measurements. The separated region just upstream of the wing contains an area of reversed flow near the fuselage surface where the turbulence level is high. Outside of this area the flow skews as it passes around the body, and in this skewed region the magnitude and distribution of the turbulent normal and shear stresses within the shear layer are modified slightly by the skewing and deceleration of the flow. A short distance downstream of the wing leading edge the secondary flow vortext is tightly rolled up and redistributes both mean flow and turbulence in the juncture. The data acquisition technique employed here allows a hot wire to be used in a reversed flow region to indicate flow direction.

Formation of trihalomethanes of dissolved organic matter fractions in reservoir and canal waters.

PubMed

Musikavong, Charongpun; Srimuang, Kanjanee; Tachapattaworakul Suksaroj, Thunwadee; Suksaroj, Chaisri

2016-07-28

The formation of trihalomethanes (THMs) of hydrophobic organic fraction (HPO), transphilic organic fraction (TPI), and hydrophilic organic fraction (HPI) of reservoir and canal waters from the U-Tapao River Basin, Songkhla, Thailand was investigated. Water samples were collected three times from two reservoirs, upstream, midstream, and downstream of the U-Tapao canal. The HPO was the major dissolved organic matter (DOM) fraction in reservoir and canal waters. On average, the HPO accounted for 53 and 45% of the DOM in reservoir and canal waters, respectively. The TPI of 19 and 23% in reservoir and canal waters were determined, respectively. The HPI of 29% of the reservoir water and HPI of 32% of the canal water were detected. For the reservoir water, the highest trihalomethane formation potential (THMFP)/dissolved organic carbon (DOC) was determined for the HPI, followed by the TPI and HPO, respectively. The average values of the THMFP/DOC of the HPI, TPI, and HPO of the reservoir water were 78, 52, and 49 µg THMs/mg C, respectively. The highest THMFP/DOC of the canal water was detected for the HPI, followed by HPO and TPI, respectively. Average values of the THMFP/DOC of HPI of water at upstream and midstream locations of 58 µg THMs/mg C and downstream location of 113 µg THMs/mg C were determined. Average values of THMFP/DOC of HPO of water at upstream and midstream and downstream locations were 48 and 93 µg THMs/mg C, respectively. For the lowest THMFP/DOC fraction, the average values of THMFP/DOC of TPI of water at upstream and midstream and downstream locations were 35 and 73 µg THMs/mg C, respectively.

5. Looking west upstream, towards the location of the erstwhile ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

5. Looking west upstream, towards the location of the erstwhile intake flume into canal from the upper reaches of the Potomac River above the Great Falls, on the old Potowmack Canal built by George Washington. The plan contemplated canal navigation around the Great Falls of the Potomac River, located on the Virginia side of the Potomac, about 15 miles above Washington, D.C. The Company was organized in 1785, and by 1802, this and three or four smaller canals were substantially completed and raft-like boats began operation with materials from the west to the city of Georgetown. 'Although the canals and locks of the Potomac Canal were considered a great engineering accomplishment, the improvements to the river channel were inadequate. Disappointment ... - Potowmack Company: Great Falls Canal & Locks, Great Falls, Fairfax County, VA

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex.

PubMed

McHugh, Thomas; Beckley, Lila; Sullivan, Terry; Lutes, Chris; Truesdale, Robert; Uppencamp, Rob; Cosky, Brian; Zimmerman, John; Schumacher, Brian

2017-11-15

The role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into the duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. These test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope. Copyright © 2017 Elsevier B.V. All rights reserved.

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex

DOE PAGES

McHugh, Thomas; Beckley, Lila; Sullivan, Terry; ...

2017-04-26

We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less

Evidence of a sewer vapor transport pathway at the USEPA vapor intrusion research duplex

DOE Office of Scientific and Technical Information (OSTI.GOV)

McHugh, Thomas; Beckley, Lila; Sullivan, Terry

We report the role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into themore » duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. Finally, these test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope.« less

The far reach of ice-shelf thinning in Antarctica

NASA Astrophysics Data System (ADS)

Reese, R.; Gudmundsson, G. H.; Levermann, A.; Winkelmann, R.

2018-01-01

Floating ice shelves, which fringe most of Antarctica's coastline, regulate ice flow into the Southern Ocean1-3. Their thinning4-7 or disintegration8,9 can cause upstream acceleration of grounded ice and raise global sea levels. So far the effect has not been quantified in a comprehensive and spatially explicit manner. Here, using a finite-element model, we diagnose the immediate, continent-wide flux response to different spatial patterns of ice-shelf mass loss. We show that highly localized ice-shelf thinning can reach across the entire shelf and accelerate ice flow in regions far from the initial perturbation. As an example, this `tele-buttressing' enhances outflow from Bindschadler Ice Stream in response to thinning near Ross Island more than 900 km away. We further find that the integrated flux response across all grounding lines is highly dependent on the location of imposed changes: the strongest response is caused not only near ice streams and ice rises, but also by thinning, for instance, well-within the Filchner-Ronne and Ross Ice Shelves. The most critical regions in all major ice shelves are often located in regions easily accessible to the intrusion of warm ocean waters10-12, stressing Antarctica's vulnerability to changes in its surrounding ocean.

Sequence and transcriptional analysis of the barley ctDNA region upstream of psbD-psbC encoding trnK(UUU), rps16, trnQ(UUG), psbK, psbI, and trnS(GCU).

PubMed

Berends Sexton, T; Jones, J T; Mullet, J E

1990-05-01

A 6.25 kbp barley plastid DNA region located between psbA and psbD-psbC were sequenced and RNAs produced from this DNA were analyzed. TrnK(UUU), rps16 and trnQ(UUG) were located upstream of psbA. These genes were transcribed from the same DNA strand as psbA and multiple RNAs hybridized to them. TrnK and rsp16 contained introns; a 504 amino acid open reading frame (ORF504) was located within the trnK intron. Between trnQ and psbD-psbC was a 2.24 kbp region encoding psbK, psbI and trnS(GCU). PsbK and psbI are encoded on the same DNA strand as psbD-psbC whereas trnS(GCU) is transcribed from the opposite strand. Two large RNAs accumulate in barley etioplasts which contain psbK, psbI, anti-sense trnS(GCU) and psbD-psbC sequences. Other RNAs encode psbK and psbI only, or psbK only. The divergent trnS(GCU) located upstream of psbD-psbC and a second divergent trnS(UGA) located downstream of psbD-psbC were both expressed. Furthermore, RNA complementary to psbK and psbI mRNA was detected, suggesting that transcription from divergent overlapping transcription units may modulate expression from this DNA region.

ESR1 Is Co-Expressed with Closely Adjacent Uncharacterised Genes Spanning a Breast Cancer Susceptibility Locus at 6q25.1

PubMed Central

Dunbier, Anita K.; Anderson, Helen; Ghazoui, Zara; Lopez-Knowles, Elena; Pancholi, Sunil; Ribas, Ricardo; Drury, Suzanne; Sidhu, Kally; Leary, Alexandra; Martin, Lesley-Ann; Dowsett, Mitch

2011-01-01

Approximately 80% of human breast carcinomas present as oestrogen receptor α-positive (ER+ve) disease, and ER status is a critical factor in treatment decision-making. Recently, single nucleotide polymorphisms (SNPs) in the region immediately upstream of the ER gene (ESR1) on 6q25.1 have been associated with breast cancer risk. Our investigation of factors associated with the level of expression of ESR1 in ER+ve tumours has revealed unexpected associations between genes in this region and ESR1 expression that are important to consider in studies of the genetic causes of breast cancer risk. RNA from tumour biopsies taken from 104 postmenopausal women before and after 2 weeks treatment with an aromatase (oestrogen synthase) inhibitor was analyzed on Illumina 48K microarrays. Multiple-testing corrected Spearman correlation revealed that three previously uncharacterized open reading frames (ORFs) located immediately upstream of ESR1, C6ORF96, C6ORF97, and C6ORF211 were highly correlated with ESR1 (Rs = 0.67, 0.64, and 0.55 respectively, FDR<1×10−7). Publicly available datasets confirmed this relationship in other groups of ER+ve tumours. DNA copy number changes did not account for the correlations. The correlations were maintained in cultured cells. An ERα antagonist did not affect the ORFs' expression or their correlation with ESR1, suggesting their transcriptional co-activation is not directly mediated by ERα. siRNA inhibition of C6ORF211 suppressed proliferation in MCF7 cells, and C6ORF211 positively correlated with a proliferation metagene in tumours. In contrast, C6ORF97 expression correlated negatively with the metagene and predicted for improved disease-free survival in a tamoxifen-treated published dataset, independently of ESR1. Our observations suggest that some of the biological effects previously attributed to ER could be mediated and/or modified by these co-expressed genes. The co-expression and function of these genes may be important influences on the recently identified relationship between SNPs in this region and breast cancer risk. PMID:21552322

The ygaVP Genes of Escherichia coli Form a Tributyltin-Inducible Operon▿ †

PubMed Central

Gueuné, Hervé; Durand, Marie-José; Thouand, Gérald; DuBow, Michael S.

2008-01-01

A tributyltin (TBT) luxAB transcriptional fusion in Escherichia coli revealed that a TBT-activated promoter is located upstream of two cotranscribed orphan genes, ygaV and ygaP. We demonstrate that transcription from the promoter upstream of ygaVP is constitutive in a ygaVP mutant, suggesting that YgaV is an autoregulated, TBT-inducible repressor. PMID:18245262

Two essays on electricity markets: Entry into hydroelectric generation industry and the political cycle of regulated prices

NASA Astrophysics Data System (ADS)

Moita, Rodrigo Menon Simoes

This dissertation is about the electricity industry and the problems that arise with the liberalization and de-regulation of the industry. Characteristics intrinsic to the electricity market create problems that can compromise an efficient functioning of this market. Each of the two chapters of this dissertation focus on a specific aspect of this industry. The first chapter analyzes entry in the hydroelectric generation industry. The operation of a generator upstream regularizes the river flow for generators located downstream on the same river, increasing the production capacity of the latter. This positive externality increases the attractiveness of the locations downstream whenever a generator decides to enter upstream. Therefore, the entry decision of a generator in a given location may affect all entry decisions in potential locations for plants located downstream. I first model the problem of generators located in cascade on the same river and show the positive effect of the externality. Second, I use a panel of data on investment decisions of hydro-generation firms to estimate an entry model that takes into account the effect of the externality generated by entry upriver. The results show a positive incentive to locate downstream from existing plants and from locations where entry is likely to occur. Location characteristics also play an important role on the entrants' decisions. The model provides estimates of the average expected market price across the different years covered by the sample and shows that it rose one year before the energy crisis of 2001, evidencing that the market anticipated the crisis. This result has important implications on the evaluation of the Brazilian market design. It shows that entry responded to a rise in expectations about excess demand in the future, contradicting the argument that the crisis was a consequence of mis-designed market institutions. The second chapter deals with the problem of the political cycle in regulated industries. It follows Paiva (1995) in combining elements of both the political cycle approach of Rogoff and Sibert and the political theory of regulation of Peltzman: the idea that policy decisions may change with the proximity of elections is borrowed from the political business cycle theory and added to enhance the traditional, static models of political regulation. More specifically, I combine the main ideas of Peltzman (1976) and Rogoff and Sibert (1988) to model the regulator's problem as a signaling game where politicians set the regulated price trying to maximize electoral support by signaling to voters a pro-consumer behavior. Political incentives and welfare constraints interact in the model yielding an equilibrium in which the real price in a regulated industry falls in periods immediately preceding an election. Besides presenting a new model of political price cycles in regulated industries, this paper empirically test this theory. Using quarterly data from 35 industrial and developing countries over the period 1978-2004, I find a negative but not statistically significant relationship between elections and electricity prices.

Field Evaluation of Detection-Control System

DOT National Transportation Integrated Search

2015-04-01

In this research, a field evaluation of the Detection-Control System (D-CS) was conducted at eight sites located in four States. D-CS is similar to a traditional advance detector system in that it uses information from detectors located upstream of t...

2. Rockwork on north bank of S. Platte River located ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

2. Rockwork on north bank of S. Platte River located 2.1 miles upstream from the Keystone Bridge. View looking northwest at a distance of 30 feet. - Denver & Rio Grande Rockwork, East of South Platte, Waterton, Jefferson County, CO

Responses of riparian reptile communities to damming and urbanization

USGS Publications Warehouse

Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.

2013-01-01

Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.

RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

PubMed

KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

2018-06-20

Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

Sharing the opportunity cost among power companies to support hydropower-to-environment water transfers

NASA Astrophysics Data System (ADS)

Tilmant, Amaury; Marques, Guilherme

2016-04-01

Among the environmental impacts caused by dams, the alteration of flow regimes is one of the most critical to river ecosystems given its influence in long river reaches and its continuous pattern. Provided it is technically feasible, the reoperation of hydroelectric reservoir systems can, in principle, mitigate the impacts on degraded freshwater ecosystems by recovering some of the natural flow regime. The typical approach to implement hydropower-to-environment water transfers focuses on the reoperation of the dam located immediately upstream of the environmentally sensitive area, meaning that only one power station will bear the brunt of the benefits forgone for the power sector. By ignoring the contribution of upstream infrastructures to the alteration of the flow regime, the opportunity cost associated with the restoration of a flow regime is not equitably distributed among the power companies in the river basin, therefore slowing the establishment of environmental flow programs. Yet, there is no criterion, nor institutional mechanisms, to ensure a fair distribution of the opportunity cost among power stations. This paper addresses this issue by comparing four rules to redistribute the costs faced by the power sector when environmental flows must be implemented in a multireservoir system. The rules are based on the the installed capacity of the power plants, the live storage capacity of the reservoirs, the ratio between the incremental flows and the live storage capacity, and the extent of the storage services; that is, the volume of water effectively transferred by each reservoir. The analysis is carried out using the Parana River Basin (Brazil) as a case study.

Nucleoside Triphosphate Phosphohydrolase I (NPH I) Functions as a 5′ to 3′ Translocase in Transcription Termination of Vaccinia Early Genes*

PubMed Central

Hindman, Ryan; Gollnick, Paul

2016-01-01

Vaccinia virus early genes are transcribed immediately upon infection. Nucleoside triphosphate phosphohydrolase I (NPH I) is an essential component of the early gene transcription complex. NPH I hydrolyzes ATP to release transcripts during transcription termination. The ATPase activity of NPH I requires single-stranded (ss) DNA as a cofactor; however, the source of this cofactor within the transcription complex is not known. Based on available structures of transcription complexes it has been hypothesized that the ssDNA cofactor is obtained from the unpaired non-template strand within the transcription bubble. In vitro transcription on templates that lack portions of the non-template strand within the transcription bubble showed that the upstream portion of the transcription bubble is required for efficient NPH I-mediated transcript release. Complementarity between the template and non-template strands in this region is also required for NPH I-mediated transcript release. This observation complicates locating the source of the ssDNA cofactor within the transcription complex because removal of the non-template strand also disrupts transcription bubble reannealing. Prior studies have shown that ssRNA binds to NPH I, but it does not activate ATPase activity. Chimeric transcription templates with RNA in the non-template strand confirm that the source of the ssDNA cofactor for NPH I is the upstream portion of the non-template strand in the transcription bubble. Consistent with this conclusion we also show that isolated NPH I acts as a 5′ to 3′ translocase on single-stranded DNA. PMID:27189950

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.

PubMed Central

Mavrothalassitis, G J; Watson, D K; Papas, T S

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393

Effects of grade control structures on the macroinvertebrate assemblage of an agriculturally impacted stream

USGS Publications Warehouse

Litvan, M.E.; Stewart, T.W.; Pierce, C.L.; Larson, C.J.

2008-01-01

Nearly 400 rock rip-rap grade control structures (hereafter GCS) were recently placed in streams of western Iowa, USA to reduce streambank erosion and protect bridge infrastructure and farmland. In this region, streams are characterized by channelized reaches, highly incised banks and silt and sand substrates that normally support low macroinvertebrate abundance and diversity. Therefore, GCS composed of rip-rap provide the majority of coarse substrate habitat for benthic macroinvertebrates in these streams. We sampled 20 sites on Walnut Creek, Montgomery County, Iowa to quantify macroinvertebrate assemblage characteristics (1) on GCS rip-rap and at sites located (2) 5-50 m upstream of GCS, (3) 5-50 m downstream of GCS and (4) at least 1 km from any GCS (five sites each). Macroinvertebrate biomass, numerical densities and diversity were greatest at sites with coarse substrates, including GCS sites and one natural riffle site and relatively low at remaining sites with soft substrates. Densities of macroinvertebrates in the orders Ephemeroptera, Trichoptera, Diptera, Coleoptera and Acariformes were abundant on GCS rip-rap. Increases in macroinvertebrate biomass, density and diversity at GCS may improve local efficiency of breakdown of organic matter and nutrient and energy flow, and provide enhanced food resources for aquatic vertebrates. However, lack of positive macroinvertebrate responses immediately upstream and downstream of GCS suggest that positive effects might be restricted to the small areas of streambed covered by GCS. Improved understanding of GCS effects at both local and ecosystem scales is essential for stream management when these structures are present. Copyright ?? 2007 John Wiley & Sons, Ltd.

Fish assemblages in a western Iowa stream modified by grade control structures

USGS Publications Warehouse

Litvan, M.E.; Pierce, C.L.; Stewart, T.W.; Larson, C.J.

2008-01-01

Over 400 riprap grade control structures (GCSs) have been built in streams of western Iowa to reduce erosion and protect bridges, roads, and farmland. In conjunction with a companion study evaluating fish passage over GCSs in Turkey Creek, we evaluated the differences in fish assemblage and habitat characteristics in reaches immediately downstream from GCSs (GCS sites) and reaches at least 1 km from any GCS (non-GCS sites). The GCS sites were characterized by greater proportions of pool habitat, maximum depths, fish biomass, and abundance of juvenile largemouth bass Micropterus salmoides than were non-GCS sites. Index of biotic integrity (IBI) scores were poor or fair (<43 on a 0-100 scale) and not significantly different between the GCS and non-GCS sites. Additionally, we investigated both the longitudinal changes in fish assemblages in this GCS-fragmented stream and the changes in fish assemblages after slope modifications of three GCSs to facilitate fish passage. Thirteen fish species were present throughout the study area, whereas another 15 species exhibited truncated distributions not extending to the most upstream sampling location. After modification of the GCSs, IBI scores increased at seven of nine sites (mean increase =4.6 points). Also, channel catfish Ictalurus punctatus were detected 7.3 km upstream at sites where, 2 years before GCS modification, they had been absent from collections. Given the number and distribution of GCSs in western Iowa streams, understanding the effects of these structures is vital to the conservation and management of fish assemblages in this and other regions where GCSs or similar structures are used. ?? Copyright by the American Fisheries Society 2008.

Induction of surfactin production in Bacillus subtilis by gsp, a gene located upstream of the gramicidin S operon in Bacillus brevis.

PubMed Central

Borchert, S; Stachelhaus, T; Marahiel, M A

1994-01-01

The deduced amino acid sequence of the gsp gene, located upstream of the 5' end of the gramicidin S operon (grs operon) in Bacillus brevis, showed a high degree of similarity to the sfp gene product, which is located downstream of the srfA operon in B. subtilis. The gsp gene complemented in trans a defect in the sfp gene (sfpO) and promoted production of the lipopeptide antibiotic surfactin. The functional homology of Gsp and Sfp and the sequence similarity of these two proteins to EntD suggest that the three proteins represent a new class of proteins involved in peptide secretion, in support of a hypothesis published previously (T. H. Grossman, M. Tuckman, S. Ellestad, and M. S. Osburne, J. Bacteriol. 175:6203-6211, 1993). Images PMID:7512553

Arc burst pattern analysis fault detection system

NASA Technical Reports Server (NTRS)

Russell, B. Don (Inventor); Aucoin, B. Michael (Inventor); Benner, Carl L. (Inventor)

1997-01-01

A method and apparatus are provided for detecting an arcing fault on a power line carrying a load current. Parameters indicative of power flow and possible fault events on the line, such as voltage and load current, are monitored and analyzed for an arc burst pattern exhibited by arcing faults in a power system. These arcing faults are detected by identifying bursts of each half-cycle of the fundamental current. Bursts occurring at or near a voltage peak indicate arcing on that phase. Once a faulted phase line is identified, a comparison of the current and voltage reveals whether the fault is located in a downstream direction of power flow toward customers, or upstream toward a generation station. If the fault is located downstream, the line is de-energized, and if located upstream, the line may remain energized to prevent unnecessary power outages.

Satellite Altimetry based River Forecasting of Transboundary Flow

NASA Astrophysics Data System (ADS)

Hossain, F.; Siddique-E-Akbor, A.; Lee, H.; Shum, C.; Biancamaria, S.

2012-12-01

Forecasting of this transboundary flow in downstream nations however remains notoriously difficult due to the lack of basin-wide in-situ hydrologic measurements or its real-time sharing among nations. In addition, human regulation of upstream flow through diversion projects and dams, make hydrologic models less effective for forecasting on their own. Using the Ganges-Brahmaputra (GB) basin as an example, this study assesses the feasibility of using JASON-2 satellite altimetry for forecasting such transboundary flow at locations further inside the downstream nation of Bangladesh by propagating forecasts derived from upstream (Indian) locations through a hydrodynamic river model. The 5-day forecast of river levels at upstream boundary points inside Bangladesh are used to initialize daily simulation of the hydrodynamic river model and yield the 5-day forecast river level further downstream inside Bangladesh. The forecast river levels are then compared with the 5-day-later "now cast" simulation by the river model based on in-situ river level at the upstream boundary points in Bangladesh. Future directions for satellite-based forecasting of flow are also briefly overviewed.round tracks or virtual stations of JASON-2 (J2) altimeter over the GB basin shown in yellow lines. The locations where the track crosses a river and used for deriving forecasting rating curves is shown with a circle and station number (magenta- Brahmaputra basin; blue - Ganges basin). Circles without a station number represent the broader view of sampling by JASON-2 if all the ground tracks on main stem rivers and neighboring tributaries of Ganges and Brahmaputra are considered.

Method and system for control of upstream flowfields of vehicle in supersonic or hypersonic atmospheric flight

NASA Technical Reports Server (NTRS)

Daso, Endwell O. (Inventor); Pritchett, II, Victor E. (Inventor); Wang, Ten-See (Inventor); Farr, Rebecca Ann (Inventor)

2012-01-01

The upstream flowfield of a vehicle traveling in supersonic or hypersonic atmospheric flight is actively controlled using attribute(s) experienced by the vehicle. Sensed attribute(s) include pressure along the vehicle's outer mold line, temperature along the vehicle's outer mold line, heat flux along the vehicle's outer mold line, and/or local acceleration response of the vehicle. A non-heated, non-plasma-producing gas is injected into an upstream flowfield of the vehicle from at least one surface location along the vehicle's outer mold line. The pressure of the gas so-injected is adjusted based on the attribute(s) so-sensed.

Measurement of turbulent flow upstream and downstream of a circular pipe bend

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakakibara, Jun; Machida, Nobuteru

2012-04-15

We measured velocity distribution in cross sections of a fully developed turbulent pipe flow upstream and downstream of a 90 degree sign bend by synchronizing two sets of a particle image velocimetry (PIV) system. Unsteady undulation of Dean vortices formed downstream from the bend was characterized by the azimuthal position of the stagnation point found on the inner and outer sides of the bend. Linear stochastic estimation was applied to capture the upstream flow field conditioned by the azimuthal location of the stagnation point downstream from the bend. When the inner-side stagnation point stayed below (above) the symmetry plane, themore » conditional streamwise velocity upstream from the bend exhibited high-speed streaks extended in a quasi-streamwise direction on the outer side of the curvature above (below) the symmetry plane.« less

Experimental investigation of sound generation by a protuberance in a laminar boundary layer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, M.; Asai, M.; Inasawa, A.

2014-08-15

Sound radiation from a two-dimensional protuberance glued on the wall in a laminar boundary layer was investigated experimentally at low Mach numbers. When the protuberance was as high as the boundary-layer thickness, a feedback-loop mechanism set in between protuberance-generated sound and Tollmien-Schlichting (T-S) waves generated by the leading-edge receptivity to the upstream-propagating sound. Although occurrence of a separation bubble immediately upstream of the protuberance played important roles in the evolution of instability waves into vortices interacting with the protuberance, the frequency of tonal vortex sound was determined by the selective amplification of T-S waves in the linear instability stage upstreammore » of the separation bubble and was not affected by the instability of the separation bubble.« less

Introduction to Blueweb: A Decentralized Scatternet Formation Algorithm for Bluetooth Ad Hoc Networks

NASA Astrophysics Data System (ADS)

Yu, Chih-Min; Huang, Chia-Chi

In this letter, a decentralized scatternet formation algorithm called Bluelayer is proposed. First, Bluelayer uses a designated root to construct a tree-shaped subnet and propagates an integer variable k1 called counter limit as well as a constant k in its downstream direction to determine new roots. Then each new root asks its upstream master to start a return connection procedure to convert the tree-shaped subnet into a web-shaped subnet for its immediate upstream root. At the same time, each new root repeats the same procedure as the root to build its own subnet until the whole scatternet is formed. Simulation results show that Bluelayer achieves good network scalability and generates an efficient scatternet configuration for various sizes of Bluetooth ad hoc network.

B-Bolivia, an Allele of the Maize b1 Gene with Variable Expression, Contains a High Copy Retrotransposon-Related Sequence Immediately Upstream1

PubMed Central

Selinger, David A.; Chandler, Vicki L.

2001-01-01

The maize (Zea mays) b1 gene encodes a transcription factor that regulates the anthocyanin pigment pathway. Of the b1 alleles with distinct tissue-specific expression, B-Peru and B-Bolivia are the only alleles that confer seed pigmentation. B-Bolivia produces variable and weaker seed expression but darker, more regular plant expression relative to B-Peru. Our experiments demonstrated that B-Bolivia is not expressed in the seed when transmitted through the male. When transmitted through the female the proportion of kernels pigmented and the intensity of pigment varied. Molecular characterization of B-Bolivia demonstrated that it shares the first 530 bp of the upstream region with B-Peru, a region sufficient for seed expression. Immediately upstream of 530 bp, B-Bolivia is completely divergent from B-Peru. These sequences share sequence similarity to retrotransposons. Transient expression assays of various promoter constructs identified a 33-bp region in B-Bolivia that can account for the reduced aleurone pigment amounts (40%) observed with B-Bolivia relative to B-Peru. Transgenic plants carrying the B-Bolivia promoter proximal region produced pigmented seeds. Similar to native B-Bolivia, some transgene loci are variably expressed in seeds. In contrast to native B-Bolivia, the transgene loci are expressed in seeds when transmitted through both the male and female. Some transgenic lines produced pigment in vegetative tissues, but the tissue-specificity was different from B-Bolivia, suggesting the introduced sequences do not contain the B-Bolivia plant-specific regulatory sequences. We hypothesize that the chromatin context of the B-Bolivia allele controls its epigenetic seed expression properties, which could be influenced by the adjacent highly repeated retrotransposon sequence. PMID:11244116

Water table and overbank flow frequency changes due to suburbanization-induced channel incision, Virginia Coastal Plain, USA

NASA Astrophysics Data System (ADS)

Hancock, G.; Mattell, N.; Christianson, E.; Wacksman, J.

2004-12-01

Channel incision is a widely observed response to increased flow in urbanized watersheds, but the effects of channel lowering on riparian water tables is not well documented. In a rapidly incising suburban stream in the Virginia Coastal Plain, we hypothesize that incision has lowered floodplain water tables and decreased the overbank flow frequency, and suggest these changes impact vegetation distribution in a diverse, protected riparian habitat. The monitored stream is a tributary to the James River draining 1.3 km2, of which 15% is impervious cover. Incision has occurred largely through upstream migration of a one m high knickpoint at a rate of 1-2 m/yr, primarily during high flow events. We installed 33 wells in six floodplain transects to assess water table elevations beneath the floodplain adjacent to the incising stream. To document the impacts of incision, two transects are located 30 and 50 m upstream of the knickpoint in unincised floodplain, and the remainder are 5, 30, 70, and 100 m downstream of the knickpoint in incised floodplain. In one transect above and two below, pressure transducers attached to dataloggers provide a high-resolution record of water table response to storm events. Significant differences have been observed in the water table above and below the knickpoint. Above the knickpoint, the water table is relatively flat and is 0.2-0.4 m below the floodplain surface. Water table response to precipitation events is nearly immediate, with the water table rising to the floodplain surface in significant rainfall events. In the transect immediately downstream of the knickpoint, the water table possesses a steep gradient, rising from ~1 m below the floodplain at the stream to 0.3 m below the surface within 20 m. In the most downstream transects, the water table is relatively flat, but is one m below the floodplain surface, equivalent to the depth of incision generated by knickpoint passage. Upstream of the knickpoint, overbank flooding occurs frequently, while below the knickpoint the majority of storm flow is contained within the incised channel and occupation of the floodplain is rare. Plant diversity surveys reveal differences in the total density of herbaceous growth and species distribution between the floodplain above and below the knickpoint. Results from >100 plots show that there is more leaf litter, less exposed ground, and a decrease in floodplain species cover in the incised portion of the floodplain. The changes in flood frequency and water table elevation appear to have allowed one invasive species, Japanese stilt grass (Microstegium vimineum), to become dominant in the floodplain understory, displacing native wetland species.

1988 Hanford riverbank springs characterization report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dirkes, R.L.

1990-12-01

This reports presents the results of a special study undertaken to characterize the riverbank springs (i.e., ground-water seepage) entering the Columbia River along the Hanford Site. Radiological and nonradiological analyses were performed. River water samples were also analyzed from upstream and downstream of the Site as well as from the immediate vicinity of the springs. In addition, irrigation return water and spring water entering the river along the shoreline opposite Hanford were analyzed. Hanford-origin contaminants were detected in spring water entering the Columbia River along the Hanford Site. The type and concentrations of contaminants in the spring water were similarmore » to those known to exist in the ground water near the river. The location and extent of the contaminated discharges compared favorably with recent ground-water reports and predictions. Spring discharge volumes remain very small relative to the flow of the Columbia. Downstream river sampling demonstrates the impact of ground-water discharges to be minimal, and negligible in most cases. Radionuclide concentrations were below US Department of Energy Derived Concentration Guides (DCGs) with the exception {sup 90}Sr near the 100-N Area. Tritium, while below the DCG, was detected at concentrations above the US Environmental Protection Agency drinking water standards in several springs. All other radionuclide concentrations were below drinking water standards. Nonradiological contaminants were generally undetectable in the spring water. River water contaminant concentrations, outside of the immediate discharge zones, were below drinking water standards in all cases. 19 refs., 5 figs., 12 tabs.« less

Several N-Glycans on the HIV Envelope Glycoprotein gp120 Preferentially Locate Near Disulphide Bridges and Are Required for Efficient Infectivity and Virus Transmission.

PubMed

Mathys, Leen; Balzarini, Jan

2015-01-01

The HIV envelope glycoprotein gp120 contains nine disulphide bridges and is highly glycosylated, carrying on average 24 N-linked glycans. Using a probability calculation, we here demonstrate that there is a co-localization of disulphide bridges and N-linked glycans in HIV-1 gp120, with a predominance of N-linked glycans in close proximity to disulphide bridges, at the C-terminal side of the involved cysteines. Also, N-glycans are frequently found immediately adjacent to disulphide bridges in gp120 at the N-terminal side of the involved cysteines. In contrast, N-glycans at positions close to, but not immediately neighboring disulphide bridges seem to be disfavored at the N-terminal side of the involved cysteines. Such a pronounced co-localization of disulphide bridges and N-glycans was also found for the N-glycans on glycoprotein E1 of the hepatitis C virus (HCV) but not for other heavily glycosylated proteins such as E2 from HCV and the surface GP from Ebola virus. The potential functional role of the presence of N-glycans near disulphide bridges in HIV-1 gp120 was studied using site-directed mutagenesis, either by deleting conserved N-glycans or by inserting new N-glycosylation sites near disulphide bridges. The generated HIV-1NL4.3 mutants were subjected to an array of assays, determining the envelope glycoprotein levels in mutant viral particles, their infectivity and the capture and transmission efficiencies of mutant virus particles by DC-SIGN. Three N-glycans located nearby disulphide bridges were found to be crucial for the preservation of several of these functions of gp120. In addition, introduction of new N-glycans upstream of several disulphide bridges, at locations where there was a significant absence of N-glycans in a broad variety of virus strains, was found to result in a complete loss of viral infectivity. It was shown that the N-glycan environment around well-defined disulphide bridges of gp120 is highly critical to allow efficient viral infection and transmission.

Several N-Glycans on the HIV Envelope Glycoprotein gp120 Preferentially Locate Near Disulphide Bridges and Are Required for Efficient Infectivity and Virus Transmission

PubMed Central

Mathys, Leen; Balzarini, Jan

2015-01-01

The HIV envelope glycoprotein gp120 contains nine disulphide bridges and is highly glycosylated, carrying on average 24 N-linked glycans. Using a probability calculation, we here demonstrate that there is a co-localization of disulphide bridges and N-linked glycans in HIV-1 gp120, with a predominance of N-linked glycans in close proximity to disulphide bridges, at the C-terminal side of the involved cysteines. Also, N-glycans are frequently found immediately adjacent to disulphide bridges in gp120 at the N-terminal side of the involved cysteines. In contrast, N-glycans at positions close to, but not immediately neighboring disulphide bridges seem to be disfavored at the N-terminal side of the involved cysteines. Such a pronounced co-localization of disulphide bridges and N-glycans was also found for the N-glycans on glycoprotein E1 of the hepatitis C virus (HCV) but not for other heavily glycosylated proteins such as E2 from HCV and the surface GP from Ebola virus. The potential functional role of the presence of N-glycans near disulphide bridges in HIV-1 gp120 was studied using site-directed mutagenesis, either by deleting conserved N-glycans or by inserting new N-glycosylation sites near disulphide bridges. The generated HIV-1NL4.3 mutants were subjected to an array of assays, determining the envelope glycoprotein levels in mutant viral particles, their infectivity and the capture and transmission efficiencies of mutant virus particles by DC-SIGN. Three N-glycans located nearby disulphide bridges were found to be crucial for the preservation of several of these functions of gp120. In addition, introduction of new N-glycans upstream of several disulphide bridges, at locations where there was a significant absence of N-glycans in a broad variety of virus strains, was found to result in a complete loss of viral infectivity. It was shown that the N-glycan environment around well-defined disulphide bridges of gp120 is highly critical to allow efficient viral infection and transmission. PMID:26121645

Air bubble location inside the uterus after transfer: is the embryo really there?

PubMed

Soares, Sérgio Reis; Godinho, Catarina; Nunes, Sofia; Pellicer, António

2008-08-01

To demonstrate that the location of the air bubble after embryo transfer (ET) does not necessarily indicate the final embryo location. Case report. Private clinic. A couple with primary infertility for whom a diagnosis of bicornuate uterus with a very open angle between horns was confirmed. Laparoscopy and hysteroscopy were performed before an IVF cycle in which a single embryo was replaced. Air bubble image immediately after ET and gestational sac location 3 weeks later. Immediately after a single ET, the air bubble was seen in the left uterine horn. Three weeks later, a gestational sac was seen in the right uterine horn. The location of the air bubble immediately after ET does not necessarily indicate the final embryo location.

Formation of halogenated organics during waste-water disinfection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singer, P.C.; Brown, R.A.; Wiseman, J.F.

The research examined the formation of trihalomethanes (THMs) and total organic halides (TOX) during wastewater chlorination at three wastewater treatment plants in the central Piedmont of North Carolina. Secondary effluent samples were collected before and after the addition of chlorine at each of the three treatment facilities; chlorinated samples were taken from various locations within the chlorine contact chambers and at the plant discharge. Water samples were also collected upstream and downstream from two of the plant outfalls to determine the increase and persistence of THMs and TOX below each plant. TOX and THM formation was evaluated in terms ofmore » effluent wastewater quality (e.g., residual chemical oxygen demand, total organic carbon and ammonia concentration), chlorine dose, chlorine contacting system, methods of chlorine addition, and chlorine-to-ammonia ratio. The results showed that TOX was present in the unchlorinated wastewater and that additional TOX was formed immediately after chlorine addition. Small to insignificant amounts of THMS were detected. TOX formation did not increase with increasing contact time, due to the rapid depletion of free chlorine and the formation of combined chlorine in the chlorine contact chamber.« less

A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

PubMed Central

Clos, J; Buttgereit, D; Grummt, I

1986-01-01

A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

The effect of wing dihedral and section suction distribution on vortex bursting

NASA Technical Reports Server (NTRS)

Washburn, K. E.; Gloss, B. B.

1975-01-01

Eleven semi-span wing models were tested in the 1/8-scale model of the Langley V/STOL tunnel to qualitatively study vortex bursting. Flow visualization was achieved by using helium filled soap bubbles introduced upstream of the model. The angle of attack range was from 0 deg to 45 deg. The results show that the vortex is unstable, that is, the bursting point location is not fixed at a given angle of attack but moves within certain bounds. Upstream of the trailing edge, the bursting point location has a range of two inches; downstream, the range is about six inches. Anhedral and dihedral appear to have an insignificant effect on the vortex and its bursting point location. Altering the section suction distribution by improving the triangularity generally increases the angle of attack at which vortex bursting occurs at the trailing edge.

Requirements, model and prototype for a multi-utility locational and security information hub.

DOT National Transportation Integrated Search

2015-11-01

This project lays the foundation for building an exchange hub for locational and security data and risk assessment of potential excavation work. It acts primarily at 2 stages: upstream of the mark-out process, as a decision support tool to help strea...

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

PubMed

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

PubMed Central

Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

2012-01-01

Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

Effects of an oil spill on leafpack-inhabiting macroinvertebrates in the Chariton river, Missouri

USGS Publications Warehouse

Poulton, B.C.; Callahan, E.V.; Hurtubise, R.D.; Mueller, B.G.

1998-01-01

Artificial leaf packs were used to determine the effects of an oil spill on stream macroinvertebrate communities in the Chariton River, Missouri. Plastic mesh leaf retainers with approximately 10 g of leaves from five tree species were deployed at five sites (two upstream of the spill and three downstream) immediately after the spill and one year later. Four macroinvertebrate species dominating the community at upstream sites were virtually eliminated below the spill, including the stonefly Isoperla bilineata, the caddisfly Potamyia flava, the midge Thienemanniella xena, and blackfly larvae (Simulium sp.). Density of collector and shredder functional groups, and number of shredder taxa differed between upstream sites and the two furthest downstream sites during the 1990 sample period (Kruskal-Wallis w/Bonferroni paired comparisons, experiment wise error rate = 0.05). With one exception, no differences between sites were detected in the 1991-1992 sample period, indicating that the benthic community had at least partially recovered from the oil spill after one year. The odds of obtaining a sample with a small abundance of shredders (abundance < median) in 1990 was significantly greater downstream of the spill than upstream, and the odds of obtaining a sample with a small abundance of shredders at downstream sites was greater in 1990 than in 1991-1992. A similar pattern was observed in abundance and taxa richness of the collector functional group. No significant differences between the two sampling periods were detected at upstream sites. Observed effects appeared to be associated with oil sorption and substrate coating, creating conditions unsuitable for successful colonization.

In vivo and in vitro neurochemical-based assessments of wastewater effluents from the Maumee River area of concern.

EPA Science Inventory

Fathead minnows (Pimephales promelas) were caged for four days at multiple locations upstream and downstream of a wastewater treatment plant (WWTP) discharge into the Maumee River (USA, OH). Grab water samples collected at the same location were extracted using several different ...

33 CFR 165.810 - Mississippi River, LA-regulated navigation area.

Code of Federal Regulations, 2010 CFR

2010-07-01

.... (c) Movement of vessels in vicinity of Algiers Point, New Orleans Harbor: (1) Control lights. When... green lights designated and located as follows: Governor Nicholls Light located on the left descending bank on the wharf shed at the upstream end of Esplanade Avenue Wharf, New Orleans, approximately 94.3...

Signaling cascades modulate the speed of signal propagation through space.

PubMed

Govern, Christopher C; Chakraborty, Arup K

2009-01-01

Cells are not mixed bags of signaling molecules. As a consequence, signals must travel from their origin to distal locations. Much is understood about the purely diffusive propagation of signals through space. Many signals, however, propagate via signaling cascades. Here, we show that, depending on their kinetics, cascades speed up or slow down the propagation of signals through space, relative to pure diffusion. We modeled simple cascades operating under different limits of Michaelis-Menten kinetics using deterministic reaction-diffusion equations. Cascades operating far from enzyme saturation speed up signal propagation; the second mobile species moves more quickly than the first through space, on average. The enhanced speed is due to more efficient serial activation of a downstream signaling module (by the signaling molecule immediately upstream in the cascade) at points distal from the signaling origin, compared to locations closer to the source. Conversely, cascades operating under saturated kinetics, which exhibit zero-order ultrasensitivity, can slow down signals, ultimately localizing them to regions around the origin. Signal speed modulation may be a fundamental function of cascades, affecting the ability of signals to penetrate within a cell, to cross-react with other signals, and to activate distant targets. In particular, enhanced speeds provide a way to increase signal penetration into a cell without needing to flood the cell with large numbers of active signaling molecules; conversely, diminished speeds in zero-order ultrasensitive cascades facilitate strong, but localized, signaling.

Effect of Inductive Coil Geometry on the Operating Characteristics of a Pulsed Inductive Plasma Accelerator

NASA Technical Reports Server (NTRS)

Hallock, Ashley K.; Polzin, Kurt A.; Kimberlin, Adam C.

2012-01-01

Operational characteristics of two separate inductive thrusters with coils of different cone angles are explored through thrust stand measurements and time-integrated, un- filtered photography. Trends in impulse bit measurements indicate that, in the present experimental configuration, the thruster with the inductive coil possessing a smaller cone angle produced larger values of thrust, in apparent contradiction to results of a previous thruster acceleration model. Areas of greater light intensity in photographs of thruster operation are assumed to qualitatively represent locations of increased current density. Light intensity is generally greater in images of the thruster with the smaller cone angle when compared to those of the thruster with the larger half cone angle for the same operating conditions. The intensity generally decreases in both thrusters for decreasing mass ow rate and capacitor voltage. The location of brightest light intensity shifts upstream for decreasing mass ow rate of propellant and downstream for decreasing applied voltage. Recognizing that there typically exists an optimum ratio of applied electric field to gas pressure with respect to breakdown efficiency, this result may indicate that the optimum ratio was not achieved uniformly over the coil face, leading to non-uniform and incomplete current sheet formation in violation of the model assumption of immediate formation where all the injected propellant is contained in a magnetically-impermeable current sheet.

Effect of Inductive Coil Geometry on the Operating Characteristics of an Inductive Pulsed Plasma Thruster

NASA Technical Reports Server (NTRS)

Hallock, Ashley K.; Polzin, Kurt A.; Kimberlin, Adam C.; Perdue, Kevin A.

2012-01-01

Operational characteristics of two separate inductive thrusters with conical theta pinch coils of different cone angles are explored through thrust stand measurements and time- integrated, unfiltered photography. Trends in impulse bit measurements indicate that, in the present experimental configuration, the thruster with the inductive coil possessing a smaller cone angle produced larger values of thrust, in apparent contradiction to results of a previous thruster acceleration model. Areas of greater light intensity in photographs of thruster operation are assumed to qualitatively represent locations of increased current density. Light intensity is generally greater in images of the thruster with the smaller cone angle when compared to those of the thruster with the larger half cone angle for the same operating conditions. The intensity generally decreases in both thrusters for decreasing mass flow rate and capacitor voltage. The location of brightest light intensity shifts upstream for decreasing mass flow rate of propellant and downstream for decreasing applied voltage. Recognizing that there typically exists an optimum ratio of applied electric field to gas pressure with respect to breakdown efficiency, this result may indicate that the optimum ratio was not achieved uniformly over the coil face, leading to non-uniform and incomplete current sheet formation in violation of the model assumption of immediate formation where all the injected propellant is contained in a magnetically-impermeable current sheet.

Transcriptional mapping of the varicella-zoster virus regulatory genes encoding open reading frames 4 and 63.

PubMed Central

Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E

1994-01-01

Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496

Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

PubMed Central

Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

2015-01-01

The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

Streamflow gain-loss characteristics of Elkhead Creek downstream from Elkhead Reservoir near Craig, Colorado, 2009

USGS Publications Warehouse

Ruddy, Barbara C.

2010-01-01

The U.S. Geological Survey (USGS), in cooperation with the Colorado Water Conservation Board, the Upper Colorado River Endangered Fish Recovery Program (UCREFRP), Colorado Division of Water Resources, and City of Craig studied the gain-loss characteristics of Elkhead Creek downstream from Elkhead Reservoir to the confluence with the Yampa River during August through October 2009. Earlier qualitative interpretation of streamflow data downstream from the reservoir indicated that there could be a transit loss of nearly 10 percent. This potential loss could be a significant portion of the releases from Elkhead Reservoir requested by UCREFRP during late summer and early fall for improving critical habitat for endangered fish downstream in the Yampa River. Information on the gain-loss characteristics was needed for the effective management of the reservoir releases. In order to determine streamflow gain-loss characteristics for Elkhead Creek, eight measurement sets were made at four strategic instream sites and at one diversion from August to early October 2009. An additional measurement set was made after the study period during low-flow conditions in November 2009. Streamflow measurements were made using an Acoustic Doppler Velocimeter to provide high accuracy and consistency, especially at low flows. During this study, streamflow ranged from about 5 cubic feet per second up to more than 90 cubic feet per second with step increments in between. Measurements were made at least 24 hours after a change in reservoir release (streamflow) during steady-state conditions. The instantaneous streamflow measurements and the streamflow volume comparisons show the reach of Elkhead Creek immediately downstream from Elkhead Reservoir to the streamflow-gaging station 09246500, Elkhead Creek near Craig, CO, is neither a gaining nor losing reach. The instantaneous measurements immediately downstream from the dam and the combined measurements of Norvell ditch plus streamflow-gaging station 09246500 are mostly within the plus or minus 5-percent measurement error of each other. The variability of data is such that sometimes the streamflow is greater upstream than downstream and sometimes the streamflow is greater downstream than upstream. Streamflow volumes were calculated for multiple time periods as determined by a change in release from the reservoir. Streamflow volumes were greater downstream than upstream for all but one time period. The predominance of greater streamflows downstream is due to the difference between the USGS instantaneous measurements and record computation with the Supervisory Control and Data Acquisition (SCADA) record at the dam. Immediately following an increase in streamflow from the reservoir, the downstream volume was smaller than the upstream volume, but this was an artifact of the traveltime between the two sites and possibly small amounts of water entering the streambank. Traveltimes were shorter at higher streamflows and when streamflow was increasing.

Analyzing the Impacts of Dams on Riparian Ecosystems: A Review of Research Strategies and Their Relevance to the Snake River Through Hells Canyon

PubMed Central

Braatne, Jeffrey H.; Goater, Lori A.; Blair, Charles L.

2007-01-01

River damming provides a dominant human impact on river environments worldwide, and while local impacts of reservoir flooding are immediate, subsequent ecological impacts downstream can be extensive. In this article, we assess seven research strategies for analyzing the impacts of dams and river flow regulation on riparian ecosystems. These include spatial comparisons of (1) upstream versus downstream reaches, (2) progressive downstream patterns, or (3) the dammed river versus an adjacent free-flowing or differently regulated river(s). Temporal comparisons consider (4) pre- versus post-dam, or (5) sequential post-dam conditions. However, spatial comparisons are complicated by the fact that dams are not randomly located, and temporal comparisons are commonly limited by sparse historic information. As a result, comparative approaches are often correlative and vulnerable to confounding factors. To complement these analyses, (6) flow or sediment modifications can be implemented to test causal associations. Finally, (7) process-based modeling represents a predictive approach incorporating hydrogeomorphic processes and their biological consequences. In a case study of Hells Canyon, the upstream versus downstream comparison is confounded by a dramatic geomorphic transition. Comparison of the multiple reaches below the dams should be useful, and the comparison of Snake River with the adjacent free-flowing Salmon River may provide the strongest spatial comparison. A pre- versus post-dam comparison would provide the most direct study approach, but pre-dam information is limited to historic reports and archival photographs. We conclude that multiple study approaches are essential to provide confident interpretations of ecological impacts downstream from dams, and propose a comprehensive study for Hells Canyon that integrates multiple research strategies. PMID:18043964

Flow-Field Investigation of Gear-Flap Interaction on a Gulfstream Aircraft Model

NASA Technical Reports Server (NTRS)

Yao, Chung-Sheng; Jenkins, Luther N.; Bartram, Scott M.; Harris, Jerome; Khorrami, Mehdi R.; Mace, W. Derry

2014-01-01

Off-surface flow measurements of a high-fidelity 18% scale Gulfstream aircraft model in landing configuration with the main landing gear deployed are presented. Particle Image Velocimetry (PIV) and Laser Velocimetry (LV) were used to measure instantaneous velocities in the immediate vicinity of the main landing gear and its wake and near the inboard tip of the flap. These measurements were made during the third entry of a series of tests conducted in the NASA Langley Research Center (LaRC) 14- by 22-Foot Subsonic Tunnel (14 x 22) to obtain a comprehensive set of aeroacoustic measurements consisting of both aerodynamic and acoustic data. The majority of the off-body measurements were obtained at a freestream Mach number of 0.2, angle of attack of 3 degrees, and flap deflection angle of 39 degrees with the landing gear on. A limited amount of data was acquired with the landing gear off. LV was used to measure the velocity field in two planes upstream of the landing gear and to measure two velocity profiles in the landing gear wake. Stereo and 2-D PIV were used to measure the velocity field over a region extending from upstream of the landing gear to downstream of the flap trailing edge. Using a special traverse system installed under the tunnel floor, the velocity field was measured at 92 locations to obtain a comprehensive picture of the pertinent flow features and characteristics. The results clearly show distinct structures in the wake that can be associated with specific components on the landing gear and give insight into how the wake is entrained by the vortex at the inboard tip of the flap.

Suspended-sediment trapping in the tidal reach of an estuarine tributary channel

USGS Publications Warehouse

Downing-Kunz, Maureen; Schoellhamer, David H.

2015-01-01

Evidence of decreasing sediment supply to estuaries and coastal oceans worldwide illustrates the need for accurate and updated estimates. In the San Francisco Estuary (Estuary), recent research suggests a decrease in supply from its largest tributaries, implying the increasing role of smaller, local tributaries in sediment supply to this estuary. Common techniques for estimating supply from tributaries are based on gages located above head of tide, which do not account for trapping processes within the tidal reach. We investigated the effect of a tidal reach on suspended-sediment discharge for Corte Madera Creek, a small tributary of the Estuary. Discharge of water (Q) and suspended-sediment (SSD) were observed for 3 years at two locations along the creek: upstream of tidal influence and at the mouth. Comparison of upstream and mouth gages showed nearly 50 % trapping of upstream SSD input within the tidal reach over this period. At the storm time scale, suspended-sediment trapping efficiency varied greatly (range −31 to 93 %); storms were classified as low- or high-yield based on upstream SSD. As upstream peak Q increased, high-yield storms exhibited significantly decreased trapping. Tidal conditions at the mouth—ebb duration and peak ebb velocity—during storms had a minor effect on sediment trapping, suggesting fluvial processes dominate. Comparison of characteristic fluvial and tidal discharges at the storm time scale demonstrated longitudinal differences in the regulating process for SSD. These results suggest that SSD from gages situated above head of tide overestimate sediment supply to the open waters beyond tributary mouths and thus trapping processes within the tidal reach should be considered.

Evolving force balance at Columbia Glacier, Alaska, during its rapid retreat

USGS Publications Warehouse

O'Neel, S.; Pfeffer, W.T.; Krimmel, R.; Meier, M.

2005-01-01

Changes in driving and resistive stresses play an essential role in governing the buoyancy forces that are important controls on the speed and irreversibility of tidewater glacier retreats. We describe changes in geometry, velocity, and strain rate and present a top-down force balance analysis performed over the lower reach of Columbia Glacier. Our analysis uses new measurements and estimates of basal topography and photogrammetric surface velocity measurements made between 1977 and 2001, while assuming depth-independent strain. Sensitivity tests show that the method is robust and insensitive to small changes in the calculation parameters. Spatial distributions of ice speed show little correspondence with driving stress. Instead, spatial patterns of ice speed exhibit a nonlinear correspondence with basal drag. Primary resistance to flow comes from basal drag, but lateral drag becomes increasingly more important throughout the retreat, which may account for observed increases in speed. Maximum basal drag is always located in a prominent constriction located ~12 km upstream from the preretreat terminus. Once the terminus retreated into deep water off the terminal moraine marking the modern maximum extent, the upstream location of this maximum basal drag helped to promote thinning and decrease effective pressure in the lower region by limiting replenishing ice flow from upstream. An increase in both ice velocity and calving resulted, initiating what appears to be an irreversible retreat. Copyright 2005 by the American Geophysical Union.

Energies of backstreaming protons in the foreshock

NASA Technical Reports Server (NTRS)

Greenstadt, E. W.

1976-01-01

A predicted pattern of energy vs detector location in the cislunar region is displayed for protons of zero pitch angle traveling upstream away from the quasi-parallel bow shock. The pattern is implied by upstream wave boundary properties. In the solar ecliptic, protons are estimated to have a minimum of 1.1 times the solar wind bulk energy E sub SW when the wave boundary is in the early morning sector and a maximum of 8.2 E sub SW when the boundary is near the predawn flank.

Pump CFD code validation tests

NASA Technical Reports Server (NTRS)

Brozowski, L. A.

1993-01-01

Pump CFD code validation tests were accomplished by obtaining nonintrusive flow characteristic data at key locations in generic current liquid rocket engine turbopump configurations. Data were obtained with a laser two-focus (L2F) velocimeter at scaled design flow. Three components were surveyed: a 1970's-designed impeller, a 1990's-designed impeller, and a four-bladed unshrouded inducer. Two-dimensional velocities were measured upstream and downstream of the two impellers. Three-dimensional velocities were measured upstream, downstream, and within the blade row of the unshrouded inducer.

Interactions between Point Bar Growth and Bank Erosion on a Low Sinuosity Meander Bend in an Ephemeral Channel: Insights from Repeat Topographic Surveys and Numerical Modeling

NASA Astrophysics Data System (ADS)

Ursic, M.; Langendoen, E. J.

2017-12-01

Interactions between point bar growth, bank migration, and hydraulics on meandering rivers are complicated and not well understood. For ephemeral streams, rapid fluctuations in flow further complicate studying and understanding these interactions. This study seeks to answer the following `cause-and-effect' question: Does point bar morphologic adjustment determine where bank erosion occurs (for example, through topographic steering of the flow), or does local bank retreat determine where accretion/erosion occurs on the point bar, or do bank erosion and point bar morphologic adjustment co-evolve? Further, is there a response time between the `cause-and-effect' processes and what variables determine its magnitude and duration? In an effort to answer these questions for an ephemeral stream, a dataset of forty-eight repeat topographic surveys over a ten-year period (1996-2006) of a low sinuosity bend within the Goodwin Creek Experimental Watershed, located near Batesville, MS, were utilized in conjunction with continuous discharge measurements to correlate flow variability and erosional and depositional zones, spatially and temporally. Hydraulically, the bend is located immediately downstream of a confluence with a major tributary. Supercritical flumes on both the primary and tributary channels just upstream of the confluence provide continuous measured discharges to the bend over the survey period. In addition, water surface elevations were continuously measured at the upstream and downstream ends of the bend. No spatial correlation trends could be discerned between reach-scale bank retreat, point bar morphologic adjustment, and flow discharge. Because detailed flow patterns were not available, the two-dimensional computer model Telemac2D was used to provide these details. The model was calibrated and validated for a set of runoff events for which more detailed flow data were available. Telemac2D simulations were created for each topographic survey period. Flows greater than baseflow were combined to create contiguous hydrographs for each survey period. Statistical examination of local flow variability and morphological changes throughout the bend will be conducted and presented.

Operations Plans for Anadromous Fish Production Facilities in the Columbia River Basin, Volume II of V; 1992 Annual Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hutchison, Bill

1993-05-01

Clearwater Hatchery is located on the north bank of the North Fork of the Clearwater River, downstream from Dworshak Dam. It is approximately 72 miles from Lower Granite Dam, and 504 miles from the mouth of the Columbia River. Site elevation is approximately 994 feet above sea level. The hatchery is staffed with 7 FTE's. Clearwater Hatchery has two pipelines from Dworshak Reservoir. One is attached to a floating platform and is capable of providing various temperatures at varying depths. The other is a stationary intake about 245 feet below the top of the dam. All water is gravity fedmore » to the hatchery. An l8 inch intake pipe provides an estimated 10 cfs with temperature remaining constant at approximately 40 F. The primary 42-inch intake pipe can draw water from 5 to 45 feet in depth with temperatures ranging from 55 to 60 F and 70 cfs of flow. The hatchery facility consists of 11 chinook raceways, 24 steelhead raceways, 2 adult holding ponds, a covered spawning area with 2 live wells and 60 concrete rearing vats. There are 40 double stacks of Heath-type incubators and each vat also has an incubation jar. All facility units are in excellent condition. Clearwater Hatchery also supports satellite facilities at Red River, Crooked River and Powell. The Red River satellite facility is located approximately 15 miles east of Elk City, Idaho. It is approximately 186 miles upstream from Lower Granite Dam and 618 miles from the mouth of the Columbia River. It was first built in 1974 by the Columbia River Project and then remodeled by the U.S. Army Corps of Engineers in 1986. Red River is supplied by gravity flow from an intake located at the bottom of the South Fork of Red River, 225 yards upstream from the facility. Water rights allow for 10 cfs and during low flows in the summer about 5 cfs is available. Temperatures range from 40 F in the spring to 71 F in early August. The facility consists of two adult holding ponds, a removable tripod and panel weir, and a rearing pond. All units are in good condition due to the recent remodeling. The Crooked River satellite facility is located 20 miles downstream of Red River. The trap is located 0.5 miles upstream of the mouth of Crooked River, a tributary of the South Fork of the Clearwater River. The rearing ponds are 10 miles upstream from the Crooked River adult trap. Crooked River water is supplied by gravity flow by an intake 200 yards upstream of the facility raceways. Water rights allow for 10 cfs at the rearing facility and 10 cfs at the trapping facility. Water temperatures range from 42 to 70 F. The trap and weir are located at the mouth of Crooked River. Ten miles upstream from the mouth are two raceways, a cleaning waste pond and final settling pond. All facility units are in good condition. The Powell satellite facility is located 122 miles east of the Clear-water Hatchery at the headwaters of the Lochsa River, the confluence of the Crooked Fork Creek and White Sands Creek. Powell is 192.5 miles from Lower Granite Dam and 624 miles from the mouth of the Columbia River. The Powell Facility receives gravity flow water from Walton Creek at a rate of 7 cfs with the intake being located 100 yards upstream from the facility. Powell also has a pumped supply from White Sands Creek at 3 cfs. Water temperature ranges from 45.8 to 50.2 F from the Walton Creek intake and 41 to 65 F from the White Sands pump station. The facility consists of one rearing pond, a diversion and intake screen, two adult holding ponds, a floating weir, and an open bay spawning shelter. All facility units are in good condition.« less

75 FR 66178 - Self-Regulatory Organizations; NASDAQ OMX BX, Inc.; Notice of Filing and Immediate Effectiveness...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-27

... Codify Pricing for Co-Location Services October 21, 2010. Pursuant to Section 19(b)(1) of the Securities...-location services. BX will implement the proposed change immediately. The text of the proposed rule change... Recently, the Commission approved an initial fee schedule of existing fees for the Exchange's co-location...

75 FR 67422 - Self-Regulatory Organizations; NASDAQ OMX BX, Inc.; Notice of Filing and Immediate Effectiveness...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-02

... Modify Pricing for Co-Location Services October 27, 2010. Pursuant to Section 19(b)(1) of the Securities... co-location services. BX will implement the proposed change immediately. The text of the proposed... Exchange is proposing to modify its fee schedule \\5\\ for co- location services.\\6\\ These modifications are...

Transition control of Mach to regular reflection induced interaction using an array of micro ramp vane-type vortex generators

NASA Astrophysics Data System (ADS)

Verma, Shashi B.; Chidambaranathan, Manisankar

2015-10-01

An experimental investigation has been conducted to favorably control/modify a Mach reflection induced interaction in a Mach 2.05 flow on a flat plate using an array of single row mechanical micro vane-type vortex generators (VGs). The objective was to study the variation in (i) control device configuration (trapezoidal and the split-trapezoidal or ramp vane-type), (ii) control device height (h/δ = 0.3, 0.5), and (iii) control location (X/δ = 9, 15 upstream of the interaction) in controlling the overall interaction. The primary aim was to investigate a control location and VG configuration which is able to effectively initiate a transition from Mach reflection to regular reflection with minimum changes to the separation characteristics for no control. While the trapezoidal configuration is seen to move the separation location upstream only slightly, the split-trapezoidal configurations result in a considerable upstream movement that is associated with significant reduction in separation shock strength. The latter flow modification causes the Mach stem to completely disappear resulting in a transition from Mach to regular reflection. The control location of X/δ = 15 seems to be most effective for all control device configurations tested. It is further observed that whilst the effectiveness of the split-trapezoidal configuration of h/δ = 0.3 in controlling the transition improves with increasing X/δ, increasing its height to h/δ = 0.5 not only controls the transition process but is also able to control the extent of separation. All the control devices, however, are seen to increase the flow unsteadiness in the intermittent region of separation for both control locations. From this perspective, increasing the height of the control device seems favorable for the closer control location as it not only completely modifies the Mach reflection but also keeps the peak rms value similar to the baseline case.

Channel evolution on the dammed Elwha River, Washington, USA

USGS Publications Warehouse

Draut, A.E.; Logan, J.B.; Mastin, M.C.

2011-01-01

Like many rivers in the western U.S., the Elwha River, Washington, has changed substantially over the past century in response to natural and human forcing. The lower river is affected by two upstream dams that are slated for removal as part of a major river restoration effort. In preparation for studying the effects of dam removal, we present a comprehensive field and aerial photographic analysis of dam influence on an anabranching, gravel-bed river. Over the past century with the dams in place, loss of the upstream sediment supply has caused spatial variations in the sedimentary and geomorphic character of the lower Elwha River channel. Bed sediment is armored and better sorted than on the naturally evolving bed upstream of the dams. On time scales of flood seasons, the channel immediately below the lower dam is fairly stable, but progresses toward greater mobility downstream such that the lowermost portion of the river responded to a recent 40-year flood with bank erosion and bed-elevation changes on a scale approaching that of the natural channel above the dams. In general, channel mobility in the lowest 4 km of the Elwha River has not decreased substantially with time. Enough fine sediment remains in the floodplain that – given sufficient flood forcing – the channel position, sinuosity, and braiding index change substantially. The processes by which this river accesses new fine sediment below the dams (rapid migration into noncohesive banks and avulsion of new channels) allow it to compensate for loss of upstream sediment supply more readily than would a dammed river with cohesive banks or a more limited supply of alluvium. The planned dam removal will provide a valuable opportunity to evaluate channel response to the future restoration of natural upstream sediment supply.

Paleogeomorphology of the early Colorado River inferred from relationships in Mohave and Cottonwood Valleys, Arizona, California and Nevada

USGS Publications Warehouse

Pearthree, Philip; House, P. Kyle

2014-01-01

Geologic investigations of late Miocene–early Pliocene deposits in Mohave and Cottonwood valleys provide important insights into the early evolution of the lower Colorado River system. In the latest Miocene these valleys were separate depocenters; the floor of Cottonwood Valley was ∼200 m higher than the floor of Mohave Valley. When Colorado River water arrived from the north after 5.6 Ma, a shallow lake in Cottonwood Valley spilled into Mohave Valley, and the river then filled both valleys to ∼560 m above sea level (asl) and overtopped the bedrock divide at the southern end of Mohave Valley. Sediment-starved water spilling to the south gradually eroded the outlet as siliciclastic Bouse deposits filled the lake upstream. When sediment accumulation reached the elevation of the lowering outlet, continued erosion of the outlet resulted in recycling of stored lacustrine sediment into downstream basins; depth of erosion of the outlet and upstream basins was limited by the water levels in downstream basins. The water level in the southern Bouse basin was ∼300 m asl (modern elevation) at 4.8 Ma. It must have drained and been eroded to a level <150 m asl soon after that to allow for deep erosion of bedrock divides and basins upstream, leading to removal of large volumes of Bouse sediment prior to massive early Pliocene Colorado River aggradation. Abrupt lowering of regional base level due to spilling of a southern Bouse lake to the Gulf of California could have driven observed upstream river incision without uplift. Rapid uplift of the entire region immediately after 4.8 Ma would have been required to drive upstream incision if the southern Bouse was an estuary.

Movement of the saltwater interface in the surficial aquifer system in response to hydrologic stresses and water-management practices, Broward County, Florida

USGS Publications Warehouse

Dausman, Alyssa M.; Langevin, Christian D.

2005-01-01

A study was conducted to evaluate the relation between water-level fluctuations and saltwater intrusion in Broward County, Florida. The objective was achieved through data collection at selected wells in Broward County and through the development of a variable-density ground-water flow model. The numerical model is representative of many locations in Broward County that contain a well field, control structure, canal, the Intracoastal Waterway, and the Atlantic Ocean. The model was used to simulate short-term movement (from tidal fluctuations to monthly changes) and long-term movement (greater than 10 years) of the saltwater interface resulting from changes in rainfall, well-field withdrawals, sea-level rise, and upstream canal stage. The SEAWAT code, which is a combined version of the computer codes, MODFLOW and MT3D, was used to simulate the complex variable-density flow patterns. Model results indicated that the canal, control structure, and sea level have major effects on ground-water flow. For periods greater than 10 years, the upstream canal stage controls the movement and location of the saltwater interface. If upstream canal stage is decreased by 1 foot (0.3048 meter), the saltwater interface takes 50 years to move inland and stabilize. If the upstream canal stage is then increased by 1 foot (0.3048 meter), the saltwater interface takes 90 years to move seaward and stabilize. If sea level rises about 48 centimeters over the next 100 year as predicted, then inland movement of the saltwater interface may cause well-field contamination. For periods less than 10 years, simulation results indicated that a 3-year drought with increased well-field withdrawals probably will not have long-term effects on the position of the saltwater interface in the Biscayne aquifer. The saltwater interface returns to its original position in less than 10 years. Model results, however, indicated that the interface location in the lower part of the surficial aquifer system takes longer than 10 years to recover from a drought. Additionally, rainfall seems to have the greatest effect on saltwater interface movement in areas some distance from canals, but the upstream canal stage has the greatest effect on the movement of the saltwater interface near canals. Field data indicated that saltwater interface movement includes short-term fluctuations caused by tidal fluctuations and long-term seasonal fluctuations. Statistical analyses of daily-averaged data indicated that the saltwater interface moves in response to pumpage, rainfall, and upstream canal stage. In areas near the canal, the saltwater interface is most affected by canal stage because water-management structures control the stage in the upstream part of the canal and allow movement of the saltwater interface. In areas away from the canal, the saltwater interface is most affected by pumpage and rainfall, depending on the location of well fields. Data analyses also revealed that rainfall changes the vertical flow direction in the Biscayne aquifer. Results from the study indicated that upstream canal stage substantially affects the long-term position of the saltwater interface in the surficial aquifer system. The saltwater interface moves faster inland than seaward because of changes in upstream canal stage. For short-term problems, such as drought, the threat of saltwater intrusion in the Biscayne aquifer does not appear to be severe if the well-field withdrawal is increased; however, this conclusion is based on the assumption that well-field withdrawals will decrease once the drought is over. Sea-level rise may be a potential threat to the water supply in Broward County as the saltwater interface moves inland toward well fields.

Effect of location in an array on heat transfer to a cylinder in crossflow

NASA Technical Reports Server (NTRS)

Simoneau, R. J.; Vanfossen, G. J., Jr.

1982-01-01

An experiment was conducted to measure the heat transfer from a heated cylinder in crossflow in an array of circular cylinders. All cylinders had a length-to-diameter ratio of 3.0. Both in-line and staggered array patterns were studied. The cylinders were spaced 2.67 diameters apart center-to-center in both the axial and transverse directions to the flow. The row containing the heated cylinder remained in a fixed position in the channel and the relative location of this row within the array was changed by adding up to five upstream rows. The working fluid was nitrogen gas at pressures from 100 to 600 kPa. The Reynolds number ranged based on cylinder diameter and average unobstructed channel velocity was from 5,000 to 125,000. Turbulence intensity: profiles were measured for each case at a point one half space upstream of the row containing the heated cylinder. The basis of comparison for all the heat transfer data was the single row with the heated cylinder. For the in-line cases the addition of a single row of cylinders upstream of the row containing the heated cylinder increased the heat transfer by an average of 50 percent above the base case. Adding up to five more rows caused no increase or decrease in heat transfer. Adding rows in the staggered array cases resulted in average increases in heat transfer of 21, 64, 58, 46, and 46 percent for one to five upstream rows, respectively.

Submarine Alkalic Lavas Around the Hawaiian Hotspot; Plume and Non-Plume Signatures Determined by Noble Gases

NASA Astrophysics Data System (ADS)

Hanyu, T.; Clague, D. A.; Kaneoka, I.; Dunai, T. J.; Davies, G. R.

2004-12-01

Noble gas isotopic ratios were determined for submarine alkalic volcanic rocks distributed around the Hawaiian islands to constrain the origin of such alkalic volcanism. Samples were collected by dredging or using submersibles from the Kauai Channel between Oahu and Kauai, north of Molokai, northwest of Niihau, Southwest Oahu, South Arch and North Arch volcanic fields. Sites located downstream from the center of the hotspot have 3He/4He ratios close to MORB at about 8 Ra, demonstrating that the magmas erupted at these sites had minimum contribution of volatiles from a mantle plume. In contrast, the South Arch, located upstream of the hotspot on the Hawaiian Arch, has 3He/4He ratios between 17 and 21 Ra, indicating a strong plume influence. Differences in noble gas isotopic characteristics between alkalic volcanism downstream and upstream of the hotspot imply that upstream volcanism contains incipient melts from an upwelling mantle plume, having primitive 3He/4He. In combination with lithophile element isotopic data, we conclude that the most likely source of the upstream magmatism is depleted asthenospheric mantle that has been metasomatised by incipient melt from a mantle plume. After major melt extraction from the mantle plume during production of magmas for the shield stage, the plume material is highly depleted in noble gases and moderately depleted in lithophile elements. Partial melting of the depleted mantle impregnated by melts derived from this volatile depleted plume source may explain the isotopic characteristics of the downstream alkalic magmatism.

Predicting recolonization patterns and interactions between potamodromous and anadromous salmonids in response to dam removal in the Elwha River, Washington State, USA

USGS Publications Warehouse

Brenkman, S.J.; Pess, G.R.; Torgersen, C.E.; Kloehn, K.K.; Duda, J.J.; Corbett, S.C.

2008-01-01

The restoration of salmonids in the Elwha River following dam removal will cause interactions between anadromous and potamodromous forms as recolonization occurs in upstream and downstream directions. Anadromous salmonids are expected to recolonize historic habitats, and rainbow trout (Oncorhynchus mykiss) and bull trout (Salvelinus confluentus) isolated above the dams for 90 years are expected to reestablish anadromy. We summarized the distribution and abundance of potamodromous salmonids, determined locations of spawning areas, and mapped natural barriers to fish migration at the watershed scale based on data collected from 1993 to 2006. Rainbow trout were far more abundant than bull trout throughout the watershed and both species were distributed up to river km 71. Spawning locations for bull trout and rainbow trout occurred in areas where we anticipate returning anadromous fish to spawn. Nonnative brook trout were confined to areas between and below the dams, and seasonal velocity barriers are expected to prevent their upstream movements. We hypothesize that the extent of interaction between potamodromous and anadromous salmonids will vary spatially due to natural barriers that will limit upstream-directed recolonization for some species of salmonids. Consequently, most competitive interactions will occur in the main stem and floodplain downstream of river km 25 and in larger tributaries. Understanding future responses of Pacific salmonids after dam removal in the Elwha River depends upon an understanding of existing conditions of the salmonid community upstream of the dams prior to dam removal.

Improving upstream transmission performance using a receiver with decision threshold level adjustment in a loopback WDM-PON

NASA Astrophysics Data System (ADS)

Cho, Seung-Hyun; Lee, Sang-Soo; Shin, Dong-Wook

2010-06-01

We have experimentally demonstrated that the use of an optical receiver with decision threshold level adjustment (DTLA) improved the performance of an upstream transmission in reflective semiconductor optical amplifier (RSOA)-based loopback wavelength division multiplexing-passive optical network (WDM-PON). Even though the extinction ratio (ER) of the downstream signal was as much as 9 dB and the injection power into the RSOA at the optical network unit was about -24 dBm, we successfully obtained error-free transmission results for the upstream signal through careful control of the decision threshold value in the optical receiver located at optical line terminal (OLT). Using an optical receiver with DTLA for upstream signal detection overcame significant obstacles related to the injection power into the RSOA and the ER of the downstream signal, which were previously considered limitations of the wavelength remodulation scheme. This technique is expected to provide flexibility for the optical link design in the practical deployment of a WDM-PON.

Relationship between wave energy and free energy from pickup ions in the Comet Halley environment

NASA Technical Reports Server (NTRS)

Huddleston, D. E.; Johnstone, A. D.

1992-01-01

The free energy available from the implanted heavy ion population at Comet Halley is calculated by assuming that the initial unstable velocity space ring distribution of the ions evolves toward a bispherical shell. Ultimately this free energy adds to the turbulence in the solar wind. Upstream and downstream free energies are obtained separately for the conditions observed along the Giotto spacecraft trajectory. The results indicate that the waves are mostly upstream propagating in the solar wind frame. The total free energy density always exceeds the measured wave energy density because, as expected in the nonlinear process of ion scattering, the available energy is not all immediately released. An estimate of the amount which has been released can be obtained from the measured oxygen ion distributions and again it exceeds that observed. The theoretical analysis is extended to calculate the k spectrum of the cometary-ion-generated turbulence.

The immediate upstream region of the 5′-UTR from the AUG start codon has a pronounced effect on the translational efficiency in Arabidopsis thaliana

PubMed Central

Kim, Younghyun; Lee, Goeun; Jeon, Eunhyun; Sohn, Eun ju; Lee, Yongjik; Kang, Hyangju; Lee, Dong wook; Kim, Dae Heon; Hwang, Inhwan

2014-01-01

The nucleotide sequence around the translational initiation site is an important cis-acting element for post-transcriptional regulation. However, it has not been fully understood how the sequence context at the 5′-untranslated region (5′-UTR) affects the translational efficiency of individual mRNAs. In this study, we provide evidence that the 5′-UTRs of Arabidopsis genes showing a great difference in the nucleotide sequence vary greatly in translational efficiency with more than a 200-fold difference. Of the four types of nucleotides, the A residue was the most favourable nucleotide from positions −1 to −21 of the 5′-UTRs in Arabidopsis genes. In particular, the A residue in the 5′-UTR from positions −1 to −5 was required for a high-level translational efficiency. In contrast, the T residue in the 5′-UTR from positions −1 to −5 was the least favourable nucleotide in translational efficiency. Furthermore, the effect of the sequence context in the −1 to −21 region of the 5′-UTR was conserved in different plant species. Based on these observations, we propose that the sequence context immediately upstream of the AUG initiation codon plays a crucial role in determining the translational efficiency of plant genes. PMID:24084084

Noncanonical expression of a murine cytomegalovirus early protein CD8 T-cell epitope as an immediate early epitope based on transcription from an upstream gene.

PubMed

Fink, Annette; Büttner, Julia K; Thomas, Doris; Holtappels, Rafaela; Reddehase, Matthias J; Lemmermann, Niels A W

2014-02-14

Viral CD8 T-cell epitopes, represented by viral peptides bound to major histocompatibility complex class-I (MHC-I) glycoproteins, are often identified by "reverse immunology", a strategy not requiring biochemical and structural knowledge of the actual viral protein from which they are derived by antigen processing. Instead, bioinformatic algorithms predicting the probability of C-terminal cleavage in the proteasome, as well as binding affinity to the presenting MHC-I molecules, are applied to amino acid sequences deduced from predicted open reading frames (ORFs) based on the genomic sequence. If the protein corresponding to an antigenic ORF is known, it is usually inferred that the kinetic class of the protein also defines the phase in the viral replicative cycle during which the respective antigenic peptide is presented for recognition by CD8 T cells. We have previously identified a nonapeptide from the predicted ORFm164 of murine cytomegalovirus that is presented by the MHC-I allomorph H-2 Dd and that is immunodominant in BALB/c (H-2d haplotype) mice. Surprisingly, although the ORFm164 protein gp36.5 is expressed as an Early (E) phase protein, the m164 epitope is presented already during the Immediate Early (IE) phase, based on the expression of an upstream mRNA starting within ORFm167 and encompassing ORFm164.

Immediate, early and late seizures after primary intracerebral hemorrhage.

PubMed

Qian, Cheng; Löppönen, Pekka; Tetri, Sami; Huhtakangas, Juha; Juvela, Seppo; Turtiainen, Hanna-Maria E; Bode, Michaela K; Hillbom, Matti

2014-05-01

Seizures after primary intracerebral hemorrhage (PICH) are significant and treatable complications, but the factors predicting immediate, early and late seizures are poorly known. We investigated characteristics and outcome with special reference to occurrence and timing of a first seizure among consecutive subjects with PICH. A population-based study was conducted in Northern Ostrobothnia, Finland, in 1993-2008 that included all patients with a first-ever primary ICH without any prior diagnosis of epilepsy. Immediate (<24h after admission), early (1-14 days) and late (>2 weeks) seizures were considered separately. Out of a total of 935 ICH patients, 51 had immediate, 21 early and 58 late seizures. The patients with seizures were significantly younger than the others and more often had a subcortical hematoma location (p<0.05). Lifestyle factors did not differ between the groups. The risk factors for immediate seizures in multivariable analysis were a low Glasgow coma scale score (GCS) on admission, subcortical location and age inversely (p<0.01). The only independent risk factor for early seizures was subcortical location (p<0.001), whereas subcortical location (p<0.001), age inversely (p<0.01) and hematoma evacuation (p<0.05) independently predicted late seizures. Immediate and early seizures predicted infectious complications (p<0.05). Patients with subcortical hematoma and of younger age are at risk for immediate seizures after primary ICH irrespective of hematoma size. Patients with immediate and early seizures more often had infectious complications. Surgery increases the risk of a late seizure after ICH. Copyright © 2014 Elsevier B.V. All rights reserved.

Ducks in space: from nonlinear absolute instability to noise-sustained structures in a pattern-forming system

NASA Astrophysics Data System (ADS)

Avitabile, D.; Desroches, M.; Knobloch, E.; Krupa, M.

2017-11-01

A subcritical pattern-forming system with nonlinear advection in a bounded domain is recast as a slow-fast system in space and studied using a combination of geometric singular perturbation theory and numerical continuation. Two types of solutions describing the possible location of stationary fronts are identified, whose origin is traced to the onset of convective and absolute instability when the system is unbounded. The former are present only for non-zero upstream boundary conditions and provide a quantitative understanding of noise-sustained structures in systems of this type. The latter correspond to the onset of a global mode and are present even with zero upstream boundary conditions. The role of canard trajectories in the nonlinear transition between these states is clarified and the stability properties of the resulting spatial structures are determined. Front location in the convective regime is highly sensitive to the upstream boundary condition, and its dependence on this boundary condition is studied using a combination of numerical continuation and Monte Carlo simulations of the partial differential equation. Statistical properties of the system subjected to random or stochastic boundary conditions at the inlet are interpreted using the deterministic slow-fast spatial dynamical system.

Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

PubMed Central

Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

2012-01-01

Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

Ducks in space: from nonlinear absolute instability to noise-sustained structures in a pattern-forming system.

PubMed

Avitabile, D; Desroches, M; Knobloch, E; Krupa, M

2017-11-01

A subcritical pattern-forming system with nonlinear advection in a bounded domain is recast as a slow-fast system in space and studied using a combination of geometric singular perturbation theory and numerical continuation. Two types of solutions describing the possible location of stationary fronts are identified, whose origin is traced to the onset of convective and absolute instability when the system is unbounded. The former are present only for non-zero upstream boundary conditions and provide a quantitative understanding of noise-sustained structures in systems of this type. The latter correspond to the onset of a global mode and are present even with zero upstream boundary conditions. The role of canard trajectories in the nonlinear transition between these states is clarified and the stability properties of the resulting spatial structures are determined. Front location in the convective regime is highly sensitive to the upstream boundary condition, and its dependence on this boundary condition is studied using a combination of numerical continuation and Monte Carlo simulations of the partial differential equation. Statistical properties of the system subjected to random or stochastic boundary conditions at the inlet are interpreted using the deterministic slow-fast spatial dynamical system.

Translational profiling of B cells infected with the Epstein-Barr virus reveals 5' leader ribosome recruitment through upstream open reading frames.

PubMed

Bencun, Maja; Klinke, Olaf; Hotz-Wagenblatt, Agnes; Klaus, Severina; Tsai, Ming-Han; Poirey, Remy; Delecluse, Henri-Jacques

2018-04-06

The Epstein-Barr virus (EBV) genome encodes several hundred transcripts. We have used ribosome profiling to characterize viral translation in infected cells and map new translation initiation sites. We show here that EBV transcripts are translated with highly variable efficiency, owing to variable transcription and translation rates, variable ribosome recruitment to the leader region and coverage by monosomes versus polysomes. Some transcripts were hardly translated, others mainly carried monosomes, showed ribosome accumulation in leader regions and most likely represent non-coding RNAs. A similar process was visible for a subset of lytic genes including the key transactivators BZLF1 and BRLF1 in cells infected with weakly replicating EBV strains. This suggests that ribosome trapping, particularly in the leader region, represents a new checkpoint for the repression of lytic replication. We could identify 25 upstream open reading frames (uORFs) located upstream of coding transcripts that displayed 5' leader ribosome trapping, six of which were located in the leader region shared by many latent transcripts. These uORFs repressed viral translation and are likely to play an important role in the regulation of EBV translation.

Influence of Wastewater Discharge on the Metabolic Potential of the Microbial Community in River Sediments.

PubMed

Li, Dong; Sharp, Jonathan O; Drewes, Jörg E

2016-01-01

To reveal the variation of microbial community functions during water filtration process in river sediments, which has been utilized widely in natural water treatment systems, this study investigates the influence of municipal wastewater discharge to streams on the phylotype and metabolic potential of the microbiome in upstream and particularly various depths of downstream river sediments. Cluster analyses based on both microbial phylogenetic and functional data collectively revealed that shallow upstream sediments grouped with those from deeper subsurface downstream regions. These sediment samples were distinct from those found in shallow downstream sediments. Functional genes associated with carbohydrate, xenobiotic, and certain amino acid metabolisms were overrepresented in upstream and deep downstream samples. In contrast, the more immediate contact with wastewater discharge in shallow downstream samples resulted in an increase in the relative abundance of genes associated with nitrogen, sulfur, purine and pyrimidine metabolisms, as well as restriction-modification systems. More diverse bacterial phyla were associated with upstream and deep downstream sediments, mainly including Actinobacteria, Planctomycetes, and Firmicutes. In contrast, in shallow downstream sediments, genera affiliated with Betaproteobacteria and Gammaproteobacteria were enriched with putative functions that included ammonia and sulfur oxidation, polyphosphate accumulation, and methylotrophic bacteria. Collectively, these results highlight the enhanced capabilities of microbial communities residing in deeper stream sediments for the transformation of water contaminants and thus provide a foundation for better design of natural water treatment systems to further improve the removal of contaminants.

Investigation of the Impact of the Upstream Induction Zone on LIDAR Measurement Accuracy for Wind Turbine Control Applications using Large-Eddy Simulation

NASA Astrophysics Data System (ADS)

Simley, Eric; Y Pao, Lucy; Gebraad, Pieter; Churchfield, Matthew

2014-06-01

Several sources of error exist in lidar measurements for feedforward control of wind turbines including the ability to detect only radial velocities, spatial averaging, and wind evolution. This paper investigates another potential source of error: the upstream induction zone. The induction zone can directly affect lidar measurements and presents an opportunity for further decorrelation between upstream wind and the wind that interacts with the rotor. The impact of the induction zone is investigated using the combined CFD and aeroelastic code SOWFA. Lidar measurements are simulated upstream of a 5 MW turbine rotor and the true wind disturbances are found using a wind speed estimator and turbine outputs. Lidar performance in the absence of an induction zone is determined by simulating lidar measurements and the turbine response using the aeroelastic code FAST with wind inputs taken far upstream of the original turbine location in the SOWFA wind field. Results indicate that while measurement quality strongly depends on the amount of wind evolution, the induction zone has little effect. However, the optimal lidar preview distance and circular scan radius change slightly due to the presence of the induction zone.

67. DETAIL OF VIDEO CAMERA CONTROL PANEL LOCATED IMMEDIATELY WEST ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

67. DETAIL OF VIDEO CAMERA CONTROL PANEL LOCATED IMMEDIATELY WEST OF ASSISTANT LAUNCH CONDUCTOR PANEL SHOWN IN CA-133-1-A-66 - Vandenberg Air Force Base, Space Launch Complex 3, Launch Operations Building, Napa & Alden Roads, Lompoc, Santa Barbara County, CA

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

PubMed Central

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Predicting the Inflow Distortion Tone Noise of the NASA Glenn Advanced Noise Control Fan with a Combined Quadrupole-Dipole Model

NASA Technical Reports Server (NTRS)

Koch, L. Danielle

2012-01-01

A combined quadrupole-dipole model of fan inflow distortion tone noise has been extended to calculate tone sound power levels generated by obstructions arranged in circumferentially asymmetric locations upstream of a rotor. Trends in calculated sound power level agreed well with measurements from tests conducted in 2007 in the NASA Glenn Advanced Noise Control Fan. Calculated values of sound power levels radiated upstream were demonstrated to be sensitive to the accuracy of the modeled wakes from the cylindrical rods that were placed upstream of the fan to distort the inflow. Results indicate a continued need to obtain accurate aerodynamic predictions and measurements at the fan inlet plane as engineers work towards developing fan inflow distortion tone noise prediction tools.

Late Cenozoic Colorado River Incision and Implications for Neogene Uplift of the Colorado Rockies

NASA Astrophysics Data System (ADS)

Aslan, A.; Karlstrom, K. E.; Kirby, E.; Heizler, M. T.

2012-12-01

Basalt flows and volcanic ashes serve as a datum for calculating post-10 Ma river incision rates in western Colorado. The main picture that emerges from the data is one of regional variability of incision rates, which we hypothesize to reflect differential uplift of the Colorado Rockies during the Neogene. Maximum rates (90-180 m/Ma) and magnitudes (750-1500 m) of river incision are recorded between Grand Mesa and Glenwood Canyon, and in the Flat Tops. Minimum rates (<30 m/Ma) and magnitudes (<250 m) of river incision are associated post-Laramide normal faults within the Browns Park-Sand Wash basin in northwestern Colorado and in Middle Park of north-central Colorado. Differential uplift of the Colorado Rockies during the late Cenozoic can be inferred by comparing incision rates and magnitudes at locations upstream and downstream of knickzones. Along the Colorado River, post-10 Ma incision rates and magnitudes incision remain fairly constant (rates >100 m/Ma; magnitudes >1000 m) from Grand Mesa upstream to Gore Canyon, and then decrease markedly in Middle Park (rates <10 m/Ma; magnitudes <100 m) across the Gore Canyon knickzone. Normal-faulting of ca. 10 Ma deposits in Middle Park shows that incision rate variations partly reflect late Cenozoic faulting. Along the Yampa River, post-10 Ma incision rates and magnitudes are low (rates 15-27 m/Ma; magnitudes < 230 m) immediately upstream of Yampa Canyon, and then increase significantly (rates 96-132 m/Ma; magnitudes ~1250 m) upstream near the headwaters. We interpret this upstream increase in river incision rate and magnitude to reflect Neogene uplift of the Yampa River headwaters relative to its lower reaches. Lastly, differential late Cenozoic uplift of the Colorado Rockies is suggested by differences in the timing of regional exhumation and river incision within different drainage basins. Colorado River incision and regional exhumation occurred between 9.8 and 7.8 Ma. In contrast, Yampa River incision began between 8 and 6 Ma. Because incision in both the Colorado and Yampa River systems began prior to integration of the Colorado River through Grand Canyon, it is plausible that differences in the timing of river incision in the upper Colorado Basin are related to Neogene differential uplift. Assuming river incision and rock uplift magnitudes are subequal, flexural isostatic modeling suggests that isostatic adjustments account for only 33-50% of the post-10 Ma rock uplift recorded in western Colorado, and that there has been 0.75 to 1.0 km of post-10 Ma epeirogenic rock uplift. Areas with the largest magnitudes of post-10 Ma rock uplift generally overlie areas of basaltic magmatism and anomalously low mantle P-wave velocities. We support the hypothesis that mantle buoyancy has produced 0.75-1.0 km of Neogene uplift of the Colorado Rockies.

Survey of shock-wave structures of smooth-particle granular flows.

PubMed

Padgett, D A; Mazzoleni, A P; Faw, S D

2015-12-01

We show the effects of simulated supersonic granular flow made up of smooth particles passing over two prototypical bodies: a wedge and a disk. We describe a way of computationally identifying shock wave locations in granular flows and tabulate the shock wave locations for flow over wedges and disks. We quantify the shock structure in terms of oblique shock angle for wedge impediments and shock standoff distance for disk impediments. We vary granular flow parameters including upstream volume fraction, average upstream velocity, granular temperature, and the collision coefficient of restitution. Both wedges and disks have been used in the aerospace community as prototypical impediments to flowing air in order to investigate the fundamentally different shock structures emanating from sharp and blunt bodies, and we present these results in order to increase the understanding of the fundamental behavior of supersonic granular flow.

Spawning migration movements of Lost River and shortnose suckers in the Williamson and Sprague Rivers, Oregon, following the removal of Chiloquin Dam-2009 Annual Report

USGS Publications Warehouse

Ellsworth, Craig M.; VanderKooi, Scott P.

2011-01-01

The Chiloquin Dam was located at river kilometer (rkm) 1.3 on the Sprague River near the town of Chiloquin, Oregon. The dam was identified as a barrier that potentially inhibited or prevented the upstream spawning migrations and other movements of endangered Lost River suckers (Deltistes luxatus), shortnose suckers (Chasmistes brevirostris), and other fish in the Sprague River. Our research objectives in 2009 were to evaluate adult catostomid spawning migration patterns using radio telemetry to identify and describe shifts in spawning area distribution and migration behavior following the removal of Chiloquin Dam in 2008. We attached external radio transmitters to 58 Lost River suckers and 59 shortnose suckers captured at the Williamson River fish weir. A total of 17 radio-tagged Lost River suckers and one radio-tagged shortnose sucker were detected approaching the site of the former Chiloquin Dam but only two radio-tagged fish (one male Lost River sucker and one female Lost River sucker) were detected crossing upstream of the dam site. A lower proportion of radio-tagged shortnose suckers were detected migrating into the Sprague River when compared with previous years. Detections on remote passive integrated transponder (PIT) tag arrays located in the Sprague River show that although the proportion of fish coming into the Sprague River is small when compared to the number of fish crossing the Williamson River fish weir, the number of fish migrating upstream of the Chiloquin Dam site increased exponentially in the first year since its removal. These data will be used in conjunction with larval production and adult spawning distribution data to evaluate the effectiveness of dam removal in order to provide increased access to underutilized spawning habitat located further upstream in the Sprague River and to reduce the crowding of spawning fish below the dam site.

Spatial and temporal patterns of micropollutants in streams and effluent of 24 WWTPs across Switzerland

NASA Astrophysics Data System (ADS)

Schönenberger, Urs; Spycher, Barbara; Kistler, David; Burdon, Frank; Reyes, Marta; Eggen, Rik; Joss, Adriano; Singer, Heinz; Stamm, Christian

2016-04-01

Treated municipal wastewater is an important source of micropollutants entering the environment. Micropollutants are a diverse range of chemicals of which concentrations vary strongly in space and time. To better quantitatively understand the spatio-temporal patterns of micropollutants in streams, we compared upstream and downstream locations at 24 wastewater treatment plants (WWTPs) across the Swiss Plateau and Jura regions. Each site represents the most upstream treatment plant in the corresponding catchment. In 2013, a broad analytical screening was applied to samples collected at 12 sites during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 at 12 additional sites were analysed for a group of approximately 60 selected organic micropollutants. The screening results demonstrate that generally, pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest share of the organic micropollutants in wastewater. Pesticides including biocides and plant protection products are also regularly found, but at lower concentrations. The opposite holds true for the concentration variability: pesticides vary the most across time and space, while pharmaceuticals exhibit more stable concentrations. Heavy metals fluctuate to a similar degree as pharmaceuticals. Principal component analyses suggest that pesticide and pharmaceutical levels at both upstream locations and in the wastewater vary independently of each other. At the upstream locations, the pesticide levels increased with the proportion of arable land in the watershed, whilst decreasing with greater cover of pasture and forest. Interestingly, the same patterns hold true for the composition of wastewater when considering land use in the catchments of the WWTPs. This suggests that pesticide-intensive agricultural crops not only impact surface water quality via diffuse pollution but also increase levels of pesticides in wastewater discharged to the streams. As a consequence, catchment land uses and effluent composition appear to be inextricably bound.

Upstream movements of Atlantic Salmon in the Lower Penobscot River, Maine following two dam removals and fish passage modifications

USGS Publications Warehouse

Izzo, Lisa K.; Maynard, George A.; Zydlewski, Joseph D.

2016-01-01

The Penobscot River Restoration Project (PRRP), to be completed in 2016, involved an extensive plan of dam removal, increases in hydroelectric capacity, and fish passage modifications to increase habitat access for diadromous species. As part of the PRRP, Great Works and Veazie dams were removed, making Milford Dam the first impediment to federally endangered Atlantic Salmon Salmo salar. Upstream habitat access for Atlantic Salmon is dependent upon successful and timely passage at Milford Dam because nearly all suitable spawning habitat is located upstream. In 2014 and 2015, a total of 73 adult salmon were radio-tagged to track their upstream movements through the Penobscot River to assess potential delays at (1) the dam remnants, (2) the confluence of the Stillwater Branch and the main stem of the Penobscot River below the impassable Orono Dam, and (3) the Milford Dam fish lift (installed in 2014). Movement rates through the dam remnants and the Stillwater confluence were comparable to open river reaches. Passage efficiency of the fish lift was high in both years (95% and 100%). However, fish experienced long delays at Milford Dam, with approximately one-third of fish taking more than a week to pass in each year, well below the Federal Energy Regulatory Commission passage standard of 95% within 48 h. Telemetry indicates most fish locate the fishway entrance within 5 h of arrival and were observed at the entrance at all hours of the day. These data indicate that overall transit times through the lower river were comparable to reported movement rates prior to changes to the Penobscot River due to the substantial delays seen at Milford Dam. The results of this study show that while adult Atlantic Salmon locate the new fish lift entrance quickly, passage of these fish was significantly delayed under 2014–2015 operations.

Differential regulation of proximal and distal Vbeta segments upstream of a functional VDJbeta1 rearrangement upon beta-selection.

PubMed

Brady, Brenna L; Bassing, Craig H

2011-09-15

Developmental stage-specific regulation of transcriptional accessibility helps control V(D)J recombination. Vβ segments on unrearranged TCRβ alleles are accessible in CD4(-)/CD8(-) (double-negative [DN]) thymocytes, when they recombine, and inaccessible in CD4(+)/CD8(+) (double-positive [DP]) thymocytes, when they do not rearrange. Downregulation of Vβ accessibility on unrearranged alleles is linked with Lat-dependent β-selection signals that inhibit Vβ rearrangement, stimulate Ccnd3-driven proliferation, and promote DN-to-DP differentiation. Transcription and recombination of Vβs on VDJβ-rearranged alleles in DN cells has not been studied; Vβs upstream of functional VDJβ rearrangements have been found to remain accessible, yet not recombine, in DP cells. To elucidate contributions of β-selection signals in regulating Vβ transcription and recombination on VDJβ-rearranged alleles, we analyzed wild-type, Ccnd3(-/-), and Lat(-/-) mice containing a preassembled functional Vβ1DJCβ1 (Vβ1(NT)) gene. Vβ10 segments located just upstream of this VDJCβ1 gene were the predominant germline Vβs that rearranged in Vβ1(NT/NT) and Vβ1(NT/NT)Ccnd3(-/-) thymocytes, whereas Vβ4 and Vβ16 segments located further upstream rearranged at similar levels as Vβ10 in Vβ1(NT/NT)Lat(-/-) DN cells. We previously showed that Vβ4 and Vβ16, but not Vβ10, are transcribed on Vβ1(NT) alleles in DP thymocytes; we now demonstrate that Vβ4, Vβ16, and Vβ10 are transcribed at similar levels in Vβ1(NT/NT)Lat(-/-) DN cells. These observations indicate that suppression of Vβ rearrangements is not dependent on Ccnd3-driven proliferation, and DN residence can influence the repertoire of Vβs that recombine on alleles containing an assembled VDJCβ1 gene. Our findings also reveal that β-selection can differentially silence rearrangement of germline Vβ segments located proximal and distal to functional VDJβ genes.

Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

1987-11-01

To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells.more » However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.« less

Short interspersed elements (SINEs) from insectivores. Two classes of mammalian SINEs distinguished by A-rich tail structure.

PubMed

Borodulina, O R; Kramerov, D A

2001-10-01

Four tRNA-related SINE families were isolated from the genome of the shrew Sorex araneus (SOR element), mole Mogera robusta (TAL element), and hedgehog Mesechinus dauuricus (ERI-1 and ERI-2 elements). Each of these SINEs families is specific for a single Insectivora family: SOR, for Soricidae (shrews); TAL, for Talpidae (moles and desmans); ERI-1 and ERI-2, for Erinaceidae (hedgehogs). There is a long polypyrimidine region (TC-motif) in TAL, ERI-1, and ERI-2 elements located immediately upstream of an A-rich tail with polyadenylation signals (AATAAA) and an RNA polymerase III terminator (T(4-6)) or TCT(3-4)). Ten out of 14 analyzed mammalian tRNA-related SINE families have an A-rich tail similar to that of TAL, ERI-1, and ERI-2 elements. These elements were assigned to class T+. The other four SINEs including SOR element have no polyadenylation signal and transcription terminator in their A-rich tail and were assigned to class T-. Class T+ SINEs occur only in mammals, and most of them have a long polypyrimidine region. Possible models of retroposition of class T+ and T- SINEs are discussed.

Dominant integration locus drives continuous diversification of plant immune receptors with exogenous domain fusions.

PubMed

Bailey, Paul C; Schudoma, Christian; Jackson, William; Baggs, Erin; Dagdas, Gulay; Haerty, Wilfried; Moscou, Matthew; Krasileva, Ksenia V

2018-02-19

The plant immune system is innate and encoded in the germline. Using it efficiently, plants are capable of recognizing a diverse range of rapidly evolving pathogens. A recently described phenomenon shows that plant immune receptors are able to recognize pathogen effectors through the acquisition of exogenous protein domains from other plant genes. We show that plant immune receptors with integrated domains are distributed unevenly across their phylogeny in grasses. Using phylogenetic analysis, we uncover a major integration clade, whose members underwent repeated independent integration events producing diverse fusions. This clade is ancestral in grasses with members often found on syntenic chromosomes. Analyses of these fusion events reveals that homologous receptors can be fused to diverse domains. Furthermore, we discover a 43 amino acid long motif associated with this dominant integration clade which is located immediately upstream of the fusion site. Sequence analysis reveals that DNA transposition and/or ectopic recombination are the most likely mechanisms of formation for nucleotide binding leucine rich repeat proteins with integrated domains. The identification of this subclass of plant immune receptors that is naturally adapted to new domain integration will inform biotechnological approaches for generating synthetic receptors with novel pathogen "baits."

Proton and Electron Threshold Energy Measurements for Extravehicular Activity Space Suits. Chapter 2

NASA Technical Reports Server (NTRS)

Moyers, M. F.; Nelson, G. D.; Saganti, P. B.

2003-01-01

Construction of ISS will require more than 1000 hours of EVA. Outside of ISS during EVA, astronauts and cosmonauts are likely to be exposed to a large fluence of electrons and protons. Development of radiation protection guidelines requires the determination of the minimum energy of electrons and protons that penetrate the suits at various locations. Measurements of the water-equivalent thickness of both US. and Russian EVA suits were obtained by performing CT scans. Specific regions of interest of the suits were further evaluated using a differential range shift technique. This technique involved measuring thickness ionization curves for 6-MeV electron and 155-MeV proton beams with ionization chambers using a constant source-to-detector distance. The thicknesses were obtained by stacking polystyrene slabs immediately upstream of the detector. The thicknesses of the 50% ionizations relative to the maximum ionizations were determined. The detectors were then placed within the suit and the stack thickness adjusted until the 50% ionization was reestablished. The difference in thickness between the 50% thicknesses was then used with standard range-energy tables to determine the threshold energy for penetration. This report provides a detailed description of the experimental arrangement and results.

Dissolved pesticide concentrations detected in storm-water runoff at selected sites in the San Joaquin River basin, California, 2000-2001

USGS Publications Warehouse

Orlando, James L.; Kuivila, Kathryn; Whitehead, Andrew

2003-01-01

As part of a collaborative study involving the United States Geological Survey Toxics Substances Hydrology Project (Toxics Project) and the University of California, Davis, Bodega Marine Laboratory (BML), water samples were collected at three sites within the San Joaquin River Basin of California and analyzed for dissolved pesticides. Samples were collected during, and immediately after, the first significant rainfall (greater than 0.5 inch per day) following the local application of dormant spray, organophosphate insecticides during the winters of 2000 and 2001. All samples were collected in conjunction with fish-caging experiments conducted by BML researchers. Sites included two locations potentially affected by runoff of agricultural chemicals (San Joaquin River near Vernalis, California, and Orestimba Creek at River Road near Crows Landing, California, and one control site located upstream of pesticide input (Orestimba Creek at Orestimba Creek Road near Newman, California). During these experiments, fish were placed in cages and exposed to storm runoff for up to ten days. Following exposure, the fish were examined for acetylcholinesterase concentrations and overall genetic damage. Water samples were collected throughout the rising limb of the stream hydrograph at each site for later pesticide analysis. Concentrations of selected pesticides were measured in filtered water samples using solid-phase extraction (SPE) and gas chromatography-mass spectrometry (GC/MS) at the U.S. Geological Survey organic chemistry laboratory in Sacramento, California. Results of these analyses are presented.

Evidence of a sewer vapor transport pathway at the USEPA ...

EPA Pesticide Factsheets

The role of sewer lines as preferential pathways for vapor intrusion is poorly understood. Although the importance of sewer lines for volatile organic compound (VOC) transport has been documented at a small number of sites with vapor intrusion, sewer lines are not routinely sampled during most vapor intrusion investigations. We have used a tracer study and VOC concentration measurements to evaluate the role of the combined sanitary/storm sewer line in VOC transport at the USEPA vapor intrusion research duplex in Indianapolis, Indiana. The results from the tracer study demonstrated gas migration from the sewer main line into the duplex. The migration pathway appears to be complex and may include leakage from the sewer lateral at a location below the building foundation. Vapor samples collected from the sewer line demonstrated the presence of tetrachloroethene (PCE) and chloroform in the sewer main in front of the duplex and at multiple sample locations within the sewer line upstream of the duplex. These test results combined with results from the prior multi-year study of the duplex indicate that the sewer line plays an important role in transport of VOCs from the subsurface source to the immediate vicinity of the duplex building envelope. Highlights • The sewer line is an important pathway for VOC transport at the USEPA duplex. • The importance of this pathway was not identified during prior study of the duplex. • Sewer lines should be routinely evaluated

13. A CLOSEUP VIEW FROM THE SAME LOCATION AS THE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

13. A CLOSE-UP VIEW FROM THE SAME LOCATION AS THE PREVIOUS PHOTO, LOOKING EAST, OF THE CENTRAL PIER AND THE UNDERSIDE OF THE BRIDGE. BOTH THE NORTH AND THE SOUTH SHEARWATERS ARE VISIBLE, SHOWING THE SLIGHTLY LARGER PROFILE OF THE UPSTREAM PIER. - Putnam County Bridge No. 111, Spanning Little Walnut Creek on County Road 50, Greencastle, Putnam County, IN

Odor-conditioned rheotaxis of the sea lamprey: modeling, analysis and validation

USGS Publications Warehouse

Choi, Jongeun; Jean, Soo; Johnson, Nicholas S.; Brant, Cory O.; Li, Weiming

2013-01-01

Mechanisms for orienting toward and locating an odor source are sought in both biology and engineering. Chemical ecology studies have demonstrated that adult female sea lamprey show rheotaxis in response to a male pheromone with dichotomous outcomes: sexually mature females locate the source of the pheromone whereas immature females swim by the source and continue moving upstream. Here we introduce a simple switching mechanism modeled after odor-conditioned rheotaxis for the sea lamprey as they search for the source of a pheromone in a one-dimensional riverine environment. In this strategy, the females move upstream only if they detect that the pheromone concentration is higher than a threshold value and drifts down (by turning off control action to save energy) otherwise. In addition, we propose various uncertainty models such as measurement noise, actuator disturbance, and a probabilistic model of a concentration field in turbulent flow. Based on the proposed model with uncertainties, a convergence analysis showed that with this simplistic switching mechanism, the lamprey converges to the source location on average in spite of all such uncertainties. Furthermore, a slightly modified model and its extensive simulation results explain the behaviors of immature female lamprey near the source location.

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

PubMed

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Preliminary Feasibility and Risk Analysis of a Carbon Dioxide Barrier at Brandon Road Lock and Dam

DTIC Science & Technology

2017-09-01

designed bubble plume must be maintained. Wuest and Lorke (2003) describe this as natural (i.e., wind induced) turbulent mixing in lakes. Their study is...elevated CO2 concentrations in areas sheltered from wind and wave action (much like the approach channel and immediately upstream of the lock chamber) may...or kill them. As part of the development of fish barriers to prevent entrainment of fish into a pump turbine hydropower system, Nestler et al

Buffalo Metropolitan Area, New York Water Resources Management. Feasibility of Comprehensive Water and Related Land Management.

DTIC Science & Technology

1975-12-01

of these is the Lake Plain, a relatively flat and fertile agricultural belt which is wide in the northern portion of the region but narrow in the south...acres, occurs only during large flood events. Evidence of this can be seen in numerous highway relocations where secondary roads follow stream courses...obstructions of flow caused by fallen trees and shrub and tree growth encroaching on the high water stream channel can be seen immediately upstream of the

Interim Report on Feasibility of Improving Recreation Access and Related Water and Land Management in the Buffalo Metropolitan Area, New York.

DTIC Science & Technology

1979-04-01

Buffalo Metropolitan Study Area. One of these is the Lake Plain, a relatively flat and fertile agricultural belt which is wide in the northern portion of...events. Evidence of this can be seen in numerous highway relocations where secondary roads follow stream courses closely. A field reconnaissance was made...shrub and tree growth encroaching on the high water stream channel can be seen immediately upstream of the eroding area. The SCS has provided technical

78 FR 52694 - Drawbridge Operation Regulation; Trent River, New Bern, NC

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-26

... several times every day for recreational vessels transiting to and from the local marinas located upstream. Although openings occur throughout the day, the morning hours have the fewest vessel transits. Vessels able...

34. VIEW OF THREE MONITORS LOCATED IMMEDIATELY WEST OF THOSE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

34. VIEW OF THREE MONITORS LOCATED IMMEDIATELY WEST OF THOSE IN PHOTO A-33. TELEPHONE BELOW THE CENTER MONITOR IS LABLED 'ACCIDENT REPORTING EMERGENCY NOTIFICATION SYSTEM ONLY.' - Vandenberg Air Force Base, Space Launch Complex 3, Launch Operations Building, Napa & Alden Roads, Lompoc, Santa Barbara County, CA

Exhaust emission control and diagnostics

DOEpatents

Mazur, Christopher John; Upadhyay, Devesh

2006-11-14

A diesel engine emission control system uses an upstream oxidation catalyst and a downstream SCR catalyst to reduce NOx in a lean exhaust gas environment. The engine and upstream oxidation catalyst are configured to provide approximately a 1:1 ratio of NO to NO2 entering the downstream catalyst. In this way, the downstream catalyst is insensitive to sulfur contamination, and also has improved overall catalyst NOx conversion efficiency. Degradation of the system is determined when the ratio provided is no longer near the desired 1:1 ratio. This condition is detected using measurements of engine operating conditions such as from a NOx sensor located downstream of the catalysts. Finally, control action to adjust an injected amount of reductant in the exhaust gas based on the actual NO to NO2 ratio upstream of the SCR catalyst and downstream of the oxidation catalyst.

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Biological assessment of aquaculture effects on effluent-receiving streams in Ghana using structural and functional composition of fish and macroinvertebrate assemblages.

PubMed

Ansah, Yaw Boamah; Frimpong, Emmanuel A; Amisah, Stephen

2012-07-01

Biological assessment of aquatic ecosystems is widely employed as an alternative or complement to chemical and toxicity testing due to numerous advantages of using biota to determine ecosystem condition. These advantages, especially to developing countries, include the relatively low cost and technical requirements. This study was conducted to determine the biological impacts of aquaculture operations on effluent-receiving streams in the Ashanti Region of Ghana. We collected water, fish and benthic macroinvertebrate samples from 12 aquaculture effluent-receiving streams upstream and downstream of fish farms and 12 reference streams between May and August of 2009, and then calculated structural and functional metrics for biotic assemblages. Fish species with non-guarding mode of reproduction were more abundant in reference streams than downstream (P = 0.0214) and upstream (P = 0.0251), and sand-detritus spawning fish were less predominant in reference stream than upstream (P = 0.0222) and marginally less in downstream locations (P = 0.0539). A possible subsidy-stress response of macroinvertebrate family richness and abundance was also observed, with nutrient (nitrogen) augmentation from aquaculture and other farming activities likely. Generally, there were no, or only marginal differences among locations downstream and upstream of fish farms and in reference streams in terms of several other biotic metrics considered. Therefore, the scale of impact in the future will depend not only on the management of nutrient augmentation from pond effluents, but also on the consideration of nutrient discharges from other industries like fruit and vegetable farming within the study area.

Ambient conditions and fate and transport simulations of dissolved solids, chloride, and sulfate in Beaver Lake, Arkansas, 2006--10

USGS Publications Warehouse

Green, W. Reed

2013-01-01

Beaver Lake is a large, deep-storage reservoir located in the upper White River Basin in northwestern Arkansas, and was completed in 1963 for the purposes of flood control, hydroelectric power, and water supply. Beaver Lake is affected by point and nonpoint sources of minerals, nutrients, and sediments. The City of Fayetteville discharges about half of its sewage effluent into the White River immediately upstream from the backwater of the reservoir. The City of West Fork discharges its sewage effluent into the West Fork of the White River, and the City of Huntsville discharges its sewage effluent into a tributary of War Eagle Creek. A study was conducted to describe the ambient conditions and fate and transport of dissolved solids, chloride, and sulfate concentrations in Beaver Lake. Dissolved solids, chloride, and sulfate are components of wastewater discharged into Beaver Lake and a major concern of the drinking water utilities that use Beaver Lake as their source. A two-dimensional model of hydrodynamics and water quality was calibrated to include simulations of dissolved solids, chloride, and sulfate for the period January 2006 through December 2010. Estimated daily dissolved solids, chloride, and sulfate loads were increased in the White River and War Eagle Creek tributaries, individually and the two tributaries together, by 1.2, 1.5, 2.0, 5.0, and 10.0 times the baseline conditions to examine fate and transport of these constituents through time at seven locations (segments) in the reservoir, from upstream to downstream in Beaver Lake. Fifteen dissolved solids, chloride, and sulfate fate and transport scenarios were compared to the baseline simulation at each of the seven downstream locations in the reservoir, both 2 meters (m) below the surface and 2 m above the bottom. Concentrations were greater in the reservoir at model segments closer to where the tributaries entered the reservoir. Concentrations resulting from the increase in loading became more diluted farther downstream from the source. Differences in concentrations between the baseline condition and the 1.2, 1.5, and 2.0 times baseline concentration scenarios were smaller than the differences in the 5.0 and 10.0 times baseline concentration scenarios. The results for both the 2 m below the surface and 2 m above the bottom were similar, with the exception of concentrations resulting from the increased loading factors (5.0 and 10.0 times), where concentrations 2 m above the bottom were consistently greater than those 2 m below the surface at most segments.

Questa baseline and premining ground-water quality investigation. 8. Lake-sediment geochemical record from 1960 to 2002, Eagle Rock and Fawn Lakes, Taos County, New Mexico

USGS Publications Warehouse

Church, S.E.; Fey, D.L.; Marot, M.E.

2005-01-01

Geochemical studies of lake sediment from Eagle Rock Lake and upper Fawn Lake were conducted to evaluate the effect of mining at the Molycorp Questa porphyry molybdenum deposit located immediately north of the Red River. Two cores were taken, one from each lake near the outlet where the sediment was thinnest, and they were sampled at 1-cm intervals to provide geochemical data at less than 1-year resolution. Samples from the core intervals were digested and analyzed for 34 elements using ICP-AES (inductively coupled plasma-atomic emission spectrometry). The activity of 137Cs has been used to establish the beginning of sedimentation in the two lakes. Correlation of the geochemistry of heavy-mineral suites in the cores from both Fawn and Eagle Rock Lakes has been used to develop a sedimentation model to date the intervals sampled. The core from upper Fawn Lake, located upstream of the deposit, provided an annual sedimentary record of the geochemical baseline for material being transported in the Red River, whereas the core from Eagle Rock Lake, located downstream of the deposit, provided an annual record of the effect of mining at the Questa mine on the sediment in the Red River. Abrupt changes in the concentrations of many lithophile and deposit-related metals occur in the middle of the Eagle Rock Lake core, which we correlate with the major flood-of-record recorded at the Questa gage at Eagle Rock Lake in 1979. Sediment from the Red River collected at low flow in 2002 is a poor match for the geochemical data from the sediment core in Eagle Rock Lake. The change in sediment geochemistry in Eagle Rock Lake in the post-1979 interval is dramatic and requires that a new source of sediment be identified that has substantially different geochemistry from that in the pre-1979 core interval. Loss of mill tailings from pipeline breaks are most likely responsible for some of the spikes in trace-element concentrations in the Eagle Rock Lake core. Enrichment of Al2O3, Cu, and Zn occurred as a result of chemical precipitation of these metals from ground water upstream in the Red River. Comparisons of the geochemistry of the post-1979 sediment core with both mine wastes and with premining sediment from the vicinity of the Questa mine indicate that both are possible sources for this new component of sediment. Existing data have not resolved this enigma.

The katG mRNA of Mycobacterium tuberculosis and Mycobacterium smegmatis is processed at its 5' end and is stabilized by both a polypurine sequence and translation initiation

PubMed Central

Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela

2008-01-01

Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are shown to contribute to mRNA stability. The furA-katG mRNA is transcribed from the furA promoter and immediately processed; this processing is prevented by a double stranded RNA at the cutting site, suggesting that the endoribonuclease responsible for the cleavage cuts single stranded RNA. PMID:18394163

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Evaluating the effects of check dams on channel geometry, bed sediment size and riparian vegetation in Mediterranean mountain torrents.

PubMed

Zema, Demetrio Antonio; Bombino, Giuseppe; Denisi, Pietro; Lucas-Borja, Manuel Esteban; Zimbone, Santo Marcello

2018-06-12

In mountain streams possible negative impacts of check dams on soil, water and riparian vegetation due to check dam installation can be noticed. In spite of the ample literature on the qualitative effects of engineering works on channel hydrology, morphology, sedimentary effects and riparian vegetation characteristics, quantitative evaluations of the changes induced by check dams on headwater characteristics are rare. In order to fill this gap, this study has evaluated the effects of check dams located in headwaters of Calabria (Southern Italy) on hydrological and geomorphological processes and on the response of riparian vegetation to these actions. The analysis has compared physical and vegetation indicators in transects identified around check dams (upstream and downstream) and far from their direct influence (control transects). Check dams were found to influence significantly unit discharge, surface and subsurface sediments (both upstream and downstream), channel shape and transverse distribution of riparian vegetation (upstream) as well as cover and structure of riparian complexes (downstream). The actions of the structures on torrent longitudinal slope and biodiversity of vegetation were less significant. The differences on bed profile slope were significant only between upstream and downstream transects. The results of the Agglomerative Hierarchical Cluster analysis confirmed the substantial similarity between upstream and control transects, thus highlighting that the construction of check dams, needed to mitigate the hydro-geological risks, has not strongly influenced the torrent functioning and ecology before check dam construction. Moreover, simple and quantitative linkages between torrent hydraulics, geomorphology and vegetation characteristics exist in the analysed headwaters; these relationships among physical adjustments of channels and most of the resulting characteristics of the riparian vegetation are specific for the transect locations with respect of check dams. Conversely, the biodiversity of the riparian vegetation basically eludes any quantitative relations with the physical and other vegetal characteristics of the torrent transects. Copyright © 2018 Elsevier B.V. All rights reserved.

Novel mechanism of JNK pathway activation by adenoviral E1A

PubMed Central

Morrison, Helen; Pospelova, Tatiana V.; Pospelov, Valery A.; Herrlich, Peter

2014-01-01

The adenoviral oncoprotein E1A influences cellular regulation by interacting with a number of cellular proteins. In collaboration with complementary oncogenes, E1A fully transforms primary cells. As part of this action, E1A inhibits transcription of c-Jun:Fos target genes while promoting that of c-Jun:ATF2-dependent genes including jun. Both c-Jun and ATF2 are hyperphosphorylated in response to E1A. In the current study, E1A was fused with the ligand binding domain of the estrogen receptor (E1A-ER) to monitor the immediate effect of E1A activation. With this approach we now show that E1A activates c-Jun N-terminal kinase (JNK), the upstream kinases MKK4 and MKK7, as well as the small GTPase Rac1. Activation of the JNK pathway requires the N-terminal domain of E1A, and, importantly, is independent of transcription. In addition, it requires the presence of ERM proteins. Downregulation of signaling components upstream of JNK inhibits E1A-dependent JNK/c-Jun activation. Taking these findings together, we show that E1A activates the JNK/c-Jun signaling pathway upstream of Rac1 in a transcription-independent manner, demonstrating a novel mechanism of E1A action. PMID:24742962

Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus.

PubMed

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P

2006-05-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with D-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. D-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating D-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na(+) and moderate concentrations of Mg(2+) and Ca(2+) but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg(2+)-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg(2+)-induced repression of the dlt operon in S. aureus.

Cation-Induced Transcriptional Regulation of the dlt Operon of Staphylococcus aureus

PubMed Central

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P.

2006-01-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with d-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. d-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating d-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na+ and moderate concentrations of Mg2+ and Ca2+ but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg2+-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg2+-induced repression of the dlt operon in S. aureus. PMID:16672616

The possible influence of upstream upper-level baroclinic processes on the development of the QE II storm

NASA Technical Reports Server (NTRS)

Uccellini, L. W.

1986-01-01

An analysis of the QE II storm of September 9-11, 1978 presents evidence for the existence of upper-level baroclinic processes upstream of the rapidly developing cyclone. The analysis shows that a deepening shortwave trough was located 400 to 500 km upstream of the site of the storm 12 h prior to rapid cyclogenesis. The trough was associated with: (1) a polar jet marked by 65 m/s winds in its core and significant vertical and horizontal wind shear, (2) positive vorticity advection and divergence at the 300 mb level, and (3) an intense frontal zone that extended from 300 mb down to the surface. It also appears that a tropopause fold likely extruded stratospheric air down to the 700-800 mb level, 400-500 km upstream of the surface low and 12 h prior to the explosive development phase of the cyclone. These findings raise questions about Gyakum's (1983) assertion that the QE II storm developed in an area in which the baroclinic support was confined to the lower troposphere and the related assertion by Anthes et al. (1983) that upper-level forcing upstream of the area of rapid cyclogenesis was weak and apparently not important in this case.

A rare case of 46, XX SRY-negative male with approximately 74-kb duplication in a region upstream of SOX9.

PubMed

Xiao, Bing; Ji, Xing; Xing, Ya; Chen, Ying-Wei; Tao, Jiong

2013-12-01

The 46, XX male disorder of sex development (DSD) is a rare genetic condition. Here, we report the case of a 46, XX SRY-negative male with complete masculinization. The coding region and exon/intron boundaries of the DAX1, SOX9 and RSPO1 genes were sequenced, and no mutations were detected. Using whole genome array analysis and real-time PCR, we identified a approximately 74-kb duplication in a region approximately 510-584 kb upstream of SOX9 (chr17:69,533,305-69,606,825, hg19). Combined with the results of previous studies, the minimum critical region associated with gonadal development is a 67-kb region located 584-517 kb upstream of SOX9. The amplification of this region might lead to SOX9 overexpression, causing female-to-male sex reversal. Gonadal-specific enhancers in the region upstream of SOX9 may activate the SOX9 expression through long-range regulation, thus triggering testicular differentiation. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Synchronized flow in oversaturated city traffic.

PubMed

Kerner, Boris S; Klenov, Sergey L; Hermanns, Gerhard; Hemmerle, Peter; Rehborn, Hubert; Schreckenberg, Michael

2013-11-01

Based on numerical simulations with a stochastic three-phase traffic flow model, we reveal that moving queues (moving jams) in oversaturated city traffic dissolve at some distance upstream of the traffic signal while transforming into synchronized flow. It is found that, as in highway traffic [Kerner, Phys. Rev. E 85, 036110 (2012)], such a jam-absorption effect in city traffic is explained by a strong driver's speed adaptation: Time headways (space gaps) between vehicles increase upstream of a moving queue (moving jam), resulting in moving queue dissolution. It turns out that at given traffic signal parameters, the stronger the speed adaptation effect, the shorter the mean distance between the signal location and the road location at which moving queues dissolve fully and oversaturated traffic consists of synchronized flow only. A comparison of the synchronized flow in city traffic found in this Brief Report with synchronized flow in highway traffic is made.

Separated Flow over Wind Turbines

NASA Astrophysics Data System (ADS)

Brown, David; Lewalle, Jacques

2015-11-01

The motion of the separation point on an airfoil under unsteady flow can affect its performance and longevity. Of interest is to understand and control the performance decrease in wind turbines subject to turbulent flow. We examine flow separation on an airfoil at a 19 degree angle of attack under unsteady flow conditions. We are using a DU-96-W180 airfoil of chord length 242 mm. The unsteadiness is generated by a cylinder with diameter 203 mm located 7 diameters upstream of the airfoil's leading edge. The data comes from twenty surface pressure sensors located on the top and bottom of the airfoil as well as on the upstream cylinder. Methods of analysis include Mexican hat transforms, Morlet wavelet transforms, power spectra, and various cross correlations. With this study I will explore how the differences of signals on the pressure and suction sides of an airfoil are related to the motion of the separation point.

Mercury accumulation in biota of Thunder Creek, Saskatchewan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munro, D.J.; Gummer, W.D.

Collection of biological organisms was undertaken to investigate the bioaccumulation of mercury in the food chain, the results of which are reported. Two sites were selected on Thunder Creek; the control or background site, site number 2, is located approximately 2.5 km upstream, from site number 1. The selection of organisms for analysis was based on the presence and abundance of each at both locations. Only crayfish (Orconcetes virilis) pearl dace (Semotilus margarita) and brook stickleback (Culaea inconstans) were found to be sufficiently abundant. The importance of the data obtained is the significant difference in concentration between the upstream andmore » downstream sites on Thunder Creek. This difference shows that more mercury is available to the biological community at site number 1 than at site number 2 confirming that mercury in the contaminated sediments is being methylated and taken up into the food chain.« less

Magnetic resonance imaging of living systems by remote detection

DOEpatents

Wemmer, David; Pines, Alexander; Bouchard, Louis; Xu, Shoujun; Harel, Elad; Budker, Dmitry; Lowery, Thomas; Ledbetter, Micah

2013-10-29

A novel approach to magnetic resonance imaging is disclosed. Blood flowing through a living system is prepolarized, and then encoded. The polarization can be achieved using permanent or superconducting magnets. The polarization may be carried out upstream of the region to be encoded or at the place of encoding. In the case of an MRI of a brain, polarization of flowing blood can be effected by placing a magnet over a section of the body such as the heart upstream of the head. Alternatively, polarization and encoding can be effected at the same location. Detection occurs at a remote location, using a separate detection device such as an optical atomic magnetometer, or an inductive Faraday coil. The detector may be placed on the surface of the skin next to a blood vessel such as a jugular vein carrying blood away from the encoded region.

Synchronized flow in oversaturated city traffic

NASA Astrophysics Data System (ADS)

Kerner, Boris S.; Klenov, Sergey L.; Hermanns, Gerhard; Hemmerle, Peter; Rehborn, Hubert; Schreckenberg, Michael

2013-11-01

Based on numerical simulations with a stochastic three-phase traffic flow model, we reveal that moving queues (moving jams) in oversaturated city traffic dissolve at some distance upstream of the traffic signal while transforming into synchronized flow. It is found that, as in highway traffic [Kerner, Phys. Rev. EPLEEE81539-375510.1103/PhysRevE.85.036110 85, 036110 (2012)], such a jam-absorption effect in city traffic is explained by a strong driver's speed adaptation: Time headways (space gaps) between vehicles increase upstream of a moving queue (moving jam), resulting in moving queue dissolution. It turns out that at given traffic signal parameters, the stronger the speed adaptation effect, the shorter the mean distance between the signal location and the road location at which moving queues dissolve fully and oversaturated traffic consists of synchronized flow only. A comparison of the synchronized flow in city traffic found in this Brief Report with synchronized flow in highway traffic is made.

A speed limit compliance model for dynamic speed display sign.

PubMed

Ardeshiri, Anam; Jeihani, Mansoureh

2014-12-01

Violating speed limits is a major cause of motor vehicle crashes. Various techniques have been adopted to ensure that posted speed limits are obeyed by drivers. This study investigates the effect of dynamic speed display signs (DSDSs) on drivers' compliance with posted speed limit. An extensive speed data collection upstream of, adjacent to, and downstream of DSDS locations on multiple road classes with different speed limits (25, 35, and 45 mph) was performed short-term and long-term after DSDS installation. Conventional statistical analysis, regression models, and a Bayesian network were developed to assess the DSDS's effectiveness. General compliance with speed limit (upstream of the DSDS location), time of day, day of week, duration of DSDS operation, and distance from the DSDS location were significantly correlated with speed limit compliance adjacent to the DSDS. While compliance with the speed limit due to the DSDS increased by 5%, speed reduction occurred in 40% of the cases. Since drivers were likely to increase their speed after passing the DSDS, it should be installed on critical points supplemented with enforcement. Copyright © 2014 Elsevier Ltd. All rights reserved.

Modelling the detachment dependence on strike point location in the small angle slot divertor (SAS) with SOLPS

NASA Astrophysics Data System (ADS)

Casali, Livia; Covele, Brent; Guo, Houyang

2017-10-01

The new Small Angle Slot (SAS) divertor in DIII-D is characterized by a shallow-angle target enclosed by a slot structure about the strike point (SP). SOLPS modelling results of SAS have demonstrated divertor closure's utility in widening the range of acceptable densities for adequate heat handling. An extensive database of runs has been built to study the detachment dependence on SP location in SAS. Density scans show that lower Te at lower upstream density occur when the SP is at the critical location in the slot. The cooling front spreads across the entire target at higher densities, in agreement with experimental Langmuir probe measurements. A localized increase of the atomic and molecular density takes place near the SP, which reduces the target incident power density and facilitates detachment at lower upstream density. Systematic scans of variables such as power, transport, and viscosity have been carried out to assess the detachment sensitivity. Therein, a positive role of the viscosity is found. This work supported by DOE Contract Number DE-FC02-04ER54698.

Body morphology differs in wild juvenile Chinook salmon Oncorhynchus tshawytscha in the Willamette River, Oregon, USA

USGS Publications Warehouse

Billman, E.J.; Whitman, L.D.; Schroeder, R.K.; Sharpe, C.S.; Noakes, David L. G.; Schreck, Carl B.

2014-01-01

Body morphology of juvenile Chinook salmon Oncorhynchus tshawytscha in the upper Willamette River, Oregon, U.S.A., was analysed to determine if variation in body shape is correlated with migratory life-history tactics followed by juveniles. Body shape was compared between migrating juveniles that expressed different life-history tactics, i.e. autumn migrants and yearling smolts, and among parr sampled at three sites along a longitudinal river gradient. In the upper Willamette River, the expression of life-history tactics is associated with where juveniles rear in the basin with fish rearing in downstream locations generally completing ocean ward migrations earlier in life than fish rearing in upstream locations. The morphological differences that were apparent between autumn migrants and yearling smolts were similar to differences between parr rearing in downstream and upstream reaches, indicating that body morphology is correlated with life-history tactics. Autumn migrants and parr from downstream sampling sites had deeper bodies, shorter heads and deeper caudal peduncles compared with yearling smolts and parr from the upstream sampling site. This study did not distinguish between genetic and environmental effects on morphology; however, the results suggest that downstream movement of juveniles soon after emergence is associated with differentiation in morphology and with the expression of life-history variation.

Geomorphic Effects of Boulder Placement on Gravel Capture and Retention in a Regulated Reach of the North Umpqua River, OR.

NASA Astrophysics Data System (ADS)

Stallman, J.; Braudrick, C.; Pedersen, D.; Cui, Y.; Sklar, L.; Dietrich, B.; Real de Asua, R.

2004-12-01

Hydroelectric projects in the mountainous western Cascades often occur in steep, confined channels where salmonid spawning habitat is limited to gravel deposits forced by planform curvature, channel width changes, and flow separation associated with large bedrock and boulder obstructions. The paucity of gravel deposition in steepland channels may be exacerbated in regulated rivers where sediment trapping by impoundments reduces coarse sediment supply to downstream reaches. Placing boulders to capture and retain gravel may be an effective approach to enhancing spawning habitat in these settings. To better understand the potential use of boulders as a tool for enhancing spawning habitat, three experimental designs were tested in a 0.6-mile bypass reach of the North Umpqua River, OR. The bedrock-confined study reach has an average slope of 0.013 and plane-bed morphology with coarse cobble substrate, abundant marginal boulders, and small associated patches of sand and gravel. Experiments involved (1) placement of boulder clusters, (2) gravel augmentation and placement of boulder clusters, and (3) gravel augmentation alone. Boulder clusters were designed to promote scour and deposition during floods with a 5-10 year recurrence interval. Boulders were typically placed obliquely upstream at locations where existing hydraulics favored gravel deposition. Monitoring from 2002 to 2004 occurred prior to implementation, immediately following implementation, and following winter high flows. Sites were monitored using high-density topographic surveys, low-altitude aerial photography, facies mapping, pebble counts, scour cores and chains, and marked rocks. Stage heights were monitored using pressure transducers at the upstream and downstream ends of the study reach, and flood recurrence interval was assessed using a nearby USGS gauge. The arrangement of boulder clusters was modified after the first year of monitoring to improve gravel capture and retention. Peak flow during the two-year monitoring period had a recurrence interval of less than 1.5 years. Flows were insufficient to mobilize the bed as a whole, but did adjust bed surface texture and topography adjacent to boulder accumulations. Select sites captured and retained modest amounts of gravel even at the relatively low peaks experienced during 2003 and 2004. The effects of increasing coarse sediment supply will be tested in 2005 through the introduction of a large gravel pulse at the upstream end of the study reach.

X-Prolyl Dipeptidyl Aminopeptidase Gene (pepX) Is Part of the glnRA Operon in Lactobacillus rhamnosus

PubMed Central

Varmanen, Pekka; Savijoki, Kirsi; Åvall, Silja; Palva, Airi; Tynkkynen, Soile

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate l-glycyl-l-prolyl-β-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks. PMID:10613874

X-prolyl dipeptidyl aminopeptidase gene (pepX) is part of the glnRA operon in Lactobacillus rhamnosus.

PubMed

Varmanen, P; Savijoki, K; Avall, S; Palva, A; Tynkkynen, S

2000-01-01

A peptidase gene expressing X-prolyl dipeptidyl aminopeptidase (PepX) activity was cloned from Lactobacillus rhamnosus 1/6 by using the chromogenic substrate L-glycyl-L-prolyl-beta-naphthylamide for screening of a genomic library in Escherichia coli. The nucleotide sequence of a 3.5-kb HindIII fragment expressing the peptidase activity revealed one complete open reading frame (ORF) of 2,391 nucleotides. The 797-amino-acid protein encoded by this ORF was shown to be 40, 39, and 36% identical with PepXs from Lactobacillus helveticus, Lactobacillus delbrueckii, and Lactococcus lactis, respectively. By Northern analysis with a pepX-specific probe, transcripts of 4.5 and 7.0 kb were detected, indicating that pepX is part of a polycistronic operon in L. rhamnosus. Cloning and sequencing of the upstream region of pepX revealed the presence of two ORFs of 360 and 1,338 bp that were shown to be able to encode proteins with high homology to GlnR and GlnA proteins, respectively. By multiple primer extension analyses, the only functional promoter in the pepX region was located 25 nucleotides upstream of glnR. Northern analysis with glnA- and pepX-specific probes indicated that transcription from glnR promoter results in a 2.0-kb dicistronic glnR-glnA transcript and also in a longer read-through polycistronic transcript of 7.0 kb that was detected with both probes in samples from cells in exponential growth phase. The glnA gene was disrupted by a single-crossover recombinant event using a nonreplicative plasmid carrying an internal part of glnA. In the disruption mutant, glnRA-specific transcription was derepressed 10-fold compared to the wild type, but the 7.0-kb transcript was no longer detectable with either the glnA- or pepX-specific probe, demonstrating that pepX is indeed part of glnRA operon in L. rhamnosus. Reverse transcription-PCR analysis further supported this operon structure. An extended stem-loop structure was identified immediately upstream of pepX in the glnA-pepX intergenic region, a sequence that showed homology to a 23S-5S intergenic spacer and to several other L. rhamnosus-related entries in data banks.

Reservoir Sedimentation and Upstream Sediment Sources: Perspectives and Future Research Needs on Streambank and Gully Erosion.

PubMed

Fox, G A; Sheshukov, A; Cruse, R; Kolar, R L; Guertault, L; Gesch, K R; Dutnell, R C

2016-05-01

The future reliance on water supply and flood control reservoirs across the globe will continue to expand, especially under a variable climate. As the inventory of new potential dam sites is shrinking, construction of additional reservoirs is less likely compared to simultaneous flow and sediment management in existing reservoirs. One aspect of this sediment management is related to the control of upstream sediment sources. However, key research questions remain regarding upstream sediment loading rates. Highlighted in this article are research needs relative to measuring and predicting sediment transport rates and loading due to streambank and gully erosion within a watershed. For example, additional instream sediment transport and reservoir sedimentation rate measurements are needed across a range of watershed conditions, reservoir sizes, and geographical locations. More research is needed to understand the intricate linkage between upland practices and instream response. A need still exists to clarify the benefit of restoration or stabilization of a small reach within a channel system or maturing gully on total watershed sediment load. We need to better understand the intricate interactions between hydrological and erosion processes to improve prediction, location, and timing of streambank erosion and failure and gully formation. Also, improved process-based measurement and prediction techniques are needed that balance data requirements regarding cohesive soil erodibility and stability as compared to simpler topographic indices for gullies or stream classification systems. Such techniques will allow the research community to address the benefit of various conservation and/or stabilization practices at targeted locations within watersheds.

Reservoir Sedimentation and Upstream Sediment Sources: Perspectives and Future Research Needs on Streambank and Gully Erosion

NASA Astrophysics Data System (ADS)

Fox, G. A.; Sheshukov, A.; Cruse, R.; Kolar, R. L.; Guertault, L.; Gesch, K. R.; Dutnell, R. C.

2016-05-01

The future reliance on water supply and flood control reservoirs across the globe will continue to expand, especially under a variable climate. As the inventory of new potential dam sites is shrinking, construction of additional reservoirs is less likely compared to simultaneous flow and sediment management in existing reservoirs. One aspect of this sediment management is related to the control of upstream sediment sources. However, key research questions remain regarding upstream sediment loading rates. Highlighted in this article are research needs relative to measuring and predicting sediment transport rates and loading due to streambank and gully erosion within a watershed. For example, additional instream sediment transport and reservoir sedimentation rate measurements are needed across a range of watershed conditions, reservoir sizes, and geographical locations. More research is needed to understand the intricate linkage between upland practices and instream response. A need still exists to clarify the benefit of restoration or stabilization of a small reach within a channel system or maturing gully on total watershed sediment load. We need to better understand the intricate interactions between hydrological and erosion processes to improve prediction, location, and timing of streambank erosion and failure and gully formation. Also, improved process-based measurement and prediction techniques are needed that balance data requirements regarding cohesive soil erodibility and stability as compared to simpler topographic indices for gullies or stream classification systems. Such techniques will allow the research community to address the benefit of various conservation and/or stabilization practices at targeted locations within watersheds.

Nucleotide sequence of the gene for the Mr 32,000 thylakoid membrane protein from Spinacia oleracea and Nicotiana debneyi predicts a totally conserved primary translation product of Mr 38,950

PubMed Central

Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick

1982-01-01

The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262

An analysis of effect of land use change on river flow variability

NASA Astrophysics Data System (ADS)

Zhang, Tao; Liu, Yuting; Yang, Xinyue; Wang, Xiang

2018-02-01

Land use scenario analysis, SWAT model, flow characteristic indices and flow variability technology were used to analyze the effect of land use quantity and location change on river flow. Results showed that river flow variation caused by land use change from forest to crop was larger than that caused by land use change from forest to grass; Land use change neither from upstream to downstream nor from downstream to upstream had little effect on annual average discharge and maximum annual average discharge. But it had obvious effect on maximum daily discharge; Land use change which occurred in upstream could lead to producing larger magnitude flood more easily; Land use change from forest to crop or grass could increase the number of large magnitude floods and their total duration. And it also could increase the number of small magnitude floods but decrease their duration.

Fuel injection assembly for use in turbine engines and method of assembling same

DOEpatents

Uhm, Jong Ho; Johnson, Thomas Edward

2015-03-24

A fuel injection assembly for use in a turbine engine is provided. The fuel injection assembly includes a plurality of tube assemblies, wherein each of the tube assemblies includes an upstream portion and a downstream portion. Each tube assembly includes a plurality of tubes that extend from the upstream portion to the downstream portion or from the upstream portion through the downstream portion. At least one injection system is coupled to at least one tube assembly of the plurality of tube assemblies. The injection system includes a fluid supply member that extends from a fluid source to the downstream portion of the tube assembly. The fluid supply member includes a first end portion located in the downstream portion of the tube assembly, wherein the first end portion has at least one first opening for channeling fluid through the tube assembly to facilitate reducing a temperature therein.

Water Quality, Fish Tissue, and Bed Sediment Monitoring in Waterbodies of Fort Chaffee Maneuver Training Center, Arkansas, 2002-2004

USGS Publications Warehouse

Justus, B.G.; Stanton, Gregory P.

2005-01-01

The Fort Chaffee Maneuver Training Center is a facility used to train as many as 50,000 Arkansas National Guardsmen each year. Due to the nature of ongoing training and also to a poor understanding of environmental procedures that were practiced in the World War II era, areas within Fort Chaffee have the potential to be sources of a large number of contaminants. Because some streams flow on to Fort Chaffee, there is also the potential for sources that are off post to affect environmental conditions on post. This study evaluates constituent concentrations in water, fish tissue, and bed sediment collected from waterbodies on Fort Chaffee between September 2002 and July 2004. Constituent concentrations detected in the three media and measured at nine stream sites and four lake sites were compared to national and regional criteria when available. Two of the larger streams, Big and Vache Grasse Creeks, were sampled at multiple sites. All three sampled media were analyzed for insecticides, PCBs, explosives, and trace elements. Additionally, water samples were analyzed for nutrients and herbicides. The different constituents detected in the three sample media (water, fish tissue, and bed sediment) indicate that land-use activities both on and off post are influencing environmental conditions. Contaminants such as explosives that were sometimes detected in water samples have an obvious relation to military training; however, the occurrence and locations of some nutrients, insecticides, and trace elements suggest that land use both on and off post also could be influencing environmental conditions to some degree. Constituent concentrations at sites on Vache Grasse Creek, and particularly the most upstream site, which was located immediately downstream from an off-post wastewater-treatment facility, indicate that environmental conditions were being influenced by an off-post source. The most upstream site on Vache Grasse Creek had both the highest number of detections and the highest concentrations detected of all sites sampled. Event-mean storm concentrations and storm loads calculated from storm-flow samples at two sites each for Big and Vache Grasse Creeks indicate that storm loads were highest at the two Vache Grasse Creek sites for 24 of the 25 constituents detected. Further evaluation by normalizing storm loads at Big Creek to storm loads at Vache Grasse Creek by stream flow indicate that event loads at Vache Grasse Creek were about two or more times higher than those on Big Creek for 15 of the 25 constituents measured. Low concentrations of arsenic and lead were detected in water samples, but all detections for the two trace elements occurred in samples collected at the upstream site on Vache Grasse Creek. The nickel concentration in fish livers collected from the upstream site on Vache Grasse Creek was 45 percent higher than the median of a national study of 145 sites. Mercury concentrations in edible fish tissue, which are a widespread concern in the United States, exceeded an USEPA criterion for methylmercury of 300 ?g/kg in four of nine samples; however, concentrations are typical of mercury concentrations in fish tissues for the State of Arkansas. Constituent concentrations at some sites indicate that environmental conditions are being influenced by on-post activities. Of the 55 (excluding total organic carbon) organic constituents analyzed in water samples, only 10 were detected above the minimum detection limit but four of those were explosives. Bed-sediment samples from one site located on Grayson Creek, and nearest the administrative and residential (cantonment) area, had detections for arsenic, copper, lead, manganese, nickel, and zinc that were above background concentrations, and concentrations for arsenic and nickel at this site exceeded lowest effect level criteria established by the U.S. Environmental Protection Agency. The site on Grayson Creek also had the only detections of DDT metabolites in bed sedi

Spatiotemporal distribution of nitrogen dioxide within and around a large-scale wind farm - a numerical case study

NASA Astrophysics Data System (ADS)

Mo, Jingyue; Huang, Tao; Zhang, Xiaodong; Zhao, Yuan; Liu, Xiao; Li, Jixiang; Gao, Hong; Ma, Jianmin

2017-12-01

As a renewable and clean energy source, wind power has become the most rapidly growing energy resource worldwide in the past decades. Wind power has been thought not to exert any negative impacts on the environment. However, since a wind farm can alter the local meteorological conditions and increase the surface roughness lengths, it may affect air pollutants passing through and over the wind farm after released from their sources and delivered to the wind farm. In the present study, we simulated the nitrogen dioxide (NO2) air concentration within and around the world's largest wind farm (Jiuquan wind farm in Gansu Province, China) using a coupled meteorology and atmospheric chemistry model WRF-Chem. The results revealed an edge effect, which featured higher NO2 levels at the immediate upwind and border region of the wind farm and lower NO2 concentration within the wind farm and the immediate downwind transition area of the wind farm. A surface roughness length scheme and a wind turbine drag force scheme were employed to parameterize the wind farm in this model investigation. Modeling results show that both parameterization schemes yield higher concentration in the immediate upstream of the wind farm and lower concentration within the wind farm compared to the case without the wind farm. We infer this edge effect and the spatial distribution of air pollutants to be the result of the internal boundary layer induced by the changes in wind speed and turbulence intensity driven by the rotation of the wind turbine rotor blades and the enhancement of surface roughness length over the wind farm. The step change in the roughness length from the smooth to rough surfaces (overshooting) in the upstream of the wind farm decelerates the atmospheric transport of air pollutants, leading to their accumulation. The rough to the smooth surface (undershooting) in the downstream of the wind farm accelerates the atmospheric transport of air pollutants, resulting in lower concentration level.

The fluvial sediment budget of a dammed river (upper Muga, southern Pyrenees)

NASA Astrophysics Data System (ADS)

Piqué, G.; Batalla, R. J.; López, R.; Sabater, S.

2017-09-01

Many rivers in the Mediterranean region are regulated for urban and agricultural purposes. Reservoir presence and operation results in flow alteration and sediment discontinuity, altering the longitudinal structure of the fluvial system. This study presents a 3-year sediment budget of a highly dammed Mediterranean river (the Muga, southern Pyrenees), which has experienced flow regulation since the 1969 owing to a 61-hm3 reservoir. Flow discharge and suspended sediment concentration were monitored immediately upstream and downstream from the reservoir, whereas bedload transport was estimated by means of bedload formulae and estimated from regional data. Results show how the dam modifies river flow, reducing the magnitude of floods and shortening its duration. At the same time, duration of low flows increases. The downstream flow regime follows reservoir releases that are mostly driven by the irrigation needs in the lowlands. Likewise, suspended sediment and bedload transport are shown to be notably affected by the dam. Sediment transport upstream was mainly associated with floods and was therefore concentrated in short periods of time (i.e., > 90% of the sediment load occurred in < 1% of the time). Downstream from the dam, sediments were transported more constantly (i.e., 90% of the load was carried during 50% of the time). Total sediment load upstream from the dam equalled 23,074 t, while downstream it was < 1000 t. Upstream, sediment load was equally distributed between suspension and bedload (i.e., 10,278 and 12,796 t respectively), whereas suspension dominated sediment transport downstream. More than 95% of the sediments transported from the upstream basins were trapped in the reservoir, a fact that explains the sediment deficit and the river bed armouring observed downstream. Overall, the dam disrupted the natural water and sediment fluxes, generating a highly modified environment downstream. Below the dam, the whole ecosystem shifted to stable conditions owing to the reduction of water and sediment loads.

ENERGETIC PARTICLE PRESSURE AT INTERPLANETARY SHOCKS: STEREO-A OBSERVATIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lario, D.; Decker, R. B.; Roelof, E. C.

2015-11-10

We study periods of elevated energetic particle intensities observed by STEREO-A when the partial pressure exerted by energetic (≥83 keV) protons (P{sub EP}) is larger than the pressure exerted by the interplanetary magnetic field (P{sub B}). In the majority of cases, these periods are associated with the passage of interplanetary shocks. Periods when P{sub EP} exceeds P{sub B} by more than one order of magnitude are observed in the upstream region of fast interplanetary shocks where depressed magnetic field regions coincide with increases of energetic particle intensities. When solar wind parameters are available, P{sub EP} also exceeds the pressure exertedmore » by the solar wind thermal population (P{sub TH}). Prolonged periods (>12 hr) with both P{sub EP} > P{sub B} and P{sub EP} > P{sub TH} may also occur when energetic particles accelerated by an approaching shock encounter a region well upstream of the shock characterized by low magnetic field magnitude and tenuous solar wind density. Quasi-exponential increases of the sum P{sub SUM} = P{sub B} + P{sub TH} + P{sub EP} are observed in the immediate upstream region of the shocks regardless of individual changes in P{sub EP}, P{sub B}, and P{sub TH}, indicating a coupling between P{sub EP} and the pressure of the background medium characterized by P{sub B} and P{sub TH}. The quasi-exponential increase of P{sub SUM} implies a radial gradient ∂P{sub SUM}/∂r > 0 that is quasi-stationary in the shock frame and results in an outward force applied to the plasma upstream of the shock. This force can be maintained by the mobile energetic particles streaming upstream of the shocks that, in the most intense events, drive electric currents able to generate diamagnetic cavities and depressed solar wind density regions.« less

Void/particulate detector

DOEpatents

Claytor, T.N.; Karplus, H.B.

1983-09-26

Apparatus for detecting voids and particulates in a flowing stream of fluid contained in a pipe may comprise: (a) a transducer for transmitting an ultrasonic signal into the stream, coupled to the pipe at a first location; (b) a second transducer for detecting the through-transmission of said signal, coupled to the pipe at a second location; (c) a third transducer for detecting the back-scattering of said signal, coupled to the pipe at a third location, said third location being upstream from said first location; (d) circuit means for normalizing the back-scattered signal from said third transducer to the through-transmitted signal from said second transducer; which normalized signal provides a measure of the voids and particulates flowing past said first location.

Identification of hypothalamic arcuate nucleus-specific enhancer region of Kiss1 gene in mice.

PubMed

Goto, Teppei; Tomikawa, Junko; Ikegami, Kana; Minabe, Shiori; Abe, Hitomi; Fukanuma, Tatsuya; Imamura, Takuya; Takase, Kenji; Sanbo, Makoto; Tomita, Koichi; Hirabayashi, Masumi; Maeda, Kei-ichiro; Tsukamura, Hiroko; Uenoyama, Yoshihisa

2015-01-01

Pulsatile secretion of GnRH plays a pivotal role in follicular development via stimulating tonic gonadotropin secretion in mammals. Kisspeptin neurons, located in the arcuate nucleus (ARC), are considered to be an intrinsic source of the GnRH pulse generator. The present study aimed to determine ARC-specific enhancer(s) of the Kiss1 gene by an in vivo reporter assay. Three green fluorescent protein (GFP) reporter constructs (long, medium length, and short) were generated by insertion of GFP cDNA at the Kiss1 locus. Transgenic female mice bearing the long and medium-length constructs showed apparent GFP signals in kisspeptin-immunoreactive cells in both the ARC and anteroventral periventricular nucleus, in which another population of kisspeptin neurons are located. On the other hand, transgenic mice bearing 5'-truncated short construct showed few GFP signals in the ARC kisspeptin-immunoreactive cells, whereas they showed colocalization of GFP- and kisspeptin-immunoreactivities in the anteroventral periventricular nucleus. In addition, chromatin immunoprecipitation and chromosome conformation capture assays revealed recruitment of unoccupied estrogen receptor-α in the 5'-upstream region and intricate chromatin loop formation between the 5'-upstream and promoter regions of Kiss1 locus in the ARC. Taken together, the present results indicate that 5'-upstream region of Kiss1 locus plays a critical role in Kiss1 gene expression in an ARC-specific manner and that the recruitment of estrogen receptor-α and formation of a chromatin loop between the Kiss1 promoter and the 5' enhancer region may be required for the induction of ARC-specific Kiss1 gene expression. These results suggest that the 5'-upstream region of Kiss1 locus functions as an enhancer for ARC Kiss1 gene expression in mice.

Location Is Everything: Evaluating the Effects of Terrestrial and Marine Resource Subsidies on an Estuarine Bivalve

PubMed Central

Harding, Joel M. S.; Segal, Michelle R.; Reynolds, John D.

2015-01-01

Estuaries are amongst the world’s most productive ecosystems, lying at the intersection between terrestrial and marine environments. They receive substantial inputs from adjacent landscapes but the importance of resource subsidies is not well understood. Here, we test hypotheses for the effects of both terrestrial- and salmon-derived resource subsidies on the diet (inferred from stable isotopes of muscle tissue), size and percent nitrogen of the soft-shell clam (Mya arenaria), a sedentary estuarine consumer. We examine how these relationships shift across natural gradients among 14 estuaries that vary in upstream watershed size and salmon density on the central coast of British Columbia, Canada. We also test how assimilation and response to subsidies vary at smaller spatial scales within estuaries. The depletion and enrichment of stable isotope ratios in soft-shell clam muscle tissue correlated with increasing upstream watershed size and salmon density, respectively. The effects of terrestrial- and salmon-derived subsidies were also strongest at locations near stream outlets. When we controlled for age of individual clams, there were larger individuals with higher percent nitrogen content in estuaries below larger watersheds, though this effect was limited to the depositional zones below river mouths. Pink salmon exhibited a stronger effect on isotope ratios of clams than chum salmon, which could reflect increased habitat overlap as spawning pink salmon concentrate in lower stream reaches, closer to intertidal clam beds. However, there were smaller clams in estuaries that had higher upstream pink salmon densities, possibly due to differences in habitat requirements. Our study highlights the importance of upstream resource subsidies to this bivalve species, but that individual responses to subsidies can vary at smaller scales within estuaries. PMID:25993002

81. THREE ADDITIONAL BLACK AND WHITE VIDEO MONITORS LOCATED IMMEDIATELY ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

81. THREE ADDITIONAL BLACK AND WHITE VIDEO MONITORS LOCATED IMMEDIATELY WEST OF THOSE IN CA-133-1-A-80. COMPLEX SAFETY WARNING LIGHTS FOR SLC-3E (PAD 2) AND BLDG. 763 (LOB) LOCATED ABOVE MONITOR 3; GREEN LIGHTS ON BOTTOM OF EACH STACK ILLUMINATED. LEFT TO RIGHT BELOW MONITORS: ACCIDENT REPORTING EMERGENCY NOTIFICATION SYSTEM TELEPHONE, ATLAS H FUEL COUNTER, AND DIGITAL COUNTDOWN CLOCK. - Vandenberg Air Force Base, Space Launch Complex 3, Launch Operations Building, Napa & Alden Roads, Lompoc, Santa Barbara County, CA

Optimization Review, Black Butte Mine Superfund Site, Lane County, Oregon

EPA Pesticide Factsheets

The BBM Superfund Site (the site) is located in Lane County, Oregon, approximately 35 miles southeast of Eugene and approximately 10 miles upstream from the Cottage Grove Reservoir (CGR). Mercury mining and processing operations were active at the site...

Closed circuit steam cooled turbine shroud and method for steam cooling turbine shroud

DOEpatents

Burdgick, Steven Sebastian; Sexton, Brendan Francis; Kellock, Iain Robertson

2002-01-01

A turbine shroud cooling cavity is partitioned to define a plurality of cooling chambers for sequentially receiving cooling steam and impingement cooling of the radially inner wall of the shoud. An impingement baffle is provided in each cooling chamber for receiving the cooling media from a cooling media inlet in the case of the first chamber or from the immediately upstream chamber in the case of the second through fourth chambers and includes a plurality of impingement holes for effecting the impingement cooling of the shroud inner wall.

The flow across a street canyon of variable width—Part 2:. Scalar dispersion from a street level line source

NASA Astrophysics Data System (ADS)

Simoëns, Serge; Wallace, James M.

As described in Part 1 [Simoëns et al., 2007. The flow across a street canyon of variable width—Part 1: kinematic description. Atmospheric Environment 41, 9002-9017] measurements have been made of the velocity field around and within the canyon formed by two obstacles placed on the wall of a turbulent boundary layer. Here in Part 2 measurements of the scalar dispersion of smoke released from a two-dimensional slot in the wall perpendicular to the mean flow and located parallel to and midway between these two square obstacles are presented. The Reynolds number of the boundary layer at the slot location without the obstacles in place was Rθ≈980. Statistical properties of the concentration field and the scalar fluxes in the streamwise plane are reported here for canyon openings that have been chosen based on characteristics of the kinematic description. These opening widths, expressed as multiples of the obstacle height, are 1 h, 4 h and 8 h. The mean concentration field revealed that the much of the scalar is trapped on the leeward side of the upstream obstacle before some of it escapes the canyon and is entrained on the roof of the upstream obstacle. It then is spread downstream by the turbulence in the wake of this obstacle. Surprisingly, the root mean square (rms) concentration field reveals that high concentration fluctuations exist in a zone where velocity field turbulence is very low. Measured streamwise scalar fluxes were found to be negative above the obstacles, whereas they are mainly positive between the obstacles. The measured wall normal scalar fluxes have an inverse behavior. Within the canyon, the scalar fluxes are greatest in the region between the large primary vortex, evident in the kinematic field, and the secondary vortex located in the corner of the leeward side of the upstream obstacle. In the flow above the obstacle roofs the wake of the upstream obstacle seems to dominate the scalar transport. Between the obstacles in and above the canyon, the existence of intermittent and intense events appear to prevent the modelling of these fluxes with a simple mean concentration gradient model.

Motif types, motif locations and base composition patterns around the RNA polyadenylation site in microorganisms, plants and animals

PubMed Central

2014-01-01

Background The polyadenylation of RNA is critical for gene functioning, but the conserved sequence motifs (often called signal or signature motifs), motif locations and abundances, and base composition patterns around mRNA polyadenylation [poly(A)] sites are still uncharacterized in most species. The evolutionary tendency for poly(A) site selection is still largely unknown. Results We analyzed the poly(A) site regions of 31 species or phyla. Different groups of species showed different poly(A) signal motifs: UUACUU at the poly(A) site in the parasite Trypanosoma cruzi; UGUAAC (approximately 13 bases upstream of the site) in the alga Chlamydomonas reinhardtii; UGUUUG (or UGUUUGUU) at mainly the fourth base downstream of the poly(A) site in the parasite Blastocystis hominis; and AAUAAA at approximately 16 bases and approximately 19 bases upstream of the poly(A) site in animals and plants, respectively. Polyadenylation signal motifs are usually several hundred times more abundant around poly(A) sites than in whole genomes. These predominant motifs usually had very specific locations, whether upstream of, at, or downstream of poly(A) sites, depending on the species or phylum. The poly(A) site was usually an adenosine (A) in all analyzed species except for B. hominis, and there was weak A predominance in C. reinhardtii. Fungi, animals, plants, and the protist Phytophthora infestans shared a general base abundance pattern (or base composition pattern) of “U-rich—A-rich—U-rich—Poly(A) site—U-rich regions”, or U-A-U-A-U for short, with some variation for each kingdom or subkingdom. Conclusion This study identified the poly(A) signal motifs, motif locations, and base composition patterns around mRNA poly(A) sites in protists, fungi, plants, and animals and provided insight into poly(A) site evolution. PMID:25052519

Data Validation Package - June 2015 Groundwater and Surface Water Sampling at the Green River, Utah, Disposal Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linard, Joshua; Price, Jeffrey

2015-08-01

Groundwater samples were collected during the 2015 sampling event from point-of-compliance (POC) wells 0171, 0173, 0176, 0179, 0181, and 0813 to monitor the disposition of contaminants in the middle sandstone unit of the Cedar Mountain Formation. Groundwater samples also were collected from alluvium monitoring wells 0188, 0189, 0192, 0194, and 0707, and basal sandstone monitoring wells 0182, 0184, 0185, and 0588 as a best management practice. Surface locations 0846 and 0847 were sampled to monitor for degradation of water quality in the backwater area of Brown’s Wash and in the Green River immediately downstream of Brown’s Wash. The Green Rivermore » location 0801 is upstream from the site and is sampled to determine background-threshold values (BTVs). Sampling and analyses were conducted as specified in Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites (LMS/PRO/S04351, continually updated, http://energy.gov/lm/downloads/sampling-and- analysis-plan-us-department-energy-office-legacy-management-sites). Water levels were measured at each sampled well. The analytical data and associated qualifiers can be viewed in environmental database reports and are also available for viewing with dynamic mapping via the GEMS (Geospatial Environmental Mapping System) website at http://gems.lm.doe.gov/#. All six POC wells are completed in the middle sandstone unit of the Cedar Mountain Formation and are monitored to measure contaminant concentrations for comparison to proposed alternate concentration limits (ACLs), as provided in Table 1. Contaminant concentrations in the POC wells remain below their respective ACLs.« less

Boundary Layer Transition During the Orion Exploration Flight Test 1 (EFT-1)

NASA Technical Reports Server (NTRS)

Kirk, Lindsay C.

2016-01-01

Boundary layer transition was observed in the thermocouple data on the windside backshell of the Orion reentry capsule. Sensors along the windside centerline, as well as off-centerline, indicated transition late in the flight at approximately Mach 4 conditions. Transition progressed as expected, beginning at the sensors closest to the forward bay cover (FBC) and moving towards the heatshield. Sensors placed in off-centerline locations did not follow streamlines, so the progression of transition observed in these sensors is less intuitive. Future analysis will include comparisons to pre-flight predictions and expected transitional behavior will be investigated. Sensors located within the centerline and off-centerline launch abort system (LAS) attach well cavities on the FBC also showed indications of boundary layer transition. The transition within the centerline cavity was observed in the temperature traces prior to transition onset on the sensors upstream of the cavity. Transition behavior within the off centerline LAS attach well cavity will also be investigated. Heatshield thermocouples were placed within Avcoat plugs to attempt to capture transitional behavior as well as better understand the aerothermal environments. Thermocouples were placed in stacks of two or five vertically within the plugs, but the temperature data obtained at the sensors closest to the surface did not immediately indicate transitional behavior. Efforts to use the in depth thermocouple temperatures to reconstruct the surface heat flux are ongoing and any results showing the onset of boundary layer transition obtained from those reconstructions will also be included in this paper. Transition on additional features of interest, including compression pad ramps, will be included if it becomes available.

Sulfur oxide adsorbents and emissions control

DOEpatents

Li, Liyu [Richland, WA; King, David L [Richland, WA

2006-12-26

High capacity sulfur oxide absorbents utilizing manganese-based octahedral molecular sieve (Mn--OMS) materials are disclosed. An emissions reduction system for a combustion exhaust includes a scrubber 24 containing these high capacity sulfur oxide absorbents located upstream from a NOX filter 26 or particulate trap.

10. Photocopy of Drawing, Barnstead Bridge, Pittsfield, New Hampshire, Sheet ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

10. Photocopy of Drawing, Barnstead Bridge, Pittsfield, New Hampshire, Sheet 2, Upstream Elevation, Sections, Details and Quantities. Original located at the New Hampshire Department of Transportation, Concord, New Hampshire. - Barnstead Bridge, Spanning Suncook River at Barnstead Road, Pittsfield, Merrimack County, NH

39. DIABLO POWERHOUSE: GRAVITY LUBRICATING OIL TANKS. THESE TANKS ARE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

39. DIABLO POWERHOUSE: GRAVITY LUBRICATING OIL TANKS. THESE TANKS ARE LOCATED AT ROOF LEVEL AT THE NORTHEAST REAR CORNER OF DIABLO POWERHOUSE, 1989. - Skagit Power Development, Diablo Powerhouse, On Skagit River, 6.1 miles upstream from Newhalem, Newhalem, Whatcom County, WA

Research on the upstream passage of juvenile salmon through culverts : retrofit baffles

DOT National Transportation Integrated Search

2006-04-01

This report provides data from biological tests conducted November 2005 through January 2006 by Battelle for the Washington State Department of Transportation (WSDOT) at the Culvert Test Bed Facility located at the Washington Department of Fish and W...

An in situ Comparison of Electron Acceleration at Collisionless Shocks under Differing Upstream Magnetic Field Orientations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Masters, A.; Dougherty, M. K.; Sulaiman, A. H.

A leading explanation for the origin of Galactic cosmic rays is acceleration at high-Mach number shock waves in the collisionless plasma surrounding young supernova remnants. Evidence for this is provided by multi-wavelength non-thermal emission thought to be associated with ultrarelativistic electrons at these shocks. However, the dependence of the electron acceleration process on the orientation of the upstream magnetic field with respect to the local normal to the shock front (quasi-parallel/quasi-perpendicular) is debated. Cassini spacecraft observations at Saturn’s bow shock have revealed examples of electron acceleration under quasi-perpendicular conditions, and the first in situ evidence of electron acceleration at amore » quasi-parallel shock. Here we use Cassini data to make the first comparison between energy spectra of locally accelerated electrons under these differing upstream magnetic field regimes. We present data taken during a quasi-perpendicular shock crossing on 2008 March 8 and during a quasi-parallel shock crossing on 2007 February 3, highlighting that both were associated with electron acceleration to at least MeV energies. The magnetic signature of the quasi-perpendicular crossing has a relatively sharp upstream–downstream transition, and energetic electrons were detected close to the transition and immediately downstream. The magnetic transition at the quasi-parallel crossing is less clear, energetic electrons were encountered upstream and downstream, and the electron energy spectrum is harder above ∼100 keV. We discuss whether the acceleration is consistent with diffusive shock acceleration theory in each case, and suggest that the quasi-parallel spectral break is due to an energy-dependent interaction between the electrons and short, large-amplitude magnetic structures.« less

Recommendations for a wind profiling network to support Space Shuttle launches

NASA Technical Reports Server (NTRS)

Zamora, R. J.

1992-01-01

The feasibility is examined of a network of clear air radar wind profilers to forecast wind conditions before Space Shuttle launches during winter. Currently, winds are measured only in the vicinity of the shuttle launch site and wind loads on the launch vehicle are estimated using these measurements. Wind conditions upstream of the Cape are not monitored. Since large changes in the wind shear profile can be associated with weather systems moving over the Cape, it may be possible to improve wind forecasts over the launch site if wind measurements are made upstream. A radar wind profiling system is in use at the Space Shuttle launch site. This system can monitor the wind profile continuously. The existing profiler could be combined with a number of radars located upstream of the launch site. Thus, continuous wind measurements would be available upstream and at the Cape. NASA-Marshall representatives have set the requirements for radar wind profiling network. The minimum vertical resolution of the network must be set so that the wind shears over the depths greater than or = 1 km will be detected. The network should allow scientists and engineers to predict the wind profile over the Cape 6 hours before a Space Shuttle launch.

Identification and management of microbial contaminations in a surface drinking water source.

PubMed

Aström, J; Pettersson, T J R; Stenström, T A

2007-01-01

Microbial contamination of surface waters constitutes a health risk for drinking water consumers which may be lowered by closing the raw water intake. We have evaluated microbial discharge events reported in the river Göta älv, which is used for raw water supply to the city of Göteborg. Elevated levels of faecal indicator bacteria were observed during periods of closed raw water intake. High bacteria levels were, however, also occasionally detected during periods of open intake, probably as a result of microbial discharge far upstream in the river which may be difficult to predict and manage by closing the intake. Accumulated upstream precipitations, resulting in surface runoff and wastewater contaminations in the catchment, correlated positively with the levels of total coliforms, E. coli, intestinal enterococci and sulfite-reducing clostridia. Levels of faecal indicator organisms were negatively correlated to the water temperature due to enhanced survival at lower temperatures. Wastewater discharges from a municipality located just upstream of the water intake resulted in elevated E. coli concentrations downstream at the raw water intake for Göteborg. To improve the prediction of microbial contaminations within the river Göta älv, monitoring data on turbidity and upstream precipitation are of particular importance.

8” x 10” black and white photographic print made from ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. DECEMBER 31, 1934 PHOTOGRAPH NO. 61 OF CONTRACT NO. 4 SHOWING BRIDGE SUPERSTRUCTURE UPSTREAM CONCRETE ROADWAY. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

The location of a disease-associated polymorphism and genomic structure of the human 52-kDa Ro/SSA locus (SSA1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsugu, H.; Horowitz, R.; Gibson, N.

1994-12-01

Sera from approximately 30% of patients with systemic lupus erythematosus (SLE) contain high titers of autoantibodies that bind to the 52-kDa Ro/SSA protein. We previously detected polymorphisms in the 52-kDa Ro/SSA gene (SSA1) with restriction enzymes, one of which is strongly associated with the presence of SLE (P < 0.0005) in African Americans. A higher disease frequency and more severe forms of the disease are commonly noted among these female patients. To determine the location and nature of this polymorphism, we obtained two clones that span 8.5 kb of the 52-kDa Ro/SSA locus including its upstream regulatory region. Six exonsmore » were identified, and their nucleotide sequences plus adjacent noncoding regions were determined. No differences were found between these exons and the coding region of one of the reported cDNAs. The disease-associated polymorphic site suggested by a restriction enzyme map and confirmed by DNA amplification and nucleotide sequencing was present upstream of exon 1. This polymorphism may be a genetic marker for a disease-related variation in the coding region for the protein or in the upstream regulatory region of this gene. Although this RFLP is present in Japanese, it is not associated with lupus in this race. 41 refs., 4 figs., 2 tabs.« less

Experimental evaluation and analysis of methane fire and explosion mitigation using isolation valves integrated with a vent system.

PubMed

Ajrash, Mohammed J; Zanganeh, Jafar; Moghtaderi, Behdad

2017-10-05

There has been a surge of interest from the extractive industries in the application of mechanical means to the mitigation of flame deflagration. To verify the implementation and performance of passive and active mitigation protection, a comprehensive experimental investigation has been conducted on a large scale detonation tube, 30m long and 0.5m in diameter, with two mitigation valves (passive and active) and a burst panel venting system. The valves were used alternately to mitigate the flame deflagration of methane in concentrations ranging from 1.25% to 7.5%. The experimental work revealed that locating the passive mitigation valve at 22m distance from the ignition source mitigates the flame by fully isolating the tube. However, closing the valve structure in the axial direction generated another pressure wave upstream, which was approximately the same value as for the original pressure wave upstream. In the case of the active mitigation system, the system perfectly isolated upstream from downstream with no further pressure wave generation. When the vent was located at 6.5m from the ignition source, the total pressure was reduced by 0.48bar. Due to the counter flow of the reflected pressure wave the flame was extinguished at 12.5m from the ignition source. Copyright © 2017 Elsevier B.V. All rights reserved.

Estimation of potential runoff-contributing areas in the Kansas-Lower Republican River Basin, Kansas

USGS Publications Warehouse

Juracek, Kyle E.

1999-01-01

Digital soils and topographic data were used to estimate and compare potential runoff-contributing areas for 19 selected subbasins representing soil, slope, and runoff variability within the Kansas-Lower Republican (KLR) River Basin. Potential runoff-contributing areas were estimated separately and collectively for the processes of infiltration-excess and saturation-excess overland flow using a set of environmental conditions that represented high, moderate, and low potential runoff. For infiltration-excess overland flow, various rainfall intensities and soil permeabilities were used. For saturation-excess overland flow, antecedent soil-moisture conditions and a topographic wetness index were used. Results indicated that the subbasins with relatively high potential runoff are located in the central part of the KLR River Basin. These subbasins are Black Vermillion River, Clarks Creek, Delaware River upstream from Muscotah, Grasshopper Creek, Mill Creek (Wabaunsee County), Soldier Creek, Vermillion Creek (Pottawatomie County), and Wildcat Creek. The subbasins with relatively low potential runoff are located in the western one-third of the KLR River Basin, with one exception, and are Buffalo Creek, Little Blue River upstream from Barnes, Mill Creek (Washington County), Republican River between Concordia and Clay Center, Republican River upstream from Concordia, Wakarusa River downstream from Clinton Lake (exception), and White Rock Creek. The ability to distinguish the subbasins as having relatively high or low potential runoff was possible mostly due to the variability of soil permeability across the KLR River Basin.

Photographic copy of early black and white photograph. Located loose ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photographic copy of early black and white photograph. Located loose in oversized box at the National Museum of American History, Smithsonian Institution, Archives Center, Work and Industry Division, Washington, D.C. Original Photographer unknown. EARLY PHOTOGRAPH OF BRIDGE TAKEN FROM WEST BANK APPROACH LOOKING NORTH TOWARD EAST BANK. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

Large Eddy Simulation of the fuel transport and mixing process in a scramjet combustor with rearwall-expansion cavity

NASA Astrophysics Data System (ADS)

Cai, Zun; Liu, Xiao; Gong, Cheng; Sun, Mingbo; Wang, Zhenguo; Bai, Xue-Song

2016-09-01

Large Eddy Simulation (LES) was employed to investigate the fuel/oxidizer mixing process in an ethylene fueled scramjet combustor with a rearwall-expansion cavity. The numerical solver was first validated for an experimental flow, the DLR strut-based scramjet combustor case. Shock wave structures and wall-pressure distribution from the numerical simulations were compared with experimental data and the numerical results were shown in good agreement with the available experimental data. Effects of the injection location on the flow and mixing process were then studied. It was found that with a long injection distance upstream the cavity, the fuel is transported much further into the main flow and a smaller subsonic zone is formed inside the cavity. Conversely, with a short injection distance, the fuel is entrained more into the cavity and a larger subsonic zone is formed inside the cavity, which is favorable for ignition in the cavity. For the rearwall-expansion cavity, it is suggested that the optimized ignition location with a long upstream injection distance should be in the bottom wall in the middle part of the cavity, while the optimized ignition location with a short upstream injection distance should be in the bottom wall in the front side of the cavity. By employing a cavity direct injection on the rear wall, the fuel mass fraction inside the cavity and the local turbulent intensity will both be increased due to this fueling, and it will also enhance the mixing process which will also lead to increased mixing efficiency. For the rearwall-expansion cavity, the combined injection scheme is expected to be an optimized injection scheme.

Formation of fluvial knickzones in Japanese mountainous areas: A spatial analysis using GIS and DEMs

NASA Astrophysics Data System (ADS)

Hayakawa, Y. S.; Oguchi, T.

2006-12-01

Fluvial knickzones are the elements of bedrock rivers that can enhance stream erosion into bedrock, and they can be key morphologies highlighting interactions among earth surface processes such as erosion, tectonics, and volcanism. This study examines the longitudinal profiles of Japanese mountain rivers to illustrate the distribution of knickzones and discusses their role in the landscape development. Using 50-m DEMs, knickzones were extracted based on a quantitative criterion, and 5,753 knickzones were identified in the rivers of ca. 65,000 km long. The location of the knickzones was then examined along with other GIS data including topography, geology and precipitation. Overall, topographical conditions have the strongest influences on knickzone abundance, and upstream steep reaches of the rivers are more favorable for knickzone existence. The knickzone abundance for each rock type is also controlled by stream gradients, and lighologic boundaries do not show significant correlations with the knickzone locations. The controls of lithologic substrate on the knickzone locations are therefore limited. The abundant knickzones in steep river reaches indicate a hydraulic origin of knickzones, where stream erosions have enough strength in shaping the bedrock. Moreover, the knickzones are frequently observed in reaches slightly upstream from the major confluences at which stream discharge abruptly increases, indicating that the hydraulic anomalies of water flows at the confluences can cause knickzones which may later migrate upstream. The other possible causes of knickzone initiation including volcanic, tectonic and climatic effects are also suggested. The abundant knickzones in Japanese mountain rivers, resulted from the interactions among surface processes, suggest that river morphology modeling needs to consider the initiation and development of knickzones. tokyo.ac.jp/~hayakawa/

Characterization and placement of wetlands for integrated watershed conservation practice planning

USDA-ARS?s Scientific Manuscript database

Constructed wetlands have been recognized as an efficient and cost-effective conservation practice to protect water quality through reducing the transport of sediments and nutrients from upstream croplands to downstream water bodies. The challenge resides in targeting the strategic location of wetla...

Mutually Exclusive Splicing of the Insect Dscam Pre-mRNA Directed by Competing Intronic RNA Secondary Structures

PubMed Central

Graveley, Brenton R.

2008-01-01

Summary Drosophila Dscam encodes 38,016 distinct axon guidance receptors through the mutually exclusive alternative splicing of 95 variable exons. Importantly, known mechanisms that ensure the mutually exclusive splicing of pairs of exons cannot explain this phenomenon in Dscam. I have identified two classes of conserved elements in the Dscam exon 6 cluster, which contains 48 alternative exons—the docking site, located in the intron downstream of constitutive exon 5, and the selector sequences, which are located upstream of each exon 6 variant. Strikingly, each selector sequence is complementary to a portion of the docking site, and this pairing juxtaposes one, and only one, alternative exon to the upstream constitutive exon. The mutually exclusive nature of the docking site:selector sequence interactions suggests that the formation of these competing RNA structures is a central component of the mechanism guaranteeing that only one exon 6 variant is included in each Dscam mRNA. PMID:16213213

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

Temporal genetic monitoring of hybridization between native westslope cutthroat trout and introduced rainbow trout in the Stehekin River, Washington

USGS Publications Warehouse

Ostberg, Carl O.; Chase, Dorothy M.

2012-01-01

Introgressive hybridization with introduced rainbow trout (RBT) (Oncorhynchus mykiss) has led to the loss of native cutthroat trout species (O. clarkii) throughout their range, creating conservation concerns. Monitoring temporal hybridization trends provides resource managers with a tool for determining population status and information for establishing conservation goals for native cutthroat trout. In this study, we re-sampled six locations in 2010 within the Stehekin River watershed, North Cascades National Park, which were originally sampled between 1999 and 2003. We used genetic markers to monitor changes in hybridization levels between sampling periods in the native westslope cutthroat trout (WCT) (O. c. lewisi) stemming from past RBT introductions. Additionally, two new locations from the lower Stehekin drainage were added to the baseline data. We found that the frequency of WCT, RBT, and their hybrids was not significantly different between monitoring periods, but that RBT allele frequencies decreased in two locations and increased in one location. We also found a consistent, substantial reduction in the frequency of RBT alleles over the monitoring period in the Stehekin River upstream of Bridge Creek (SR3) compared to the Stehekin River downstream of Bridge Creek (SR1 -2) and within lower Bridge Creek (BR1) although these three locations are confined to a small geographic area (approximately 5 km). Ecological and/or evolutionary processes likely restrict the dispersal of RBT alleles in the Stehekin River upstream of Bridge Creek.

Water quality in the Little Sac River basin near Springfield, Missouri, 1999-2001

USGS Publications Warehouse

Smith, Brenda J.

2002-01-01

The Little Sac River, north of Springfield, Missouri, flows through mainly agricultural and forest land. However, the quality of the river water is a concern because the river flows into Stockton Lake, which is a supplemental drinking water source for Springfield. Large bacterial densities and nutrient concentrations are primary concerns to the water quality of the river.A 29-river mile reach of the Little Sac River is on the 1998 list of waters of Missouri designated under section 303(d) of the Federal Clean Water Act because of fecal coliform densities larger than the Missouri Department of Natural Resources standard (hereinafter referred to as Missouri standard) of 200 colonies per 100 milliliters for whole-body contact recreation. During an investigation of the water quality in the Little Sac River by the U.S. Geological Survey, in cooperation with the Watershed Committee of the Ozarks, fecal coliform bacteria densities exceeded the Missouri standard (the standard applies from April 1 through October 31) in one sample from a site near Walnut Grove. At other sites on the Little Sac River, the Missouri standard was exceeded in two samples and equalled in one sample upstream from the Northwest Wastewater Treatment Plant (NW WTP) and in one sample immediately downstream from the NW WTP.Effluent from the NW WTP flows into the Little Sac River. Annually from April 1 through October 31, the effluent is disinfected to meet the Missouri standard for whole-body contact recreation. Fecal coliform bacteria densities in samples collected during this period generally were less than 100 colonies per 100 milliliters. For the rest of the year when the effluent was not disinfected, the bacteria densities in samples ranged from 50 (sample collected on November 1, 2000) to 10,100 colonies per 100 milliliters (both counts were non-ideal). When the effluent was disinfected and the fecal coliform bacteria density was small, samples from sites upstream and downstream from the NW WTP had a bacteria density larger than the density in the effluent. Other sources of bacteria are likely to be present in the study area in addition to the NW WTP. These potential sources include effluent from domestic septic systems and animal wastes.Nutrient concentrations in the Little Sac River immediately downstream from the NW WTP were affected by effluent from the NW WTP and possibly other sources. At two sites upstream from the NW WTP, median nitrite plus nitrate concentrations were 1.1 and 1.4 milligrams per liter. The median nitrite plus nitrate concentration for the effluent from the NW WTP was 6.4 milligrams per liter, and the median concentration decreased downstream in the Little Sac River to 2.2, 1.2, and 0.56 milligrams per liter.The effects of the effluent from the NW WTP on the water quality of the Little Sac River downstream from the NW WTP were reflected in an increase in discharge (effluent from the NW WTP can be as much as 50 percent of the flow at the site about 1.5 river miles downstream from the NW WTP), an increase in specific conductance values, an increase in several inorganic constituent concentrations, including calcium, magnesium, and sulfate, and a large increase in sodium and chloride concentrations. The effluent from the NW WTP seemed to have no effect on the pH value, temperature, and dissolved oxygen concentrations in the Little Sac River.Results of repetitive element polymerase chain reaction (rep-PCR) pattern analysis indicated that most Escherichia coli (E. coli) bacteria in water samples probably were from nonhuman sources, such as horses and cattle. The rep-PCR pattern analysis indicated that horses were an important source of E. coli downstream from the NW WTP, which was consistent with horses pastured adjacent to the sampling site. Fecal coliform bacteria loads increased upstream from the NW WTP from the most upstream site to the site immediately upstream from the NW WTP. Loads in the effluent from the NW WTP and also tho

76 FR 56724 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-14

.../town/county Source of flooding Location ** ground [caret] Elevation in meters (MSL) Existing Modified... Datum. Depth in feet above ground. [caret] Mean Sea Level, rounded to the nearest 0.1 meter. ** BFEs to... upstream of Cradduck Road None +876 Oklahoma Unincorporated Areas of Town Branch Approximately 400 feet...

75 FR 31361 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-03

... source(s) elevation ground [caret] Elevation Communities affected in meters (MSL) Effective Modified... meter. ** BFEs to be changed include the listed downstream and upstream BFEs, and include BFEs located... Sea Level, rounded to the nearest 0.1 meter. ** BFEs to be changed include the listed downstream and...

4. Rockwork on north bank of the S. Platte River. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. Rockwork on north bank of the S. Platte River. Located approximately 2.4 miles upstream from KeysTone Bridge and about 30 feet above river. View looking northwest from 70 fee. - Denver & Rio Grande Rockwork, East of South Platte, Waterton, Jefferson County, CO

77 FR 66737 - Final Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-07

... +45 upstream of Cedar Swamp Road. Clapps Swamp Approximately 0.4 mile +51 Unincorporated Areas of.... 4104, and 44 CFR part 67. FEMA has developed criteria for floodplain management in floodprone areas in... Location Depth in feet above ground [caret] Elevation in meters (MSL)Modified Unincorporated Areas of...

A simulation method for combining hydrodynamic data and acoustic tag tracks to predict the entrainment of juvenile salmonids onto the Yolo Bypass under future engineering scenarios

USGS Publications Warehouse

Blake, Aaron R.; Stumpner, Paul; Burau, Jon R.

2017-01-01

During water year 2016 the U.S. Geological Survey California Water Science Center (USGS) collaborated with the California Department of Water Resources (DWR) to conduct a joint hydrodynamic and fisheries study to acquire data that could be used to evaluate the effects of proposed modifications to the Fremont Weir on outmigrating juvenile Chinook salmon. During this study the USGS surgically implanted acoustic tags in juvenile late fall run Chinook salmon from the Coleman National Fish Hatchery, released the acoustically tagged juvenile salmon into the Sacramento River upstream of the Fremont Weir, and tracked their movements as they emigrated past the western end of the Fremont Weir.The USGS analyzed tracking data from the acoustically tagged juvenile salmon along with detailed hydrodynamic data collected in the Sacramento River during the winter/spring of water year 2016 in the vicinity of the western end of the Fremont Weir to assess the potential for enhancing the entrainment of Sacramento River Chinook salmon onto the Yolo Bypass under six different Fremont Weir modification scenarios. Each modification scenario consists of a notch or multiple notches in the Fremont Weir which are designed to divert a portion of the Sacramento River onto the Yolo Bypass when the Sacramento River is below the crest of the Fremont Weir. The primary goal of this entrainment analysis was to investigate how the location of the notch or notches in each scenario affected the entrainment of juvenile Chinook salmon onto the Yolo Bypass, and to predict the notch location or locations that would result in maximum entrainment under each modification scenario. Stumpner et al.’s (in review) analysis of hydraulic data collected during the 2016 study period showed that backwater effects in the Sacramento River created significant variability in the relationship between Sacramento River stage and the proportion of the Sacramento River flow that we expect to be diverted onto the Yolo Bypass under the modification scenarios. Because of this variability, accurately evaluating the entrainment potential of possible notch locations for each scenario required combining historic abundance data for juvenile Sacramento River Chinook salmon with historic hydraulic data for the Sacramento River in the vicinity of the Fremont Weir, so that the entrainment estimates would reflect the covariance between Sacramento River stage, Sacramento River discharge, and juvenile salmon abundance within the historic record.We used a Monte Carlo simulation framework to combine the high resolution hydrodynamic data and acoustic tag track data collected in 2016 with historic juvenile salmon abundance, Sacramento River stage, and Sacramento River discharge data from a period spanning water years 1996-2010 to assess the entrainment potential of different weir modification scenarios under historic conditions. The scenarios we simulated consisted of four single notch configurations, and two multiple notch configurations in the vicinity of the western end of the Fremont Weir. For each notch configuration the 15-water-year entrainment simulation was repeated for 63 possible notch locations in the vicinity of the western end of the Fremont Weir. This approach allowed us to assess the effect of notch location on the entrainment of juvenile salmonids onto the Yolo Bypass for each of the six notch configurations that we evaluated.The entrainment simulations showed that the location of each notch configuration had a major impact on the entrainment for each scenario; the predicted entrainment of some scenarios varied by as much as 400% based on where the notch (or notches) was (were) located in the study area. All of the single notch scenarios performed best when they were located within a 330 ft (100 meter) long section of the Sacramento River bank adjacent to the western terminus of the Fremont Weir (Table 1). Both of the multiple notch scenarios performed best when their upstream notches were located about 660 ft (200 meters) upstream of the western terminus of the Fremont Weir (Table 1). The results of the entrainment simulations indicated that for each notch configuration the same notch location produced near-maximum entrainment regardless of run abundance timing; this result suggests that there are areas within the study are where a notch (or notches) can be sited to achieve maximum entrainment for all runs (barring significant behavioral or physiological differences between runs). In addition, the simulation results indicate that for each notch configuration the same location is expected to produce nearmaximum entrainment for both wet water years and dry water years.Based on the results of the entrainment simulation we make three general recommendations for strategies to improve the entrainment potential of a notch in the Fremont Weir:1) Comparisons between the maximum entrainment potential for each scenario suggested that total entrainment of winter run, spring run, and fall run salmon onto the Yolo Bypass can be increased by increasing the amount of water entering a notch when the Sacramento River stage is between 19 ft and 22 ft NAVD88; this could be accomplished by lowering notch invert elevations or by adding a control section to the Sacramento River to raise stage for a given discharge.2) The relationship between Sacramento River stage and entrainment for each scenario indicated that entrainment efficiency for each scenario declined significantly once Sacramento River stage exceeded bankfull (approximately 28.5 ft NAVD88). This effect was likely due to inundation of the floodplain between the Sacramento River and the Fremont Weir; Stumpner et. al (In Review) have documented a reduction in the strength of the secondary circulation and centralization of the downwelling zone in the Sacramento River when this floodplain is inundated. Therefore, increasing the height of the river right bank of the Sacramento River to coincide with the height of the Fremont Weir is recommended to increase entrainment at higher stages. 3) Bathymetric features upstream of notch openings appeared to have a major impact on the entrainment potential of the simulated notches. For this reason we recommend taking care to avoid siting notches immediately downstream of bank features that alter the sidewall boundary layer, and we expect that smoothing the bank bathymetry upstream of a notch will enhance entrainment. Finally, we caution that the entrainment simulation was based on the behavior of large hatchery smolts, so it is likely that our results will be sensitive to any differences in behavior and physiology between these hatchery surrogates and naturally migrating juvenile salmon.

Functional elements in the minimal promoter of the human proton-coupled folate transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stark, Michal; Gonen, Nitzan; Assaraf, Yehuda G., E-mail: assaraf@tx.technion.ac.il

2009-10-09

The proton-coupled folate transporter (PCFT) is the dominant intestinal folate transporter, however, its promoter has yet to be revealed. Hence, we here cloned a 3.1 kb fragment upstream to the first ATG of the human PCFT gene and generated sequential deletion constructs evaluated in luciferase reporter assay. This analysis mapped the minimal promoter to 157 bp upstream to the first ATG. Crucial GC-box sites were identified within the minimal promoter and in its close vicinity which substantially contribute to promoter activity, as their disruption resulted in 94% loss of luciferase activity. We also identified upstream enhancer elements including YY1 andmore » AP1 which, although distantly located, prominently transactivated the minimal promoter, as their inactivation resulted in 50% decrease in reporter activity. This is the first functional identification of the minimal PCFT promoter harboring crucial GC-box elements that markedly contribute to its transcriptional activation via putative interaction with distal YY1 and AP1 enhancer elements.« less

8” x 10” black and white photographic print made from ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

8” x 10” black and white photographic print made from original 1934, 8” x 10” black and white photographic negative. New 4” x 5” archival negative made from print. Original photographer unknown. Original 8” x 10” negative located in the files of the New Orleans Public Belt Railroad administrative offices at 5100 Jefferson Highway, Jefferson, LA 70123. NOVEMBER 5, 1934 PHOTOGRAPH NO. 44 OF CONTRACT NO. 4 SHOWING BRIDGE SUPERSTRUCTURE ERECTING HIGHWAY FORMS UPSTREAM ROADWAY BETWEEN PIERS V TO D. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

78 FR 6743 - Final Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-31

... in feet (NGVD) + Elevation in feet (NAVD) Flooding source(s) Location of referenced Depth in feet... downstream of Greely Allen County. Chapel Road. Approximately 750 feet + 965 upstream of Faulkner Road. Dug.... Approximately 100 feet + 827 downstream of North Cable Road. Dug Run Tributary At the Dug Run confluence + 813...

76 FR 13569 - Proposed Flood Elevation Determinations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-14

..., FEMA published in the Federal Register a proposed rule that included erroneous Base Flood Elevation... for the proposed BFE of 1,290 feet, referenced to the North American Vertical Datum of 1988, should... Vertical Datum of 1988, should have located the proposed BFE as being approximately 0.24 mile upstream of...

77 FR 24471 - Takes of Marine Mammals Incidental to Specified Activities; Russian River Estuary Management...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-24

... Estuary Outlet Channel Adaptive Management Plan; and Feasibility of Alternatives to the Goat Rock State... to, migration, breathing, nursing, breeding, feeding, or sheltering [Level B harassment].'' Summary... is located at Goat Rock State Beach; the estuary extends from the mouth upstream approximately 10 to...

Back-pressure Effect on Shock-Train Location in a Scramjet Engine Isolator

DTIC Science & Technology

2010-03-01

valves .......................................................................................... 57 Side project: making an actuator stand...21 Figure 8. Main manual shut off valve ...................................................................................22 Figure 9 . A small...characteristic about this wind tunnel. With Mach 1.8 nozzle, prior to test runs, the upstream regulator pressure valve (Figure 9 ) was set at

Modeling the Northern Adriatic Double-Gyre Response to Intense Bora Wind: A Revist

DTIC Science & Technology

2006-12-27

simulation (Adriatic monthly upstream location-i. Chiggiato , personal communication) climatological values were used instead). Consequently. in the...geofizicheskaVa. chap. 5, pp. 331 352, Joint Yugoslav-Italian Sci. Coop. Program, Signell, R. P., S. Carniel, L. Cavaleri, J. Chiggiato , J. D. Doyle, J

Three-Dimensional, Laminar Flow Past a Short, Surface-Mounted Cylinder

NASA Astrophysics Data System (ADS)

Liakos, Anastasios; Malamataris, Nikolaos

2016-11-01

The topology and evolution of three-dimensional flow past a cylinder of slenderness ratio SR = 1 mounted in a wind tunnel is examined for 0 . 1 <= Re <= 325 (based on the diameter of the cylinder) where steady-state solutions have been obtained. Direct numerical simulations were computed using an in-house parallel finite element code. Results indicate that symmetry breaking occurs at Re = 1 , while the first prominent structure is a horseshoe vortex downstream from the cylinder. At Re = 150 , two foci are observed, indicating the formation of two tornadolike vortices downstream. Concurrently, another horseshoe vortex is formed upstream from the cylinder. For higher Reynolds numbers, the flow downstream is segmented to upper and lower parts, whereas the topology of the flow on the solid boundaries remains unaltered. Pressure distributions show that pressure, the key physical parameter in the flow, decreases everywhere except immediately upstream from the cylinder. In addition, creation of critical points from saddle-node-type bifurcations occur when the streamwise component of the pressure gradient changes sign. Finally, at Re = 325 , an additional horseshoe vorrtex is formed at the wake of the cylinder

A conserved catalytic residue in the ubiquitin-conjugating enzyme family

PubMed Central

Wu, Pei-Ying; Hanlon, Mary; Eddins, Michael; Tsui, Colleen; Rogers, Richard S.; Jensen, Jane P.; Matunis, Michael J.; Weissman, Allan M.; Wolberger, Cynthia P.; Pickart, Cecile M.

2003-01-01

Ubiquitin (Ub) regulates diverse functions in eukaryotes through its attachment to other proteins. The defining step in this protein modification pathway is the attack of a substrate lysine residue on Ub bound through its C-terminus to the active site cysteine residue of a Ub-conjugating enzyme (E2) or certain Ub ligases (E3s). So far, these E2 and E3 cysteine residues are the only enzyme groups known to participate in the catalysis of conjugation. Here we show that a strictly conserved E2 asparagine residue is critical for catalysis of E2- and E2/RING E3-dependent isopeptide bond formation, but dispensable for upstream and downstream reactions of Ub thiol ester formation. In constrast, the strictly conserved histidine and proline residues immediately upstream of the asparagine are dispensable for catalysis of isopeptide bond formation. We propose that the conserved asparagine side chain stabilizes the oxyanion intermediate formed during lysine attack. The E2 asparagine is the first non-covalent catalytic group to be proposed in any Ub conjugation factor. PMID:14517261

The control of lambda DNA terminase synthesis.

PubMed Central

Murialdo, H; Davidson, A; Chow, S; Gold, M

1987-01-01

Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

Properties of an intergenic terminator and start site switch that regulate IMD2 transcription in yeast.

PubMed

Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel

2008-06-01

The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.

Spatial and temporal patterns of micropollutants upstream and downstream of 24 WWTPs across Switzerland

NASA Astrophysics Data System (ADS)

Spycher, Barbara; Deuber, Fabian; Kistler, David; Burdon, Frank; Reyes, Marta; Alder, Alfredo C.; Joss, Adriano; Eggen, Rik; Singer, Heinz; Stamm, Christian

2015-04-01

Treated wastewater is an important source of micropollutants in many streams. These chemicals consist of very diverse set of compounds that may vary in space and time. In order to improve our understanding of such spatio-temporal patterns of micropollutants in surface waters, we compared upstream and downstream locations at 24 sites across the Swiss Plateau and Jura (12 sites in the 2013 campaign, 12 sites during the 2014 campaign). Each site represents the most upstream treatment plant in the corresponding catchment. This survey is part of the interdisciplinary, Eawag-wide research project EcoImpact that aims at elucidating the ecological effects of micropollutants on stream ecosystems. In 2013, a broad analytical screening was applied to samples collected during winter (January) and summer conditions (June). Based in these results, the bi-monthly samples obtained in 2014 were analysed for a set of about 60 selected organic micropollutants and 10 heavy metals. The screening results demonstrate that generally pharmaceuticals, artificial sweeteners and corrosion inhibitors make up the largest part of the organic micropollutants. Pesticides including biocides and plant protection products are also regularly found but at lower concentrations. This presentation will analyse the variability of the micropollutant patterns across the different sites and how upstream conditions and the wastewater composition changes with season.

Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence

PubMed Central

Gordon, Christopher T.; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y.; Munnich, Arnold; Pennacchio, Len A.; Abadie, Véronique; Temple, I. Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A.; Visel, Axel; Lyonnet, Stanislas

2015-01-01

Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ~1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harbouring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple non-coding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS. PMID:24934569

The economic benefits of vegetation in the upstream area of Ciliwung watershed

NASA Astrophysics Data System (ADS)

Saridewi, T. R.; Nazaruddin

2018-04-01

Ciliwung watershed has strategic values since its entire downstream area is located in the Special Administrative Region of Jakarta (DKI Jakarta), the capital of Indonesia. This causes forest and farmland areas are converted into open areas or built-up areas. The existence of these areas provides enormous environmental and economic benefits. Economic benefit values are very important to be considered in developing a policy development plan, but they have not been calculated yet. This study aims to determine the economic benefits provided by trees and other vegetation anddevelops a development policy that takes into account simultaneously ecological and economic aspects. The study is conducted in the upstream Ciliwung watershed, by using land cover patterns in 1989, 2000, 2010 and 2014, and employs GIS and CITY green analysis. The results show that conversion of forest and farmland areas reduces the ability of Ciliwung upstream watershed to store water. Therefore, its ability to reduce the flow of surface has been decreased. This creates a decrease in the cost savings of annual stormwater, from US 15,175,721 in 1989 to US 13,317,469 in 2014. The Environmental Services Payment Policy (PES) for upstream community groups managing the watershed has been considered as a fairly effective policy.

Application of a Depositional Facies Model to an Acid Mine Drainage Site▿ †

PubMed Central

Brown, Juliana F.; Jones, Daniel S.; Mills, Daniel B.; Macalady, Jennifer L.; Burgos, William D.

2011-01-01

Lower Red Eyes is an acid mine drainage site in Pennsylvania where low-pH Fe(II) oxidation has created a large, terraced iron mound downstream of an anoxic, acidic, metal-rich spring. Aqueous chemistry, mineral precipitates, microbial communities, and laboratory-based Fe(II) oxidation rates for this site were analyzed in the context of a depositional facies model. Depositional facies were defined as pools, terraces, or microterracettes based on cm-scale sediment morphology, irrespective of the distance downstream from the spring. The sediments were composed entirely of Fe precipitates and cemented organic matter. The Fe precipitates were identified as schwertmannite at all locations, regardless of facies. Microbial composition was studied with fluorescence in situ hybridization (FISH) and transitioned from a microaerophilic, Euglena-dominated community at the spring, to a Betaproteobacteria (primarily Ferrovum spp.)-dominated community at the upstream end of the iron mound, to a Gammaproteobacteria (primarily Acidithiobacillus)-dominated community at the downstream end of the iron mound. Microbial community structure was more strongly correlated with pH and geochemical conditions than depositional facies. Intact pieces of terrace and pool sediments from upstream and downstream locations were used in flowthrough laboratory reactors to measure the rate and extent of low-pH Fe(II) oxidation. No change in Fe(II) concentration was observed with 60Co-irradiated sediments or with no-sediment controls, indicating that abiotic Fe(II) oxidation was negligible. Upstream sediments attained lower effluent Fe(II) concentrations compared to downstream sediments, regardless of depositional facies. PMID:21097582

Effect of an upstream bulge configuration on film cooling with and without mist injection.

PubMed

Wang, Jin; Li, Qianqian; Sundén, Bengt; Ma, Ting; Cui, Pei

2017-12-01

To meet the economic requirements of power output, the increased inlet temperature of modern gas turbines is above the melting point of the material. Therefore, high-efficient cooling technology is needed to protect the blades from the hot mainstream. In this study, film cooling was investigated in a simplified channel. A bulge located upstream of the film hole was numerically investigated by analysis of the film cooling effectiveness distribution downstream of the wall. The flow distribution in the plate channel is first presented. Comparing with a case without bulge, different cases with bulge heights of 0.1d, 0.3d and 0.5d were examined with blowing ratios of 0.5 and 1.0. Cases with 1% mist injection were also included in order to obtain better cooling performance. Results show that the bulge configuration located upstream the film hole makes the cooling film more uniform, and enhanceslateral cooling effectiveness. Unlike other cases, the configuration with a 0.3d-height bulge shows a good balance in improving the downstream and lateral cooling effectiveness. Compared with the case without mist at M = 0.5, the 0.3d-height bulge with 1% mist injection increases lateral average effectiveness by 559% at x/d = 55. In addition, a reduction of the thermal stress concentration can be obtained by increasing the height of the bulge configuration. Copyright © 2017 Elsevier Ltd. All rights reserved.

Photographic copy of circa 1934, black and white photograph. Located ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photographic copy of circa 1934, black and white photograph. Located loose in oversized box at the National Museum of American History, Smithsonian Institution, Archives Center, Work and Industry Division, Washington, D.C. Original Photographer unknown. CIRCA 1934 PHOTOGRAPH TAKEN ON WEST BANK APPROACH ROADWAY LOOKING NORTHEAST TOWARD EAST BANK SHOWING DETAIL OF RAILING AND DECORATIVE LIGHT STANDARD AND FIXTURE. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES

PubMed Central

Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.

2008-01-01

Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195

Geological-Seismological Evaluation of Earthquake Hazards for Appurtenant Structures at Gathright Dam, Virginia

DTIC Science & Technology

1990-07-01

1979, Late Holocene faulting and earthquake recurrence in the Reelfoot Lake area, northwestern Tennessee, Bull, Geol. Soc. Am.. vol. J. pp. 1013-1018...upstream from Covington, Virginia. The dam is located in northern Alleghany County and the majority of the reservoir, Lake Moomaw, is located in southern...Bath County. Lake Moomaw is approximately 12 miles (19 km) long and ranges from less than 1/4 to 1-1/2 miles (1/2 to 2-1/2 km) in width. Gathright Dam

The response of streambed nitrogen cycling to spatial and temporal hyporheic vertical flux patterns and associated residence times

NASA Astrophysics Data System (ADS)

Briggs, M. A.; Lautz, L. K.; Hare, D. K.

2011-12-01

Small beaver dams enhance the development of patchy micro-environments along the stream corridor by trapping sediment and creating complex streambed morphologies. This generates intricate hyporheic flux patterns that govern the exchange of oxygen and redox sensitive solutes between the water column and the streambed, and exert control on the biogeochemical cycling of nitrogen. Specifically, flowpaths from the stream into the subsurface with low residence times create oxic conditions that favor nitrification, while flowpaths with longer residence times become anoxic and favor denitrification. To investigate these processes we collected vertical profiles of pore water upstream of two beaver dams in Wyoming, USA at nine locations with varied morphology. We sampled pore water to the 0.55 m depth every week for five weeks as stream discharge dropped by 45% and subsequently measured concentrations of dissolved oxygen and several redox sensitive solutes, including nitrate. Additionally, estimates of hyporheic flux along these nine vertical profiles through time were made using high-resolution heat data combined with 1-D heat transport modeling. The data show that areas of rapid, deep hyporheic flux at the glides immediately upstream of the dams were oxygen rich, and were generally sites of moderate net nitrification to at least the 0.35 m depth. These conditions were relatively steady over the study period. Hyporheic zones at sediment bars closest to the dams were hotspots of nitrate production to a depth of 0.35 m, with nitrate concentrations increasing by as much as 400% as vertical flux fell sharply and residence times increased over the study period. In contrast, shallow bars farther upstream from the dams showed increasing fluxes and decreased residence times, which caused a shift from net denitrification to net nitrification over the period at shallow depths. These results support previous work indicating threshold behavior of nitrogen cycling in response to flowpath residence time. Furthermore the threshold between oxic and anoxic conditions, and subsequently the zone of peak net nitrification, can be approached from either end of the redox spectrum simultaneously within the same system in response to complex temporal changes in vertical flux. Finally, pools were sites of weak hyporheic flux, overall anoxic conditions and net denitrification. These patterns offer more evidence of the complicated spatial and temporal patterns of nitrogen cycling in the hyporheic zone, but also show that flux patterns measured with 1-D heat transport models may be used to develop predictive relationships regarding streambed biogeochemical conditions and hot spots of nitrogen cycling.

Analysis of C. elegans VIG-1 expression.

PubMed

Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

2008-12-31

Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

Logistic model of nitrate in streams of the upper-midwestern United States

USGS Publications Warehouse

Mueller, D.K.; Ruddy, B.C.; Battaglin, W.A.

1997-01-01

Nitrate in surface water can have adverse effects on aquatic life and, in drinking-water supplies, can be a risk to human health. As part of a regional study, nitrates as N (NO3-N) was analyzed in water samples collected from streams throughout 10 Midwestern states during synoptic surveys in 1989, 1990, and 1994. Data from the period immediately following crop planting at 124 sites were analyzed during logistic regression to relate discrete categories of NO3-N concentrations to characteristics of the basins upstream from the sites. The NO3-N data were divided into three categories representing probable background concentrations (10 mg L-1). Nitrate-N concentrations were positively correlated to streamflow, upstream area planted in corn (Zea mays L.), and upstream N- fertilizers application rates. Elevated NO3-N concentrations were associated with poorly drained soils and were weakly correlated with population density. Nitrate-N and streamflow data collected during 1989 and 1990 were used to calibrate the model, and data collected during 1994 were used for verification. The model correctly estimated NO3-N concentration categories for 79% of the samples in the calibration data set and 60% of the samples in the verification data set. The model was used to indicate where NO3-N concentrations might be elevated or exceed the NO3-N MCL in streams throughout the study area. The potential for elevated NO3-N concentrations was predicted to be greatest for streams in Illinois, Indiana, Iowa, and western Ohio.

Temporary Restoration of Bull Trout Passage at Albeni Falls Dam, 2008 Progress Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bellgraph, Brian J.

2009-03-31

The goal of this project is to provide temporary upstream passage of bull trout around Albeni Falls Dam on the Pend Oreille River, Idaho. Our specific objectives are to capture fish downstream of Albeni Falls Dam, tag them with combination acoustic and radio transmitters, release them upstream of Albeni Falls Dam, and determine if genetic information on tagged fish can be used to accurately establish where fish are located during the spawning season. In 2007, radio receiving stations were installed at several locations throughout the Pend Oreille River watershed to detect movements of adult bull trout; however, no bull troutmore » were tagged during that year. In 2008, four bull trout were captured downstream of Albeni Falls Dam, implanted with transmitters, and released upstream of the dam at Priest River, Idaho. The most-likely natal tributaries of bull trout assigned using genetic analyses were Grouse Creek (N = 2); a tributary of the Pack River, Lightning Creek (N = 1); and Rattle Creek (N = 1), a tributary of Lightning Creek. All four bull trout migrated upstream from the release site in Priest River, Idaho, were detected at monitoring stations near Dover, Idaho, and were presumed to reside in Lake Pend Oreille from spring until fall 2008. The transmitter of one bull trout with a genetic assignment to Grouse Creek was found in Grouse Creek in October 2008; however, the fish was not found. The bull trout assigned to Rattle Creek was detected in the Clark Fork River downstream from Cabinet Gorge Dam (approximately 13 km from the mouth of Lightning Creek) in September but was not detected entering Lightning Creek. The remaining two bull trout were not detected in 2008 after detection at the Dover receiving stations. This report details the progress by work element in the 2008 statement of work, including data analyses of fish movements, and expands on the information reported in the quarterly Pisces status reports.« less

Identifying and Classifying Pollution Hotspots to Guide Watershed Management in a Large Multiuse Watershed.

PubMed

Su, Fangli; Kaplan, David; Li, Lifeng; Li, Haifu; Song, Fei; Liu, Haisheng

2017-03-03

In many locations around the globe, large reservoir sustainability is threatened by land use change and direct pollution loading from the upstream watershed. However, the size and complexity of upstream basins makes the planning and implementation of watershed-scale pollution management a challenge. In this study, we established an evaluation system based on 17 factors, representing the potential point and non-point source pollutants and the environmental carrying capacity which are likely to affect the water quality in the Dahuofang Reservoir and watershed in northeastern China. We used entropy methods to rank 118 subwatersheds by their potential pollution threat and clustered subwatersheds according to the potential pollution type. Combining ranking and clustering analyses allowed us to suggest specific areas for prioritized watershed management (in particular, two subwatersheds with the greatest pollution potential) and to recommend the conservation of current practices in other less vulnerable locations (91 small watersheds with low pollution potential). Finally, we identified the factors most likely to influence the water quality of each of the 118 subwatersheds and suggested adaptive control measures for each location. These results provide a scientific basis for improving the watershed management and sustainability of the Dahuofang reservoir and a framework for identifying threats and prioritizing the management of watersheds of large reservoirs around the world.

Identifying and Classifying Pollution Hotspots to Guide Watershed Management in a Large Multiuse Watershed

PubMed Central

Su, Fangli; Kaplan, David; Li, Lifeng; Li, Haifu; Song, Fei; Liu, Haisheng

2017-01-01

In many locations around the globe, large reservoir sustainability is threatened by land use change and direct pollution loading from the upstream watershed. However, the size and complexity of upstream basins makes the planning and implementation of watershed-scale pollution management a challenge. In this study, we established an evaluation system based on 17 factors, representing the potential point and non-point source pollutants and the environmental carrying capacity which are likely to affect the water quality in the Dahuofang Reservoir and watershed in northeastern China. We used entropy methods to rank 118 subwatersheds by their potential pollution threat and clustered subwatersheds according to the potential pollution type. Combining ranking and clustering analyses allowed us to suggest specific areas for prioritized watershed management (in particular, two subwatersheds with the greatest pollution potential) and to recommend the conservation of current practices in other less vulnerable locations (91 small watersheds with low pollution potential). Finally, we identified the factors most likely to influence the water quality of each of the 118 subwatersheds and suggested adaptive control measures for each location. These results provide a scientific basis for improving the watershed management and sustainability of the Dahuofang reservoir and a framework for identifying threats and prioritizing the management of watersheds of large reservoirs around the world. PMID:28273834

Rainfall characteristics and thresholds for periglacial debris flows in the Parlung Zangbo Basin, southeast Tibetan Plateau

NASA Astrophysics Data System (ADS)

Deng, Mingfeng; Chen, Ningsheng; Ding, Haitao

2018-02-01

The Parlung Zangbo Basin in the southeastern Tibet Plateau is affected by the summer monsoon from the Indian Ocean, which produces large rainfall gradients in the basin. Rainfall data during 2012-2015 from five new meteorological stations are used to analyse the rainfall characteristics. The daily rainfall, rainfall duration, mean rainfall intensity, and peak rainfall intensity are consistent, but sometimes contrasting. For example, these values decrease with increasing altitude, and the gradient is large downstream and small upstream, respectively. Moreover, the rainfall intensity peaks between 01:00 and 06:00 and increases during the afternoon. Based on the analysis of 14 debris flow cases in the basin, differences in the rainfall threshold differ depending on the location as sediment varieties. The sediment in the middle portions of the basin is wet and well structured; thus, long-duration, high-intensity rainfall is required to generate debris flows. Ravels in the upstream area are arid and not well structured, and short-duration rainfall is required to trigger debris flows. Between the above two locations, either long-duration, low-intensity rainfall or short-duration, high-intensity rainfall could provoke debris flows. Clearly, differences in rainfall characteristics and rainfall thresholds that are associated with the location must be considered in debris flow monitoring and warnings.

Modeling hydraulic and sediment transport processes in white sturgeon spawning habitat on the Kootenai River, Idaho

USGS Publications Warehouse

McDonald, Richard R.; Nelson, Jonathan M.; Vaughn Paragamian,; Barton, Gary J.

2017-01-01

The Kootenai River white sturgeon currently spawn (2005) in an 18-kilometer reach of the Kootenai River, Idaho. Since completion of Libby Dam upstream from the spawning reach, there has been only one successful year of recruitment of juvenile fish. Where successful in other rivers, white sturgeon spawn over clean coarse material of gravel size or larger. The channel substrate in the current spawning reach is composed primarily of sand and some buried gravel; within a few kilometers upstream there is clean gravel. We used a 2-dimensional flow and sediment-transport model and the measured locations of sturgeon spawning from 1994-2002 to gain insight into the paradox between the current spawning location and the absence of suitable substrate. Spatial correlations between spawning locations and the model simulations of velocity and depth indicate the white sturgeon tend to select regions of highest velocity and depth within any river cross-section to spawn. These regions of high velocity and depth are independent of pre- or post-dam flow conditions. A simple sediment-transport simulation suggests that high discharge and relatively long duration flow associated with pre-dam flow events might be sufficient to scour the sandy substrate and expose existing lenses of gravel and cobble as lag deposits in the current spawning reach.

Effect of wastewater treatment facility closure on endocrine disrupting chemicals in a Coastal Plain stream

USGS Publications Warehouse

Bradley, Paul M.; Journey, Celeste A.; Clark, Jimmy M.

2016-01-01

Wastewater treatment facility (WWTF) closures are rare environmental remediation events; offering unique insight into contaminant persistence, long-term wastewater impacts, and ecosystem recovery processes. The U.S. Geological Survey assessed the fate of select endocrine disrupting chemicals (EDC) in surface water and streambed sediment one year before and one year after closure of a long-term WWTF located within the Spirit Creek watershed at Fort Gordon, Georgia. Sample sites included a WWTF-effluent control located upstream from the outfall, three downstream effluent-impacted sites located between the outfall and Spirit Lake, and one downstream from the lake's outfall. Prior to closure, the 2.2-km stream segment downstream from the WWTF outfall was characterized by EDC concentrations significantly higher (α = 0.05) than at the control site; indicating substantial downstream transport and limited in-stream attenuation of EDC, including pharmaceuticals, estrogens, alkylphenol ethoxylate (APE) metabolites, and organophosphate flame retardants (OPFR). Wastewater-derived pharmaceutical, APE metabolites, and OPFR compounds were also detected in the outflow of Spirit Lake, indicating the potential for EDC transport to aquatic ecosystems downstream of Fort Gordon under effluent discharge conditions. After the WWTF closure, no significant differences in concentrations or numbers of detected EDC compounds were observed between control and downstream locations. The results indicated EDC pseudo-persistence under preclosure, continuous supply conditions, with rapid attenuation following WWTF closure. Low concentrations of EDC at the control site throughout the study and comparable concentrations in downstream locations after WWTF closure indicated additional, continuing, upstream contaminant sources within the Spirit Creek watershed. 

The effect of catch-and-release angling at high water temperatures on behaviour and survival of Atlantic salmon Salmo salar during spawning migration.

PubMed

Havn, T B; Uglem, I; Solem, Ø; Cooke, S J; Whoriskey, F G; Thorstad, E B

2015-08-01

In this study, behaviour and survival following catch-and-release (C&R) angling was investigated in wild Atlantic salmon Salmo salar (n = 75) angled on sport fishing gear in the River Otra in southern Norway at water temperatures of 16.3-21.1 °C. Salmo salar were tagged externally with radio transmitters and immediately released back into the river to simulate a realistic C&R situation. The majority of S. salar (91%) survived C&R. Most S. salar that were present in the River Otra during the spawning period 3-4 months later were located at known spawning grounds. Downstream movements (median furthest position: 0.5 km, range: 0.1-11.0 km) during the first 4 days after release were recorded for 72% of S. salar, presumably stress-induced fallback associated with C&R. Individuals that fell back spent a median of 15 days before commencing their first upstream movement after release, and 34 days before they returned to or were located above their release site. Mortality appeared to be somewhat elevated at the higher end of the temperature range (14% at 18-21 °C), although sample sizes were low. In conclusion, C&R at water temperatures up to 18 °C had small behavioural consequences and was associated with low mortality (7%). Nevertheless, low levels of mortality occur due to C&R angling and these losses should be accounted for by management authorities in rivers where C&R is practised. Refinement of best practices for C&R may help to reduce mortality, particularly at warmer temperatures. © 2015 The Fisheries Society of the British Isles.

Nonlinearity Analysis for Efficient Modelling of Long-Term CO2 Storage

NASA Astrophysics Data System (ADS)

Li, Boxiao; Benson, Sally; Tchelepi, Hamdi

2014-05-01

Numerical simulation is widely used to predict the long-term fate of the injected CO2 in a storage formation. Performing large-scale simulations is often limited by the computational speed, where convergence failure of Newton iterations is one of the main bottlenecks. In order to design better numerical schemes and faster nonlinear solvers for modelling long-term CO2 storage, the nonlinearity in the simulations has to be analysed thoroughly, and the cause of convergence failures has to be identified clearly. We focus on the transport of CO2 and water in the presence of viscous, gravity, and heterogeneous capillary forces. We investigate the nonlinearity of the discrete transport equation obtained from finite-volume discretization with single-point phase-based upstream weighting, which is the industry standard. In particular, we study the discretized flux expressed as a function of saturations at the upstream and downstream (with respect to the total velocity) of each gridblock interface. We analyse the locations and complexity of the unit-flux, zero-flux, and inflection lines on the numerical flux. The unit- and zero-flux lines, referred to as kinks, correspond to a change of the flow direction, which often occurs when strong buoyancy and capillarity are present. We observe that these kinks and inflection lines are major sources of nonlinear convergence difficulties. We find that kinks create more challenges than inflection lines, especially when their locations depend on both the upstream and downstream saturations of the total velocity. When the flow is driven by viscous and gravity forces (e.g., during CO2 injection), one kink will occur in the numerical flux and its location depends only on the upstream saturation. However, when capillarity is dominant (e.g., during the post-injection period), two kinks will occur and both are functions of the upstream and downstream saturations, causing severe convergence difficulties particularly when heterogeneity is present. Our analysis of the numerical flux theoretically describes the cause of the convergence failures for simulating long-term CO2 storage. This understanding provides useful guidance in designing numerical schemes and nonlinear solvers that overcome the convergence bottlenecks. For example, to reduce the nonlinearity introduced by the two kinks in the presence of capillarity, we modify the method of Cances (2009) to discretize the capillary flux. Consequently, only one kink will occur even for coupled viscous, buoyancy, and heterogeneous capillary forces, and the kink depends only on the upstream saturation of the total velocity. An efficient nonlinear solver that is a significant refinement of the works of Jenny et al. (2009) and Wang and Tchelepi (2013) has also been proposed and demonstrated. References [1] C. Cances. Finite volume scheme for two-phase flows in heterogeneous porous media involving capillary pressure discontinuities. ESAIM:M2AN., 43, 973-1001, (2009). [2] P. Jenny, H.A. Tchelepi, and S.H. Lee. Unconditionally convergent nonlinear solver for hyperbolic conservation laws with S-shaped flux functions. J. Comput. Phys., 228, 7497-7512, (2009). [3] X. Wang and H.A. Tchelepi. Trust-region based solver for nonlinear transport in heterogeneous porous media. J. Comput. Phys., 253, 114-137, (2013).

Occurrence and partitioning of antibiotic compounds found in the water column and bottom sediments from a stream receiving two wastewater treatment plant effluents in northern New Jersey, 2008.

PubMed

Gibs, Jacob; Heckathorn, Heather A; Meyer, Michael T; Klapinski, Frank R; Alebus, Marzooq; Lippincott, Robert L

2013-08-01

An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature. Published by Elsevier B.V.

Occurence of antibiotic compounds found in the water column and bottom sediments from a stream receiving two waste water treatment plant effluents in northern New Jersey, 2008

USGS Publications Warehouse

Gibs, Jacob; Heckathorn, Heather A.; Meyer, Michael T.; Klapinski, Frank R.; Alebus, Marzooq; Lippincott, Robert

2013-01-01

An urban watershed in northern New Jersey was studied to determine the presence of four classes of antibiotic compounds (macrolides, fluoroquinolones, sulfonamides, and tetracyclines) and six degradates in the water column and bottom sediments upstream and downstream from the discharges of two wastewater treatment plants (WWTPs) and a drinking-water intake (DWI). Many antibiotic compounds in the four classes not removed by conventional WWTPs enter receiving waters and partition to stream sediments. Samples were collected at nine sampling locations on 2 days in September 2008. Two of the nine sampling locations were background sites upstream from two WWTP discharges on Hohokus Brook. Another background site was located upstream from a DWI on the Saddle River above the confluence with Hohokus Brook. Because there is a weir downstream of the confluence of Hohokus Brook and Saddle River, the DWI receives water from Hohokus Brook at low stream flows. Eight antibiotic compounds (azithromycin (maximum concentration 0.24 μg/L), ciprofloxacin (0.08 μg/L), enrofloxacin (0.015 μg/L), erythromycin (0.024 μg/L), ofloxacin (0.92 μg/L), sulfamethazine (0.018 μg/L), sulfamethoxazole (0.25 μg/L), and trimethoprim (0.14 μg/L)) and a degradate (erythromycin-H2O (0.84 μg/L)) were detected in the water samples from the sites downstream from the WWTP discharges. The concentrations of six of the eight detected compounds and the detected degradate compound decreased with increasing distance downstream from the WWTP discharges. Azithromycin, ciprofloxacin, ofloxacin, and trimethoprim were detected in stream-bottom sediments. The concentrations of three of the four compounds detected in sediments were highest at a sampling site located downstream from the WWTP discharges. Trimethoprim was detected in the sediments from a background site. Pseudo-partition coefficients normalized for streambed sediment organic carbon concentration were calculated for azithromycin, ciprofloxacin, and ofloxacin. Generally, there was good agreement between the decreasing order of the pseudo-partition coefficients in this study and the order reported in the literature.

Optimization of Microphone Locations for Acoustic Liner Impedance Eduction

NASA Technical Reports Server (NTRS)

Jones, M. G.; Watson, W. R.; June, J. C.

2015-01-01

Two impedance eduction methods are explored for use with data acquired in the NASA Langley Grazing Flow Impedance Tube. The first is an indirect method based on the convected Helmholtz equation, and the second is a direct method based on the Kumaresan and Tufts algorithm. Synthesized no-flow data, with random jitter to represent measurement error, are used to evaluate a number of possible microphone locations. Statistical approaches are used to evaluate the suitability of each set of microphone locations. Given the computational resources required, small sample statistics are employed for the indirect method. Since the direct method is much less computationally intensive, a Monte Carlo approach is employed to gather its statistics. A comparison of results achieved with full and reduced sets of microphone locations is used to determine which sets of microphone locations are acceptable. For the indirect method, each array that includes microphones in all three regions (upstream and downstream hard wall sections, and liner test section) provides acceptable results, even when as few as eight microphones are employed. The best arrays employ microphones well away from the leading and trailing edges of the liner. The direct method is constrained to use microphones opposite the liner. Although a number of arrays are acceptable, the optimum set employs 14 microphones positioned well away from the leading and trailing edges of the liner. The selected sets of microphone locations are also evaluated with data measured for ceramic tubular and perforate-over-honeycomb liners at three flow conditions (Mach 0.0, 0.3, and 0.5). They compare favorably with results attained using all 53 microphone locations. Although different optimum microphone locations are selected for the two impedance eduction methods, there is significant overlap. Thus, the union of these two microphone arrays is preferred, as it supports usage of both methods. This array contains 3 microphones in the upstream hard wall section, 14 microphones opposite the liner, and 3 microphones in the downstream hard wall section.

Simulating the hydrologic impacts of land-cover and climate changes in a semi-arid watershed

EPA Science Inventory

Changes in climate and land cover are principal variables affecting watershed hydrology. This paper uses a cell-based model to examine the hydrologic impacts of climate and land cover changes in the semi-arid Lower Virgin River (LVR) watershed located upstream of Lake Mead, Nevad...

Supersonic Particle Impact Test Capabilities: Investigative Report

NASA Technical Reports Server (NTRS)

Rosales, Keisa

2007-01-01

NASA Johnson Space Center White Sands Test Facility (WSTF) performed particle impact flow tests to determine the maximum capabilities of the particle impact test systems in different configurations. Additional flow tests were performed to determine the target pressures at given upstream conditions to supplement the WSTF data located in ASTM Manual 36 (2000).

ARSENIC TRANSPORT ACROSS THE GROUNDWATER – SURFACE WATER INTERFACE AT A SITE IN CENTRAL MASSACHUSETTS

EPA Science Inventory

Plow Shop Pond, located in central Massachusetts within the New England ‘arsenic belt,’ receives water from a series of interconnected upstream ponds as well as from upward-discharging groundwater. A small, shallow embayment on the southwest side of the pond is known as Red Cove...

EVALUATION OF MICROSOMAL AND CYTOSOLIC BIOMARKERS IN A SEVEN-DAY LARVAL TROUT SEIMENT TOXICITY TEST

EPA Science Inventory

Rainbow trout (Oncorhynclus mykiss) sac fry (larvae) were exposed to River Po sediments for 7 days. The sediments were collected in the River Po at two sites located upstream and downstream of the confluence of a polluted tributary, the River Lambro. An additional sediment treatm...

33 CFR 165.170 - Safety Zone; Military Munitions Recovery, Raritan River, Raritan, NJ.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 2 2014-07-01 2014-07-01 false Safety Zone; Military Munitions... § 165.170 Safety Zone; Military Munitions Recovery, Raritan River, Raritan, NJ. (a) Location. The following area is a safety zone: All navigable waters of the Raritan River upstream of the Perth Amboy...

21. DIABLO POWERHOUSE: LOOKING AT THE TRUNION FOR THE BUTTERFLY ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

21. DIABLO POWERHOUSE: LOOKING AT THE TRUNION FOR THE BUTTERFLY VALVE AND DRAIN FOR SCROLL CASE FOR UNIT 32. THESE ARE LOCATED ON THE SAME LEVEL IN THE POWERHOUSE AS THE LOWER OIL ROOM, 1989. - Skagit Power Development, Diablo Powerhouse, On Skagit River, 6.1 miles upstream from Newhalem, Newhalem, Whatcom County, WA

Shape of the equatorial magnetopause affected by the radial interplanetary magnetic field

NASA Astrophysics Data System (ADS)

Grygorov, K.; Šafránková, J.; Němeček, Z.; Pi, G.; Přech, L.; Urbář, J.

2017-11-01

The ability of a prediction of the magnetopause location under various upstream conditions can be considered as a test of our understanding of the solar wind-magnetosphere interaction. The present magnetopause models are parametrized with the solar wind dynamic pressure and usually with the north-south interplanetary magnetic field (IMF) component. However, several studies pointed out an importance of the radial IMF component, but results of these studies are controversial up to now. The present study compares magnetopause observations by five THEMIS spacecraft during long lasting intervals of the radial IMF with two empirical magnetopause models. A comparison reveals that the magnetopause location is highly variable and that the average difference between the observed and predicted positions is ≈ + 0.7 RE under this condition. The difference does not depend on the local times and other parameters, like the upstream pressure, IMF north-south component, or tilt angle of the Earth dipole. We conclude that our results strongly support the suggestion on a global expansion of the equatorial magnetopause during intervals of the radial IMF.

Association of ADRB2 polymorphism with triglyceride levels in Tongans.

PubMed

Naka, Izumi; Ohashi, Jun; Kimura, Ryosuke; Inaoka, Tsukasa; Matsumura, Yasuhiro

2013-07-23

Our previous study demonstrated that the A-allele of the single nucleotide polymorphism (SNP) rs34623097 located in the upstream region of the β2 adrenergic receptor gene (ADRB2) is significantly associated with risk for obesity in Oceanic populations. To investigate whether the ADRB2 polymorphisms explain part of the individual differences in lipid mobilization, energy expenditure and glycogen breakdown, the associations of 10 ADRB2 SNPs with total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and triglyceride levels were examined in 128 adults in Tonga. A multiple linear regression analysis adjusted for age, sex, and body mass index revealed that rs34623097 was significantly associated with triglyceride levels (P-value = 0.037). A copy of the rs34623097-A allele increased serum triglyceride levels by 70.1 mg/dL (0.791 mmol/L). None of the ADRB2 SNPs showed a significant association with total-cholesterol, high-density lipoprotein cholesterol, or low-density lipoprotein cholesterol. In a Tongan population, a SNP located in the upstream region of ADRB2 is associated with triglyceride levels independent of body mass index.

Effects of Unsteadiness Due to Wake Passing on Rotor Blade Heat Transfer

NASA Technical Reports Server (NTRS)

Ameri, Ali A.; Rigby, David L.; Heidmann, James; Steinthorsson, Erlendur; Fabian, John C.

2007-01-01

14. ABSTRACT In a gas turbine engine, the turbine rotor blades are buffeted by the wakes of the vanes located upstream. There is a transient effect from the passing of wakes on the blade heat transfer. This transient effect has been computed for a representative rotor by introducing a wake upstream via an unsteady inlet flow boundary condition, or "gust" condition. Two cases of turbulent flow and laminar flow with Reynolds numbers of 385,000 and 385 respectively were considered. For the turbulent flow case a quasi-steady calculation was also performed. The variation in the unsteady heat transfer coefficient was found to be as high as 120 percent of the mean. For the turbulent flow case a quasisteady calculation was also performed. The time mean of the unsteady heat transfer, the mean of the quasi-steady variations and the steady results agree reasonably well on all blade locations except for the turbulent results which differ near the leading edge. The quasi-steady heat transfer results do not agree with the instantaneous unsteady results, although the time-mean values are similar.

Video evaluation of passage efficiency of American shad and sea lamprey in a modified Ice Harbor fishway

USGS Publications Warehouse

Haro, A.; Kynard, B.

1997-01-01

Movement and behavior of adult American shad Alosa sapidissima and sea lamprey Petromyzon marinus were monitored by closed-circuit video at several locations within a modified Ice Harbor fishway. American shad ascended and descended the fishway exclusively by surface weirs, while sea lampreys used both surface weirs and submerged orifices. Upstream movement of American shad during the day was higher than at night at both lower and middle fishway observation sites. Peak downstream movement of American shad at both locations was associated with decreasing light levels in the evening. Sea lampreys moved primarily at night at the lower and middle fishway sites. Mean daily passage efficiency was low (1% for American shad, -2% for sea lamprey) at the lower fishway surface weir, but passage efficiency at the middle fishway surface weir was moderate (70% for American shad, 35% for sea lamprey). High water velocity, air entrainment, and turbulence of the modified Ice Harbor fishway design appeared to inhibit American shad and sea lamprey passage by disrupting upstream migratory motivation and visual and rheotactic orientation.

Kin28 regulates the transient association of Mediator with core promoters.

PubMed

Jeronimo, Célia; Robert, François

2014-05-01

Mediator is an essential, broadly used eukaryotic transcriptional coactivator. How and what Mediator communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence, upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity or in cells in which the RNAPII C-terminal domain is mutated to replace Ser5 with alanine, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is released quickly from promoters after phosphorylation of Ser5 by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter.

Simultaneous observation of Pc 3-4 pulsations in the solar wind and in the earth's magnetosphere

NASA Technical Reports Server (NTRS)

Engebretson, M. J.; Zanetti, L. J.; Potemra, T. A.; Baumjohann, W.; Luehr, H.; Acuna, M. H.

1987-01-01

The equatorially orbiting Active Magnetospheric Particle Tracer Explorers CCE and IRM satellites have made numerous observations of Pc 3-4 magnetic field pulsations (10-s to 100-s period) simultaneously at locations upstream of the earth's bow shock and inside the magnetosphere. These observations show solar wind/IMF control of two categories of dayside magnetospheric pulsations. Harmonically structured, azimuthally polarized pulsations are commonly observed from L = 4 to 9 in association with upstream waves. More monochromatic compressional pulsations are clearly evident on occasion, with periods identical to those observed simultaneously in the solar wind. The observations reported here are consistent with a high-latitude (cusp) entry mechanism for wave energy related to harmonically structured pulsations.

Variation in local abundance and species richness of stream fishes in relation to dispersal barriers: Implications for management and conservation

USGS Publications Warehouse

Nislow, K.H.; Hudy, M.; Letcher, B.H.; Smith, E.P.

2011-01-01

1.Barriers to immigration, all else being equal, should in principle depress local abundance and reduce local species richness. These issues are particularly relevant to stream-dwelling species when improperly designed road crossings act as barriers to migration with potential impacts on the viability of upstream populations. However, because abundance and richness are highly spatially and temporally heterogeneous and the relative importance of immigration on demography is uncertain, population- and community-level effects can be difficult to detect. 2.In this study, we tested the effects of potential barriers to upstream movements on the local abundance and species richness of a diverse assemblage of resident stream fishes in the Monongahela National Forest, West Virginia, U.S.A. Fishes were sampled using simple standard techniques above- and below road crossings that were either likely or unlikely to be barriers to upstream fish movements (based on physical dimensions of the crossing). We predicted that abundance of resident fishes would be lower in the upstream sections of streams with predicted impassable barriers, that the strength of the effect would vary among species and that variable effects on abundance would translate into lower species richness. 3.Supporting these predictions, the statistical model that best accounted for variation in abundance and species richness included a significant interaction between location (upstream or downstream of crossing) and type (passable or impassable crossing). Stream sections located above predicated impassable culverts had fewer than half the number of species and less than half the total fish abundance, while stream sections above and below passable culverts had essentially equivalent richness and abundance. 4.Our results are consistent with the importance of immigration and population connectivity to local abundance and species richness of stream fishes. In turn, these results suggest that when measured at appropriate scales (multiple streams within catchments), with simple protocols amenable to use by management agencies, differences in local abundance and species richness may serve as indicators of the extent to which road crossings are barriers to fish movement and help determine whether road-crossing improvements have restored connectivity to stream fish populations and communities. Published 2011. This article is a US Government work and is in the public domain in the USA.

Assessment of potential effects of water produced from coalbed natural gas development on macroinvertebrate and algal communities in the Powder River and Tongue River, Wyoming and Montana, 2010

USGS Publications Warehouse

Peterson, David A.; Hargett, Eric G.; Feldman, David L.

2011-01-01

Ongoing development of coalbed natural gas in the Powder River structural basin in Wyoming and Montana led to formation of an interagency aquatic task group to address concerns about the effects of the resulting production water on biological communities in streams of the area. Ecological assessments, made from 2005–08 under the direction of the task group, indicated biological condition of the macroinvertebrate and algal communities in the middle reaches of the Powder was lower than in the upper or lower reaches. On the basis of the 2005–08 results, sampling of the macroinvertebrate and algae communities was conducted at 18 sites on the mainstem Powder River and 6 sites on the mainstem Tongue River in 2010. Sampling-site locations were selected on a paired approach, with sites located upstream and downstream of discharge points and tributaries associated with coalbed natural gas development. Differences in biological condition among site pairs were evaluated graphically and statistically using multiple lines of evidence that included macroinvertebrate and algal community metrics (such as taxa richness, relative abundance, functional feeding groups, and tolerance) and output from observed/expected (O/E) macroinvertebrate models from Wyoming and Montana. Multiple lines of evidence indicated a decline in biological condition in the middle reaches of the Powder River, potentially indicating cumulative effects from coalbed natural gas discharges within one or more reaches between Flying E Creek and Wild Horse Creek in Wyoming. The maximum concentrations of alkalinity in the Powder River also occurred in the middle reaches. Biological condition in the upper and lower reaches of the Powder River was variable, with declines between some site pairs, such as upstream and downstream of Dry Fork and Willow Creek, and increases at others, such as upstream and downstream of Beaver Creek. Biological condition at site pairs on the Tongue River showed an increase in one case, near the Wyoming-Montana border, and a decrease in another case, upstream of Tongue River Reservoir. Few significant differences were noted from upstream to downstream of Prairie Dog Creek, a major tributary to the Tongue River. Further study would be needed to confirm the observed patterns and choose areas to examine in greater detail.

Continuous measurements of water surface height and width along a 6.5km river reach for discharge algorithm development

NASA Astrophysics Data System (ADS)

Tuozzolo, S.; Durand, M. T.; Pavelsky, T.; Pentecost, J.

2015-12-01

The upcoming Surface Water and Ocean Topography (SWOT) satellite will provide measurements of river width and water surface elevation and slope along continuous swaths of world rivers. Understanding water surface slope and width dynamics in river reaches is important for both developing and validating discharge algorithms to be used on future SWOT data. We collected water surface elevation and river width data along a 6.5km stretch of the Olentangy River in Columbus, Ohio from October to December 2014. Continuous measurements of water surface height were supplemented with periodical river width measurements at twenty sites along the study reach. The water surface slope of the entire reach ranged from during 41.58 cm/km at baseflow to 45.31 cm/km after a storm event. The study reach was also broken into sub-reaches roughly 1km in length to study smaller scale slope dynamics. The furthest upstream sub-reaches are characterized by free-flowing riffle-pool sequences, while the furthest downstream sub-reaches were directly affected by two low-head dams. In the sub-reaches immediately upstream of each dam, baseflow slope is as low as 2 cm/km, while the furthest upstream free-flowing sub-reach has a baseflow slope of 100 cm/km. During high flow events the backwater effect of the dams was observed to propagate upstream: sub-reaches impounded by the dams had increased water surface slopes, while free flowing sub-reaches had decreased water surface slopes. During the largest observed flow event, a stage change of 0.40 m affected sub-reach slopes by as much as 30 cm/km. Further analysis will examine height-width relationships within the study reach and relate cross-sectional flow area to river stage. These relationships can be used in conjunction with slope data to estimate discharge using a modified Manning's equation, and are a core component of discharge algorithms being developed for the SWOT mission.

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression.

PubMed

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-04-08

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located approximately 2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Lunar Surface Electric Potential Changes Associated with Traversals through the Earth's Foreshock

NASA Technical Reports Server (NTRS)

Collier, Michael R.; Hills, H. Kent; Stubbs, Timothy J.; Halekas, Jasper S.; Delory, Gregory T.; Espley, Jared; Farrell, William M.; Freeman, John W.; Vondrak, Richard

2011-01-01

We report an analysis of one year of Suprathermal Ion Detector Experiment (SIDE) Total Ion Detector (TID) resonance events observed between January 1972 and January 1973. The study includes only those events during which upstream solar wind conditions were readily available. The analysis shows that these events are associated with lunar traversals through the dawn flank of the terrestrial magnetospheric bow shock. We propose that the events result from an increase in lunar surface electric potential effected by secondary electron emission due to primary electrons in the Earth's foreshock region (although primary ions may play a role as well). This work establishes (1) the lunar surface potential changes as the Moon moves through the terrestrial bow shock, (2) the lunar surface achieves potentials in the upstream foreshock region that differ from those in the downstream magnetosheath region, (3) these differences can be explained by the presence of energetic electron beams in the upstream foreshock region and (4) if this explanation is correct, the location of the Moon with respect to the terrestrial bow shock influences lunar surface potential.

Upstream vertical cavity surface-emitting lasers for fault monitoring and localization in WDM passive optical networks

NASA Astrophysics Data System (ADS)

Wong, Elaine; Zhao, Xiaoxue; Chang-Hasnain, Connie J.

2008-04-01

As wavelength division multiplexed passive optical networks (WDM-PONs) are expected to be first deployed to transport high capacity services to business customers, real-time knowledge of fiber/device faults and the location of such faults will be a necessity to guarantee reliability. Nonetheless, the added benefit of implementing fault monitoring capability should only incur minimal cost associated with upgrades to the network. In this work, we propose and experimentally demonstrate a fault monitoring and localization scheme based on a highly-sensitive and potentially low-cost monitor in conjunction with vertical cavity surface-emitting lasers (VCSELs). The VCSELs are used as upstream transmitters in the WDM-PON. The proposed scheme benefits from the high reflectivity of the top distributed Bragg reflector (DBR) mirror of optical injection-locked (OIL) VCSELs to reflect monitoring channels back to the central office for monitoring. Characterization of the fault monitor demonstrates high sensitivity, low bandwidth requirements, and potentially low output power. The added advantage of the proposed fault monitoring scheme incurs only a 0.5 dB penalty on the upstream transmissions on the existing infrastructure.

Upstream Passage, Spawning, and Stock Identification of Fall Chinook in the Snake River, 1992 and 1993 : Final Report.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blankenship, H. Lee; Mendel, Glen W.

This final report of the 3-year study summarizes activities and results for 1993. Study objectives were to: (1) determine the source of losses (or accounting errors) for adult chinook salmon between Ice Harbor Dam (IHR) and Lower Granite Dam (LGR), and upstream of LGR in the Snake River; (2) identify spawning locations upstream of LGR for calibration of aerial redd surveys, redd habitat mapping, carcass recovery for genetic stock profile analysis, and correction of estimated adult/redd ratios; and (3) estimate passage and migration times at Snake River. 200 fall chinook salmon were radio tagged and tracked with aerial, fixed-site, andmore » ground mobile tracking. Fish were released upstream of IHR at Charbonneau Park (CHAR). 190 of the fish were tracked or relocated away from CHAR. 59 fish descended to below IHR without crossing Lower Monumental Dam (LMO). Another 128 salmon passed upstream of LMO without falling back at IHR. Only 80 salmon passed Little Goose Dam (LGO) without falling back at a downstream dam; 66 of these fish passed LGR. Many fish that fell back reascended the dams. A total of 72 salmon released at CHAR passed upstream of LGR, including fish that had fallen back and reascended a dam. Over 80 percent of the salmon that entered Lyons Ferry Hatchery each year had reached LGO before descending to the hatchery. Extensive wandering was documented between LMO and upstream of LGR before salmon entered Lyons Ferry Hatchery or the Tucannon River. In 1993, 41 salmon were found to be of hatchery origin when recovered. These fish entered Lyons Ferry Hatchery with similar movements to unmarked salmon. Each year a few salmon have remained near the hatchery without entering, which suggests the hatchery may have inadequate attraction flows. Fall chinook passed lower Snake River dams in 2-5 days each on average. Median travel times through LMO and LGO were 1.0-1.3 days each, which was slower than for spring chinook or steelhead in 1993. 5 refs., 21 figs., 20 tabs.« less

An allele of the crm gene blocks cyanobacterial circadian rhythms.

PubMed

Boyd, Joseph S; Bordowitz, Juliana R; Bree, Anna C; Golden, Susan S

2013-08-20

The SasA-RpaA two-component system constitutes a key output pathway of the cyanobacterial Kai circadian oscillator. To date, rhythm of phycobilisome associated (rpaA) is the only gene other than kaiA, kaiB, and kaiC, which encode the oscillator itself, whose mutation causes completely arrhythmic gene expression. Here we report a unique transposon insertion allele in a small ORF located immediately upstream of rpaA in Synechococcus elongatus PCC 7942 termed crm (for circadian rhythmicity modulator), which results in arrhythmic promoter activity but does not affect steady-state levels of RpaA. The crm ORF complements the defect when expressed in trans, but only if it can be translated, suggesting that crm encodes a small protein. The crm1 insertion allele phenotypes are distinct from those of an rpaA null; crm1 mutants are able to grow in a light:dark cycle and have no detectable oscillations of KaiC phosphorylation, whereas low-amplitude KaiC phosphorylation rhythms persist in the absence of RpaA. Levels of phosphorylated RpaA in vivo measured over time are significantly altered compared with WT in the crm1 mutant as well as in the absence of KaiC. Taken together, these results are consistent with the hypothesis that the Crm polypeptide modulates a circadian-specific activity of RpaA.

A novel membrane-bound toxin for cell division, CptA (YgfX), inhibits polymerization of cytoskeleton proteins, FtsZ and MreB, in Escherichia coli.

PubMed

Masuda, Hisako; Tan, Qian; Awano, Naoki; Yamaguchi, Yoshihiro; Inouye, Masayori

2012-03-01

Nearly all free-living bacteria carry toxin-antitoxin (TA) systems on their genomes, through which cell growth and death are regulated. Toxins target a variety of essential cellular functions, including DNA replication, translation, and cell division. Here, we identified a novel toxin, YgfX, on the Escherichia coli genome. The toxin, consisting of 135 residues, is composed of the N-terminal membrane domain, which encompasses two transmembrane segments, and the C-terminal cytoplasmic domain. Upon YgfX expression, the cells were initially elongated and then the middle portion of the cells became inflated to form a lemon shape. YgfX was found to interact with MreB and FtsZ, two essential cytoskeletal proteins in E. coli. The cytoplasmic domain [YgfX(C)] was found to be responsible for the YgfX toxicity, as purified YgfX(C) was found to block the polymerization of FtsZ and MreB in vitro. YgfY, located immediately upstream of YgfX, was shown to be the cognate antitoxin; notably, YgfX is the first membrane-associating toxin in bacterial TA systems. We propose to rename the toxin and the antitoxin as CptA and CptB (for Cytoskeleton Polymerization inhibiting Toxin), respectively. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Cellodextrin utilization by bifidobacterium breve UCC2003.

PubMed

Pokusaeva, Karina; O'Connell-Motherway, Mary; Zomer, Aldert; Macsharry, John; Fitzgerald, Gerald F; van Sinderen, Douwe

2011-03-01

Cellodextrins, the incomplete hydrolysis products from insoluble cellulose, are accessible as a carbon source to certain members of the human gut microbiota, such as Bifidobacterium breve UCC2003. Transcription of the cldEFGC gene cluster of B. breve UCC2003 was shown to be induced upon growth on cellodextrins, implicating this cluster in the metabolism of these sugars. Phenotypic analysis of a B. breve UCC2003::cldE insertion mutant confirmed that the cld gene cluster is exclusively required for cellodextrin utilization by this commensal. Moreover, our results suggest that transcription of the cld cluster is controlled by a LacI-type regulator encoded by cldR, located immediately upstream of cldE. Gel mobility shift assays using purified CldR(His) (produced by the incorporation of a His(12)-encoding sequence into the 3' end of the cldC gene) indicate that the cldEFGC promoter is subject to negative control by CldR(His), which binds to two inverted repeats. Analysis by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) of medium samples obtained during growth of B. breve UCC2003 on a mixture of cellodextrins revealed its ability to utilize cellobiose, cellotriose, cellotetraose, and cellopentaose, with cellotriose apparently representing the preferred substrate. The cldC gene of the cld operon of B. breve UCC2003 is, to the best of our knowledge, the first described bifidobacterial β-glucosidase exhibiting hydrolytic activity toward various cellodextrins.

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE PAGES

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.; ...

2015-04-08

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Rhodopseudomonas palustris CGA010 Proteome Implicates Extracytoplasmic Function Sigma Factor in Stress Response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, Michael S.; Hurst, Gregory B.; Lu, Tse-Yuan S.

Rhodopseudomonas palustris encodes 16 extracytoplasmic function (ECF) σ factors. In this paper, to begin to investigate the regulatory network of one of these ECF σ factors, the whole proteome of R. palustris CGA010 was quantitatively analyzed by tandem mass spectrometry from cultures episomally expressing the ECF σ RPA4225 (ecfT) versus a WT control. Among the proteins with the greatest increase in abundance were catalase KatE, trehalose synthase, a DPS-like protein, and several regulatory proteins. Alignment of the cognate promoter regions driving expression of several upregulated proteins suggested a conserved binding motif in the -35 and -10 regions with the consensusmore » sequence GGAAC-18N-TT. Additionally, the putative anti-σ factor RPA4224, whose gene is contained in the same predicted operon as RPA4225, was identified as interacting directly with the predicted response regulator RPA4223 by mass spectrometry of affinity-isolated protein complexes. Furthermore, another gene (RPA4226) coding for a protein that contains a cytoplasmic histidine kinase domain is located immediately upstream of RPA4225. The genomic organization of orthologs for these four genes is conserved in several other strains of R. palustris as well as in closely related α-Proteobacteria. Finally, taken together, these data suggest that ECF σ RPA4225 and the three additional genes make up a sigma factor mimicry system in R. palustris.« less

Shikimate Induced Transcriptional Activation of Protocatechuate Biosynthesis Genes by QuiR, a LysR-Type Transcriptional Regulator, in Listeria monocytogenes.

PubMed

Prezioso, Stephanie M; Xue, Kevin; Leung, Nelly; Gray-Owen, Scott D; Christendat, Dinesh

2018-04-27

Listeria monocytogenes is a common foodborne bacterial pathogen that contaminates plant and animal consumable products. The persistent nature of L. monocytogenes is associated with millions of dollars in food recalls annually. Here, we describe the role of shikimate in directly modulating the expression of genes encoding enzymes for the conversion of quinate and shikimate metabolites to protocatechuate. In L. monocytogenes, these genes are found within two operons, named qui1 and qui2. In addition, a gene named quiR, encoding a LysR-Type Transcriptional Regulator (QuiR), is located immediately upstream of the qui1 operon. Transcriptional lacZ-promoter fusion experiments show that QuiR induces gene expression of both qui1 and qui2 operons in the presence of shikimate. Furthermore, co-crystallization of the QuiR effector binding domain in complex with shikimate provides insights into the mechanism of activation of this regulator. Together these data show that upon shikimate accumulation, QuiR activates the transcription of genes encoding enzymes involved in shikimate and quinate utilization for the production of protocatechuate. Furthermore, the accumulation of protocatechuate leads to the inhibition of Listeria growth. Since protocatechuate is not known to be utilized by Listeria, its role is distinct from those established in other bacteria. Copyright © 2018 Elsevier Ltd. All rights reserved.

Simple setup for gas-phase H/D exchange mass spectrometry coupled to electron transfer dissociation and ion mobility for analysis of polypeptide structure on a liquid chromatographic time scale.

PubMed

Mistarz, Ulrik H; Brown, Jeffery M; Haselmann, Kim F; Rand, Kasper D

2014-12-02

Gas-phase hydrogen/deuterium exchange (HDX) is a fast and sensitive, yet unharnessed analytical approach for providing information on the structural properties of biomolecules, in a complementary manner to mass analysis. Here, we describe a simple setup for ND3-mediated millisecond gas-phase HDX inside a mass spectrometer immediately after ESI (gas-phase HDX-MS) and show utility for studying the primary and higher-order structure of peptides and proteins. HDX was achieved by passing N2-gas through a container filled with aqueous deuterated ammonia reagent (ND3/D2O) and admitting the saturated gas immediately upstream or downstream of the primary skimmer cone. The approach was implemented on three commercially available mass spectrometers and required no or minor fully reversible reconfiguration of gas-inlets of the ion source. Results from gas-phase HDX-MS of peptides using the aqueous ND3/D2O as HDX reagent indicate that labeling is facilitated exclusively through gaseous ND3, yielding similar results to the infusion of purified ND3-gas, while circumventing the complications associated with the use of hazardous purified gases. Comparison of the solution-phase- and gas-phase deuterium uptake of Leu-Enkephalin and Glu-Fibrinopeptide B, confirmed that this gas-phase HDX-MS approach allows for labeling of sites (heteroatom-bound non-amide hydrogens located on side-chains, N-terminus and C-terminus) not accessed by classical solution-phase HDX-MS. The simple setup is compatible with liquid chromatography and a chip-based automated nanoESI interface, allowing for online gas-phase HDX-MS analysis of peptides and proteins separated on a liquid chromatographic time scale at increased throughput. Furthermore, online gas-phase HDX-MS could be performed in tandem with ion mobility separation or electron transfer dissociation, thus enabling multiple orthogonal analyses of the structural properties of peptides and proteins in a single automated LC-MS workflow.

Modelling Escherichia coli concentrations in the tidal Scheldt river and estuary.

PubMed

de Brauwere, Anouk; de Brye, Benjamin; Servais, Pierre; Passerat, Julien; Deleersnijder, Eric

2011-04-01

Recent observations in the tidal Scheldt River and Estuary revealed a poor microbiological water quality and substantial variability of this quality which can hardly be assigned to a single factor. To assess the importance of tides, river discharge, point sources, upstream concentrations, mortality and settling a new model (SLIM-EC) was built. This model was first validated by comparison with the available field measurements of Escherichia coli (E. coli, a common fecal bacterial indicator) concentrations. The model simulations agreed well with the observations, and in particular were able to reproduce the observed long-term median concentrations and variability. Next, the model was used to perform sensitivity runs in which one process/forcing was removed at a time. These simulations revealed that the tide, upstream concentrations and the mortality process are the primary factors controlling the long-term median E. coli concentrations and the observed variability. The tide is crucial to explain the increased concentrations upstream of important inputs, as well as a generally increased variability. Remarkably, the wastewater treatment plants discharging in the study domain do not seem to have a significant impact. This is due to a dilution effect, and to the fact that the concentrations coming from upstream (where large cities are located) are high. Overall, the settling process as it is presently described in the model does not significantly affect the simulated E. coli concentrations. Copyright © 2011 Elsevier Ltd. All rights reserved.

Interaction of upstream flow distortions with high Mach number cascades

NASA Technical Reports Server (NTRS)

Englert, G. W.

1981-01-01

Features of the interaction of flow distortions, such as gusts and wakes with blade rows of advance type fans and compressors having high tip Mach numbers are modeled. A typical disturbance was assumed to have harmonic time dependence and was described, at a far upstream location, in three orthogonal spatial coordinates by a double Fourier series. It was convected at supersonic relative to a linear cascade described as an unrolled annulus. Conditions were selected so that the component of this velocity parallel to the axis of the turbomachine was subsonic, permitting interaction between blades through the upstream as well as downstream flow media. A strong, nearly normal shock was considered in the blade passages which was allowed curvature and displacement. The flows before and after the shock were linearized relative to uniform mean velocities in their respective regions. Solution of the descriptive equations was by adaption of the Wiener-Hopf technique, enabling a determination of distortion patterns through and downstream of the cascade as well as pressure distributions on the blade and surfaces. Details of interaction of the disturbance with the in-passage shock were discussed. Infuences of amplitude, wave length, and phase of the disturbance on lifts and moments of cascade configurations are presented. Numerical results are clarified by reference to an especially orderly pattern of upstream vertical motion in relation to the cascade parameters.

Interactions of a co-rotating vortex pair at multiple offsets

NASA Astrophysics Data System (ADS)

Forster, Kyle J.; Barber, Tracie J.; Diasinos, Sammy; Doig, Graham

2017-05-01

Two NACA0012 vanes at various lateral offsets were investigated by wind tunnel testing to observe the interactions between the streamwise vortices. The vanes were separated by nine chord lengths in the streamwise direction to allow the upstream vortex to impact on the downstream geometry. These vanes were evaluated at an angle of incidence of 8° and a Reynolds number of 7 ×104 using particle image velocimetry. A helical motion of the vortices was observed, with rotational rate increasing as the offset was reduced to the point of vortex merging. Downstream meandering of the weaker vortex was found to increase in magnitude near the point of vortex merging. The merging process occurred more rapidly when the upstream vortex was passed on the pressure side of the vane, with the downstream vortex being produced with less circulation and consequently merging into the upstream vortex. The merging distance was found to be statistical rather than deterministic quantity, indicating that the meandering of the vortices affected their separations and energies. This resulted in a fluctuation of the merging location. A loss of circulation associated with the merging process was identified, with the process of achieving vortex circularity causing vorticity diffusion, however all merged cases maintained higher circulation than a single vortex condition. The presence of the upstream vortex was found to reduce the strength of the downstream vortex in all offsets evaluated.

Real-Time River Channel-Bed Monitoring at the Chariton and Mississippi Rivers in Missouri, 2007-09

USGS Publications Warehouse

Rydlund, Jr., Paul H.

2009-01-01

Scour and depositional responses to hydrologic events have been important to the scientific community studying sediment transport as well as potential effects on bridges and other hydraulic structures within riverine systems. A river channel-bed monitor composed of a single-beam transducer was installed on a bridge crossing the Chariton River near Prairie Hill, Missouri (structure L-344) as a pilot study to evaluate channel-bed change in response to the hydrologic condition disseminated from an existing streamgage. Initial results at this location led to additional installations in cooperation with the Missouri Department of Transportation at an upstream Chariton River streamgage location at Novinger, Missouri (structure L-534) and a Mississippi River streamgage location near Mehlville, Missouri (structures A-1850 and A-4936). In addition to stage, channel-bed elevation was collected at all locations every 15 minutes and transmitted hourly to a U.S. Geological Survey database. Bed elevation data for the Chariton River location at Novinger and the Mississippi River location near Mehlville were provided to the World Wide Web for real-time monitoring. Channel-bed data from the three locations indicated responses to hydrologic events depicted in the stage record; however, notable bedforms apparent during inter-event flows also may have affected the relation of scour and deposition to known hydrologic events. Throughout data collection periods, Chariton River locations near Prairie Hill and Novinger reflected bed changes as much as 13 feet and 5 feet. Nearly all of the bed changes correlated well with the hydrographic record at these locations. The location at the Mississippi River near Mehlville indicated a much more stable channel bed throughout the data collection period. Despite missing data resulting from damage to one of the river channel-bed monitors from ice accumulation at the upstream nose of the bridge pier early in the record, the record from the downstream river channel-bed monitor demonstrated a good correlation (regardless of a 7 percent high bias) between bedform movement and the presence of bedforms surrounding the bridge as indicated by coincident bathymetric surveys using multibeam sonar.

Increased responses in the somatosensory thalamus immediately after spinal cord injury.

PubMed

Alonso-Calviño, E; Martínez-Camero, I; Fernández-López, E; Humanes-Valera, D; Foffani, G; Aguilar, J

2016-03-01

Spinal cord injury (SCI) involves large-scale deafferentation of supraspinal structures in the somatosensory system, producing well-known long-term effects at the thalamo-cortical level. We recently showed that SCI provokes immediate changes in cortical spontaneous and evoked responses and here, we have performed a similar study to define the immediate changes produced in the thalamic ventro-postero-lateral nucleus (VPL) that are associated with the forepaw and hindpaw circuits. Extracellular electrophysiological recordings from the VPL reflected the spontaneous activity and the responses to peripheral electrical stimulation applied to the paws. Accordingly, the activity of the neuronal populations recorded at specific thalamic locations that correspond to the forepaw and hindpaw circuits was recorded under control conditions and immediately after thoracic SCI. The results demonstrate that peripheral inputs from both extremities overlap on neuronal populations in the somatosensory thalamus. In addition, they show that the responses of thalamic neurons to forepaw and hindpaw stimuli are increased immediately after SCI, in association with a specific decrease in spontaneous activity in the hindpaw locations. Finally, the increased thalamic responses after SCI have a state-dependent component in relation with cortical activity. Together, our results indicate that the thalamic changes occurring immediately after SCI could contribute to the cortical changes also detected immediately after such spinal lesions. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Characterization of Sea Lamprey stream entry using dual‐frequency identification sonar

USGS Publications Warehouse

McCain, Erin L.; Johnson, Nicholas; Hrodey, Peter J.; Pangle, Kevin L.

2018-01-01

Effective methods to control invasive Sea Lampreys Petromyzon marinus in the Laurentian Great Lakes often rely on knowledge of the timing of the Sea Lamprey spawning migration, which has previously been characterized using data gathered from traps. Most assessment traps are located many kilometers upstream from the river mouth, so less is known about when Sea Lampreys enter spawning streams and which environmental cues trigger their transition from lakes to rivers. To decide how to develop barriers and traps that target Sea Lampreys when they enter a stream, the stream entry of Sea Lampreys into a Lake Huron tributary during 2 years was assessed using dual‐frequency identification sonar (DIDSON). Sea Lampreys entered the stream in low densities when temperatures first reached 4°C, which was up to 6 weeks and a mean of 4 weeks earlier than when they were first captured in traps located upstream. The probability of stream entry was significantly affected by stream temperature and discharge, and stream entry timing peaked when stream temperatures rose to 12°C and discharge was high. Examination of the entry at a finer temporal resolution (i.e., minutes) indicated that Sea Lampreys did not exhibit social behavior (e.g., shoaling) during stream entry. Our findings indicate that Sea Lampreys may be vulnerable to alternative trap types near river mouths and hydraulic challenges associated with traditional traps. Also, seasonal migration barriers near stream mouths may need to be installed soon after ice‐out to effectively block the entire adult Sea Lamprey cohort from upstream spawning habitat.

Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

PubMed Central

Gao, Chao; Hu, Chunhui; Zheng, Zhaojuan; Jiang, Tianyi; Dou, Peipei; Zhang, Wen; Che, Bin; Wang, Yujiao; Lv, Min

2012-01-01

NAD-independent l-lactate dehydrogenase (l-iLDH) and NAD-independent d-lactate dehydrogenase (d-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an l-iLDH), and lldE (encoding a d-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses d-iLDH and l-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldRM, lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. l-Lactate and d-lactate interfered with the DNA-binding activity of LldR. Thus, l-iLDH and d-iLDH were expressed when the operon was induced in the presence of l-lactate or d-lactate. PMID:22408166

A 5′ Splice Site-Proximal Enhancer Binds SF1 and Activates Exon Bridging of a Microexon

PubMed Central

Carlo, Troy; Sierra, Rebecca; Berget, Susan M.

2000-01-01

Internal exon size in vertebrates occurs over a narrow size range. Experimentally, exons shorter than 50 nucleotides are poorly included in mRNA unless accompanied by strengthened splice sites or accessory sequences that act as splicing enhancers, suggesting steric interference between snRNPs and other splicing factors binding simultaneously to the 3′ and 5′ splice sites of microexons. Despite these problems, very small naturally occurring exons exist. Here we studied the factors and mechanism involved in recognizing a constitutively included six-nucleotide exon from the cardiac troponin T gene. Inclusion of this exon is dependent on an enhancer located downstream of the 5′ splice site. This enhancer contains six copies of the simple sequence GGGGCUG. The enhancer activates heterologous microexons and will work when located either upstream or downstream of the target exon, suggesting an ability to bind factors that bridge splicing units. A single copy of this sequence is sufficient for in vivo exon inclusion and is the binding site for the known bridging mammalian splicing factor 1 (SF1). The enhancer and its bound SF1 act to increase recognition of the upstream exon during exon definition, such that competition of in vitro reactions with RNAs containing the GGGGCUG repeated sequence depress splicing of the upstream intron, assembly of the spliceosome on the 3′ splice site of the exon, and cross-linking of SF1. These results suggest a model in which SF1 bridges the small exon during initial assembly, thereby effectively extending the domain of the exon. PMID:10805741

Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

PubMed

Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

2013-01-01

Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

Tanana River Monitoring and Research Program: Relationships Among Bank Recession, Vegetation, Soils, Sediments and Permafrost on the Tanana River Near Fairbanks, Alaska.

DTIC Science & Technology

1984-07-01

field book for scale). Figure 2 (cont’d). Figure 3. Upstream portion of reach 2, 9 May 1980; USGS gauging station (A) and the approximate location...eral information was taken from maps, and site-specific data were obtained from the logs of wells drilled by the Corps of Engineers. The well log data...were drilled along or near this route, which runs approximately parallel to the bank, but not near the riverbank aL most locations (Fig. 1). The

Abiquiu Dam and Reservoir, Rio Grande Basin, Rio Chama, New Mexico. Embankment Criteria and Performance Report.

DTIC Science & Technology

1987-04-01

EMBANKMENT CRITERIA AND PERFORMANCE REPORT PERTINENT DATA 1. General Data. LOCATION: Rio Arriba County, New Mexico, on the Rio Chama at river mile 33. PURPOSE...is located across the Rio Chama, approximately 30 miles upstream from its confluence with the Rio Grande, in Rio Arriba County, New Mexico. The dam is...6600- 4 i ’. 6600 65060- -60 6600- a + v6500s-go FA**v~w -6500 6300- 60 - ~ ~ ~ wo Ala filll------------------ EMBNKEN SECTION62 *LDN WOR SAFEL VAIE

Pennsylvania StreamStats--A web-based application for obtaining water-resource-related information

USGS Publications Warehouse

Stuckey, Marla H.; Hoffman, Scott A.

2010-01-01

StreamStats is a national web-based Geographic Information System (GIS) application, developed by the U.S. Geological Survey (USGS), in cooperation with Environmental Systems Research Institute, Inc., to provide a variety of water-resource-related information. Users can easily obtain descriptive information, basin characteristics, and streamflow statistics for USGS streamgages and ungaged stream locations throughout Pennsylvania. StreamStats also allows users to search upstream and (or) downstream from user-selected points to identify locations of and obtain information for water-resource-related activities, such as dams and streamgages.

Productivity of tree swallows (Tachycineta bicolor) exposed to PCBs at the Kalamazoo River superfund site.

PubMed

Neigh, Arianne M; Zwiernik, Matthew J; MacCarroll, Monica A; Newsted, John L; Blankenship, Alan L; Jones, Paul D; Kay, Denise P; Giesy, John P

2006-03-01

A 123-km stretch of the Kalamazoo River in Michigan, was designated a Superfund site in 1990 due to historical releases of effluent containing polychlorinated biphenyl (PCB)-contaminated paper waste. Risk to bird species in the river ecosystem was evaluated using the tree swallow (Tachycineta bicolor) as a monitor for possible effects due to PCB exposure at two nesting locations, one in the Superfund site and one in an upstream reference location that is less contaminated with PCBs. In 2 of the 3 years of the study, clutch size at the contaminated location was 3.7 +/- 1.4 and 4.8 +/- 0.73 eggs per nest (mean +/- SD), which was significantly less than the clutch size at the reference location (5.0 +/- 1.1 and 5.3 +/- 1.1 eggs per nest). However, there were no statistically significant differences in fledging success, predicted brood size, predicted number of fledglings, or growth of nestlings between the Kalamazoo River Superfund site and an upstream reference location with lesser concentrations of PCBs in the sediments and riparian soils. Productivity and hatching success comparisons between these same sites were also not significantly different; however, the power of these conclusions was less (p < .10). The reduction in clutch size at the co-contaminated location could not be attributed to PCBs due to a number of confounding factors, including Co-cocontaminants, habitat structure, and food availability. Other reproductive parameters were not significantly impaired, and the size of the newly established colony at the Kalamazoo River Superfund site continued to grow over the period of the study. These site-specific observations, combined with multiple lines of evidence approach that considered results reported for the effects of both total PCBs and 2,3,7,8 tetrachlorodibenzo-p-dioxin equivalents (TEQ) on tree swallows at other locations, suggest that there were no significant population-level effects of PCBs on tree swallows at the Kalamazoo River Superfund site.

40 CFR 63.5385 - How do I measure the quantity of finish applied to the leather?

Code of Federal Regulations, 2010 CFR

2010-07-01

...) of this section: (i) Locate the flow sensor and other necessary equipment such as straightening vanes in or as close to a position that provides a representative flow. (ii) Use a flow sensor with a... distributions due to upstream and downstream disturbances. (iv) Conduct a flow sensor calibration check at least...

Photographic copy of photograph, photographer unknown, 18 February 1908 (original ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photographic copy of photograph, photographer unknown, 18 February 1908 (original print located at U.S. Bureau of Reclamation Upper Columbia Area Office, Yakima, Washington). "LAKE KACHESS CRIB DAM. TAKEN FROM UPSTREAM SIDE. 4 FEET OF SNOW" - Kachess Dam, 1904 Cascade Canal Company Crib Dam, Kachess River, 1.5 miles north of Interstate 90, Easton, Kittitas County, WA

30 CFR 816.72 - Disposal of excess spoil: Valley fills/head-of-hollow fills.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., 6-hour precipitation event. (b) Rock-core chimney drains. A rock-core chimney drain may be used in a... as the fill is not located in an area containing intermittent or perennial streams. A rock-core... upstream drainage is diverted around the fill. The alternative rock-core chimney drain system shall be...

30 CFR 816.72 - Disposal of excess spoil: Valley fills/head-of-hollow fills.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., 6-hour precipitation event. (b) Rock-core chimney drains. A rock-core chimney drain may be used in a... as the fill is not located in an area containing intermittent or perennial streams. A rock-core... upstream drainage is diverted around the fill. The alternative rock-core chimney drain system shall be...

30 CFR 816.72 - Disposal of excess spoil: Valley fills/head-of-hollow fills.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., 6-hour precipitation event. (b) Rock-core chimney drains. A rock-core chimney drain may be used in a... as the fill is not located in an area containing intermittent or perennial streams. A rock-core... upstream drainage is diverted around the fill. The alternative rock-core chimney drain system shall be...

30 CFR 816.72 - Disposal of excess spoil: Valley fills/head-of-hollow fills.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., 6-hour precipitation event. (b) Rock-core chimney drains. A rock-core chimney drain may be used in a... as the fill is not located in an area containing intermittent or perennial streams. A rock-core... upstream drainage is diverted around the fill. The alternative rock-core chimney drain system shall be...

40 CFR 63.5385 - How do I measure the quantity of finish applied to the leather?

Code of Federal Regulations, 2011 CFR

2011-07-01

...) of this section: (i) Locate the flow sensor and other necessary equipment such as straightening vanes in or as close to a position that provides a representative flow. (ii) Use a flow sensor with a... distributions due to upstream and downstream disturbances. (iv) Conduct a flow sensor calibration check at least...

40 CFR 63.5385 - How do I measure the quantity of finish applied to the leather?

Code of Federal Regulations, 2014 CFR

2014-07-01

...) through (v) of this section: (i) Locate the flow sensor and other necessary equipment such as straightening vanes in or as close to a position that provides a representative flow. (ii) Use a flow sensor... distributions due to upstream and downstream disturbances. (iv) Conduct a flow sensor calibration check at least...

40 CFR 63.5385 - How do I measure the quantity of finish applied to the leather?

Code of Federal Regulations, 2013 CFR

2013-07-01

...) through (v) of this section: (i) Locate the flow sensor and other necessary equipment such as straightening vanes in or as close to a position that provides a representative flow. (ii) Use a flow sensor... distributions due to upstream and downstream disturbances. (iv) Conduct a flow sensor calibration check at least...

40 CFR 63.5385 - How do I measure the quantity of finish applied to the leather?

Code of Federal Regulations, 2012 CFR

2012-07-01

...) through (v) of this section: (i) Locate the flow sensor and other necessary equipment such as straightening vanes in or as close to a position that provides a representative flow. (ii) Use a flow sensor... distributions due to upstream and downstream disturbances. (iv) Conduct a flow sensor calibration check at least...

78 FR 23746 - Takes of Marine Mammals Incidental to Specified Activities; Russian River Estuary Management...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-22

..., breathing, nursing, breeding, feeding, or sheltering [Level B harassment].'' Summary of Request We received... located at Goat Rock State Beach; the estuary extends from the mouth upstream approximately 10 to 11 km (6... `Feasibility of Alternatives to the Goat Rock State Beach Jetty for Managing Lagoon Water Surface Elevations--A...

Improved efficiency in amplification of Escherichia coli o-antigen gene clusters using genome-wide sequence comparison

USDA-ARS?s Scientific Manuscript database

Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...

76 FR 72309 - Drawbridge Operation Regulations; Chelsea River, Chelsea and East Boston, MA

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-23

... installed new vertical lift bridge span will undergo testing for three weeks. This deviation requires a four hour advance notice for bridge openings during the lift span test period. DATES: This deviation is... facilities located upstream from the new bridge. The lift span at the new bridge will be operated by the...

30 CFR 816.72 - Disposal of excess spoil: Valley fills/head-of-hollow fills.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., 6-hour precipitation event. (b) Rock-core chimney drains. A rock-core chimney drain may be used in a... as the fill is not located in an area containing intermittent or perennial streams. A rock-core... upstream drainage is diverted around the fill. The alternative rock-core chimney drain system shall be...

FUBT, a putative MFS transporter, promotes secretion of fusaric acid in the cotton pathogen Fusarium oxysporum f.sp. vasinfectum

USDA-ARS?s Scientific Manuscript database

Fusaric acid (FA), a phytotoxic polyketide produced by Fusarium oxysporum f. sp. vasinfectum (FOV), has been shown to be associated with disease symptoms on cotton. A gene located upstream of the polyketide synthase gene responsible for the biosynthesis of FA is predicted to encode a member of the ...

33 CFR 110.72 - Blackhole Creek, Md.

Code of Federal Regulations, 2010 CFR

2010-07-01

... tip of an unnamed island located 0.16 mile upstream from the mouth of the creek approximately 660 feet to the west shore of the creek; northwest of a line ranging from the southwesterly tip of the island... line 100 feet from and parallel to the shore of the creek to its intersection with the south property...

33 CFR 110.72 - Blackhole Creek, Md.

Code of Federal Regulations, 2011 CFR

2011-07-01

... tip of an unnamed island located 0.16 mile upstream from the mouth of the creek approximately 660 feet to the west shore of the creek; northwest of a line ranging from the southwesterly tip of the island... line 100 feet from and parallel to the shore of the creek to its intersection with the south property...

33 CFR 110.72 - Blackhole Creek, Md.

Code of Federal Regulations, 2012 CFR

2012-07-01

... tip of an unnamed island located 0.16 mile upstream from the mouth of the creek approximately 660 feet to the west shore of the creek; northwest of a line ranging from the southwesterly tip of the island... line 100 feet from and parallel to the shore of the creek to its intersection with the south property...

Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

PubMed

Lee, Sooncheol; Kang, Changwon

2011-05-06

The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

The proteins encoded by the Drosophila Planar Polarity Effector genes inturned, fuzzy and fritz interact physically and can re-pattern the accumulation of “upstream” Planar Cell Polarity proteins

PubMed Central

Wang, Ying; Yan, Jie; Lee, Haeryun; Lu, Qiuheng; Adler, Paul N.

2014-01-01

The frizzled/starry night pathway regulates planar cell polarity in a wide variety of tissues in many types of animals. It was discovered and has been most intensively studied in the Drosophila wing where it controls the formation of the array of distally pointing hairs that cover the wing. The pathway does this by restricting the activation of the cytoskeleton to the distal edge of wing cells. This results in hairs initiating at the distal edge and growing in the distal direction. All of the proteins encoded by genes in the pathway accumulate asymmetrically in wing cells. The pathway is a hierarchy with the Planar Cell Polarity (PCP) genes (aka the core genes) functioning as a group upstream of the Planar Polarity Effector (PPE) genes which in turn function as a group upstream of multiple wing hairs. Upstream proteins, such as Frizzled accumulate on either the distal and/or proximal edges of wing cells. Downstream PPE proteins accumulate on the proximal edge under the instruction of the upstream proteins. A variety of types of data support this hierarchy, however, we have found that when over expressed the PPE proteins can alter both the subcellular location and level of accumulation of the upstream proteins. Thus, the epistatic relationship is context dependent. We further show that the PPE proteins interact physically and can modulate the accumulation of each other in wing cells. We also find that over expression of Frtz results in a marked delay in hair initiation suggesting that it has a separate role/activity in regulating the cytoskeleton that is not shared by other members of the group. PMID:25072625

Evidence of Asian carp spawning upstream of a key choke point in the Mississippi River

USGS Publications Warehouse

Larson, James H.; Knights, Brent C.; McCalla, S. Grace; Monroe, Emy; Tuttle-Lau, Maren T.; Chapman, Duane C.; George, Amy E.; Vallazza, Jon; Amberg, Jon J.

2017-01-01

Bighead Carp Hypophthalmichthys nobilis, Silver Carp H. molitrix, and Grass Carp Ctenopharyngodon idella(collectively termed “Asian carp”) were introduced into North America during the 1960s and 1970s and have become established in the lower Mississippi River basin. Previously published evidence for spawning of these species in the upper Mississippi River has been limited to an area just downstream of Dam 22 (near Saverton, Missouri). In 2013 and 2014, we sampled ichthyoplankton at 18 locations in the upper Mississippi River main stem from Dam 9 through Dam 19 and in four tributaries of the Mississippi River (Des Moines, Skunk, Iowa, and Wisconsin rivers). We identified eggs and larvae by using morphological techniques and then used genetic tools to confirm species identity. The spawning events we observed often included more than one species of Asian carp and in a few cases included eggs that must have been derived from more than one upstream spawning event. The upstream extent of genetically confirmed Grass Carp ichthyoplankton was the Wisconsin River, while Bighead Carp and Silver Carp ichthyoplankton were observed in Pool 16. In all these cases, ichthyoplankton likely drifted downstream for several hours prior to collection. Higher water velocities (and, to a lesser extent, higher temperatures) were associated with an increased likelihood of observing eggs or larvae, although the temperature range we encountered was mostly above 17°C. Several major spawning events were detected in 2013, but no major spawning events were observed in 2014. The area between Dam 15 and Dam 19 appears to be the upstream edge of spawning activity for both Silver Carp and Bighead Carp, suggesting that this area could be a focal point for management efforts designed to limit further upstream movement of these species..

The Effect of Landuse and Other External Factors on Water Quality Within two Creeks in Northern Kentucky

NASA Astrophysics Data System (ADS)

Boateng, S.

2006-05-01

The purpose of this study was to monitor the water quality in two creeks in Northern Kentucky. These are the Banklick Creek in Kenton County and the Woolper Creek in Boone County, Kentucky. The objective was to evaluate the effect of landuse and other external factors on surface water quality. Landuse within the Banklick watershed is industrial, forest and residential (urban) whereas that of Woolper Creek is agricultural and residential (rural). Two testing sites were selected along the Banklick Creek; one site was upstream the confluence with an overflow stream from an adjacent lake; the second site was downstream the confluence. Most of the drainage into the lake is over a near-by industrial park and the urban residential areas of the cities of Elsmere and Erlanger, Kentucky. Four sampling locations were selected within the Woolper Creek watershed to evaluate the effect of channelization and subsequent sedimentation on the health of the creek. Water quality parameters tested for include dissolved oxygen, phosphates, chlorophyll, total suspended sediments (TSS), pH, oxidation reduction potential (ORP), nitrates, and electrical conductivity. Sampling and testing were conducted weekly and also immediately after storm events that occurred before the regular sampling dates. Sampling and testing proceeded over a period of 29 weeks. Biological impact was determined, only in Woolper Creek watershed, by sampling benthic macroinvertebrates once every four weeks. The results showed significant differences in the water quality between the two sites within the Banklick Creek. The water quality may be affected by the stream overflow from the dammed lake. Also, channelization in the Woolper Creek seemed to have adverse effects on the water quality. A retention pond, constructed to prevent sediments from flowing into the Woolper Creek, did not seem to be effective. This is because the water quality downstream of the retention pond was significantly worse than that of the upstream site. The benthic macroinvertebrates sampled indicate worse water quality downstream of the sediment retention pond. Overall, landuse and the channelization have some effect on the water quality in the two creeks.

An upstream sequence modulates phenazine production at the level of transcription and translation in the biological control strain Pseudomonas chlororaphis 30-84

PubMed Central

Wang, Dongping; Ries, Tessa R.; Pierson, Leland S.; Pierson, Elizabeth A.

2018-01-01

Phenazines are bacterial secondary metabolites and play important roles in the antagonistic activity of the biological control strain P. chlororaphis 30–84 against take-all disease of wheat. The expression of the P. chlororaphis 30–84 phenazine biosynthetic operon (phzXYFABCD) is dependent on the PhzR/PhzI quorum sensing system located immediately upstream of the biosynthetic operon as well as other regulatory systems including Gac/Rsm. Bioinformatic analysis of the sequence between the divergently oriented phzR and phzX promoters identified features within the 5’-untranslated region (5’-UTR) of phzX that are conserved only among 2OHPCA producing Pseudomonas. The conserved sequence features are potentially capable of producing secondary structures that negatively modulate one or both promoters. Transcriptional and translational fusion assays revealed that deletion of 90-bp of sequence at the 5’-UTR of phzX led to up to 4-fold greater expression of the reporters with the deletion compared to the controls, which indicated this sequence negatively modulates phenazine gene expression both transcriptionally and translationally. This 90-bp sequence was deleted from the P. chlororaphis 30–84 chromosome, resulting in 30-84Enh, which produces significantly more phenazine than the wild-type while retaining quorum sensing control. The transcriptional expression of phzR/phzI and amount of AHL signal produced by 30-84Enh also were significantly greater than for the wild-type, suggesting this 90-bp sequence also negatively affects expression of the quorum sensing genes. In addition, deletion of the 90-bp partially relieved RsmE-mediated translational repression, indicating a role for Gac/RsmE interaction. Compared to the wild-type, enhanced phenazine production by 30-84Enh resulted in improvement in fungal inhibition, biofilm formation, extracellular DNA release and suppression of take-all disease of wheat in soil without negative consequences on growth or rhizosphere persistence. This work provides greater insight into the regulation of phenazine biosynthesis with potential applications for improved biological control. PMID:29451920

Aggradation and Degradation of the Palisades Gully Network, 1996 to 2005, with Emphasis on the November 2004 High-Flow Experiment, Grand Canyon National Park, Arizona

USGS Publications Warehouse

Hazel, Joseph E.; Kaplinski, Matt; Parnell, Roderic A.; Fairley, Helen C.

2008-01-01

This study examines a large drainage network incised into alluvial terraces located along the Colorado River downstream of Palisades Creek in Grand Canyon National Park, Ariz. Gully erosion in the drainage affects archaeological sites found on the wide, relatively flat alluvial terraces. In 1996, 7-d release of 1,274 cubic meters per second of water from Glen Canyon Dam, known as a controlled flood, deposited fine-grained sediment - sand, silt, and clay - in the mouth of the network's largest gully, informally known as south gully. The deposit persisted for several years, but the drainage network steepened in the downstream reaches between 1999 and 2004. A high-flow experiment similar to the 1996 controlled flood was conducted in November 2004. The 2004 experiment was of a lower magnitude and shorter duration compared to the 1996 controlled flood. Topographic surveys were made in the field before, immediately after, and 6 months following the November 2004 experiment, and these measurements were compared to those made in 1996 and in other years. Similar to the response in 1996, fine-grained sediment was deposited in the mouth of the south gully and this mass was largely retained during the 6 months following the 2004 event. The magnitude of deposition in 2004 was nearly two times greater than that resulting from the 1996 controlled flood. We attribute this marked difference to increased accommodation space for deposition in the gully mouth, which was more deeply eroded in 2004 than it was in 1996. The second of the two primary gullies found within the Palisades gully network, the north gully, was largely unaffected by either high flow. Between 1996 and 2005, erosion was primarily confined to the lower reach of the south gully, while the upper reach remained relatively stable. The available data suggest that local base-level changes in the south gully mouth were not linked to the stability of the upstream gully reach. It could not be determined whether temporary base-level increases or maintenance of erosion-control structures were causal factors in limiting erosion in the upstream reaches of the drainage network.

Kin28 regulates the transient association of Mediator with core promoters

PubMed Central

Jeronimo, Célia; Robert, François

2014-01-01

Mediator is an essential, broadly utilized eukaryotic transcriptional co-activator. How and what it communicates from activators to RNA polymerase II (RNAPII) remains an open question. Here we performed genome-wide location profiling of Saccharomyces cerevisiae Mediator subunits. Mediator is not found at core promoters but rather occupies the upstream activating sequence (UAS), upstream of the pre-initiation complex. In the absence of Kin28 (CDK7) kinase activity, or in cells where the RNAPII C-terminal domain (CTD) is mutated to replace Ser5 with alanines, however, Mediator accumulates at core promoters together with RNAPII. We propose that Mediator is quickly released from promoters upon Ser5 phosphorylation by Kin28 (CDK7), which also allows for RNAPII to escape from the promoter. PMID:24704787

Near infrared reflectance spectroscopy studies of Chinese giant salamanders in aquaculture production

USDA-ARS?s Scientific Manuscript database

NIR spectra were collected at three surface locations for Chinese giant salamanders to ascertain whether spectral signatures could be separated by anatomical, presumably physiologically-based, locations. The first location was the smooth area immediately above the cloaca on the animal’s abdomen, whi...

Impact-Locator Sensor Panels

NASA Technical Reports Server (NTRS)

Christiansen, Eric L.; Byers, Terry; Gibbons, Frank

2008-01-01

Electronic sensor systems for detecting and locating impacts of rapidly moving particles on spacecraft have been invented. Systems of this type could also be useful on Earth in settings in which the occurrence of impacts and/or the locations of impacts are not immediately obvious and there are requirements to detect and quickly locate impacts to prevent or minimize damage.

Hydrodynamic control of inorganic calcite precipitation in Huanglong Ravine, China: Field measurements and theoretical prediction of deposition rates

NASA Astrophysics Data System (ADS)

Zaihua, Liu; Svensson, U.; Dreybrodt, W.; Daoxian, Yuan; Buhmann, D.

1995-08-01

Hydrochemical and hydrodynamical investigations are presented to explain tufa deposition rates along the flow path of the Huanglong Ravine, located in northwestern Sichuan province, China, on an altitude of about 3400 m asl. Due to outgassing of CO 2 the mainly spring-fed stream exhibits, along a valley of 3.5 km, calcite precipitation rates up to a few mm/year. We have carried out in situ experiments to measure calcite deposition rates at rimstone dams, inside of pools and in the stream-bed. Simultaneously, the downstream evolution of water chemistry was investigated at nine locations with respect to Ca 2+, Mg 2+, Na +, Cl -, SO 42-, and alkalinity. Temperature, pH, and conductivity were measured in situ, while total hardness, Ca T, and alkalinity have been determined immediately after sampling, performing standard titration methods. The water turned out to be of an almost pure CaMgHCO 3 type. The degassing of CO 2 causes high supersaturation with respect to calcite and due to calcite precipitation the Ca 2+ concentration decreases from 6·10 -3 mole/1 upstream down to 2.5·10 -3 mole/1 at the lower course. Small rectangular shaped tablets of pure marble were mounted under different flow regimes, i.e., at the dam sites with fast water flow as well as inside pools with still water. After the substrate samples had stayed in the water for a period of a few days, the deposition rates were measured by weight increase, up to several tens of milligrams. Although there were no differences in hydrochemistry, deposition rates in fast flowing water were higher by as much as a factor of four compared to still water, indicating a strong influence of hydrodynamics. While upstream rates amounted up to 5 mm/year, lower rates of about 1 mm/year were observed downstream. Inspection of the marble substrate surfaces by EDAX and SEM (scanning electron microscope) revealed authigeneously grown calcite crystals of about 10 μm. Their shape and habit are indicative of a chemically controlled inorganic origin. By applying a mass transfer model for calcite precipitation taking into account the reaction rates at the surface given by Plummer et al. (1978), slow conversion of CO 2 into H + and HCO 3- , and diffusional mass transport across a diffusion boundary layer, we have calculated the deposition rates from the hydrochemistry of the corresponding locations. The calculated rates agree within a factor of two with the experimental results. Our findings confirm former conclusions with respect to fast flow conditions: reasonable rates of calcite precipitation can be estimated in reducing the PWP-rate calculated from the chemical composition of the water by a factor of about ten, thus correcting for the influence of the diffusion boundary layer.

Hydrologic, water-quality, and meteorologic data from selected sites in the Upper Catawba River Basin, North Carolina, January 1993 through March 1994

USGS Publications Warehouse

Jaynes, M.L.

1994-01-01

Hydrologic, water-quality, and meteorologic data were collected from January 1993 through March 1994 as part of a water-quality investigation of the Upper Catawba River Basin, North Carolina. Specific objectives of the investigation were to characterize the water quality of Rhodhiss Lake, Lake Hickory, and three tributary streams, and to calibrate hydrodynamic water-quality models for the two reservoirs. Sampling locations included 11 sites in Rhodhiss Lake, 14 sites in Lake Hickory, and 3 tributary sites. Tributary sites were located at Lower Creek upstream from Rhodhiss Lake and at Upper Little River and Middle Little River upstream from Lake Hickory. During 21 sampling visits, specific conductance, pH, water temperature, dissolved-oxygen concentration, and water transparency were measured at all sampling locations. Water samples were collected for analysis of biochemical oxygen demand, fecal coliform bacteria, hardness, alkalinity, total and volatile suspended solids, suspended sediment, nutrients, total organic carbon, chlorophyll, iron, calcium, and magnesium from three sites in each reservoir and from the three tributary sites. Chemical and particle-size analyses of bottom material from Rhodhiss Lake and Lake Hickory were performed once during the study. At selected locations, automated instruments recorded water level, streamflow, water temperature, solar radiation, and air temperature at 15-minute intervals throughout the study. Hydrologic data presented in the report include monthly water-level statistics and daily mean values of discharge. Diagrams, tables, and statistical summaries of water-quality data are provided. Meteorologic data in the report include monthly precipitation, and daily mean values of solar radiation and air temperature.

Two novel heat shock genes encoding proteins produced in response to heterologous protein expression in Escherichia coli.

PubMed Central

Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M

1992-01-01

In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969

Bedload transport over run-of-river dams, Delaware, U.S.A.

NASA Astrophysics Data System (ADS)

Pearson, Adam J.; Pizzuto, Jim

2015-11-01

We document the detailed morphology and bed sediment size distribution of a stream channel upstream and downstream of a 200-year-old run-of-river dam on the Red Clay Creek, a fifth order stream in the Piedmont of northern Delaware, and combine these data with HEC-RAS modeling and bedload transport computations. We hypothesize that coarse bed material can be carried through run-of-river impoundments before they completely fill with sediment, and we explore mechanisms to facilitate this transport. Only 25% of the accommodation space in our study site is filled with sediment, and maximum water depths are approximately equal to the dam height. All grain-size fractions present upstream of the impoundment are also present throughout the impoundment. A characteristic coarse-grained sloping ramp leads from the floor of the impoundment to the crest of the dam. A 2.3-m-deep plunge pool has been excavated below the dam, followed immediately downstream by a mid-channel bar composed of coarse bed material similar in size distribution to the bed material of the impoundment. The mid-channel bar stores 1472 m3 of sediment, exceeding the volume excavated from the plunge pool by a factor of 2.8. These field observations are typical of five other sites nearby and suggest that all bed material grain-size fractions supplied from upstream can be transported through the impoundment, up the sloping ramp, and over the top of the dam. Sediment transport computations suggest that all grain sizes are in transport upstream and within the impoundment at all discharges with return periods from 1 to 50 years. Our computations suggest that transport of coarse bed material through the impoundment is facilitated by its smooth, sandy bed. Model results suggest that the impoundment is currently aggrading at 0.26 m/year, but bed elevations may be recovering after recent scour from a series of large floods during water year 2011-2012. We propose that impoundments upstream of these run-of-river dams behave as long pools that adjust their bed elevation and texture to transport the load supplied by the watershed, rather than as impounded reservoirs with little bed material transport capacity. Scour may only occur during episodic high flows, followed by aggradation during periods of low flow.

Cascabel prescribed fire long-term watershed study: an opportunity to monitor climate change

Treesearch

Gerald Gottfried; Daniel Neary; Peter Ffolliott; Karen Koestner

2012-01-01

Experimental watershed studies can provide answers to new challenges facing land managers and society including the impacts of fires and climate change on upstream and regional hydrology. The Cascabel Watersheds long-term prescribed fire study provides a unique opportunity to monitor climate change because of its location in an oak savanna situated between deserts or...

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest that the mechanism for previously described upregulation of platelet thromboxane receptors after acute myocardial infarction is increased thromboxane receptor gene transcription in platelet-progenitor cells.

Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C.H.; Wei, Li-Na; Copeland, N.G.

We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

Hyperspectral proximal sensing of Salix Alba trees in the Sacco river valley (Latium, Italy).

PubMed

Moroni, Monica; Lupo, Emanuela; Cenedese, Antonio

2013-10-29

Recent developments in hardware and software have increased the possibilities and reduced the costs of hyperspectral proximal sensing. Through the analysis of high resolution spectroscopic measurements at the laboratory or field scales, this monitoring technique is suitable for quantitative estimates of biochemical and biophysical variables related to the physiological state of vegetation. Two systems for hyperspectral imaging have been designed and developed at DICEA-Sapienza University of Rome, one based on the use of spectrometers, the other on tunable interference filters. Both systems provide a high spectral and spatial resolution with low weight, power consumption and cost. This paper describes the set-up of the tunable filter platform and its application to the investigation of the environmental status of the region crossed by the Sacco river (Latium, Italy). This was achieved by analyzing the spectral response given by tree samples, with roots partly or wholly submerged in the river, located upstream and downstream of an industrial area affected by contamination. Data acquired is represented as reflectance indices as well as reflectance values. Broadband and narrowband indices based on pigment content and carotenoids vs. chlorophyll content suggest tree samples located upstream of the contaminated area are 'healthier' than those downstream.

Association of ADRB2 polymorphism with triglyceride levels in Tongans

PubMed Central

2013-01-01

Background Our previous study demonstrated that the A-allele of the single nucleotide polymorphism (SNP) rs34623097 located in the upstream region of the β2 adrenergic receptor gene (ADRB2) is significantly associated with risk for obesity in Oceanic populations. Methods To investigate whether the ADRB2 polymorphisms explain part of the individual differences in lipid mobilization, energy expenditure and glycogen breakdown, the associations of 10 ADRB2 SNPs with total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol and triglyceride levels were examined in 128 adults in Tonga. Results A multiple linear regression analysis adjusted for age, sex, and body mass index revealed that rs34623097 was significantly associated with triglyceride levels (P-value = 0.037). A copy of the rs34623097-A allele increased serum triglyceride levels by 70.1 mg/dL (0.791 mmol/L). None of the ADRB2 SNPs showed a significant association with total-cholesterol, high-density lipoprotein cholesterol, or low-density lipoprotein cholesterol. Conclusions In a Tongan population, a SNP located in the upstream region of ADRB2 is associated with triglyceride levels independent of body mass index. PMID:23875540

Monocyte-specific Accessibility of a Matrix Attachment Region in the Tumor Necrosis Factor Locus*

PubMed Central

Biglione, Sebastian; Tsytsykova, Alla V.; Goldfeld, Anne E.

2011-01-01

Regulation of TNF gene expression is cell type- and stimulus-specific. We have previously identified highly conserved noncoding regulatory elements within DNase I-hypersensitive sites (HSS) located 9 kb upstream (HSS−9) and 3 kb downstream (HSS+3) of the TNF gene, which play an important role in the transcriptional regulation of TNF in T cells. They act as enhancers and interact with the TNF promoter and with each other, generating a higher order chromatin structure. Here, we report a novel monocyte-specific AT-rich DNase I-hypersensitive element located 7 kb upstream of the TNF gene (HSS−7), which serves as a matrix attachment region in monocytes. We show that HSS−7 associates with topoisomerase IIα (Top2) in vivo and that induction of endogenous TNF mRNA expression is suppressed by etoposide, a Top2 inhibitor. Moreover, Top2 binds to and cleaves HSS−7 in in vitro analysis. Thus, HSS−7, which is selectively accessible in monocytes, can tether the TNF locus to the nuclear matrix via matrix attachment region formation, potentially promoting TNF gene expression by acting as a Top2 substrate. PMID:22027829

The nT1 translocation separates vulval regulatory elements from the egl-18 and elt-6 GATA factor genes.

PubMed

Koh, Kyunghee; Bernstein, Yelena; Sundaram, Meera V

2004-03-01

egl-18 and elt-6 are partially redundant, adjacent genes encoding GATA factors essential for viability, seam cell development, and vulval development in Caenorhabditis elegans. The nT1 reciprocal translocation causes a strong Vulvaless phenotype, and an nT1 breakpoint was previously mapped to the left arm of LGIV, where egl-18/elt-6 are located. Here we present evidence that the nT1 vulval phenotype is due to a disruption of egl-18/elt-6 function specifically in the vulva. egl-18 mutations do not complement nT1 for vulval defects, and the nT1 breakpoint on LGIV is located within approximately 800 bp upstream of a potential transcriptional start site of egl-18. In addition, we have identified a approximately 350-bp cis-regulatory region sufficient for vulval expression just upstream of the nT1 breakpoint. By examining the fusion state and division patterns of the cells in the developing vulva of nT1 mutants, we demonstrate that egl-18/elt-6 prevent fusion and promote cell proliferation at multiple steps of vulval development.

Atmospheric structure prior to tornadoes as derived from proximity and precedent upper-air soundings, covering the period April 1977-June 1979

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, G.E.; Darkow, G.L.

1982-05-01

The uniqueness of the thermodynamic and dynamic structure of the atmosphere in the area of imminent tornado bearing storm development is analyzed by comparing 115 tornado proximity soundings with upper air soundings made at the same location 6 and 12 hours earlier (precedent soundings) and with soundings made simultaneously at neighboring upper air stations. The comparisons suggest that both the proximity station and the neighboring station upstream with respect to the mean flow in the low level moist air display very similar degrees of hydrostatic and potential-convective instability by late afternoon. The principal difference is in the wind profiles atmore » the two locations. The tornado proximity station displays significantly stronger wind speeds above 1 km with the most striking difference being in the vertical shear of the wind in the layer from 1 to 3 km above ground level. In this layer the winds at the proximity station show an average increase of about 3 m sec/sup -1/ while the upstream, non-tornadic, station shows a slight decrease of wind speed with height.« less

Behaviour and Locomotor Activity of a Migratory Catostomid during Fishway Passage

PubMed Central

Silva, Ana T.; Hatry, Charles; Thiem, Jason D.; Gutowsky, Lee F. G.; Hatin, Daniel; Zhu, David Z.; W. Dawson, Jeffery; Katopodis, Christos; J. Cooke, Steven

2015-01-01

Fishways have been developed to restore longitudinal connectivity in rivers. Despite their potential for aiding fish passage, fishways may represent a source of significant energetic expenditure for fish as they are highly turbulent environments. Nonetheless, our understanding of the physiological mechanisms underpinning fishway passage of fish is still limited. We examined swimming behaviour and activity of silver redhorse (Moxostoma anisurum) during its upriver spawning migration in a vertical slot fishway. We used an accelerometer-derived instantaneous activity metric (overall dynamic body acceleration) to estimate location-specific swimming activity. Silver redhorse demonstrated progressive increases in activity during upstream fishway passage. Moreover, location-specific passage duration decreased with an increasing number of passage attempts. Turning basins and the most upstream basin were found to delay fish passage. No relationship was found between basin-specific passage duration and activity and the respective values from previous basins. The results demonstrate that successful fishway passage requires periods of high activity. The resultant energetic expenditure may affect fitness, foraging behaviour and increase susceptibility to predation, compromising population sustainability. This study highlights the need to understand the physiological mechanisms underpinning fishway passage to improve future designs and interpretation of biological evaluations. PMID:25853245

Water-quality data for the Ohio River from Willow Island Dam to Belleville Dam, West Virginia and Ohio, June-October 1991

USGS Publications Warehouse

Chambers, D.B.; Miller, K.F.; Waldron, M.C.; Falkenburg, C.W.

1994-01-01

This report contains water-quality data for the Ohio River from river mile 160.6 (1.1 mi upstream from Willow Island Dam) to river mile 203.6 (0.3 mi upstream from Belleville Dam) during the summer of 1991. Water quality was determined by a combi- nation of synoptic field measurements and laboratory analyses. Synoptic sampling consisted of 8 cross-sectional transects and a longitudinal transect with 28 mid-channel stations. Each cross- sectional transect included five vertical profiles of water temperature, dissolved oxygen concen- tration, pH, and specific conductance. Longi- tudinal transect stations were sampled at three depths (near the surface, middle of the water column, and at or near the bottom) for the same characteristics. Sampling was completed in 3 days or less, and was repeated approximately every 2 weeks from June through October 1991. Beginning in August 1991, water samples were collected at selected locations and analyzed for chlorophyll-a and pheophytin concentrations, as measures of phytoplankton biomass and phytoplankton-degradation products, respectively. The depth of light penetration was estimated at all pigment-sampling locations.

Sex Differences in Object Location Memory: The Female Advantage of Immediate Detection of Changes

ERIC Educational Resources Information Center

Honda, Akio; Nihei, Yoshiaki

2009-01-01

Object location memory has been considered the only spatial ability in which females display an advantage over males. We examined sex differences in long-term object location memory. After participants studied an array of objects, they were asked to recall the locations of these objects three minutes later or one week later. Results showed a…

Combining split-beam and dual-frequency identification sonars to estimate abundance of anadromous fishes in the Roanoke River, North Carolina

USGS Publications Warehouse

Hughes, Jacob B.; Hightower, Joseph E.

2015-01-01

Riverine hydroacoustic techniques are an effective method for evaluating abundance of upstream migrating anadromous fishes. To use these methods in the Roanoke River, North Carolina, at a wide site with uneven bottom topography, we used a combination of split-beam sonar and dual-frequency identification sonar (DIDSON) deployments. We aimed a split-beam sonar horizontally to monitor midchannel and near-bottom zones continuously over the 3-month spring monitoring periods in 2010 and 2011. The DIDSON was rotated between seven cross-channel locations (using a vertical aim) and nearshore regions (using horizontal aims). Vertical deployment addressed blind spots in split-beam coverage along the bottom and provided reliable information about the cross-channel and vertical distributions of upstream migrants. Using a Bayesian framework, we modeled sonar counts within four cross-channel strata and apportioned counts by species using species proportions from boat electrofishing and gill netting. Modeled estimates (95% credible intervals [CIs]) of total upstream migrants in 2010 and 2011 were 2.5 million (95% CI, 2.4–2.6 million) and 3.6 million (95% CI, 3.4–3.9 million), respectively. Results indicated that upstream migrants are extremely shore- and bottom-oriented, suggesting nearshore DIDSON monitoring improved the accuracy and precision of our estimates. This monitoring protocol and model may be widely applicable to river systems regardless of their cross-sectional width or profile.

The Effects of Dams on Downstream Channel Characteristics in Pennsylvania and Maryland: Assessing the Potential Consequences of Dam Removal

NASA Astrophysics Data System (ADS)

Skalak, K. J.; Pizzuto, J. E.; Jenkins, P.

2003-12-01

The potential downstream effects of dam removal were assessed on fifteen sites of varying dam size and characteristics in Pennsylvania and Maryland. The dams ranged in size from a 30 cm high fish weir to a water supply dam 57 m high. Stream order ranged from 1 to 4. The dams are located in watersheds with varying degrees of human disturbance and urbanization. The dams are also operated differently, with significant consequences for hydraulic residence time and downstream flow variability. Most streams were alluvial, but 6 of the reaches were clearly bedrock channels. We hypothesize that the channel upstream, which is unaffected by the dam, will provide an accurate model for the channel downstream of the dam long after dam removal. Therefore, reaches upstream and downstream of the dam were compared to determine the effects of the dam as well as the condition of the stream that will ultimately develop decades after dam removal. Surprisingly, the dams had no consistent influence on channel morphology. However, the percentage of sand is significantly lower downstream than upstream: the mean % sand downstream is 11.47%, while the mean % sand upstream is 21.39%. The coarser fractions of the bed, as represented by the 84th percentile grain diameter, are unaffected by the presence of the dam. These results imply that decades after dam removal, the percentage of sand on the bed will increase, but the coarse fraction of the bed will remain relatively unchanged.

Quantifying translational coupling in E. coli synthetic operons using RBS modulation and fluorescent reporters.

PubMed

Levin-Karp, Ayelet; Barenholz, Uri; Bareia, Tasneem; Dayagi, Michal; Zelcbuch, Lior; Antonovsky, Niv; Noor, Elad; Milo, Ron

2013-06-21

Translational coupling is the interdependence of translation efficiency of neighboring genes encoded within an operon. The degree of coupling may be quantified by measuring how the translation rate of a gene is modulated by the translation rate of its upstream gene. Translational coupling was observed in prokaryotic operons several decades ago, but the quantitative range of modulation translational coupling leads to and the factors governing this modulation were only partially characterized. In this study, we systematically quantify and characterize translational coupling in E. coli synthetic operons using a library of plasmids carrying fluorescent reporter genes that are controlled by a set of different ribosome binding site (RBS) sequences. The downstream gene expression level is found to be enhanced by the upstream gene expression via translational coupling with the enhancement level varying from almost no coupling to over 10-fold depending on the upstream gene's sequence. Additionally, we find that the level of translational coupling in our system is similar between the second and third locations in the operon. The coupling depends on the distance between the stop codon of the upstream gene and the start codon of the downstream gene. This study is the first to systematically and quantitatively characterize translational coupling in a synthetic E. coli operon. Our analysis will be useful in accurate manipulation of gene expression in synthetic biology and serves as a step toward understanding the mechanisms involved in translational expression modulation.

Risk assessment of imidacloprid use in forest settings on the aquatic macroinvertebrate community.

PubMed

Benton, Elizabeth P; Grant, Jerome F; Nichols, Rebecca J; Webster, R Jesse; Schwartz, John S; Bailey, Joseph K

2017-11-01

The isolated effects of a single insecticide can be difficult to assess in natural settings because of the presence of numerous pollutants in many watersheds. Imidacloprid use for suppressing hemlock woolly adelgid, Adelges tsugae (Annand) (Hemiptera: Adelgidae), in forests offers a rare opportunity to assess potential impacts on aquatic macroinvertebrates in relatively pristine landscapes. Aquatic macroinvertebrate communities were assessed in 9 streams in Great Smoky Mountains National Park (southern Appalachian Mountains, USA). The streams flow through hemlock conservation areas where imidacloprid soil drench treatments were applied for hemlock woolly adelgid suppression. Sites were located upstream and downstream of the imidacloprid treatments. Baseline species presence data (pre-imidacloprid treatment) were available from previous sample collections at downstream sites. Downstream and upstream sites did not vary in numerous community measures. Although comparisons of paired upstream and downstream sites showed differences in diversity in 7 streams, higher diversity was found more often in downstream sites. Macroinvertebrate functional feeding groups and life habits were similar between downstream and upstream sites. Downstream and baseline stream samples were similar. While some functional feeding group and life habit species richness categories varied, variations did not indicate poorer quality downstream communities. Imidacloprid treatments applied according to US Environmental Protection Agency federal restrictions did not result in negative effects to aquatic macroinvertebrate communities, which indicates that risks of imidacloprid use in forest settings are low. Environ Toxicol Chem 2017;36:3108-3119. © 2017 SETAC. © 2017 SETAC.

Reactive transport modeling of nitrogen in Seine River sediments

NASA Astrophysics Data System (ADS)

Akbarzadeh, Z.; Laverman, A.; Raimonet, M.; Rezanezhad, F.; Van Cappellen, P.

2016-02-01

Biogeochemical processes in sediments have a major impact on the fate and transport of nitrogen (N) in river systems. Organic matter decomposition in bottom sediments releases inorganic N species back to the stream water, while denitrification, anammox and burial of organic matter remove bioavailable N from the aquatic environment. To simulate N cycling in river sediments, a multi-component reactive transport model has been developed in MATLAB®. The model includes 3 pools of particulate organic N, plus pore water nitrate, nitrite, nitrous oxide and ammonium. Special attention is given to the production and consumption of nitrite, a N species often neglected in early diagenetic models. Although nitrite is usually considered to be short-lived, elevated nitrite concentrations have been observed in freshwater streams, raising concerns about possible toxic effects. We applied the model to sediment data sets collected at two locations in the Seine River, one upstream, the other downstream, of the largest wastewater treatment plant (WWTP) of the Paris conurbation. The model is able to reproduce the key features of the observed pore water depth profiles of the different nitrogen species. The modeling results show that the presence of oxygen in the overlying water plays a major role in controlling the exchanges of nitrite between the sediments and the stream water. In August 2012, sediments upstream of the WWTP switch from being a sink to a source of nitrite as the overlying water becomes anoxic. Downstream sediments remain a nitrite sink in oxic and anoxic conditions. Anoxic bottom waters at the upstream location promote denitrification, which produces nitrite, while at the downstream site, anammox and DNRA are important removal processes of nitrite.

Detection of direct and indirect noise generated by synthetic hot spots in a duct

NASA Astrophysics Data System (ADS)

De Domenico, Francesca; Rolland, Erwan O.; Hochgreb, Simone

2017-04-01

Sound waves in a combustor are generated from fluctuations in the heat release rate (direct noise) or the acceleration of entropy, vorticity or compositional perturbations through nozzles or turbine guide vanes (indirect or entropy noise). These sound waves are transmitted downstream as well as reflected upstream of the acceleration point, contributing to the overall noise emissions, or triggering combustion instabilities. Previous experiments attempted to isolate indirect noise by generating thermoacoustic hot spots electrically and measuring the transmitted acoustic waves, yet there are no measurements on the backward propagating entropy and acoustic waves. This work presents the first measurements which clearly separate the direct and indirect noise contributions to pressure fluctuations upstream of the acceleration point. Synthetic entropy spots are produced by unsteady electrical heating of a grid of thin wires located in a tube. Compression waves (direct noise) are generated from this heating process. The hot spots are then advected with the mean flow and finally accelerated through an orifice plate located at the end of the tube, producing a strong acoustic signature which propagates upstream (indirect noise). The convective time is selected to be longer than the heating pulse length, in order to obtain a clear time separation between direct and indirect noise in the overall pressure trace. The contribution of indirect noise to the overall noise is shown to be non-negligible either in subsonic or sonic throat conditions. However, the absolute amplitude of direct noise is larger than the corresponding fraction of indirect noise, explaining the difficulty in clearly identifying the two contributions when they are merged. Further, the work shows the importance of using appropriate pressure transducer instrumentation and correcting for the respective transfer functions in order to account for low frequency effects in the determination of pressure fluctuations.

Cyclic steps due to the surge-type turbidity currents in flume experiments: effect of surge duration on the topography of steps

NASA Astrophysics Data System (ADS)

Yokokawa, Miwa; Yamano, Junpei; Miyai, Masatomo; Hughes Clarke, John; Izumi, Norihiro

2017-04-01

Field observations of turbidity currents and seabed topography on the Squamish delta in British Columbia, Canada revealed that cyclic steps formed by the surge-type turbidity currents (e.g., Hughes Clarke et al., 2014). The high-density portion of the flow, which affects the sea floor morphology, lasted only 30-60 seconds. We are doing flume experiments aiming to investigate the relationship between the condition of surges and topography of resultant steps. In this presentation, we are going to discuss about the effect of surge duration on the topography of steps. The experiments have been performed at Osaka Institute of Technology. A flume, which is 7.0 m long, 0.3 m deep and 2 cm wide, was suspended in a larger tank, which is 7.6 m long, 1.2 m deep and 0.3 m wide, filled with water. The inner flume tilted at 7 degrees. As a source of turbidity currents, mixture of salt water (1.17 g/cm^3) and plastic particles (1.3 g/cm^3, 0.1-0.18 mm in diameter) was prepared. The concentration of the sediments was 6.1 weight % (5.5 volume %) in the head tank. This mixture of salt water and plastic particles poured into the upstream end of the inner flume from head tank for 3 seconds or 7 seconds. 140 surges were made respectively. Discharge of the currents were fluctuated but range from 306 to 870 mL for 3s-surge, and from 1134 to 2030 mL for 7s-surge. As a result, five or six steps were formed respectively. At the case of 3s-surge, steps located at upstream portion of the flume moved vigorously toward upstream direction, whereas steps at downstream portion of the flume moved toward upstream direction at the case of 7s-surge. The wavelengths and wave heights of the steps by 3s-surge are larger than those of 7s-surge at the upstream portion of the flume, but the size of steps of 3s-surge are smaller than those of 7s-surge at the downstream portion of the flume. In this condition of slope and concentration, the longer surge duration, i.e. larger discharge of the current transports the sediment further and makes the steps larger and active at the further location from the source of the currents.

Temperature measurement in a gas turbine engine combustor

DOE Office of Scientific and Technical Information (OSTI.GOV)

DeSilva, Upul

A method and system for determining a temperature of a working gas passing through a passage to a turbine section of a gas turbine engine. The method includes identifying an acoustic frequency at a first location in the engine upstream from the turbine section, and using the acoustic frequency for determining a first temperature value at the first location that is directly proportional to the acoustic frequency and a calculated constant value. A second temperature of the working gas is determined at a second location in the engine and, using the second temperature, a back calculation is performed to determinemore » a temperature value for the working gas at the first location. The first temperature value is compared to the back calculated temperature value to change the calculated constant value to a recalculated constant value. Subsequent first temperature values at the first location may be determined based on the recalculated constant value.« less

Reflection type skin friction meter

NASA Technical Reports Server (NTRS)

Bandyopadhyay, Promode R. (Inventor); Weinstein, Leonard M. (Inventor)

1993-01-01

A housing block is provided having an upper surface conforming to the test surface of a model or aircraft. An oil film is supplied upstream of a transparent wedge window located in this upper surface by an oil pump system located external to the housing block. A light source located within the housing block supplies a light beam which passes through this transparent window and is reflected back through the transparent window by the upper surface of the oil film to a photo-sensitive position sensor located within the housing. This position sensor allows the slope history of the oil film caused by and aerodynamic flow to be determined. The skin friction is determined from this slope history. Internally located mirrors augment and sensitize the reflected beam as necessary before reaching the position sensor. In addition, a filter may be provided before this sensor to filter the beam.

Photographic copy of 3 ½” x 5” glass lantern slide ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photographic copy of 3 ½” x 5” glass lantern slide no. 11 of map. Located in wooden pine box #23 in box 84 of 94 at the National Museum of American History, Smithsonian Institution, Archives Center, Work and industry Division, Washington, D.C. Original photographer, Milton R. Homes, Philadelphia, Pennsylvania. EARLY MAP OF “LOCATION OF NEW ORLEANS BRIDGE” AND THE VARIOUS RAILROADS SERVING THE GREATER NEW ORLEANS AREA. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

Molecular links among the causative genes for ocular malformation: Otx2 and Sox2 coregulate Rax expression

PubMed Central

Danno, Hiroki; Michiue, Tatsuo; Hitachi, Keisuke; Yukita, Akira; Ishiura, Shoichi; Asashima, Makoto

2008-01-01

The neural-related genes Sox2, Pax6, Otx2, and Rax have been associated with severe ocular malformations such as anophthalmia and microphthalmia, but it remains unclear as to how these genes are linked functionally. We analyzed the upstream signaling of Xenopus Rax (also known as Rx1) and identified the Otx2 and Sox2 proteins as direct upstream regulators of Rax. We revealed that endogenous Otx2 and Sox2 proteins bound to the conserved noncoding sequence (CNS1) located ≈2 kb upstream of the Rax promoter. This sequence is conserved among vertebrates and is required for potent transcriptional activity. Reporter assays showed that Otx2 and Sox2 synergistically activated transcription via CNS1. Furthermore, the Otx2 and Sox2 proteins physically interacted with each other, and this interaction was affected by the Sox2-missense mutations identified in these ocular disorders. These results demonstrate that the direct interaction and interdependence between the Otx2 and Sox2 proteins coordinate Rax expression in eye development, providing molecular linkages among the genes responsible for ocular malformation. PMID:18385377

Assessment of De Facto Wastewater Reuse across the US: trends between 1980 and 2008.

PubMed

Rice, Jacelyn; Wutich, Amber; Westerhoff, Paul

2013-10-01

De facto wastewater reuse is the incidental presence of treated wastewater in a water supply source. In 1980 the EPA identified drinking water treatment plants (DWTPs) impacted by upstream wastewater treatment plant (WWTP) discharges and found the top 25 most impacted DWTPs contained between 2% and 16% wastewater discharges from upstream locations (i.e., de facto reuse) under average streamflow conditions. This study is the first to provide an update to the 1980 EPA analysis. An ArcGIS model of DWTPs and WWTPs across the U.S. was created to quantify de facto reuse for the top 25 cities in the 1980 EPA study. From 1980 to 2008, de facto reuse increased for 17 of the 25 DWTPs, as municipal flows upstream of the sites increased by 68%. Under low streamflow conditions, de facto reuse in DWTP supplies ranged from 7% to 100%, illustrating the importance of wastewater in sustainable water supplies. Case studies were performed on four cities to analyze the reasons for changes in de facto reuse over time. Three of the four sites have greater than 20% treated wastewater effluent within their drinking water source for streamflow less than the 25th percentile historic flow.

Association of the 5′-upstream regulatory region of the α7 nicotinic acetylcholine receptor subunit gene (CHRNA7) with schizophrenia

PubMed Central

Stephens, Sarah H.; Logel, Judith; Barton, Amanda; Franks, Alexis; Schultz, Jessica; Short, Margaret; Dickenson, Jane; James, Benjamin; Fingerlin, Tasha E.; Wagner, Brandie; Hodgkinson, Colin; Graw, Sharon; Ross, Randal G.; Freedman, Robert; Leonard, Sherry

2009-01-01

Background The α7 neuronal nicotinic acetylcholine receptor subunit gene (CHRNA7) is localized in a chromosomal region (15q14) linked to schizophrenia in multiple independent studies. CHRNA7 was selected as the best candidate gene in the region for a well-documented endophenotype of schizophrenia, the P50 sensory processing deficit, by genetic linkage and biochemical studies. Methods Subjects included Caucasian-Non Hispanic and African-American case-control subjects collected in Denver, and schizophrenic subjects from families in the NIMH Genetics Initiative on Schizophrenia. Thirty-five single nucleotide polymorphisms (SNPs) in the 5′-upstream regulatory region of CHRNA7 were genotyped for association with schizophrenia, and for smoking in schizophrenia. Results The rs3087454 SNP, located at position −1831 bp in the upstream regulatory region of CHRNA7, was significantly associated with schizophrenia in the case-control samples after multiple-testing correction (P = 0.0009, African American; P = 0.013, Caucasian-Non Hispanic); the association was supported in family members. There was nominal association of this SNP with smoking in schizophrenia. Conclusions The data support association of regulatory region polymorphisms in the CHRNA7 gene with schizophrenia. PMID:19181484

Flowfield dynamics in blunt fin-induced shock wave/turbulent boundary layer interactions

NASA Technical Reports Server (NTRS)

Dolling, David S.; Brusniak, Leon

1994-01-01

Fluctuating wall pressure measurements have been made on centerline upstream of a blunt fin in a Mach 5 turbulent boundary layer. By examining the ensemble averaged wall pressure distributions for different separation shock foot positions, it has been shown that local fluctuating wall pressure measurements are due to a distinct pressure distribution, Rho(sub i), which undergoes a stretching and flattening effect as its upstream boundary translates aperiodically between the upstream influence and separation lines. The locations of the maxima and minima in the wall pressure standard deviation can be accurately predicted using this distribution, providing quantitative confirmation of the model. This model also explains the observed cross-correlations and ensemble average measurements within the interaction. Using the Rho(sub i) model, wall pressure signals from under the separated flow region were used to reproduce the position-time history of the separation shock foot. Further, the negative time delay peak in the cross-correlation between the predicted and actual shock foot histories suggests that the separated region fluctuations precede shock foot motion. The unsteady behavior of the primary horseshoe vortex and its relation to the unsteady separation shock are described.

Magnetosheath plasma stability and ULF wave occurrence as a function of location in the magnetosheath and upstream bow shock parameters

NASA Astrophysics Data System (ADS)

Soucek, Jan; Escoubet, C. Philippe; Grison, Benjamin

2015-04-01

We present the results of a statistical study of the distribution of mirror and Alfvén-ion cyclotron (AIC) waves in the magnetosheath together with plasma parameters important for the stability of ULF waves, specifically ion temperature anisotropy and ion beta. Magnetosheath crossings registered by Cluster spacecraft over the course of 2 years served as a basis for the statistics. For each observation we used bow shock, magnetopause, and magnetosheath flow models to identify the relative position of the spacecraft with respect to magnetosheath boundaries and local properties of the upstream shock crossing. A strong dependence of both plasma parameters and mirror/AIC wave occurrence on upstream ΘBn and MA is identified. We analyzed a joint dependence of the same parameters on ΘBn and fractional distance between shock and magnetopause, zenith angle, and length of the flow line. Finally, the occurrence of mirror and AIC modes was compared against the respective instability thresholds. We noted that AIC waves occurred nearly exclusively under mirror stable conditions. This is interpreted in terms of different characters of nonlinear saturation of the two modes.

Different Types of Ion Populations Upstream of the 2013 October 8 Interplanetary Shock

NASA Astrophysics Data System (ADS)

Kajdič, Primož; Hietala, Heli; Blanco-Cano, Xóchitl

2017-11-01

We show for the first time that different types of suprathermal ion distributions may exist upstream of a single interplanetary shock. ACE and the two ARTEMIS satellites observed a shock on 2013 October 8. The ARTEMIS P1 and P2 spacecraft first observed field-aligned ions (P1) and gyrating ions (P2) arriving from the shock. These were followed by intermediate ions and later by a diffuse population. At the location of the P2 the shock exhibited an Alfvénic Mach number of M A = 5.7 and was marginally quasi-perpendicular ({θ }{Bn}=47^\\circ ). At P1 spacecraft the shock was weaker (M A = 4.9) and more perpendicular ({θ }{Bn}=61^\\circ ). Consequently, the observed suprathermal ion and ultra-low-frequency wave properties were somewhat different. At P2 the ultra-low-frequency waves are more intense and extend farther upstream from the shock. The energies of field-aligned and gyrating ions in the shock rest-frame were ˜20 keV, which is much more than in the case of the stronger (M A = 6-7) Earth’s bow shock, where they are less than 10 keV.

Internal Performance of a Fixed-Shroud Nonaxisymmetric Nozzle Equipped with an Aft-Hood Exhaust Deflector

NASA Technical Reports Server (NTRS)

Asbury, Scott C.

1997-01-01

An investigation was conducted in the model preparation area of the Langley 16-Foot Transonic Tunnel to determine the internal performance of a fixed-shroud nonaxisymmetric nozzle equipped with an aft-hood exhaust deflector. Model geometric parameters investigated included nozzle power setting, aft-hood deflector angle, throat area control with the aft-hood deflector deployed, and yaw vector angle. Results indicate that cruise configurations produced peak performance in the range consistent with previous investigations of nonaxisymmetric convergent-divergent nozzles. The aft-hood deflector produced resultant pitch vector angles that were always less than the geometric aft-hood deflector angle when the nozzle throat was positioned upstream of the deflector exit. Significant losses in resultant thrust ratio occurred when the aft-hood deflector was deployed with an upstream throat location. At each aft-hood deflector angle, repositioning the throat to the deflector exit improved pitch vectoring performance and, in some cases, substantially improved resultant thrust ratio performance. Transferring the throat to the deflector exit allowed the flow to be turned upstream of the throat at subsonic Mach numbers, thereby eliminating losses associated with turning supersonic flow. Internal throat panel deflections were largely unsuccessful in generating yaw vectoring.

Environmental Health: Advancing Emancipatory Policies for the Common Good.

PubMed

Valentine-Maher, Sarah K; Butterfield, Patricia G; Laustsen, Gary

Human health is substantially impacted by the state of the environment, and environmental degradation has a disproportionate impact on persons with less immediate access to financial and social power. This article calls for upstream nursing action to address the natural environment in order to turn about health injustices and improve health for all. Such action would move nursing towards a greater actualization of the nursing environmental domain. The health impacts of climate change, air and water quality, and toxic chemical exposure are substantiated and specific policy leadership recommendations are proposed. Recommended actions include work to build environmental health literacy and empowerment, advocacy for regulatory protection and enforcement, and environmental engagement within health care systems.

Autogenic incision and terrace formation resulting from abrupt late-glacial base-level fall, lower Chippewa River, Wisconsin, USA

NASA Astrophysics Data System (ADS)

Faulkner, Douglas J.; Larson, Phillip H.; Jol, Harry M.; Running, Garry L.; Loope, Henry M.; Goble, Ronald J.

2016-08-01

A paucity of research exists regarding the millennial-scale response of inland alluvial streams to abrupt base-level fall. Studies of modern systems indicate that, over short time scales, the response is a diffusion-like process of upstream-propagating incision. In contrast, evidence from the lower Chippewa River (LCR), located in the upper Midwest of the USA, suggests that autogenic controls operating over time scales of several millennia can overwhelm diffusion, resulting in incision that is prolonged and episodic. During the Last Glacial Maximum, the LCR drained the Chippewa Lobe of the Laurentide Ice Sheet to the glacial upper Mississippi River (UMR). As a meltwater stream, it aggraded and filled its valley with glacial outwash, as did its largest tributaries, which were also meltwater streams. Its nonglacial tributaries aggraded, too, filling their valleys with locally derived sediment. During deglaciation, the UMR incised at least twice, abruptly lowering the LCR's base level - 15 m at 16 ka or earlier and an additional 40 m at ca. 13.4 ka. Each of these base-level falls initiated incision of the LCR, led by upstream migrating knickpoints. The propagation of incision has, however, been a lengthy process. The optically stimulated luminescence (OSL) ages of terrace alluvium indicate that, by 13.5 ka, incision had advanced up the LCR only 15 km, and by 9 ka, only 55 km. The process has also been episodic, resulting in the formation of fill-cut terraces (inferred from GPR surveys and exposures of terrace alluvium) that are younger and more numerous in the upstream direction. Autogenic increases in sediment load and autogenic bed armoring, the result of periodic tributary-stream rejuvenation and preferential winnowing of fines by the incising river, may have periodically caused knickpoint migration and incision to slow and possibly stop, allowing lateral erosion and floodplain formation to dominate. A decline in sediment flux from stabilizing incised tributary stream systems would have led to renewed knickpoint migration and incision when floods of sufficient magnitude to breach the channel armor occurred. Minimal floodplain development along the upper section of the present-day LCR, along with the channel morphology of an unstable wandering gravel-bed river immediately downstream from it, suggest that the river is still responding to the base-level falls that happened many millennia ago. The autogenic controls on the LCR's response to UMR incision are a direct consequence of the thick fills of noncohesive sediment that accumulated in its valley and the valleys of its tributary streams during the Late Wisconsinan, making the LCR a prime example of a former proglacial river that remains a paraglacial fluvial system.

Understanding the hydrologic impacts of wastewater treatment plant discharge to shallow groundwater: Before and after plant shutdown

USGS Publications Warehouse

Hubbard, Laura E.; Keefe, Steffanie H.; Kolpin, Dana W.; Barber, Larry B.; Duris, Joseph W.; Hutchinson, Kasey J.; Bradley, Paul M.

2016-01-01

Effluent-impacted surface water has the potential to transport not only water, but wastewater-derived contaminants to shallow groundwater systems. To better understand the effects of effluent discharge on in-stream and near-stream hydrologic conditions in wastewater-impacted systems, water-level changes were monitored in hyporheic-zone and shallow-groundwater piezometers in a reach of Fourmile Creek adjacent to and downstream of the Ankeny (Iowa, USA) wastewater treatment plant (WWTP). Water-level changes were monitored from approximately 1.5 months before to 0.5 months after WWTP closure. Diurnal patterns in WWTP discharge were closely mirrored in stream and shallow-groundwater levels immediately upstream and up to 3 km downstream of the outfall, indicating that such discharge was the primary control on water levels before shutdown. The hydrologic response to WWTP shutdown was immediately observed throughout the study reach, verifying the far-reaching hydraulic connectivity and associated contaminant transport risk. The movement of WWTP effluent into alluvial aquifers has implications for potential WWTP-derived contamination of shallow groundwater far removed from the WWTP outfall.

Green house emissions, inventories and evaluation of marine environment visa vis offshore oil field development activities Bombay high (west coast) upstream petroleum sector, India

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, J.S.; Ahmed, S.; Negi, C.V.S.

1996-12-31

Wide use of petroleum products contributes significant amount of emission to the global environment and hence maintaining emission inventories are of great importance while assessing the global green house emissions. The present paper describes a brief account of green house emission and inventories for CO{sub 2}, CO, NO{sub x}, HC particulate and SO{sub 2} emissions generated due to upstream petroleum sector activities viz. discharges of gaseous emission, combustion of Natural Gas anti HSD from production and drilling facilities of Bombay offshore area located in Exclusive Economic Zone (EEZ) west coast of India. Besides, authors have also given an account onmore » west coast marine base line status including impact of oil field activities on marine ecosystem.« less

Apparatus for measuring the decontamination factor of a multiple filter air-cleaning system

DOEpatents

Ortiz, John P.

1986-01-01

An apparatus for measuring the overall decontamination factor of first and second filters located in a plenum. The first filter separates the plenum's upstream and intermediate chambers. The second filter separates the plenum's intermediate and downstream chambers. The apparatus comprises an aerosol generator that generates a challenge aerosol. An upstream collector collects unfiltered aerosol which is piped to first and second dilution stages and then to a laser aerosol spectrometer. An intermediate collector collects challenge aerosol that penetrates the first filter. The filtered aerosol is piped to the first dilution stage, diluted, and then piped to the laser aerosol spectrometer which detects single particles. A downstream collector collects challenge aerosol that penetrates both filters. The twice-filtered aerosol is piped to the aerosol spectrometer. A pump and several valves control the movement of aerosol within the apparatus.

Apparatus for measuring the decontamination factor of a multiple filter air-cleaning system

DOEpatents

Ortiz, J.P.

1985-07-03

An apparatus for measuring the overall decontamination factors of first and second filters located in a plenum. The first filter separates the plenum's upstream and intermediate chambers. The second filter separates the plenum's intermediate and downstream chambers. The apparatus comprises an aerosol generator that generates a challenge aerosol. An upstream collector collects unfiltered aerosol which is piped to first and second dilution stages and then to a laser aerosol spectrometer. An intermediate collector collects challenge aerosol that penetrates the first filter. The filtered aerosol is piped to the first dilution stage, diluted, and then piped to the laser aerosol spectrometer which detects single particles. A downstream collector collects challenge aerosol that penetrates both filters. The twice-filtered aerosol is piped to the aerosol spectrometer. A pump and several valves control the movement of aerosol within the apparatus.

Emission of Sound from Turbulence Convected by a Parallel Mean Flow in the Presence of a Confining Duct

NASA Technical Reports Server (NTRS)

Goldstein, Marvin E.; Leib, Stewart J.

1999-01-01

An approximate method for calculating the noise generated by a turbulent flow within a semi-infinite duct of arbitrary cross section is developed. It is based on a previously derived high-frequency solution to Lilley's equation, which describes the sound propagation in a transversely-sheared mean flow. The source term is simplified by assuming the turbulence to be axisymmetric about the mean flow direction. Numerical results are presented for the special case of a ring source in a circular duct with an axisymmetric mean flow. They show that the internally generated noise is suppressed at sufficiently large upstream angles in a hard walled duct, and that acoustic liners can significantly reduce the sound radiated in both the upstream and downstream regions, depending upon the source location and Mach number of the flow.

Emission of Sound From Turbulence Convected by a Parallel Mean Flow in the Presence of a Confining Duct

NASA Technical Reports Server (NTRS)

Goldstein, Marvin E.; Leib, Stewart J.

1999-01-01

An approximate method for calculating the noise generated by a turbulent flow within a semi-infinite duct of arbitrary cross section is developed. It is based on a previously derived high-frequency solution to Lilley's equation, which describes the sound propagation in transversely-sheared mean flow. The source term is simplified by assuming the turbulence to be axisymmetric about the mean flow direction. Numerical results are presented for the special case of a ring source in a circular duct with an axisymmetric mean flow. They show that the internally generated noise is suppressed at sufficiently large upstream angles in a hard walled duct, and that acoustic liners can significantly reduce the sound radiated in both the upstream and downstream regions, depending upon the source location and Mach number of the flow.

Pillsbury Mills LLC Removal Site

EPA Pesticide Factsheets

The Pillsbury Mills LLC removal site is located at 1525 E. Phillips St., Springfield, IL. Residential properties are located immediately across the street on the north and east perimeters. The site is a former Pillsbury grain mill on about 18 acres.

Generating A Strobed Laser Light Sheet

NASA Technical Reports Server (NTRS)

Leighty, Bradley D.; Franke, John M.; Rhodes, David B.; Jones, Stephen B.

1994-01-01

An optoelectronic system generating synchronous, strobed sheet of laser light developed for use in making visible flow of air about model helicopter rotor. Used in wind-tunnel tests to determine actual locations of vortices for comparison with locations predicted by mathematical models to validate models. Each blade tip produces vortex. By establishing successive vortex locations, researcher determines trajectory of vortex pattern. Light-sheet strobe circuits provide selection of blade positions, strobe-pulse durations, and multiple pulses per revolution for rotors having two to nine blades. To make flow visible, vaporizing propylene glycol injected upstream of model. System also provides calibrated trigger delay of strobe pulses, adjustable strobe-pulse durations, selectable number of blades, and slip-sync mode to make flow visible as though in slow motion.

Traveling-wave device with mass flux suppression

DOEpatents

Swift, Gregory W.; Backhaus, Scott N.; Gardner, David L.

2000-01-01

A traveling-wave device is provided with the conventional moving pistons eliminated. Acoustic energy circulates in a direction through a fluid within a torus. A side branch may be connected to the torus for transferring acoustic energy into or out of the torus. A regenerator is located in the torus with a first heat exchanger located on a first side of the regenerator downstream of the regenerator relative to the direction of the circulating acoustic energy; and a second heat exchanger located on an upstream side of the regenerator. The improvement is a mass flux suppressor located in the torus to minimize time-averaged mass flux of the fluid. In one embodiment, the device further includes a thermal buffer column in the torus to thermally isolate the heat exchanger that is at the operating temperature of the device.

The use of remote sensing for rapid post-disaster assessment - an example from Kedarnath, Uttarakhand, north India (Invited)

NASA Astrophysics Data System (ADS)

Petley, D. N.

2013-12-01

Kedarnath is small town built around in important Hindu temple in the Rudraprayag district, Uttarakhand in northern India. Located at an elevation of 3,583 m, it is situated in a remote valley with no vehicular access. In summer, the temple is an important pilgrimage destination, with thousands of visitors per day, all of whom have to access the location via a 14 km trek or horse ride along a paved pathway, or via a helicopter ride. Between 14th and 17th June 2013, Uttarakhand was affected by unusually heavy early monsoonal rainfall. Whilst the rainfall totals did not reach record levels, the precipitation fell onto thawing snow, inducing very large debris flows. Kedarnath was affected by two major debris flows. According to eyewitness reports the first struck without warning in the evening of 16th June at about 7 pm local time. The second, larger, event occurred the following morning at about 6 am. The two debris flows destroyed most of the buildings in Kedarnath, although the temple survived with some damage. Across Uttarakhand it is estimated that about 5700 people died in the debris flows; the majority of these losses were at Kedarnath and in the immediate downstream communities. In the aftermath of the disaster there was considerable uncertainty as to the cause of the debris flows, with much speculation about the possibility that either a rock avalanche had developed on the flanks of the adjacent mountains or that there had been a catastrophic glacial collapse event upstream of the town. On 18th June the Indian Remote Sensing Organisation (IRSO) captured and released a RISAT-1 image of Kedarnath. Although the resolution was insufficient to determine what had occurred to trigger the disaster, it served to highlight two potential sources of the debris flows. One of these was an area of disturbance at the snout of the Charobari Glacier upslope from the town; the other was a possible landslide scar on an adjacent slope. On 23rd June 2013 NASA captured a Landsat 8 image of the site, which suggested that both of these sources might have been responsible for the debris flows. Finally, on 27th June IRSO released a high resolution RISAT-1 image of the Kedarnath region. This showed clearly that the first (16th June) debris flow originated from a landslide event upstream and to the east of the town. This took the form of an initially small, superficial landslide that entrained large volumes of debris before striking the town as a highly mobile debris flow. The second debris flow (on 17th June) was caused when an ephemeral lake, trapped behind a lateral moraine from the Charobari glacier upstream and to the east of the town, overtopped and catastrophically breached its barrier. The resultant flood scoured a large volume of sediment from the steep channel above the town, generating a very dense debris flow that was exceptionally destructive. Subsequent analyses by ground-based teams has suggested that this initial interpretation from remotely-sensed data was correct. Both of the sources of the debris flows were clearly evident on images captured before the event, and it is also clear that temple and the adjacent town were built on a terrace constructed in an earlier debris event. Thus, remotely sensed images could have played a role in the management of the hazard prior to the disaster.

Interplanetary Circumstances of Quasi-Perpendicular Interplanetary Shocks in 1996-2005

NASA Technical Reports Server (NTRS)

Richardson, I. G.; Cane, H. V.

2010-01-01

The angle (theta(sub Bn)) between the normal to an interplanetary shock front and the upstream magnetic field direction, though often thought of as a property "of the shock," is also determined by the configuration of the magnetic field immediately upstream of the shock. We investigate the interplanetary circumstances of 105 near-Earth quasi-perpendicular shocks during 1996-2005 identified by theta(sub Bn) greater than or equal to 80 degrees and/or by evidence of shock drift particle acceleration. Around 87% of these shocks were driven by interplanetary coronal mass ejections (ICMEs); the remainder were probably the forward shocks of corotating interaction regions. For around half of the shocks, the upstream field was approximately perpendicular to the radial direction, either east-west or west-east or highly inclined to the ecliptic. Such field directions will give quasi-perpendicular configurations for radially propagating shocks. Around 30% of the shocks were propagating through, or closely followed, ICMEs at the time of observation. Another quarter were propagating through the heliospheric plasma sheet (HPS), and a further quarter occurred in slow solar wind that did not have characteristics of the HPS. Around 11% were observed in high-speed streams, and 7% in the sheaths following other shocks. The fraction of shocks found in high-speed streams is around a third of that expected based on the fraction of the time when such streams were observed at Earth. Quasi-perpendicular shocks are found traveling through ICMEs around 2-3 times more frequently than expected. In addition, shocks propagating through ICMEs are more likely to have larger values of theta(sub Bn) than shocks outside ICMEs.

Direct Spectroscopic Study of Reconstituted Transcription Complexes Reveals That Intrinsic Termination Is Driven Primarily by Thermodynamic Destabilization of the Nucleic Acid Framework*S

PubMed Central

Datta, Kausiki; von Hippel, Peter H.

2008-01-01

Changes in near UV circular dichroism (CD) and fluorescence spectra of site-specifically placed pairs of 2-aminopurine residues have been used to probe the roles of the RNA hairpin and the RNA-DNA hybrid in controlling intrinsic termination of transcription. Functional transcription complexes were assembled directly by mixing preformed nucleic acid scaffolds of defined sequence with T7 RNA polymerase (RNAP). Scaffolds containing RNA hairpins immediately upstream of a GC-rich hybrid formed complexes of reduced stability, whereas the same hairpins adjacent to a hybrid of rU-dA base pairs triggered complex dissociation and transcript release. 2-Aminopurine probes at the upstream ends of the hairpin stems show that the hairpins open on RNAP binding and that stem re-formation begins after one or two RNA bases on the downstream side of the stem have emerged from the RNAP exit tunnel. Hairpins directly adjacent to the RNA-DNA hybrid weaken RNAP binding, decrease elongation efficiency, and disrupt the upstream end of the hybrid as well as interfere with the movement of the template base at the RNAP active site. Probing the edges of the DNA transcription bubble demonstrates that termination hairpins prevent translocation of the RNAP, suggesting that they transiently “lock” the polymerase to the nucleic acid scaffold and, thus, hold the RNA-DNA hybrid “in frame.” At intrinsic terminators the weak rU-dA hybrid and the adjacent termination hairpin combine to destabilize the elongation complex sufficiently to permit significant transcript release, whereas hairpin-dependent pausing provides time for the process to go to completion. PMID:18070878

Effect of Dam operation on monthly and annual trends of flow discharge in the Qom Rood Watershed, Iran

NASA Astrophysics Data System (ADS)

Yaghmaei, Hiva; Sadeghi, Seyed Hamidreza; Moradi, Hamidreza; Gholamalifard, Mehdi

2018-02-01

Trends in flow discharge, temperature and rainfall from the Qom Rood Watershed, Iran, for a period of 1979-2016 were analyzed at monthly and annual time scales. Trend analyses were conducted using the Mann-Kendall test, the double-mass curve of mean annual discharge versus rainfall, and rainfall-runoff relationship before and after the 15 Khordad Dam operation. Multiple regression of flow discharge against rainfall and temperature was used to determine the residual trend at four meteorological and hydrological stations located upstream and downstream of the Qom Rood Watershed. Results showed that the temperature at the upstream and downstream stations did not have any significant trend, but a significant decreasing trend (P < .05) in rainfall was detected only in May (z = -1.66) at the downstream stations. There was a significant positive trend (P < .05) in rainfall in February (z = 2.22) and July (z = 2.15) at the upstream stations, and in October (z = 2.3) and November (z = 1.8) at the downstream stations. However, there was a noticeable decrease in monthly and annual flow discharge, and residual trend at 99% significance level at the downstream stations. At the upstream stations, the flow discharges had significant (P < .05) declining trend in all months, but annual flow discharge did not change significantly. Analysis of double mass curve between runoff and rainfall at the downstream stations showed an inconsistency in the line slope concordant with the time of 15 Khordad Dam operation. Annual mean discharge at the upstream stations did not show a significant change before and after 15 Khordad Dam operation. However, annual flow magnitude decreased significantly by 87.5 and 81.7% in Shad Abad and KoohSefid, respectively. These results confirmed that natural driving forces did not affect flow discharge changes and the observed decreasing tendency in flow discharge at the downstream stations was due to 15 Khordad Dam, and at the upstream stations due to diversion/storage dams. These findings highlighted the role of human interference in changing the hydrologic regime in the study area based on which appropriate adaptive decisions can be made.

Coronal mass ejection hits mercury: A.I.K.E.F. hybrid-code results compared to MESSENGER data

NASA Astrophysics Data System (ADS)

Exner, W.; Heyner, D.; Liuzzo, L.; Motschmann, U.; Shiota, D.; Kusano, K.; Shibayama, T.

2018-04-01

Mercury is the closest orbiting planet around the sun and is therefore embedded in an intensive and highly varying solar wind. In-situ data from the MESSENGER spacecraft of the plasma environment near Mercury indicates that a coronal mass ejection (CME) passed the planet on 23 November 2011 over the span of the 12 h MESSENGER orbit. Slavin et al. (2014) derived the upstream parameters of the solar wind at the time of that orbit, and were able to explain the observed MESSENGER data in the cusp and magnetopause segments of MESSENGER's trajectory. These upstream parameters will be used for our first simulation run. We use the hybrid code A.I.K.E.F. which treats ions as individual particles and electrons as a mass-less fluid, to conduct hybrid simulations of Mercury's magnetospheric response to the impact of the CME on ion gyro time scales. Results from the simulation are in agreement with magnetic field measurements from the inner day-side magnetosphere and the bow-shock region. However, at the planet's nightside, Mercury's plasma environment seemed to be governed by different solar wind conditions, in conclusion, Mercury's interaction with the CME is not sufficiently describable by only one set of upstream parameters. Therefore, to simulate the magnetospheric response while MESSENGER was located in the tail region, we use parameters obtained from the MHD solar wind simulation code SUSANOO (Shiota et al. (2014)) for our second simulation run. The parameters of the SUSANOO model achieve a good agreement of the data concerning the plasma tail crossing and the night-side approach to Mercury. However, the polar and closest approach are hardly described by both upstream parameters, namely, neither upstream dataset is able to reproduce the MESSENGER crossing of Mercury's magnetospheric cusp. We conclude that the respective CME was too variable on the timescale of the MESSENGER orbit to be described by only two sets of upstream conditions. Our results suggest locally strong and highly variable dynamics of the CME on timescales of 15 min while MESSENGER was near closest approach.

Jigsaw Puzzles and River Banks: Two Ways of Picturing Our Future

ERIC Educational Resources Information Center

Kretchmar, R. Scott

2005-01-01

The papers presented at the 2004 Academy meetings can be thought of as pieces from jigsaw puzzles. While the employment of this metaphor over the years has been useful, we may be ready for a new image, one that is both more accurate and inspiring. We can picture ourselves working at different locations along a river bank. Some of us work upstream,…

The Solar Wind-Mars Interaction Boundaries in Three Dimensions

NASA Astrophysics Data System (ADS)

Gruesbeck, J.; Espley, J. R.; Connerney, J. E. P.; DiBraccio, G. A.; Soobiah, Y. I. J.

2017-12-01

The Martian magnetosphere is a product of the interaction of Mars with the interplanetary magnetic field and the supersonic solar wind. A bow shock forms upstream of the planet as the solar wind is diverted around the planet. Closer to the planet another boundary is located that separates the shock-heated solar wind plasma from the planetary plasma in the Martian magnetosphere. The Martian magnetosphere is induced by the pile-up of the interplanetary magnetic field. This induced magnetospheric boundary (IMB) has been referred to by different names, in part due to the observations available at the time. The location of these boundaries have been previously analyzed using data from Phobos 2, Mars Global Surveyor, and Mars Express resulting in models describing their average shapes. Observations of individual transitions demonstrate that it is a boundary with a finite thickness. The MAVEN spacecraft has been in orbit about Mars since November 2014 resulting in many encounters of the spacecraft with the boundaries. Using data from the Particle and Fields Package (PFP), we identify over 1000 bow shock crossings and over 4000 IMB crossings that we use to model the average locations. We model the boundaries as a 3-dimensional surface allowing observations of asymmetry. The average location of the bow shock and IMB lies further from the planet in the southern hemisphere, where stronger crustal fields are present. The MAVEN PFP dataset allows concurrent observations of the magnetic field and plasma environment to investigate the nature of the IMB and the relationship of the boundary to the different plasma signatures. Finally, we model the upstream and downstream encounters of the boundaries separately to produce shell models that quantify the finite thicknesses of the boundaries.

Distribution of Organic Carbon in the Sediments of Xinxue River and the Xinxue River Constructed Wetland, China.

PubMed

Cao, Qingqing; Wang, Renqing; Zhang, Haijie; Ge, Xiuli; Liu, Jian

2015-01-01

Wetland ecosystems are represented as a significant reservoir of organic carbon and play an important role in mitigating the greenhouse effect. In order to compare the compositions and distribution of organic carbon in constructed and natural river wetlands, sediments from the Xinxue River Constructed Wetland and the Xinxue River, China, were sampled at two depths (0-15 cm and 15-25 cm) in both upstream and downstream locations. Three types of organic carbon were determined: light fraction organic carbon, heavy fraction organic carbon, and dissolved organic carbon. The results show that variations in light fraction organic carbon are significantly larger between upstream and downstream locations than they are between the two wetland types; however, the opposite trend is observed for the dissolved organic carbon. There are no significant differences in the distribution of heavy fraction organic carbon between the discrete variables (e.g., between the two depths, the two locations, or the two wetland types). However, there are significant cross-variable differences; for example, the distribution patterns of heavy fraction organic carbon between wetland types and depths, and between wetland types and locations. Correlation analysis reveals that light fraction organic carbon is positively associated with light fraction nitrogen in both wetlands, while heavy fraction organic carbon is associated with both heavy fraction nitrogen and the moisture content in the constructed wetland. The results of this study demonstrate that the constructed wetland, which has a relatively low background value of heavy fraction organic carbon, is gradually accumulating organic carbon of different types, with the level of accumulation dependent on the balance between carbon accumulation and carbon decomposition. In contrast, the river wetland has relatively stable levels of organic carbon.

Distribution of Organic Carbon in the Sediments of Xinxue River and the Xinxue River Constructed Wetland, China

PubMed Central

Cao, Qingqing; Wang, Renqing; Zhang, Haijie; Ge, Xiuli; Liu, Jian

2015-01-01

Wetland ecosystems are represented as a significant reservoir of organic carbon and play an important role in mitigating the greenhouse effect. In order to compare the compositions and distribution of organic carbon in constructed and natural river wetlands, sediments from the Xinxue River Constructed Wetland and the Xinxue River, China, were sampled at two depths (0–15 cm and 15–25 cm) in both upstream and downstream locations. Three types of organic carbon were determined: light fraction organic carbon, heavy fraction organic carbon, and dissolved organic carbon. The results show that variations in light fraction organic carbon are significantly larger between upstream and downstream locations than they are between the two wetland types; however, the opposite trend is observed for the dissolved organic carbon. There are no significant differences in the distribution of heavy fraction organic carbon between the discrete variables (e.g., between the two depths, the two locations, or the two wetland types). However, there are significant cross-variable differences; for example, the distribution patterns of heavy fraction organic carbon between wetland types and depths, and between wetland types and locations. Correlation analysis reveals that light fraction organic carbon is positively associated with light fraction nitrogen in both wetlands, while heavy fraction organic carbon is associated with both heavy fraction nitrogen and the moisture content in the constructed wetland. The results of this study demonstrate that the constructed wetland, which has a relatively low background value of heavy fraction organic carbon, is gradually accumulating organic carbon of different types, with the level of accumulation dependent on the balance between carbon accumulation and carbon decomposition. In contrast, the river wetland has relatively stable levels of organic carbon. PMID:26230255

A varied subglacial landscape under Thwaites Glacier, West Antarctica

NASA Astrophysics Data System (ADS)

Christianson, K. A.; Holschuh, N.; Paden, J. D.; Sprick, J.; Peters, L. E.; Anandakrishnan, S.; Alley, R. B.

2017-12-01

Deglaciated landscapes, whether subaerial or submarine, are often host to a rich panoply of subglacial landforms, such as drumlims, crags, megascale glacial lineations, grounding-line wedges, deep meltwater channels, and more. These landforms are formed and shaped by interactions between the ice and underlying substrate, and thus have implications for the flow of the overlying ice. Robust interpretations of the relationship between the ice and its substrate based on subglacial landforms that remain after deglaciation have been inhibited by a dearth of high-resolution observations of currently glaciated subglacial landscapes, where ice flow speed is known and where subglacial conditions can be ascertained using geophysical methods. Past direct observations of landforms under currently fast-flowing ice have been limited to a few ice streams, where relatively homogeneous, thick dilatant till layers may favor formation of specific subglacial features, i.e., megascale glacial lineations and grounding-zone wedges. Here we present two detailed gridded subglacial topographies, obtained from ice-penetrating radar measurements, from Thwaites Glacier, West Antarctica, where ice flows over a highly variable bed (in both topography and model-inferred basal shear stress). One grid is located ˜170 km downstream from the ice divide where ice is moving ˜100 m/yr. Here the ice advects over a broad basin and then flows into a subglacial ridge (of several hundred meters amplitude) oriented orthogonally to flow. A deep canyon ( 400 m) that cuts through this ridge in roughly the ice-flow direction and relatively soft sediments on the downstream side of the basin (immediately upstream of the canyon) suggest that a large subglacial lake may have formed in this location and drained catastrophically, as has been hypothesized as the formation mechanism for the deep canyons observed on the Amundsen Sea continental shelf. Numerous multiscale glacial lineations are also observed in the subglacial basin. The second grid is located ˜300 km downstream of the ice divide where the ice is moving ˜350 m/yr. A large crag and even more extensive multiscale subglacial lineations are observed in the downstream grid. Our results suggest that multiple subglacial landforms form in close geographic proximity due to heterogeneous basal conditions.

Mapping contacts between gRNA and mRNA in trypanosome RNA editing.

PubMed

Leung, S S; Koslowsky, D J

1999-02-01

All guide RNAs (gRNAs) identified to date have defined 5' anchor sequences, guiding sequences and a non-encoded 3' uridylate tail. The 5' anchor is required for in vitro editing and is thought to be responsible for selection and binding to the pre-edited mRNA. Little is known, however, about how the gRNAs are used to direct RNA editing. Utilizing the photo-reactive crosslinking agent, azidophenacyl (APA), attached to the 5'- or 3'-terminus of the gRNA, we have begun to map the structural relationships between the different defined regions of the gRNA with the pre-edited mRNA. Analyses of crosslinked conjugates produced with a 5'-terminal APA group confirm that the anchor of the gRNA is correctly positioning the interacting molecules. 3' Crosslinks (X-linker placed at the 3'-end of a U10tail) have also been mapped for three different gRNA/mRNA pairs. In all cases, analyses indicate that the U-tail can interact with a range of nucleotides located upstream of the first edited site. It appears that the U-tail prefers purine-rich sites, close to the first few editing sites. These results suggest that the U-tail may act in concert with the anchor to melt out secondary structure in the mRNA in the immediate editing domain, possibly increasing the accessibility of the editing complex to the proper editing sites.

Cellodextrin Utilization by Bifidobacterium breve UCC2003▿ †

PubMed Central

Pokusaeva, Karina; O'Connell-Motherway, Mary; Zomer, Aldert; MacSharry, John; Fitzgerald, Gerald F.; van Sinderen, Douwe

2011-01-01

Cellodextrins, the incomplete hydrolysis products from insoluble cellulose, are accessible as a carbon source to certain members of the human gut microbiota, such as Bifidobacterium breve UCC2003. Transcription of the cldEFGC gene cluster of B. breve UCC2003 was shown to be induced upon growth on cellodextrins, implicating this cluster in the metabolism of these sugars. Phenotypic analysis of a B. breve UCC2003::cldE insertion mutant confirmed that the cld gene cluster is exclusively required for cellodextrin utilization by this commensal. Moreover, our results suggest that transcription of the cld cluster is controlled by a LacI-type regulator encoded by cldR, located immediately upstream of cldE. Gel mobility shift assays using purified CldRHis (produced by the incorporation of a His12-encoding sequence into the 3′ end of the cldC gene) indicate that the cldEFGC promoter is subject to negative control by CldRHis, which binds to two inverted repeats. Analysis by high-performance anion-exchange chromatography with pulsed amperometric detection (HPAEC-PAD) of medium samples obtained during growth of B. breve UCC2003 on a mixture of cellodextrins revealed its ability to utilize cellobiose, cellotriose, cellotetraose, and cellopentaose, with cellotriose apparently representing the preferred substrate. The cldC gene of the cld operon of B. breve UCC2003 is, to the best of our knowledge, the first described bifidobacterial β-glucosidase exhibiting hydrolytic activity toward various cellodextrins. PMID:21216899

Properties of blocking and non-blocking monoclonal antibodies specific for human macrophage galactose-type C-type lectin (MGL/ClecSF10A/CD301).

PubMed

Sano, Yoshihiko; Usami, Katsuaki; Izawa, Ryota; Denda-Nagai, Kaori; Higashi, Nobuaki; Kimura, Toshifumi; Suzuki, Noriko; Irimura, Tatsuro

2007-01-01

Monoclonal antibodies (mAbs) specific for the human macrophage galactose-type calcium-type lectin (MGL) were established. The recombinant extracellular domain of MGL was used to immunize a mouse, and 10 hybridoma clones were obtained. Binding of recombinant MGL to asialo-bovine submaxillary mucin was shown to be blocked by mAbs MLD-1, 4 and 6. Immunoprecipitation of MGL from lysates of COS-1 cells transfected with MGL cDNA (form 6A) was achieved with mAbs MLD-1, 4, 7, 8 and 16. Chimeric recombinant proteins between human MGL and mouse MGL1 were used to determine the location of the epitopes for these mAbs. mAbs MLD-8, 13, 15 and 16 interacted with the amino terminal side of the conserved WVDGTD sequence immediately upstream of QPD, whereas mAbs MLD-7, 12 and 17 interacted with the other side. mAbs MLD-1, 4, and 6 apparently required both sides of this boundary. mAbs MLD-15 and 16 were shown to recognize the protein products of alternatively spliced mRNA 6A/8A and 6C/8A, having deletions at the boundary of exons 7 and 8, in addition to full length and other spliced forms of MGL (6A, 6B and 6C), whereas the other mAbs bound only full length and forms 6A, 6B and 6C.

Dam Breach Release of Non-Cohesive Sediments: Channel Response and Recovery Rates

NASA Astrophysics Data System (ADS)

Collins, M. J.; Boardman, G.; Banks, W.; Andrews, M.; Conlon, M.; Dillow, J. J. A.; Gellis, A.; Lowe, S.; McClain, S.; Miller, A. J.; Snyder, N. P.; Wilcock, P. R.

2014-12-01

Dam removals featuring unchecked releases of non-cohesive sediments are excellent opportunities to learn more about stream channel response to abrupt increases in bed material supply that can occur deliberately or by natural processes like landslides and volcanic eruptions. Understanding channel response to sediment pulses, including response rates, is essential because human uses of river channels and floodplains are impacted by these events as are aquatic habitats. We had the opportunity to study a dam removal site at the Simkins Dam in Maryland, USA, that shares many important geophysical attributes of another well-studied dam removal in the humid northeast United States [Merrimack Village Dam, New Hampshire; Pearson et al., 2011]. The watershed sizes are the same order of magnitude (102 km2), and at both sites relatively low head dams were removed (~ 3-4 m) and ~60,000 m3 of dominantly sand-sized sediments discharged to low-gradient reaches immediately downstream. Analyzing four years of repeat morphometry and bed sediment grain size surveys at the Simkins site on the Patapsco River, as well as continuous discharge and suspended sediment gaging data, we clearly document a two-phase response in the upstream reach as described by Pearson et al. [2011] for their New Hampshire site and noted at other dam removals [e.g., Major et al., 2012]. In the early phase, approximately 50% of the impounded sediment mass was eroded rapidly over a period of about three months when flows were very modest (Figure 1). After incision to base level and channel widening in the former impoundment, a second phase began when further erosion depended on floods large enough to access impounded sediments more distant from the newly-formed channel. We also found important differences in the upstream responses at the Maryland and New Hampshire sites that appear to be related to valley type (non-glaciated versus glaciated, respectively). Response variances immediately downstream between the respective sites are potentially related to local gradient and hydraulics.

Geomorphic responses to large check-dam removal on a mountain river in Taiwan

NASA Astrophysics Data System (ADS)

Wang, H.; Stark, C. P.; Cook, K. L.; Kuo, W.

2011-12-01

Dam removal has become an important aspect of river restoration in recent years, but studies documenting the physical and ecological response to dam removal are still lacking - particularly in mountain rivers and following major floods. This presentation documents the recent removal of a large dam on a coarse-grained, steep (an order of magnitude greater than on the Marmot) mountain channel in Taiwan. The Chijiawan river, a tributary of the Tachia River draining a 1236 km2 watershed, is the only habitat in Taiwan of the endangered Formosan landlocked salmon. The habitat of this fish has been cut significantly since the 1960s following construction of check dams designed to prevent reservoir sedimentation downstream. The largest and lowermost barrier on Chijiawan creek is the 15m high, "No. 1 Check Dam" built in 1971. Forty years later, in early 2011, the sediment wedge behind the dam had reached an estimated 0.2 million m3 and the dam toe had been scoured about 4m below its foundation, posing a serious risk of dam failure. For these reasons, the Shei-Pa National Park removed the dam in late May 2011. To monitor the response of the river to dam removal, we installed video cameras, time-lapse cameras, stage recorders, and turbidity sensors, conducted surveys of grain size distributions and longitudinal profiles, and carried out repeat photography. Channel changes were greatest immediately following removal as a result of the high stream power, steep energy slope, and unconsolidated alluvial fill behind the dam. Headcut propagation caused immediate removal of the sand-grade sediment and progressive channel widening. One month after dam removal, a minor flood event excavated a big wedge of sediment from the impoundment. Most of the subsequent downstream deposition occurred within 500m of the dam, with alluviation reaching up to 0.5m in places. Two months after dam removal, erosion had propagated 300m upstream into the impounded sediment along a bed profile of gradient at 1.4% at a headcut with a local gradient of 5.1%. The change in grain size was a fining of the sediment at the two downstream sites and a slight coarsening at the upstream site from April 2010 to July 2011. This is likely due to the increase in energy upstream of the dam post-removal, which has transported the fine-grained sediments downstream. As the river adjusts over coming months and years, we anticipate that observations such as these will help generate an important resource for all those concerned with dam removal and river restoration.

2. VIEW OF THE LOCATION WHERE A STREAM CROSSING WILL ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

2. VIEW OF THE LOCATION WHERE A STREAM CROSSING WILL BE CONSTRUCTED FOR TRUCK HAULING PURPOSES DURING THE SALE AND WHERE THE AREA WILL BE RETURNED TO ITS NATURAL STATE AFTER HAULING IS COMPLETED. LOCATED IMMEDIATELY SOUTH OF HELIPAD #13. FACING NORTH 5 WEST (355ø). - Genoa Peak Road, Spur, Glenbrook, Douglas County, NV

75 FR 67414 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Filing and Immediate...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-02

... Proposed Rule Change To Modify Prices for Co-Location Services October 27, 2010. Pursuant to Section 19(b... Proposed Rule Change NASDAQ proposes to change to modify [sic] pricing for co-location services NASDAQ will... proposing to modify its fee schedule \\5\\ for co- location services.\\6\\ These modifications are summarized...

75 FR 66179 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Filing and Immediate...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-27

... Proposed Rule Change To Codify Prices for Co-Location Services October 21, 2010. Pursuant to Section 19(b... the Proposed Rule Change NASDAQ proposes to change to codify pricing for co-location services NASDAQ... Commission approved an initial fee schedule of existing fees for the Exchange's co-location services.\\3\\ This...

[Impacts on skin blood flow under moving cupping along meridians in different directions].

PubMed

Tian, Yu-Ying; Wang, Guang-Jun; Huang, Tao; Jia, Shu-Yong; Zhang, Yu-Qin; Zhang, Wei-Bo

2013-03-01

To compare the impacts on skin blood flow between moving cupping following the meridian running direction and that against the running direction. JLG-2 meridian cupping drainage instru ment was used for moving cupping on the back along the Bladder Meridian running course in either single direction for 20 times. The cupping device was Bian stone cup, 44 mm in inner diameter, negative pressure from -0.03 to -0.04 MPa. PeriScan PIM II laser Doppler perfusion imager was used to observe the changes in skin blood flow on the running course of the Bladder Meridian with cup moved up and down and in the same region on the contralateral Bladder Meridian. Blood flow was measured before cupping, at the immediate time after cupping and 10 min after cupping separately. Fourteen healthy volunteers received the test. The measuring region was subdivided into a moving cupping area, an upstream area, a downstream area, a contralateral moving cupping area, a contralateral upstream area and a contralateral downstream area. The mean blood flow was calculated in each area. Blood flow was increased significantly in each area and was more apparently increased in the moving cupping area. In comparison of the changing rate of blood flow between cupping following the meridian running direction and that against the running direction, it was only found that the changing rate in the upstream area of moving cupping against the running direction was significantly higher than that following the running direction (P < 0.05). The differences were not statistically significant in comparison among the other areas. Additionally, the changing rates of blood flow in the upstream and downstream area of the Bladder Meridian were increased significantly as compared with the contralateral Bladder Meridian. The local effects are similar between moving cupping following the meridian running direction and that against the running direction. The abscopal effect of moving cupping against the running direction is superior to that following the running direction. It is suggested that the dual-directional moving cupping is applicable for the treatment of local disorders and the abscopal effect is better with moving cupping against the meridian running direction.

76 FR 55432 - Self-Regulatory Organizations; New York Stock Exchange LLC; Notice of Filing and Immediate...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-07

...-Regulatory Organizations; New York Stock Exchange LLC; Notice of Filing and Immediate Effectiveness of Proposed Rule Change Amending Its Price List for Co-Location Services To Correct Several Typographical...'') \\1\\ and Rule 19b-4 thereunder,\\2\\ notice is hereby given that, on August 24, 2011, New York Stock...

Modeling migratory energetics of Connecticut River American shad (Alosa sapidissima): implications for the conservation of an iteroparous anadromous fish

USGS Publications Warehouse

Castro-Santos, Theodore; Letcher, Benjamin H.

2010-01-01

We present a simulation model in which individual adult migrant American shad (Alosa sapidissima) ascend the Connecticut River and spawn, and survivors return to the marine environment. Our approach synthesizes bioenergetics, reproductive biology, and behavior to estimate the effects of migratory distance and delays incurred at dams on spawning success and survival. We quantified both the magnitude of effects and the consequences of uncertainty in the estimates of input variables. Behavior, physiology, and energetics strongly affected both the distribution of spawning effort and survival to the marine environment. Delays to both upstream and downstream movements had dramatic effects on spawning success, determining total fecundity and spatial extent of spawning. Delays, combined with cues for migratory reversal, also determined the likelihood of survival. Spawning was concentrated in the immediate vicinity of dams and increased with greater migratory distance and delays to downstream migration. More research is needed on reproductive biology, behavior, energetics, and barrier effects to adequately understand the interplay of the various components of this model; it does provide a framework, however, that suggests that provision of upstream passage at dams in the absence of expeditious downstream passage may increase spawning success — but at the expense of reduced iteroparity. 

Ion dynamics at supercritical quasi-parallel shocks: Hybrid simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su Yanqing; Lu Quanming; Gao Xinliang

2012-09-15

By separating the incident ions into directly transmitted, downstream thermalized, and diffuse ions, we perform one-dimensional (1D) hybrid simulations to investigate ion dynamics at a supercritical quasi-parallel shock. In the simulations, the angle between the upstream magnetic field and shock nominal direction is {theta}{sub Bn}=30 Degree-Sign , and the Alfven Mach number is M{sub A}{approx}5.5. The shock exhibits a periodic reformation process. The ion reflection occurs at the beginning of the reformation cycle. Part of the reflected ions is trapped between the old and new shock fronts for an extended time period. These particles eventually form superthermal diffuse ions aftermore » they escape to the upstream of the new shock front at the end of the reformation cycle. The other reflected ions may return to the shock immediately or be trapped between the old and new shock fronts for a short time period. When the amplitude of the new shock front exceeds that of the old shock front and the reformation cycle is finished, these ions become thermalized ions in the downstream. No noticeable heating can be found in the directly transmitted ions. The relevance of our simulations to the satellite observations is also discussed in the paper.« less

The CUG-initiated larger form coat protein of Chinese wheat mosaic virus binds to the cysteine-rich RNA silencing suppressor.

PubMed

Sun, Liying; Andika, Ida Bagus; Shen, Jiangfeng; Yang, Di; Ratti, Claudio; Chen, Jianping

2013-10-01

Some viruses use alternative translation initiation at non-AUG codons as a strategy to produce multiple proteins during gene expression. Here we show that, using this strategy, Chinese wheat mosaic virus (CWMV; Furovirus) expresses a larger form of coat protein (N-ext/CP) in infected plants. Site-directed mutagenesis and transient expression analysis confirmed that CWMV N-ext/CP is initiated at an upstream in-frame CUG codon at nucleotide position 207-209 of RNA 2, which adds a 39 amino acid (aa) N-terminal extension to the major CP. Interestingly, in planta and in vitro analyses indicated that CWMV N-ext/CP but not CP interacts with the CWMV cysteine-rich protein (CRP), an RNA silencing suppressor. We further determined that the N-terminal 39 aa extension, particularly the 10 aa region immediately upstream of the major CP coding region is responsible for the interaction of N-ext/CP with CRP. In an Agrobacterium co-infiltration assay, co-expression with N-ext/CP did not affect CRP silencing suppression activity. Thus the alternative translation initiation at a CUG codon provides the CWMV N-ext/CP with the ability to bind to the viral silencing suppressor. Copyright © 2013 Elsevier B.V. All rights reserved.

Coliphage HK022 Nun protein inhibits RNA polymerase translocation

PubMed Central

Vitiello, Christal L.; Kireeva, Maria L.; Lubkowska, Lucyna; Kashlev, Mikhail; Gottesman, Max

2014-01-01

The Nun protein of coliphage HK022 arrests RNA polymerase (RNAP) in vivo and in vitro at pause sites distal to phage λ N-Utilization (nut) site RNA sequences. We tested the activity of Nun on ternary elongation complexes (TECs) assembled with templates lacking the λ nut sequence. We report that Nun stabilizes both translocation states of RNAP by restricting lateral movement of TEC along the DNA register. When Nun stabilized TEC in a pretranslocated register, immediately after NMP incorporation, it prevented binding of the next NTP and stimulated pyrophosphorolysis of the nascent transcript. In contrast, stabilization of TEC by Nun in a posttranslocated register allowed NTP binding and nucleotidyl transfer but inhibited pyrophosphorolysis and the next round of forward translocation. Nun binding to and action on the TEC requires a 9-bp RNA–DNA hybrid. We observed a Nun-dependent toe print upstream to the TEC. In addition, mutations in the RNAP β′ subunit near the upstream end of the transcription bubble suppress Nun binding and arrest. These results suggest that Nun interacts with RNAP near the 5′ edge of the RNA–DNA hybrid. By stabilizing translocation states through restriction of TEC lateral mobility, Nun represents a novel class of transcription arrest factors. PMID:24853501

Rearrangement of Upstream Sequences of the hTERT Gene During Cellular Immortalization

PubMed Central

Zhao, Yuanjun; Wang, Shuwen; Popova, Evgenya Y.; Grigoryev, Sergei A.; Zhu, Jiyue

2010-01-01

Telomerase expression, resulting from transcriptional activation of the hTERT gene, allows cells to acquire indefinite proliferative potential during cellular immortalization and tumorigenesis. However, mechanisms of hTERT gene activation in many immortal cell lines and cancer cells are poorly understood. Here, we report our studies on hTERT activation using genetically related pairs of telomerase-negative (Tel−) and -positive (Tel+) fibroblast lines. First, whereas transiently transfected plasmid reporters did not recapitulate the endogenous hTERT promoter, the promoter in chromosomally integrated bacterial artificial chromosome (BAC) reporters was activated in a subset of Tel+ cells, indicating that activation of the hTERT promoter required native chromatin context and/or distal regulatory elements. Second, the hTERT gene, located near the telomere of chromosome 5p, was translocated in all three Tel+ cell lines but not in their parental pre-crisis cells and Tel− immortal siblings. The breakage points were mapped to regions upstream of the hTERT promoter, indicating that the hTERT gene was the target of these chromosomal rearrangements. In two Tel+ cell lines, translocation of the endogenous hTERT gene appeared to be the major mechanism of its activation as the activity of hTERT promoter in many chromosomally integrated BAC reporters, with intact upstream and downstream neighboring loci, remained relatively low. Therefore, our results suggest that rearrangement of upstream sequences is an important new mechanism of hTERT promoter activation during cellular immortalization. The chromosomal rearrangements likely occurred during cellular crisis and facilitated by telomere dysfunction. Such translocations allowed the hTERT promoter to escape from the native condensed chromatin environment. PMID:19672873

Effects of climate change on streamflow extremes and implications for reservoir inflow in the United States

NASA Astrophysics Data System (ADS)

Naz, Bibi S.; Kao, Shih-Chieh; Ashfaq, Moetasim; Gao, Huilin; Rastogi, Deeksha; Gangrade, Sudershan

2018-01-01

The magnitude and frequency of hydrometeorological extremes are expected to increase in the conterminous United States (CONUS) over the rest of this century, and their increase will significantly impact water resource management. In this study, we evaluated the large-scale climate change effects on extreme hydrological events and their implications for reservoir inflows in 138 headwater subbasins located upstream of reservoirs across CONUS using the Variable Infiltration Capacity (VIC) hydrologic model. The VIC model was forced with a 10-member ensemble of global circulation models under the Representative Concentration Pathway 8.5 that were dynamically downscaled using a regional climate model (RegCM4) and bias-corrected to 1/24° grid cell resolution. Four commonly used indices, including mean annual flow, annual center timing, 100-year daily high streamflow, and 10-year 7-day average low streamflow were used for evaluation. The results projected an increase in the high streamflow by 44% for a majority of subbasins upstream of flood control reservoirs in the central United States (US) and a decrease in the low streamflow by 11% for subbasins upstream of hydropower reservoirs across the western US. In the eastern US, frequencies of both high and low streamflow were projected to increase in the majority of subbasins upstream of both hydropower and flood control reservoirs. Increased frequencies of both high and low streamflow events can potentially make reservoirs across CONUS more vulnerable to future climate conditions. This study estimates reservoir inflow changes over the next several decades, which can be used to optimize water supply management downstream.

Adequacy of Nasqan data to describe areal and temporal variability of water quality of the San Juan River Drainage basin upstream from Shiprock New Mexico

USGS Publications Warehouse

Goetz, C.L.; Abeyta, Cynthia G.

1987-01-01

Analyses indicate that water quality in the San Juan River drainage basin upstream from Shiprock, New Mexico, is quite variable from station to station. Analyses are based on water quality data from the U.S. Geological Survey WATSTORE files and the New Mexico Environmental Improvement Division 's files. In the northeastern part of the basin, most streams are calcium-bicarbonate waters. In the northwestern and southern part of the basin, the streams are calcium-sulfate and sodium-sulfate waters. Geology, climate, and land use and water use affect the water quality. Statistical analysis shows that streamflow, suspended-sediment, dissolved-iron, dissolved-orthophosphate-phosphorus, dissolved-sodium, dissolved-sulfate, and dissolved-manganese concentrations, specific conductance, and pH are highly variable among most stations. Dissolved-radium-226 concentration is the least variable among stations. A trend in one or more water quality constituents for the time period, October 1, 1973, through September 30, 1981, was detected at 15 out of 36 stations tested. The NASQAN stations Animas River at Farmington and San Juan River at Shiprock, New Mexico, record large volumes of flow that represent an integration of the flow from many upstream tributaries. The data collected do not represent what is occurring at specific points upstream in the basin, but do provide accurate information on how water quality is changing over time at the station location. A water quality, streamflow model would be necessary to predict accurately what is occurring simultaneously in the entire basin. (USGS)

Electronic search and rescue aids

NASA Technical Reports Server (NTRS)

Trudell, B. J.

1980-01-01

There are two elements to the basic electronic search and rescue problem: a means for immediately alerting potential rescuers and an effective method to guide the rescue forces to the scene of the emergency. An Emergency Locator Transmitter (ELT) used by aircraft or an Emergency Position Indicating Radio Beacon (EPIRB) used by maritime vessels has the capability of providing for both an immediate alert and a homing signal to assist rescue forces in locating the site of the distress. This paper describes the development of ELT/EPIRB systems. Emphasis is placed on the SARSAT project, the COSPAS/SARSAT project, and an experimental 406 MHz ELT/EPIRB system.

Monitoring of endangered Roanoke logperch (Percina rex) in Smith River upstream from the Philpott Reservoir on U.S. Army Corps of Engineers property near Martinsville, Virginia

USGS Publications Warehouse

Roberts, James H.; Angermeier, Paul L.

2012-01-01

The purpose of this study was to continue annual monitoring of Roanoke logperch (Percina rex), an endangered fish, in the Smith River immediately upstream from Philpott Reservoir. This river reach is owned by the U.S. Army Corps of Engineers (USACE), which must ensure that appropriate actions are undertaken to aid in recovery of logperch. Monitoring of fish abundance and habitat conditions provides a means for assessing the species’ status and its responses to USACE management actions. The Roanoke logperch is a large darter (Percidae: Etheostomatinae) endemic to the Roanoke, Dan, and Nottoway River basins of Virginia and North Carolina, where it occupies third- to sixth-order streams containing relatively silt-free substrate (Jenkins and Burkhead, 1994). Because of its rarity, small range, and vulnerability to siltation, the Roanoke logperch was listed in 1989 as endangered under the U.S. Endangered Species Act (ESA) (U.S. Federal Register 54:34468-34472). Within the Dan basin, Roanoke logperch have long been known to occupy the Smith River and one of its largest tributaries, Town Creek (Jenkins and Burkhead, 1994). Logperch also recently were discovered in other tributaries of the Dan River, including North Carolina segments of the Mayo River, Cascade Creek, Big Beaver Island Creek, Wolf Island Creek (William Hester, U.S. Fish and Wildlife Service, personal commun., 2012). Within the Smith River, Roanoke logperch are present both upstream and downstream from Philpott Reservoir, a hydroelectric and water storage project owned and operated by the USACE. Although logperch have not been observed in the reservoir itself, the species is relatively abundant in a free-flowing, ≈ 2.5-km-long segment of Smith River upstream from the reservoir on USACE property (Lahey and Angermeier, 2006). This segment is bounded on the downstream end by the lentic conditions of the reservoir and on the upstream end by White Falls, a natural waterfall that presumably allows fish passage during all but the lowest streamflow (Roberts and Angermeier, 2009). The ESA stipulates that USACE must ensure that its actions do not jeopardize Roanoke logperch and ensure that appropriate actions are taken to aid in the recovery of Roanoke logperch. USACE recognized that additional information was needed to assess compliance with these stipulations, including data on baseline population levels, habitat availability, and potential threats to the species on USACE property. USACE therefore contracted with Virginia Tech (VT) and the U.S. Geological Survey via the Virginia Cooperative Fisheries and Wildlife Research Unit (VCFWRU) to continue ecological monitoring that was initiated in a pilot study in 2005 (Lahey and Angermeier, 2006). The VCFWRU is jointly sponsored by the U.S. Geological Survey, Virginia Tech, Virginia Department of Game and Inland Fisheries, and Wildlife Management Institute. This final report summarizes results of biological monitoring performed by VT and the VCFWRU in 2011, and compares these data to data collected during 2006–2010 (Roberts and Angermeier, 2011). Where appropriate, a comparison was made to data on Roanoke logperch collected previously in the study reach (Lahey and Angermeier, 2006) and in the upper Roanoke River (Roberts and Angermeier, 2011). This work was performed under the auspices of VT’s Institutional Animal Care and Use Committee (IACUC) protocol 11-035-FIW. Specifically, the following objectives were addressed: * Estimate population density of Roanoke logperch on USACE property; * Measure and map by suitability class the distribution of habitat suitable for Roanoke logperch in the project area; * Assess water quality relative to Roanoke logperch habitat in the project area; * Use the data on logperch abundance, habitat suitability, and water quality to test the general validity of correlates of logperch abundance from other locations; * Identify opportunities and threats related to protecting and enhancing Roanoke logperch habitat; and * Provide suggestions on the necessity and scale of future studies and monitoring related to logperch in and near USACE waters.

Effects of free-stream turbulence intensity on transition in a laminar separation bubble formed over an airfoil

NASA Astrophysics Data System (ADS)

Istvan, Mark S.; Yarusevych, Serhiy

2018-03-01

The laminar-to-turbulent transition process in a laminar separation bubble formed over a NACA 0018 airfoil is investigated experimentally. All experiments are performed for an angle of attack of 4°, chord Reynolds numbers of 80,000 and 125,000, and free-stream turbulence intensities between 0.06 and 1.99%. The results show that increasing the level of free-stream turbulence intensity leads to a decrease in separation bubble length, attributed to a downstream shift in mean separation and an upstream shift in mean reattachment, the later ascribed to an upstream shift in mean transition. Maximum spatial amplification rates of disturbances in the separated shear layer decrease with increasing free-stream turbulence intensity, implying that the larger initial amplitudes of disturbances are solely responsible for the upstream shift in mean transition and as a result mean reattachment. At the baseline level of turbulence intensity, coherent structures forming in the aft portion of the bubble are characterized by strong spanwise coherence at formation, and undergo spanwise deformations leading to localized breakup in the vicinity of mean reattachment. As the level of free-stream turbulence intensity is increased, the spanwise coherence of the shear layer rollers is reduced, and spanwise undulations in the vortex filaments start to take place at the mean location of roll-up. At the highest level of turbulence intensity investigated, streamwise streaks originating in the boundary layer upstream of the separation bubble are observed within the bubble. These streaks signify an onset of bypass transition upstream of the separation bubble, which gives rise to a highly three-dimensional shear layer roll-up. A quantitative analysis of the associated changes in salient characteristics of the coherent structures is presented, connecting the effect of elevated free-stream turbulence intensity on the time-averaged and dynamic characteristics of the separation bubble.

Effects of high salinity wastewater discharges on unionid mussels in the Allegheny River, Pennsylvania

USGS Publications Warehouse

Kathleen Patnode,; Hittle, Elizabeth A.; Robert Anderson,; Lora Zimmerman,; Fulton, John W.

2015-01-01

We examined the effect of high salinity wastewater (brine) from oil and natural gas drilling on freshwater mussels in the Allegheny River, Pennsylvania, during 2012. Mussel cages (N = 5 per site) were deployed at two sites upstream and four sites downstream of a brine treatment facility on the Allegheny River. Each cage contained 20 juvenile northern riffleshell mussels Epioblasma torulosa rangiana). Continuous specific conductance and temperature data were recorded by water quality probes deployed at each site. To measure the amount of mixing throughout the entire study area, specific conductance surveys were completed two times during low-flow conditions along transects from bank to bank that targeted upstream (reference) reaches, a municipal wastewater treatment plant discharge upstream of the brine-facility discharge, the brine facility, and downstream reaches. Specific conductance data indicated that high specific conductance water from the brine facility (4,000–12,000 µS/cm; mean 7,846) compared to the reference reach (103–188 µS/cm; mean 151) is carried along the left descending bank of the river and that dilution of the discharge via mixing does not occur until 0.5 mi (805 m) downstream. Juvenile northern riffleshell mussel survival was severely impaired within the high specific conductance zone (2 and 34% at and downstream of the brine facility, respectively) and at the municipal wastewater treatment plant (21%) compared to background (84%). We surveyed native mussels (family Unionidae) at 10 transects: 3 upstream, 3 within, and 4 downstream of the high specific conductance zone. Unionid mussel abundance and diversity were lower for all transects within and downstream of the high conductivity zone compared to upstream. The results of this study clearly demonstrate in situ toxicity to juvenile northern riffleshell mussels, a federally endangered species, and to the native unionid mussel assemblage located downstream of a brine discharge to the Allegheny River.

Defective distal regulatory element at the 5' upstream of rat prolactin gene of steroid-nonresponsive GH-subclone.

PubMed

Kumar, V; Wong, D T; Pasion, S G; Biswas, D K

1987-12-08

The prolactin-nonproducing (PRL-) GH cell strains (rat pituitary tumor cells in culture). GH12C1 and F1BGH12C1, do not respond to steroid hormones estradiol or hydrocortisone (HC). However, the stimulatory effect of estradiol and the inhibitory effect of hydrocortisone on prolactin synthesis can be demonstrated in the prolactin-producing GH cell strain, GH4C1. In this investigation we have examined the 5' end flanking region of rat prolactin (rat PRL) gene of steroid-responsive, GH4C1 cells to identify the positive and negative regulatory elements and to verify the status of these elements in steroid-nonresponsive F1BGH12C1 cells. Results presented in this report demonstrate that the basel level expression of the co-transferred Neo gene (neomycin phosphoribosyl transferase) is modulated by the distal upstream regulatory elements of rat PRL gene in response to steroid hormones. The expression of adjacent Neo gene is inhibited by dexamethasone and is stimulated by estradiol in transfectants carrying distal regulatory elements (SRE) of steroid-responsive cells. These responses are not observed in transfectants with the rat PRL upstream sequences derived from steroid-nonresponsive cells. The basal level expression of the host cell alpha-2 tubulin gene is not affected by dexamethasone. We report here the identification of the distal steroid regulatory element (SRE) located between 3.8 and 7.8 kb upstream of the transcription initiation site of rat PRL gene. Both the positive and the negative effects of steroid hormones can be identified within this upstream sequence. This distal SRE appears to be nonfunctional in steroid-nonresponsive cells. Though the proximal SRE is functional, the defect in the distal SRE makes the GH substrain nonresponsive to steroid hormones. These results suggest that both the proximal and the distal SREs are essential for the mediation of action of steroid hormones in GH cells.

Characterization of the microbial community composition and the distribution of Fe-metabolizing bacteria in a creek contaminated by acid mine drainage.

PubMed

Sun, Weimin; Xiao, Enzong; Krumins, Valdis; Dong, Yiran; Xiao, Tangfu; Ning, Zengping; Chen, Haiyan; Xiao, Qingxiang

2016-10-01

A small watershed heavily contaminated by long-term acid mine drainage (AMD) from an upstream abandoned coal mine was selected to study the microbial community developed in such extreme system. The watershed consists of AMD-contaminated creek, adjacent contaminated soils, and a small cascade aeration unit constructed downstream, which provide an excellent contaminated site to study the microbial response in diverse extreme AMD-polluted environments. The results showed that the innate microbial communities were dominated by acidophilic bacteria, especially acidophilic Fe-metabolizing bacteria, suggesting that Fe and pH are the primary environmental factors in governing the indigenous microbial communities. The distribution of Fe-metabolizing bacteria showed distinct site-specific patterns. A pronounced shift from diverse communities in the upstream to Proteobacteria-dominated communities in the downstream was observed in the ecosystem. This location-specific trend was more apparent at genus level. In the upstream samples (sampling sites just below the coal mining adit), a number of Fe(II)-oxidizing bacteria such as Alicyclobacillus spp., Metallibacterium spp., and Acidithrix spp. were dominant, while Halomonas spp. were the major Fe(II)-oxidizing bacteria observed in downstream samples. Additionally, Acidiphilium, an Fe(III)-reducing bacterium, was enriched in the upstream samples, while Shewanella spp. were the dominant Fe(III)-reducing bacteria in downstream samples. Further investigation using linear discriminant analysis (LDA) effect size (LEfSe), principal coordinate analysis (PCoA), and unweighted pair group method with arithmetic mean (UPGMA) clustering confirmed the difference of microbial communities between upstream and downstream samples. Canonical correspondence analysis (CCA) and Spearman's rank correlation indicate that total organic carbon (TOC) content is the primary environmental parameter in structuring the indigenous microbial communities, suggesting that the microbial communities are shaped by three major environmental parameters (i.e., Fe, pH, and TOC). These findings were beneficial to a better understanding of natural attenuation of AMD.

Transport of chemical and microbial compounds from known wastewater discharges: Potential for use as indicators of human fecal contamination

USGS Publications Warehouse

Glassmeyer, S.T.; Furlong, E.T.; Kolpin, D.W.; Cahill, J.D.; Zaugg, S.D.; Werner, S.L.; Meyer, M.T.; Kryak, D.D.

2005-01-01

The quality of drinking and recreational water is currently (2005) determined using indicator bacteria. However, the culture tests used to analyze for these bacteria require a long time to complete and do not discriminate between human and animal fecal material sources. One complementary approach is to use chemicals found in human wastewater, which would have the advantages of (1) potentially shorter analysis times than the bacterial culture tests and (2) being selected for human-source specificity. At 10 locations, water samples were collected upstream and at two successive points downstream from a wastewaster treatment plant (WWTP); a treated effluent sample was also collected at each WWTP. This sampling plan was used to determine the persistence of a chemically diverse suite of emerging contaminants in streams. Samples were also collected at two reference locations assumed to have minimal human impacts. Of the 110 chemical analytes investigated in this project, 78 were detected at least once. The number of compounds in a given sample ranged from 3 at a reference location to 50 in a WWTP effluent sample. The total analyte load at each location varied from 0.018 μg/L at the reference location to 97.7 μg/L in a separate WWTP effluent sample. Although most of the compound concentrations were in the range of 0.01−1.0 μg/L, in some samples, individual concentrations were in the range of 5−38 μg/L. The concentrations of the majority of the chemicals present in the samples generally followed the expected trend:  they were either nonexistent or at trace levels in the upstream samples, had their maximum concentrations in the WWTP effluent samples, and then declined in the two downstream samples. This research suggests that selected chemicals are useful as tracers of human wastewater discharge.

Near-field vector intensity measurements of a small solid rocket motor.

PubMed

Gee, Kent L; Giraud, Jarom H; Blotter, Jonathan D; Sommerfeldt, Scott D

2010-08-01

Near-field vector intensity measurements have been made of a 12.7-cm diameter nozzle solid rocket motor. The measurements utilized a test rig comprised of four probes each with four low-sensitivity 6.35-mm pressure microphones in a tetrahedral arrangement. Measurements were made with the rig at nine positions (36 probe locations) within six nozzle diameters of the plume shear layer. Overall levels at these locations range from 135 to 157 dB re 20 microPa. Vector intensity maps reveal that, as frequency increases, the dominant source region contracts and moves upstream with peak directivity at greater angles from the plume axis.

The velocity field created by a shallow bump in a boundary layer

NASA Technical Reports Server (NTRS)

Gaster, Michael; Grosch, Chester E.; Jackson, Thomas L.

1994-01-01

We report the results of measurements of the disturbance velocity field generated in a boundary layer by a shallow three-dimensional bump oscillating at a very low frequency on the surface of a flat plate. Profiles of the mean velocity, the disturbance velocity at the fundamental frequency and at the first harmonic are presented. These profiles were measured both upstream and downstream of the oscillating bump. Measurements of the disturbance velocity were also made at various spanwise and downstream locations at a fixed distance from the boundary of one displacement thickness. Finally, the spanwise spectrum of the disturbances at three locations downstream of the bump are presented.

Modeled de facto reuse and contaminants of emerging concern in drinking water source waters

USGS Publications Warehouse

Nguyen, Thuy; Westerhoff, Paul; Furlong, Edward T.; Kolpin, Dana W.; Batt, Angela L.; Mash, Heath E.; Schenck, Kathleen M.; Boone, J. Scott; Rice, Jacelyn; Glassmeyer, Susan T.

2018-01-01

De facto reuse is the percentage of drinking water treatment plant (DWTP) intake potentially composed of effluent discharged from upstream wastewater treatment plants (WWTPs). Results from grab samples and a De Facto Reuse in our Nation's Consumable Supply (DRINCS) geospatial watershed model were used to quantify contaminants of emerging concern (CECs) concentrations at DWTP intakes to qualitatively compare exposure risks obtained by the two approaches. Between nine and 71 CECs were detected in grab samples. The number of upstream WWTP discharges ranged from 0 to >1,000; comparative de facto reuse results from DRINCS ranged from <0.1 to 13% during average flow and >80% during lower streamflows. Correlation between chemicals detected and DRINCS modeling results were observed, particularly DWTPs withdrawing from midsize water bodies. This comparison advances the utility of DRINCS to identify locations of DWTPs for future CEC sampling and treatment technology testing.

Analysis of the Giacobini-Zinner bow wave

NASA Technical Reports Server (NTRS)

Smith, E. J.; Slavin, J. A.; Bame, S. J.; Thomsen, M. F.; Cowley, S. W. H.; Richardson, I. G.; Hovestadt, D.; Ipavich, F. M.; Ogilvie, K. W.; Coplan, M. A.

1986-01-01

The cometary bow wave of P/Giacobini-Zinner has been analyzed using the complete set of ICE field and particle observations to determine if it is a shock. Changes in the magnetic field and plasma flow velocities from upstream to downstream have been analyzed to determine the direction of the normal and the propagation velocity of the bow wave. The velocity has then been compared with the fast magnetosonic wave speed upstream to derive the Mach number and establish whether it is supersonic, i.e., a shock, or subsonic, i.e., a large amplitude wave. The various measurements have also been compared with values derived from a Rankine-Hugoniot analysis. The results indicate that, inbound, the bow wave is a shock with M = 1.5. Outbound, a subsonic Mach number is obtained, however, arguments are presented that the bow wave is also likely to be a shock at this location.

Alphavirus replicon approach to promoterless analysis of IRES elements.

PubMed

Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

2007-04-10

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

PubMed Central

Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

2007-01-01

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

Noise of a simulated installed model counterrotation propeller at angle-of-attack and takeoff/approach conditions

NASA Technical Reports Server (NTRS)

Woodward, Richard P.

1990-01-01

Acoustic results for two model counterrotation propellers are presented. The propellers were tested over a range of rotational speeds and propeller axis angles of attack in both the baseline configuration and the installed configuration consisting of a simulated upstream nacelle support pylon and fuselage section. Acoustic data were taken with a polar microphone probe attached to the downstream propeller housing, capable of surveying directivities at several azimuthal locations. The forward and aft rotor power coefficients and fundamental rotor-alone tone levels are found to be directly controlled by propeller axis angle of attack. The second-order rotor-alone tones are strongly influenced by the upstream pylon wake at 80 percent speed; however, rotor-alone mechanisms control the tone level at 90 percent speed, while rotor-rotor interaction tones are essentially unaffected by the presence of the simulated installation.

Turbine exhaust diffuser with a gas jet producing a coanda effect flow control

DOEpatents

Orosa, John; Montgomery, Matthew

2014-02-11

An exhaust diffuser system and method for a turbine engine includes an inner boundary and an outer boundary with a flow path defined therebetween. The inner boundary is defined at least in part by a hub structure that has an upstream end and a downstream end. The outer boundary may include a region in which the outer boundary extends radially inward toward the hub structure and may direct at least a portion of an exhaust flow in the diffuser toward the hub structure. The hub structure includes at least one jet exit located on the hub structure adjacent to the upstream end of the tail cone. The jet exit discharges a flow of gas substantially tangential to an outer surface of the tail cone to produce a Coanda effect and direct a portion of the exhaust flow in the diffuser toward the inner boundary.

Hydrology of area 52, Rocky Mountain coal province Wyoming, Colorado, Idaho, and Utah

USGS Publications Warehouse

Lowham, H.W.; Peterson, D.A.; Larson, L.R.; Zimmerman, E.A.; Ringen, B.H.; Mora, K.L.

1985-01-01

This report is one of a series designed to characterize the hydrology of drainage basins within coal provinces, nationwide. Area 52 (in the Rocky Mountain Coal Province) includes the Green River Basin upstream from the Yampa River, and the Bear River upstream from the Bear Lake - a total of 23,870 sq mi. Area 52 contains over 3 billion tons of strippable coal, most of which is located in the arid and semiarid plains. The report represents a summary of results of the water resources investigations of the U.S. Geological Survey, carried out in cooperation with State and other Federal agencies. More than 40 individual topics are discussed in a brief text that is accompanied by maps, graphs, photographs, and other illustrations. Primary topics in the report are: general features, resources and economy, surface-water quantity and quality, and groundwater. (USGS)

Radio frequency coaxial feedthrough device

DOEpatents

Owens, Thomas L.; Baity, Frederick W.; Hoffman, Daniel J.; Whealton, John H.

1987-01-01

A radio frequency coaxial vacuum feedthrough is provided which utilizes a cylindrical ceramic vacuum break formed of an alumina ceramic. The cylinder is coaxially disposed and brazed between tapered coaxial conductors to form a vacuum sealed connection between a pressurized upstream coaxial transmission line and a utilization device located within a vacuum container. The feedthrough provides 50 ohm matched impedance RF feedthrough up to about 500 MHz at power levels in the multimegawatt range.

Hydrologic effects of size and location of harvesting on a large drained pine forest on organic soils

Treesearch

Devendra M. Amatya; Kim Hyunwoo; George M. Chescheir; R. Wayne Nettles Skaggs

2008-01-01

A calibrated DRAINWAT model was used to evaluate long -term hydrologic effects of conversion to agriculture of a 30 km2 pine forest on mostly organic soils in North Carolina, USA. Fifty years of weather data were used for determining baseline outflows. Simulation revealed that increased mean annual outflow was significant only for a 75% conversion at both upstream and...

11. Photographic copy of photograph, photographer unknown, 2 July 1938 ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. Photographic copy of photograph, photographer unknown, 2 July 1938 (original print located at U.S. Bureau of Reclamation Upper Columbia Area Office, Yakima, Washington). "Inspecting concrete on upstream face of Keechelus Dam spillway. Joseph Jacobs, consulting engineer; M.B. Lemon, Gatetender; Paul Taylor, assistant engineer; and C.H. Paul, consulting engineer." - Keechelus Dam, Spillway, Yakim River, 10 miles northwest of Easton, Easton, Kittitas County, WA

Diet of juvenile and adult American Shad in the Columbia River

USGS Publications Warehouse

Sauter, Sally T.; Blubaugh, J; Parsley, Michael J.

2011-01-01

The diet of juvenile and adult American shad Alosa sapidissima captured from various locations in the Columbia River was investigated during 2007 and 2008. Collection efforts in 2007 were restricted to fish collected from existing adult and juvenile fish collection facilities located at Bonneville Dam and to adult shad captured by angling downstream from Bonneville Dam. In 2008, we used gillnets, electrofishing, beach seining, or cast nets to collect juvenile and adult shad from the saline estuary near Astoria (approximately river km 24) to just upstream from McNary Dam (approximately river km 472). We examined the stomach contents of 436 American shad captured in 2007 and 1,272 captured in 2008. Fish caught within the river were much more likely to contain food items than fish removed from fish collection facilities.

The diet of age-0 American shad varied spatially and temporally, but was comprised primarily of crustaceans and insects. Prey diversity of age-0 American shad, as assessed by the Shannon Diversity Index, increased with decreasing distance to the estuary. Pre- and partial-spawn American shad primarily consumed Corophium spp. throughout the Columbia River; however, post-spawn adults primarily consumed gastropods upstream of McNary Dam

Application of holography to the determination of flow conditions within the rotating blade row of a compressor

NASA Technical Reports Server (NTRS)

Hantman, R. G.; Burr, R. J.; Alwang, W. G.; Williams, M. C.

1973-01-01

The double-pulse, double-exposure holography technique was applied to visualize the flow field within a transonic compressor rotor with a tip speed of 1800 ft/sec. The principal objective was to visualize the shock waves created in the flow field which was supersonic relative to the rotating blade row. The upstream rotor blade bow shocks and, at high speed, the outermost portion of the leading edge passage shock were successfully observed in the holograms. Techniques were devised for locating these shocks in three dimensions, and the results were compared with theoretical predictions. Density changes between the two pulses due to motion of the shocks were large and, therefore, it was not possible to resolve the fringe systems in detail for the 100% speed conditions. However, gross features of the shocks were easily observed, and the upstream shocks were well displayed. In all cases the shock angles were somewhat larger than predicted by theory, and a distinct increase in angle near the outer wall was observed, which may be attributed to endwall boundary layer effects. The location and orientation of the observed leading edge passage shocks were in good agreement with static pressure contours obtained from measurements in the outer casing over the rotor tip.

Hyperspectral Proximal Sensing of Salix Alba Trees in the Sacco River Valley (Latium, Italy)

PubMed Central

Moroni, Monica; Lupo, Emanuela; Cenedese, Antonio

2013-01-01

Recent developments in hardware and software have increased the possibilities and reduced the costs of hyperspectral proximal sensing. Through the analysis of high resolution spectroscopic measurements at the laboratory or field scales, this monitoring technique is suitable for quantitative estimates of biochemical and biophysical variables related to the physiological state of vegetation. Two systems for hyperspectral imaging have been designed and developed at DICEA-Sapienza University of Rome, one based on the use of spectrometers, the other on tunable interference filters. Both systems provide a high spectral and spatial resolution with low weight, power consumption and cost. This paper describes the set-up of the tunable filter platform and its application to the investigation of the environmental status of the region crossed by the Sacco river (Latium, Italy). This was achieved by analyzing the spectral response given by tree samples, with roots partly or wholly submerged in the river, located upstream and downstream of an industrial area affected by contamination. Data acquired is represented as reflectance indices as well as reflectance values. Broadband and narrowband indices based on pigment content and carotenoids vs. chlorophyll content suggest tree samples located upstream of the contaminated area are ‘healthier’ than those downstream. PMID:24172281

Evaluation of alternatives for lowering the groundwater table in a village in upper Egypt affected by the construction of the New Naga Hammadi barrage

NASA Astrophysics Data System (ADS)

Mageed, Neveen B. Abd El; Ansary, Amgad S. El; Ghanem, Ashraf M.; Elsaeed, Gamal H.

2009-03-01

The Egyptian government is replacing the existing Naga Hammadi barrage, located across the Nile River some 450 km south of Cairo, with the New Naga Hammadi barrage (NNHB) to incorporate a hydropower plant and to improve conditions for river traffic. The new structure will lead to an increase in river water levels, both locally near the new barrage and upstream. The rise in river water levels will in turn result in changes in groundwater levels in the aquifer system up and downstream of the barrages. In this paper, an area is chosen, which is expected to suffer from a high groundwater table after the construction of the NNHB, to investigate the problem and propose alternatives for lowering the groundwater levels. The study area is a village called Bakhaness, with an area of 588 ha. It is located some 1.5 km upstream of the NNHB. A computer model (MicroFEM) has been used to simulate the groundwater conditions before and after construction of the NNHB. Alternatives for lowering the groundwater table are proposed, simulated and evaluated. The systems, which are assessed are a municipal sewer system, a system of perforated pipes in urban areas, and tile drainage with different values of efficiency in agricultural areas.

Role of origin and release location in pre-spawning distribution and movements of anadromous alewife

USGS Publications Warehouse

Frank, Holly J.; Mather, M. E.; Smith, Joseph M.; Muth, Robert M.; Finn, John T.

2011-01-01

Capturing adult anadromous fish that are ready to spawn from a self sustaining population and transferring them into a depleted system is a common fisheries enhancement tool. The behaviour of these transplanted fish, however, has not been fully evaluated. The movements of stocked and native anadromous alewife, Alosa pseudoharengus (Wilson), were monitored in the Ipswich River, Massachusetts, USA, to provide a scientific basis for this management tool. Radiotelemetry was used to examine the effect of origin (native or stocked) and release location (upstream or downstream) on distribution and movement during the spawning migration. Native fish remained in the river longer than stocked fish regardless of release location. Release location and origin influenced where fish spent time and how they moved. The spatial mosaic of available habitats and the entire trajectory of freshwater movements should be considered to restore effectively spawners that traverse tens of kilometres within coastal rivers.

77 FR 28414 - Self-Regulatory Organizations; NASDAQ OMX BX, Inc.; Notice of Filing and Immediate Effectiveness...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-14

... Modify the Exchange's Co-Location Super High Density Cabinet Monthly Fee May 8, 2012. Pursuant to Section... Change The Exchange proposes to modify the Exchange's co-location super high-density cabinet monthly fee... modifying Rule 7034(a) by reducing its co-location super high-density cabinet on-going monthly fee from $15...

76 FR 28262 - Self-Regulatory Organizations; The NASDAQ Stock Market LLC; Notice of Filing and Immediate...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-16

... Proposed Rule Change To Modify Fees for Non Co-Location Services May 9, 2011. Pursuant to Section 19(b)(1... Rule Change The Exchange proposes to modify fees for non co-location services. While changes to the Fee...-location services as a means to facilitate the trading activities of those customers who believe that the...

76 FR 28248 - Self-Regulatory Organizations; NASDAQ OMX BX, Inc.; Notice of Filing and Immediate Effectiveness...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-05-16

... Modify Fees for Non Co-Location Services May 9, 2011. Pursuant to Section 19(b)(1) of the Securities... fees for non co-location services. While changes to the Fee Schedule pursuant to this proposal are... operates in a highly competitive market in which exchanges offer non co-location services as a means to...

75 FR 66176 - Self-Regulatory Organizations; NASDAQ OMX PHLX LLC; Notice of Filing and Immediate Effectiveness...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-27

... Change To Codify Prices for Co-Location Services October 21, 2010. Pursuant to Section 19(b)(1) of the... (``Commission'') a proposed rule change to codify pricing for co- location services. The text of the proposed... for the Exchange's co-location services.\\3\\ This filing seeks to codify additional fees not included...

Involvement of hippocampal NMDA receptors in encoding and consolidation, but not retrieval, processes of spontaneous object location memory in rats.

PubMed

Yamada, Kazuo; Arai, Misaki; Suenaga, Toshiko; Ichitani, Yukio

2017-07-28

The hippocampus is thought to be involved in object location recognition memory, yet the contribution of hippocampal NMDA receptors to the memory processes, such as encoding, retention and retrieval, is unknown. First, we confirmed that hippocampal infusion of a competitive NMDA receptor antagonist, AP5 (2-amino-5-phosphonopentanoic acid, 20-40nmol), impaired performance of spontaneous object location recognition test but not that of novel object recognition test in Wistar rats. Next, the effects of hippocampal AP5 treatment on each process of object location recognition memory were examined with three different injection times using a 120min delay-interposed test: 15min before the sample phase (Time I), immediately after the sample phase (Time II), and 15min before the test phase (Time III). The blockade of hippocampal NMDA receptors before and immediately after the sample phase, but not before the test phase, markedly impaired performance of object location recognition test, suggesting that hippocampal NMDA receptors play an important role in encoding and consolidation/retention, but not retrieval, of spontaneous object location memory. Copyright © 2017 Elsevier B.V. All rights reserved.

Hazardous Waste Cleanup: Akzo Nobel Polymer Chemicals, LLC, Burt, New York

EPA Pesticide Factsheets

Akzo Nobel Polymer Chemicals, LLC is located in northern Niagara County, south of Lake Ontario. The facility encompasses 350 acres, of which 30 acres are used for the production of organic peroxides. Eighteen Mile Creek is located immediately west of the

12 CFR 303.45 - Special provisions.

Code of Federal Regulations, 2010 CFR

2010-01-01

... that an office be immediately relocated to a temporary location, applicants shall notify the... appropriate FDIC office, that identifies the nature of the emergency or disaster, specifies the location of the temporary branch, and provides an estimate of the duration the bank plans to operate the temporary...

Effect of chevron nozzle penetration on aero-acoustic characteristics of jet at M = 0.8

NASA Astrophysics Data System (ADS)

Nikam, S. R.; Sharma, S. D.

2017-12-01

Aero-acoustic characteristics of a high-speed jet with chevron nozzles are experimentally investigated at a Mach number of 0.8. The main focus is to examine the effects of the extent of chevron penetration and its position in the mixing layer. Chevron nozzles with three different levels of penetration employed at three different longitudinal locations from the nozzle lip are tested, and the results are compared with those of a plain baseline nozzle. The chevrons are found to produce a lobed shear layer through the notched region, thereby increasing the surface area of the jet, particularly in the close vicinity of the nozzle, which increases the mixing and reduces the potential core length. This effect becomes more prominent with increasing penetration closer to the nozzle lip in the thinner mixing layer. Near field and far field noise measurements show distinctly different acoustic features due to chevrons. The chevrons are found to effectively shift the dominant noise source upstream closer to the nozzle. Present investigation proposes a simpler method for locating the dominant noise source from the peak of the centerline velocity decay rate. The overall noise levels registered along the jet edge immediately downstream of the chevrons are higher, but further downstream they are reduced in comparison with the plain baseline nozzle. Also, the chevrons beam the noise towards higher polar angles at higher frequencies. At shallow polar angles with respect to the jet axis in the far field, chevrons suppress the noise at low frequencies with increasing penetration, but for higher polar angles, while they continue to suppress the low frequency noise, at higher frequencies the trend is found to reverse. The noise measured in the near field close to the jet edge is composed of two components: acoustic and hydrodynamic. Of these two components, the chevrons are found to reduce the hydrodynamic component in comparison with the acoustic one.

Effects of barge traffic on distribution and survival of ichthyoplankton and small fishes in the upper Mississippi River

USGS Publications Warehouse

Holland, L.E.

1986-01-01

Short-term impacts of commercial barge traffic on fish eggs, larvae, young-of-the-year (age-0) fishes, and small adults in the main channel of the upper Mississippi River were examined. Barge passages caused significant changes in the distribution of eggs and larvae in the study area. The mean catch of ichthyoplankton was reduced in both surface and bottom waters for 90 min after passage of vessels downstream. The effects of upstream traffic on catch ranged from nil in surface or bottom samples to short-term increases in surface samples immediately after passage. No consistent effect on the catch of age-0 or small adult fishes in surface or bottom trawls was evident.

Pressure and velocity profiles in a static mechanical hemilarynx model

NASA Astrophysics Data System (ADS)

Alipour, Fariborz; Scherer, Ronald C.

2002-12-01

This study examined pressure and velocity profiles in a hemilarynx mechanical model of phonation. The glottal section had parallel walls and was fabricated from hard plastic. Twelve pressure taps were created in the vocal fold surface and connected to a differential pressure transducer through a pressure switch. The glottal gap was measured with feeler gauges and the uniform glottal duct was verified by use of a laser system. Eight pressure transducers were placed in the flat wall opposite the vocal fold. Hot-wire anemometry was used to obtain velocity profiles upstream and downstream of the glottis. The results indicate that the pressure distribution on the vocal fold surface was consistent with pressure change along a parallel duct, whereas the pressures on the opposite flat wall typically were lower (by 8%-40% of the transglottal pressure just past mid-glottis). The upstream velocity profiles were symmetric regardless of the constriction shape and size. The jet flow downstream of the glottis was turbulent even for laminar upstream conditions. The front of the jet was consistently approximately 1.5 mm from the flat wall for glottal gaps of 0.4, 0.8 and 1.2 mm. The turbulence intensity also remained approximately at the same location of about 4 mm from the flat wall for the two larger gaps.

Pressure and velocity profiles in a static mechanical hemilarynx model.

PubMed

Alipour, Fariborz; Scherer, Ronald C

2002-12-01

This study examined pressure and velocity profiles in a hemilarynx mechanical model of phonation. The glottal section had parallel walls and was fabricated from hard plastic. Twelve pressure taps were created in the vocal fold surface and connected to a differential pressure transducer through a pressure switch. The glottal gap was measured with feeler gauges and the uniform glottal duct was verified by use of a laser system. Eight pressure transducers were placed in the flat wall opposite the vocal fold. Hot-wire anemometry was used to obtain velocity profiles upstream and downstream of the glottis. The results indicate that the pressure distribution on the vocal fold surface was consistent with pressure change along a parallel duct, whereas the pressures on the opposite flat wall typically were lower (by 8%-40% of the transglottal pressure just past mid-glottis). The upstream velocity profiles were symmetric regardless of the constriction shape and size. The jet flow downstream of the glottis was turbulent even for laminar upstream conditions. The front of the jet was consistently approximately 1.5 mm from the flat wall for glottal gaps of 0.4, 0.8 and 1.2 mm. The turbulence intensity also remained approximately at the same location of about 4 mm from the flat wall for the two larger gaps.

Repression of enhancer II activity by a negative regulatory element in the hepatitis B virus genome.

PubMed Central

Lo, W Y; Ting, L P

1994-01-01

Enhancer II of human hepatitis B virus has dual functions in vivo. Located at nucleotides (nt) 1646 to 1741, it can stimulate the surface and X promoters from a downstream position. Moreover, the same sequence can also function as upstream regulatory element that activates the core promoter in a position- and orientation-dependent manner. In this study, we report the identification and characterization of a negative regulatory element (NRE) upstream of enhancer II (nt 1613 to 1636) which can repress both the enhancer and upstream stimulatory function of the enhancer II sequence in differentiated liver cells. This NRE has marginal inhibitory effect by itself but a strong repressive function in the presence of a functional enhancer II. Mutational analysis reveals that sequence from nt 1616 to 1621 is required for repression of enhancer activity by the NRE. Gel shift analysis reveals that this negative regulatory region can be recognized by a specific protein factor(s) present at the 0.4 M NaCl fraction of HepG2 nuclear extracts. The discovery of the NRE indicates that HBV gene transcription is controlled by combined effects of both positive and negative regulation. It also provides a unique system with which to study the mechanism of negative regulation of gene expression. Images PMID:8107237

Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

PubMed Central

Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

2014-01-01

Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

Test of a non-physical barrier consisting of light, sound, and bubble screen to block upstream movement of sea lamprey in an experimental raceway

USGS Publications Warehouse

Miehls, Scott M.; Johnson, Nicholas S.; Hrodey, Pete J.

2017-01-01

Control of the invasive Sea Lamprey Petromyzon marinus is critical for management of commercial and recreational fisheries in the Laurentian Great Lakes. Use of physical barriers to block Sea Lampreys from spawning habitat is a major component of the control program. However, the resulting interruption of natural streamflow and blockage of nontarget species present substantial challenges. Development of an effective nonphysical barrier would aid the control of Sea Lampreys by eliminating their access to spawning locations while maintaining natural streamflow. We tested the effect of a nonphysical barrier consisting of strobe lights, low-frequency sound, and a bubble screen on the movement of Sea Lampreys in an experimental raceway designed as a two-choice maze with a single main channel fed by two identical inflow channels (one control and one blocked). Sea Lampreys were more likely to move upstream during trials when the strobe light and low-frequency sound were active compared with control trials and trials using the bubble screen alone. For those Sea Lampreys that did move upstream to the confluence of inflow channels, no combination of stimuli or any individual stimulus significantly influenced the likelihood that Sea Lampreys would enter the blocked inflow channel, enter the control channel, or return downstream.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Optimal joint management of a coastal aquifer and a substitute resource

NASA Astrophysics Data System (ADS)

Moreaux, M.; Reynaud, A.

2004-06-01

This article characterizes the optimal joint management of a coastal aquifer and a costly water substitute. For this purpose we use a mathematical representation of the aquifer that incorporates the displacement of the interface between the seawater and the freshwater of the aquifer. We identify the spatial cost externalities created by users on each other and we show that the optimal water supply depends on the location of users. Users located in the coastal zone exclusively use the costly substitute. Those located in the more upstream area are supplied from the aquifer. At the optimum their withdrawal must take into account the cost externalities they generate on users located downstream. Last, users located in a median zone use the aquifer with a surface transportation cost. We show that the optimum can be implemented in a decentralized economy through a very simple Pigouvian tax. Finally, the optimal and decentralized extraction policies are simulated on a very simple example.

Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

PubMed

Lee, S H; Minowa, M T; Mouradian, M M

1996-10-11

The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has two functional TATA-less promoters, both in D1A expressing cultured neuroblastoma cells and in the human striatum.

Diverse Early Life-History Strategies in Migratory Amazonian Catfish: Implications for Conservation and Management.

PubMed

Hegg, Jens C; Giarrizzo, Tommaso; Kennedy, Brian P

2015-01-01

Animal migrations provide important ecological functions and can allow for increased biodiversity through habitat and niche diversification. However, aquatic migrations in general, and those of the world's largest fish in particular, are imperiled worldwide and are often poorly understood. Several species of large Amazonian catfish carry out some of the longest freshwater fish migrations in the world, travelling from the Amazon River estuary to the Andes foothills. These species are important apex predators in the main stem rivers of the Amazon Basin and make up the region's largest fishery. They are also the only species to utilize the entire Amazon Basin to complete their life cycle. Studies indicate both that the fisheries may be declining due to overfishing, and that the proposed and completed dams in their upstream range threaten spawning migrations. Despite this, surprisingly little is known about the details of these species' migrations, or their life history. Otolith microchemistry has been an effective method for quantifying and reconstructing fish migrations worldwide across multiple spatial scales and may provide a powerful tool to understand the movements of Amazonian migratory catfish. Our objective was to describe the migratory behaviors of the three most populous and commercially important migratory catfish species, Dourada (Brachyplatystoma rousseauxii), Piramutaba (Brachyplatystoma vaillantii), and Piraíba (Brachyplatystoma filamentosum). We collected fish from the mouth of the Amazon River and the Central Amazon and used strontium isotope signatures ((87)Sr/(86)Sr) recorded in their otoliths to determine the location of early rearing and subsequent. Fish location was determined through discriminant function classification, using water chemistry data from the literature as a training set. Where water chemistry data was unavailable, we successfully in predicted (87)Sr/(86)Sr isotope values using a regression-based approach that related the geology of the upstream watershed to the Sr isotope ratio. Our results provide the first reported otolith microchemical reconstruction of Brachyplatystoma migratory movements in the Amazon Basin. Our results indicate that juveniles exhibit diverse rearing strategies, rearing in both upstream and estuary environments. This contrasts with the prevailing understanding that juveniles rear in the estuary before migrating upstream; however, it is supported by some fisheries data that has indicated the presence of alternate spawning and rearing life-histories. The presence of alternate juvenile rearing strategies may have important implications for conservation and management of the fisheries in the region.

Health assessment using aqua-quality indicators of alpine streams (Khunjerab National Park), Gilgit, Pakistan.

PubMed

Ali, Salar; Gao, Junfeng; Begum, Farida; Rasool, Atta; Ismail, Muhammad; Cai, Yongjiu; Ali, Shaukat; Ali, Shujaat

2017-02-01

This preliminary research was conducted to evaluate the alpine stream health by using water quality as an indicator in Khunjerab National park of the Karakoram ranges located in Pak-China boarder Pakistan having altitude of 3660 m. This study investigated the stream health in the context of the presence or absence of sensitive species, their diversity, and their taxa richness. The water and macroinvertebrate samples were collected from 17 different locations from upstream and downstream of the river by using random sampling method. Macroinvertebrate samples were obtained using kick net (500-μm mesh size) and hand-picking method (NYSDEC). A total of 710 counts including 41 families of macroinvertebrates were recorded comprising of 7 orders including: Ephemeroptera (46%) being the most dominant group, Plecoptera (33%), Trichoptera (5%), Chironomidae (Diptera) (14%), Heteroptera (1%), and Coleoptera (1%). Ephemeroptera, Trichoptera, and Plecoptera (EPT) were found in abundance at the main source, Qarchanai, Dhee, and Tourqeen Nullah, as compared to the other locations of the stream. The most dominant macroinvertebrate was Ephemeroptera whose relative abundance is Pi = 0.49 by using the Shannon index. However, different statistical tools, including principal component analysis (PCA), cluster analysis (CA), ANOVA, and linear regression model, show a strong correlation between water quality and macroinvertebrates. The overall results of the biological indicators showed better ecological health at downstream compared to upstream. This study will provide basic information and understanding about the macroinvertebrates for future researchers, and the data will be helpful for upcoming research programs on alpine streams for the discovery and occurrences of macroinvertebrates and associated fauna.

Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

PubMed

Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

1994-05-01

Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

Fuel decomposition and boundary-layer combustion processes of hybrid rocket motors

NASA Technical Reports Server (NTRS)

Chiaverini, Martin J.; Harting, George C.; Lu, Yeu-Cherng; Kuo, Kenneth K.; Serin, Nadir; Johnson, David K.

1995-01-01

Using a high-pressure, two-dimensional hybrid motor, an experimental investigation was conducted on fundamental processes involved in hybrid rocket combustion. HTPB (Hydroxyl-terminated Polybutadiene) fuel cross-linked with diisocyanate was burned with GOX under various operating conditions. Large-amplitude pressure oscillations were encountered in earlier test runs. After identifying the source of instability and decoupling the GOX feed-line system and combustion chamber, the pressure oscillations were drastically reduced from +/-20% of the localized mean pressure to an acceptable range of +/-1.5% Embedded fine-wire thermocouples indicated that the surface temperature of the burning fuel was around 1000 K depending upon axial locations and operating conditions. Also, except near the leading-edge region, the subsurface thermal wave profiles in the upstream locations are thicker than those in the downstream locations since the solid-fuel regression rate, in general, increases with distance along the fuel slab. The recovered solid fuel slabs in the laminar portion of the boundary layer exhibited smooth surfaces, indicating the existence of a liquid melt layer on the burning fuel surface in the upstream region. After the transition section, which displayed distinct transverse striations, the surface roughness pattern became quite random and very pronounced in the downstream turbulent boundary-layer region. Both real-time X-ray radiography and ultrasonic pulse-echo techniques were used to determine the instantaneous web thickness burned and instantaneous solid-fuel regression rates over certain portions of the fuel slabs. Globally averaged and axially dependent but time-averaged regression rates were also obtained and presented.

Correlating field and laboratory rates of particle abrasion, Rio Medio, Sangre de Cristo Mountains, New Mexico

NASA Astrophysics Data System (ADS)

Polito, P. J.; Sklar, L. S.

2006-12-01

River bed sediments commonly fine downstream due to a combination of particle abrasion, selective transport of finer grains, and fining of the local sediment supply from hillslopes and tributaries. Particle abrasion rates can be directly measured in the laboratory using tumbling barrels and annular flumes, however, scaling experimental particle abrasion rates to the field has proven difficult due to the confounding effects of selective transport and local supply variations. Here we attempt to correlate laboratory and field rates of particle abrasion in a field setting where these confounding effects can be controlled. The Rio Medio, which flows westward from the crest of the Sangre de Cristo Mountains in north central New Mexico, is one of several streams studied by John P. Miller in the early 1960's. Several kilometers downstream of its headwaters, the river crosses the Picuris-Pecos fault. Upstream of the fault the river receives quartzite, sandstone and shale clasts from the Ortega Formation, while downstream sediments are supplied by the Embudo Granite. Because the upstream lithologies are not resupplied downstream of the fault, any observed fining of these clasts should be due only to abrasion and selective transport. We hypothesize that we can account for the effects of selective transport by comparing relative fining rates for the different upstream lithologies from both the field and a laboratory tumbler. By correlating laboratory abrasion rates with rock strength, we can predict the relative fining rates due solely to abrasion expected in the field; differences between the predicted and observed fining rates could then be attributed to selective transport. We used point counts to measure bed surface sediment grain size distributions at 15 locations along a 25 kilometer reach of the Rio Medio, beginning just downstream of the fault and ending upstream of a developed area with disturbed channel conditions. We recorded intermediate particle diameter as well as lithologic composition for 100 clasts at each location. To better characterize the size distribution of poorly represented lithologies we also measured every grain we could find of these minority lithologies within a one square meter area on adjacent bar top surfaces. At each sampling site we also measured channel gradient, and bank-full width and depth. We collected gravel samples for laboratory tumbling experiments and larger bedrock blocks from which we extracted cores for the Brazilian tensile splitting strength test. Preliminary results show very rapid fining of the weak sedimentary rocks downstream of the fault, much less rapid fining of the quartzite and a net downstream coarsening of the granitic sediments, which dominate the bed in the downstream end of the study reach. This enigmatic downstream coarsening may be a legacy of Pliestocene glaciation, which is evident in the landscape upstream of the fault. Outburst floods or debris flows from upstream moraines may have delivered large quantities of coarse sediments to downstream reaches, which are now relatively immobile. Despite these complications, the Rio Medio site may yet provide sufficient information to test our proposed method for scaling laboratory particle abrasion rates to the field.

Estimation of constituent concentrations, densities, loads, and yields in lower Kansas River, northeast Kansas, using regression models and continuous water-quality monitoring, January 2000 through December 2003

USGS Publications Warehouse

Rasmussen, Teresa J.; Ziegler, Andrew C.; Rasmussen, Patrick P.

2005-01-01

The lower Kansas River is an important source of drinking water for hundreds of thousands of people in northeast Kansas. Constituents of concern identified by the Kansas Department of Health and Environment (KDHE) for streams in the lower Kansas River Basin include sulfate, chloride, nutrients, atrazine, bacteria, and sediment. Real-time continuous water-quality monitors were operated at three locations along the lower Kansas River from July 1999 through September 2004 to provide in-stream measurements of specific conductance, pH, water temperature, turbidity, and dissolved oxygen and to estimate concentrations for constituents of concern. Estimates of concentration and densities were combined with streamflow to calculate constituent loads and yields from January 2000 through December 2003. The Wamego monitoring site is located 44 river miles upstream from the Topeka monitoring site, which is 65 river miles upstream from the DeSoto monitoring site, which is 18 river miles upstream from where the Kansas River flows into the Missouri River. Land use in the Kansas River Basin is dominated by grassland and cropland, and streamflow is affected substantially by reservoirs. Water quality at the three monitoring sites varied with hydrologic conditions, season, and proximity to constituent sources. Nutrient and sediment concentrations and bacteria densities were substantially larger during periods of increased streamflow, indicating important contributions from nonpoint sources in the drainage basin. During the study period, pH remained well above the KDHE lower criterion of 6.5 standard units at all sites in all years, but exceeded the upper criterion of 8.5 standard units annually between 2 percent of the time (Wamego in 2001) and 65 percent of the time (DeSoto in 2003). The dissolved oxygen concentration was less than the minimum aquatic-life-support criterion of 5.0 milligrams per liter less than 1 percent of the time at all sites. Dissolved solids, a measure of the dissolved material in water, exceeded 500 milligrams per liter about one-half of the time at the three Kansas River sites. Larger dissolved-solids concentrations upstream likely were a result of water inflow from the highly mineralized Smoky Hill River that is diluted by tributary flow as it moves downstream. Concentrations of total nitrogen and total phosphorus at the three monitoring sites exceeded the ecoregion water-quality criteria suggested by the U.S. Environmental Protection Agency during the entire study period. Median nitrogen and phosphorus concentrations were similar at all three sites, and nutrient load increased moving from the upstream to downstream sites. Total nitrogen and total phosphorus yields were nearly the same from site to site indicating that nutrient sources were evenly distributed throughout the lower Kansas River Basin. About 11 percent of the total nitrogen load and 12 percent of the total phosphorus load at DeSoto during 2000-03 originated from wastewater-treatment facilities. Escherichia coli bacteria densities were largest at the middle site, Topeka. On average, 83 percent of the annual bacteria load at DeSoto during 2000-03 occurred during 10 percent of the time, primarily in conjunction with runoff. The average annual sediment loads at the middle and downstream monitoring sites (Topeka and DeSoto) were nearly double those at the upstream site (Wamego). The average annual sediment yield was largest at Topeka. On average, 64 percent of the annual suspended-sediment load at DeSoto during 2000-03 occurred during 10 percent of the time. Trapping of sediment by reservoirs located on contributing tributaries decreases transport of sediment and sediment-related constituents. The average annual suspended-sediment load in the Kansas River at DeSoto during 2000-03 was estimated at 1.66 million tons. An estimated 13 percent of this load consisted of sand-size particles, so approximately 216,000 tons of sand were transported

Evaluation of stream flow effects on smolt survival in the Yakima River Basin, Washington, 2012-2014

USGS Publications Warehouse

Courter, Ian; Garrison, Tommy; Kock, Tobias J.; Perry, Russell W.

2015-01-01

The influence of stream flow on survival of emigrating juvenile (smolts) Pacific salmon Oncorhynchus spp. and steelhead trout O. mykiss is of key management interest. However, few studies have quantified flow effects on smolt migration survival, and available information does not indicate a consistent flow-survival relationship within the typical range of flows under management control. It is hypothesized that smolt migration and dam passage survival are positively correlated with stream flow because higher flows increase migration rates, potentially reducing exposure to predation, and reduce delays in reservoirs. However, available empirical data are somewhat equivocal concerning the influence of flow on smolt survival and the underlying mechanisms driving this relationship. Stream flow effects on survival of emigrating anadromous salmonids in the Yakima Basin have concerned water users and fisheries managers for over 20 years, and previous studies do not provide sufficient information at the resolution necessary to inform water operations, which typically occur on a small spatiotemporal scale. Using a series of controlled flow releases from 2012-2014, combined with radio telemetry, we quantified the relationship between flow and smolt survival from Roza Dam 208 km downstream to the Yakima River mouth, as well as for specific routes of passage at Roza Dam. A novel multistate mark-recapture model accounted for weekly variation in flow conditions experienced by radio-tagged fish. Groups of fish were captured and radio-tagged at Roza Dam and released at two locations, upstream at the Big Pines Campground (river kilometer [rkm] 211) and downstream in the Roza Dam tailrace (rkm 208). A total of 904 hatchery-origin yearling Chinook salmon O. tshawytscha were captured in the Roza Dam fish bypass, radio-tagged and released upstream of Roza Dam. Two hundred thirty seven fish were released in the tailrace of Roza Dam. Fish released in the tailrace of Roza Dam were tagged concurrently with fish released upstream of the dam using identical tagging methods. Tagging and release events were conducted to target a range of flow conditions indicative of flows observed during the typical migration period (March-May) for juvenile spring Chinook salmon in the Yakima River. Three, five and four separate upstream releases were conducted in 2012, 2013, and 2014 respectively, and at least 43 fish were released alive on each occasion. The release sample sizes in 2014 were much larger (~130) compared to previous years for the purpose of increasing precision of survival estimates across the range of flows tested. Migration movements of radio-tagged spring Chinook salmon smolts were monitored with an array of telemetry receiver stations (fixed sites) that extended 208 rkm downstream from the forebay of Roza Dam to the mouth of the Yakima River. Fixed monitoring sites included the forebay of Roza Dam (rkm 208), the tailrace of Roza Dam (rkm 207.9), the mouth of Wenas Creek (rkm 199.2), the mouth of the Naches River (two sites, rkm 189.4), Sunnyside Dam (two sites, rkm 169.1), Prosser Dam (rkm 77.2), and the mouth of the Yakima River (two sites, rkm2 3). This array segregated the study area into four discrete reaches in which survival of tagged fish was estimated. Aerial and underwater antennas were also used to monitor tagged fish at Roza Dam. Aerial antennas were located in the forebay, on the East gate, on the West gate, and in the tailrace of Roza Dam. Underwater antennas were located in the fish bypass, upstream of the East gate, and upstream of the West gate to collect route-specific passage data for tagged fish. Additional years of data collection and analysis could alter or improve our understanding of the influence of flow and other environmental factors on smolt survival in the Yakima River. Nevertheless, during 2012-2014, yearling hatchery Chinook salmon smolt emigration survival was significantly associated with stream flow in the

78 FR 77765 - Self-Regulatory Organizations; NYSE Arca, Inc.; Notice of Filing and Immediate Effectiveness of...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-24

...-location services allow Users to rent space in the data center so they may locate their electronic servers... Cabinets A User is able to request a physical cabinet to house its servers and other equipment in the data... order gateway, regardless of whether the sender is co-located in the data center or not. In addition, co...

The Serum Response Factor and a Putative Novel Transcription Factor Regulate Expression of the Immediate-Early Gene Arc/Arg3.1 in Cultured Cortical Neurons

PubMed Central

Pintchovski, Sean A.; Peebles, Carol L.; Kim, Hong Joo; Verdin, Eric; Finkbeiner, Steven

2010-01-01

The immediate-early effector gene Arc/Arg3.1 is robustly upregulated by synaptic activity associated with learning and memory. Here we show in primary cortical neuron culture that diverse stimuli induce Arc expression through new transcription. Searching for regulatory regions important for Arc transcription, we found nine DNaseI-sensitive nucleosome-depleted sites at this genomic locus. A reporter gene encompassing these sites responded to synaptic activity in an NMDA receptor–dependent manner, consistent with endogenous Arc mRNA. Responsiveness mapped to two enhancer regions ∼6.5 kb and ∼1.4 kb upstream of Arc. We dissected these regions further and found that the proximal enhancer contains a functional and conserved “Zeste-like” response element that binds a putative novel nuclear protein in neurons. Therefore, activity regulates Arc transcription partly by a novel signaling pathway. We also found that the distal enhancer has a functional and highly conserved serum response element. This element binds serum response factor, which is recruited by synaptic activity to regulate Arc. Thus, Arc is the first target of serum response factor that functions at synapses to mediate plasticity. PMID:19193899

Characterization of the Rana grylio virus 3{beta}-hydroxysteroid dehydrogenase and its novel role in suppressing virus-induced cytopathic effect

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun Wei; Huang Youhua; Zhao Zhe

2006-12-08

The 3{beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) isoenzymes play a key role in cellular steroid hormone synthesis. Here, a 3{beta}-HSD gene homolog was cloned from Rana grylio virus (RGV), a member of family Iridoviridae. RGV 3{beta}-HSD gene has 1068 bp, encoding a 355 aa predicted protein. Transcription analyses showed that RGV 3{beta}-HSD gene was transcribed immediate-early during infection from an initiation site 19 nucleotides upstream of the translation start site. Confocal microscopy revealed that the 3{beta}-HSD-EGFP fusion protein was exclusively colocalized with the mitochondria marker (pDsRed2-Mito) in EPC cells. Upon morphological observation and MTT assay, it was revealed that overexpression of RGV 3{beta}-HSDmore » in EPC cells could apparently suppress RGV-induced cytopathic effect (CPE). The present studies indicate that the RGV immediate-early 3{beta}-HSD gene encodes a mitochondria-localized protein, which has a novel role in suppressing virus-induced CPE. All these suggest that RGV 3{beta}-HSD might be a protein involved in host-virus interaction.« less

Mesoscale Surface Pressure and Temperature Features Associated with Bow Echoes

DTIC Science & Technology

2010-01-01

contain several bowing segments. These multiple segments could occur at the same time and be located within the same bow, such as the serial derecho ...Examination of derecho environments using proximity soundings. Wea. Forecasting, 16, 329–342. Fovell, R. G., 2002: Upstream influence of numerically...Se- vere Local Storms, Hyannis, MA, Amer. Meteor. Soc., 4.6. Johns, R. H., and W. D. Hirt, 1987: Derechos : Widespread con- vectively induced

National Program for Inspection of Non-Federal Dams. Singletary Pond Dam (MA 00144), Blackstone River Basin, Millbury, Massachusetts. Phase I Inspection Report.

DTIC Science & Technology

1979-02-01

to a gra- vel access drive. There are two wood-framed gate structures at the crest of the dam. The intake gate house is on the upstream edge of the...Reservoirs. Nov,. 19 *ILI Inspected by L..Q..: aden . .. Date JuI7~ 3.7,12bDamn No.-3- 1.6 Town ...... LLuy... . ... : ......... Location. , ) j ~.. 3lier

Photographic copy of July 30, 1934 black and white photograph. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photographic copy of July 30, 1934 black and white photograph. Loose in oversized box located at the National Museum of American History, Smithsonian Institution, Archives Center, Work and Industry Division, Washington, D.C. Original Photographer unknown. 1934 PHOTOGRAPH OF PIER IV LOOKING NORTHWEST FROM BEST BANK TOWARD EAST BANK. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

Mount St. Helens Long-Term Sediment Management Plan for Flood Risk Reduction

DTIC Science & Technology

2010-06-01

one dredge would direct pump to the Wasser Winters disposal site, located along the southern bank of the Cowlitz River mouth. The average annual...dredge would pipeline pump either upstream to disposal site 20cde or downstream to the Wasser Winters site. Pumping distances would not exceed 6.0...estimates referenced the Wasser Winters upland preparation estimates and were based on the relationship between acreage and effort. Total site

Mathematical evaluation of the influence of multiple factors on implant stability quotient values in clinical practice: a retrospective study

PubMed Central

Huang, Hairong; Wismeijer, Daniel; Shao, Xianhong; Wu, Gang

2016-01-01

Objectives The objective of this study is to mathematically evaluate the influence of multiple factors on implant stability quotient values in clinical practice. Patients and methods Resonance frequency analysis was performed at T1 (measured immediately at the time of implant placement) and at T2 (measured before dental restoration) in 177 patients (329 implants). Using a multivariate linear regression model, we analyzed the influence of the following eleven candidate factors: sex, age, maxillary/mandibular location, bone type, immediate/delayed implantation, bone grafting (presence or absence), insertion torque, I-/II-stage healing pattern, implant diameter, implant length, and T1–T2 time interval. Results The following factors were identified to significantly influence the implant stability quotient (ISQ) values at T1: insertion torque, bone grafting, I-/II-stage healing pattern, immediate/delayed implantation, maxillary/mandibular location, implant diameter, and sex. In contrast, the ISQ values at T2 were significantly influenced only by three factors: implant diameter, T1–T2 time interval, and insertion torque. Conclusion Among the eleven candidate factors, seven key factors were found to influence the T1-ISQ values, while only three key factors influenced the T2-ISQ values. Both T1 and T2-ISQ values were found to be influenced by implant diameter and insertion torque. T1 was influenced specifically by the sex of the patient, the location (maxillary or mandibular), the implantation mode (immediate/delayed implantation), the healing stage, and the absence or presence of bone graft materials. PMID:27785040

Channel adjustments in a Mediterranean river over the last 150 years in the context of anthropic and natural controls

NASA Astrophysics Data System (ADS)

Scorpio, Vittoria; Rosskopf, Carmen M.

2016-12-01

Evolutionary trajectories and related control factors of the Fortore River (southern Italy) are analyzed over a 150-year period as to assess channel modifications. A multitemporal GIS analysis of topographic maps and aerial photographs together with topographic and geomorphological field surveys were performed. Attention was focused on the impact caused by human disturbance, above all the presence of the Occhito dam at only 40 km upstream of the Fortore mouth (central Adriatic coast). Results show that channel adjustments occurred in three distinct phases and were primarily driven by human disturbance that diversely affected reaches located upstream and downstream of the dam. From the last decades of the nineteenth century to the 1950s (phase 1), channel widening prevailed along upstream reaches whilst narrowing along downstream reaches. Major channel adjustments occurred from the 1950s until the end of the 1990s (phase 2), especially channel narrowing of up to 81% in upstream reaches and 98% in downstream reaches. Narrowing was accompanied by channel-bed lowering of 1 to 5 m and by pattern changes in prevalence from multithread to largely prevailing single-thread channel configurations. In-channel mining, channel works, and hydraulic interventions are considered key driving factors of observed channel adjustments. The closure of the Occhito dam in 1966 had significant and permanent effects on downstream reaches through overall discharge regulation and permanent sediment trapping as also proved by the progressive retreat of the Fortore river mouth area. From 2000 to 2015 (phase 3), a substantial trend inversion was observed with overall channel widening and partial aggradation of upstream reaches and total stabilization of downstream reaches. As highlighted by an integrated multitemporal analysis of recent channel changes and flood events, the latter have played an important role in channel recovery of upstream reaches. Comparison between the Fortore River and other rivers in southern Italy has allowed us to ascertain that the reconstructed evolutionary trajectories are quite similar and that control factors are essentially the same. In particular, it confirms the role of major hydraulic structures as to the amount of channel adjustments of downstream reaches and the ensuing scarce to nil potential to channel recovery of regulated reaches.

Determination of real-time predictors of the wind turbine wake meandering

NASA Astrophysics Data System (ADS)

Muller, Yann-Aël; Aubrun, Sandrine; Masson, Christian

2015-03-01

The present work proposes an experimental methodology to characterize the unsteady properties of a wind turbine wake, called meandering, and particularly its ability to follow the large-scale motions induced by large turbulent eddies contained in the approach flow. The measurements were made in an atmospheric boundary layer wind tunnel. The wind turbine model is based on the actuator disc concept. One part of the work has been dedicated to the development of a methodology for horizontal wake tracking by mean of a transverse hot wire rake, whose dynamic response is adequate for spectral analysis. Spectral coherence analysis shows that the horizontal position of the wake correlates well with the upstream transverse velocity, especially for wavelength larger than three times the diameter of the disc but less so for smaller scales. Therefore, it is concluded that the wake is actually a rather passive tracer of the large surrounding turbulent structures. The influence of the rotor size and downstream distance on the wake meandering is studied. The fluctuations of the lateral force and the yawing torque affecting the wind turbine model are also measured and correlated with the wake meandering. Two approach flow configurations are then tested: an undisturbed incoming flow (modelled atmospheric boundary layer) and a disturbed incoming flow, with a wind turbine model located upstream. Results showed that the meandering process is amplified by the presence of the upstream wake. It is shown that the coherence between the lateral force fluctuations and the horizontal wake position is significant up to length scales larger than twice the wind turbine model diameter. This leads to the conclusion that the lateral force is a better candidate than the upstream transverse velocity to predict in real time the meandering process, for either undisturbed (wake free) or disturbed incoming atmospheric flows.

[Residue Concentration and Distribution Characteristics of Perfluorinated Compounds in Surface Water from Qiantang River in Hangzhou Section].

PubMed

Zhang, Ming; Tang, Fang-liang; Yu, Ya-yun; Xu, Jian-fen; Li, Hua; Wu, Min-hua; Zhang, Wei; Pan, Jian-yang

2015-12-01

This study studied the pollution characteristics of perfluorinated compounds (PFCs) in Qiantang River in Hangzhou section (QR). Surface water samples, collected in July 2014 and January 2015 from 14 sites in QR were analyzed for 16 PFCs. All samples were prepared by solid-phase extraction with Oasis WAX cartridges and analyzed using the ultra performance liquid chromatography interfaced to tandem mass spectrometry ( UPLC-MS/MS). The results showed that 8 medium-and short-chain PFCs including C₄ and C₈ perfluorinated sulfonates (PFSAs) and C₄-C₉ perfluorinated carboxylic acids (PFCAs) were detected in the surface waters. The total concentrations of PFCs ranged from 0.98 to 609 ng · L⁻¹, while perfluorooctanoic acid (PFOA) dominated, with range of 0.59-538 ng L⁻¹, and perfluorooctane sulfonate (PFOS) was detected at lower levels, ranging from 0 to 2.48 ng · L⁻¹. The spatial distribution of PFCs varied, and the pollutant concentrations at the sampling sites located in upstream of the river such as Lanjiangkou and Jiangjunyan were relatively high, PFCs concentration showed a decreasing trend from the upstream to the downstream. According to the ratio of feature components, PFCs in surface water of QR originated largely from the input of direct sewage emissions. Taken together, the PFCs pollution was highly correlated with the upstream of Qiantang River valley's industry distribution, and most of the mass load in the investigated river was attributed to upstream running water with a minor influence from the wastewater discharges along the river basin. Overall, the results presented here indicated that greater attention should be given to the contamination of PFCs, especially for PFOA in water body of QR.

Draft Supplement to the Environmental Statement Fiscal Year 1975 Proposed Program : Facility Location Evaluation for San Juan Island Service : Decatur Land Line and East Lopez Island Substation Study Area 74-7.

DOE Office of Scientific and Technical Information (OSTI.GOV)

United States. Bonneville Power Administration.

1974-03-08

Proposed construction of a 1.7-mile 34.5-kV double-circuit transmission line crossing Decatur Island from east to west. The new line would replace 0.7 of a mile of an existing BPA 24.5-kV line and would then parallel and existing 24.5-kV line for a distance of 1.0 mile. The proposal also requires the construction of a new substation to be located on the eastern side of Lopez Island, Washington. The additional easement required for the proposed transmission line would remove about 1.1 acres of forestland from timber production diverting it to nonforest uses compatable with the transmission line right-of-way. Depending upon the actualmore » site location the Lopez Island Substation could remove from 1 to 3.2 acres of forestland and 2 acres of pastureland from production. Disturbance of game in the immediate vicintiy of the transmission facilities will occur during construction, as will some soil erosion primarily during and immediately after construction, siltation in nearby streams, disturbance of nearby residents from noise and dust during construction, and some degradation of AM reception immediately adjacent to the right-of-way. 7 figs.« less

Deregulation of polycomb repressor complex 1 modifier AUTS2 in T-cell leukemia.

PubMed

Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G; MacLeod, Roderick A F

2016-07-19

Recently, we identified deregulated expression of the B-cell specific transcription factor MEF2C in T-cell acute lymphoid leukemia (T-ALL). Here, we performed sequence analysis of a regulatory upstream section of MEF2C in T-ALL cell lines which, however, proved devoid of mutations. Unexpectedly, we found strong conservation between the regulatory upstream region of MEF2C (located at chromosomal band 5q14) and an intergenic stretch at 7q11 located between STAG3L4 and AUTS2, covering nearly 20 kb. While the non-coding gene STAG3L4 was inconspicuously expressed, AUTS2 was aberrantly upregulated in 6% of T-ALL patients (public dataset GSE42038) and in 3/24 T-ALL cell lines, two of which represented very immature differentiation stages. AUTS2 expression was higher in normal B-cells than in T-cells, indicating lineage-specific activity in lymphopoiesis. While excluding chromosomal aberrations, examinations of AUTS2 transcriptional regulation in T-ALL cells revealed activation by IL7-IL7R-STAT5-signalling and MEF2C. AUTS2 protein has been shown to interact with polycomb repressor complex 1 subtype 5 (PRC1.5), transforming this particular complex into an activator. Accordingly, expression profiling and functional analyses demonstrated that AUTS2 activated while PCGF5 repressed transcription of NKL homeobox gene MSX1 in T-ALL cells. Forced expression and pharmacological inhibition of EZH2 in addition to H3K27me3 analysis indicated that PRC2 repressed MSX1 as well. Taken together, we found that AUTS2 and MEF2C, despite lying on different chromosomes, share strikingly similar regulatory upstream regions and aberrant expression in T-ALL subsets. Our data implicate chromatin complexes PRC1/AUTS2 and PRC2 in a gene network in T-ALL regulating early lymphoid differentiation.

Evaluation of Head-of-Reservoir Conditions for Downstream Migration of Juvenile Chinook Salmon and Steelhead at Shasta Lake, California

NASA Astrophysics Data System (ADS)

Clancey, K. M.; Saito, L.; Svoboda, C.; Bender, M. D.; Hannon, J.; Hellmann, K. M.

2015-12-01

Since completion of Shasta Dam, migration of Chinook salmon and steelhead trout in the Sacramento River has been blocked, causing loss of spawning and rearing habitat. This has been a factor leading to population declines of these fish species over several decades. Winter-run Chinook salmon, spring-run Chinook salmon and steelhead trout are now listed under the Endangered Species Act. A habitat assessment of the tributaries upstream of Shasta Dam showed that the Sacramento and McCloud tributaries have suitable habitat for reintroduction of adult salmon and steelhead for spawning. Such reintroduction would require downstream passage of juvenile Chinook salmon and steelhead past Shasta Dam. To evaluate the possibility of collecting and transporting juvenile Chinook salmon and steelhead past Shasta Dam, a CE-QUAL-W2 model of Shasta Lake and the Sacramento River, McCloud River, Pit River and Squaw Creek tributaries was used to assess where and when conditions were favorable at head-of-reservoir locations upstream of proposed temperature curtains to collect juvenile fish. Head-of-reservoir is the zone of transition between the river and the upstream end of the reservoir. Criteria for evaluating locations suitable to collect these fish included water temperature and velocities in the Sacramento and McCloud tributaries. Model output was analyzed during months of downstream migration under dry, median and wet year conditions. Potential for proposed temperature curtains, anchored and floating, to improve conditions for fish migration was also evaluated with the CE-QUAL-W2 model. Use of temperature curtains to assist fish migration is a novel approach that to our knowledge has not previously been assessed for recovery of Chinook salmon and steelhead populations. Providing safe passage conditions is challenging, however the study findings may assist in formulation of a juvenile fish passage alternative that is suitable for Shasta Lake.

Mutations That Stimulate flhDC Expression in Escherichia coli K-12.

PubMed

Fahrner, Karen A; Berg, Howard C

2015-10-01

Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Deletions involving long-range conserved nongenic sequences upstream and downstream of FOXL2 as a novel disease-causing mechanism in blepharophimosis syndrome.

PubMed

Beysen, D; Raes, J; Leroy, B P; Lucassen, A; Yates, J R W; Clayton-Smith, J; Ilyina, H; Brooks, S Sklower; Christin-Maitre, S; Fellous, M; Fryns, J P; Kim, J R; Lapunzina, P; Lemyre, E; Meire, F; Messiaen, L M; Oley, C; Splitt, M; Thomson, J; Van de Peer, Y; Veitia, R A; De Paepe, A; De Baere, E

2005-08-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes.

Deletions Involving Long-Range Conserved Nongenic Sequences Upstream and Downstream of FOXL2 as a Novel Disease-Causing Mechanism in Blepharophimosis Syndrome

PubMed Central

Beysen, D.; Raes, J.; Leroy, B. P.; Lucassen, A.; Yates, J. R. W.; Clayton-Smith, J.; Ilyina, H.; Brooks, S. Sklower; Christin-Maitre, S.; Fellous, M.; Fryns, J. P.; Kim, J. R.; Lapunzina, P.; Lemyre, E.; Meire, F.; Messiaen, L. M.; Oley, C.; Splitt, M.; Thomson, J.; Peer, Y. Van de; Veitia, R. A.; De Paepe, A.; De Baere, E.

2005-01-01

The expression of a gene requires not only a normal coding sequence but also intact regulatory regions, which can be located at large distances from the target genes, as demonstrated for an increasing number of developmental genes. In previous mutation studies of the role of FOXL2 in blepharophimosis syndrome (BPES), we identified intragenic mutations in 70% of our patients. Three translocation breakpoints upstream of FOXL2 in patients with BPES suggested a position effect. Here, we identified novel microdeletions outside of FOXL2 in cases of sporadic and familial BPES. Specifically, four rearrangements, with an overlap of 126 kb, are located 230 kb upstream of FOXL2, telomeric to the reported translocation breakpoints. Moreover, the shortest region of deletion overlap (SRO) contains several conserved nongenic sequences (CNGs) harboring putative transcription-factor binding sites and representing potential long-range cis-regulatory elements. Interestingly, the human region orthologous to the 12-kb sequence deleted in the polled intersex syndrome in goat, which is an animal model for BPES, is contained in this SRO, providing evidence of human-goat conservation of FOXL2 expression and of the mutational mechanism. Surprisingly, in a fifth family with BPES, one rearrangement was found downstream of FOXL2. In addition, we report nine novel rearrangements encompassing FOXL2 that range from partial gene deletions to submicroscopic deletions. Overall, genomic rearrangements encompassing or outside of FOXL2 account for 16% of all molecular defects found in our families with BPES. In summary, this is the first report of extragenic deletions in BPES, providing further evidence of potential long-range cis-regulatory elements regulating FOXL2 expression. It contributes to the enlarging group of developmental diseases caused by defective distant regulation of gene expression. Finally, we demonstrate that CNGs are candidate regions for genomic rearrangements in developmental genes. PMID:15962237

Experimental studies of hypersonic shock-wave boundary-layer interactions

NASA Technical Reports Server (NTRS)

Lu, Frank K.

1992-01-01

Two classes of shock-wave boundary-layer interactions were studied experimentally in a shock tunnel in which a low Reynolds number, turbulent flow at Mach 8 was developed on a cold, flat test surface. The two classes of interactions were: (1) a swept interaction generated by a wedge ('fin') mounted perpendicularly on the flat plate; and (2) a two-dimensional, unseparated interaction induced by a shock impinging near an expansion corner. The swept interaction, with wedge angles of 5-20 degrees, was separated and there was also indication that the strongest interactions prossessed secondary separation zones. The interaction spread out extensively from the inviscid shock location although no indication of quasi-conical symmetry was evident. The surface pressure from the upstream influence to the inviscid shock was relatively low compared to the inviscid downstream value but it rose rapidly past the inviscid shock location. However, the surface pressure did not reach the downstream inviscid value and reasons were proposed for this anomalous behavior compared to strongly separated, supersonic interactions. The second class of interactions involved weak shocks impinging near small expansion corners. As a prelude to studying this interaction, a hypersonic similarity parameter was identified for the pure, expansion corner flow. The expansion corner severely damped out surface pressure fluctuations. When a shock impinged upstream of the corner, no significant changes to the surface pressure were found as compared to the case when the shock impinged on a flat plate. But, when the shock impinged downstream of the corner, a close coupling existed between the two wave systems, unlike the supersonic case. This close coupling modified the upstream influence. Regardless of whether the shock impinged ahead or behind the corner, the downstream region was affected by the close coupling between the shock and the expansion. Not only was the mean pressure distribution modified but the unsteadiness in the surface pressure was reduced compared to the flat-plate case.

Arc fault detection system

DOEpatents

Jha, Kamal N.

1999-01-01

An arc fault detection system for use on ungrounded or high-resistance-grounded power distribution systems is provided which can be retrofitted outside electrical switchboard circuits having limited space constraints. The system includes a differential current relay that senses a current differential between current flowing from secondary windings located in a current transformer coupled to a power supply side of a switchboard, and a total current induced in secondary windings coupled to a load side of the switchboard. When such a current differential is experienced, a current travels through a operating coil of the differential current relay, which in turn opens an upstream circuit breaker located between the switchboard and a power supply to remove the supply of power to the switchboard.

Physical characteristics of stream subbasins in the Pomme de Terre River Basin, west-central Minnesota

USGS Publications Warehouse

Lorenz, D.L.; Payne, G.A.

1994-01-01

Data describing the physical characteristics of stream subbasins upstream from selected points on streams in the Pomme de Terre River Basin, located in west-central Minnesota, are presented in this report. The physical characteristics are the drainage area of the subbasin, the percentage area of the subbasin covered only by lakes, the percentage area of the subbasin covered by both lakes and wetlands, the main-channel length, and the main-channel slope. The points on the stream include outlets of subbasins of at least 5 square miles, outfalls of sewage treatment plants, and locations of U.S. Geological Survey low-flow, high-flow, and continuous-record gaging stations.

Flow structure of vortex-wing interaction

NASA Astrophysics Data System (ADS)

McKenna, Christopher K.

Impingement of a streamwise-oriented vortex upon a fin, tail, blade or wing represents a fundamental class of flow-structure interaction that extends across a range of applications. This interaction can give rise to time-averaged loading, as well as unsteady loading known as buffeting. The loading is sensitive to parameters of the incident vortex as well as the location of vortex impingement on the downstream aerodynamic surface, generically designated as a wing. Particle image velocimetry is employed to determine patterns of velocity, vorticity, swirl ratio, and streamlines on successive cross-flow planes upstream of and along the wing, which lead to volume representations and thereby characterization of the interaction. At locations upstream of the leading edge of the wing, the evolution of the incident vortex is affected by the presence of the wing, and is highly dependent on the spanwise location of vortex impingement. Even at spanwise locations of impingement well outboard of the wing tip, a substantial influence on the structure of the incident vortex at locations significantly upstream of the leading edge of the wing was observed. For spanwise locations close to or intersecting the vortex core, the effects of upstream influence of the wing on the vortex are to: decrease the swirl ratio; increase the streamwise velocity deficit; decrease the streamwise vorticity; increase the azimuthal vorticity; increase the upwash; decrease the downwash; and increase the root-mean-square fluctuations of both streamwise velocity and vorticity. The interrelationship between these effects is addressed, including the rapid attenuation of axial vorticity in presence of an enhanced defect of axial velocity in the central region of the vortex. Moreover, when the incident vortex is aligned with, or inboard of, the tip of the wing, the swirl ratio decreases to values associated with instability of the vortex, giving rise to enhanced values of azimuthal vorticity relative to the streamwise (axial) vorticity, as well as relatively large root-mean-square values of streamwise velocity and vorticity. Along the chord of the wing, the vortex interaction gives rise to distinct modes, which may involve either enhancement or suppression of the vortex generated at the tip of the wing. These modes are classified and interpreted in conjunction with computed modes at the Air Force Research Laboratory. Occurrence of a given mode of interaction is predominantly determined by the dimensionless location of the incident vortex relative to the tip of the wing and is generally insensitive to the Reynolds number and dimensionless circulation of the incident vortex. The genesis of the basic modes of interaction is clarified using streamline topology with associated critical points. Whereas formation of an enhanced tip vortex involves a region of large upwash in conjunction with localized flow separation, complete suppression of the tip vortex is associated with a small-scale separation-attachment bubble bounded by downwash at the wing tip. Oscillation of the wing at an amplitude and velocity nearly two orders of magnitude smaller than the wing chord and free stream velocity respectively can give rise to distinctive patterns of upwash, downwash, and shed vorticity, which are dependent on the outboard displacement of the incident vortex relative to the wing tip. Moreover, these patterns are a strong function of the phase of the wing motion during its oscillation cycle. At a given value of phase, the wing oscillation induces upwash that is reinforced by the upwash of the incident vortex, giving a maximum value of net upwash. Conversely, when these two origins of upwash counteract, rather than reinforce, one another during the oscillation cycle, the net upwash has its minimum value. Analogous interpretations hold for regions of maximum and minimum net downwash located outboard of the regions of upwash. During the oscillation cycle of the wing, the magnitude and scale of the vorticity shed from the tip of the wing are directly correlated with the net upwash, which takes different forms related to the outboard displacement of the incident vortex. As the location of the incident vortex is displaced towards the wing tip, both the maximum upwash and the maximum vorticity of the tip vortex initially increase, then decrease. For the limiting case where the incident vortex impinges directly upon the tip of the wing, there is no tip vortex or induced region of upwash. Furthermore, at small values of vortex displacement from the wing tip, the position of the incident vortex varies significantly from its nominal position during the oscillation cycle. For all locations of the incident vortex, it is shown that, despite the small amplitude of the wing motion, the flow topology is fundamentally different at maximum positive and negative values of the wing velocity, that is, they are not symmetric.

30 CFR 717.18 - Dams constructed of or impounding waste material.

Code of Federal Regulations, 2011 CFR

2011-07-01

... shall design, locate, construct, operate, maintain, modify, and abandon or remove all dams (used either... design. (ix) A permanent identification marker, at least 6 feet high that shows the dam number assigned... located on or immediately adjacent to each dam within 30 days of certification of design pursuant to this...

An Optimal Algorithm towards Successive Location Privacy in Sensor Networks with Dynamic Programming

NASA Astrophysics Data System (ADS)

Zhao, Baokang; Wang, Dan; Shao, Zili; Cao, Jiannong; Chan, Keith C. C.; Su, Jinshu

In wireless sensor networks, preserving location privacy under successive inference attacks is extremely critical. Although this problem is NP-complete in general cases, we propose a dynamic programming based algorithm and prove it is optimal in special cases where the correlation only exists between p immediate adjacent observations.

Topological transitions for lattice bosons in a magnetic field

PubMed Central

Huber, Sebastian D.; Lindner, Netanel H.

2011-01-01

The Hall response provides an important characterization of strongly correlated phases of matter. We study the Hall conductivity of interacting bosons on a lattice subjected to a magnetic field. We show that for any density or interaction strength, the Hall conductivity is characterized by an integer. We find that the phase diagram is intersected by topological transitions between different values of this integer. These transitions lead to surprising effects, including sign reversal of the Hall conductivity and extensive regions in the phase diagram where it acquires a negative sign, which implies that flux flow is reversed in these regions—vortices there flow upstream. Our findings have immediate applications to a wide range of phenomena in condensed matter physics, which are effectively described in terms of lattice bosons. PMID:22109548

Complete mitochondrial genome of Chocolate Pansy, Junonia iphita (Lepidoptera: Nymphalidae: Nymphalinae).

PubMed

Vanlalruati, Catherine; Mandal, Surajit De; Gurusubramanian, Guruswami; Senthil Kumar, Nachimuthu

2016-07-01

The complete mitochondrial genome of Junonia iphita was determined to be 15,433 bp in length, including 37 typical mitochondrial genes and an AT-rich region. All the protein coding genes (PCGs) are initiated by typical ATN codons, except cox1 gene that is by CGA codon. Eight genes use complete termination codon (TAA), whereas the cox1, cox2 and nad5 genes end with single T; nad4 and nad1 ends with stop codon TA. All the tRNA show secondary cloverleaf structures except trnS1 (AGN). The A + T rich region is 546 bp in length containing ATAGA motif followed by a 18 bp poly-T stretch, two microsatellite-like (TA)9 elements and 8 bp poly-A stretch immediately upstream of trnM gene.

Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

PubMed

Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

2016-02-01

It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

Persistence of asymmetry in nonaxisymmetric entry flow in a circular cylindrical tube and its relevance to arterial pulse wave diagnosis.

PubMed

Xue, H; Fung, Y C

1989-02-01

In an experiment motivated by the study of arterial blood flow along the lines suggested by the traditional Chinese medicine, the flow in a pipe whose lumen was blocked by a semi-circular plug two tube-diameters long was visualized by suspended particles, recorded by cinematography, and analyzed digitally. The Reynolds number was in the range of 100 to 450 based on the pipe diameter, similar to that of blood flow in the radial artery in the arms of man. The blockage was found to have a profound effect on the velocity profile of the flow in the wake, but it had little influence on the symmetry of the velocity profile upstream of the block, except in its immediate neighborhood. When the end conditions far away from the block were steady, the flow in the wake was steady. The asymmetry of the flow in the wake can be judged by the deviation of the location of the maximum axial velocity from the center line of the pipe as seen in the plane of symmetry of the blockage. Our results show that the deviation can be described as the sum of two components. The first is a strong one which decays exponentially in an entry length which is about twice as long as the classical Boussinesq entry length of axisymmetric flow. The second is a weaker component which is wavy spatially and persists far downstream (many times the entry length). The separated flow and vortex system behind the blockage are sensitive to the flow rate.(ABSTRACT TRUNCATED AT 250 WORDS)

Variable Access to Immediate Bedside Ultrasound in the Emergency Department

PubMed Central

Talley, Brad E.; Ginde, Adit A.; Raja, Ali S.; Sullivan, Ashley F.; Espinola, Janice A.; Camargo, Carlos A.

2011-01-01

Objective: Use of bedside emergency department (ED) ultrasound has become increasingly important for the clinical practice of emergency medicine (EM). We sought to evaluate differences in the availability of immediate bedside ultrasound based on basic ED characteristics and physician staffing. Methods: We surveyed ED directors in all 351 EDs in Colorado, Georgia, Massachusetts, and Oregon between January and April 2009. We assessed access to bedside ED ultrasound by the question: “Is bedside ultrasound available immediately in the ED?” ED characteristics included location, visit volume, admission rate, percent uninsured, total emergency physician full-time equivalents and proportion of EM board-certified (BC) or EM board-eligible (BE) physicians. Data analysis used chi-square tests and multivariable logistical regression to compare differences in access to bedside ED ultrasound by ED characteristics and staffing. Results: We received complete responses from 298 (85%) EDs. Immediate access to bedside ultrasound was available in 175 (59%) EDs. ED characteristics associated with access to bedside ultrasound were: location (39% for rural vs. 71% for urban, P<0.001); visit volume (34% for EDs with low volume [<1 patient/hour] vs. 79% for EDs with high volume [≥3 patients/hour], P<0.001); admission rate (39% for EDs with low [0–10%] admission rates vs. 84% for EDs with high [>20%] rates, P<0.001); and EM BC/BE physicians (26% for EDs with a low percentage [0–20%] vs.74% for EDs with a high percentage [≥80%], P<0.001). Conclusion: U.S. EDs differ significantly in their access to immediate bedside ultrasound. Smaller, rural EDs and those staffed by fewer EM BC/BE physicians more frequently lacked access to immediate bedside ultrasound in the ED. PMID:21691479

The GhTT2_A07 gene is linked to the brown colour and natural flame retardancy phenotypes of Lc1 cotton (Gossypium hirsutum L.) fibres

PubMed Central

Hinchliffe, Doug J.; Condon, Brian D.; Thyssen, Gregory; Naoumkina, Marina; Madison, Crista A.; Reynolds, Michael; Delhom, Christopher D.; Fang, David D.; Li, Ping; McCarty, Jack

2016-01-01

Some naturally coloured brown cotton fibres from accessions of Gossypium hirsutum L. can be used to make textiles with enhanced flame retardancy (FR). Several independent brown fibre loci have been identified and mapped to chromosomes, but the underlying genes have not yet been identified, and the mechanism of lint fibre FR is not yet fully understood. In this study, we show that both the brown colour and enhanced FR of the Lc1 lint colour locus are linked to a 1.4Mb inversion on chromosome A07 that is immediately upstream of a gene with similarity to Arabidopsis TRANSPARENT TESTA 2 (TT2). As a result of the alternative upstream sequence, the transcription factor GhTT2_A07 is highly up-regulated in developing fibres. In turn, genes in the phenylpropanoid metabolic pathway are activated, leading to biosynthesis of proanthocyanidins and accumulation of inorganic elements. We show that enhanced FR and anthocyanin precursors appear in developing brown fibres well before the brown colour is detectible, demonstrating for the first time that the polymerized proanthocyanidins that constitute the brown colour are not the source of enhanced FR. Identifying the particular colourless metabolite that provides Lc1 cotton with enhanced FR could help minimize the use of synthetic chemical flame retardant additives in textiles. PMID:27567364

Ice Engineering: Ice Jams, Winter 2002-2003

DTIC Science & Technology

2004-07-01

located between Caribou and Fort Fairfield, and from Presque Isle and Washburn (NWS 2003i). Of the seven, four were reported in December and three...the towns of Washburn and Presque Isle ) was estimated to be one-quarter of a mile long in December. This jam remained in place until 21 April 2003...then appeared to break in half, sending the downstream floe of ice southeast through the town of Presque Isle while the most upstream section of

Detonation Characteristics of Some Dusts and Liquid-Dust Suspensions

DTIC Science & Technology

1983-07-01

instrumentation which includes pressure switches, pressure transducers, a photodiode, and streak photography. The pressure switch , which is a mechanical on/ off...camera through a lens. The Xenon light is triggered by the pressure switch located upstream of the window section. A time delay device is used in...conjunction with the pressure switch and the light source power supply. When the pressure switch is swept by the shock wave, a signal is sent to the delay unit

Photographic copy of circa, 1934 black and white photograph. Loose ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Photographic copy of circa, 1934 black and white photograph. Loose in oversized box located at the National Museum of American History, Smithsonian Institution, Archives Center, Work and Industry Division, Washington, D.C. Original Photographer unknown. DECK TRUSS UNDER CONSTRUCTION BETWEEN PIERS C, B, AND V TAKEN AT GROUND LEVEL FROM EAST BANK. - Huey P. Long Bridge, Spanning Mississippi River approximately midway between nine & twelve mile points upstream from & west of New Orleans, Jefferson, Jefferson Parish, LA

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Treesearch

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Comparison of the landslide susceptibility models in Taipei Water Source Domain, Taiwan

NASA Astrophysics Data System (ADS)

WU, C. Y.; Yeh, Y. C.; Chou, T. H.

2017-12-01

Taipei Water Source Domain, locating at the southeast of Taipei Metropolis, is the main source of water resource in this region. Recently, the downstream turbidity often soared significantly during the typhoon period because of the upstream landslides. The landslide susceptibilities should be analysed to assess the influence zones caused by different rainfall events, and to ensure the abilities of this domain to serve enough and quality water resource. Generally, the landslide susceptibility models can be established based on either a long-term landslide inventory or a specified landslide event. Sometimes, there is no long-term landslide inventory in some areas. Thus, the event-based landslide susceptibility models are established widely. However, the inventory-based and event-based landslide susceptibility models may result in dissimilar susceptibility maps in the same area. So the purposes of this study were to compare the landslide susceptibility maps derived from the inventory-based and event-based models, and to interpret how to select a representative event to be included in the susceptibility model. The landslide inventory from Typhoon Tim in July, 1994 and Typhoon Soudelor in August, 2015 was collected, and used to establish the inventory-based landslide susceptibility model. The landslides caused by Typhoon Nari and rainfall data were used to establish the event-based model. The results indicated the high susceptibility slope-units were located at middle upstream Nan-Shih Stream basin.

Water organic pollution and eutrophication influence soil microbial processes, increasing soil respiration of estuarine wetlands: site study in jiuduansha wetland.

PubMed

Zhang, Yue; Wang, Lei; Hu, Yu; Xi, Xuefei; Tang, Yushu; Chen, Jinhai; Fu, Xiaohua; Sun, Ying

2015-01-01

Undisturbed natural wetlands are important carbon sinks due to their low soil respiration. When compared with inland alpine wetlands, estuarine wetlands in densely populated areas are subjected to great pressure associated with environmental pollution. However, the effects of water pollution and eutrophication on soil respiration of estuarine and their mechanism have still not been thoroughly investigated. In this study, two representative zones of a tidal wetland located in the upstream and downstream were investigated to determine the effects of water organic pollution and eutrophication on soil respiration of estuarine wetlands and its mechanism. The results showed that eutrophication, which is a result of there being an excess of nutrients including nitrogen and phosphorus, and organic pollutants in the water near Shang shoal located upstream were higher than in downstream Xia shoal. Due to the absorption and interception function of shoals, there to be more nitrogen, phosphorus and organic matter in Shang shoal soil than in Xia shoal. Abundant nitrogen, phosphorus and organic carbon input to soil of Shang shoal promoted reproduction and growth of some highly heterotrophic metabolic microorganisms such as β-Proteobacteria, γ-Proteobacteria and Acidobacteria which is not conducive to carbon sequestration. These results imply that the performance of pollutant interception and purification function of estuarine wetlands may weaken their carbon sequestration function to some extent.