Sample records for longus type iv

  1. Structural characterization of CFA/III and Longus type IVb pili from enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramaniapillai; Roos, Justin; Yuen, Alex S W; Pierce, Owen M; Craig, Lisa

    2012-05-01

    The type IV pili are helical filaments found on many Gram-negative pathogenic bacteria, with multiple diverse roles in pathogenesis, including microcolony formation, adhesion, and twitching motility. Many pathogenic enterotoxigenic Escherichia coli (ETEC) isolates express one of two type IV pili belonging to the type IVb subclass: CFA/III or Longus. Here we show a direct correlation between CFA/III expression and ETEC aggregation, suggesting that these pili, like the Vibrio cholerae toxin-coregulated pili (TCP), mediate microcolony formation. We report a 1.26-Å resolution crystal structure of CofA, the major pilin subunit from CFA/III. CofA is very similar in structure to V. cholerae TcpA but possesses a 10-amino-acid insertion that replaces part of the α2-helix with an irregular loop containing a 3(10)-helix. Homology modeling suggests a very similar structure for the Longus LngA pilin. A model for the CFA/III pilus filament was generated using the TCP electron microscopy reconstruction as a template. The unique 3(10)-helix insert fits perfectly within the gap between CofA globular domains. This insert, together with differences in surface-exposed residues, produces a filament that is smoother and more negatively charged than TCP. To explore the specificity of the type IV pilus assembly apparatus, CofA was expressed heterologously in V. cholerae by replacing the tcpA gene with that of cofA within the tcp operon. Although CofA was synthesized and processed by V. cholerae, no CFA/III filaments were detected, suggesting that the components of the type IVb pilus assembly system are highly specific to their pilin substrates.

  2. Fiber types of the anterior and lateral cervical muscles in elderly males.

    PubMed

    Cornwall, Jon; Kennedy, Ewan

    2015-09-01

    The anterior and lateral cervical muscles (ALCM) are generally considered to be postural, yet few studies have investigated ALCM fiber types to help clarify the function of these muscles. This study aimed to systematically investigate ALCM fiber types in cadavers. Anterior and lateral cervical muscles (four scalenus anterior, medius, posterior muscles; five longus colli, five longus capitis taken bilaterally from one cadaver) were removed from four male embalmed cadavers (mean age 87.25 years). Paraffin-embedded specimens were sectioned then stained immunohistochemically to identify type I and II skeletal muscle fibers. Proportional fiber type numbers and cross-sectional area (CSA) occupied by fiber types were determined using stereology (random systematic sampling). Results were analyzed using ANOVA (P < 0.05) and descriptive statistics. Scalenus anterior had the greatest average number and CSA of type I fibers (71.9 and 83.7%, respectively); longus capitis had the lowest number (48.5%) and CSA (61.4%). All scalene muscles had significantly greater type I CSA than longus capitis and longus colli; scalenus anterior and medius had significantly greater type I numbers than longus capitis and longus colli. Some significant differences were observed between individual cadavers in longus colli for CSA, and longus capitis for number. The ALCM do not share a common functional fiber type distribution, although similar fiber type distributions are shared by longus colli and longus capitis, and by the scalene muscles. Contrary to conventional descriptions, longus colli and longus capitis have type I fiber proportions indicative of postural as well as phasic muscle function.

  3. Peroneus longus tears associated with pathology of the os peroneum.

    PubMed

    Stockton, Kristopher G; Brodsky, James W

    2014-04-01

    There is a range of different types of tears and pathology of the peroneal tendons. One of the least common types is the tear of the peroneus longus associated with fracture, enlargement, or entrapment at the cuboid tunnel of the os peroneum. The purpose of this study was to evaluate the pathologic patterns of these uncommon peroneal tendon tears, to review the treatment, and to report the patient outcomes following treatment with excision of the os peroneum, debridement, and tenodesis of the peroneus longus to the peroneus brevis. A 5-year retrospective review of all patients with peroneal tendon tears identified 12 patients operatively treated for peroneus longus tendon tears with associated pathology of the os peroneum, and in whom there was a viable peroneus brevis. All patients were treated with an operative procedure consisting of excision of the os peroneum, debridement, and tenodesis of the peroneus longus to the peroneus brevis. Mean age was 51.5 (range, 33 to 73) years, including 7 males and 5 females. Operative and radiographic records were reviewed to characterize the nature of the peroneus longus tears and associated pathology. Preoperative and postoperative AOFAS hindfoot, SF-36 questionnaires, and Visual Analog Scale (VAS) pain scores were compiled and patient records were reviewed for complications. Mean follow-up after surgery was 63.3 (range, 12 to 114) months. All of the patients had an os peroneum associated with a complex, irreparable tear of the peroneus longus tendon. The peroneus longus was typically enlarged, fibrotic, and adhered to the surrounding tissues. In 8 patients, the peroneus longus tendon tear was associated with a fracture of the os peroneum, and in 4 patients with an enlarged and entrapped os peroneum which prevented movement at the cuboid tunnel. Of the 12 patients, 9 had partial tears of the peroneus brevis, which were treated with debridement and suture repair. AOFAS hindfoot scores increased from a preoperative mean of 61 (range, 46 to 75) to a postoperative mean of 91.7 (range, 60 to 100). Mean preoperative SF-36 Physical Component Scores (PCS) increased from 36 to 52 postoperatively. Mean VAS pain scores decreased from a preoperative mean of 6.3 (range, 4 to 8) to a postoperative mean of 1.0 (range, 0 to 4). Complications included 2 patients with sural neuritis and 3 with superficial delayed wound healing successfully treated nonoperatively. Tears of the distal peroneus longus tendon, which are much less commonly reported than tears of the peroneus brevis, can be associated with pathology of the os peroneum. Excision of the os peroneum, tendon debridement, and tenodesis of the longus to brevis was an effective surgical technique. Level IV, case series.

  4. Assessment of the presence/absence of the palmaris longus muscle in different sports, and elite and non-elite sport populations.

    PubMed

    Fowlie, Craig; Fuller, Colin; Pratten, Margaret K

    2012-06-01

    To investigate whether higher presence of the palmaris longus muscle is associated with sports that require hand grip. Cross-sectional study. Six hundred and forty-two medical students, members of sports clubs and national athletes. Participants were invited to complete a questionnaire that assessed their main sport, elite or non-elite level of participation, and level of activity. The presence of the palmaris longus was assessed visually using a standardised test. Presence of the palmaris longus, type of hand grip required for the sport and the level of participation. The presence of the palmaris longus was higher in elite athletes (21/22, 96%) than non-elite athletes (66/84, 79%; P=0.066) for sports that require a dominant-handed or two-handed cylindrical grip (18/22, 82% and 19/35, 54%, respectively; P=0.034). For both elite and non-elite athletes, the presence of the palmaris longus was higher in those participating in sustained grip sports (325/387, 84%) compared with sports that do not require a sustained grip (150/197, 76%; P=0.012). The palmaris longus may provide an advantage in certain types of sport that require hand grip, and for elite athletes participating in sports that require a dominant-handed or two-handed cylindrical hand grip. Orthopaedic specialists considering the use of the palmaris longus for a grafting procedure on an athlete should consider the level of participation and the type of hand grip required in the athlete's sport. Copyright © 2011 Chartered Society of Physiotherapy. Published by Elsevier Ltd. All rights reserved.

  5. The expression of Longus type 4 pilus of enterotoxigenic Escherichia coli is regulated by LngR and LngS and by H-NS, CpxR and CRP global regulators.

    PubMed

    De la Cruz, Miguel A; Ruiz-Tagle, Alejandro; Ares, Miguel A; Pacheco, Sabino; Yáñez, Jorge A; Cedillo, Lilia; Torres, Javier; Girón, Jorge A

    2017-05-01

    Enterotoxigenic Escherichia coli produces a long type 4 pilus called Longus. The regulatory elements and the environmental signals controlling the expression of Longus-encoding genes are unknown. We identified two genes lngR and lngS in the Longus operon, whose predicted products share homology with transcriptional regulators. Isogenic lngR and lngS mutants were considerably affected in transcription of lngA pilin gene. The expression of lngA, lngR and lngS genes was optimally expressed at 37°C at pH 7.5. The presence of glucose and sodium chloride had a positive effect on Longus expression. The presence of divalent ions, particularly calcium, appears to be an important stimulus for Longus production. In addition, we studied H-NS, CpxR and CRP global regulators, on Longus expression. The response regulator CpxR appears to function as a positive regulator of lng genes as the cpxR mutant showed reduced levels of lngRSA expression. In contrast, H-NS and CRP function as negative regulators since expression of lngA was up-regulated in isogenic hns and crp mutants. H-NS and CRP were required for salt- and glucose-mediated regulation of Longus. Our data suggest the existence of a complex regulatory network controlling Longus expression, involving both local and global regulators in response to different environmental signals. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

    PubMed Central

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-01-01

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

  7. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-10-23

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Histochemical and morphometric characteristics of the normal human vastus medialis longus and vastus medialis obliquus muscles.

    PubMed Central

    Travnik, L; Pernus, F; Erzen, I

    1995-01-01

    The histochemical and morphometric characteristics of the vastus medialis longus and vastus medialis obliquus muscles were studied and compared with data on vastus lateralis. Cross-sections of autopsied muscles from 9 healthy men, aged 18-44 y, who had died suddenly were analysed. Data were obtained on proportions, cross-sectional diameter, and on atrophy and hypertrophy factors, of type 1, 2a, 2b, and 2c fibres. The analysis showed that the anatomical differences and the different functional demands placed on vastus medialis longus and vastus medialis obliquus are also expressed in different proportions and sizes of fibre types in the two muscles. The proportion of type 1 fibres was significantly higher (P < 0.01), and the proportion of 2b fibres was significantly lower (P < 0.01) in vastus medialis longus than in vastus medialis obliquus. The diameters of type 1 and type 2a fibres were significantly smaller (P < 0.01) in vastus medialis longus than in vastus medialis obliquus, although the differences were small. Within muscles a nonrandom arrangement of fibre types existed with the deeper portions of the muscles having more type 1 fibres than the more superficial portions. The histochemical and morphometric characteristics of vastus lateralis and vastus medialis obliquus show great similarity, reflecting the common function of both muscles which is taking part in transverse knee stability. Estimates of the limits of normality of the proportion, diameter, atrophy and hypertrophy factors of type 1, 2a, 2b, and 2c fibres might be useful in obtaining information on how different physiological and pathological conditions influence the proportion and size of different fibre types.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7592003

  9. Muscular hypertrophy and atrophy in normal rats provoked by the administration of normal and denervated muscle extracts.

    PubMed

    Agüera, Eduardo; Castilla, Salvador; Luque, Evelio; Jimena, Ignacio; Leiva-Cepas, Fernando; Ruz-Caracuel, Ignacio; Peña, José

    2016-12-01

    This study was conducted to determine the effects of extracts obtained from both normal and denervated muscles on different muscle types. Wistar rats were used and were divided into a control group and four experimental groups. Each experimental group was treated intraperitoneally during 10 consecutive days with a different extract. These extracts were obtained from normal soleus muscle, denervated soleus, normal extensor digitorum longus, and denervated extensor digitorum longus. Following treatment, the soleus and extensor digitorum longus muscles were obtained for study under optic and transmission electron microscope; morphometric parameters and myogenic responses were also analyzed. The results demonstrated that the treatment with normal soleus muscle and denervated soleus muscle extracts provoked hypertrophy and increased myogenic activity. In contrast, treatment with extracts from the normal and denervated EDL had a different effect depending on the muscle analyzed. In the soleus muscle it provoked hypertrophy of type I fibers and increased myogenic activity, while in the extensor digitorum longus atrophy of the type II fibers was observed without changes in myogenic activity. This suggests that the muscular responses of atrophy and hypertrophy may depend on different factors related to the muscle type which could be related to innervation.

  10. Effect of hindlimb suspension and clenbuterol treatment on polyamine levels in skeletal muscle

    NASA Technical Reports Server (NTRS)

    Abukhalaf, Imad K.; von Deutsch, Daniel A.; Wineski, Lawrence E.; Silvestrov, Natalia A.; Abera, Saare A.; Sahlu, Sinafikish W.; Potter, David E.; Thierry-Palmer, M. (Principal Investigator)

    2002-01-01

    Polyamines are unbiquitous, naturally occurring small aliphatic, polycationic, endogenous compounds. They are involved in many cellular processes and may serve as secondary or tertiary messengers to hormonal regulation. The relationship of polyamines and skeletal muscle mass of adductor longus, extensor digitorum longus, and gastrocnemius under unloading (hindlimb suspension) conditions was investigated. Unloading significantly affected skeletal muscle polyamine levels in a fiber-type-specific fashion. Under loading conditions, clenbuterol treatment increased all polyamine levels, whereas under unloading conditions, only the spermidine levels were consistently increased. Unloading attenuated the anabolic effects of clenbuterol in predominately slow-twitch muscles (adductor longus), but had little impact on clenbuterol's action as a countermeasure in fast- twitch muscles such as the extensor digitorum longus. Spermidine appeared to be the primary polyamine involved in skeletal muscle atrophy/hypertrophy. Copyright 2002 S. Karger AG, Basel.

  11. Clinical recovery of two hip adductor longus ruptures: a case-report of a soccer player

    PubMed Central

    2013-01-01

    Background Non-operative treatment of acute hip adductor longus ruptures in athletes has been described in the literature. However, very limited information concerning the recovery of this type of injury exists. This case represented a unique possibility to study the recovery of two acute adductor longus ruptures, using novel, reliable and validated assessment methods. Case presentation A 22-year old male soccer player (Caucasian) sustained two subsequent acute adductor longus ruptures, one in each leg. The injuries occurred 10 months apart, and were treated non-surgically in both situations. He was evaluated using hip-strength assessments, self-report and ultrasonography until complete muscle-strength recovery of the hip adductors had occurred. The player was able to participate in a full soccer training session without experiencing pain 15 weeks after the first rupture, and 12 weeks after the second rupture. Full hip adductor muscle-strength recovery was obtained 52 weeks after the first rupture and 10 weeks after the second rupture. The adductor longus injuries, as verified by initial ultrasonography (10 days post-injury), showed evidence of a complete tendon rupture in both cases, with an almost identical imaging appearance. It was only at 6 and 10 weeks ultrasonographic follow-up that the first rupture was found to include a larger anatomical area than the second rupture. Conclusion From this case we can conclude that two apparently similar hip adductor longus ruptures, verified by initial ultrasonography (10 days post-injury), can have very different hip adductor strength recovery times. Assessment of adductor strength recovery may therefore in the future be a useful and important additional measure for determining when soccer players with hip adductor longus ruptures can return safely to play. PMID:23693119

  12. Multiple tendon ruptures of unknown etiology.

    PubMed

    Axibal, Derek P; Anderson, John G

    2013-10-01

    Tendon ruptures are common findings in foot and ankle practice. The etiology of tendon ruptures tends to be multifactorial-usually due to a combination of trauma, effects of systemic diseases, adverse effects of medications, and obesity. We present an unusual case of right Achilles tendinitis, left Achilles tendon rupture, bilateral peroneus longus tendon rupture, and left peroneus brevis tendon rupture of unknown etiology. This case report highlights the need for research for other possible, lesser known etiologies of tendon pathology. Therapeutic, Level IV, Case Study.

  13. Feed artery role in blood flow control to rat hindlimb skeletal muscles.

    PubMed Central

    Williams, D A; Segal, S S

    1993-01-01

    1. Vasomotor tone and reactivity were investigated in feed arteries of the extensor digitorum longus and soleus muscles. Feed arteries are located external to the muscle and give rise to the microcirculation within each muscle. Resting diameter was smaller in feed arteries of the soleus muscle. 2. Feed arteries of both muscles dilated to similar peak values with sodium nitroprusside. 3. Micropressure measurements demonstrated resistance to blood flow in the feed arteries supplying both muscles. Feed arteries supplying soleus muscle demonstrated greater resistance to blood flow compared to feed arteries of extensor digitorum longus muscle. 4. Greater resting tone and larger pressure drop for feed arteries of soleus muscle suggest greater range of flow control compared to feed arteries of extensor digitorum longus muscle. 5. In both muscles, feed artery diameter increased with muscle contraction (functional dilatation) and in response to transient ischaemia (reactive dilatation). The magnitude of these responses varied between muscles. 6. Feed arteries are active sites of blood flow control in extensor digitorum longus and soleus muscles of the rat. These muscles differ in fibre type and recruitment properties. Differences in feed artery reactivity may contribute to differences in blood flow between these muscles observed at rest and during exercise. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8246199

  14. Catalase-positive microperoxisomes in rat soleus and extensor digitorum longus muscle fiber types

    NASA Technical Reports Server (NTRS)

    Riley, Danny A.; Bain, James L. W.; Ellis, Stanley

    1988-01-01

    The size, distribution, and content of catalase-reactive microperoxisomes were investigated cytochemically in three types of muscle fibers from the soleus and the extensor digitorum longus (EDL) of male rats. Muscle fibers were classified on the basis of the mitochondrial content and distribution, the Z-band widths, and the size and shape of myofibrils as the slow-twitch oxidative (SO), the fast-twitch oxidative glycolytic (FOG), and the fast-twitch glycolytic (FG) fibers. It was found that both the EDL and soleus SO fibers possessed the largest microperoxisomes. A comparison of microperoxisome number per muscle fiber area or the microperoxisome area per fiber area revealed following ranking, starting from the largest number and the area-ratio values: soleus SO, EDL SO, EDL FOG, and EDL FG.

  15. Myostatin dysfunction impairs force generation in extensor digitorum longus muscle and increases exercise-induced protein efflux from extensor digitorum longus and soleus muscles.

    PubMed

    Baltusnikas, Juozas; Kilikevicius, Audrius; Venckunas, Tomas; Fokin, Andrej; Bünger, Lutz; Lionikas, Arimantas; Ratkevicius, Aivaras

    2015-08-01

    Myostatin dysfunction promotes muscle hypertrophy, which can complicate assessment of muscle properties. We examined force generating capacity and creatine kinase (CK) efflux from skeletal muscles of young mice before they reach adult body and muscle size. Isolated soleus (SOL) and extensor digitorum longus (EDL) muscles of Berlin high (BEH) mice with dysfunctional myostatin, i.e., homozygous for inactivating myostatin mutation, and with a wild-type myostatin (BEH+/+) were studied. The muscles of BEH mice showed faster (P < 0.01) twitch and tetanus contraction times compared with BEH+/+ mice, but only EDL displayed lower (P < 0.05) specific force. SOL and EDL of age-matched but not younger BEH mice showed greater exercise-induced CK efflux compared with BEH+/+ mice. In summary, myostatin dysfunction leads to impairment in muscle force generating capacity in EDL and increases susceptibility of SOL and EDL to protein loss after exercise.

  16. Outcome of Lateral Transfer of the FHL or FDL for Concomitant Peroneal Tendon Tears.

    PubMed

    Seybold, Jeffrey D; Campbell, John T; Jeng, Clifford L; Short, Kelly W; Myerson, Mark S

    2016-06-01

    Concomitant tears of the peroneus longus and brevis tendons are rare injuries, with literature limited to case reports and small patient series. Only 1 recent study directly compared the results of single-stage lateral deep flexor transfer, and no previous series objectively evaluated power and balance following transfer. The purpose of this study was to evaluate clinical outcomes, patient satisfaction, and objective power and balance data following single-stage flexor hallucis longus (FHL) and flexor digitorum longus (FDL) tendon transfers for treatment of concomitant peroneus longus and brevis tears. Over an 8-year period (2005-2012), 9 patients underwent lateral transfer of the FHL or FDL tendon for treatment of concomitant peroneus longus and brevis tears. All but 1 patient underwent additional procedures to address hindfoot malalignment or other contributing deformity at the time of surgery. Mean age was 56.9 years, and average body mass index was 27.9. Lateral transfer of the FHL was performed in 5 patients, and FDL transfer performed in 4 with mean follow-up 35.7 months (range: 11-94). Eight of 9 patients completed SF-12 and Foot Function Index (FFI) scores, and 7 returned for range of motion (ROM) and manual strength testing of the involved and normal extremities. These 7 patients also completed force plate balance tests, in addition to peak force and power testing on a PrimusRS machine with a certified physical therapist. All patients were satisfied with the results of the procedure. Mean SF-12 physical and mental scores were 32 and 55, respectively; mean FFI total score was 56.7. No postoperative infections were noted. Two patients continued to utilize orthotics or braces, and 2 patients reported occasional pain with weightbearing activity. Three patients noted mild paresthesias in the distribution of the sural nerve and 2 demonstrated tibial neuritis. All patients demonstrated 4/5 eversion strength in the involved extremity. Average loss of inversion and eversion ROM were 24.7% and 27.2% of normal, respectively. Mean postoperative eversion peak force and power were decreased greater than 55% relative to the normal extremity. Patients demonstrated nearly 50% increases in both center-of-pressure tracing length and velocity during balance testing. There were no statistically significant differences between the FHL and FDL transfer groups with regards to clinical examination or objective power and balance tests. The FHL and FDL tendons were both successful options for lateral transfer in cases of concomitant peroneus longus and brevis tears. Objective measurements of strength and balance demonstrated significant deficits in the operative extremity, even years following the procedure. These differences, however, did not appear to alter or inhibit patient activity levels or high satisfaction rates with the procedure. Although anatomic studies have demonstrated benefits of FHL transfer over the FDL tendon, further studies with increased patient numbers are needed to determine if these differences are clinically significant. Level IV, retrospective case series. © The Author(s) 2016.

  17. Effects of Postmortem Freezing on Passive Properties of Rabbit Extensor Digtorum Longus Muscle Tendon Complex

    DTIC Science & Technology

    1993-06-14

    AD-A266 429 INSTITUTE REPORT NO. 483 Effects of Postmortem Freezing on Passive Properties of Rabbit Extensor Digtorum Longus Muscle Tendon Complex D...Extensor Digtorum Longus Muscle Tendon Complex -- Paul H. Leitschuh, Tammy J. Doherty, Dean C. Taylor, Daniel E. Brooks, John B. Ryan This document has...ABSTRACT The tensile properties of the extensor digitorum longus muscle tendon unit (EDL MTU) were studied in 16 white male New Zealand rabbits in both

  18. Life-long calorie restriction in Fischer 344 rats attenuates age-related loss in skeletal muscle-specific force and reduces extracellular space.

    PubMed

    Payne, Anthony M; Dodd, Stephen L; Leeuwenburgh, Christiaan

    2003-12-01

    The decline in muscle function is associated with an age-related decrease in muscle mass and an age-related decline in strength. However, decreased strength is not solely due to decreased muscle mass. The age-related decline in muscle-specific force (force/muscle cross-sectional area), a measure of intrinsic muscle function, also contributes to age-related strength decline, and the mechanisms by which this occurs are only partially known. Moreover, changes in the extracellular space could have a profound effect on skeletal muscle function. Life-long calorie restriction in rodents has shown to be a powerful anti-aging intervention. In this study, we examine whether calorie restriction is able to attenuate the loss of muscle function and elevations in extracellular space associated with aging. We hypothesize that calorie restriction attenuates the age-associated decline in specific force and increases in extracellular space. Measurements of in vitro contractile properties of the extensor digitorum longus (type II) and soleus (type I) muscles from 12-mo and 26- to 28-mo-old ad libitum-fed, as well as 27- to 28-mo-old life-long calorie-restricted male Fischer 344 rats, were performed. We found that calorie restriction attenuated the age-associated decline in muscle mass-to-body mass ratio (mg/g) and strength-to-body mass ratio (N/kg) in the extensor digitorum longus muscle (P < 0.05) but not in the soleus muscle (P > 0.05). Importantly, muscle-specific force (N/cm2) in the extensor digitorum longus, but not in the soleus muscle, of the old calorie-restricted rats was equal to that of the young 12-mo-old animals. Moreover, the age-associated increase in extracellular space was reduced in the fast-twitch extensor digitorum longus muscle (P < 0.05) but not in the soleus muscle with calorie restriction. We also found a significant correlation between the extracellular space and the muscle-specific force in the extensor digitorum longus (r = -0.58; P < 0.05) but not in the soleus muscle (r = -0.38; P > 0.05). Hence, this study shows a loss of muscle function with age and suggests that long-term calorie restriction is an effective intervention against the loss of muscle function with age.

  19. Electromyography comparison of the effects of various footwear in the activity patterns of the peroneus longus and brevis muscles.

    PubMed

    Roca-Dols, Andrea; Losa-Iglesias, Marta Elena; Sánchez-Gómez, Rubén; López-López, Daniel; Becerro-de-Bengoa-Vallejo, Ricardo; Calvo-Lobo, César

    2018-06-01

    Peroneus longus and brevis (PLB) disorders are commonly in people with lateral ligamentous instability, ankle pain, lateral hindfoot pain and structures of the proximal compartment of the lower legs and their muscle activity is believed to be influenced by different footwear types. The proposal of this research is to evaluate the effects of five types of footwear with respect to the barefoot condition and analyze the activity patterns of PLB muscles in healthy subjects during the gait cycle. Thirty healthy subjects were recruited in a laboratory in this cross-sectional research design. While walking, electromyography (EMG) activity was measured from PLB via surface electrodes in six experimental conditions: 1) barefoot, 2) minimalist, 3) pronated control, 4) air chamber, 5) ethyl-vinyl-acetate (EVA) and 6) boost. These data were obtained and compared. The peroneus brevis showed significant reductions in the peak amplitude of the five footwear types (minimalist, pronation control, air chamber, EVA and boost) with respect to the barefoot condition in the propulsion phase of the gait cycle during walking (P = 0.034; P < 0.001; P < 0.001; P < 0.001; P = 0.006) and running (P = 0.004; P < 0.001; P = 0.001; P < 0.001; P = 0.001), respectively. Furthermore, peroneus longus showed significant reductions in the peak amplitude of these five footwear types with respect to the barefoot condition in the propulsion phase of the gait cycle during running (P = 0.005; P = 0.038; P = 0.019; P = 0.025; P = 0.021). The EMG activity patterns of the PLB muscles may depend on the use of different types of sport shoes such as minimalist, pronation control, air chamber, EVA and boost footwear with respect the barefoot condition in different phases of the gait cycle during walking and running. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Incidence and Association of CT Findings of Ankle Tendon Injuries in Patients Presenting With Ankle and Hindfoot Fractures.

    PubMed

    Golshani, Ashkahn; Zhu, Liang; Cai, Chunyan; Beckmann, Nicholas M

    2017-02-01

    Tendon injuries are a commonly encountered finding in ankle CT examinations performed for fractures. This study was designed to identify the incidence and associations of tendon injuries in ankle CT examinations performed for fractures. A retrospective review was performed of 410 patients who underwent ankle CT during a 6-year period. Tendon injuries were common, seen in 25% of all ankle CT examinations. Tendon subluxation-dislocation accounted for most of the tendon injuries (77 of 196 total injuries). Pilon fractures carried 2.2 times increased risk of tibialis posterior tendon injury (p = 0.0094). Calcaneus fractures carried 11.86 times increased risk of peroneus brevis tendon and 10.71 times increased risk of peroneus longus tendon injury (p < 0.0001). Calcaneus fractures also carried 5.21 times increased risk of flexor hallucis longus tendon injury (p = 0.0024). Talus fracture was associated with injury to all flexor compartment tendons. Talus fractures carried 3.43 times increased risk of tibialis posterior tendon injury (p < 0.0001), 4.51 times increased risk of flexor digitorum longus tendon injury (p = 0.0005), and 6.97 times increased risk of flexor hallucis longus tendon injury (p < 0.0001). Calcaneal fractures are prone to peroneal tendon injury, and talus fractures are prone to flexor tendon injury. In patients with pilon fractures, it is important to look for tibialis posterior tendon injury, specifically for entrapment. Overall, the most common type of injury is tendon malalignment, so it is imperative to know the normal tendon paths and associated bony landmarks to identify tendon injury.

  1. Are Ultrasonographic Measures of Cervical Flexor Muscles Correlated With Flexion Endurance in Chronic Neck Pain and Asymptomatic Participants?

    PubMed

    Ghamkhar, Leila; Kahlaee, Amir Hossein

    2017-12-01

    This study compared the relationship between some clinical factors and the size of neck flexors in participants with or without chronic neck pain. In this case-control study, the correlation between flexor endurance capacity as well as thickness, cross-section area, and shape ratio of longus colli/capitis and sternocleidomastoid muscles were examined in 30 patients with chronic neck pain and 30 asymptomatic participants. The patients showed lower flexor endurance (P = 0.02), smaller thickness (P = 0.03), and cross-section area (P < 0.01) of longus colli as compared with controls. Longus capitis and sternocleidomastoid size were not different between the two groups. The flexor endurance showed a negative correlation with longus colli shape ratio (r = -0.38, P = 0.03) and a positive correlation with longus capitis cross-section area (r = 0.38, P = 0.03) in the patients with chronic neck pain. In the control group, flexor endurance was negatively correlated with longus colli shape ratio (r = -0.45, P = 0.01) but positively correlated with longus capitis thickness (r = 0.45, P = 0.01) and cross-section area (r = 0.38, P = 0.03). Neck disability and pain intensity indices were not significantly correlated with either flexor muscles endurance or size. The ultrasonographic measures of the deep neck flexor muscles and the flexor endurance test, being associated with each other, could successfully differentiate patients with chronic neck pain from asymptomatic participants. However, the endurance test scores were not correlated with self-reported disability or pain intensity indices.

  2. EMG of the hip adductor muscles in six clinical examination tests.

    PubMed

    Lovell, Gregory A; Blanch, Peter D; Barnes, Christopher J

    2012-08-01

    To assess activation of muscles of hip adduction using EMG and force analysis during standard clinical tests, and compare athletes with and without a prior history of groin pain. Controlled laboratory study. 21 male athletes from an elite junior soccer program. Bilateral surface EMG recordings of the adductor magnus, adductor longus, gracilis and pectineus as well as a unilateral fine-wire EMG of the pectineus were made during isometric holds in six clinical examination tests. A load cell was used to measure force data. Test type was a significant factor in the EMG output for all four muscles (all muscles p < 0.01). EMG activation was highest in Hips 0 or Hips 45 for adductor magnus, adductor longus and gracilis. EMG activation for pectineus was highest in Hips 90. Injury history was a significant factor in the EMG output for the adductor longus (p < 0.05), pectineus (p < 0.01) and gracilis (p < 0.01) but not adductor magnus. For force data, clinical test type was a significant factor (p < 0.01) with Hips 0 being significantly stronger than Hips 45, Hips 90 and Side lay. BMI (body mass index) was a significant factor (p < 0.01) for producing a higher force. All other factors had no significant effect on the force outputs. Hip adduction strength assessment is best measured at hips 0 (which produced most force) or 45° flexion (which generally gave the highest EMG output). Muscle EMG varied significantly with clinical test position. Athletes with previous groin injury had a significant fall in some EMG outputs. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Chronic triceps insufficiency managed with extensor carpi radialis longus and palmaris longus tendon grafts.

    PubMed

    Singh, Dhanpal; Kumar, K Arun; Dinesh, Mc; Raj, Ranju

    2012-03-01

    Chronic triceps insufficiency, causing prolonged disability, occurs due to a missed diagnosis of an acute rupture. We report a 25 year old male with history of a significant fall sustaining multiple injuries. Since then, he had inability in extending his right elbow for which he sought intervention after a year. Diagnosis of triceps rupture was made clinicoradiologically and surgery was planned. Intraoperative findings revealed a deficient triceps with a fleck of avulsed bone from olecranon. Ipsilateral double tendon graft including extensor carpi radialis longus and palmaris longus were anchored to triceps and secured with the olecranon. Six-months follow revealed a complete active extension of elbow and a full function at the donor site.

  4. Fiber transformation and replacement in low-frequency stimulated rabbit fast-twitch muscles.

    PubMed

    Schuler, M; Pette, D

    1996-08-01

    The fast-to-slow conversion of rabbit skeletal muscles by chronic low-frequency (10 Hz, 12 h daily) stimulation involves (1) sequential fast-to-slow fiber-type transitions in the order of type IID-->type IIA-->type I, and (2) the replacement of deteriorating fast-twitch glycolytic fibers by new fibers derived from satellite cells and myotubes. These two processes were analyzed in 30- and 60-day stimulated extensor digitorum longus and tibialis anterior muscles. Fast-to-slow transforming fibers were identified by myofibrillar actomyosin histochemistry as type C fibers and immunohistochemically by their reaction with monoclonal antibodies specific to slow and fast myosin heavy chain isoforms. In situ hybridization of mRNA specific to the myosin heavy chain I isoform identified all fibers expressing slow myosin, i.e., type I and C fibers. The fraction of transforming fibers ranged between 35% and 50% in 30-day stimulated muscles. The percentage of type I fibers (20%) was threefold elevated in extensor digitorum longus muscle, but unaltered (3.5%) in tibialis anterior muscle, suggesting that fast-to-slow fiber conversion was more advanced in the former than in the latter. Fiber replacement was indicated by the finding that the fiber populations of both muscles contained 15% myotubes or small fibers with central nuclei. In situ hybridization revealed that myotubes and small regenerating fibers uniformly expressed myosin heavy chain I mRNA. Similarly, high percentages of slow-myosin-expressing myotubes and small fibers were found in 60-day stimulated muscles.

  5. Effects of two types of foot orthoses on lower limb muscle activity before and after a one-month period of wear.

    PubMed

    Moisan, Gabriel; Cantin, Vincent

    2016-05-01

    The purpose of this study was to quantify the effects of two types of foot orthoses (FOs) on muscle activity during walking. Twenty-one healthy participants were recruited to walk on a five-meter walkway with a control condition (no FOs) and two experimental conditions (FOs and FOs with lateral bar). The experimental protocol was performed before and after a one-month period of wear for each experimental condition. Electromyographic signals were recorded for six muscles (gluteus medius, vastus lateralis, medial gastrocnemius, lateral gastrocnemius, peroneus longus and tibialis anterior). Mean muscle activity was analyzed during the contact, the combined midstance/terminal stance and the pre-swing phases of gait. Peak amplitude and time to peak amplitude were quantified during the stance phase. Unacceptable level of variability was observed between the testing sessions. Therefore, no comparisons were performed to compare the effects of the experimental conditions between testing sessions. After a one-month period of wear, FOs with lateral bar decreased peak amplitude and mean activity of the peroneus longus muscle during the combined midstance/terminal stance phase and FOs decreased peak amplitude and mean activity of the tibialis anterior muscle during the contact phase compared to a control condition. In conclusion, repeated-test design should be used with caution when assessing the muscular adaptation to the wear of FOs for a certain period of time. More studies are needed to determine if the decreased activity of the peroneus longus muscle could be of benefit to treat pathologies such as peroneal tendinopathy or lateral ankle instability. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Morphological and biochemical changes in soleus and extensor digitorum longus muscles of rats orbited in Spacelab 3

    NASA Technical Reports Server (NTRS)

    Riley, D. A.; Slocum, T.; Bain, J. L. W.; Sedlak, F. R.; Elis, S.; Satyanarayana, T.

    1985-01-01

    Muscle atrophy in rats exposed to hypogravity for seven days aboard Spacelab 3 is examined. Hindlimb muscles were harvested 12-16 days postflight, and prepared for enzyme studies and electron microscopy. Simple cell shrinkage was found, with a mean fiber area decrease of 35.8 percent for soleus and 24.9 percent for extensor digitorum longus (EDL) flight muscle fibers, as compared with control muscle fibers. EDL and soleus muscles showed increases in alkaline myofibrillar ATPase, alpha glycerophosphate dehydrogenase, and glycogen, and a decrease in NADH dehydrogenase staining. The 26 percent increase in calcium activated protease suggests that the focal degradation of myofibrils is the key process of myofibril breakdown. The presence in the flight soleus muscles of one percent necrotic fibers is unexplained. The observed shift towards histochemical fast-muscle type properties is consistent with previous findings.

  7. Peroneus longus stretch reflex amplitude increases after ankle brace application

    PubMed Central

    Cordova, M; Ingersoll, C

    2003-01-01

    Background: The use of external ankle support is widespread throughout sports medicine. However, the application of ankle bracing to a healthy ankle over a long period has been scrutinised because of possible neuromuscular adaptations resulting in diminished dynamic support offered by the peroneus longus. Objective: To investigate the immediate and chronic effects of ankle brace application on the amplitude of peroneus longus stretch reflex. Methods: Twenty physically active college students (mean (SD) age 23.6 (1.7) years, height 168.7 (8.4) cm, and mass 69.9 (12.0) kg) who had been free from lower extremity pathology for the 12 months preceding the study served as subjects. None had been involved in a strength training or conditioning programme in the six months preceding the study. A 3 x 3 x 2 (test condition x treatment condition x time) design with repeated measures on the first and third factor was used. The peroneus longus stretch reflex (% of maximum amplitude) during sudden foot inversion was evaluated under three ankle brace conditions (control, lace up, and semi-rigid) before and after eight weeks of ankle brace use. Results: A 3 x 3 x 2 repeated measures analysis of variance showed that peroneus longus stretch reflex amplitude increased immediately after application of a lace up brace (67.1 (4.4)) compared with the semi-rigid (57.9 (4.3)) and control (59.0 (5.2)) conditions (p<0.05). Peroneus longus stretch reflex also increased after eight weeks of use of the semi-rigid brace compared with the lace up and control conditions (p<0.05). Conclusions: Initial application of a lace up style ankle brace and chronic use of a semi-rigid brace facilitates the amplitude of the peroneus longus stretch reflex. It appears that initial and long term ankle brace use does not diminish the magnitude of this stretch reflex in the healthy ankle. PMID:12782553

  8. Risk factors and clinical features of text message injuries.

    PubMed

    Sharan, Deepak; Ajeesh, P S

    2012-01-01

    Use of mobile phone and sending text message is a very common in today's life. While sending a text message the users need to use their thumb and other palm muscles extensively. The thumb most of the time adducted on the key pad of the mobile and use high force to type the letters. Studies in literature showed that text messaging has an adverse effect on musculoskeletal system of hand. But the extensive study on the type of disorders set in among the users who extensively use mobile phone for texting. This study aims at to evaluate risk factor and clinical feature of the MSD due to hand held devices. Twenty seven subjects participated in this study. Predefined protocols were used to evaluate type of MSD occurred among the subjects. The study revealed that development of tendinitis in extensor pollicis longus, myofascial pain syndrome (70.37%) of adductor pollicis, 1st interossei and extensor digitorum communis . Other associated problems diagnosed were thoracic outlet syndrome (51.85%), fibromyalgia syndrome (25.93%), hypothyroidism (7.41%), wrist tendinitis (14.81%) and De Quervain's syndrome (7.41%). It has been observed that the pathology were tendinitis of extensor pollicis longus, myofascial pain syndrome of thenar muscles and 1st interossei, extensor digitorum communis.

  9. The histochemical profile of the rat extensor digitorum longus muscle differentiates after birth and dedifferentiates in senescence.

    PubMed

    Lehnert, M; Laurer, H; Maier, B; Frank, J; Marzi, I; Steudel, W-I; Mautes, A

    2007-01-01

    Age dependent motor unit dedifferentiation is a key component of impaired muscle function in advanced age. Here, we tested the hypothesis that rat muscle histochemical profile during the lifespan of an individual has an age-specific pattern since comprehensive longitudinal studies of muscle differentiation after birth and dedifferentiation in advanced age are scarce. Our results show that extensor digitorum longus muscle (EDL) is comprised only of two fiber types after birth, type slow-oxidative (SO) and type SDH-intermediate (SDH-INT), the latter being indicative for the presence of polyneuronal innervation. In contrast to the constantly growing cross-sectional area of the muscle fibers, a dramatic decrease in SDH-INT proportion occurs between day 14 and 21 after birth resulting in a complete loss of fiber type SDH-INT at the age of 90 days (p<0.05). At the age of 270 days, the fiber type composition of rat EDL dedifferentiates as shown by the reappearance of the SDH-INT type with a further increase at the age of 540 days (p<0.05). These changes in histochemical fiber type spectra are brought about by fiber type conversion within the fast twich fibers. The findings of the present study provide further evidence that fiber type conversion is a basic mechanism leading to motor unit differentiation and dedifferentiation during ontogenesis. Fiber type conversion shows a distinct time specific pattern and is also characteristic for motor unit regeneration after peripheral nerve repair. Factors that influence fiber type conversion and thereby motor unit organization may provide a future therapeutic option to enhance the regenerative capacity of motor units.

  10. Effect of thumb anaesthesia on weight perception, muscle activity and the stretch reflex in man.

    PubMed Central

    Marsden, C D; Rothwell, J C; Traub, M M

    1979-01-01

    1. We have confirmed the results of Gandevia & McCloskey (1977) on the effect of thumb anaesthesia on perception of weights lifted by the thumb. Weights lifted by flexion feel heavier and weights lifted by extension feel lighter. 2. The change in size of the long-latency stretch reflex in flexor pollicis longus or extensor pollicis longus after thumb anaesthesia cannot explain the effect on weight perception by removal or augmentation of the background servo assistance to muscular contraction. 3. During smooth thumb flexion, thumb anaesthesia increases e.m.g. activity in flexor pollicis longus and extensor pollicis longus for any given opposing torque. 4. During smooth thumb extension the opposite occurs: e.m.g. activity in both extensor and flexor pollicis longus decreases. 5. Clamping the thumb at the proximal phalanx to limit movement solely to the interphalangeal joint reduces or abolishes the effect of anaesthesia on both weight perception and e.m.g. activity during both flexion or extension tasks. 6. Gandevia & McCloskey's findings on the distorting effects of thumb anaesthesia on weight perception cannot be used to support the hypothesis of an efferent monitoring system of the sense of effort. Our results emphasize the close functional relationship between cutaneous and joint afferent information and motor control. PMID:512948

  11. Tibial Lengthening: Extraarticular Calcaneotibial Screw to Prevent Ankle Equinus

    PubMed Central

    Belthur, Mohan V.; Paley, Dror; Jindal, Gaurav; Burghardt, Rolf D.; Specht, Stacy C.

    2008-01-01

    Between 2003 and 2006, we used an extraarticular, cannulated, fully threaded posterior calcaneotibial screw to prevent equinus contracture in 10 patients (four male and six female patients, 14 limbs) undergoing tibial lengthening with the intramedullary skeletal kinetic distractor. Diagnoses were fibular hemimelia (two), mesomelic dwarfism (two), posteromedial bow (one), hemihypertrophy (one), poliomyelitis (one), achondroplasia (one), posttraumatic limb-length discrepancy (one), and hypochondroplasia (one). Average age was 24.5 years (range, 15–54 years). The screw (length, typically 125 mm; diameter, 7 mm) was inserted with the ankle in 10° dorsiflexion. Gastrocnemius soleus recession was performed in two patients to achieve 10° dorsiflexion. Average lengthening was 4.9 cm (range, 3–7 cm). Screws were removed after a mean 3.3 months (range, 2–6 months). Preoperative ankle range of motion was regained within 6 months of screw removal. No neurovascular complications were encountered, and no patients experienced equinus contracture. We also conducted a cadaveric study in which one surgeon inserted screws in eight cadaveric legs under image intensifier control. The flexor hallucis longus muscle belly was the closest anatomic structure noted during dissection. The screw should be inserted obliquely from upper lateral edge of the calcaneus and aimed lateral in the tibia to avoid the flexor hallucis longus muscle. Level of Evidence: Level IV, therapeutic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18800215

  12. Comparative proteomic analysis of the aging soleus and extensor digitorum longus rat muscles using TMT labeling and mass spectrometry

    PubMed Central

    Chaves, Daniela F. S.; Carvalho, Paulo C.; Lima, Diogo B.; Nicastro, Humberto; Lorenzetti, Fábio M.; Filho, Mário S.; Hirabara, Sandro M.; Alves, Paulo H. M.; Moresco, James J.; Yates, John R.; Lancha, Antonio H.

    2013-01-01

    Sarcopenia describes an age-related decline in skeletal muscle mass, strength, and function that ultimately impairs metabolism, leads to poor balance, frequent falling, limited mobility, and a reduction in quality of life. Here we investigate the pathogenesis of sarcopenia through a proteomic shotgun approach. Briefly, we employed tandem mass tags (TMT) to quantitate and compare the protein profiles obtained from young versus old rat slow-twitch type of muscle (soleus) and a fast-twitch type of muscle (extensor digitorum longus, EDL). Our results disclose 3452 and 1848 proteins identified from soleus and EDL muscles samples of which 78 and 174 were found to be differentially expressed, respectively. In general, most of the proteins were structural related, involved in energy metabolism, oxidative stress, detoxification, or transport. Aging affected soleus and EDL muscles differently and several proteins were regulated in opposite ways. For example, pyruvate kinase had its expression and activity different in both soleus and EDL muscles. We were able to verify with existing literature many of our differentially expressed proteins as candidate aging biomarkers, and most importantly, disclose several new candidate biomarkers such as the glioblastoma amplified sequence (GAS), zero beta-globin, and prolargin. PMID:24001182

  13. Comparative proteomic analysis of the aging soleus and extensor digitorum longus rat muscles using TMT labeling and mass spectrometry.

    PubMed

    Chaves, Daniela F S; Carvalho, Paulo C; Lima, Diogo B; Nicastro, Humberto; Lorenzeti, Fábio M; Siqueira-Filho, Mário; Hirabara, Sandro M; Alves, Paulo H M; Moresco, James J; Yates, John R; Lancha, Antonio H

    2013-10-04

    Sarcopenia describes an age-related decline in skeletal muscle mass, strength, and function that ultimately impairs metabolism and leads to poor balance, frequent falling, limited mobility, and a reduction in quality of life. Here we investigate the pathogenesis of sarcopenia through a proteomic shotgun approach. In brief, we employed tandem mass tags to quantitate and compare the protein profiles obtained from young versus old rat slow-twitch type of muscle (soleus) and a fast-twitch type of muscle (extensor digitorum longus, EDL). Our results disclose 3452 and 1848 proteins identified from soleus and EDL muscles samples, of which 78 and 174 were found to be differentially expressed, respectively. In general, most of the proteins were structural related and involved in energy metabolism, oxidative stress, detoxification, or transport. Aging affected soleus and EDL muscles differently, and several proteins were regulated in opposite ways. For example, pyruvate kinase had its expression and activity different in both soleus and EDL muscles. We were able to verify with existing literature many of our differentially expressed proteins as candidate aging biomarkers and, most importantly, disclose several new candidate biomarkers such as the glioblastoma amplified sequence, zero β-globin, and prolargin.

  14. Effects of dexamethasone treatment on insulin-stimulated rates of glycolysis and glycogen synthesis in isolated incubated skeletal muscles of the rat.

    PubMed Central

    Leighton, B; Challiss, R A; Lozeman, F J; Newsholme, E A

    1987-01-01

    1. Rats were treated with dexamethasone for 4 days before measurement of the rates of lactate formation [which is an index of hexose transport; see Challiss, Lozeman, Leighton & Newsholme (1986) Biochem. J. 233, 377-381] and glycogen synthesis in response to various concentrations of insulin in isolated incubated soleus and extensor digitorum longus muscle preparations. 2. The concentration of insulin required to stimulate these processes half-maximally in soleus and extensor digitorum longus muscles isolated from control rats was about 100 muunits/ml. 3. Dexamethasone increases the concentration of insulin required to stimulate glycolysis half-maximally in soleus and extensor digitorum longus preparations to 250 and 300 muunits/ml respectively. The respective insulin concentrations necessary to stimulate glycogen synthesis half-maximally were about 430 and 370 muunits/ml for soleus and extensor digitorum longus muscle preparations isolated from steroid-treated rats. 5. Dexamethasone treatment did not change the amount of insulin bound to soleus muscle. PMID:3318810

  15. Region-Specific Responses of Adductor Longus Muscle to Gravitational Load-Dependent Activity in Wistar Hannover Rats

    PubMed Central

    Ohira, Takashi; Terada, Masahiro; Kawano, Fuminori; Nakai, Naoya; Ogura, Akihiko; Ohira, Yoshinobu

    2011-01-01

    Response of adductor longus (AL) muscle to gravitational unloading and reloading was studied. Male Wistar Hannover rats (5-wk old) were hindlimb-unloaded for 16 days with or without 16-day ambulation recovery. The electromyogram (EMG) activity in AL decreased after acute unloading, but that in the rostral region was even elevated during continuous unloading. The EMG levels in the caudal region gradually increased up to 6th day, but decreased again. Approximately 97% of fibers in the caudal region were pure type I at the beginning of experiment. Mean percentage of type I fibers in the rostral region was 61% and that of type I+II and II fiber was 14 and 25%, respectively. The percent type I fibers decreased and de novo appearance of type I+II was noted after unloading. But the fiber phenotype in caudal, not rostral and middle, region was normalized after 16-day ambulation. Pronounced atrophy after unloading and re-growth following ambulation was noted in type I fibers of the caudal region. Sarcomere length in the caudal region was passively shortened during unloading, but that in the rostral region was unchanged or even stretched slightly. Growth-associated increase of myonuclear number seen in the caudal region of control rats was inhibited by unloading. Number of mitotic active satellite cells decreased after unloading only in the caudal region. It was indicated that the responses of fiber properties in AL to unloading and reloading were closely related to the region-specific neural and mechanical activities, being the caudal region more responsive. PMID:21731645

  16. Thyroid hormone stimulates myoglobin expression in soleus and extensorum digitalis longus muscles of rats: concomitant alterations in the activities of Krebs cycle oxidative enzymes.

    PubMed

    dos Santos, R A; Giannocco, G; Nunes, M T

    2001-06-01

    Myoglobin (Mb) gene expression, Citrate Synthase (CS) and Succinate Dehydrogenase (SDH) activities of Soleus (S) and Extensorum Digitalis Longus (EDL) muscles were studied in intact, thyroidectomized and T3-treated (25 microg/100g, BW, ip, 15 days) rats. The fiber type composition of S muscle was also evaluated and used as control of the T3-induced effects. In the S muscle, the T3 treatment increased the Mb mRNA and protein expression, as well as the CS and SDH activity. These changes occurred parallel to the expected increase in type II (fast) and decrease in type I (slow)-fibers in S muscle. In the hypothyroid state, the Mb mRNA was decreased, while the Mb expression and CS activity tended to decrease. In contrast the SDH activity was increased, probably due to the enhanced motor activity that occurs as a short-term response to the hypothermia induced by hypothyroidism. In the EDL, the alterations were milder than those in S muscle in both thyroid states. These findings show that Mb gene expression is induced by T3. This is concomitant with the enhancement of Krebs Cycle enzyme activities and provides additional evidence that thyroid hormone increases the aerobic potential of skeletal muscles, as well as the speed of muscle contraction.

  17. Reversed Palmaris Longus Muscle Causing Volar Forearm Pain and Ulnar Nerve Paresthesia.

    PubMed

    Bhashyam, Abhiram R; Harper, Carl M; Iorio, Matthew L

    2017-04-01

    A case of volar forearm pain associated with ulnar nerve paresthesia caused by a reversed palmaris longus muscle is described. The patient, an otherwise healthy 46-year-old male laborer, presented after a previous unsuccessful forearm fasciotomy for complaints of exercise exacerbated pain affecting the volar forearm associated with paresthesia in the ulnar nerve distribution. A second decompressive fasciotomy was performed revealing an anomalous "reversed" palmaris longus, with the muscle belly located distally. Resection of the anomalous muscle was performed with full relief of pain and sensory symptoms. Copyright © 2017 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  18. Myopathic changes in murine skeletal muscle lacking synemin

    PubMed Central

    García-Pelagio, Karla P.; Muriel, Joaquin; O'Neill, Andrea; Desmond, Patrick F.; Lovering, Richard M.; Lund, Linda; Bond, Meredith

    2015-01-01

    Diseases of striated muscle linked to intermediate filament (IF) proteins are associated with defects in the organization of the contractile apparatus and its links to costameres, which connect the sarcomeres to the cell membrane. Here we study the role in skeletal muscle of synemin, a type IV IF protein, by examining mice null for synemin (synm-null). Synm-null mice have a mild skeletal muscle phenotype. Tibialis anterior (TA) muscles show a significant decrease in mean fiber diameter, a decrease in twitch and tetanic force, and an increase in susceptibility to injury caused by lengthening contractions. Organization of proteins associated with the contractile apparatus and costameres is not significantly altered in the synm-null. Elastimetry of the sarcolemma and associated contractile apparatus in extensor digitorum longus myofibers reveals a reduction in tension consistent with an increase in sarcolemmal deformability. Although fatigue after repeated isometric contractions is more marked in TA muscles of synm-null mice, the ability of the mice to run uphill on a treadmill is similar to controls. Our results suggest that synemin contributes to linkage between costameres and the contractile apparatus and that the absence of synemin results in decreased fiber size and increased sarcolemmal deformability and susceptibility to injury. Thus synemin plays a moderate but distinct role in fast twitch skeletal muscle. PMID:25567810

  19. Activation of the hip adductor muscles varies during a simulated weight-bearing task.

    PubMed

    Hides, Julie A; Beall, Paula; Franettovich Smith, Melinda M; Stanton, Warren; Miokovic, Tanja; Richardson, Carolyn

    2016-01-01

    To investigate the pattern of muscle activation of the individual hip adductor muscles using a standardised simulated unilateral weight-bearing task. A repeated measures design. Laboratory. 20 healthy individuals (11 females, 9 males) participated in the study. Age ranged from 20 to 25 years. Surface electromyography recordings from adductor magnus and adductor longus muscles were taken at levels representing 10-50% of body weight during a simulated weight-bearing task. Electromyography (EMG) data were normalised to maximal voluntary isometric contraction. The adductor magnus was recruited at significantly higher levels than the adductor longus muscle during a simulated weight-bearing task performed across 10-50% of body weight (p < 0.01). Adductor magnus and adductor longus muscles are recruited to different extents during a simulated weight-bearing task. This information should be considered when selecting exercises for management and prevention of groin strains. Closed chain exercises with weight-bearing through the lower limb are more likely to recruit the adductor magnus muscle over the adductor longus muscle. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Tendon rupture associated with excessive smartphone gaming.

    PubMed

    Gilman, Luke; Cage, Dori N; Horn, Adam; Bishop, Frank; Klam, Warren P; Doan, Andrew P

    2015-06-01

    Excessive use of smartphones has been associated with injuries. A 29-year-old, right hand-dominant man presented with chronic left thumb pain and loss of active motion from playing a Match-3 puzzle video game on his smartphone all day for 6 to 8 weeks. On physical examination, the left extensor pollicis longus tendon was not palpable, and no tendon motion was noted with wrist tenodesis. The thumb metacarpophalangeal range of motion was 10° to 80°, and thumb interphalangeal range of motion was 30° to 70°. The clinical diagnosis was rupture of the left extensor pollicis longus tendon. The patient subsequently underwent an extensor indicis proprius (1 of 2 tendons that extend the index finger) to extensor pollicis longus tendon transfer. During surgery, rupture of the extensor pollicis longus tendon was seen between the metacarpophalangeal and wrist joints. The potential for video games to reduce pain perception raises clinical and social considerations about excessive use, abuse, and addiction. Future research should consider whether pain reduction is a reason some individuals play video games excessively, manifest addiction, or sustain injuries associated with video gaming.

  1. Initial experience with visualizing hand and foot tendons by dual-energy computed tomography.

    PubMed

    Deng, Kai; Sun, Cong; Liu, Cheng; Ma, Rui

    2009-01-01

    To assess the feasibility of visualizing hand and foot tendons by dual-energy computed tomography (CT). Twenty patients who suffered from hand or feet pains were scanned on dual-source CT (Definition, Forchheim, Germany) with dual-energy mode at tube voltages of 140 and 80 kV and a corresponding ratio of 1:4 between tube currents. The reconstructed images were postprocessed by volume rendering techniques (VRT) and multiplanar reconstruction (MPR). All of the suspected lesions were confirmed by surgery or follow-up studies. Twelve patients (total of 24 hands and feet, respectively) were found to be normal and the other eight patients (total of nine hands and feet, respectively) were found abnormal. Dual-energy techniques are very useful in visualizing tendons of the hands and feet, such as flexor pollicis longus tendon, flexor digitorum superficialis/profundus tendon, Achilles tendon, extensor hallucis longus tendon, and extensor digitorum longus tendon, etc. It can depict the whole shape of the tendons and their fixation points clearly. Peroneus longus tendon in the sole of the foot was not displayed very well. The distal ends of metacarpophalangeal joints with extensor digitoium tendon and extensor pollicis longus tendon were poorly shown. The lesions of tendons such as the circuitry, thickening, and adherence were also shown clearly. Dual-energy CT offers a new method to visualize tendons of the hand and foot. It could clearly display both anatomical structures and pathologic changes of hand and foot tendons.

  2. Reliability and discriminative validity of sudden ankle inversion measurements in patients with chronic ankle instability.

    PubMed

    Eechaute, Christophe; Vaes, Peter; Duquet, William; Van Gheluwe, Bart

    2009-07-01

    Studies investigating peroneal muscle reaction times in chronically unstable ankle joints present conflicting results. The degree of reliability and accuracy of these measurements is unknown in patients with chronic ankle instability (CAI). 40 patients with CAI and 30 healthy subjects were tested using a sudden ankle inversion of 50 degrees while standing on a trapdoor device. Sudden ankle inversion measurements were registered using electromyography, accelerometry and electrogoniometry. For reliability testing, intra-class coefficients (ICCs; model 3,1) and standard errors of measurements of the latency time, motor response time and electromechanical delay of the peroneus longus muscle, the time and angular position of onset of decelerations, the mean and maximum inversion speed and the total inversion time were calculated in 15 patients with CAI. To assess between-group differences, t-tests for independent samples (p<.05) were used. ICCs ranged from .20 (angular position of onset of the second deceleration) to .98 (electromechanical delay of the peroneus longus muscle). Significant between-group differences were observed in only 2 of the 12 variables (for the electromechanical delay of the peroneus longus muscle, p=.001; time of onset of the second deceleration, p=.040). The latency time and motor response time of the peroneus longus muscle, the total inversion time and the mean inversion speed demonstrate acceptable reliability in healthy subjects and patients. The latency time and motor response time of the peroneus longus muscle are not delayed in patients with CAI. Ankle inversion measurements are not discriminative for CAI.

  3. The Hindlimb Myology of Tyto alba (Tytonidae, Strigiformes, Aves).

    PubMed

    Mosto, M C

    2017-02-01

    This work is the first myological dissection performed in detail on the hindlimb of Tyto alba. Six specimens were dissected and their muscle masses were obtained. T. alba has the classical myological pattern present in other species of Strigiformes, such as a well-developed m. flexor digitorum longus and the absence of the m. plantaris, flexor cruris lateralis and ambiens. Also, T. alba lacks the m. extensor propius digiti III, m. extensor propius digiti IV and m. lumbricalis, present in the Strigidae. Hindlimb muscle mass accounts for 14.13% of total body mass, which is within the range of values of both nocturnal (Strigiformes) and diurnal (Falconidae and Accipitridae) raptors. This study provides important information for future studies related to functional morphology and ecomorphology. © 2016 Blackwell Verlag GmbH.

  4. Temporal changes in sarcomere lesions of rat adductor longus muscles during hindlimb reloading

    NASA Technical Reports Server (NTRS)

    Krippendorf, B. B.; Riley, D. A.

    1994-01-01

    Focal sarcomere disruptions were previously observed in adductor longus muscles of rats flown approximately two weeks aboard the Cosmos 1887 and 2044 biosatellite flights. These lesions, characterized by breakage and loss of myofilaments and Z-line streaming, resembled damage induced by unaccustomed exercise that includes eccentric contractions in which muscles lengthen as they develop tension. We hypothesized that sarcomere lesions in atrophied muscles of space flow rats were not produced in microgravity by muscle unloading but resulted from muscle reloading upon re-exposure to terrestrial gravity. To test this hypothesis, we examined temporal changes in sarcomere integrity of adductor longus muscles from rats subjected to 12.5 days of hindlimb suspension unloading and subsequent reloading by return to vivarium cages for 0, 6, 12, or 48 hours of normal weightbearing. Our ultrastructural observations suggested that muscle unloading (0 h reloading) induced myofibril misalignment associated with myofiber atrophy. Muscle reloading for 6 hours induced focal sarcomere lesions in which cross striations were abnormally widened. Such lesions were electron lucent due to extensive myofilament loss. Lesions in reloaded muscles showed rapid restructuring. By 12 hours of reloading, lesions were moderately stained foci and by 48 hours darkly stained foci in which the pattern of cross striations was indistinct at the light and electron microscopic levels. These lesions were spanned by Z-line-like electron dense filamentous material. Our findings suggest a new role for Z-line streaming in lesion restructuring: rather than an antecedent to damage, this type of Z-line streaming may be indicative of rapid, early sarcomere repair.

  5. Does the longus colli have an effect on cervical vertigo?

    PubMed Central

    Liu, Xiao-Ming; Pan, Fu-Min; Yong, Zhi-Yao; Ba, Zhao-yu; Wang, Shan-Jin; Liu, Zheng; Zhao, Wei-dong; Wu, De-Sheng

    2017-01-01

    Abstract The aim of the study was to evaluate the role of the longus colli muscles in cervical vertigo. We retrospectively analyzed 116 adult patients who underwent anterior cervical discectomy and fusion (ACDF) during 2014 in our department. Patients were assigned to the vertigo group or the nonvertigo group. Demographic data were recorded. Inner distance and cross-sectional area (CSA) of longus colli were measured using coronal magnetic resonance imaging (MRI). The vertigo group (n = 44) and the nonvertigo group (n = 72) were similar in demographic data. Mean preoperative Japanese Orthopaedic Association (JOA) score was higher in the vertigo group than in the nonvertigo group (P = 0.037), but no difference postoperatively. Mean JOA scores increased significantly postoperatively in both groups (P = 0.002 and P = 0.001). The mean vertigo score decreased significantly from pre- to postoperatively in the vertigo group (P = 0.023). The mean preoperative Cobb angle was significantly smaller in the vertigo group than in the nonvertigo group (P <0.001), but no significant difference postoperatively. After ACDF, the mean Cobb angle increased significantly in the vertigo group (P <0.001). The instability rates of C3/4 and C4/5 were significantly higher in the vertigo group (P <0.001 and P <0.001). The inner distance of longus colli was significantly shorter (P = 0.032 and P = 0.026) and CSA significantly smaller (P = 0.041 and P = 0.035), at C3/4 and C4/5 in the vertigo group than in the nonvertigo group. Mean Miyazaki scores were significantly higher in the vertigo group at C3/4 and C4/5 (P = 0.044 and P = 0.037). Moreover, a shorter inner distance and smaller CSA were related to a higher Miyazaki score. Inner distance and cross-sectional area (CSA) of longus colli are associated closely with cervical vertigo. Shorter inner distance and smaller CSA of the longus colli muscles might be risk factors for cervical vertigo. ACDF provided a good resolution of cervical vertigo. PMID:28328822

  6. Does the longus colli have an effect on cervical vertigo?: A retrospective study of 116 patients.

    PubMed

    Liu, Xiao-Ming; Pan, Fu-Min; Yong, Zhi-Yao; Ba, Zhao-Yu; Wang, Shan-Jin; Liu, Zheng; Zhao, Wei-Dong; Wu, De-Sheng

    2017-03-01

    The aim of the study was to evaluate the role of the longus colli muscles in cervical vertigo.We retrospectively analyzed 116 adult patients who underwent anterior cervical discectomy and fusion (ACDF) during 2014 in our department. Patients were assigned to the vertigo group or the nonvertigo group. Demographic data were recorded. Inner distance and cross-sectional area (CSA) of longus colli were measured using coronal magnetic resonance imaging (MRI).The vertigo group (n = 44) and the nonvertigo group (n = 72) were similar in demographic data. Mean preoperative Japanese Orthopaedic Association (JOA) score was higher in the vertigo group than in the nonvertigo group (P = 0.037), but no difference postoperatively. Mean JOA scores increased significantly postoperatively in both groups (P = 0.002 and P = 0.001). The mean vertigo score decreased significantly from pre- to postoperatively in the vertigo group (P = 0.023). The mean preoperative Cobb angle was significantly smaller in the vertigo group than in the nonvertigo group (P <0.001), but no significant difference postoperatively. After ACDF, the mean Cobb angle increased significantly in the vertigo group (P <0.001). The instability rates of C3/4 and C4/5 were significantly higher in the vertigo group (P <0.001 and P <0.001). The inner distance of longus colli was significantly shorter (P = 0.032 and P = 0.026) and CSA significantly smaller (P = 0.041 and P = 0.035), at C3/4 and C4/5 in the vertigo group than in the nonvertigo group. Mean Miyazaki scores were significantly higher in the vertigo group at C3/4 and C4/5 (P = 0.044 and P = 0.037). Moreover, a shorter inner distance and smaller CSA were related to a higher Miyazaki score.Inner distance and cross-sectional area (CSA) of longus colli are associated closely with cervical vertigo. Shorter inner distance and smaller CSA of the longus colli muscles might be risk factors for cervical vertigo. ACDF provided a good resolution of cervical vertigo.

  7. Muscles within muscles: a tensiomyographic and histochemical analysis of the normal human vastus medialis longus and vastus medialis obliquus muscles

    PubMed Central

    Travnik, Ludvik; Djordjevič, Srdjan; Rozman, Sergej; Hribernik, Marija; Dahmane, Raja

    2013-01-01

    The aim of this study was to show the connection between structure (anatomical and histochemical) and function (muscle contraction properties) of vastus medialis obliquus (VMO) and vastus medialis longus (VML). The non-invasive tensiomyography (TMG) method was used to determine the contractile properties (contraction time; Tc) of VML and VMO muscle, as a reflection of the ratio between the slow and fast fibers in two groups of nine young men. VML and VMO significantly (P < 0.01) differ in the proportion of type 1 (59.6: 44%) and type 2b (6.3: 15%) fibers. The VML muscle is almost entirely composed of type 1 and type 2a fibers. In many samples of this muscle no type 2b fibers were found. The proportion of slow-twitch type 1 fibers is nearly twice as high as the proportion of fast-twitch type 2a fibers. These observations indicate that VML is a slower and more fatigue-resistant muscle than VMO muscle. These characteristics correspond to the different functions of the VML, which is an extensor of the knee, and to the VMO, which maintains the stable position of the patella in the femoral groove. Our results obtained by TMG provided additional evidence that muscle fibers within the segments of VM muscle were not homogenous with regard to their contractile properties, thereby confirming the histochemical results. Tc can be attributed to the higher percentage of slow-twitch fibers – type 1. The statistically shorter Tc (P ≤ 0.001) of VMO (22.8 ± 4.0 ms) compared with VML (26.7 ± 4.0 ms) in our study is consistent with previously found differences in histochemical, morphological and electrophysiological data. In conclusion, the results of this study provide evidence that the VML and VMO muscles are not only anatomically and histochemically different muscles, but also functionally different biological structures. PMID:23586984

  8. The influence of the Peroneus Longus muscle on the foot under axial loading: A CT evaluated dynamic cadaveric model study.

    PubMed

    Dullaert, K; Hagen, J; Klos, K; Gueorguiev, B; Lenz, M; Richards, R G; Simons, P

    2016-05-01

    Subtle hypermobility of the first tarsometatarsal joint can occur concomitantly with other pathologies and may be difficult to diagnose. Peroneus Longus muscle might influence stability of this joint. Collapse of the medial longitudinal arch is common in flatfoot deformity and the muscle might also play a role in correcting Meary's angle. A radiolucent frame was used to simulate weightbearing during CT examination. Eight pairs fresh-frozen lower legs were imaged in neutral position under non-weightbearing (75N), weightbearing (700N) and with 15kg weights hung from Peroneus Longus tendon. Measurements included first metatarsal rotation, intermetatarsal angle, first tarsometatarsal joint subluxation and Meary's angle. Weightbearing significantly increased Meary's angle and significantly decreased first tarsometatarsal joint subluxation (both P<0.01). Pulling Peroneus Longus tendon significantly increased first metatarsal rotation (P<0.01), significantly decreased the intermetatarsal angle (P<0.01) and increased non-significantly Meary's angle (P=0.52). A considerable effect weightbearing has on the medial longitudinal arch and first tarsometatarsal joint was observed. Pulling Peroneus Longus tendon improved first metatarsal subluxation but increased its rotation. The study calls into question the importance of this tendon in maintaining the medial longitudinal arch and raises concerns about rotational deformity of the first metatarsal following hallux valgus correction without first tarsometatarsal arthrodesis. Study outcomes will provide more insight in foot pathology. Weightbearing affects anatomy of the foot. No reliable information is available concerning the influence of the Peroneus muscle. This study investigates the influence of weightbearing and the impact the Peroneus muscle on the anatomy of the foot. Copyright © 2016. Published by Elsevier Ltd.

  9. Muscle stiffness of posterior lower leg in runners with a history of medial tibial stress syndrome.

    PubMed

    Saeki, J; Nakamura, M; Nakao, S; Fujita, K; Yanase, K; Ichihashi, N

    2018-01-01

    Previous history of medial tibial stress syndrome (MTSS) is a risk factor for MTSS relapse, which suggests that there might be some physical factors that are related to MTSS development in runners with a history of MTSS. The relationship between MTSS and muscle stiffness can be assessed in a cross-sectional study that measures muscle stiffness in subjects with a history of MTSS, who do not have pain at the time of measurement, and in those without a history of MTSS. The purpose of this study was to compare the shear elastic modulus, which is an index of muscle stiffness, of all posterior lower leg muscles of subjects with a history of MTSS and those with no history and investigate which muscles could be related to MTSS. Twenty-four male collegiate runners (age, 20.0±1.7 years; height, 172.7±4.8 cm; weight, 57.3±3.7 kg) participated in this study; 14 had a history of MTSS, and 10 did not. The shear elastic moduli of the lateral gastrocnemius, medial gastrocnemius, soleus, peroneus longus, peroneus brevis, flexor hallucis longus, flexor digitorum longus, and tibialis posterior were measured using shear wave elastography. The shear elastic moduli of the flexor digitorum longus and tibialis posterior were significantly higher in subjects with a history of MTSS than in those with no history. However, there was no significant difference in the shear elastic moduli of other muscles. The results of this study suggest that flexor digitorum longus and tibialis posterior stiffness could be related to MTSS. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Peroneal perforator-based peroneus longus tendon and sural neurofasciocutaneous composite flap transfer for a large soft-tissue defect of the forearm: A case report.

    PubMed

    Hayashida, Kenji; Saijo, Hiroto; Fujioka, Masaki

    2018-01-01

    We describe the use of a composite flap composed of a sural neurofasciocutaneous flap and a vascularized peroneus longus tendon for the reconstruction of severe composite forearm tissue defects in a patient. A 43-year-old man had his left arm caught in a conveyor belt resulting in a large soft-tissue defect of 18 × 11 cm over the dorsum forearm. The extensor carpi radialis, superficial radial nerve, and radial artery were severely damaged. A free neurofasciocutaneous composite flap measuring 16 × 11 cm was outlined on the patient's left lower leg to allow simultaneous skin, tendon, nerve, and artery reconstruction. The flap, which included the peroneus longus tendon, was elevated on the subfascial plane. After the flap was transferred to the recipient site, the peroneal artery was anastomosed to the radial artery in a flow-through manner. The vascularized tendon graft with 15 cm in length was used to reconstruct the extensor carpi radialis longus tendon defect using an interlacing suture technique. As the skin paddle of the sural neurofasciocutaneous flap and the vascularized peroneus longus tendon graft were linked by the perforator and minimal fascial tissue, the skin paddle was able to rotate and slide with comparative ease. The flap survived completely without any complications. The length of follow-up was 12 months and was uneventful. Range of motion of his left wrist joint was slightly limited to 75 degrees. This novel composite flap may be useful for reconstructing long tendon defects associated with extensive forearm soft tissue defects. © 2016 Wiley Periodicals, Inc.

  11. Fatigability of rat hindlimb muscle: associations between electromyogram and force during a fatigue test.

    PubMed Central

    Enoka, R M; Rankin, L L; Stuart, D G; Volz, K A

    1989-01-01

    1. An experimental protocol designed to assess fatigability in motor units (Burke, Levine, Tsairis & Zajac, 1973) has been applied to the whole muscles of anaesthetized adult rats, and the association between the electromyogram (EMG) and force was monitored over the course of the test. 2. Both test muscles (soleus and extensor digitorum longus) exhibited a wide range of fatigability, which was defined as the decline in isometric peak force at 6 min, such that the data could be separated into five levels of fatigability. Fatigue indices for each test muscle were distributed across three levels. 3. The EMG was quantified with four measures of amplitude, four of duration, and one interaction term (area). Correlation analyses indicated that the EMG was adequately represented by one measure of amplitude (absolute amplitude), one of duration (peak-to-peak duration) and area. The best single measure was area. 4. The EMG-force associations for soleus varied markedly among its three fatigability groups. In contrast, over the course of the test, all three extensor digitorum longus groups displayed qualitatively similar EMG-force associations. 5. Multiple regression analyses indicated that the EMG parameters were able to predict peak force better for extensor digitorum longus than for soleus. Furthermore, for both test muscle, the prediction was best for the most fatigable group. 6. The associations between EMG and force exhibited three patterns for the two test muscles and three levels of fatigability. These differences suggested variation in the mechanisms, related to both fibre-type composition and susceptibility to fatigue, that dictate the performance elicited by this particular stimulus regimen. The mechanisms seem to include both intracellular and transmission processes. Images Fig. 1 PMID:2778729

  12. Intermediate term follow-up of calcaneal osteotomy and flexor digitorum longus transfer for treatment of posterior tibial tendon dysfunction.

    PubMed

    Fayazi, Amir H; Nguyen, Hoan-Vu; Juliano, Paul J

    2002-12-01

    Twenty-three patients with stage II posterior tibial tendon dysfunction who had failed non-surgical therapy were treated with flexor digitorum longus transfer and calcaneal osteotomy. At latest follow-up averaging 35 +/- 7 months (range, 24 to 51 months), 22 patients (96%) were subjectively "better" or "much better." No patient had difficulty with shoe wear; however, four patients (17%) required routine orthotic use consisting of a molded shoe insert. AOFAS scores were available on 21 patients and improved from a preoperative mean of 50 +/- 14 (range, 27 to 85) to a postoperative mean of 89 +/- 10 (range, 70 to 100). Our experience, at an intermediate date follow-up is that calcaneal osteotomy and flexor digitorum longus transfer is a safe and effective form of treatment for stage II posterior tibial tendon dysfunction.

  13. Reconstruction of large defects of the lips and commissure using a composite radial forearm palmaris longus free flap associated with a lengthening temporalis myoplasty.

    PubMed

    Martin, Thomas; Sury, Florent; Goga, Dominique; Parmentier, Jerome; Rozen, Adam; Laure, Boris

    2012-08-01

    We performed a single-stage operation to reconstruct a large defect of the lips and commissure using a composite radial forearm-palmaris longus free flap. To obtain cranial traction and a voluntary smile, independently from any jaw movement, traction was achieved by using a lengthening temporalis myoplasty. The tendon attached to the coronoid process was fixed to the palmaris longus tendon, recreating a new commissure and a "neo-modiolus." Physical therapy was started on the 21st postoperative day to facilitate progress from a "mandibular smile," to ideally a spontaneous and symmetric smile after 3 months of therapy. This procedure was able to obtain good oral continence and a good commissural movement during smile which has not previously been mentioned in the published literature.

  14. Anatomical Study of the Neurovascular in Flexor Hallucis Longus Tendon Transfers.

    PubMed

    Mao, Haijiao; Dong, Wenwei; Shi, Zengyuan; Yin, Weigang; Xu, Dachuan; Wapner, Keith L

    2017-10-27

    The transfer of the flexor hallucis longus tendon or flexor digitorum longus tendon is frequently used for the treatment of posterior tibial tendon insufficiency or chronic Achilles tendinopathy. According to several anatomical studies, harvesting the flexor hallucis longus (FHL) tendon may cause nerve injury. Sixty-eight embalmed feet were dissected and anatomically classified to define the relationship between Henry's knot and the plantar nerves. Two different configurations were identified. In Pattern 1, which was observed in 64 specimens (94.1%), the distance between the medial plantar nerve and Henry's knot was 5.96 mm (range, 3.34 to 7.84, SD = 1.12). In Pattern 2, which was observed in 4 specimens (5.9%), there was no distance between the medial plantar nerve (MPN) and Henry's knot. No statistically significant difference was observed according to gender or side (p > 0.05). A retraction was performed to harvest the FHL through the posteromedial hindfoot incision using a single minimally invasive technique, and the medial and lateral plantar nerve lesions were scrupulously assessed. In conclusion, medial and lateral plantar nerve injuries did not occur more frequently, even after performing a single minimally invasive incision to harvest the FHL tendon, due to the large distance between the FHL tendon and the medial and lateral plantar nerves.

  15. Small flake, big problem: an unreported cause of extensor pollicis longus tendon rupture.

    PubMed

    Durrant, C A T; Bantick, G

    2010-01-01

    Fracture of the base of the third metacarpal with associated avulsion of the extensor carpi radialis brevis tendon is a rare injury. We report such a fracture and the unusual resulting complication of division of the extensor pollicis longus tendon by the avulsed bony fragment. Careful monitoring using lateral radiographs is needed to make the diagnosis and displacement of the avulsed fragment warrants open reduction and internal fixation.

  16. Abductor pollicis longus: a case of mistaken identity.

    PubMed

    Elliott, B G

    1992-08-01

    Abductor pollicis longus, long regarded as a motor for the thumb, is anatomically and functionally a radial deviator of the wrist and should be so named. The abductor carpi is proposed. If the other radial deviators of the wrist are acting this tendon can be selectively utilized as a transfer without loss of function. Reflex spasm of this muscle probably plays an important role in the radial deviation deformity seen in the rheumatoid hand.

  17. Reduction-oxidation state and protein degradation in skeletal muscle of fasted and refed rats

    NASA Technical Reports Server (NTRS)

    Fagan, Julie M.; Tischler, Marc E.

    1986-01-01

    Redox state and protein degradation were measured in isolated muscles of fasted (up to 10 d) and refed (up to 4 d) 7- to 14-wk-old rats. Protein degradation in the extensor digitorum longus muscle, but not in the soleus muscle, was greater in the fasted rats than in weight-matched muscle from fed rats. The NAD couple was more oxidized in incubated and fresh extensor digitorum longus muscles and in some incubated soleus muscles of fasted rats than in weight-matched muscle from fed rats. In the extensor digitorum longus muscle of refed or prolonged fasted rats, protein degradation was slower and the NAD couple was more reduced than in the fed state. Therefore, oxidation of the NAD couple was associated with increased muscle breakdown during fasting, whereas reduction of the NAD couple was associated with muscle conservation and deposition.

  18. Velopharyngeal closure and the longus capitis muscle.

    PubMed

    Yamawaki, Y; Nishimura, Y; Suzuki, Y

    1996-09-01

    The dynamic mechanism of velopharyngeal function not only in normal individuals but also in patients with velopharyngeal insufficiency, which is mainly related to cleft palate, has been the subject of considerable interest and controversy. Recently, in order to clarify velopharyngeal movement in the valvular action on phonation we examined dynamic MR images of this area taken in the transverse plane in parallel with the muscle sling of levator veli palatini. In cases in whom the closure pattern in that plane is circular, detailed observation revealed a very interesting result; that is, the longus capitis muscle, one of the group of anterior vertebral muscles, is directly involved in velopharyngeal valving function. It has not previously been reported that the longus capitis muscle acts as one of the velopharyngeal closure muscles, in addition to levator veli palatini. The present study demonstrated that contraction of the muscle contributed to velopharyngeal closure by forward movement of the pharyngeal wall.

  19. Myosin heavy chain isoform composition and Ca(2+) transients in fibres from enzymatically dissociated murine soleus and extensor digitorum longus muscles.

    PubMed

    Calderón, Juan C; Bolaños, Pura; Caputo, Carlo

    2010-01-01

    Electrically elicited Ca(2+) transients reported with the fast Ca(2+) dye MagFluo-4 AM and myosin heavy chain (MHC) electrophoretic patterns were obtained in intact, enzymatically dissociated fibres from adult mice extensor digitorum longus (EDL) and soleus muscles. Thirty nine fibres (23 from soleus and 16 from EDL) were analysed by both fluorescence microscopy and electrophoresis. These fibres were grouped as follows: group 1 included 13 type I and 4 type IC fibres; group 2 included 2 type IIC, 3 IIA and 1 I/IIA/IIX fibres; group 3 included 4 type IIX and 1 type IIX/IIB fibres; group 4 included 2 type IIB/IIX and 9 type IIB fibres. Ca(2+) transients obtained in groups 1, 2, 3 and 4 had the following kinetic parameters (mean +/- s.e.m.): amplitude (F/F): 0.61 +/- 0.05, 0.53 +/- 0.08, 0.61 +/- 0.06 and 0.61 +/- 0.03; rise time (ms): 1.64 +/- 0.05, 1.35 +/- 0.05, 1.18 +/- 0.06 and 1.14 +/- 0.04; half-amplitude width (ms): 19.12 +/- 1.85, 11.86 +/- 3.03, 4.62 +/- 0.31 and 4.23 +/- 0.37; and time constants of decay (tau(1) and tau(2), ms): 3.33 +/- 0.13 and 52.48 +/- 3.93, 2.69 +/- 0.22 and 41.06 +/- 9.13, 1.74 +/- 0.06 and 12.88 +/- 1.93, and 1.56 +/- 0.11 and 9.45 +/- 1.03, respectively. The statistical differences between the four groups and the analysis of the distribution of the parameters of Ca(2+) release and clearance show that there is a continuum from slow to fast, that parallels the MHC continuum from pure type I to pure IIB. However, type IIA fibres behave more like IIX and IIB fibres regarding Ca(2+) release but closer to type I fibres regarding Ca(2+) clearance. In conclusion, we show for the first time the diversity of Ca(2+) transients for the whole continuum of fibre types and correlate this functional diversity with the structural and biochemical diversity of the skeletal muscle fibres.

  20. Electromyographic Analysis of the Peroneous Longus during Bicycle Ergometry across Work Load and Pedal Type.

    DTIC Science & Technology

    1983-01-01

    adjusted for each subject to 60 cycles per minute using a metronome. Gait cycle was determined using an electrical pressure switch attached to the...dental burr. Electrodes were filled with conducting gel and held in place with double adhesive rings. An electrical pressure switch was taped to the...the pressure switch was carried on a separate wire to the recording equipment. All wires were held tightly against the subject’s leg to reduce

  1. Comparative anatomy of the radial sesamoid bone in the polar bear (Ursus maritimus), the brown bear (Ursus arctos) and the giant panda (Ailuropoda melanoleuca).

    PubMed

    Endo, H; Makita, T; Sasaki, M; Arishima, K; Yamamoto, M; Hayashi, Y

    1999-08-01

    Since we have clarified the manipulation mechanism using the radial sesamoid (RS) in the giant panda (Ailuropoda melanoleuca), our aim in this study is to examine the position, shape and function of the RS morphologically, and to observe the attachment to the RS of the M. abductor pollicis longus and the M. opponens pollicis in the other Ursidae species. So, we focused on the carpus and manus of the polar bear (Ursus maritimus) and the brown bear (Ursus arctos) in this study. The RS was tightly articulated to the radial carpal, and could not adduct-abduct independently of the radial carpal. The M. abductor pollicis longus tendon and the M. opponens pollicis belly were attached to the RS, independently. In the polar bear, the deep concave and the flat surface were confirmed in attachment area for these two muscles. The morphological relationship between the RS and the M. abductor pollicis longus and the M. opponens pollicis in the two species of bears were essentially consistent with that in the giant panda. It also demonstrated that the manipulation mechanism of the giant panda has been completely based on the functional relationship between the small RS, and the M. abductor pollicis longus and the M. opponens pollicis in Ursidae species.

  2. Skeletal muscle fiber, nerve, and blood vessel breakdown in space-flown rats

    NASA Technical Reports Server (NTRS)

    Riley, D. A.; Ilyina-Kakueva, E. I.; Ellis, S.; Bain, J. L.; Slocum, G. R.; Sedlak, F. R.

    1990-01-01

    Histochemical and ultrastructural analyses were performed postflight on hind limb skeletal muscles of rats orbited for 12.5 days aboard the unmanned Cosmos 1887 biosatellite and returned to Earth 2 days before sacrifice. The antigravity adductor longus (AL), soleus, and plantaris muscles atrophied more than the non-weight-bearing extensor digitorum longus, and slow muscle fibers were more atrophic than fast fibers. Muscle fiber segmental necrosis occurred selectively in the AL and soleus muscles; primarily, macrophages and neutrophils infiltrated and phagocytosed cellular debris. Granule-rich mast cells were diminished in flight AL muscles compared with controls, indicating the mast cell secretion contributed to interstitial tissue edema. Increased ubiquitination of disrupted myofibrils implicated ubiquitin in myofilament degradation. Mitochondrial content and succinic dehydrogenase activity were normal, except for subsarcolemmal decreases. Myofibrillar ATPase activity of flight AL muscle fibers shifted toward the fast type. Absence of capillaries and extravasation of red blood cells indicated failed microcirculation. Muscle fiber regeneration from activated satellite cells was detected. About 17% of the flight AL end plates exhibited total or partial denervation. Thus, skeletal muscle weakness associated with spaceflight can result from muscle fiber atrophy and segmental necrosis, partial motor denervation, and disruption of the microcirculation.

  3. Five myofibrillar lesion types in eccentrically challenged, unloaded rat adductor longus muscle--a test model

    NASA Technical Reports Server (NTRS)

    Thompson, J. L.; Balog, E. M.; Fitts, R. H.; Riley, D. A.

    1999-01-01

    Sarcomere disruptions are observed in the adductor longus (AL) muscles following voluntary reloading of spaceflown and hindlimb suspension unloaded (HSU) rat, which resemble lesions in eccentrically challenged muscle. We devised and tested an eccentric contraction (ECCON) test system for the 14-day HSU rat AL. Six to 7 hours following ECCON, ALs were fixed to allow immunostaining and electron microscopy (EM). Toluidine blue-stained histology semithin sections were screened for lesion density (#/mm2). Serial semithin sections from the ECCON group were characterized for myosin immunointensity of lesions. Five myofibrillar lesion types were identified in histological semithin sections: focal contractions; wide A-bands; opaque areas; missing A-bands; and hyperstretched sarcomeres. Lesion density by type was greater for ECCON than NonECCON ALs (P< or =0.05; focal contractions and opaque regions). Lesion density (#-of-all-five-types/mm2) was significantly different (ECCON: 23.91+/-10.58 vs. NonECCON: 5.48+/-1.28, P< or =0.05; ECCON vs. SHAM: 0.00+/-0.00; P< or = 0.025). PostECCON optimal tension decreased (Poi-drop, 17.84+/-4.22%) and was correlated to lesion density (R2=0.596), but prestretch tension demonstrated the highest correlation with lesion density (R2=0.994). In lesions, the darkly staining A-band lost the normally organized thick filament alignment to differing degrees across the different lesion types. Ranking the five lesion types by a measure of lesion length deformation (hypercontracted to hyperstretched) at the light microscopy level, related to the severity of thick filament registry loss across the lesion types at the electron microscopic level. This ranking suggested that the five lesion types seen in semithin sections at the light level represented a lesion progression sequence and paralleled myosin immunostaining loss as the distorted A-band filaments spread across the hyperlengthening lesion types. Lesion ultrastructure indicated damage involved calcium homeostasis loss (focal contraction lesions) and "thick-filament-centering" failure of titin (wide A-band lesions) in the early stages of lesion development.

  4. Physiological changes in fast and slow muscle with simulated weightlessness

    NASA Technical Reports Server (NTRS)

    Dettbarn, W. D.; Misulis, K. E.

    1984-01-01

    A rat hindlimb suspension model of simulated weightlessness was used to examine the physiological characteristics of skeletal muscle. The physiological sequelae of hindlimb suspension were compared to those of spinal cord section, denervation by sciatic nerve crush, and control. Muscle examined were the predominantly slow (Type 1) soleus (SOL) and the predominantly fast (Type 2) extensor digitorum longus (EDL). Two procedures which alter motor unit activity, hindlimb suspension and spinal cord section, produce changes in characteristics of skeletal muscles that are dependent upon fiber type. The SOL develops characteristics more representative of a fast muscle, including smaller Type 1 fiber proportion and higher AChE activity. The EDL, which is already predominantly fast, loses most of its few Type 1 fibers, thus also becoming faster. These data are in agreement with the studies in which rats experienced actual weightlessness.

  5. Effects of chronic administration of clenbuterol on contractile properties and calcium homeostasis in rat extensor digitorum longus muscle.

    PubMed

    Sirvent, Pascal; Douillard, Aymerick; Galbes, Olivier; Ramonatxo, Christelle; Py, Guillaume; Candau, Robin; Lacampagne, Alain

    2014-01-01

    Clenbuterol, a β2-agonist, induces skeletal muscle hypertrophy and a shift from slow-oxidative to fast-glycolytic muscle fiber type profile. However, the cellular mechanisms of the effects of chronic clenbuterol administration on skeletal muscle are not completely understood. As the intracellular Ca2+ concentration must be finely regulated in many cellular processes, the aim of this study was to investigate the effects of chronic clenbuterol treatment on force, fatigue, intracellular calcium (Ca2+) homeostasis and Ca2+-dependent proteolysis in fast-twitch skeletal muscles (the extensor digitorum longus, EDL, muscle), as they are more sensitive to clenbuterol-induced hypertrophy. Male Wistar rats were chronically treated with 4 mg.kg-1 clenbuterol or saline vehicle (controls) for 21 days. Confocal microscopy was used to evaluate sarcoplasmic reticulum Ca2+ load, Ca2+-transient amplitude and Ca2+ spark properties. EDL muscles from clenbuterol-treated animals displayed hypertrophy, a shift from slow to fast fiber type profile and increased absolute force, while the relative force remained unchanged and resistance to fatigue decreased compared to control muscles from rats treated with saline vehicle. Compared to control animals, clenbuterol treatment decreased Ca2+-transient amplitude, Ca2+ spark amplitude and frequency and the sarcoplasmic reticulum Ca2+ load was markedly reduced. Conversely, calpain activity was increased by clenbuterol chronic treatment. These results indicate that chronic treatment with clenbuterol impairs Ca2+ homeostasis and this could contribute to the remodeling and functional impairment of fast-twitch skeletal muscle.

  6. Gene Expression Profiling in Slow-Type Calf Soleus Muscle of 30 Days Space-Flown Mice.

    PubMed

    Gambara, Guido; Salanova, Michele; Ciciliot, Stefano; Furlan, Sandra; Gutsmann, Martina; Schiffl, Gudrun; Ungethuem, Ute; Volpe, Pompeo; Gunga, Hanns-Christian; Blottner, Dieter

    2017-01-01

    Microgravity exposure as well as chronic disuse are two main causes of skeletal muscle atrophy in animals and humans. The antigravity calf soleus is a reference postural muscle to investigate the mechanism of disuse-induced maladaptation and plasticity of human and rodent (rats or mice) skeletal musculature. Here, we report microgravity-induced global gene expression changes in space-flown mouse skeletal muscle and the identification of yet unknown disuse susceptible transcripts found in soleus (a mainly slow phenotype) but not in extensor digitorum longus (a mainly fast phenotype dorsiflexor as functional counterpart to soleus). Adult C57Bl/N6 male mice (n = 5) flew aboard a biosatellite for 30 days on orbit (BION-M1 mission, 2013), a sex and age-matched cohort were housed in standard vivarium cages (n = 5), or in a replicate flight habitat as ground control (n = 5). Next to disuse atrophy signs (reduced size and myofiber phenotype I to II type shift) as much as 680 differentially expressed genes were found in the space-flown soleus, and only 72 in extensor digitorum longus (only 24 genes in common) compared to ground controls. Altered expression of gene transcripts matched key biological processes (contractile machinery, calcium homeostasis, muscle development, cell metabolism, inflammatory and oxidative stress response). Some transcripts (Fzd9, Casq2, Kcnma1, Ppara, Myf6) were further validated by quantitative real-time PCR (qRT-PCR). Besides previous reports on other leg muscle types we put forth for the first time a complete set of microgravity susceptible gene transcripts in soleus of mice as promising new biomarkers or targets for optimization of physical countermeasures and rehabilitation protocols to overcome disuse atrophy conditions in different clinical settings, rehabilitation and spaceflight.

  7. Gene Expression Profiling in Slow-Type Calf Soleus Muscle of 30 Days Space-Flown Mice

    PubMed Central

    Gambara, Guido; Salanova, Michele; Ciciliot, Stefano; Furlan, Sandra; Gutsmann, Martina; Schiffl, Gudrun; Ungethuem, Ute; Volpe, Pompeo; Gunga, Hanns-Christian; Blottner, Dieter

    2017-01-01

    Microgravity exposure as well as chronic disuse are two main causes of skeletal muscle atrophy in animals and humans. The antigravity calf soleus is a reference postural muscle to investigate the mechanism of disuse-induced maladaptation and plasticity of human and rodent (rats or mice) skeletal musculature. Here, we report microgravity-induced global gene expression changes in space-flown mouse skeletal muscle and the identification of yet unknown disuse susceptible transcripts found in soleus (a mainly slow phenotype) but not in extensor digitorum longus (a mainly fast phenotype dorsiflexor as functional counterpart to soleus). Adult C57Bl/N6 male mice (n = 5) flew aboard a biosatellite for 30 days on orbit (BION-M1 mission, 2013), a sex and age-matched cohort were housed in standard vivarium cages (n = 5), or in a replicate flight habitat as ground control (n = 5). Next to disuse atrophy signs (reduced size and myofiber phenotype I to II type shift) as much as 680 differentially expressed genes were found in the space-flown soleus, and only 72 in extensor digitorum longus (only 24 genes in common) compared to ground controls. Altered expression of gene transcripts matched key biological processes (contractile machinery, calcium homeostasis, muscle development, cell metabolism, inflammatory and oxidative stress response). Some transcripts (Fzd9, Casq2, Kcnma1, Ppara, Myf6) were further validated by quantitative real-time PCR (qRT-PCR). Besides previous reports on other leg muscle types we put forth for the first time a complete set of microgravity susceptible gene transcripts in soleus of mice as promising new biomarkers or targets for optimization of physical countermeasures and rehabilitation protocols to overcome disuse atrophy conditions in different clinical settings, rehabilitation and spaceflight. PMID:28076365

  8. Alterations in intrinsic mitochondrial function with aging are fiber type-specific and do not explain differential atrophy between muscles.

    PubMed

    Picard, Martin; Ritchie, Darmyn; Thomas, Melissa M; Wright, Kathryn J; Hepple, Russell T

    2011-12-01

    To determine whether mitochondrial dysfunction is causally related to muscle atrophy with aging, we examined respiratory capacity, H(2) O(2) emission, and function of the mitochondrial permeability transition pore (mPTP) in permeabilized myofibers prepared from four rat muscles that span a range of fiber type and degree of age-related atrophy. Muscle atrophy with aging was greatest in fast-twitch gastrocnemius (Gas) muscle (-38%), intermediate in both the fast-twitch extensor digitorum longus (EDL) and slow-twitch soleus (Sol) muscles (-21%), and non-existent in adductor longus (AL) muscle (+47%). In contrast, indices of mitochondrial dysfunction did not correspond to this differential degree of atrophy. Specifically, despite higher protein expression for oxidative phosphorylation (oxphos) system in fast Gas and EDL, state III respiratory capacity per myofiber wet weight was unchanged with aging, whereas the slow Sol showed proportional decreases in oxphos protein, citrate synthase activity, and state III respiration. Free radical leak (H(2) O(2) emission per O(2) flux) under state III respiration was higher with aging in the fast Gas, whereas state II free radical leak was higher in the slow AL. Only the fast muscles had impaired mPTP function with aging, with lower mitochondrial calcium retention capacity in EDL and shorter time to mPTP opening in Gas and EDL. Collectively, our results underscore that the age-related changes in muscle mitochondrial function depend largely upon fiber type and are unrelated to the severity of muscle atrophy, suggesting that intrinsic changes in mitochondrial function are unlikely to be causally involved in aging muscle atrophy. © 2011 The Authors. Aging Cell © 2011 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

  9. Mitochondrial oxidative enzyme activity in individual fibre types in hypo- and hyperthyroid rat skeletal muscles.

    PubMed

    Johnson, M A; Turnbull, D M

    1984-04-01

    Quantitative cytochemical and biochemical techniques have been used in combination to study the response of mitochondrial oxidative enzymes in individual muscle fibre types to hypo- and hyperthyroidism. Hypothyroidism resulted in decreased activity of succinate dehydrogenase (SDH), L-glycerol-3-phosphate dehydrogenase (L-GPDH), and D-3-hydroxybutyrate dehydrogenase (D-HBDH) in all fibre types of both slow-twitch soleus and fast-twitch extensor digitorum longus (e.d.l.) muscles. In hyperthyroidism, only L-GPDH activity increased in e.d.l. but more marked increases were seen in soleus muscles, which also showed increased SDH activity. In addition to these alterations in the enzyme activity in individual fibre types the metabolic profile of the muscle is further modified by the hormone-induced interconversion of slow- to fast-twitch fibres and vice versa.

  10. Reconstruction of closed rupture of thumb flexor tendon pulleys with a single free palmaris longus tendon graft: a case report and review of literature.

    PubMed

    Fazilleau, F; Cheval, D; Richou, J; Le Nen, D

    2014-02-01

    Closed rupture of thumb flexor tendon pulleys is extremely rare. Several techniques have already been described for finger pulley reconstruction. Various techniques based on prior anatomic and biomedical studies have been proposed for thumb pulley reconstruction, in which one or two of the three pulleys are replaced. In the present study, we describe an original technique using a single, free palmaris longus (PL) autograft for thumb pulley reconstruction. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  11. Palmaris Longus Muscle's Prevalence in Different Nations and Interesting Anatomical Variations: Review of the Literature.

    PubMed

    Ioannis, Dimitriou; Anastasios, Katsourakis; Konstantinos, Natsis; Lazaros, Kostretzis; Georgios, Noussios

    2015-11-01

    The prevalence of the palmaris longus (PL) muscle varies more than any other muscle in the human body. Its absence across the world ranges between 1.5% and 63.9%. It presents with many different anomalies, discovered either clinically, intraoperatively or after anatomical examination of cadavers. This paper includes recent studies and reports about the presence and variations of the PL muscle, thereby illustrating the differences between ethnic groups, as well as emphasizing the different ways of finding it, during daily clinical and surgical practice.

  12. Effects of lng Mutations on LngA Expression, Processing, and CS21 Assembly in Enterotoxigenic Escherichia coli E9034A

    PubMed Central

    Saldaña-Ahuactzi, Zeus; Rodea, Gerardo E.; Cruz-Córdova, Ariadnna; Rodríguez-Ramírez, Viridiana; Espinosa-Mazariego, Karina; González-Montalvo, Martín A.; Ochoa, Sara A.; González-Pedrajo, Bertha; Eslava-Campos, Carlos A.; López-Villegas, Edgar O.; Hernández-Castro, Rigoberto; Arellano-Galindo, José; Patiño-López, Genaro; Xicohtencatl-Cortes, Juan

    2016-01-01

    Enterotoxigenic Escherichia coli (ETEC) is a major cause of morbidity in children under 5 years of age in low- and middle-income countries and a leading cause of traveler's diarrhea worldwide. The ability of ETEC to colonize the intestinal epithelium is mediated by fimbrial adhesins, such as CS21 (Longus). This adhesin is a type IVb pilus involved in adherence to intestinal cells in vitro and bacterial self-aggregation. Fourteen open reading frames have been proposed to be involved in CS21 assembly, hitherto only the lngA and lngB genes, coding for the major (LngA) and minor (LngB) structural subunit, have been characterized. In this study, we investigated the role of the LngA, LngB, LngC, LngD, LngH, and LngP proteins in the assembly of CS21 in ETEC strain E9034A. The deletion of the lngA, lngB, lngC, lngD, lngH, or lngP genes, abolished CS21 assembly in ETEC strain E9034A and the adherence to HT-29 cells was reduced 90%, compared to wild-type strain. Subcellular localization prediction of CS21 proteins was similar to other well-known type IV pili homologs. We showed that LngP is the prepilin peptidase of LngA, and that ETEC strain E9034A has another peptidase capable of processing LngA, although with less efficiency. Additionally, we present immuno-electron microscopy images to show that the LngB protein could be localized at the tip of CS21. In conclusion, our results demonstrate that the LngA, LngB, LngC, LngD, LngH, and LngP proteins are essential for CS21 assembly, as well as for bacterial aggregation and adherence to HT-29 cells. PMID:27536289

  13. Eversion Strength and Surface Electromyography Measures With and Without Chronic Ankle Instability Measured in 2 Positions.

    PubMed

    Donnelly, Lindsy; Donovan, Luke; Hart, Joseph M; Hertel, Jay

    2017-07-01

    Individuals with chronic ankle instability (CAI) have demonstrated strength deficits compared to healthy controls; however, the influence of ankle position on force measures and surface electromyography (sEMG) activation of the peroneus longus and brevis has not been investigated. The purpose of this study was to compare sEMG amplitudes of the peroneus longus and brevis and eversion force measures in 2 testing positions, neutral and plantarflexion, in groups with and without CAI. Twenty-eight adults (19 females, 9 males) with CAI and 28 healthy controls (19 females, 9 males) participated. Hand-held dynamometer force measures were assessed during isometric eversion contractions in 2 testing positions (neutral, plantarflexion) while surface sEMG amplitudes of the peroneal muscles were recorded. Force measures were normalized to body mass, and sEMG amplitudes were normalized to a resting period. The group with CAI demonstrated less force when compared to the control group ( P < .001) in both the neutral and plantarflexion positions: neutral position, CAI: 1.64 Nm/kg and control: 2.10 Nm/kg) and plantarflexion position, CAI: 1.40 Nm/kg and control: 1.73 Nm/kg). There were no differences in sEMG amplitudes between the groups or muscles ( P > .05). Force measures correlated with both muscles' sEMG amplitudes in the healthy group (neutral peroneus longus: r = 0.42, P = .03; plantarflexion peroneus longus: r = 0.56, P = .002; neutral peroneus brevis: r = 0.38, P = .05; plantarflexion peroneus longus: r = 0.40, P = .04), but not in the group with CAI ( P > .05). The group with CAI generated less force when compared to the control group during both testing positions. There was no selective activation of the peroneal muscles with testing in both positions, and force output and sEMG activity was only related in the healthy group. Clinicians should assess eversion strength and implement strength training exercises in different sagittal plane positions and evaluate for other pathologies that may contribute to reduced eversion strength in patients with CAI. Level III, cross-sectional.

  14. [Reconstruction of chronic Achilles tendon rupture with flexor hallucis longus tendon harvested using a minimally invasive technique].

    PubMed

    Miao, Xudong; Wu, Yongping; Tao, Huimin; Yang, Disheng

    2011-07-01

    To evaluate the effectiveness of flexor hallucis longus tendon harvested using a minimally invasive technique in reconstruction of chronic Achilles tendon rupture. Between July 2006 and December 2009, 22 patients (22 feet) with chronic Achilles tendon rupture were treated, including 16 males and 6 females with a median age of 48 years (range, 28-65 years). The disease duration was 27-1,025 days (median, 51 days). Twenty-one patients had hooflike movement's history and 1 patient had no obvious inducement. The result of Thompson test was positive in 22 cases. The score was 53.04 +/- 6.75 according to American Orthopedic Foot and Ankle Society (AOFAS) ankle and hindfoot score system. MRI indicated that the gap of the chronic Achilles tendon rupture was 4.2-8.0 cm. A 3 cm-long incision was made vertically in the plantar aspect of the midfoot and a 1 cm-long transverse incision was made in a plantar flexor crease at the base of the great toe to harvest flexor hallucis longus tendon. The flexor hallucis longus tendon was 10.5-13.5 cm longer from tuber calcanei to the end of the Achilles tendon, and then the tendon was fixed to the tuber calcanei using interface screws or anchor nail after they were woven to form reflexed 3-bundle and sutured. Wound healed by first intention in all patients and no early complication occurred. Twenty-two patients were followed up 12-42 months (mean, 16.7 months). At 12 months after operation, The AOFAS ankle and hindfoot score was 92.98 +/- 5.72, showing significant difference when compared with that before operation (t= -40.903, P=0.000). The results were excellent in 18 cases, good in 2 cases, and fair in 2 cases with an excellent and good rate of 90.9%. No sural nerve injury, posterior tibial nerve injury, plantar painful scar, medial plantar nerve injury, and lateral plantar nerve injury occurred. Chronic Achilles tendon rupture reconstruction with flexor hallucis longus tendon harvested using a minimally invasive technique offers a desirable outcome in operative recovery, tendon fixation, and complications.

  15. Arthroscopic procedures and therapeutic results of anatomical reconstruction of the coracoclavicular ligaments for acromioclavicular Joint dislocation.

    PubMed

    Takase, K; Yamamoto, K

    2016-09-01

    Surgical treatment is recommended for type 5 acromioclavicular joint dislocation on Rockwood's classification. We believe that anatomic repair of the coracoclavicular ligaments best restores the function of the acromioclavicular joint. We attempted to correctly reconstruct the anatomy of the coracoclavicular ligaments under arthroscopy, and describe the minimally invasive arthroscopic procedure. There were 22 patients; mean age at surgery, 38.1 years. Mean time to surgery was 13.2 days. Mean follow-up was 3 years 2 months. The palmaris longus tendon was excised from the ipsilateral side to replace the conoid ligament, while artificial ligament was used for reconstructing the trapezoid ligament. Both ligament reconstructions were performed arthroscopically. No temporary fixation of the acromioclavicular joint was performed. On postoperative radiographic evaluation, 4 patients showed subluxation and 2 showed dislocation of the acromioclavicular joint; the other 16 patients had maintained reduction at the final consultation. MR images 1year after surgery clearly revealed the reconstructed ligaments in 19 patients. Only 1 patient showed osteoarthritis of the acromioclavicular joint. Although it requires resection of the ipsilateral palmaris longus for grafting, we believe that anatomic reconstruction of both coracoclavicular ligaments best restores the function of the acromioclavicular joint. 4. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. Thumb postures and physical loads during mobile phone use - a comparison of young adults with and without musculoskeletal symptoms.

    PubMed

    Gustafsson, Ewa; Johnson, Peter W; Hagberg, Mats

    2010-02-01

    The aim of this study was to evaluate thumb postures, thumb movements and muscle activity when using mobile phones for SMS messaging and to determine whether there were differences in these exposures (a) across various mobile phone tasks, (b) between gender and (c) between subjects with and without musculoskeletal symptoms in shoulders and upper extremities. Fifty-six young adults (15 healthy and 41 with musculoskeletal symptoms) performed a series of distinct tasks on a mobile phone. Muscular load in four forearm/hand muscles in the right arm and the right and left trapezius muscles were measured using electromyography (EMG). Thumb movements were registered using an electrogoniometer. The results showed that postures (sitting or standing) and the type of mobile phone task (holding the phone versus texting) affected muscle activity and thumb positions. Females compared to males had higher muscle activity in the extensor digitorum and the abductor pollicis longus when entering SMS messages and tended to have greater thumb abduction, higher thumb movement velocities and fewer pauses in the thumb movements. Subjects with symptoms had lower muscle activity levels in the abductor pollicis longus and tended to have higher thumb movement velocities and fewer pauses in the thumb movements compared to those without symptoms.

  17. Cuboid oedema due to peroneus longus tendinopathy: a report of four cases.

    PubMed

    O'Donnell, Paul; Saifuddin, Asif

    2005-07-01

    To highlight focal bone abnormality in the cuboid due to tendinopathy of the adjacent peroneus longus. A retrospective review was carried out of the relevant clinical and imaging features. Two male and two female patients were studied, mean age 51.5 years (range 32-67 years), referred with foot pain and imaging showing an abnormal cuboid thought to represent either tumour or infection. A long history of foot pain was usual with a maximum of 8 years. Radiographs were normal in two cases and showed erosion in two, one of which exhibited periosteal new bone formation affecting the cuboid. Bone scintigraphy was undertaken in two patients, both of whom showed increased uptake of isotope. MRI, performed in all patients, showed oedema in the cuboid adjacent to the peroneus longus tendon. The tendon and/or paratendinous tissues were abnormal in all cases, but no tendon discontinuity was identified. One patient possessed an os peroneum. Unequivocal evidence of bone erosion was seen using MRI in three patients, but with greater clarity in two cases using CT. Additional findings of tenosynovitis of tibialis posterior, oedema in the adjacent medial malleolus and synovitis of multiple joints in the foot were seen in one patient. Imaging diagnosis was made in all cases avoiding bone biopsy, but surgical exploration of the peroneal tendons was performed in two cases and biopsy of ankle synovium in one. Oedema with erosion of the cuboid bone, simulating a bone lesion (cuboid "pseudotumour"), may be caused by adjacent tendinopathy of peroneus longus. It is vital to be aware of this entity to avoid unnecessary biopsy of the cuboid.

  18. Proteomic analysis reveals the distinct energy and protein metabolism characteristics involved in myofiber type conversion and resistance of atrophy in the extensor digitorum longus muscle of hibernating Daurian ground squirrels.

    PubMed

    Chang, Hui; Jiang, Shanfeng; Ma, Xiufeng; Peng, Xin; Zhang, Jie; Wang, Zhe; Xu, Shenhui; Wang, Huiping; Gao, Yunfang

    2018-06-01

    Previous hibernation studies demonstrated that such a natural model of skeletal muscle disuse causes limited muscle atrophy and a significant fast-to-slow fiber type shift. However, the underlying mechanism as defined in a large-scale analysis remains unclarified. Isobaric tags for relative and absolute quantification (iTRAQ) based quantitative analysis were used to examine proteomic changes in the fast extensor digitorum longus muscles (EDL) of Daurian ground squirrels (Spermophilus dauricus). Although the wet weights and fiber cross-sectional area of the EDL muscle showed no significant decrease, the percentage of slow type fiber was 61% greater (P < 0.01) in the hibernation group. Proteomics analysis identified 264 proteins that were significantly changed (ratio < 0.83 or >1.2-fold and P < 0.05) in the hibernation group, of which 23 proteins were categorized into energy production and conversion and translation and 22 proteins were categorized into ribosomal structure and biogenesis. Along with the validation by western blot, MAPKAP kinase 2, ATP5D, ACADSB, calcineurin, CSTB and EIF2S were up-regulated in the hibernation group, whereas PDK4, COX II and EIF3C were down-regulated in the hibernation group. MAPKAP kinase 2 and PDK4 were associated with glycolysis, COX II and ATP5D were associated with oxidative phosphorylation, ACADSB was associated with fatty acid metabolism, calcineurin and CSTB were associated with catabolism, and EIF2S and EIF3C were associated with anabolism. Moreover, the total proteolysis rate of EDL in the hibernation group was significantly inhibited compared with that in the pre-hibernation group. These distinct energy and protein metabolism characteristics may be involved in myofiber type conversion and resistance to atrophy in the EDL of hibernating Daurian ground squirrels. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Surgical treatment for partial rupture of the distal biceps tendon using palmaris longus tendon graft: A case report.

    PubMed

    Ozasa, Yasuhiro; Wada, Takuro; Iba, Kousuke; Yamashita, Toshihiko

    2018-03-08

    We report a case of a partial rupture of the distal biceps tendon that was surgically treated using a palmaris longus tendon graft. A 58-year-old man complained of increasing pain with resisted elbow flexion and supination in the antecubital fossa. Magnetic resonance imaging revealed the irregularity of a distal attachment of the biceps brachii and peripheral signal changes. We diagnosed a partial rupture of the distal biceps tendon. Because conservative treatment failed, surgical treatment was performed through a single anterior approach. The insertion of the tendon was partially ruptured at the radial tuberosity. After the involved site was debrided, the palmaris longus tendon was grafted with suture anchors to reinforce the remaining tendon. Postoperative immobilization was not performed, and all moves were freed after 3 weeks. At the 6-year postoperative follow-up, the patient no longer experienced pain and returned to his original job without any limitations. Copyright © 2018 Turkish Association of Orthopaedics and Traumatology. Production and hosting by Elsevier B.V. All rights reserved.

  20. The influence in airforce soldiers through wearing certain types of army-issue footwear on muscle activity in the lower extremities.

    PubMed

    Schulze, Christoph; Lindner, Tobias; Schulz, Katharina; Finze, Susanne; Kundt, Guenther; Mittelmeier, Wolfram; Bader, Rainer

    2011-01-01

    The objective of the study was to analyse the influence of the shape and material of the military footwear worn by soldiers on muscle activity in the lower extremities, and whether such footwear could explain specific strain complaints and traumatic lesions in the region of the lower extremities.37 soldiers (one woman, 36 men) aged between 20 and 53 years underwent a dynamic electromyography (EMG) analysis. Wearing - one pair at a time - five different types of shoes, the subjects were asked to walk on a treadmill, where an EMG of the following muscles was taken: M. tibialis anterior, M. gastrocnemius mediales, M. gastrocnemius laterales, M. peroneus longus and M. rectus femoris.When the subjects wore old-fashioned outdoor jogging shoes increased muscle activity was observed in the region of the M. peroneus longus. This can be interpreted as a sign of the upper ankle joint requiring increased support and thus explain the higher susceptibility to sprains experienced in connection with these shoes. When the subjects wore combat boots, increased activity was observed in the region of the Mm. tibialis anterior and rectus femoris. The specific activity differences that were observed in particular muscles may have influence in the occurrence of certain disorders, especially in untrained recruits. This can be linked to various strain-related disorders such as shin splints and patellofemoral pain. The data obtained using EMG can provide information about the likelihood of a clustering of the complaints experienced by soldiers during training or active service.

  1. The Influence in Airforce Soldiers Through Wearing Certain Types of Army-Issue Footwear on Muscle Activity in the Lower Extremities

    PubMed Central

    Schulze, Christoph; Lindner, Tobias; Schulz, Katharina; Finze, Susanne; Kundt, Guenther; Mittelmeier, Wolfram; Bader, Rainer

    2011-01-01

    The objective of the study was to analyse the influence of the shape and material of the military footwear worn by soldiers on muscle activity in the lower extremities, and whether such footwear could explain specific strain complaints and traumatic lesions in the region of the lower extremities. 37 soldiers (one woman, 36 men) aged between 20 and 53 years underwent a dynamic electromyography (EMG) analysis. Wearing – one pair at a time - five different types of shoes, the subjects were asked to walk on a treadmill, where an EMG of the following muscles was taken: M. tibialis anterior, M. gastrocnemius mediales, M. gastrocnemius laterales, M. peroneus longus and M. rectus femoris. When the subjects wore old-fashioned outdoor jogging shoes increased muscle activity was observed in the region of the M. peroneus longus. This can be interpreted as a sign of the upper ankle joint requiring increased support and thus explain the higher susceptibility to sprains experienced in connection with these shoes. When the subjects wore combat boots, increased activity was observed in the region of the Mm. tibialis anterior and rectus femoris. The specific activity differences that were observed in particular muscles may have influence in the occurrence of certain disorders, especially in untrained recruits. This can be linked to various strain-related disorders such as shin splints and patellofemoral pain. The data obtained using EMG can provide information about the likelihood of a clustering of the complaints experienced by soldiers during training or active service. PMID:21886685

  2. Contribution of flexor pollicis longus to pinch strength: an in vivo study.

    PubMed

    Goetz, Thomas J; Costa, Joseph A; Slobogean, Gerard; Patel, Satyam; Mulpuri, Kishore; Travlos, Andrew

    2012-11-01

    To estimate the contribution of the flexor pollicis longus (FPL) to key pinch strength. Secondary outcomes include tip pinch, 3-point chuck pinch, and grip strength. Eleven healthy volunteers consented to participate in the study. We recorded baseline measures for key, 3-point chuck, and tip pinch and for grip strength. In order to control for instability of the interphalangeal (IP) joint after FPL paralysis, pinch measurements were repeated after immobilizing the thumb IP joint. Measures were repeated after subjects underwent electromyography-guided lidocaine blockade of the FPL muscle. Nerve conduction studies and clinical examinations were used to confirm FPL blockade and to rule out median nerve blockade. Paired t-tests were used to compare pre- and postblock means for both unsplinted and splinted measures. The difference in means was used to estimate the contribution of FPL to pinch strength. All 3 types of pinch strength showed a significant decrease between pre- and postblock measurements. The relative contribution of FPL for each pinch type was 56%, 44%, and 43% for key, chuck, and tip pinch, respectively. Mean grip strength did not decrease significantly. Splinting of the IP joint had no significant effect on pinch measurements. FPL paralysis resulted in a statistically significant decrease in pinch strength. IP joint immobilization to simulate IP joint fusion did not affect results. Reconstruction after acute or chronic loss of FPL function should be considered when restoration of pinch strength is important. Copyright © 2012 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  3. Endoscopic-assisted Repair of Neglected Rupture or Rerupture After Primary Repair of Extensor Hallucis Longus Tendon.

    PubMed

    Lui, Tun Hing; Chang, Joseph Jeremy; Maffulli, Nicola

    2016-03-01

    Rerupture of the extensor hallucis longus tendon after primary repair and neglected rupture of the tendon poses surgical challenges to orthopedic surgeons. Open exploration and repair of the tendon ends usually requires large incision and extensive dissection. This may induce scarring and adhesion around the repaired tendon. Endoscopic-assisted repair has the advantage of minimally invasive surgery including less soft tissue trauma and scar formation and better cosmetic result. The use of Krackow locking suture and preservation of the extensor retinacula allow early mobilization of the great toe.

  4. Physiological comparison of rat muscle in body suspension and weightlessness

    NASA Technical Reports Server (NTRS)

    Musacchia, X. J.; Steffen, J. M.; Fell, R. D.; Dombrovski, J.

    1987-01-01

    Hind limb unloading is achieved with whole body suspension (WBS) and with tail suspension (TS). Comparable levels of muscle mass loss and decreases in protein levels result during one to three weeks of exposure to microgravity (microG), WBS, and TS. Losses are most apparent in soleus (S), intermediate in gastrocnemius (G) and least in extensor digigorum longus (EDL). Comparison of S and EDL type I and II fiber changes (numbers and area) after seven days of microG flight and WBS showed, in S, an increase in Type I and Type II fiber density and a decrease in area. Except for a decrease in Type I fiber density in EDL, all other parameters remained comparable. The general conclusions were that the S under microG and WBS responds in a similar manner. The EDL, for the most part, shows little change under both conditions.

  5. Test-retest reliability of sudden ankle inversion measurements in subjects with healthy ankle joints.

    PubMed

    Eechaute, Christophe; Vaes, Peter; Duquet, William; Van Gheluwe, Bart

    2007-01-01

    Sudden ankle inversion tests have been used to investigate whether the onset of peroneal muscle activity is delayed in patients with chronically unstable ankle joints. Before interpreting test results of latency times in patients with chronic ankle instability and healthy subjects, the reliability of these measures must be first demonstrated. To investigate the test-retest reliability of variables measured during a sudden ankle inversion movement in standing subjects with healthy ankle joints. Validation study. Research laboratory. 15 subjects with healthy ankle joints (30 ankles). Subjects stood on an ankle inversion platform with both feet tightly fixed to independently moveable trapdoors. An unexpected sudden ankle inversion of 50 degrees was imposed. We measured latency and motor response times and electromechanical delay of the peroneus longus muscle, along with the time and angular position of the first and second decelerating moments, the mean and maximum inversion speed, and the total inversion time. Correlation coefficients and standard error of measurements were calculated. Intraclass correlation coefficients ranged from 0.17 for the electromechanical delay of the peroneus longus muscle (standard error of measurement = 2.7 milliseconds) to 0.89 for the maximum inversion speed (standard error of measurement = 34.8 milliseconds). The reliability of the latency and motor response times of the peroneus longus muscle, the time of the first and second decelerating moments, and the mean and maximum inversion speed was acceptable in subjects with healthy ankle joints and supports the investigation of the reliability of these measures in subjects with chronic ankle instability. The lower reliability of the electromechanical delay of the peroneus longus muscle and the angular positions of both decelerating moments calls the use of these variables into question.

  6. Transposition of branches of radial nerve innervating supinator to posterior interosseous nerve for functional reconstruction of finger and thumb extension in 4 patients with middle and lower trunk root avulsion injuries of brachial plexus.

    PubMed

    Wu, Xia; Cong, Xiao-Bing; Huang, Qi-Shun; Ai, Fang-Xin; Liu, Yu-Tian; Lu, Xiao-Cheng; Li, Jin; Weng, Yu-Xiong; Chen, Zhen-Bing

    2017-12-01

    This study aimed to investigate the reconstruction of the thumb and finger extension function in patients with middle and lower trunk root avulsion injuries of the brachial plexus. From April 2010 to January 2015, we enrolled in this study 4 patients diagnosed with middle and lower trunk root avulsion injuries of the brachial plexus via imaging tests, electrophysiological examinations, and clinical confirmation. Muscular branches of the radial nerve, which innervate the supinator in the forearm, were transposed to the posterior interosseous nerve to reconstruct the thumb and finger extension function. Electrophysiological findings and muscle strength of the extensor pollicis longus and extensor digitorum communis, as well as the distance between the thumb tip and index finger tip, were monitored. All patients were followed up for 24 to 30 months, with an average of 27.5 months. Motor unit potentials (MUP) of the extensor digitorum communis appeared at an average of 3.8 months, while MUP of the extensor pollicis longus appeared at an average of 7 months. Compound muscle action potential (CMAP) appeared at an average of 9 months in the extensor digitorum communis, and 12 months in the extensor pollicis longus. Furthermore, the muscle strength of the extensor pollicis longus and extensor digitorum communis both reached grade III at 21 months. Lastly, the average distance between the thumb tip and index finger tip was 8.8 cm at 21 months. In conclusion, for patients with middle and lower trunk injuries of the brachial plexus, transposition of the muscular branches of the radial nerve innervating the supinator to the posterior interosseous nerve for the reconstruction of thumb and finger extension function is practicable and feasible.

  7. Late extensor pollicis longus rupture following plate fixation in Galeazzi fracture dislocation

    PubMed Central

    Sabat, Dhananjaya; Dabas, Vineet; Dhal, Anil

    2014-01-01

    Late rupture of extensor pollicis longus (EPL) tendon after Galeazzi fracture dislocation fixation is an unknown entity though it is a well-established complication following distal radius fractures. We report the case of a 55-year old male who presented with late EPL tendon rupture 4 months following internal fixation of Galeazzi fracture dislocation with a Locking Compression Plate (LCP). He was managed with extensor indicis proprius (EIP) transfer to restore thumb extension. At 4 years followup, functional result of the transfer was good. We identify possible pitfalls with this particular patient and discuss how to avoid them in future. PMID:25143650

  8. [Musculature of the pelvic limb of the American weasel (Mustela nigripes, Audubon and Bachman)].

    PubMed

    Bisaillon, A

    1976-01-01

    The origins and insertions of the muscles of the pelvic limb of the black-footed ferret (Mustela nigripes) are illustrated and described. The results based on the dissection of two adult specimens are compared with those of other investigations on the myology of the Mustelids. The musculature of the pelvic limb of Mustela nigripes is substantially similar to that of other Mustelids investigated except for slight differences of individual muscles. The most obvious differences involve the tendons of the mm. fibularis longus, fibularis brevis and extensor digitalis lateralis. The tendon of the m. fibularis longus contains a small sesamoid bone.

  9. Effects of balance training by knee joint motions on muscle activity in adult men with functional ankle instability.

    PubMed

    Nam, Seung-Min; Kim, Won-Bok; Yun, Chang-Kyo

    2016-05-01

    [Purpose] This study examined the effects of balance training by applying knee joint movements on muscle activity in male adults with functional ankle instability. [Subjects and Methods] 28 adults with functional ankle instability, divided randomly into an experimental group, which performed balance training by applying knee joint movements for 20 minutes and ankle joint exercises for 10 minutes, and a control group, which performed ankle joint exercise for 30 minutes. Exercises were completed three times a week for 8 weeks. Electromyographic values of the tibialis anterior, peroneus longus, peroneus brevis, and the lateral gastrocnemius muscles were obtained to compare and analyze muscle activity before and after the experiments in each group. [Results] The experimental group had significant increases in muscle activity in the tibialis anterior, peroneus longus, and lateral gastrocnemius muscles, while muscle activity in the peroneus brevis increased without significance. The control group had significant increases in muscle activity in the tibialis anterior and peroneus longus, while muscle activity in the peroneus brevis and lateral gastrocnemius muscles increased without significance. [Conclusion] In conclusion, balance training by applying knee joint movements can be recommended as a treatment method for patients with functional ankle instability.

  10. Longitudinal changes in ventral and dorsal neck muscle layers during loading against gravity in healthy volunteers using speckle tracking.

    PubMed

    Peolsson, Anneli; Peolsson, Michael

    2014-05-01

    This study aimed to describe and compare the longitudinal mechanical activity, deformation, and deformation rate of the different layers of dorsal and ventral neck muscles in healthy volunteers during head lifts against gravity. The cross-sectional study included 19 healthy volunteers (mean age, 28 years; SD, 7 years). Ultrasound with speckle-tracking analysis was used to investigate longitudinal mechanical activation, deformation, and deformation rate of dorsal and ventral neck muscles in real time during a head lift. Significance levels were set as P = .025 or P = .0125, depending on the number of comparisons. The dorsal neck muscles did not significantly differ in deformation (P > .04); however, the multifidus had a higher deformation rate than all other dorsal muscles (P < .003). The sternocleidomastoid had significantly higher deformation than the longus capitis (P = .005) and colli (P = .001) but a lower deformation rate than the longus colli (P = .02). The sternocleidomastoid deformed more than the deeper muscles, but it did significantly slower than the longus colli. Among the dorsal muscles, the deepest (the multifidus) had the highest deformation rate. Copyright © 2014 National University of Health Sciences. Published by Mosby, Inc. All rights reserved.

  11. "Superior cleft sign" as a marker of rectus abdominus/adductor longus tear in patients with suspected sportsman's hernia.

    PubMed

    Murphy, Grainne; Foran, Paul; Murphy, Darra; Tobin, Oliver; Moynagh, Michael; Eustace, Stephen

    2013-06-01

    We describe a new imaging sign, the "superior cleft sign", identified at both symphysography and MRI, which should be used as a marker of rectus abdominis/adductor longus attachment tearing. A study population of 25 patients presenting with clinically suspected sportsman's hernia, who had undergone both symphysography and MRI of the groin were included for study. In each case, images were reviewed to determine the presence of a superior cleft, secondary cleft, and or both abnormalities. Images of all patients complaining of groin crease discomfort similar to sportsman's hernia revealed the presence of a superior cleft at the rectus abdominis/adductor longus attachment. This "superior cleft sign" correlated with the side of symptoms in each case, and, in contrast to the previously described secondary cleft along the inferior margin of the inferior pubic ramus, occurred parallel to the inferior margin of the superior pubic ramus. The presence of the "superior cleft sign" should be sought in addition to the previously described secondary cleft sign in sportspeople presenting with exercise-related groin pain or pubalgia. It should specifically be sought in patients referred with suspected sportsman's hernia.

  12. Anatomic relationship of the proximal nail matrix to the extensor hallucis longus tendon insertion.

    PubMed

    Palomo López, P; Becerro de Bengoa Vallejo, R; López López, D; Prados Frutos, J C; Alfonso Murillo González, J; Losa Iglesias, M E

    2015-10-01

    The purpose of this study was to delineate the relationship of the terminal extensor hallucis longus tendon insertion to the proximal limit of the nail matrix of the great toe. Fifty fresh-frozen human cadaver great toes with no evidence of trauma (average age, 62.5 years; 29 males and 21 females) were used for this study. Under 25X magnification, the proximal limit of the nail matrix and the terminal bony insertion of the extensor hallucis longus tendons were identified. The distance from the terminal tendon insertion to the nail matrix was ascertained using precision calipers, an optical microscope, and autocad(®) software for windows. Twenty-five great toes were placed in a neutral formalin solution and further analysed by histological longitudinal-sections. The specimens were stained with haematoxylin and eosin and examined microscopically to determine the presence of the extensor hallucis longus tendon along the dorsal aspect of the distal phalanx of each great toe. The main result we found in great toes was that the extensor tendon is between the matrix and the phalanx and extends dorsally to the distal aspect of the distal phalanx in all, 100%, specimens. The nail matrix of the great toe is not attached to the periosteum of the dorsal aspect of the base of the distal phalanx as is the case for fingers, because the extensor hallucis tendon is plantar or directly underneath the nail matrix and the tendon is dorsal to the bone. We have found that the extensor tendon is between the matrix and the phalanx and extends dorsally to the distal aspect of the distal phalanx. The nail matrix of the great toe is not attached to the periosteum of the dorsal aspect of the base of distal phalanx as is the case in fingers, because the extensor hallucis tendon is plantar or directly underneath the nail matrix and the tendon is dorsal to the bone. Our anatomic study demonstrates that the proximal limit of the matrix and nail bed of the human great toe are dorsal and overlapping the terminal extensor hallucis longus tendon until its distal bony insertion in all specimens. © 2015 European Academy of Dermatology and Venereology.

  13. Anatomical characteristics of the flexor digitorum accessorius longus muscle and their relevance to tarsal tunnel syndrome a systematic review.

    PubMed

    Deleu, Paul-André; Bevernage, Bernhard Devos; Birch, Ivan; Maldague, Pierre; Gombault, Vincent; Leemrijse, Thibaut

    2015-07-01

    Clinical and cadaver studies have reported that supernumerary muscles could be the etiology of a variety of pathologic disorders, such as posterior impingement syndrome, tarsal tunnel syndrome (TTS), and flexor hallucis longus tenosynovitis. We describe a unique variant of the flexor digitorum accessorius longus (FDAL) muscle as an apparent cause of TTS, functioning as an independent flexor of the second toe, which has not been described in the literature. In addition to this case report, a systematic review was performed of TTS caused by the FDAL muscle. A targeted search of PubMed, the Cochrane Library, the Cumulative Index to Nursing and Allied Health Literature, and Web of Science identified full-text papers that fulfilled the inclusion and exclusion criteria. Twenty-nine papers were identified for inclusion in the systematic review: 12 clinical papers of TTS caused by the FDAL muscle and 17 cadaver-based papers. Clinicians often do not include the FDAL muscle in the differential diagnosis of TTS. This literature review suggests that the FDAL is an important muscle in terms of its functional and clinical significance. Knowledge of this muscle, its anatomical location and variations, and its magnetic resonance imaging characteristics may help clinicians make an accurate differential diagnosis.

  14. Laparoscopic hernia repair with adductor tenotomy for athletic pubalgia: an established procedure for an obscure entity.

    PubMed

    Rossidis, Georgios; Perry, Andrew; Abbas, Husain; Motamarry, Isaac; Lux, Tamara; Farmer, Kevin; Moser, Michael; Clugston, Jay; Caban, Angel; Ben-David, Kfir

    2015-02-01

    Athletic pubalgia is a syndrome of chronic lower abdomen and groin pain that occurs in athletes. It is the direct result of stress and microtears of the rectus abdominis inserting on the pubis from the antagonizing adductor longus muscles, and weakness of the posterior transversalis fascia and bulging of the inguinal floor. Under IRB approval, we conducted a retrospective review of our prospectively competitive athlete patients with athletic pubalgia from 2007 to 2013. A cohort of 54 patients was examined. Mean age was 22.4 years. Most patients were football players (n = 23), triathlon (n = 11), track and field (n = 6), soccer players (n = 5), baseball players (n = 4), swimmers (n = 3), golfer (n = 1), and tennis player (n = 1). Fifty one were males and three were females. All patients failed medical therapy with physiotherapy prior to surgery. 76 % of patients had an MRI performed with 26 % having a right rectus abdominis stripping injury with concomitant strain at the adductor longus musculotendinous junction. 7 % of patients had mild nonspecific edema in the distal bilateral rectus abdominis muscles without evidence of a tear. Twenty patients had no findings on their preoperative MRI, and only one patient was noted to have an inguinal hernia on MRI. All patients underwent laparoscopic totally extraperitoneal inguinal hernia repair with synthetic mesh and ipsilateral adductor longus tenotomy. All patients were able to return to full sports-related activity in 24 days (range 21-28 days). One patient experienced urinary retention and another sustained an adductor brevis hematoma 3 months after completion of rehabilitation and surgical intervention. Mean follow up was 18 months. Athletic pubalgia is a disease with a multifactorial etiology that can be treated surgically by a laparoscopic totally extraperitoneal hernia repair with synthetic mesh accompanied with an ipsilateral adductor longus tenotomy allowing patients to return to sports-related activity early with minimal complications.

  15. Facilitation of Hoffmann reflexes of ankle muscles in prone but not standing positions by focal ankle-joint cooling.

    PubMed

    Kim, Kyung-Min; Ingersoll, Christopher D; Hertel, Jay

    2015-05-01

    Focal ankle-joint cooling (FAJC) has been shown to increase Hoffmann (H) reflex amplitudes of select leg muscles while subjects lie prone, but it is unknown whether the neurophysiological cooling effects persist in standing. To assess the effects of FAJC on H-reflexes of the soleus and fibularis longus during 3 body positions (prone, bipedal, and unipedal stances) in individuals with and without chronic ankle instability (CAI). Crossover. Laboratory. 15 young adults with CAI (9 male, 6 female) and 15 healthy controls. All subjects received both FAJC and sham treatments on separate days in a randomized order. FAJC was accomplished by applying a 1.5-L plastic bag filled with crushed ice to the ankle for 20 min. Sham treatment involved room-temperature candy corn. Maximum amplitudes of H-reflexes and motor (M) waves were recorded while subjects lay prone and then stood in quiet bipedal and unipedal stances before and immediately after each treatment. Primary outcome measures were H(max):M(max) ratios for the soleus and fibularis longus. Three-factor (group × treatment condition × time) repeated-measures ANOVAs and Fisher LSD tests were performed for statistical analyses. Significant interactions of treatment condition by time for prone H(max):M(max) ratios were found in the soleus (P = .001) and fibularis longus (P = .003). In both muscles, prone H(max):M(max) ratios moderately increased after FAJC but not after sham treatment. The CAI and healthy groups responded similarly to FAJC. In contrast, there were no significant interactions or main effects in the bipedal and unipedal stances in either muscle (P > .05). FAJC moderately increased H-reflex amplitudes of the soleus and fibularis longus while subjects were prone but not during bipedal or unipedal standing. These results were not different between groups with and without CAI.

  16. Chronic Ankle Instability and Neural Excitability of the Lower Extremity.

    PubMed

    McLeod, Michelle M; Gribble, Phillip A; Pietrosimone, Brian G

    2015-08-01

    Neuromuscular dysfunction of the leg and thigh musculature, including decreased strength and postural control, is common in patients with chronic ankle instability (CAI). Understanding how CAI affects specific neural pathways may provide valuable information for targeted therapies. To investigate differences in spinal reflexive and corticospinal excitability of the fibularis longus and vastus medialis between limbs in patients with unilateral CAI and between CAI patients and participants serving as healthy controls. Case-control study. Research laboratory. A total of 56 participants volunteered, and complete data for 21 CAI patients (9 men, 12 women; age = 20.81 ± 1.63 years, height = 171.57 ± 11.44 cm, mass = 68.84 ± 11.93 kg) and 24 healthy participants serving as controls (7 men, 17 women; age = 22.54 ± 2.92 years, height = 172.35 ± 10.85 cm, mass = 69.15 ± 12.30 kg) were included in the final analyses. Control participants were matched to CAI patients on sex, age, and limb dominance. We assigned "involved" limbs, which corresponded with the involved limbs of the CAI patients, to control participants. Spinal reflexive excitability was assessed via the Hoffmann reflex and normalized to a maximal muscle response. Corticospinal excitability was assessed using transcranial magnetic stimulation. Active motor threshold (AMT) was defined as the lowest transcranial magnetic stimulation intensity required to elicit motor-evoked potentials equal to or greater than 100 μV in 5 of 10 consecutive stimuli. We obtained motor-evoked potentials (MEPs) at percentages ranging from 100% to 140% of AMT. Fibularis longus MEP amplitudes were greater in control participants than in CAI patients bilaterally at 100% AMT (control involved limb: 0.023 ± 0.031; CAI involved limb: 0.014 ± 0.008; control uninvolved limb: 0.021 ± 0.022; CAI uninvolved limb: 0.015 ± 0.007; F1,41 = 4.551, P = .04) and 105% AMT (control involved limb: 0.029 ± 0.026; CAI involved limb: 0.021 ± 0.009; control uninvolved limb: 0.034 ± 0.037; CAI uninvolved limb: 0.023 ± 0.013; F1,35 = 4.782, P = .04). We observed no differences in fibularis longus MEP amplitudes greater than 110% AMT and no differences in vastus medialis corticospinal excitability (P > .05). We noted no differences in the Hoffmann reflex between groups for the vastus medialis (F1,37 = 0.103, P = .75) or the fibularis longus (F1,41 = 1.139, P = .29). Fibularis longus corticospinal excitability was greater in control participants than in CAI patients.

  17. Effect of NT-4 and BDNF delivery to damaged sciatic nerves on phenotypic recovery of fast and slow muscles fibres.

    PubMed

    Simon, Magda; Porter, Rebecca; Brown, Robert; Coulton, Gary R; Terenghi, Giorgio

    2003-11-01

    We investigated whether neurotrophin-4 (NT-4) and brain-derived neurotrophic factor (BDNF) affected the reinnervation of slow and fast motor units. Neurotrophin-impregnated or plain fibronectin (FN) conduits were inserted into a sciatic nerve gap. Fast extensor digitorum longus (EDL) and slow soleus muscles were collected 4 months postsurgery. Muscles were weighed and fibre type proportion and mean fibre diameters were derived from muscle cross-sections. All fibre types in muscles from FN animals were severely atrophied and this correlated well with type 1 fibre loss and atrophy in soleus and type 2b loss and atrophy in EDL. Treatment with NT-4 reversed soleus but not EDL mass loss above the FN group by significantly restoring type 1 muscle fibre proportion and diameters towards those of normal unoperated animals. BDNF did not increase muscle mass but did have minor effects on fibre type and diameter. Thus, NT-4 significantly improved slow motor unit recovery, and provides a basis for therapies intended to aid the functional recovery of muscles after denervating injury.

  18. Extension of the classical classification of β-turns

    PubMed Central

    de Brevern, Alexandre G.

    2016-01-01

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

  19. Extension of the classical classification of β-turns.

    PubMed

    de Brevern, Alexandre G

    2016-09-15

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

  20. Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

    PubMed

    Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

    2017-01-01

    The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  1. AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

    PubMed

    Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

    2007-08-01

    Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

  2. [Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

    PubMed

    Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

    1985-04-01

    Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

  3. Calcific retropharyngeal tendinitis. [Radiological findings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karasick, D.; Karasick, S.

    1981-12-01

    Calcific retropharyngeal tendinitis is an imflammation of the longus colli muscle tendon which is located on the anterior surface of the verterbral column extending from the atlas to the third thoracic vertebra. The acute inflammatory condition is selflimiting with symptoms consisting of a gradually increasing neck pain often associated with throat pain and difficulty swallowing. The pain is aggravated by head and neck movement. Clinically the condition can be confused with retropharyngeal absecess, meningitis, infectious spondylitis, and post-traumatic muscle spasm. The radiographic features of this condition consist of pre-vertebral soft tissue swelling from C1 to C4 and amorphous calcific densitymore » in the longus colli tendon anterior to the body of C2 and inferior to the anterior arch of C1.« less

  4. Step Cut Lengthening: A Technique for Treatment of Flexor Pollicis Longus Tendon Rupture.

    PubMed

    Chong, Chew-Wei; Chen, Shih-Heng

    2018-04-01

    Reconstruction of a tendon defect is a challenging task in hand surgery. Delayed repair of a ruptured flexor pollicis longus (FPL) tendon is often associated with tendon defect. Primary repair of the tendon is often not possible, particularly after debridement of the unhealthy segment of the tendon. As such, various surgical treatments have been described in the literature, including single-stage tendon grafting, 2-stage tendon grafting, flexor digitorum superficialis tendon transfer from ring finger, and interphalangeal joint arthrodesis. We describe step cut lengthening of FPL tendon for the reconstruction of FPL rupture. This is a single-stage reconstruction without the need for tendon grafting or tendon transfer. To our knowledge, no such technique has been previously described.

  5. Two new species of Pseudochristianella Campbell & Beveridge, 1990 (Cestoda: Trypanorhyncha) from elasmobranch fishes from the Gulf of California, Mexico.

    PubMed

    Campbell, R A; Beveridge, I

    2006-12-01

    Pseudochristionella elegantissima sp. nov. (Cestoda: Trypanorhyncha) is described from the spiral valves of the rays Dasyatis brevis (Garman, 1880) and D. longus (Garman, 1880), from the Gulf of California, Mexico. Also described is P. nudisculo sp. nov. from rays Rhinobatos productus Ayres, 1854, D. longus, Myliobatis longirostris Applegate & Fitch, 1964 and Zapteryx exasperat (Jordan & Gilbert, 1880) from the same location. The species are distinguished from one another and from the only existing species within the genus, P. southwelli Campbel & Beveridge, 1990, by differences in the arrangement of bill-hooks on the external surface of the basal swelling of the tentacle and by the number of hooks in each row of the metabasasl armature.

  6. [Neglected ipsilateral simultaneous ruptures of patellar and quadriceps tendon].

    PubMed

    Karahasanoğlu, İlker; Yoloğlu, Osman; Kerimoğlu, Servet; Turhan, Ahmet Uğur

    2015-01-01

    Neglected patellar and quadriceps tendon rupture is a rare injury, but ipsilateral simultaneous patellar and quadriceps tendon rupture was not described in the literature to our knowledge. In this article, we report a 40-year-old healthy male patient with neglected ipsilateral patellar and quadriceps tendon ruptures treated by peroneus longus tendon autograft. Patient had received some conservative and surgical treatments for patellar fracture before applying to our clinic. After our treatment using peroneus longus autograft and interference nails, patient was immobilized for six weeks in cylindrical cast. Flexion exercises and full weight bearing were started after cast removal. Patient had no complaint at postoperative second year. Patient was a neglected case. Surgical repair and early rehabilitation enabled us to achieve a satisfactory outcome.

  7. Sheep YAP1 temporal and spatial expression trend and its relation with MyHCs expression.

    PubMed

    Gao, W; Sun, W; Su, R; Lv, X Y; Wang, Q Z; Li, D; Musa, H H; Chen, L; Zhou, H; Xu, H S; Hua, W H

    2016-04-04

    RT-PCR was used to study the temporal and spatial pattern of Yes-associated protein 1 (YAP1) and myosin heavy chain (MyHC) expression in four different skeletal muscles (i.e., longissimus dorsi muscle, soleus muscle, gastrocnemius muscle, and extensor digitorum longus) and three growth stages (i.e., 2 days old, 2 and 6 months old) of Hu Sheep. The results showed that YAP1 was differentially expressed in skeletal muscles of sheep, that expression increased gradually with age, and that there were high levels of expression in the gastrocnemius muscle and lower levels in the longissimus dorsi muscle. MyHCI was expressed at high levels in the soleus muscle and at lower levels in the longissimus dorsi muscle. In contrast, MyHCIIA and MyHCIIX were expressed at high levels in the extensor digitorum longus and at lower levels in the soleus muscle. The expression of MyHCI and MyHCIIA decreased with increasing age while that of MyHCIIX increased. YAP1 expression was negatively correlated with MyHCII (P < 0.01) and positively correlated with MyHCIIX (P < 0.01) across all growth stages and skeletal muscle types studied. We speculate that after birth, the thicker muscle fiber diameter is associated with the high expression of MyHCIIX. Therefore, we conclude that YAP1 expression affects sheep muscle fiber development after birth and provides important genetic information for the selection candidate genes for sheep muscle growth.

  8. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

    PubMed

    Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

    2014-04-01

    The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

  9. Extending the use of the gracilis muscle flap in perineal reconstruction surgery.

    PubMed

    Goldie, Stephen J; Almasharqah, Riyadh; Fogg, Quentin A; Anderson, William

    2016-08-01

    Reconstruction of the perineum is required following oncological resections. Plastic surgical techniques can be used to restore the aesthetics and function of the perineum. The gracilis myocutaneous flap provides a substantial skin paddle, with minimal donor site morbidity. The flap is pedicled on a perforator from the medial circumflex femoral artery, giving it limited reach across the perineum. Tunnelling the flap under the adductor longus muscle may free up more of the arterial pedicle, increasing its reach. On three female cadavers, bilateral gracilis flaps were raised in the standard surgical manner, giving six flaps in total. With the flaps pedicled across the perineum, the distance from the tip of each flap was measured to the anterior superior iliac spine (ASIS). The flaps were then tunnelled under the adductor longus muscle. The distances to the ASIS were measured again. The average pedicle length was greater than 7 cm. Tunnelling the flap under the adductor longus muscle increased the reach by more than 4 cm on average. Cadaveric dissection has shown that tunnelling of the flap in a novel way increase its reach across the perineum. This additional flexibility improves its use clinically and is of benefit to plastic surgeons operating in perineal reconstruction. Copyright © 2016 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  10. [Secondary tendon reconstruction on the thumb].

    PubMed

    Bickert, B; Kremer, T; Kneser, U

    2016-12-01

    Closed tendon ruptures of the thumb that require secondary reconstruction can affect the extensor pollicis longus (EPL), extensor pollicis brevis (EPB) and flexor pollicis longus (FPL) tendons. Treatment of rupture of the EPB tendon consists of refixation to the bone and temporary transfixation of the joint. In the case of preexisting or posttraumatic arthrosis, definitive arthrodesis of the thumb is the best procedure. Closed ruptures of the EPL and FPL tendons at the wrist joint cannot be treated by direct tendon suture. Rupture of the EPL tendon occurs after distal radius fractures either due to protruding screws or following conservative treatment especially in undisplaced fractures. Transfer of the extensor indicis tendon to the distal EPL stump is a good option and free interposition of the palmaris longus tendon is a possible alternative. The tension should be adjusted to slight overcorrection, which can be checked intraoperatively by performing the tenodesis test. Closed FPL ruptures at the wrist typically occur 3-6 months after osteosynthesis of distal radius fractures with palmar plates and are mostly characterized by crepitation and pain lasting for several weeks. They can be prevented by premature plate removal, synovectomy and carpal tunnel release. For treatment of a ruptured FPL tendon in adult patients the options for tendon reconstruction should be weighed up against the less complicated tenodesis or arthrodesis of the thumb interphalangeal joint.

  11. Genetics Home Reference: familial porencephaly

    MedlinePlus

    ... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  12. A type IV burst associated with a coronal streamer disruption event

    NASA Technical Reports Server (NTRS)

    Kundu, M. R.

    1987-01-01

    A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

  13. Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

    MedlinePlus

    ... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

  14. viking: identification and characterization of a second type IV collagen in Drosophila.

    PubMed

    Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

    1997-10-01

    We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

  15. Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

    PubMed Central

    Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

    1994-01-01

    Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

  16. Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

    MedlinePlus

    ... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  17. Systemic Microgravity Response: Utilizing GeneLab to Develop Hypotheses for Spaceflight Risks

    NASA Technical Reports Server (NTRS)

    Beheshti, Afshin; Fogle, Homer; Galazka, Jonathan; Kidane, Yared; Chakravarty, Kaushik; Berrios, Daniel C.; Costes, Sylvain V.

    2017-01-01

    Biological risks associated with microgravity is a major concern for space travel. Although determination of risk has been a focus for NASA research, data examining systemic (i.e., multi- or pan-tissue) responses to space flight are sparse. The overall goal of our work is to identify potential master regulators responsible for such responses to microgravity conditions. To do this we utilized the NASA GeneLab database which contains a wide array of omics experiments, including data from: 1) different flight conditions (space shuttle (STS) missions vs. International Space Station (ISS); 2) different tissues; and 3) different types of assays that measure epigenetic, transcriptional, and protein expression changes. We have performed meta-analysis identifying potential master regulators involved with systemic responses to microgravity. The analysis used 7 different murine and rat data sets, examining the following tissues: liver, kidney, adrenal gland, thymus, mammary gland, skin, and skeletal muscle (soleus, extensor digitorum longus, tibialis anterior, quadriceps, and gastrocnemius). Using a systems biology approach, we were able to determine that p53 and immune related pathways appear central to pan-tissue microgravity responses. Evidence for a universal response in the form of consistency of change across tissues in regulatory pathways was observed in both STS and ISS experiments with varying durations; while degree of change in expression of these master regulators varied across species and strain, some change in these master regulators was universally observed. Interestingly, certain skeletal muscle (gastrocnemius and soleus) show an overall down-regulation in these genes, while in other types (extensor digitorum longus, tibialis anterior and quadriceps) they are up-regulated, suggesting certain muscle tissues may be compensating for atrophy responses caused by microgravity. Studying these organtissue-specific perturbations in molecular signaling networks, we demonstrate the value of GeneLab in characterizing potential master regulators associated with biological risks for spaceflight.

  18. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  19. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  20. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

    PubMed Central

    Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

    2014-01-01

    Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

  1. Comparative proteomic profiling of soleus, extensor digitorum longus, flexor digitorum brevis and interosseus muscles from the mdx mouse model of Duchenne muscular dystrophy.

    PubMed

    Carberry, Steven; Brinkmeier, Heinrich; Zhang, Yaxin; Winkler, Claudia K; Ohlendieck, Kay

    2013-09-01

    Duchenne muscular dystrophy is due to genetic abnormalities in the dystrophin gene and represents one of the most frequent genetic childhood diseases. In the X-linked muscular dystrophy (mdx) mouse model of dystrophinopathy, different subtypes of skeletal muscles are affected to a varying degree albeit the same single base substitution within exon 23 of the dystrophin gene. Thus, to determine potential muscle subtype-specific differences in secondary alterations due to a deficiency in dystrophin, in this study, we carried out a comparative histological and proteomic survey of mdx muscles. We intentionally included the skeletal muscles that are often used for studying the pathomechanism of muscular dystrophy. Histological examinations revealed a significantly higher degree of central nucleation in the soleus and extensor digitorum longus muscles compared with the flexor digitorum brevis and interosseus muscles. Muscular hypertrophy of 20-25% was likewise only observed in the soleus and extensor digitorum longus muscles from mdx mice, but not in the flexor digitorum brevis and interosseus muscles. For proteomic analysis, muscle protein extracts were separated by fluorescence two-dimensional (2D) gel electrophoresis. Proteins with a significant change in their expression were identified by mass spectrometry. Proteomic profiling established an altered abundance of 24, 17, 19 and 5 protein species in the dystrophin-deficient soleus, extensor digitorum longus, flexor digitorum brevis and interosseus muscle, respectively. The key proteomic findings were verified by immunoblot analysis. The identified proteins are involved in the contraction-relaxation cycle, metabolite transport, muscle metabolism and the cellular stress response. Thus, histological and proteomic profiling of muscle subtypes from mdx mice indicated that distinct skeletal muscles are differentially affected by the loss of the membrane cytoskeletal protein, dystrophin. Varying degrees of perturbed protein expression patterns in the muscle subtypes from mdx mice may be due to dissimilar downstream events, including differences in muscle structure or compensatory mechanisms that counteract pathophysiological processes. The interosseus muscle from mdx mice possibly represents a naturally protected phenotype.

  2. Comparative proteomic profiling of soleus, extensor digitorum longus, flexor digitorum brevis and interosseus muscles from the mdx mouse model of Duchenne muscular dystrophy

    PubMed Central

    CARBERRY, STEVEN; BRINKMEIER, HEINRICH; ZHANG, YAXIN; WINKLER, CLAUDIA K.; OHLENDIECK, KAY

    2013-01-01

    Duchenne muscular dystrophy is due to genetic abnormalities in the dystrophin gene and represents one of the most frequent genetic childhood diseases. In the X-linked muscular dystrophy (mdx) mouse model of dystrophinopathy, different subtypes of skeletal muscles are affected to a varying degree albeit the same single base substitution within exon 23 of the dystrophin gene. Thus, to determine potential muscle subtype-specific differences in secondary alterations due to a deficiency in dystrophin, in this study, we carried out a comparative histological and proteomic survey of mdx muscles. We intentionally included the skeletal muscles that are often used for studying the pathomechanism of muscular dystrophy. Histological examinations revealed a significantly higher degree of central nucleation in the soleus and extensor digitorum longus muscles compared with the flexor digitorum brevis and interosseus muscles. Muscular hypertrophy of 20–25% was likewise only observed in the soleus and extensor digitorum longus muscles from mdx mice, but not in the flexor digitorum brevis and interosseus muscles. For proteomic analysis, muscle protein extracts were separated by fluorescence two-dimensional (2D) gel electrophoresis. Proteins with a significant change in their expression were identified by mass spectrometry. Proteomic profiling established an altered abundance of 24, 17, 19 and 5 protein species in the dystrophin-deficient soleus, extensor digitorum longus, flexor digitorum brevis and interosseus muscle, respectively. The key proteomic findings were verified by immunoblot analysis. The identified proteins are involved in the contraction-relaxation cycle, metabolite transport, muscle metabolism and the cellular stress response. Thus, histological and proteomic profiling of muscle subtypes from mdx mice indicated that distinct skeletal muscles are differentially affected by the loss of the membrane cytoskeletal protein, dystrophin. Varying degrees of perturbed protein expression patterns in the muscle subtypes from mdx mice may be due to dissimilar downstream events, including differences in muscle structure or compensatory mechanisms that counteract pathophysiological processes. The interosseus muscle from mdx mice possibly represents a naturally protected phenotype. PMID:23828267

  3. Osteitis pubis and adductor tendinopathy in athletes: a novel arthroscopic pubic symphysis curettage and adductor reattachment.

    PubMed

    Hopp, Sascha Jörg; Culemann, Ulf; Kelm, Jens; Pohlemann, Tim; Pizanis, Antonius

    2013-07-01

    Various surgical treatment options have been described in athletes with degenerative osteitis pubis who fail to respond to conservative treatment modalities. Although adductor longus tendinopathy often represents an additional pain generator in chronic groin pain associated with osteitis pubis, this has not been acknowledged in the surgical literature, to our knowledge. We present the results of a novel surgical technique for combined degenerative lesions of the pubic symphysis joint and the adjacent adductor longus tendon in a series of athletes with osteitis pubis. During 2009 and 2010, five competitive non-professional soccer players with considerable groin and pubic pain were referred to our clinic, after conservative therapy over a period of at least 12 months had failed. According to our clinical protocol for patients with groin pain, physical examination, pelvic radiographs and arthrography of the pubic symphysis to detect microlesions of the adjacent adductor longus tendons were performed. The patients diagnosed with degenerative osteitis pubis and concomitant lesion of the adductor longus origin were indicated for surgery. Surgery consisted of resection of the degenerative soft and bone tissue and subsequent reattachment with suture anchors. With regard to stability of the symphysis pubis, a two-portal arthroscopic curettage of the degenerative fibrocartilaginous disc tissue was performed. The patients were followed prospectively at medium term with assessment of general pain level (VAS score) and sport activity with pain (NIPPS score) pre- and postoperatively. All patients recovered to full activity sports after an average period of 14.4 weeks. VAS and NIPPS scores markedly improved and overall satisfaction with the postoperative result was high. One intraoperative bleeding occurred, needing revision surgery. None of the patients developed pubic instability due to pubic symphysis curettage in the sequel. This novel surgical technique combines successfully stability-preserving arthroscopic pubic symphysis curettage with adductor debridement and reattachment in well-selected cases of athletes suffering from degenerative osteitis pubis and concomitant adductor pathology, being refractory to conservative treatment. Diligent preoperative evaluation of the specific pathology will lead to successful outcome.

  4. Extensor Pollicis Longus Injury in Addition to De Quervain’s with Text Messaging on Mobile Phones

    PubMed Central

    Kumar, Bhaskaranand; Bhat, Anil K; Venugopal, Anand

    2014-01-01

    Objective: To do a clinical and ultrasonic evaluation of subjects with thumb pain with text messaging. Background: Thumbs are commonly used for text messaging, which are not as well designed for fine manipulative or dexterous work. Repetitive use as in text messaging can lead to the injury to the tendons of the thumb. Materials and Methods: Ninety eight students with symptoms of Repetitive Strain Type of injuries of the thumb were selected from a survey and evaluated both clinically and by ultrasound analysis of the musculotendinous unit of the thumb to note changes due to excessive use of the mobile phone. Age and sex matched controls were also subjected to ultrasound evaluation. Results: Clinical examination showed positive Finkelstein test in 40% of the cases, significant reduction in the lateral and tip pinch strengths in the cases. Ultrasound detected changes in the first and the third compartments in 19% of the cases. Conclusion: Isolated cases of pain in the thumb have been reported but this study noted changes both clinically and by ultrasound in the tendons of the thumb. These changes should be taken as warning signs of possible subclinical changes taking place in the soft tissues of the thumb in these subjects due to repetitive use of mobile phones and thus, making them prone for developing painful Musculoskeletal Disorders. Application: Repetitive use of mobile phones for text messaging can lead to the damage of Extensor pollicis longus of the thumb in addition to the tendons of the first compartment of the wrist. PMID:25584249

  5. The location of the peroneus longus tendon in the cuboid groove: sonographic study in various positions of the ankle-foot in asymptomatic volunteers.

    PubMed

    Choo, Hye Jung; Lee, Sun Joo; Huang, Brady K; Resnick, Donald L

    2018-04-10

    To evaluate the normal location of the peroneus longus tendon (PL) in the cuboid groove in various ankle-foot positions by ultrasonography in asymptomatic volunteers. Ultrasonographic assessment of the PL in the cuboid groove was performed in 20 feet of ten healthy volunteers. Each PL was examined in five ankle-foot positions (i.e., neutral, dorsiflexion, plantar-flexion, supination, and pronation). The PL location was qualitatively categorized as "inside" when the PL was entirely within the cuboid groove, as "overlying" when some part of the PL was perched on the cuboid tuberosity, and as "outside" when the PL was entirely on the cuboid tuberosity. For quantitative evaluation of the PL location, the distance between the PL and the cuboid groove was measured. The width of the cuboid groove was measured in the neutral position. The PL location did not significantly change with changes in the ankle-foot position. Qualitatively, an "overlying" PL was the most common type, regardless of the ankle-foot position. "Inside" PLs were found in only 35, 20, 30, 25, and 35% of feet in neutral, dorsiflexion, plantar-flexion, supination, and pronation positions, respectively. The quantitative PL location was also not significantly different among all ankle-foot positions and it was significantly negatively correlated with the cuboid groove width. In healthy volunteers, 65% or more of the PLs were partially or completely located outside of the cuboid groove, regardless of the ankle-foot position. The PL location relative to the cuboid groove was related to the cuboid groove width.

  6. Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

    PubMed Central

    Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

    2011-01-01

    Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

  7. Hypogravity-induced atrophy of rat soleus and extensor digitorum longus muscles

    NASA Technical Reports Server (NTRS)

    Riley, D. A.; Ellis, S.; Slocum, G. R.; Satyanarayana, T.; Bain, J. L.; Sedlak, F. R.

    1987-01-01

    Prolonged exposure of humans to hypogravity causes weakening of their skeletal muscles. This problem was studied in rats exposed to hypogravity for 7 days aboard Spacelab 3. Hindlimb muscles were harvested 12-16 hours postflight for histochemical, biochemical, and ultrastructural analyses. The majority of the soleus and extensor digitorum longus fibers exhibited simple cell shrinkage. However, approximately 1% of the fibers in flight soleus muscles appeared necrotic. Flight muscle fibers showed increased glycogen, lower subsarcolemmal staining for mitochondrial enzymes, and fewer subsarcolemmal mitochondria. During atrophy, myofibrils were eroded by multiple focal losses of myofilaments; lysosomal autophagy was not evident. Tripeptidylaminopeptidase and calcium-activated protease activities of flight soleus fibers were significantly increased, implying a role in myofibril breakdown. Simple fiber atrophy appears to account for muscle weakening during spaceflight, but fiber necrosis is also a contributing factor.

  8. Isolated avulsion fracture of the first metatarsal base at the peroneus longus tendon attachment: a case report.

    PubMed

    Weinberg, Maxwell W; Krähenbühl, Nicola; Davidson, Nathan P; Hanrahan, Christopher J; Barg, Alexej

    2018-05-01

    Avulsion fractures of the first metatarsal (MT1) base at the peroneus longus (PL) tendon attachment are rare and may be undiagnosed during an emergency visit. If the injury is not treated properly, chronic pain or persistent impairment for inversion and plantar-flexion of the first ray may occur. This case report presents a 30-year-old woman who presented 10 weeks post trauma to a foot and ankle surgeon due to a swollen right midfoot with diffuse tenderness over the medial Lisfranc joint. Further evaluation showed an isolated avulsion fracture of the first metatarsal, which was undiagnosed during the emergent visit following the accident. In this case, the patient was successfully treated conservatively. The goal of this article is to raise awareness of this rare injury for radiologists and orthopedic surgeons.

  9. Effect of fibular repositioning taping in adult basketball players with chronic ankle instability: a randomized, placebo-controlled, crossover trial.

    PubMed

    Alves, Yanina; Ribeiro, Fernando; Silva, Anabela G

    2017-07-05

    Chronic ankle instability presents a high incidence and prevalence in basketbal players. It's important to develop strategies to reduce the functional and mechanical limitations resulting from this condition. To compare the effect of Mulligan ́s fibular repositioning taping with a placebo taping immediatly after application and after a running test (Yo-Yo IRT). 16 adult basketball players (10 male, 6 female) with chronic ankle instability and mean age 21.50 ± 2.76 years old. Assessment of static postural control (15 seconds of unipedal stance test with eyes closed in a force platform), functional performance (figure 8 hop test and lateral hop test) and neuromuscular control (peroneus longus latency time in sudden inversion) in two conditions: Mulligan and Placebo. No significant effect was found for the intervantion factor in both hop tests (p>0.170), but there was a significant effect for the time factor (p<0.03). For the peroneus longus latency time, there was a significant interaction between factors (p=0.028) and also for time (p=0.042). No significant effect was found for any of the static postural control variables (area, speed and total displacement) (p≥0.10). There was no differences between Mulligan's fibular repositioning taping and Placebo taping in postural control and functional performance in basketball players with chronic ankle instability. However, Mulligan's taping appears to reduce peroneus longus latency time after a running when compared with a placebo taping.

  10. Rehabilitation and Return to Sport Following Surgical Repair of the Rectus Abdominis and Adductor Longus in a Professional Basketball Player: A Case Report.

    PubMed

    Short, Steven M; Anloague, Philip A; Strack, Donald S

    2016-08-01

    Study Design Case report. Background Acute traumatic avulsion of the rectus abdominis and adductor longus is rare. Chronic groin injuries, often falling under the athletic pubalgia spectrum, have been reported to be more common. There is limited evidence detailing the comprehensive rehabilitation and return to sport of an athlete following surgical or conservative treatment of avulsion injuries of the pubis or other sports-related groin pathologies. Case Description A 29-year-old National Basketball Association player sustained a contact injury during a professional basketball game. This case report describes a unique clinical situation specific to professional sport, in which a surgical repair of an avulsed rectus abdominis and adductor longus was combined with a multimodal impairment- and outcomes-based rehabilitation program. Outcomes The patient returned to in-season competition at 5 weeks postoperation. Objective measures were tracked throughout rehabilitation and compared to baseline assessments. Measures such as the Copenhagen Hip and Groin Outcome Score and numeric pain-rating scale revealed progress beyond the minimal important difference. Discussion This case report details the clinical reasoning and evidence-informed interventions involved in the return to elite sport. Detailed programming and objective assessment may assist in achieving desired outcomes ahead of previously established timelines. Level of Evidence Therapy, level 4. J Orthop Sports Phys Ther 2016;46(8):697-706. Epub 3 Jul 2016. doi:10.2519/jospt.2016.6352.

  11. Slow to fast alterations in skeletal muscle fibers caused by clenbuterol, a beta(2)-receptor agonist

    NASA Technical Reports Server (NTRS)

    Zeman, Richard J.; Ludemann, Robert; Easton, Thomas G.; Etlinger, Joseph D.

    1988-01-01

    The effects of a beta(2)-receptor agonist, clenbuterol, and a beta(2) antagonist, butoxamine, on the skeletal muscle fibers of rats were investigated. It was found that chronic treatment of rats with clenbuterol caused hypertrophy of histochemically identified fast-twitch, but not slow-twitch, fibers within the soleus, while in the extensor digitorum longus the mean areas of both fiber types were increased; in both muscles, the ratio of the number of fast-twitch to slow-twitch fibers was increased. In contrast, a treatment with butoxamine caused a reduction of the fast-twitch fiber size in both muscles, and the ratio of the fast-twitch to slow-twitch fibers was decreased.

  12. Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

    PubMed

    Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

    2015-09-01

    To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  14. Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

    PubMed

    Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

    2013-03-01

    The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

  15. The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

    2010-04-20

    Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

  16. Essential core of the Hawking–Ellis types

    NASA Astrophysics Data System (ADS)

    Martín-Moruno, Prado; Visser, Matt

    2018-06-01

    The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

  17. Observational properties of decameter type IV bursts

    NASA Astrophysics Data System (ADS)

    Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

    2013-04-01

    Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

  18. The miRNA Transcriptome Directly Reflects the Physiological and Biochemical Differences between Red, White, and Intermediate Muscle Fiber Types.

    PubMed

    Ma, Jideng; Wang, Hongmei; Liu, Rui; Jin, Long; Tang, Qianzi; Wang, Xun; Jiang, Anan; Hu, Yaodong; Li, Zongwen; Zhu, Li; Li, Ruiqiang; Li, Mingzhou; Li, Xuewei

    2015-04-29

    MicroRNAs (miRNAs) are small non-coding RNAs that can regulate their target genes at the post-transcriptional level. Skeletal muscle comprises different fiber types that can be broadly classified as red, intermediate, and white. Recently, a set of miRNAs was found expressed in a fiber type-specific manner in red and white fiber types. However, an in-depth analysis of the miRNA transcriptome differences between all three fiber types has not been undertaken. Herein, we collected 15 porcine skeletal muscles from different anatomical locations, which were then clearly divided into red, white, and intermediate fiber type based on the ratios of myosin heavy chain isoforms. We further illustrated that three muscles, which typically represented each muscle fiber type (i.e., red: peroneal longus (PL), intermediate: psoas major muscle (PMM), white: longissimus dorsi muscle (LDM)), have distinct metabolic patterns of mitochondrial and glycolytic enzyme levels. Furthermore, we constructed small RNA libraries for PL, PMM, and LDM using a deep sequencing approach. Results showed that the differentially expressed miRNAs were mainly enriched in PL and played a vital role in myogenesis and energy metabolism. Overall, this comprehensive analysis will contribute to a better understanding of the miRNA regulatory mechanism that achieves the phenotypic diversity of skeletal muscles.

  19. The athlete's foot: the grey zone behind the ankle.

    PubMed

    van Giffen, Nicolien; Seil, Romain; Pape, Diederich; Nührenbörger, Christian

    2009-01-01

    Posterior ankle and heel pain is common among athletes. The most common injury in this region is that of the Achilles tendon. However, besides the Achilles tendon, pain can originate from a retrocalcaneal bursitis, posterior impingement syndrome, os trigonum syndrome, or flexor hallucis longus tenosynovitis. These pathologies often caused by overuse, but can also occur after trauma. With careful examination, and the help of MRI imaging, the distinction can be made among these pathologies and the more common Achilles tendon problems. Like most overuse injuries, the majority of cases of retrocalcaneal bursitis, posterior impingement, flexor hallucis longus tenosynovitis respond to conservative treatment. However, when this fails, open or arthroscopic surgery can be proposed. Arthroscopy is less aggressive than open surgery, with the added advantage of less patient morbidity, less post-operative pain, and early functional rehabilitation. It is becoming the surgery of choice, especially among athletes.

  20. Vibration-induced muscle injury. An experimental model and preliminary findings.

    PubMed

    Necking, L E; Dahlin, L B; Fridén, J; Lundborg, G; Lundström, R; Thornell, L E

    1992-06-01

    The hind paws of rats were subjected to vibration at a frequency of 80 Hz., an acceleration of 32 m./s.2 rms (i.e. ah.w approximately 6.3 m./s.2 rms) for five hours daily during five consecutive days. Morphological, histochemical and immunohistochemical analyses of the soleus, extensor digitorum longus and the plantar muscles in the vibrated limb and the contralateral control limb were performed. No changes were seen in the soleus or extensor digitorum longus muscles but different degrees of degeneration of the muscle fibres were seen in the plantar muscle sections as well as signs of regeneration. No changes were observed in the contralateral unexposed limb. It is concluded that it is not only nervous tissue but also muscle tissue that can be affected by vibration. The changes seem to be confined to muscles close to the vibration exciter.

  1. Hindlimb immobilization - Length-tension and contractile properties of skeletal muscle

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Kim, D. H.; Fitts, R. H.

    1982-01-01

    Casts were placed around rat feet in plantar flexion position to immobilize the soleus muscle in a shortened position, while the other foot was fixed in dorsal flexion to set the extensor digitorum longus in a shortened position. The total muscular atrophy and contractile properties were measured at 1, 2, 4, 7, 14, 21, 28, 35, and 42 days after immobilization, with casts being replaced every two weeks. The slow twitch soleus and the fast-twitch vastus lateralis and longus muscles were excised after termination of the experiment. The muscles were then stretched and subjected to electric shock to elicit peak tetanic tension and peak tetanic tension development. Force velocity features of the three muscles were assayed in a series of afterloaded contractions and fiber lengths were measured from subsequently macerated muscle. All muscles atrophied during immobilization, reaching a new steady state by day 21. Decreases in fiber and sarcomere lengths were also observed.

  2. Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

    PubMed

    Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

    2007-01-01

    Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

  3. Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

    PubMed

    Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

    2014-01-01

    Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

    PubMed

    Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

    2017-08-01

    SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

  5. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  6. Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

    PubMed Central

    Megli, Christina J.

    2013-01-01

    Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

  7. Complications arising from a misdiagnosed giant lipoma of the hand and palm: a case report

    PubMed Central

    2011-01-01

    Introduction Lipomas are benign tumors which may appear in almost any human organ. Their diagnosis rate in the hand region is not known. Case Presentation We present the case of a 63-year-old Greek Caucasian woman with a giant lipoma of the hand and palm which was not initially diagnosed. After repeated surgical decompression of the carpal tunnel the patient was referred with persisting symptoms of median and ulnar nerve compression and a prominent mass of her left palm and thenar eminence. Clinical examination, magnetic resonance imaging, nerve conduction study and biopsy, revealed a giant lipoma in the deep palmar space (8.0 × 4.0 × 3.75 cm), which was also infiltrating the carpal tunnel. She had already undergone two operations for carpal tunnel syndrome with no relief of her symptoms and she also ended up with a severed flexor pollicis longus tendon. Definitive treatment was performed by marginal resection of the lipoma and restoration of the flexor pollicis longus with an intercalated graft harvested from the palmaris longus. Thirty months after surgery the patient had a fully functional hand without any neurological deficit. Conclusion Not all lipomas of the wrist and hand are diagnosed. Our report tries to emphasize the hidden danger of lipomas in cases with carpal tunnel symptoms. The need for a high index of suspicion in conjunction with good clinical evaluation and the use of appropriate investigative studies is mandatory in order to avoid unnecessary operations and complications. Marginal excision of these tumors is restorative. PMID:22085433

  8. Homologies of the transversospinalis muscles in the anterior presacral region of Sauria (crown Diapsida).

    PubMed

    Tsuihiji, Takanobu

    2005-02-01

    Homologies of muscles of the m. transversospinalis group in the dorsal and cervical regions in Sauria are established based on detailed dissections and published accounts of lepidosaurs, crocodylians, and birds. Attachments and directions of tendons comprising this muscle group are fairly conserved among the saurian clades, enabling rather robust inferences on muscle homologies. The innervation pattern indicates that mm. ascendentes are the most lateral muscles of the m. transversospinalis group in Aves, and are inferred to be homologous with the crocodylian m. tendinoarticularis based on their topological similarities. It is suggested here that the lepidosaurian articulo-parietalis part of m. longissimus cervico-capitis actually belongs to the m. transversospinalis group because its tendons of origin are shared with those of m. semispinalis. The avian m. complexus and the lateral part of the crocodylian m. transversospinalis capitis have origins and insertions similar to this lepidosaurian muscle, and are proposed to be homologous with the latter. In some birds, m. longus colli dorsalis, pars profunda continues directly into the anterior cervical region as m. splenius accessorius, suggesting a serially homologous relationship. Similarly, m. splenius anticus continues anteriorly from m. longus colli dorsalis, pars cranialis, and both of these muscles lie dorsal to m. splenius accessorius. Therefore, the currently used nomenclature that regards m. splenius accessorius as a part of m. longus colli dorsalis, pars cranialis and that regards m. splenius anticus as a part of the former muscle does not accurately reflect the serial homologies among these muscles and may not be justified. Copyright 2004 Wiley-Liss, Inc.

  9. Ultrasound evaluation of foot muscles and plantar fascia in pes planus.

    PubMed

    Angin, Salih; Crofts, Gillian; Mickle, Karen J; Nester, Christopher J

    2014-01-01

    Multiple intrinsic and extrinsic soft tissue structures that apply forces and support the medial longitudinal arch have been implicated in pes planus. These structures have common functions but their interaction in pes planus is not fully understood. The aim of this study was to compare the cross-sectional area (CSA) and thickness of the intrinsic and extrinsic foot muscles and plantar fascia thickness between normal and pes planus feet. Forty-nine adults with a normal foot posture and 49 individuals with pes planus feet were recruited from a university population. Images of the flexor digitorum longus (FDL), flexor hallucis longus (FHL), peroneus longus and brevis (PER), flexor hallucis brevis (FHB), flexor digitorum brevis (FDB) and abductor hallucis (AbH) muscles and the plantar fascia were obtained using a Venue 40 ultrasound system with a 5-13 MHz transducer. The CSA and thickness of AbH, FHB and PER muscles were significantly smaller (AbH -12.8% and -6.8%, FHB -8.9% and -7.6%, PER -14.7% and -10%), whilst FDL (28.3% and 15.2%) and FHL (24% and 9.8%) were significantly larger in the pes planus group. The middle (-10.6%) and anterior (-21.7%) portions of the plantar fascia were thinner in pes planus group. Greater CSA and thickness of the extrinsic muscles might reflect compensatory activity to support the MLA if the intrinsic foot muscle function has been compromised by altered foot structure. A thinner plantar fascia suggests reduced load bearing, and regional variations in structure and function in feet with pes planus. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. A morphometric analysis of the superior cervical ganglion and its surrounding structures.

    PubMed

    Fazliogullari, Zeliha; Kilic, Cenk; Karabulut, Ahmet Kagan; Yazar, Fatih

    2016-04-01

    The aim of this cadaveric study was to detect the superior cervical ganglion (SCG) in a topographic manner according to vertebrae and to determine the relationship between the vertebrae, mandibular angle and longus colli muscle through morphometric analysis. The present study was performed on 40 SCG of 20 human cadavers (16 males, 4 females). The level of the SCG was determined based on the vertebrae. Ganglion length, width and thickness were detected. Distance to the adjacent vertebra, the mandibular angle and medial side of the longus colli muscle were measured. The results were evaluated statistically. The SCG existing in all cadavers was detected at the C2 vertebra level in 34 cadavers and at the C3 vertebra level in 6 cadavers. The average length, width and thickness of the SCG were 15.18 ± 1.12, 4.62 ± 0.25, and 1.83 ± 0.10 mm, respectively. No statistically significant difference was detected in terms of the distances between the ganglion and anterior tubercle of transverse processes of the vertebrae as well as the mandibular angle on either side. The distance between the SCG and the medial edge of the longus colli muscle was significantly greater on the left side in both men (p < 0.001) and women (p < 0.01). Recognition of morphometric characteristics of the SCG and detection of its location according to adjacent formations may serve as a guide for nerve blockage studies and help surgeons to preserve the ganglion in both anterior and anterolateral cervical approaches.

  11. Digital image analysis of striated skeletal muscle tissue injury during reperfusion after induced ischemia

    NASA Astrophysics Data System (ADS)

    Rosero Salazar, Doris Haydee; Salazar Monsalve, Liliana

    2015-01-01

    Conditions such as surgical procedures or vascular diseases produce arterial ischemia and reperfusion injuries, which generate changes in peripheral tissues and organs, for instance, in striated skeletal muscle. To determine such changes, we conducted an experimental method in which 42 male Wistar rat were selected, to be undergone to tourniquet application on the right forelimb and left hind limb, to induce ischemia during one and three hours, followed by reperfusion periods starting at one hour and it was prolonged up to 32 days. Extensor carpi radialis longus and soleus respectively, were obtained to be processed for histochemical and morphometric analysis. By means of image processing and detection of regions of interest, variations of areas occupied by muscle fibers and intramuscular extracellular matrix (IM-ECM) throughout reperfusion were observed. In extensor carpi radialis longus, results shown reduction in the area occupied by muscle fibers; this change is significant between one hour and three hours ischemia followed by 16 hours, 48 hours and 32 days reperfusión (p˂0.005). To compare only periods of reperfusión that continued to three hours ischemia, were found significant differences, as well. For area occupied by IM-ECM, were identified increments in extensor carpi radialis longus by three hours ischemia and eight to 16 days reperfusion; in soleus, was observed difference by one hour ischemia with 42 hours reperfusion, and three hours ischemia followed by four days reperfusion (p˂0.005). Skeletal muscle develops adaptive changes in longer reperfusion, to deal with induced injury. Descriptions beyond 32 days reperfusion, can determine recovering normal pattern.

  12. Fiber-type susceptibility to eccentric contraction-induced damage of hindlimb-unloaded rat AL muscles

    NASA Technical Reports Server (NTRS)

    Vijayan, K.; Thompson, J. L.; Norenberg, K. M.; Fitts, R. H.; Riley, D. A.

    2001-01-01

    Slow oxidative (SO) fibers of the adductor longus (AL) were predominantly damaged during voluntary reloading of hindlimb unloaded (HU) rats and appeared explainable by preferential SO fiber recruitment. The present study assessed damage after eliminating the variable of voluntary recruitment by tetanically activating all fibers in situ through the motor nerve while applying eccentric (lengthening) or isometric contractions. Muscles were aldehyde fixed and resin embedded, and semithin sections were cut. Sarcomere lesions were quantified in toluidine blue-stained sections. Fibers were typed in serial sections immunostained with antifast myosin and antitotal myosin (which highlights slow fibers). Both isometric and eccentric paradigms caused fatigue. Lesions occurred only in eccentrically contracted control and HU muscles. Fatigue did not cause lesions. HU increased damage because lesioned- fiber percentages within fiber types and lesion sizes were greater than control. Fast oxidative glycolytic (FOG) fibers were predominantly damaged. In no case did damaged SO fibers predominate. Thus, when FOG, SO, and hybrid fibers are actively lengthened in chronically unloaded muscle, FOG fibers are intrinsically more susceptible to damage than SO fibers. Damaged hybrid-fiber proportions ranged between these extremes.

  13. Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

    PubMed

    Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

    2015-06-16

    Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

  14. Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

    USGS Publications Warehouse

    Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

    2005-01-01

    Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

  15. Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

    PubMed

    Zachariae, R; Bjerring, P; Arendt-Nielsen, L

    1989-11-01

    Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

  16. Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

    PubMed

    Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

    2018-05-30

    The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Comparison of foot muscle morphology and foot kinematics between recreational runners with normal feet and with asymptomatic over-pronated feet.

    PubMed

    Zhang, Xianyi; Aeles, Jeroen; Vanwanseele, Benedicte

    2017-05-01

    Over-pronated feet are common in adults and are associated with lower limb injuries. Studying the foot muscle morphology and foot kinematic patterns is important for understanding the mechanism of over-pronation related injuries. The aim of this study is to compare the foot muscle morphology and foot inter-segmental kinematics between recreational runners with normal feet and those with asymptomatic over-pronated feet. A total of 26 recreational runners (17 had normal feet and 9 had over-pronated feet) participated in this study and their foot type was assessed using the 6-item Foot Posture Index. Selected foot muscles were scanned using an ultrasound device and the scanned images were processed to measure the thickness and cross-sectional area of the muscles. Muscles of interest include abductor hallucis, abductor digiti minimi, flexor digitorum brevis and longus, tibialis anterior and peroneus muscles. Foot kinematic data during walking was collected using a 3D motion capture system incorporating the Oxford Foot Model. The results show that individuals with over-pronated feet have larger size of abductor hallucis, flexor digitorum brevis and longus and smaller abductor digiti minimi than controls. Higher rearfoot peak eversion and forefoot peak supination during walking were observed in individuals with over-pronated feet. However, during gait the forefoot peak abduction was comparable. These findings indicate that in active asymptomatic individuals with over-pronated feet, the foot muscle morphology is adapted to increase control of the foot motion. The morphological characteristics of the foot muscles in asymptomatic individuals with over-pronated feet may affect their foot kinematics and benefit prevention from injuries. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Soleus neurotomy for treatment of the spastic equinus foot. Groupe d'Evaluation et de Traitement de la Spasticité et de la Dystonie.

    PubMed

    Decq, P; Filipetti, P; Cubillos, A; Slavov, V; Lefaucheur, J P; Nguyen, J P

    2000-11-01

    This prospective, nonrandomized, noncontrolled study was performed to evaluate the results of a new type of neurotomy, namely the soleus neurotomy, for treatment of the spastic equinus foot. Between May 1996 and March 1998, 46 patients were treated for a spastic equinus foot. Clinical status, spasticity (Ashworth Scale score), and kinematic parameters of the gait were determined before and after surgery. The neurotomy was performed on the upper nerve of the soleus in all cases and was associated with other neurotomies (lower nerve of the soleus, 21 patients; gastrocnemius, 9 patients, tibialis posterior, 18 patients; flexor hallucis longus, 16 patients; and flexor digitorum longus, 17 patients). The mean follow-up period was 15 months (range, 8-28 mo). The equinus deformity disappeared clinically in all patients. Before the operation, all patients had an Ashworth Scale score of 2, with an inexhaustible clonus present on knee extension and persisting with knee flexion (Tardieu Scale score, 4), which was abolished in 95% of the patients after surgery. Two patients still had some clonus on knee extension; this did not interfere with their clinical improvement. Knee recurvatum disappeared in eight patients. Analysis of kinematic parameters demonstrated a statistically significant increase in joint motion of the second rocker (P = 0.0026) of the ankle during stance. The duration of the stance or swing phase, length of the walking cycle, and velocity or rate of spontaneous walking were not significantly modified. The study demonstrated that soleus neurotomy is effective for the treatment of spastic equinus foot, leading to abolition of spasticity and improvement in the range of ankle motion during the stance phase of gait.

  19. Skeletal muscle response to spaceflight, whole body suspension, and recovery in rats

    NASA Technical Reports Server (NTRS)

    Musacchia, X. J.; Steffen, J. M.; Fell, R. D.; Dombrowski, M. J.

    1990-01-01

    The effects of a 7-day spaceflight (SF), 7- and 14-day-long whole body suspension (WBS), and 7-day-long recovery on the muscle weight and the morphology of the soleus and the extensor digitorum longus (EDL) of rats were investigated. It was found that the effect of 7-day-long SF and WBS were highly comparable for both the soleus and the EDL, although the soleus muscle from SF rats showed greater cross-sectional area reduction than that from WBS rats. With a longer duration of WBS, there was a continued reduction in cross-sectional fast-twitch fiber area. Muscle plasticity, in terms of fiber and capillary responses, showed differences in responses of the two types of muscles, indicating that antigravity posture muscles are highly susceptible to unloading.

  20. Influence of spaceflight on rat skeletal muscle

    NASA Technical Reports Server (NTRS)

    Martin, Thomas P.; Edgerton, V. Reggie; Grindeland, Richard E.

    1988-01-01

    The effect of a 7-day spaceflight (aboard NASA's SL-3) on the size and the metabolism of single fibers from several rat muscles was investigated along with the specificity of these responses as related to the muscle type and the size of fibers. It was found that the loss of mass after flight was varied from 36 percent in the soleus to 15 percent in the extensor digitorum longus. Results of histochemical analyses showed that the succinate dehydrogenase (SDH) activity in muscles of flight-exposed rats was maintained at the control levels, whereas the alpha-glycerol phosphate dehydrogenase (GPD) activity was either maintained or increased. The analyses of the metabolic profiles of ATPase, SDH, and GPD indicated that, in some muscles, there was an increase in the poportion of fast oxidative-glycolytic fibers.

  1. Metabolomic Analysis of Oxidative and Glycolytic Skeletal Muscles by Matrix-Assisted Laser Desorption/IonizationMass Spectrometric Imaging (MALDI MSI)

    NASA Astrophysics Data System (ADS)

    Tsai, Yu-Hsuan; Garrett, Timothy J.; Carter, Christy S.; Yost, Richard A.

    2015-06-01

    Skeletal muscles are composed of heterogeneous muscle fibers that have different physiological, morphological, biochemical, and histological characteristics. In this work, skeletal muscles extensor digitorum longus, soleus, and whole gastrocnemius were analyzed by matrix-assisted laser desorption/ionization mass spectrometry to characterize small molecule metabolites of oxidative and glycolytic muscle fiber types as well as to visualize biomarker localization. Multivariate data analysis such as principal component analysis (PCA) and partial least squares discriminant analysis (PLS-DA) were performed to extract significant features. Different metabolic fingerprints were observed from oxidative and glycolytic fibers. Higher abundances of biomolecules such as antioxidant anserine as well as acylcarnitines were observed in the glycolytic fibers, whereas taurine and some nucleotides were found to be localized in the oxidative fibers.

  2. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  3. Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

    PubMed

    Wang, Chao; Zhai, Wanying; Shan, Baoqing

    2016-05-01

    Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

  4. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

    PubMed Central

    Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

    2014-01-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

  5. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

    PubMed

    Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

    2014-02-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

  6. A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

    PubMed

    Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

    2008-01-01

    To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

  7. Ultraviolet properties of IRAS-selected Be stars

    NASA Technical Reports Server (NTRS)

    Bjorkman, Karen S.; Snow, Theodore P.

    1988-01-01

    New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

  8. Genetics Home Reference: congenital insensitivity to pain with anhidrosis

    MedlinePlus

    ... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

  9. Collagen type IV at the fetal-maternal interface.

    PubMed

    Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

    2015-01-01

    Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  11. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  12. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  13. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

    Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

  15. On the Directivity of Low-Frequency Type IV Radio Bursts

    NASA Technical Reports Server (NTRS)

    Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

    2016-01-01

    An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

  16. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    PubMed

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Systemic Microgravity Response: Utilizing GeneLab to Develop Hypotheses for Spaceflight Risks

    NASA Technical Reports Server (NTRS)

    Beheshti, Afshin; Ray, Shayoni; Fogle, Homer W.; Berrios, Daniel C.; Costes, Sylvain V.

    2017-01-01

    Biological risks associated with microgravity are a major concern for long-term space travel. Although determination of risk has been a focus for NASA research, data examining systemic (i.e., multi- or pan-tissue) responses to space flight are sparse. To perform our analysis, we utilized the NASA GeneLab database which is a publicly available repository containing a wide array of omics results from experiments conducted with: i) with different flight conditions (space shuttle (STS) missions vs. International Space Station (ISS); ii) a variety of tissues; and 3) assays that measure epigenetic, transcriptional, and protein expression changes. Meta-analysis of the transcriptomic data from 7 different murine and rat data sets, examining tissues such as liver, kidney, adrenal gland, thymus, mammary gland, skin, and skeletal muscle (soleus, extensor digitorum longus, tibialis anterior, quadriceps, and gastrocnemius) revealed for the first time, the existence of potential master regulators coordinating systemic responses to microgravity in rodents. We identified p53, TGF1 and immune related pathways as the highly prevalent pan-tissue signaling pathways that are affected by microgravity. Some variability in the degree of change in their expression across species, strain and time of flight was also observed. Interestingly, while certain skeletal muscle (gastrocnemius and soleus) exhibited an overall down-regulation of these genes, some other muscle types such as the extensor digitorum longus, tibialis anterior and quadriceps, showed an up-regulated expression, indicative of potential compensatory mechanisms to prevent microgravity-induced atrophy. Key genes isolated by unbiased systems analyses displayed a major overlap between tissue types and flight conditions and established TGF1 to be the most connected gene across all data sets. Finally, a set of microgravity responsive miRNA signature was identified and based on their predicted functional state and subsequent impact on health, a theoretical health risk score was calculated. The genes and miRNAs identified from our analyses can be targeted for future research involving efficient countermeasure design. Our study thus exemplifies the utility of GeneLab data repository to aid in the process of performing novel hypothesis based spaceflight research aimed at elucidating the global impact of environmental stressors at multiple biological scales.

  18. Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

    PubMed

    Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

    2007-01-01

    Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

  19. The Effect of Lateral Ankle Ligament Repair in Muscle Reaction Time in Patients with Mechanical Ankle Instability.

    PubMed

    Li, H-Y; Zheng, J-J; Zhang, J; Hua, Y-H; Chen, S-Y

    2015-11-01

    Studies have shown that functional ankle instability can result in prolonged muscle reaction time. However, the deficit in muscle reaction time in patients with mechanical ankle instability (MAI) and the effect of lateral ankle ligament repair on muscle reaction time are unclear. The purpose of this study was to identify the deficit in muscle reaction time, and to evaluate the role of lateral ligament repair in improving muscle reaction time in MAI patients. Sixteen MAI patients diagnosed with lateral ankle ligament tears by ultrasonography and magnetic resonance imaging underwent arthroscopic debridement and open lateral ankle ligament repair with a modified Broström procedure. One day before the operation, reaction times of the tibialis anterior and peroneus longus muscles were recorded following sudden inversion perturbation while walking on a custom walkway, and anterior drawer test (ADT) and American Orthopaedic Foot and Ankle Society (AOFAS) scale score were evaluated. Six months postoperatively, muscle reaction time, ADT and AOFAS scale score were reevaluated, and muscle reaction times in 15 healthy controls were also recorded. Preoperatively, the affected ankles in the MAI group had significantly delayed tibialis anterior and peroneus longus muscles reaction times compared with controls. Six months after the operation, median AOFAS scale scores were significantly greater than preoperatively, and ADT was negative in the MAI group. However, the affected ankles in the MAI group showed no difference in muscle reaction time compared with preoperative values. MAI patients had prolonged muscle reaction time. The modified Broström procedure produced satisfactory clinical outcomes in MAI patients, but did not shorten reaction times of the tibialis anterior and peroneus longus muscles. © Georg Thieme Verlag KG Stuttgart · New York.

  20. Musculoskeletal management of a patient with a history of chronic ankle sprains: identifying rupture of peroneal brevis and peroneal longus with diagnostic ultrasonography.

    PubMed

    Bruin, Dick B; von Piekartz, Harry

    2014-09-01

    The purpose of this case report is to describe the use of mobilization and eccentric exercise training for a patient with ankle pain and a history of chronic ankle sprains and discuss the course of diagnostic decision making when the patient did not respond to care. A 48-year-old police officer who had sustained multiple ankle sprains throughout his life presented with pain and restriction in his ability to walk, run, and work. The Global Rating of Change Scale score was - 6, the Numeric Pain Rating Scale score was 7/10, and the Lower Extremity Functional Scale score was - 33. Palpation of the peroneus longus and brevis muscles and inversion with overpressure reproduced the chief concern (Numeric Pain Rating Scale 7/10). The patient was initially diagnosed with chronic peroneal tendinopathy. Treatment included lateral translation mobilization of the talocrural joint combined with eccentric exercise using an elastic band for the peroneal muscles. The patient reported improvement in pain and function during the course of intervention but not as rapidly as expected. Therefore, follow-up ultrasonographic imaging and radiography were performed. These studies revealed partial rupture of the peroneal brevis muscle and total rupture of the peroneal longus muscle. A patient with long-term concerns of the foot complex with a diagnosis of peroneal tendinopathy showed slight improvement with eccentric exercises combined with manual therapy of the talocrural joint. After a course of treatment but minimal response, a diagnosis of tendon rupture was confirmed with diagnostic ultrasonography. Clinicians should be aware that when injuries do not improve with care, tendon rupture should be considered.

  1. Muscle Reaction Time During a Simulated Lateral Ankle Sprain After Wet-Ice Application or Cold-Water Immersion.

    PubMed

    Thain, Peter K; Bleakley, Christopher M; Mitchell, Andrew C S

    2015-07-01

    Cryotherapy is used widely in sport and exercise medicine to manage acute injuries and facilitate rehabilitation. The analgesic effects of cryotherapy are well established; however, a potential caveat is that cooling tissue negatively affects neuromuscular control through delayed muscle reaction time. This topic is important to investigate because athletes often return to exercise, rehabilitation, or competitive activity immediately or shortly after cryotherapy. To compare the effects of wet-ice application, cold-water immersion, and an untreated control condition on peroneus longus and tibialis anterior muscle reaction time during a simulated lateral ankle sprain. Randomized controlled clinical trial. University of Hertfordshire human performance laboratory. A total of 54 physically active individuals (age = 20.1 ± 1.5 years, height = 1.7 ± 0.07 m, mass = 66.7 ± 5.4 kg) who had no injury or history of ankle sprain. Wet-ice application, cold-water immersion, or an untreated control condition applied to the ankle for 10 minutes. Muscle reaction time and muscle amplitude of the peroneus longus and tibialis anterior in response to a simulated lateral ankle sprain were calculated. The ankle-sprain simulation incorporated a combined inversion and plantar-flexion movement. We observed no change in muscle reaction time or muscle amplitude after cryotherapy for either the peroneus longus or tibialis anterior (P > .05). Ten minutes of joint cooling did not adversely affect muscle reaction time or muscle amplitude in response to a simulated lateral ankle sprain. These findings suggested that athletes can safely return to sporting activity immediately after icing. Further evidence showed that ice can be applied before ankle rehabilitation without adversely affecting dynamic neuromuscular control. Investigation in patients with acute ankle sprains is warranted to assess the clinical applicability of these interventions.

  2. Surface electromyography and plantar pressure changes with novel gait training device in participants with chronic ankle instability.

    PubMed

    Feger, Mark A; Hertel, Jay

    2016-08-01

    Rehabilitation is ineffective at restoring normal gait in chronic ankle instability patients. Our purpose was to determine if a novel gait-training device could decrease plantar pressure on the lateral column of the foot in chronic ankle instability patients. Ten chronic ankle instability patients completed 30s trials of baseline and gait-training walking at a self-selected pace while in-shoe plantar pressure and surface electromyography were recorded from their anterior tibialis, peroneus longus, medial gastrocnemius, and gluteus medius. The gait-training device applied a medially-directed force to the lower leg via elastic bands during the entire gait cycle. Plantar pressure measures of the entire foot and 9 specific regions of the foot as well as surface electromyography root mean square areas were compared between the baseline and gait-training conditions using paired t-tests with a priori level of significance of p≤0.05. The gait-training device decreased pressure time integrals and peak pressures in the lateral midfoot (p=0.003 and p=0.003) and lateral forefoot (p=0.023 and p=0.005), and increased pressure time integrals and peak pressures for the total foot (p=0.030 and p=0.017) and hallux (p=0.005 and p=0.002). The center of pressure was shifted medially during the entire stance phase (p<0.003 for all comparisons) due to increased peroneus longus activity prior to (p=0.002) and following initial contact (p=0.002). The gait-training device decreased pressure on the lateral column of the foot and increased peroneus longus muscle activity. Future research should analyze the efficacy of the gait-training device during gait retraining for chronic ankle instability. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Cervical stability training with and without core stability training for patients with cervical disc herniation: A randomized, single-blind study.

    PubMed

    Buyukturan, B; Guclu-Gunduz, A; Buyukturan, O; Dadali, Y; Bilgin, S; Kurt, E E

    2017-11-01

    This study aims at evaluating and comparing the effects of cervical stability training to combined cervical and core stability training in patients with neck pain and cervical disc herniation. Fifty patients with neck pain and cervical disc herniation were included in the study, randomly divided into two groups as cervical stability and cervical-core stability. Training was applied three times a week in three phases, and lasted for a total duration of 8 weeks. Pain, activation and static endurance of deep cervical flexor muscles, static endurance of neck muscles, cross-sectional diameter of M. Longus Colli, static endurance of trunk muscles, disability and kinesiophobia were assessed. Pain, activation and static endurance of deep cervical flexors, static endurance of neck muscles, cross-sectional diameter of M. Longus Colli, static endurance of trunk muscles, disability and kinesiophobia improved in both groups following the training sessions (p < 0.05). Comparison of the effectiveness of these two training methods revealed that the cervical stability group produced a greater increase in the right transverse diameter of M. Longus Colli (p < 0.05). However, static endurance of trunk muscles and kinesiophobia displayed better improvement in the cervical-core stability group (p < 0.05). Cervical stability training provided benefit to patients with cervical disc herniation. The addition of core stability training did not provide any additional significant benefit. Further research is required to investigate the efficacy of combining other techniques with cervical stability training in patients with cervical disc herniation. Both cervical stability training and its combination with core stability training were significantly and similarly effective on neck pain and neck muscle endurance in patients with cervical disc herniation. © 2017 European Pain Federation - EFIC®.

  4. No effect of hypergravity on adult rat ventral horn neuron size or SDH activity

    NASA Technical Reports Server (NTRS)

    Roy, R. R.; Ishihara, A.; Moran, M. M.; Wade, C. E.; Edgerton, V. R.

    2001-01-01

    BACKGROUND: Spaceflights of short duration (approximately 2 wk) result in adaptations in the size and/or metabolic properties of a select population of motoneurons located in the lumbosacral region of the rat spinal cord. A decrease in succinate dehydrogenase (SDH, an oxidative marker enzyme) activity of moderately sized (500-800 microm2) motoneurons in the retrodorsolateral region of the spinal cord (L6) has been observed after a 14-d flight. HYPOTHESIS: Our hypothesis was that exposure to short-term hypergravity would result in adaptations in the opposite direction, reflecting a continuum of morphological and biochemical responses in the spinal motoneurons from zero gravity to hypergravity. METHODS: Young, male rats were centrifuged at either 1.5 or 2.0 G for 2 wk. The size and SDH activity of a population of motoneurons in the retrodorsolateral region of the spinal cord (L5) were determined and compared with age-matched rats maintained at 1.0 G. The absolute and relative (to body weight) masses of the soleus, gastrocnemius, adductor longus and tibialis anterior muscles were compared among the three groups. RESULTS: There were no effects of either hypergravity intervention on the motoneuron properties. Rats maintained under hypergravity conditions gained less body mass than rats kept at 1.0 G. For the 1.5 and 2.0 G groups, the muscle absolute mass was smaller and relative mass similar to that observed in the 1.0 G rats, except for the adductor longus. The adductor longus absolute mass was similar to and the relative mass larger in both hypergravity groups than in the 1.0 G group. CONCLUSIONS: Our hypothesis was rejected. The findings suggest that rat motoneurons are more responsive to short-term chronic exposure to spaceflight than to hypergravity conditions.

  5. Contributions of foot muscles and plantar fascia morphology to foot posture.

    PubMed

    Angin, Salih; Mickle, Karen J; Nester, Christopher J

    2018-03-01

    The plantar foot muscles and plantar fascia differ between different foot postures. However, how each individual plantar structure contribute to foot posture has not been explored. The purpose of this study was to investigate the associations between static foot posture and morphology of plantar foot muscles and plantar fascia and thus the contributions of these structures to static foot posture. A total of 111 participants were recruited, 43 were classified as having pes planus and 68 as having normal foot posture using Foot Posture Index assessment tool. Images from the flexor digitorum longus (FDL), flexor hallucis longus (FHL), peroneus longus and brevis (PER), flexor hallucis brevis (FHB), flexor digitorum brevis (FDB) and abductor hallucis (AbH) muscles, and the calcaneal (PF1), middle (PF2) and metatarsal (PF3) regions of the plantar fascia were obtained using a Venue 40 ultrasound system with a 5-13 MHz transducer. In order of decreasing contribution, PF3 > FHB > FHL > PER > FDB were all associated with FPI and able to explain 69% of the change in FPI scores. PF3 was the highest contributor explaining 52% of increases in FPI score. Decreased thickness was associated with increased FPI score. Smaller cross sectional area (CSA) in FHB and PER muscles explained 20% and 8% of increase in FPI score. Larger CSA of FDB and FHL muscles explained 4% and 14% increase in FPI score respectively. The medial plantar structures and the plantar fascia appear to be the major contributors to static foot posture. Elucidating the individual contribution of multiple muscles of the foot could provide insight about their role in the foot posture. Copyright © 2018. Published by Elsevier B.V.

  6. Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

    PubMed

    Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

    2015-04-02

    Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

  7. Effects provoked by chronic undernourishment on the fibre type composition and contractility of fast muscles in male and female developing rats.

    PubMed

    Pereyra-Venegas, J; Segura-Alegría, B; Guadarrama-Olmos, J C; Mariscal-Tovar, S; Quiróz-González, S; Jiménez-Estrada, I

    2015-10-01

    In this study, we compare the effects of pre- and post-natal food deprivation on the relative proportion of fibre types and contractile responses in the extensor digitorum longus (EDL) muscle of female and male rats at different post-natal ages. EDL muscles from undernourished male (UM) rats showed a higher proportion of Type IIB than IIA fibres and larger normalized twitch responses (with respect to muscle weight) than those of controls (CM). In contrast, EDL muscles from control (CF) and undernourished female rats (UF) showed no significant differences in their fibre type composition and normalized twitch forces at most of the ages analysed. Our data are indicative that the EDL muscles from undernourished males are more susceptible to the effects exerted by low food income than the EDL muscles from female rats. It is proposed that changes in the reactive oxygen species (ROS) concentration and hormonal factors, due to undernutrition, are involved in the alterations observed in the fibre type composition and force production of EDL muscles in undernourished male rats and that estrogens may have an antioxidant protective role on the undernourished EDL muscles in female rats. Journal of Animal Physiology and Animal Nutrition © 2014 Blackwell Verlag GmbH.

  8. Effects of Pleiotrophin Overexpression on Mouse Skeletal Muscles in Normal Loading and in Actual and Simulated Microgravity

    PubMed Central

    Liantonio, Antonella; De Bellis, Michela; Cannone, Maria; Sblendorio, Valeriana; Conte, Elena; Mele, Antonietta; Tricarico, Domenico; Tavella, Sara; Ruggiu, Alessandra; Cancedda, Ranieri; Ohira, Yoshinobu; Danieli-Betto, Daniela; Ciciliot, Stefano; Germinario, Elena; Sandonà, Dorianna; Betto, Romeo; Desaphy, Jean-François

    2013-01-01

    Pleiotrophin (PTN) is a widespread cytokine involved in bone formation, neurite outgrowth, and angiogenesis. In skeletal muscle, PTN is upregulated during myogenesis, post-synaptic induction, and regeneration after crushing, but little is known regarding its effects on muscle function. Here, we describe the effects of PTN on the slow-twitch soleus and fast-twitch extensor digitorum longus (EDL) muscles in mice over-expressing PTN under the control of a bone promoter. The mice were maintained in normal loading or disuse condition, induced by hindlimb unloading (HU) for 14 days. Effects of exposition to near-zero gravity during a 3-months spaceflight (SF) into the Mice Drawer System are also reported. In normal loading, PTN overexpression had no effect on muscle fiber cross-sectional area, but shifted soleus muscle toward a slower phenotype, as shown by an increased number of oxidative type 1 fibers, and increased gene expression of cytochrome c oxidase subunit IV and citrate synthase. The cytokine increased soleus and EDL capillary-to-fiber ratio. PTN overexpression did not prevent soleus muscle atrophy, slow-to-fast transition, and capillary regression induced by SF and HU. Nevertheless, PTN exerted various effects on sarcolemma ion channel expression/function and resting cytosolic Ca2+ concentration in soleus and EDL muscles, in normal loading and after HU. In conclusion, the results show very similar effects of HU and SF on mouse soleus muscle, including activation of specific gene programs. The EDL muscle is able to counterbalance this latter, probably by activating compensatory mechanisms. The numerous effects of PTN on muscle gene expression and functional parameters demonstrate the sensitivity of muscle fibers to the cytokine. Although little benefit was found in HU muscle disuse, PTN may emerge useful in various muscle diseases, because it exerts synergetic actions on muscle fibers and vessels, which could enforce oxidative metabolism and ameliorate muscle performance. PMID:24015201

  9. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

    PubMed

    Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

    2005-04-01

    The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

  10. The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

    DTIC Science & Technology

    1999-05-01

    Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

  11. The miRNA Transcriptome Directly Reflects the Physiological and Biochemical Differences between Red, White, and Intermediate Muscle Fiber Types

    PubMed Central

    Ma, Jideng; Wang, Hongmei; Liu, Rui; Jin, Long; Tang, Qianzi; Wang, Xun; Jiang, Anan; Hu, Yaodong; Li, Zongwen; Zhu, Li; Li, Ruiqiang; Li, Mingzhou; Li, Xuewei

    2015-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that can regulate their target genes at the post-transcriptional level. Skeletal muscle comprises different fiber types that can be broadly classified as red, intermediate, and white. Recently, a set of miRNAs was found expressed in a fiber type-specific manner in red and white fiber types. However, an in-depth analysis of the miRNA transcriptome differences between all three fiber types has not been undertaken. Herein, we collected 15 porcine skeletal muscles from different anatomical locations, which were then clearly divided into red, white, and intermediate fiber type based on the ratios of myosin heavy chain isoforms. We further illustrated that three muscles, which typically represented each muscle fiber type (i.e., red: peroneal longus (PL), intermediate: psoas major muscle (PMM), white: longissimus dorsi muscle (LDM)), have distinct metabolic patterns of mitochondrial and glycolytic enzyme levels. Furthermore, we constructed small RNA libraries for PL, PMM, and LDM using a deep sequencing approach. Results showed that the differentially expressed miRNAs were mainly enriched in PL and played a vital role in myogenesis and energy metabolism. Overall, this comprehensive analysis will contribute to a better understanding of the miRNA regulatory mechanism that achieves the phenotypic diversity of skeletal muscles. PMID:25938964

  12. Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

    PubMed

    Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

    2018-06-01

    The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  13. Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

    2008-01-15

    We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

  14. The impact of the AASHTO LRFD design code on bridge stiffness and strength : Part 1 : methods and design comparisons.

    DOT National Transportation Integrated Search

    2007-01-01

    The Commonwealth of Virginia is currently transitioning from the long-used AASHTO Allowable Stress Design (ASD) specification to AASHTO's Load and Resistance Factor Design (LRFD) specification. The new specification features revised live loads, more ...

  15. Medial Tibial Stress Syndrome: Muscles Located at the Site of Pain

    PubMed Central

    Brown, Ato Ampomah

    2016-01-01

    Objective. The purpose of this study was to examine the relationship between the location of the MTSS pain (posteromedial border of tibia) and the muscles that originate from that site. Method. The study was conducted in the Department of Anatomy of the School of Medical Sciences, University of Cape Coast, and involved the use of 22 cadaveric legs (9 paired and 4 unpaired) from 11 males and 2 females. Findings. The structures that were thus observed to attach directly to the posteromedial border of the tibia were the soleus, the flexor digitorum longus, and the deep crural fascia. The soleus and flexor digitorum longus muscles were observed to attach directly to the posteromedial border of the tibia. The tibialis posterior muscle had no attachment to this site. Conclusion. The findings of this study suggest that if traction is the cause of MTSS then soleus and the flexor digitorum muscles and not the tibialis posterior muscle are the likely cause of MTSS. PMID:27066291

  16. Effect of wrist and interphalangeal thumb movement on zone T2 flexor pollicis longus tendon tension in a human cadaver model.

    PubMed

    Rappaport, Patricia O; Thoreson, Andrew R; Yang, Tai-Hua; Reisdorf, Ramona L; Rappaport, Stephen M; An, Kai-Nan; Amadio, Peter C

    2015-01-01

    Therapy after flexor pollicis longus (FPL) repair typically mimics finger flexor management, but this ignores anatomic and biomechanical features unique to the FPL. We measured FPL tendon tension in zone T2 to identify biomechanically appropriate exercises for mobilizing the FPL. Eight human cadaver hands were studied to identify motions that generated enough force to achieve FPL movement without exceeding hypothetical suture strength. With the carpometacarpal and metacarpophalangeal joints blocked, appropriate forces were produced for both passive interphalangeal (IP) motion with 30° wrist extension and simulated active IP flexion from 0° to 35° with the wrist in the neutral position. This work provides a biomechanical basis for safely and effectively mobilizing the zone T2 FPL tendon. Our cadaver study suggests that it is safe and effective to perform early passive and active exercise to an isolated IP joint. NA. Copyright © 2015 Hanley & Belfus. Published by Elsevier Inc. All rights reserved.

  17. Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

    PubMed

    de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

    2007-10-01

    The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

  18. Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

    PubMed

    Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

    2016-07-01

    To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

  19. Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

    PubMed

    Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

    2013-10-01

    To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. 46 CFR 164.019-3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

  1. Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

    2011-04-15

    Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

  2. Interstellar C IV and Si IV column densities toward early-type stars

    NASA Technical Reports Server (NTRS)

    Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

    1980-01-01

    Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

  3. Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

    PubMed

    Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

    2013-04-01

    Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

  4. The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

    DOT National Transportation Integrated Search

    1989-11-01

    The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

  5. Overuse Injury Assessment Model

    DTIC Science & Technology

    2005-03-01

    superficialis Hip (Pelvis) Flexion Iliopsoas complex, rectus femoris, tensor fasciae latae, sartorius, pectineus Extension Semitendinosus, semimembranosus...Plantar flexion Gastrocnemius, soleus, tibialis posterior, peroneous muscles, Foot flexor muscles Spine Flexion Rectus abdominis, oblique muscles Extension...digitorum superficialis Hip Flexion Iliopsoas complex, rectus femoris, tensor fasciae latae, sartorius, pectineus, adductor magnus, adductor longus

  6. Modulation of the Fibularis Longus Hoffmann Reflex and Postural Instability Associated With Chronic Ankle Instability

    PubMed Central

    Kim, Kyung-Min; Hart, Joseph M.; Saliba, Susan A.; Hertel, Jay

    2016-01-01

    Context: Individuals with chronic ankle instability (CAI) present with decreased modulation of the Hoffmann reflex (H-reflex) from a simple to a more challenging task. The neural alteration is associated with impaired postural control, but the relationship has not been investigated in individuals with CAI. Objective: To determine differences in H-reflex modulation and postural control between individuals with or without CAI and to identify if they are correlated in individuals with CAI. Design: Descriptive laboratory study. Setting: Laboratory. Patients or Other Participants: A total of 15 volunteers with CAI (9 males, 6 females; age = 22.6 ± 5.8 years, height = 174.7 ± 8.1 cm, mass = 74.9 ± 12.8 kg) and 15 healthy sex-matched volunteers serving as controls (9 males, 6 females; age = 23.8 ± 5.8 years, height = 171.9 ± 9.9 cm, mass = 68.9 ± 15.5 kg) participated. Intervention(s): Maximum H-reflex (Hmax) and motor wave (Mmax) from the soleus and fibularis longus were recorded while participants lay prone and then stood in unipedal stance. We assessed postural tasks of unipedal stance with participants' eyes closed for 10 seconds using a forceplate. Main Outcome Measure(s): We normalized Hmax to Mmax to obtain Hmax : Mmax ratios for the 2 positions. For each muscle, H-reflex modulation was quantified using the percentage change scores in Hmax : Mmax ratios calculated from prone position to unipedal stance. Center-of-pressure data were used to compute 4 time-to-boundary variables. Separate independent-samples t tests were performed to determine group differences. Pearson product moment correlation coefficients were calculated between the modulation and balance measures in the CAI group. Results: The CAI group presented less H-reflex modulation in the soleus (t26 = −3.77, P = .001) and fibularis longus (t25 = −2.59, P = .02). The mean of the time-to-boundary minima in the anteroposterior direction was lower in the CAI group (t28 = −2.06, P = .048). We observed a correlation (r = 0.578, P = .049) between the fibular longus modulation and mean of time-to-boundary minima in the anteroposterior direction. Conclusions: The strong relationship indicated that, as H-reflex amplitude in unipedal stance was less down modulated, unipedal postural control was more impaired. Given the deficits in H-reflex modulation and postural control in the CAI group, the relationship may provide insights into the neurophysiologic mechanism of postural instability. PMID:27583692

  7. Treatment of mallet finger deformity with a modified palmaris longus tendon graft through a bone tunnel.

    PubMed

    Liu, Zengbing; Ma, Kai; Huang, Dong

    2018-01-01

    To investigate the clinical effect of treating mallet finger deformity using a modified palmaris longus tendon graft through a bone tunnel. Altogether, 21 patients with mallet finger deformity (16 men, 5 women; average age 31 years, range 19-47 years) were treated with a modified palmaris longus tendon graft through a bone tunnel during 18 months (2014-2016). Four index fingers, seven middle fingers, eight ring fingers, and two little fingers were treated for four cutting injuries, eleven finger sprains, four crush injuries, and two twist injuries (7 open and 14 closed injuries). Duration from injury to surgery was 9 h to 13 weeks. Three patients underwent surgery after 6 weeks of unsuccessful conservative treatment. No tendon was attached to the extensor tendon insertion in 16 patients, and 5 had residual tendon of <0.2 cm attached. All patients had distal segment flexion deformity and dorsiflexion disorder. Surgery comprised transverse penetration and vertical drilling of the base of the distal phalanx (2.0 and 2.5 mm diameter drills). Equal shallow semitendinosus pieces of the palmaris longus tendon (4 cm) were obtained from the sagittal end and were passed through a dorsal bone hole, emerging from a transverse bone hole. The two bundles were sutured to the main tendon. Tension was adjusted, and the broken ends were sutured. The distal interphalangeal joints were fixed in hyperextension. All patients were followed for 7-16 months (average 6.0 ± 0.3 months) postoperatively. All 21 patients had grade A wound healing, with no complications (e.g., necrotic wound, recurrence, joint stiffness). The mallet finger deformity was corrected with good appearance, no obvious abnormalities, and satisfactory flexion and extension. Two patients had a superficial wound infection. Each recovered after symptomatic treatment. One patient had a mild result, with limited extension. There were no recurrences. Results were evaluated according to Patel et al.'s system, which revealed 15 excellent and 5 good results (combined 95.23% rate), with 1 mild result (limited extension). Patients were satisfied with the appearance and function of the affected fingers, and the desired surgical end result was achieved. Use of this modified surgery for treating mallet finger deformity, especially with no or little tendon attached at the extensor tendon insertion, results in nearly anatomical reconstruction of the extensor tendon insertion. Its advantages include simple surgery, reliable fixation, fewer complications, and clinical efficacy.

  8. An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

    DTIC Science & Technology

    1994-09-01

    wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

  9. Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

    PubMed Central

    Cosgrove, Dominic; Liu, Shiguang

    2016-01-01

    Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

  10. Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

    PubMed

    Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

    2015-06-01

    The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

  11. Genetics Home Reference: glycogen storage disease type IV

    MedlinePlus

    ... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

  12. Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

    PubMed

    Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

    2017-07-01

    The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Cold exposure increases slow-type myosin heavy chain 1 (MyHC1) composition of soleus muscle in rats.

    PubMed

    Mizunoya, Wataru; Iwamoto, Yohei; Sato, Yusuke; Tatsumi, Ryuichi; Ikeuchi, Yoshihide

    2014-03-01

    The aim of this study was to examine the effects of cold exposure on rat skeletal muscle fiber type, according to myosin heavy chain (MyHC) isoform and metabolism-related factors. Male Wistar rats (7 weeks old) were housed individually at 4 ± 2°C as a cold-exposed group or at room temperature (22 ± 2°C) as a control group for 4 weeks. We found that cold exposure significantly increased the slow-type MyHC1 content in the soleus muscle (a typical slow-type fiber), while the intermediate-type MyHC2A content was significantly decreased. In contrast to soleus, MyHC composition of extensor digitorum longus (EDL, a typical fast-type fiber) and gastrocnemius (a mix of slow-type and fast-type fibers) muscle did not change from cold exposure. Cold exposure increased mRNA expression of mitochondrial uncoupling protein 3 (UCP3) in both the soleus and EDL. Cold exposure also increased mRNA expression of myoglobin, peroxisome proliferator-activated receptor gamma coactivator 1α (PGC1α) and forkhead box O1 (FOXO1) in the soleus. Upregulation of UCP3 and PGC1α proteins were observed with Western blotting in the gastrocnemius. Thus, cold exposure increased metabolism-related factors in all muscle types that were tested, but MyHC isoforms changed only in the soleus. © 2013 Japanese Society of Animal Science.

  14. 10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

  15. Beneficial effects of voluntary wheel running on the properties of dystrophic mouse muscle.

    PubMed

    Hayes, A; Williams, D A

    1996-02-01

    Effects of voluntary exercise on the isometric contractile, fatigue, and histochemical properties of hindlimb dystrophic (mdx and 129ReJ dy/dy) skeletal muscles were investigated. Mice were allowed free access to a voluntary running wheel at 4 wk of age for a duration of 16 (mdx) or 5 (dy/dy) wk. Running performance of mdx mice (approximately 4 km/day at 1.6 km/h) was inferior to normal mice (approximately 6.5 km/day at 2.1 km/h). However, exercise improved the force output (approximately 15%) and the fatigue resistance of both C57BL/10 and mdx soleus muscles. These changes coincided with increased proportions of smaller type I fibers and decreased proportions of larger type IIa fibers in the mdx soleus. The extensor digitorum longus of mdx, but not of normal, mice also exhibited improved resistance to fatigue and conversion towards oxidative fiber types. The dy/dy animals were capable of exercising, yet ran significantly less than normal animals (approximately 0.5 km/day). Despite this, running increased the force output of the plantaris muscle (approximately 50%). Taken together, the results showed that exercise can have beneficial effects on dystrophic skeletal muscles.

  16. Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

    PubMed

    Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

    1970-12-01

    Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

  17. Alport Syndrome Diagnosis

    MedlinePlus

    ... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

  18. Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

    PubMed

    Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

    2010-08-01

    Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  19. The Compact Mutation of Myostatin Causes a Glycolytic Shift in the Phenotype of Fast Skeletal Muscles

    PubMed Central

    Baán, Júlia Aliz; Kocsis, Tamás; Keller-Pintér, Anikó; Müller, Géza; Zádor, Ernö; Dux, László

    2013-01-01

    Myostatin is an important negative regulator of skeletal muscle growth. The hypermuscular Compact (Cmpt) mice carry a 12-bp natural mutation in the myostatin propeptide, with additional modifier genes being responsible for the phenotype. Muscle cellularity of the fast-type tibialis anterior (TA) and extensor digitorum longus (EDL) as well as the mixed-type soleus (SOL) muscles of Cmpt and wild-type mice was examined by immunohistochemical staining of the myosin heavy chain (MHC) proteins. In addition, transcript levels of MHC isoforms were quantified by qPCR. Based on our results, all investigated muscles of Cmpt mice were significantly larger compared with that of wild-type mice, as characterized by fiber hyperplasia of different grades. Fiber hypertrophy was not present in TA; however, EDL muscles showed specific IIB fiber hypertrophy while the (I and IIA) fibers of SOL muscles were generally hypertrophied. Both the fast TA and EDL muscles of Cmpt mice contained significantly more glycolytic IIB fibers accompanied by a decreased number of IIX and IIA fibers; however, this was not the case for SOL muscles. In summary, despite the variances found in muscle cellularity between the different myostatin mutant mice, similar glycolytic shifts were observed in Cmpt fast muscles as in muscles from myostatin knockout mice. PMID:23979839

  20. Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

    PubMed

    Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

    2006-11-01

    Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

  1. A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

    PubMed

    Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

    2018-05-17

    Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

    PubMed

    Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

    2012-01-01

    Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

  3. Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

    PubMed Central

    Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

    2015-01-01

    Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

  4. Root canal morphology of South Asian Indian maxillary molar teeth

    PubMed Central

    Singh, Shishir; Pawar, Mansing

    2015-01-01

    Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

  5. Responses of skeletal muscle to unloading, a review

    NASA Technical Reports Server (NTRS)

    Tischler, M. E.; Jaspers, S. R.; Henriksen, E. J.; Jacob, S.

    1985-01-01

    Suspension models were used to study muscle response to reduced activity. During 6 days of tail casting, the soleus (SOL) atrophies while the extensor digitorum longus grows relatively normally. After discounting those changes in both muscles due primarily to increased secretion of adrenal hormones, the following conclusions regarding the specific responses of the SOL could be drawn: (1) Atrophy is probably due primarily to increased protein degradation; (2) Decreased synthesis of glutamine may result from reduced availability of ammonia due to diminished use of ATP; (3) Greater muscle glycogen seems to reflect an increased response to insulin of glucose uptake which leads to greater glucose metabolism; and (4) Faster catabolism of branched-chain amino acids can be attributed to enhanced flux through ketoacid dehydrogenase. Studies by others using tail casted suspended rats showed in the SOL: (1) a gradual switch from type 1 to type 2 fibers; (2) increased acid protease activity; and (3) altered muscle function and contractile duration. Using harness suspended rats, others showed in the SOL: (1) significant atrophy; (2) increased numbers of glucocorticoid receptors; and (3) no change in muscle fatigability.

  6. Responses of skeletal muscle to unloading - A review

    NASA Technical Reports Server (NTRS)

    Tischler, M. E.; Jaspers, S. R.; Henriksen, E. J.; Jacob, S.

    1985-01-01

    Suspension models were used to study muscle response to reduced activity. During 6 days of tail casting, the soleus (SOL) atrophies while the extensor digitorum longus grows relatively normally. After discounting those changes in both muscles due primarily to increased secretion of adrenal hormones, the following conclusions regarding the specific responses of the SOL could be drawn: (1) Atrophy is probably due primarily to increased protein degradation; (2) Decreased synthesis of glutamine may result from reduced availability of ammonia due to diminished use of ATP; (3) Greater muscle glycogen seems to reflect an increased response to insulin of glucose uptake which leads to greater glucose metabolism; and (4) Faster catabolism of branched-chain amino acids can be attributed to enhanced flux through ketoacid dehydrogenase. Studies by others using tail casted suspended rats showed in the SOL: (1) a gradual switch from type 1 to type 2 fibers; (2) increased acid protease activity; and (3) altered muscle function and contractile duration. Using harness suspended rats, others showed in the SOL: (1) significant atrophy; (2) increased numbers of glucocorticoid receptors; and (3) no change in muscle fatigability.

  7. Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

    PubMed

    Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

    2014-08-12

    Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

  8. Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

    PubMed

    Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

    2009-06-01

    Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

  9. Nandrolone decanoate treatment affects sarcoplasmic reticulum Ca(2+) ATPase function in skinned rat slow- and fast-twitch fibres.

    PubMed

    Bouhlel, Aicha; Joumaa, Wissam H; Léoty, Claude

    2003-09-01

    The effects of anabolic-androgenic steroid administration on the function of the sarcoplasmic reticulum (SR) pump were investigated in chemically skinned fibres from the extensor digitorum longus (EDL) and soleus muscles of sedentary rats. Twenty male rats were divided into two groups, one group received an intramuscular injection of nandrolone decanoate (15 mg x kg(-1)) weekly for 8 weeks, the second received similar weekly doses of vehicle (sterile peanut oil). Compared with control muscles, nandrolone decanoate treatment reduced SR Ca(2+) loading in EDL and soleus fibres by 49% and 29%, respectively. In control and treated muscles, the rate of Ca(2+) leakage depended on the quantity of Ca(2+) loaded. Furthermore, for similar SR Ca(2+) contents, the Ca(2+) leakage rate was not significantly modified by nandrolone decanoate treatment. Nandrolone decanoate treatment thus affects Ca (2+) uptake by the SR in a fibre-type dependent manner.

  10. Localization of brain-derived neurotrophic factor, neurotrophin-4, tropomyosin-related kinase b receptor, and p75 NTR receptor by high-resolution immunohistochemistry on the adult mouse neuromuscular junction.

    PubMed

    Garcia, Neus; Tomàs, Marta; Santafe, Manel M; Lanuza, M Angel; Besalduch, Nuria; Tomàs, Josep

    2010-03-01

    Neurotrophins and their receptors, the trk receptor tyrosine kinases (trks) and p75(NTR), are differentially expressed among the cell types that make up synapses. It is important to determine the precise location of these molecules involved in neurotransmission. Here we use immunostaining and Western blotting to study the localization and expression of neurotrophin brain-derived neurotrophic factor (BDNF) and neurotrophin-4 (NT-4) and the receptors tropomyosin-related kinase b (trkB) and p75(NTR) at the adult neuromuscular junction. Our confocal immunofluorescence results on the whole mounts of the mouse Levator auris longus muscle and on semithin cross-sections showed that BDNF, NT-4, trkB, and p75(NTR) were localized on the three cells in the neuromuscular synapse (motor axons, post-synaptic muscle and Schwann cells).

  11. Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

    2012-08-15

    Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

  12. Play in and around the Ancient Novel

    ERIC Educational Resources Information Center

    Kidd, Stephen E.

    2017-01-01

    The episodic structuring of ancient novels gives rise to the impression that they are not a serious genre in contrast to other genres like tragedy. Episodic plots tend to imply a playfulness not bound to causality but instead a spontaneity that includes the freedom to reinvent themselves. The author argues that novels like Longus's "Daphnis…

  13. Determining physiological cross-sectional area of extensor carpi radialis longus and brevis as a whole and by regions using 3D computer muscle models created from digitized fiber bundle data.

    PubMed

    Ravichandiran, Kajeandra; Ravichandiran, Mayoorendra; Oliver, Michele L; Singh, Karan S; McKee, Nancy H; Agur, Anne M R

    2009-09-01

    Architectural parameters and physiological cross-sectional area (PCSA) are important determinants of muscle function. Extensor carpi radialis longus (ECRL) and brevis (ECRB) are used in muscle transfers; however, their regional architectural differences have not been investigated. The aim of this study is to develop computational algorithms to quantify and compare architectural parameters (fiber bundle length, pennation angle, and volume) and PCSA of ECRL and ECRB. Fiber bundles distributed throughout the volume of ECRL (75+/-20) and ECRB (110+/-30) were digitized in eight formalin embalmed cadaveric specimens. The digitized data was reconstructed in Autodesk Maya with computational algorithms implemented in Python. The mean PCSA and fiber bundle length were significantly different between ECRL and ECRB (p < or = 0.05). Superficial ECRL had significantly longer fiber bundle length than the deep region, whereas the PCSA of superficial ECRB was significantly larger than the deep region. The regional quantification of architectural parameters and PCSA provides a framework for the exploration of partial tendon transfers of ECRL and ECRB.

  14. Sports hernia repair with adductor tenotomy.

    PubMed

    Harr, J N; Brody, F

    2017-02-01

    Sports hernias, or athletic pubalgia, is common in athletes, and primarily involves injury to the fascia, muscles, and tendons of the inguinal region near their insertion onto the pubic bone. However, management varies widely, and rectus and adductor tenotomies have not been adequately described. The purpose of this manuscript is to demonstrate a suture repair and a rectus and adductor longus tenotomy technique for sports hernias. After magnetic-resonance-imaging confirmation of sports hernias with rectus and adductor tendonitis, 22 patients underwent a suture herniorrhaphy with adductor tenotomy. The procedure is performed through a 4-cm incision, and a fascial release of the rectus abdominis and adductor tenotomy is performed to relieve the opposing vector forces on the pubic bone. All 22 patients returned to their respective sports and regained their ability to perform at a high level, including professional status. No further surgery was required. In athletes with MRI confirmation of rectus and adductor longus injuries, tenotomies along with a herniorraphy may improve outcomes. A suture repair to reinforce the inguinal floor prevents mesh-related complications, especially in young athletes.

  15. Protein degradation in skeletal muscle during experimental hyperthyroidism in rats and the effect of beta-blocking agents.

    PubMed

    Angerås, U; Hasselgren, P O

    1987-04-01

    beta-Blocking agents are increasingly used in the management of hyperthyroid patients. The effect of this treatment on increased muscle protein breakdown in the hyperthyroid state is not known. In the present study, experimental hyperthyroidism was induced in rats by daily ip injections of T3 (100 micrograms/100 g BW) during a 10-day period. Control animals received corresponding volumes of solvent. In groups of rats the selective beta-1-blocking agent metoprolol or the nonselective beta-blocker propranolol was infused by miniosmotic pumps implanted sc on the backs of the animals. Protein degradation was measured in incubated intact soleus and extensor digitorum longus muscles by determining tyrosine release into the incubation medium. The protein degradation rate in incubated extensor digitorum longus and soleus muscles was increased by 50-60% during T3 treatment. Metoprolol or propranolol did not influence muscle protein breakdown in either T3-treated or control animals. The results suggest that T3-induced increased muscle proteolysis is not mediated by beta-receptors, and muscle weakness and wasting in hyperthyroidism might not be affected by beta-blockers.

  16. Relative strengths of the calf muscles based on MRI volume measurements.

    PubMed

    Jeng, Clifford L; Thawait, Gaurav K; Kwon, John Y; Machado, Antonio; Boyle, James W; Campbell, John; Carrino, John A

    2012-05-01

    In 1985, Silver et al. published a cadaver study which determined the relative order of strength of the muscles in the calf. Muscle strength, which is proportional to volume, was obtained by dissecting out the individual muscles, weighing them, and then multiplying by the specific gravity. No similar studies have been performed using {\\it in vivo} measurements of muscle volume. Ten normal subjects underwent 3-Tesla MRI's of both lower extremities using non-fat-saturated T2 SPACE sequences. The volume for each muscle was determined by tracing the muscle contour on sequential axial images and then interpolating the volume using imaging software. The results from this study differ from Silver's original article. The lateral head of the gastrocnemius was found to be stronger than the tibialis anterior muscle. The FHL and EDL muscles were both stronger than the peroneus longus. There was no significant difference in strength between the peroneus longus and brevis muscles. This revised order of muscle strengths in the calf based on in vivo MRI findings may assist surgeons in determining the optimal tendons to transfer in order to address muscle weakness and deformity.

  17. Neurons of human nucleus accumbens.

    PubMed

    Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

    2011-08-01

    Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

  18. Adaptive strength gains in dystrophic muscle exposed to repeated bouts of eccentric contraction

    PubMed Central

    Call, Jarrod A.; Eckhoff, Michael D.; Baltgalvis, Kristen A.; Warren, Gordon L.

    2011-01-01

    The objective of this study was to determine the functional recovery and adaptation of dystrophic muscle to multiple bouts of contraction-induced injury. Because lengthening (i.e., eccentric) contractions are extremely injurious for dystrophic muscle, it was considered that repeated bouts of such contractions would exacerbate the disease phenotype in mdx mice. Anterior crural muscles (tibialis anterior and extensor digitorum longus) and posterior crural muscles (gastrocnemius, soleus, and plantaris) from mdx mice performed one or five repeated bouts of 100 electrically stimulated eccentric contractions in vivo, and each bout was separated by 10–18 days. Functional recovery from one bout was achieved 7 days after injury, which was in contrast to a group of wild-type mice, which still showed a 25% decrement in electrically stimulated isometric torque at that time point. Across bouts there was no difference in the immediate loss of strength after repeated bouts of eccentric contractions for mdx mice (−70%, P = 0.68). However, after recovery from each bout, dystrophic muscle had greater torque-generating capacity such that isometric torque was increased ∼38% for both anterior and posterior crural muscles at bout 5 compared with bout 1 (P < 0.001). Moreover, isolated extensor digitorum longus muscles excised from in vivo-tested hindlimbs 14–18 days after bout 5 had greater specific force than contralateral control muscles (12.2 vs. 10.4 N/cm2, P = 0.005) and a 20% greater maximal relaxation rate (P = 0.049). Additional adaptations due to the multiple bouts of eccentric contractions included rapid recovery and/or sparing of contractile proteins, enhanced parvalbumin expression, and a decrease in fiber size variability. In conclusion, eccentric contractions are injurious to dystrophic skeletal muscle; however, the muscle recovers function rapidly and adapts to repeated bouts of eccentric contractions by improving strength. PMID:21960659

  19. Anatomical feasibility study of flexor hallucis longus transfer in treatment of Achilles tendon and posteromedial portal of ankle arthroscopy.

    PubMed

    Mao, Haijiao; Wang, Linger; Dong, Wenwei; Liu, Zhenxin; Yin, Weigang; Xu, Dachuan; Wapner, Keith L

    2018-04-16

    The aim of this study was to evaluate the occurrence of anatomical variations of the musculotendinous junction of the flexor hallucis longus (FHL) muscle, the relationship between FHL tendon or muscle and the tibial neurovascular bundle at the level of the posterior ankle joint in human cadavers. Seventy embalmed feet from 20 male and 15 female cadavers, the cadavers' mean age was 65.4 (range from 14 to 82) years, were dissected and anatomically classified to observe FHL muscle morphology define the relationship between FHL tendon or muscle and the tibial neurovascular bundle. The distance between the musculotendinous junction and the relationship between FHL tendon or muscle and the tibial neurovascular bundle was determined. Three morphology types of FHL muscle were identified: a long lateral and shorter medial muscle belly, which was observed in 63 specimens (90%); equal length medial and lateral muscle bellies, this variant was only observed in five specimens (7.1%); one lateral and no medial muscle belly, which was observed in two specimens (2.9%). No statistically significant difference was observed according to gender or side (p > 0.05). Two patterns were identified and described between FHL tendon or muscle and the tibial neurovascular bundle. Pattern 1, the distance between the neurovascular bundle and FHL tendon was 3.46 mm (range 2.34-8.84, SD = 2.12) which was observed in 66 specimens (94.3%); Pattern 2, there was no distance which was observed in four specimens (5.7%). Knowing FHL muscle morphology, variations provide new important insights into secure planning and execution of a FHL transfer for Achilles tendon defect as well as for the interpretation of ultrasound and magnetic resonance images. With posterior arthroscopic for the treatment of various ankle pathologies, posteromedial portal may be introduced into the posterior aspect of the ankle without gross injury to the tibial neurovascular structures because of the gap between the neurovascular bundle and FHL tendon.

  20. Matching of sarcoplasmic reticulum and contractile properties in rat fast- and slow-twitch muscle fibres.

    PubMed

    Trinh, Huong H; Lamb, Graham D

    2006-07-01

    1. The twitch characteristics (fast-twitch or slow-twitch) of skeletal muscle fibres are determined not only by the contractile apparatus properties of the fibre, but also by the time-course of Ca2+ release and re-uptake by the sarcoplasmic reticulum (SR). The present study examined, in individual fibres from non-transforming muscle of the rat, whether particular SR properties are matched to the contractile apparatus properties of the fibre, in particular in the case of fibres with fast-twitch contractile apparatus located in a slow-twitch muscle, namely the soleus. 2. Force was recorded in single, mechanically skinned fibres from extensor digitorum longus (EDL), gastrocnemius, peroneus longus and soleus muscles. Using repeated cycles in which the SR was emptied of all releasable Ca2+ and then reloaded, it was possible to determine the relative amount of Ca2+ present in the SR endogenously, the maximum SR capacity and the rate of Ca2+ loading. The sensitivity of the contractile apparatus to Ca2+ and Sr2+ was used to classify the fibres as fast-twitch (FT), slow-twitch (ST) or mixed (< 3% of the fibres examined) and thereby identify the likely troponin C and myosin heavy chain types present. 3. There was no significant difference in SR properties between the groups of FT fibres obtained from the four different muscles, including soleus. Despite some overlap in the SR properties of individual fibres between the FT and ST groups, the properties of the FT fibres in all four muscles studied were significantly different from those of the ST and mixed fibres. 4. In general, in FT fibres the SR had a larger capacity and the endogenous Ca2+ content was a relatively lower percentage of maximum compared with ST fibres. Importantly, in terms of their SR properties, FT fibres from soleus muscle more closely resembled FT fibres from other muscles than they did ST fibres from soleus muscle.

  1. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  2. Effects of 2 ankle destabilization devices on electromyography measures during functional exercises in individuals with chronic ankle instability.

    PubMed

    Donovan, Luke; Hart, Joseph M; Hertel, Jay

    2015-03-01

    Randomized crossover laboratory study. To determine the effects of ankle destabilization devices on surface electromyography (sEMG) measures of selected lower extremity muscles during functional exercises in participants with chronic ankle instability. Ankle destabilization devices are rehabilitation tools that can be worn as a boot or sandal to increase lower extremity muscle activation during walking in healthy individuals. However, they have not been tested in a population with pathology. Fifteen adults with chronic ankle instability participated. Surface electromyography electrodes were located over the anterior tibialis, fibularis longus, lateral gastrocnemius, rectus femoris, biceps femoris, and gluteus medius. The activity level of these muscles was recorded in a single testing session during unipedal stance with eyes closed, the Star Excursion Balance Test, lateral hops, and treadmill walking. Each task was performed under 3 conditions: shod, ankle destabilization boot, and ankle destabilization sandal. Surface electromyography signal amplitudes were measured for each muscle during each exercise for all 3 conditions. Participants demonstrated a significant increase, with moderate to large effect sizes, in sEMG signal amplitude of the fibularis longus in the ankle destabilization boot and ankle destabilization sandal conditions during the unipedal eyes-closed balance test, the Star Excursion Balance Test in the anterior and posteromedial directions, lateral hops, and walking, when compared to the shod condition. Both devices also resulted in an increase in sEMG signal amplitudes, with large effect sizes of the lateral gastrocnemius, rectus femoris, biceps femoris, and gluteus medius during the unipedal-stance-with-eyes-closed test, compared to the shod condition. Wearing ankle destabilization devices caused greater muscle activation during functional exercises in individuals with chronic ankle instability. Based on the magnitude of the effect, there were consistent increases in fibularis longus sEMG amplitudes during the unipedal eyes-closed balance test, the Star Excursion Balance Test in the anterior and posteromedial directions, and pre-initial contact and post-initial contact during lateral hops and walking.

  3. The Relevance of Proprioception to Chronic Neck Pain: A Correlational Analysis of Flexor Muscle Size and Endurance, Clinical Neck Pain Characteristics, and Proprioception.

    PubMed

    Amiri Arimi, Somayeh; Ghamkhar, Leila; Kahlaee, Amir H

    2018-01-02

    Impairment in the cervical proprioception and deep flexor muscle function and morphology have been regarded to be associated with chronic neck pain (CNP).  The aim of the study is to assess the relationship between proprioception and flexor endurance capacity and size and clinical CNP characteristics.  This was an observational, cross-sectional study.  Rehabilitation hospital laboratory.  Sixty subjects with or without CNP participated in the study.  Joint position error, clinical deep flexor endurance test score, longus colli/capitis and sternocleidomastoid muscle size, pain intensity, neck pain-related disability, and fear of movement were assessed. Multivariate analysis of variance and Pearson correlation tests were used to compare the groups and quantify the strength of the associations among variables, respectively. Logistic regression analysis was performed to test the predictive value of the dependent variables for the development of neck pain.  CNP patients showed lower flexor endurance (P = 0.01) and smaller longus colli size (P < 0.01). The joint position error was not statistically different between the groups. Longus colli size was correlated with local flexor endurance in both CNP (P = 0.01) and control (P = 0.04) groups. Among clinical CNP characteristics, kinesiophobia showed fair correlation with joint position error (r = 0.39, P = 0.03). Left rotation error and local flexor endurance were significant predictors of CNP development (β = 1.22, P = 0.02, and β = 0.97, P = 0.02, respectively).  The results indicated that cervical proprioception was associated neither with deep flexor muscle structure/function nor with clinical CNP characteristics. Left rotation error and local flexor endurance were found relevant to neck pain development. © 2017 American Academy of Pain Medicine. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  4. Soft tissue stabilization for palmar midcarpal instability using a palmaris longus tendon graft.

    PubMed

    Chaudhry, Tahseen; Shahid, Mohammed; Wu, Feiran; Mishra, Anuj; Deshmukh, Subodh

    2015-01-01

    To report the results of a technique of soft tissue stabilization for palmar midcarpal instability using a palmaris longus graft. In patients' symptomatic wrists with palmar midcarpal instability that had failed conservative management, we used a dorsal approach and stabilized the hamate and triquetrum by reconstructing the dorsal triquetrohamate ligament. The palmaris longus tendon graft was fixed with bone anchors. Seven wrists in 6 patients were available for follow-up at a mean of 28 months (range, 17-37 mo). There was an overall meaningful improvement in function (mean preoperative Disabilities of the Arm, Shoulder, and Hand score, 49 preoperatively, 28 postoperatively). There was a significant increase in grip strength from 15 to 21 kg. At final follow-up, 2 patients had moderate pain. The others had mild or no pain. Four patients returned to their previous occupation or activity. Patients retained full pronation and supination. When compared with the normal side, flexion was reduced to 71%, extension to 81%, radial deviation to 90%, and ulnar deviation to 65% of the opposite side. Although the mean results show an improvement, one patient had a poor result with deterioration in Disabilities of the Arm, Shoulder, and Hand score in spite of a clinically stable wrist, and another had clinical evidence of recurrent instability during pregnancy. One patient had residual symptoms from a prominent bone anchor. Overall, this technique showed good medium-term results in most of our patients. It retained some midcarpal mobility, eliminated clunking in most patients, and provided a noteworthy improvement in grip strength and function. We continue to use this technique for patients with symptomatic midcarpal instability, but it requires further evaluation with larger patient numbers and a longer follow-up to assess its overall value. Copyright © 2015 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  5. Muscle Reaction Time During a Simulated Lateral Ankle Sprain After Wet-Ice Application or Cold-Water Immersion

    PubMed Central

    Thain, Peter K.; Bleakley, Christopher M.; Mitchell, Andrew C. S.

    2015-01-01

    Context Cryotherapy is used widely in sport and exercise medicine to manage acute injuries and facilitate rehabilitation. The analgesic effects of cryotherapy are well established; however, a potential caveat is that cooling tissue negatively affects neuromuscular control through delayed muscle reaction time. This topic is important to investigate because athletes often return to exercise, rehabilitation, or competitive activity immediately or shortly after cryotherapy. Objective To compare the effects of wet-ice application, cold-water immersion, and an untreated control condition on peroneus longus and tibialis anterior muscle reaction time during a simulated lateral ankle sprain. Design Randomized controlled clinical trial. Setting University of Hertfordshire human performance laboratory. Patients or Other Participants A total of 54 physically active individuals (age = 20.1 ± 1.5 years, height = 1.7 ± 0.07 m, mass = 66.7 ± 5.4 kg) who had no injury or history of ankle sprain. Intervention(s) Wet-ice application, cold-water immersion, or an untreated control condition applied to the ankle for 10 minutes. Main Outcome Measure(s) Muscle reaction time and muscle amplitude of the peroneus longus and tibialis anterior in response to a simulated lateral ankle sprain were calculated. The ankle-sprain simulation incorporated a combined inversion and plantar-flexion movement. Results We observed no change in muscle reaction time or muscle amplitude after cryotherapy for either the peroneus longus or tibialis anterior (P > .05). Conclusions Ten minutes of joint cooling did not adversely affect muscle reaction time or muscle amplitude in response to a simulated lateral ankle sprain. These findings suggested that athletes can safely return to sporting activity immediately after icing. Further evidence showed that ice can be applied before ankle rehabilitation without adversely affecting dynamic neuromuscular control. Investigation in patients with acute ankle sprains is warranted to assess the clinical applicability of these interventions. PMID:26067429

  6. Altered neuromuscular control and ankle joint kinematics during walking in subjects with functional instability of the ankle joint.

    PubMed

    Delahunt, Eamonn; Monaghan, Kenneth; Caulfield, Brian

    2006-12-01

    The ankle joint requires very precise neuromuscular control during the transition from terminal swing to the early stance phase of the gait cycle. Altered ankle joint arthrokinematics and muscular activity have been cited as potential factors that may lead to an inversion sprain during the aforementioned time periods. However, to date, no study has investigated patterns of muscle activity and 3D joint kinematics simultaneously in a group of subjects with functional instability compared with a noninjured control group during these phases of the gait cycle. To compare the patterns of lower limb 3D joint kinematics and electromyographic activity during treadmill walking in a group of subjects with functional instability with those observed in a control group. Controlled laboratory study. Three-dimensional angular velocities and displacements of the hip, knee, and ankle joints, as well as surface electromyography of the rectus femoris, peroneus longus, tibialis anterior, and soleus muscles, were recorded simultaneously while subjects walked on a treadmill at a velocity of 4 km/h. Before heel strike, subjects with functional instability exhibited a decrease in vertical foot-floor clearance (12.62 vs 22.84 mm; P < .05), as well as exhibiting a more inverted position of the ankle joint before, at, and immediately after heel strike (1.69 degrees , 2.10 degrees , and -0.09 degrees vs -1.43 degrees , -1.43 degrees , and -2.78 degrees , respectively [minus value = eversion]; P < .05) compared with controls. Subjects with functional instability were also observed to have an increase in peroneus longus integral electromyography during the post-heel strike time period (107.91%.millisecond vs 64.53%.millisecond; P < .01). The altered kinematics observed in this study could explain the reason subjects with functional instability experience repeated episodes of ankle inversion injury in situations with only slight or no external provocation. It is hypothesized that the observed increase in peroneus longus activity may be the result of a change in preprogrammed feed-forward motor control.

  7. Proposal for a histopathological consensus classification of the periprosthetic interface membrane

    PubMed Central

    Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-01-01

    Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

  8. Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

    PubMed

    Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-06-01

    The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

  9. Beef extract supplementation increases leg muscle mass and modifies skeletal muscle fiber types in rats.

    PubMed

    Yoshihara, Hiroyuki; Wakamatsu, Jun-Ichiro; Kawabata, Fuminori; Mori, Sunao; Haruno, Atsushi; Hayashi, Toshiya; Sekiguchi, Takeshi; Mizunoya, Wataru; Tatsumi, Ryuichi; Ito, Tatsumi; Ikeuchi, Yoshihide

    2006-06-01

    The objective of this research was to investigate the effects of beef extract on fat metabolism, muscle mass and muscle fiber types in rats. We also investigated the synergetic effect of endurance exercise. Twenty-four male rats weighing about 270 g were assigned to two diets containing 0 or 6% beef extract (BE). Half the rats fed each diet were subjected to compulsory exercise (CE) for 30 min every other day. After 4 weeks feeding, the blood was collected and various organs were dissected. The muscle fiber type of the soleus and extensor digitorum longus (EDL) muscles were evaluated by histochemical and electrophoretical analyses. Rats supplemented with BE showed a decrease in fat content in liver and abdomen and an increase in the activity of carnitine palmitoyl transferase II in liver. BE as well as exercise increased the relative weights of both soleus and EDL. BE alone and BE plus CE did not affect the distribution of muscle fiber types in soleus. BE without exercise decreased in type IIb of EDL from 54% to 44% with compensatory increase in type IIa from 41% to 49% and type I from 5% to 7% compared with the nonsupplemented, nonexercised control group. No synergetic effect on a fast to slow fiber conversion due to the combination of BE and CE was detected. Thus, BE supplement increased muscle mass and slow type fiber in EDL. The effects of BE supplement on muscle characteristics were similar to those of exercise. beef extract, fat metabolism, muscle fiber type, muscle mass, L-carnitine

  10. Environmentally Safe and Effective Processes for Paint Removal

    DTIC Science & Technology

    1995-04-01

    Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

  11. Ehlers-Danlos syndrome type IV

    PubMed Central

    Germain, Dominique P

    2007-01-01

    Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

  12. Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

    PubMed

    Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2016-01-01

    Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

  13. Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

    PubMed

    Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

    2016-05-01

    To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  14. [Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

    PubMed

    Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

    2012-01-01

    Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

  15. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed Central

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

  16. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

  17. Systemic Response to Microgravity: Utilizing GeneLab Datasets to Identify Molecular Targets for Future Hypotheses-Driven Spaceflight Studies

    NASA Technical Reports Server (NTRS)

    Beheshti, Afshin; Ray, Shayoni; Fogle, Homer; Berrios, Daniel C.; Costes, Sylvain V.

    2017-01-01

    Biological risks associated with microgravity are a major concern for long-term space travel. Although determination of risk has been a focus for NASA research, data examining systemic (i.e., multi- or pan-tissue) responses to space flight are sparse. To perform our analysis, we utilized the NASA GeneLab database which is a publicly available repository containing a wide array of omics results from experiments conducted with: i) with different flight conditions (space shuttle (STS) missions vs. International Space Station (ISS); ii) a variety of tissues; and 3) assays that measure epigenetic, transcriptional, and protein expression changes. Meta-analysis of the transcriptomic data from 7 different murine and rat data sets, examining tissues such as liver, kidney, adrenal gland, thymus, mammary gland, skin, and skeletal muscle (soleus, extensor digitorum longus, tibialis anterior, quadriceps, and gastrocnemius) revealed for the first time, the existence of potential master regulators coordinating systemic responses to microgravity in rodents. We identified p53, TGF(beta)1 and immune related pathways as the highly prevalent pan-tissue signaling pathways that are affected by microgravity. Some variability in the degree of change in their expression across species, strain and time of flight was also observed. Interestingly, while certain skeletal muscle (gastrocnemius and soleus) exhibited an overall down-regulation of these genes, some other muscle types such as the extensor digitorum longus, tibialis anterior and quadriceps, showed an up-regulated expression, indicative of potential compensatory mechanisms to prevent microgravity-induced atrophy. Key genes isolated by unbiased systems analyses displayed a major overlap between tissue types and flight conditions and established TGF(beta)1 to be the most connected gene across all data sets. Finally, a set of microgravity responsive miRNA signature was identified and based on their predicted functional state and subsequent impact on health, a theoretical health risk score was calculated. The genes and miRNAs identified from our analyses can be targeted for future research involving efficient countermeasure design. Our study thus exemplifies the utility of GeneLab data repository to aid in the process of performing novel hypothesis based spaceflight research aimed at elucidating the global impact of environmental stressors at multiple biological scales.

  18. Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

    PubMed

    Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

    2007-01-01

    Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

  19. Increased susceptibility to fatigue of slow- and fast-twitch muscles from mice lacking the MG29 gene.

    PubMed

    Nagaraj, R Y; Nosek, C M; Brotto, M A; Nishi, M; Takeshima, H; Nosek, T M; Ma, J

    2000-11-09

    Mitsugumin 29 (MG29), a major protein component of the triad junction in skeletal muscle, has been identified to play roles in the formation of precise junctional membrane structures important for efficient signal conversion in excitation-contraction (E-C) coupling. We carried out several experiments to not only study the role of MG29 in normal muscle contraction but also to determine its role in muscle fatigue. We compared the in vitro contractile properties of three muscles types, extensor digitorum longus (EDL) (fast-twitch muscle), soleus (SOL) (slow-twitch muscle), and diaphragm (DPH) (mixed-fiber muscle), isolated from mice lacking the MG29 gene and wild-type mice prior to and after fatigue. Our results indicate that the mutant EDL and SOL muscles, but not DPH, are more susceptible to fatigue than the wild-type muscles. The mutant muscles not only fatigued to a greater extent but also recovered significantly less than the wild-type muscles. Following fatigue, the mutant EDL and SOL muscles produced lower twitch forces than the wild-type muscles; in addition, fatiguing produced a downward shift in the force-frequency relationship in the mutant mice compared with the wild-type controls. Our results indicate that fatiguing affects the E-C components of the mutant EDL and SOL muscles, and the effect of fatigue in these mutant muscles could be primarily due to an alteration in the intracellular Ca homeostasis.

  20. Mechanisms of chiral discrimination by topoisomerase IV

    PubMed Central

    Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

    2009-01-01

    Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

  1. Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

    PubMed

    Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

    2016-11-01

    To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

  2. Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

    PubMed Central

    Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

    2011-01-01

    Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

  3. Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

    PubMed

    Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

    2016-02-28

    Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

  4. Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

    PubMed

    Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

    2013-12-01

    Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

  5. Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

    PubMed

    Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

    2017-05-04

    Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

  6. [Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

    PubMed

    Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

    2014-10-01

    To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

  7. Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

    PubMed Central

    Roos, David S.; Pohlschröder, Mechthild

    2011-01-01

    Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

  8. Accentuated hyperparathyroidism in type II Bartter syndrome.

    PubMed

    Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

    2016-07-01

    Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

  9. Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, K. R.

    1994-01-01

    Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

  10. Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

    PubMed

    Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

    2009-06-01

    Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

  11. The expression of NFATc1 in adult rat skeletal muscle fibres.

    PubMed

    Mutungi, Gabriel

    2008-03-01

    Although numerous studies have recently implicated the calcineurin-nuclear factor of activated T-cells (Cn-NFAT) signalling pathway in the regulation of activity-dependent fibre type switching in adult mammalian skeletal muscles, little is known about the endogenous expression of NFAT proteins in the various fibre types present in these muscles. In this study, the immunolocalization of NFATc1 (also known as NFATc or NFAT2) in the extensor digitorum longus (EDL; a mainly fast-twitch muscle) and the soleus (a predominantly slow-twitch muscle) muscles of adult ( approximately 90-day-old) Wistar rats was investigated. The results show that NFATc1 is expressed only in oxidative fibres (i.e. type I and type IIA fibres) that stain intensely for succinate dehydrogenase activity irrespective of whether they are from the fast- or slow-twitch muscle. Thus, 99 +/- 4% (n = 7 rats) of the muscle fibres in the soleus and 42 +/- 2% (n = 7 rats) of those in the EDL expressed NFATc1. In the soleus muscle fibres, NFATc1 was localized mainly in the fibre nuclei, whereas in the EDL fibres it was localized in both the cytoplasm and the nuclei. However, no difference in its localization was observed between type I and type IIA fibres in both muscles. Western blot experiments showed that the soleus expressed more NFATc1 proteins than the EDL. From these results, we suggest that NFATc1 controls the number and distribution of both type I and type IIA fibres, as well as the oxidative capacity of adult mammalian skeletal muscles.

  12. Effects of Fiber Type and Size on the Heterogeneity of Oxygen Distribution in Exercising Skeletal Muscle

    PubMed Central

    Liu, Gang; Mac Gabhann, Feilim; Popel, Aleksander S.

    2012-01-01

    The process of oxygen delivery from capillary to muscle fiber is essential for a tissue with variable oxygen demand, such as skeletal muscle. Oxygen distribution in exercising skeletal muscle is regulated by convective oxygen transport in the blood vessels, oxygen diffusion and consumption in the tissue. Spatial heterogeneities in oxygen supply, such as microvascular architecture and hemodynamic variables, had been observed experimentally and their marked effects on oxygen exchange had been confirmed using mathematical models. In this study, we investigate the effects of heterogeneities in oxygen demand on tissue oxygenation distribution using a multiscale oxygen transport model. Muscles are composed of different ratios of the various fiber types. Each fiber type has characteristic values of several parameters, including fiber size, oxygen consumption, myoglobin concentration, and oxygen diffusivity. Using experimentally measured parameters for different fiber types and applying them to the rat extensor digitorum longus muscle, we evaluated the effects of heterogeneous fiber size and fiber type properties on the oxygen distribution profile. Our simulation results suggest a marked increase in spatial heterogeneity of oxygen due to fiber size distribution in a mixed muscle. Our simulations also suggest that the combined effects of fiber type properties, except size, do not contribute significantly to the tissue oxygen spatial heterogeneity. However, the incorporation of the difference in oxygen consumption rates of different fiber types alone causes higher oxygen heterogeneity compared to control cases with uniform fiber properties. In contrast, incorporating variation in other fiber type-specific properties, such as myoglobin concentration, causes little change in spatial tissue oxygenation profiles. PMID:23028531

  13. Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

    NASA Astrophysics Data System (ADS)

    Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

    1996-08-01

    Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

  14. Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

    PubMed Central

    Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

    2005-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

  15. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, D.; Wang, L.; Beconi, M.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  16. Genetics Home Reference: mucolipidosis type IV

    MedlinePlus

    ... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

  17. Mass loss in the interacting semi-detached binary delta librae

    NASA Technical Reports Server (NTRS)

    Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

    1995-01-01

    The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

  18. Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

    PubMed

    Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

    2007-09-01

    Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

  19. [Mucolipidoses type IV in a patient with mapuche ancestry].

    PubMed

    Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

    2008-07-01

    We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

  20. Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

    PubMed

    Mak, Ki M; Mei, Rena

    2017-08-01

    Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. Odorant transfer characteristics of white bread during baking.

    PubMed

    Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

    2011-01-01

    The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

  2. Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

    PubMed

    Busek, P; Stremenová, J; Krepela, E; Sedo, A

    2008-01-01

    Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

  3. Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

    PubMed

    Pakravan, Nafiseh; Hassan, Zuhair Mohammad

    2018-03-01

    Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

  4. THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

    PubMed Central

    Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

    1932-01-01

    The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

  5. Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

    PubMed

    Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

    2004-06-01

    We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

  6. Overexpression of inducible 70-kDa heat shock protein in mouse improves structural and functional recovery of skeletal muscles from atrophy.

    PubMed

    Miyabara, Elen H; Nascimento, Tabata L; Rodrigues, Débora C; Moriscot, Anselmo S; Davila, Wilmer F; AitMou, Younss; deTombe, Pieter P; Mestril, Ruben

    2012-04-01

    Heat shock proteins play a key regulatory role in cellular defense. To investigate the role of the inducible 70-kDa heat shock protein (HSP70) in skeletal muscle atrophy and subsequent recovery, soleus (SOL) and extensor digitorum longus (EDL) muscles from overexpressing HSP70 transgenic mice were immobilized for 7 days and subsequently released from immobilization and evaluated after 7 days. Histological analysis showed that there was a decrease in cross-sectional area of type II myofiber from EDL and types I and II myofiber from SOL muscles at 7-day immobilization in both wild-type and HSP70 mice. At 7-day recovery, EDL and SOL myofibers from HSP70 mice, but not from wild-type mice, recovered their size. Muscle tetanic contraction decreased only in SOL muscles from wild-type mice at both 7-day immobilization and 7-day recovery; however, it was unaltered in the respective groups from HSP70 mice. Although no effect in a fatigue protocol was observed among groups, we noticed a better contractile performance of EDL muscles from overexpressing HSP70 groups as compared to their matched wild-type groups. The number of NCAM positive-satellite cells reduced after immobilization and recovery in both EDL and SOL muscles from wild-type mice, but it was unchanged in the muscles from HSP70 mice. These results suggest that HSP70 improves structural and functional recovery of skeletal muscle after disuse atrophy, and this effect might be associated with preservation of satellite cell amount.

  7. Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

    PubMed

    Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

    2011-01-01

    Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

  8. Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

    2018-03-01

    We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

  9. Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

    NASA Technical Reports Server (NTRS)

    Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

    2001-01-01

    Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

  10. Positioning Techniques to Reduce the Occurrence of DeQuervain's Tendonitis in Nursing Mothers

    ERIC Educational Resources Information Center

    Virzi, Alison

    2010-01-01

    DeQuervain's tendonitis is an inflammation of two tendons: the extensor pollicis brevis and the abductor pollicis longus as they cross in the first dorsal compartment of the wrist. Symptoms include pain, swelling along the radial aspect of the wrist, and a decrease in thumb motion. A positive Finkelstein's test at examination is seen. Frequently…

  11. Neck Pain and Acute Dysphagia.

    PubMed

    Simões, João; Romão, José; Cunha, Anita; Paiva, Sofia; Miguéis, António

    2017-02-01

    The acute tendinitis of the longus colli muscle is an unusual diagnosis in the cases of acute dysphagia with cervical pain. Is a self-limiting condition caused by abnormal calcium hydroxyapatite deposition in the prevertebral space and can cause pharyngeal swelling with impaired swallow. It is absolutely critical to make the differential diagnosis with deep cervical infections in order to avoid invasive treatments.

  12. Fibularis tertius: revisiting the anatomy.

    PubMed

    Rourke, K; Dafydd, H; Parkin, I G

    2007-11-01

    Fibularis tertius (FT) may be used during reconstructive surgery and muscle transposition with retention of function. The muscle was examined in both lower limbs of 41 cadavers. Measurements were made of muscle belly length and width, tendon length and width, and the size of the origin on the fibula. Tendon insertion, nerve and blood supplies were also examined. FT was absent in five (6.1%) lower limbs of three (7.3%) subjects. The size of its origin demonstrated inter- and intra-individual variation. FT arose from the distal fibula and on average occupied (28.4 +/- 9.1)% (mean +/- S. D.) of the total shaft length. In all cases the tendon inserted into the dorsal surface of the shafts of both the fourth and fifth metatarsals. A small nerve branch consistently arose from the deep fibular nerve near the origin of extensor digitorum longus. The nerve ran parallel to the length of this muscle, between it and extensor hallucis longus, before piercing FT. Anatomy textbooks describe FT as inserting into the fifth metatarsal only. This study, supported by data from previous reports, suggests that the "textbook" accounts of FT should be updated to record that most commonly its tendon reaches both the fourth and fifth metatarsals.

  13. The intersection syndrome: Ultrasound findings and their diagnostic value

    PubMed Central

    Montechiarello, S.; Miozzi, F.; D’Ambrosio, I.; Giovagnorio, F.

    2010-01-01

    Introduction The intersection syndrome is a well-known overuse syndrome of the distal forearm. It is characterized by noninfectious, inflammatory changes involving the area of intersection of the first (abductor pollicis longus and extensor pollicis brevis) and second (extensor carpi radialis longus and extensor carpi radialis brevis) extensor compartments in the dorsoradial aspect of the distal forearm. Imaging modalities used to diagnosis this syndrome include ultrasonography (US) and magnetic resonance imaging. The purpose of this report is to describe typical US findings in the intersection syndrome and to demonstrate the diagnostic value of this approach. Materials and methods We reviewed US findings in 4 patients (mean age 40 years) referred to our staff for symptoms suggestive of the intersection syndrome (pain, swelling, erythema, and edema of the wrist). Results In all 4 cases, the US examination revealed peritendinous edema and synovial fluid within the tendon sheaths at the intersection between the first and the second dorsal extensor tendon compartments. Discussion Our experience shows that the intersection syndrome is associated with typical signs on US. This imaging modality can be considered a reliable tool for diagnosing this syndrome and may eliminate the need for other more expensive tests. PMID:23396515

  14. Tibial and fibular nerves evaluation using intraoperative electromyography in rats.

    PubMed

    Nepomuceno, André Coelho; Politani, Elisa Landucci; Silva, Eduardo Guandelini da; Salomone, Raquel; Longo, Marco Vinicius Losso; Salles, Alessandra Grassi; Faria, José Carlos Marques de; Gemperli, Rolf

    2016-08-01

    To evaluate a new model of intraoperative electromyographic (EMG) assessment of the tibial and fibular nerves, and its respectives motor units in rats. Eight Wistar rats underwent intraoperative EMG on both hind limbs at two different moments: week 0 and week 12. Supramaximal electrical stimulation applied on sciatic nerve, and compound muscle action potential recorded on the gastrocnemius muscle (GM) and the extensor digitorum longus muscle (EDLM) through electrodes at specifics points. Motor function assessment was performaced through Walking Track Test. Exposing the muscles and nerves for examination did not alter tibial (p=0.918) or fibular (p=0.877) function between the evaluation moments. Electromyography of the GM, innervated by the tibial nerve, revealed similar amplitude (p=0.069) and latency (p=0.256) at week 0 and at 12 weeks, creating a standard of normality. Meanwhile, electromyography of the EDLM, innervated by the fibular nerve, showed significant differences between the amplitudes (p=0.003) and latencies (p=0.021) at the two different moments of observation. Intraoperative electromyography determined and quantified gastrocnemius muscle motor unit integrity, innervated by tibial nerve. Although this study was not useful to, objectively, assess extensor digitorum longus muscle motor unit, innervated by fibular nerve.

  15. Eccentric contractions disrupt FKBP12 content in mouse skeletal muscle

    PubMed Central

    Baumann, Cory W.; Rogers, Russell G.; Gahlot, Nidhi; Ingalls, Christopher P.

    2014-01-01

    Abstract Strength deficits associated with eccentric contraction‐induced muscle injury stem, in part, from impaired voltage‐gated sarcoplasmic reticulum (SR) Ca2+ release. FKBP12 is a 12‐kD immunophilin known to bind to the SR Ca2+ release channel (ryanodine receptor, RyR1) and plays an important role in excitation‐contraction coupling. To assess the effects of eccentric contractions on FKBP12 content, we measured anterior crural muscle (tibialis anterior [TA], extensor digitorum longus [EDL], extensor hallucis longus muscles) strength and FKBP12 content in pellet and supernatant fractions after centrifugation via immunoblotting from mice before and after a single bout of either 150 eccentric or concentric contractions. There were no changes in peak isometric torque or FKBP12 content in TA muscles after concentric contractions. However, FKBP12 content was reduced in the pelleted fraction immediately after eccentric contractions, and increased in the soluble protein fraction 3 day after injury induction. FKBP12 content was correlated (P = 0.025; R2= 0.38) to strength deficits immediately after injury induction. In summary, eccentric contraction‐induced muscle injury is associated with significant alterations in FKBP12 content after injury, and is correlated with changes in peak isometric torque. PMID:25347864

  16. Open ankle arthrodeses via an anterior approach.

    PubMed

    Gordon, David; Zicker, Robyn; Cullen, Nicholas; Singh, Dishan

    2013-03-01

    In open ankle arthrodesis, debate remains as to which surgical approach and fixation devices should be used. The purpose of this study was to identify union, complication, and patient satisfaction rates of ankle fusions performed at our institution, using the plane between extensor hallucis longus and tibialis anterior with medial tibiotalar screw internal fixation. A retrospective review was performed of all isolated primary fusions between 2005 and 2009. Eighty-two ankles were identified in 73 patients. All patient records were reviewed, and 57 patients (65 ankles) attended for clinical evaluation and scoring. Age range at surgery was 18 to 75 years (mean, 56.1 years); 8 patients were smokers. Diagnoses were trauma in 52 patients (63%), osteoarthritis in 17, rheumatoid arthritis in 7, Charcot-Marie-Tooth disease in 3, congenital talipes equinovarus in 2, and talar avascular necrosis in 1. Follow-up range was 7 months to 8.3 years (mean, 4 years). Time to union ranged from 8 to 39 weeks (mean, 13.3) with a union rate of 100%. The AOFAS range was 12 to 93 (mean, 70). Eighty percent were "very satisfied" or "satisfied." Major complication rate was 14.6%: 7 malalignments; 3 wound problems; 2 complex regional pain syndrome; and 2 delayed unions, both smokers. An excellent union rate, high patient satisfaction, and low complication rate were achieved with this technique. Varus malalignment and persistent pain resulted in dissatisfaction. Many patients remained highly active, and bilaterally fused patients functioned as well as unilateral ones. Level IV, retrospective case series.

  17. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

    PubMed

    Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

    2017-04-15

    Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

  18. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

    PubMed Central

    Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

    2017-01-01

    ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

  19. Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

    PubMed

    Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

    2013-11-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  20. Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

    USDA-ARS?s Scientific Manuscript database

    The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

  1. A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

    PubMed

    Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

    2018-03-09

    Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

  2. Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

    PubMed

    Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

    2014-09-01

    Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

  3. Exploring new classification criteria for the earliest type stars: the 3400 Aregion

    NASA Astrophysics Data System (ADS)

    Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

    2002-02-01

    We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

  4. Changes in the cholinergic system of rat sciatic nerve and skeletal muscle following suspension induced disuse

    NASA Technical Reports Server (NTRS)

    Gupta, R. C.; Misulis, K. E.; Dettbarn, W. D.

    1984-01-01

    Muscle disused induced changes in the cholinergic system of sciatic nerve, slow twitch soleus (SOL) and fast twitch extensor digitorum longus (EDL) muscle were studied in rats. Rats with hindlimbs suspended for 2 to 3 weeks showed marked elevation in the activity of choline acetyltransferase (ChAT) in sciatic nerve (38%), in SOL (108%) and in EDL (67%). Acetylcholinesterase (AChE) activity in SOL increased by 163% without changing the molecular forms pattern of 4S, 10S, 12S, and 16S. No significant changes in activity and molecular forms pattern of AChE were seen in EDL or in AChE activity of sciatic nerve. Nicotinic receptor binding of 3H-acetylcholine was increased in both muscles. When measured after 3 weeks of hindlimb suspension the normal distribution of type 1 fibers in SOL was reduced and a corresponding increase in type IIa and IIb fibers is seen. In EDL no significant change in fiber proportion is observed. Muscle activity, such as loadbearing, appears to have a greater controlling influence on the characteristics of the slow twitch SOL muscle than upon the fast twitch EDL muscle.

  5. Morphological and functional analyses of skeletal muscles from an immunodeficient animal model of limb-girdle muscular dystrophy type 2E.

    PubMed

    Giovannelli, Gaia; Giacomazzi, Giorgia; Grosemans, Hanne; Sampaolesi, Maurilio

    2018-02-24

    Limb-girdle muscular dystrophy type 2E (LGMD2E) is caused by mutations in the β-sarcoglycan gene, which is expressed in skeletal, cardiac, and smooth muscles. β-Sarcoglycan-deficient (Sgcb-null) mice develop severe muscular dystrophy and cardiomyopathy with focal areas of necrosis. In this study we performed morphological (histological and cellular characterization) and functional (isometric tetanic force and fatigue) analyses in dystrophic mice. Comparison studies were carried out in 1-month-old (clinical onset of the disease) and 7-month-old control mice (C57Bl/6J, Rag2/γc-null) and immunocompetent and immunodeficient dystrophic mice (Sgcb-null and Sgcb/Rag2/γc-null, respectively). We found that the lack of an immunological system resulted in an increase of calcification in striated muscles without impairing extensor digitorum longus muscle performance. Sgcb/Rag2/γc-null muscles showed a significant reduction of alkaline phosphate-positive mesoangioblasts. The immunological system counteracts skeletal muscle degeneration in the murine model of LGMD2E. Muscle Nerve, 2018. © 2018 The Authors. Muscle & Nerve Published by Wiley Periodicals, Inc.

  6. A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

    2018-04-01

    A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

  7. Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

    PubMed

    Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

    2014-04-01

    There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

  8. A study of lip print pattern in Goan dental students - A digital approach.

    PubMed

    Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

    2012-10-01

    To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

  9. Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

    PubMed

    Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

    2006-12-01

    Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

  10. Anomalous ionization seen in the spectra of B supergiants

    NASA Technical Reports Server (NTRS)

    Cassinelli, J. P.; Abbott, D. C.

    1981-01-01

    An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

  11. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  12. Singular cosmological evolution using canonical and ghost scalar fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

    2015-09-01

    We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

  13. Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

    PubMed

    Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

    2018-02-06

    Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

  14. Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

    PubMed

    Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

    2002-09-01

    With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

  15. Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

    PubMed

    Ghoshal, Uday C

    2017-07-30

    A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

  16. Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

    PubMed

    Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

    2017-10-17

    Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  17. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  18. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  19. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Astrophysics Data System (ADS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-08-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  20. Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

    PubMed

    Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

    2003-03-01

    Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

  1. Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

    PubMed

    Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

    2013-04-01

    Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

  2. A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

    PubMed

    Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

    2017-12-01

    The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  3. Extensor tendon injury during cesarean delivery.

    PubMed

    Rinker, Brian

    2011-01-01

    Fetal laceration is a recognized complication of cesarean delivery; however, major injuries are rare. The case of a healthy newborn who sustained an injury to the extensor pollicis longus tendon during cesarean delivery is reported. The tendon was repaired surgically on the sixth day of life with good recovery of function. Copyright © 2011 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  4. Modified tendon stripper for obtaining palmaris longus tendon graft.

    PubMed

    Aköz, T; Altintaş, H; Civelek, B

    1999-04-01

    Tendon graft harvesting is a challenging part of hand surgery. It is not only a time-consuming procedure but also carries the potential complications associated with it. Various alternatives for this procedure are presented in the literature to overcome these difficulties. In this paper, we are presenting a series of cases in which a newly modified tendon stripper was used for tendon graft harvesting.

  5. Myostatin promotes distinct responses on protein metabolism of skeletal and cardiac muscle fibers of rodents.

    PubMed

    Manfredi, L H; Paula-Gomes, S; Zanon, N M; Kettelhut, I C

    2017-10-19

    Myostatin is a novel negative regulator of skeletal muscle mass. Myostatin expression is also found in heart in a much less extent, but it can be upregulated in pathological conditions, such as heart failure. Myostatin may be involved in inhibiting protein synthesis and/or increasing protein degradation in skeletal and cardiac muscles. Herein, we used cell cultures and isolated muscles from rats to determine protein degradation and synthesis. Muscles incubated with myostatin exhibited an increase in proteolysis with an increase of Atrogin-1, MuRF1 and LC3 genes. Extensor digitorum longus muscles and C2C12 myotubes exhibited a reduction in protein turnover. Cardiomyocytes showed an increase in proteolysis by activating autophagy and the ubiquitin proteasome system, and a decrease in protein synthesis by decreasing P70S6K. The effect of myostatin on protein metabolism is related to fiber type composition, which may be associated to the extent of atrophy mediated effect of myostatin on muscle.

  6. Myostatin promotes distinct responses on protein metabolism of skeletal and cardiac muscle fibers of rodents

    PubMed Central

    Manfredi, L.H.; Paula-Gomes, S.; Zanon, N.M.; Kettelhut, I.C.

    2017-01-01

    Myostatin is a novel negative regulator of skeletal muscle mass. Myostatin expression is also found in heart in a much less extent, but it can be upregulated in pathological conditions, such as heart failure. Myostatin may be involved in inhibiting protein synthesis and/or increasing protein degradation in skeletal and cardiac muscles. Herein, we used cell cultures and isolated muscles from rats to determine protein degradation and synthesis. Muscles incubated with myostatin exhibited an increase in proteolysis with an increase of Atrogin-1, MuRF1 and LC3 genes. Extensor digitorum longus muscles and C2C12 myotubes exhibited a reduction in protein turnover. Cardiomyocytes showed an increase in proteolysis by activating autophagy and the ubiquitin proteasome system, and a decrease in protein synthesis by decreasing P70S6K. The effect of myostatin on protein metabolism is related to fiber type composition, which may be associated to the extent of atrophy mediated effect of myostatin on muscle. PMID:29069231

  7. Network Analysis of Rodent Transcriptomes in Spaceflight

    NASA Technical Reports Server (NTRS)

    Ramachandran, Maya; Fogle, Homer; Costes, Sylvain

    2017-01-01

    Network analysis methods leverage prior knowledge of cellular systems and the statistical and conceptual relationships between analyte measurements to determine gene connectivity. Correlation and conditional metrics are used to infer a network topology and provide a systems-level context for cellular responses. Integration across multiple experimental conditions and omics domains can reveal the regulatory mechanisms that underlie gene expression. GeneLab has assembled rich multi-omic (transcriptomics, proteomics, epigenomics, and epitranscriptomics) datasets for multiple murine tissues from the Rodent Research 1 (RR-1) experiment. RR-1 assesses the impact of 37 days of spaceflight on gene expression across a variety of tissue types, such as adrenal glands, quadriceps, gastrocnemius, tibalius anterior, extensor digitorum longus, soleus, eye, and kidney. Network analysis is particularly useful for RR-1 -omics datasets because it reinforces subtle relationships that may be overlooked in isolated analyses and subdues confounding factors. Our objective is to use network analysis to determine potential target nodes for therapeutic intervention and identify similarities with existing disease models. Multiple network algorithms are used for a higher confidence consensus.

  8. Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

    PubMed

    Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

    2017-08-01

    We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

    DOE PAGES

    Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

    2015-03-01

    Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

  10. Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

    PubMed

    Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

    2015-10-01

    Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  11. Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

    ClinicalTrials.gov

    2014-02-14

    Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  12. Specific Phobia among U.S. Adolescents: Phenomenology and Typology

    PubMed Central

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2014-01-01

    Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

  13. Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

    PubMed

    Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

    2002-12-06

    Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

  14. Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

    1994-01-01

    High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

  15. Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

    PubMed

    Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

    2006-04-01

    A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

  16. Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

    PubMed

    Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

    2013-11-22

    Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

    PubMed

    Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

    2016-10-01

    The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

  18. The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

    PubMed

    Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

    2012-06-01

    The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

  19. Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

    PubMed Central

    Watanabe, Ikuya; Wallace, Cameron

    2008-01-01

    The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

  20. Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

    PubMed Central

    Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

    2007-01-01

    Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

  1. Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

    PubMed Central

    Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

    2014-01-01

    Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

  2. Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

    PubMed

    Breadon, Jonith Y; Barnes, Chad A

    2007-01-01

    Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

  3. Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

    PubMed

    Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

    2017-09-01

    Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

    ERIC Educational Resources Information Center

    Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

    2015-01-01

    In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

  5. Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

    PubMed

    Lees, George E

    2013-01-01

    To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

  6. Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

    PubMed

    Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

    2014-05-01

    Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

    PubMed

    Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

    2010-08-01

    A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

  8. Level III and IV Ecoregions by State

    EPA Pesticide Factsheets

    Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  9. Level III and IV Ecoregions by EPA Region

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  10. Use of muscle functional magnetic resonance imaging to compare cervical flexor activity between patients with whiplash-associated disorders and people who are healthy.

    PubMed

    Cagnie, Barbara; Dolphens, Mieke; Peeters, Ian; Achten, Eric; Cambier, Dirk; Danneels, Lieven

    2010-08-01

    Chronic whiplash-associated disorders (WAD) have been shown to be associated with motor dysfunction. Increased electromyographic (EMG) activity in neck and shoulder girdle muscles has been demonstrated during different tasks in participants with persistent WAD. Muscle functional magnetic resonance imaging (mfMRI) is an innovative technique to evaluate muscle activity and differential recruitment of deep and superficial muscles following exercise. The purpose of this study was to compare the recruitment pattern of deep and superficial neck flexors between patients with WAD and controls using mfMRI. A cross-sectional design was used. The study was conducted in a physical and rehabilitation medicine department. The participants were 19 controls who were healthy (10 men, 9 women; mean [+/-SD] age=22.2+/-0.6 years) and 16 patients with WAD (5 men, 11 women; mean [+/-SD] age=32.9+/-12.7 years). The T2 values were calculated for the longus colli (Lco), longus capitis (Lca), and sternocleidomastoid (SCM) muscles at rest and following cranio-cervical flexion (CCF). In the overall statistical model for T2 shift, there was a significant main effect for muscle (F=3.906, P=.033) but not for group (F=2.855, P=.101). The muscle x group interaction effect was significant (F=3.618, P=.041). Although not significant, there was a strong trend for lesser Lco (P=.061) and Lca (P=.060) activity for the WAD group compared with the control group. Although the SCM showed higher T2 shifts, this difference was not significant (P=.291). Although mfMRI is an innovative and useful technique for the evaluation of deep cervical muscles, consideration is required, as this method encompasses a postexercise evaluation and is limited to resistance types of exercises. Muscle functional magnetic resonance imaging demonstrated a difference in muscle recruitment between the Lco, Lca, and SCM during CCF in the control group, but failed to demonstrate a changed activity pattern in the WAD group compared with the control group. The mild symptoms in the WAD group and the wide variability in T2 values may explain the lack of significance.

  11. Muscular force transmission: a unified, dual or multiple system? A review and some explorative experimental results.

    PubMed

    Huijing, P

    1999-10-01

    Structures contributing to force transmission in muscle are reviewed combining some historical and relatively recently published experimental data. Also, effects of aponeurotomy and tenotomy are reviewed shortly as well as some new experimental results regarding these interventions that reinforce the concept of myofascial force transmission. The review is also illustrated by some new images of single muscle fibres from Xenopus Laevis indicative of such transmission and some data about locations of insertion of human gluteus maximus muscle. From this review and the new material, emerges a line of thought indicating that mechanical connections between muscle fibres and intramuscular connective tissue play an important role in force transmission. New experimental observations are presented for non-spanning muscle (i.c., rat biceps femoris muscle), regarding the great variety of types of intramuscular connections that exist i n addition to myo-tendinous junctions at the perimuscular ends of muscle fibres. Such connections are classified as (1) tapered end connections, (2) Myo-myonal junctions, (3) myo-epimysial junctions and (3) Myo-endomysial junctions. This line of thought is followed up by consideration of a possible role of connections of intra- and extramuscular connective tissue in force transmission out of the muscle. Experimental results of an explorative nature, regarding the interactions of extensor digitorum longus (EDL), tibialis anterior (TA) and hallucis longus (HAL) muscles within a relatively intact dorsal flexor compartment of the rat hind leg, indicate that: (1) length force properties of EDL are influenced by TA activity in a length dependent fashion. Depending on TA length, force exerted by EDL, kept at constant origin insertion distance, is variable and the effect is influenced by EDL length itself as well; (2) Force is transmitted from muscle to extramuscular connective tissue and vice versa. As a consequence force exerted at proximal and distal tendons of a muscle are not always equal. The difference being transmitted by extramuscular connective tissue and may appear at the tendons of other muscles or may be transmitted via connective tissue directly to bone. It is concluded that the system of force transmission from skeletal muscle should be considered as a multiple system.

  12. Divergent skeletal muscle respiratory capacities in rats artificially selected for high and low running ability: a role for Nor1?

    PubMed Central

    Stephenson, Erin J.; Stepto, Nigel K.; Koch, Lauren G.; Britton, Steven L.

    2012-01-01

    Inactivity-related diseases are becoming a huge burden on Western society. While there is a major environmental contribution to metabolic health, the intrinsic properties that predispose or protect against particular health traits are harder to define. We used rat models of inborn high running capacity (HCR) and low running capacity (LCR) to determine inherent differences in mitochondrial volume and function, hypothesizing that HCR rats would have greater skeletal muscle respiratory capacity due to an increase in mitochondrial number. Additionally, we sought to determine if there was a link between the expression of the orphan nuclear receptor neuron-derived orphan receptor (Nor)1, a regulator of oxidative metabolism, and inherent skeletal muscle respiratory capacity. LCR rats were 28% heavier (P < 0.0001), and fasting serum insulin concentrations were 62% greater than in HCR rats (P = 0.02). In contrast, HCR rats had better glucose tolerance and reduced adiposity. In the primarily oxidative soleus muscle, maximal respiratory capacity was 21% greater in HCR rats (P = 0.001), for which the relative contribution of fat oxidation was 20% higher than in LCR rats (P = 0.02). This was associated with increased citrate synthase (CS; 33%, P = 0.009) and β-hydroxyacyl-CoA (β-HAD; 33%, P = 0.0003) activities. In the primarily glycolytic extensor digitum longus muscle, CS activity was 29% greater (P = 0.01) and β-HAD activity was 41% (P = 0.0004) greater in HCR rats compared with LCR rats. Mitochondrial DNA copy numbers were also elevated in the extensor digitum longus muscles of HCR rats (35%, P = 0.049) and in soleus muscles (44%, P = 0.16). Additionally, HCR rats had increased protein expression of individual mitochondrial respiratory complexes, CS, and uncoupling protein 3 in both muscle types (all P < 0.05). In both muscles, Nor1 protein was greater in HCR rats compared with LCR rats (P < 0.05). We propose that the differential expression of Nor1 may contribute to the differences in metabolic regulation between LCR and HCR phenotypes. PMID:22936731

  13. Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

    PubMed

    Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

    2010-11-01

    Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  14. Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

    PubMed Central

    Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

    2013-01-01

    Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

  15. Differences in sodium voltage-gated channel properties according to myosin heavy chain isoform expression in single muscle fibres.

    PubMed

    Rannou, F; Droguet, M; Giroux-Metges, M A; Pennec, Y; Gioux, M; Pennec, J P

    2009-11-01

    The myosin heavy chain (MHC) isoform determines the characteristics and shortening velocity of muscle fibres. The functional properties of the muscle fibre are also conditioned by its membrane excitability through the electrophysiological properties of sodium voltage-gated channels. Macropatch-clamp is used to study sodium channels in fibres from peroneus longus (PL) and soleus (Sol) muscles (Wistar rats, n = 8). After patch-clamp recordings, single fibres are identified by SDS-PAGE electrophoresis according to their myosin heavy chain isoform (slow type I and the three fast types IIa, IIx, IIb). Characteristics of sodium currents are compared (Student's t test) between fibres exhibiting only one MHC isoform. Four MHC isoforms are identified in PL and only type I in Sol single fibres. In PL, maximal sodium current (I(max)), maximal sodium conductance (g(Na,max)) and time constants of activation and inactivation ((m) and (h)) increase according to the scheme I-->IIa-->IIx-->IIb (P < 0.05). (m) values related to sodium channel type and/or function, are similar in Sol I and PL IIb fibres (P = 0.97) despite different contractile properties. The voltage dependence of activation (V(a,1/2)) shows a shift towards positive potentials from Sol type I to IIa, IIx and finally IIb fibres from PL (P < 0.05). These data are consistent with the earlier recruitment of slow fibres in a fast-mixed muscle like PL, while slow fibres of postural muscle such as soleus could be recruited in the same ways as IIb fibres in a fast muscle.

  16. Influence of chronic food deprivation on structure-function relationship of juvenile rat fast muscles.

    PubMed

    Ruiz-Rosado, Azucena; Cabrera-Fuentes, Héctor A; González-Calixto, Cecilia; González-López, Lorena; Cázares-Raga, Febe E; Segura-Alegría, Bertha; Lochnit, Günter; de la Cruz Hernández-Hernández, Fidel; Preissner, Klaus T; Jiménez-Estrada, Ismael

    2013-12-01

    In the present study, we analyze the influence of chronic undernutrition on protein expression, muscle fiber type composition, and fatigue resistance of the fast extensor digitorum longus (EDL) muscle of male juvenile rats (45 ± 3 days of life; n = 25 and 31 rats for control and undernourished groups, respectively). Using 2D gel electrophoresis and mass spectrometry, we identified in undernourished muscles 12 proteins up-regulated (8 proteins of the electron transport chain and the glycolytic pathway, 2 cross-bridge proteins, chaperone and signaling proteins that are related to the stress response). In contrast, one down-regulated protein related to the fast muscle contractile system and two other proteins with no changes in expression were used as charge controls. By means of COX and alkaline ATPase histochemical techniques and low-frequency fatigue protocols we determined that undernourished muscles showed a larger proportion (15% increase) of Type IIa/IId fibers (oxidative-glycolytic) at the expense of Type IIb (glycolytic) fibers (15.5% decrease) and increased fatigue resistance (55.3%). In addition, all fiber types showed a significant reduction in their cross-sectional area (slow: 64.4%; intermediate: 63.9% and fast: 61.2%). These results indicate that undernourished EDL muscles exhibit an increased expression of energy metabolic and myofibrillar proteins which are associated with the predominance of oxidative and Type IIa/IId fibers and to a higher resistance to fatigue. We propose that such alterations may act as protective and/or adaptive mechanisms that counterbalance the effect of chronic undernourishment.

  17. A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

    PubMed

    Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

    2005-03-01

    To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

  18. A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

    PubMed

    Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

    2016-03-01

    The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  19. Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

    NASA Astrophysics Data System (ADS)

    Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

    2018-04-01

    We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

  20. Longer reaction time of the fibularis longus muscle and reduced postural control in basketball players with functional ankle instability: A pilot study.

    PubMed

    Méndez-Rebolledo, Guillermo; Guzmán-Muñoz, Eduardo; Gatica-Rojas, Valeska; Zbinden-Foncea, Hermann

    2015-08-01

    Motor control evaluation in subjects with functional ankle instability is questionable when both ankles of the same subject are compared (affected vs non-affected). To compare the postural control and reaction time of ankle muscles among: basketball players with FAI (instability group), basketball players without FAI (non-instability group) and healthy non-basketball-playing participants (control group). Case-control study. Laboratory. Instability (n = 10), non-instability (n = 10), and control groups (n = 11). Centre of pressure variables (area, velocity and sway) were measured with a force platform. Reaction time of ankle muscles was measured via electromyography. A one-way ANOVA demonstrated that there were significant differences between the instability and non-instability groups in the fibularis longus (p < 0.001), fibularis brevis (p = 0.031) and tibialis anterior (p = 0.049) muscles. Repeated-measures ANOVA and post hoc analysis determined significant differences for the area between the instability and non-instability groups (p = 0.001). Basketball players with FAI have reduced postural control and longer reaction time of the fibularis and tibialis anterior muscles. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. The effect of repetitive ankle perturbations on muscle reaction time and muscle activity.

    PubMed

    Thain, Peter Kevin; Hughes, Gerwyn Trefor Gareth; Mitchell, Andrew Charles Stephen

    2016-10-01

    The use of a tilt platform to simulate a lateral ankle sprain and record muscle reaction time is a well-established procedure. However, a potential caveat is that repetitive ankle perturbation may cause a natural attenuation of the reflex latency and amplitude. This is an important area to investigate as many researchers examine the effect of an intervention on muscle reaction time. Muscle reaction time, peak and average amplitude of the peroneus longus and tibialis anterior in response to a simulated lateral ankle sprain (combined inversion and plantar flexion movement) were calculated in twenty-two physically active participants. The 40 perturbations were divided into 4 even groups of 10 dominant limb perturbations. Within-participants repeated measures analysis of variance (ANOVA) tests were conducted to assess the effect of habituation over time for each variable. There was a significant reduction in the peroneus longus average amplitude between the aggregated first and last 10 consecutive ankle perturbations (F2.15,45.09=3.90, P=0.03, ɳp(2)=0.16). Authors should implement no more than a maximum of 30 consecutive ankle perturbations (inclusive of practice perturbations) in future protocols simulating a lateral ankle sprain in an effort to avoid significant attenuation of muscle activity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Cold-water immersion alters muscle recruitment and balance of basketball players during vertical jump landing.

    PubMed

    Macedo, Christiane de Souza Guerino; Vicente, Rafael Chagas; Cesário, Mauricio Donini; Guirro, Rinaldo Roberto de Jesus

    2016-01-01

    The purpose of this study was to evaluate the effects of cold-water immersion on the electromyographic (EMG) response of the lower limb and balance during unipodal jump landing. The evaluation comprised 40 individuals (20 basketball players and 20 non-athletes). The EMG response in the lateral gastrocnemius, tibialis anterior, fibular longus, rectus femoris, hamstring and gluteus medius; amplitude and mean speed of the centre of pressure, flight time and ground reaction force (GRF) were analysed. All volunteers remained for 20 min with their ankle immersed in cold-water, and were re-evaluated immediately post and after 10, 20 and 30 min of reheating. The Shapiro-Wilk test, Friedman test and Dunn's post test (P < 0.05) were used. The EMG response values decreased for the lateral gastrocnemius, tibialis anterior, fibular longus and rectus femoris of both athletes and non-athletes (P < 0.05). The comparison between the groups showed that the EMG response was lower for the athletes. Lower jump flight time and GRF, greater amplitude and mean speed of centre of pressure were predominant in the athletes. Cold-water immersion decreased the EMG activity of the lower limb, flight time and GRF and increased the amplitude and mean speed of centre of pressure.

  3. Electromyographic analysis of lower limb muscles during the golf swing performed with three different clubs.

    PubMed

    Marta, Sérgio; Silva, Luís; Vaz, João Rocha; Castro, Maria António; Reinaldo, Gustavo; Pezarat-Correia, Pedro

    2016-01-01

    The aim of this study was to describe and compare the EMG patterns of select lower limb muscles throughout the golf swing, performed with three different clubs, in non-elite middle-aged players. Fourteen golfers performed eight swings each using, in random order, a pitching wedge, 7-iron and 4-iron. Surface electromyography (EMG) was recorded bilaterally from lower limb muscles: tibialis anterior, peroneus longus, gastrocnemius medialis, gastrocnemius lateralis, biceps femoris, semitendinosus, gluteus maximus, vastus medialis, rectus femoris and vastus lateralis. Three-dimensional high-speed video analysis was used to determine the golf swing phases. Results showed that, in average handicap golfers, the highest muscle activation levels occurred during the Forward Swing Phase, with the right semitendinosus and the right biceps femoris muscles producing the highest mean activation levels relative to maximal electromyography (70-76% and 68-73% EMG(MAX), respectively). Significant differences between the pitching wedge and the 4-iron club were found in the activation level of the left semitendinosus, right tibialis anterior, right peroneus longus, right vastus medialis, right rectus femuris and right gastrocnemius muscles. The lower limb muscles showed, in most cases and phases, higher mean values of activation on electromyography when golfers performed shots with a 4-iron club.

  4. Muscular activity and torque of the foot dorsiflexor muscles during decremental isometric test: A cross-sectional study.

    PubMed

    Ruiz-Muñoz, Maria; González-Sánchez, Manuel; Martín-Martín, Jaime; Cuesta-Vargas, Antonio I

    2017-06-01

    To analyse the torque variation level that could be explained by the muscle activation (EMG) amplitude of the three major foot dorsiflexor muscles (tibialis anterior (TA), extensor digitorum longus (EDL), extensor hallucis longus (EHL)) during isometric foot dorsiflexion at different intensities. In a cross-sectional study, forty-one subjects performed foot dorsiflexion at 100%, 75%, 50% and 25% of maximal voluntary contractions (MVC) with the hip and knee flexed 90° and the ankle in neutral position (90° between leg and foot). Three foot dorsiflexions were performed for each intensity. Outcome variables were: maximum (100% MVC) and relative torque (75%, 50%, 25% MVC), maximum and relative EMG amplitude. A linear regression analysis was calculated for each intensity of the isometric foot dorsiflexion. The degree of torque variation (dependent variable) from the independent variables explain (EMG amplitude of the three major foot dorsiflexor muscles) the increases when the foot dorsiflexion intensity is increased, with values of R 2 that range from 0.194 (during 25% MVC) to 0.753 (during 100% MVC). The reliability of the outcome variables was excellent. The EMG amplitude of the three main foot dorsiflexors exhibited more variance in the dependent variable (torque) when foot dorsiflexion intensity increases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. A rare cause of acute dysphagia: acute calcific tendonitis of the longus colli muscle.

    PubMed

    Abou Dargham, Hanadi; Bytyci, Faton; Shuman, Christian; Stolear, Anton

    2017-05-27

    We are presenting a case of a 78-year-old female with multiple comorbidities and history of neck surgery, who presented with acute dysphagia, odynophagia and neck pain that has been progressively getting worse over the course of 2 days, with no recent injury or infection. The patient was afebrile. There were no visible signs of infection on routine oropharyngeal examination. Initial workup was unremarkable except for elevated erythrocyte sedimentation rate, C-reactive protein and creatinine. CT of the cervical spine ruled out any fracture or cervical spine injury but showed an area of calcification, prevertebral oedema and fluid collection inferior to the anterior arch of C1. MRI of the cervical spine also showed prevertebral oedema and fluid collection in the retropharyngeal space from the skull base to the C3 level without abnormal surrounding enhancement that supported the diagnosis of acute calcific tendonitis of the longus colli muscle rather than an infectious process. There was significant improvement of symptoms 48 hours after initiating treatment with systemic steroids. The patient remains asymptomatic 6 months after treatment. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. Arthroscopic Release of Flexor Hallucis Longus Tendon Sheath in Female Ballet Dancers: Dynamic Pathology, Surgical Technique, and Return to Dancing Performance.

    PubMed

    Funasaki, Hiroki; Hayashi, Hiroteru; Sakamoto, Kanako; Tsuruga, Rei; Marumo, Keishi

    2015-12-01

    Stenosing tenosynovitis of the flexor hallucis longus (FHL) tendon is known as a major overuse lesion in female dancers. We describe arthroscopic surgical techniques in relation to the dynamic pathology of the disease. Crepitus and pain on moving the great toe with the ankle in plantar flexion on preoperative examination confirm the diagnosis of FHL stenosing tenosynovitis even if the os trigonum is not evident. The ankle is approached through standard posterolateral and posteromedial portals. A 4.0-mm-diameter 30° arthroscope is used. Soft tissues around the talus are cleared with a motorized shaver and a radiofrequency device. The posterior aspects of the talus, os trigonum, and FHL tendon surrounded by the tendon sheath are visualized. The dynamic pathology of the FHL tendon is well observed on passive motion of the great toe. The prominent bone fragment of the talus is removed and the tendon sheath is cut with a retrograde knife and a motorized shaver from the superior border down to the entrance of the fibro-osseous tunnel. Arthroscopic release of the FHL tendon sheath is a useful and easy method to directly approach the dynamic pathology of FHL tenosynovitis in female ballet dancers.

  7. Acute pancreatitis complicating choledochal cysts in children.

    PubMed

    Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

    2017-03-01

    To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  8. Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

    PubMed

    Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

    2012-07-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

  9. The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

    PubMed

    Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

    2016-04-01

    Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

  10. [Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

    PubMed

    Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

    2003-01-01

    The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

  11. Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

    PubMed

    Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

    2017-12-28

    The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

  12. Specific phobia among U.S. adolescents: phenomenology and typology.

    PubMed

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2012-12-01

    Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  13. Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

    Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

  14. Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

    PubMed Central

    Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

    1996-01-01

    We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

  15. Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

    PubMed

    Hidaka, Yoshie; Suzuki, Masakazu

    2004-06-01

    Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

  16. Level III and IV Ecoregions of the Continental United States

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  17. Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

    PubMed Central

    Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

    2014-01-01

    Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

  18. The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

    PubMed

    Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

    2007-06-01

    Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

  19. Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

    2006-10-15

    Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

  20. Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

    PubMed

    Dickens, J C; Prestwich, G D

    1989-02-01

    For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

  1. Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

    PubMed

    Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

    2017-03-01

    We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

  2. Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

    PubMed

    Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

    2015-10-01

    To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  3. Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

    2006-12-15

    We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

  4. Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

    PubMed Central

    Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

    2014-01-01

    Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

  5. Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

    PubMed

    Hardy, Christine D; Cozzarelli, Nicholas R

    2003-03-01

    DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

  6. Customizing Extensor Reconstruction in Vascularized Toe Joint Transfers to Finger Proximal Interphalangeal Joints: A Strategic Approach for Correcting Extensor Lag.

    PubMed

    Loh, Charles Yuen Yung; Hsu, Chung-Chen; Lin, Cheng-Hung; Chen, Shih-Heng; Lien, Shwu-Huei; Lin, Chih-Hung; Wei, Fu-Chan; Lin, Yu-Te

    2017-04-01

    Vascularized toe proximal interphalangeal joint transfer allows the restoration of damaged joints. However, extensor lag and poor arc of motion have been reported. The authors present their outcomes of treatment according to a novel reconstructive algorithm that addresses extensor lag and allows for consistent results postoperatively. Vascularized toe joint transfers were performed in a consecutive series of 26 digits in 25 patients. The average age was 30.5 years, with 14 right and 12 left hands. Reconstructed digits included eight index, 10 middle, and eight ring fingers. Simultaneous extensor reconstructions were performed and eight were centralization of lateral bands, five were direct extensor digitorum longus-to-extensor digitorum communis repairs, and 13 were central slip reconstructions. The average length of follow-up was 16.7 months. The average extension lag was 17.9 degrees. The arc of motion was 57.7 degrees (81.7 percent functional use of pretransfer toe proximal interphalangeal joint arc of motion). There was no significant difference in the reconstructed proximal interphalangeal joint arc of motion for the handedness (p = 0.23), recipient digits (p = 0.37), or surgical experience in vascularized toe joint transfer (p = 0.25). The outcomes of different techniques of extensor mechanism reconstruction were similar in terms of extensor lag, arc of motion, and reconstructed finger arc of motion compared with the pretransfer toe proximal interphalangeal joint arc of motion. With this treatment algorithm, consistent outcomes can be produced with minimal extensor lag and maximum use of potential toe proximal interphalangeal joint arc of motion. Therapeutic, IV.

  7. First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

    PubMed Central

    Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

    2016-01-01

    Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

  8. Lesch typology and temperament in opioid dependence: a cross-sectional study.

    PubMed

    Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

    2014-08-01

    The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

    PubMed

    Luvan, M; Kanthan, S R; Roshan, G; Saw, A

    2015-11-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

  10. Presynaptic muscarinic receptors, calcium channels, and protein kinase C modulate the functional disconnection of weak inputs at polyinnervated neonatal neuromuscular synapses.

    PubMed

    Santafe, M M; Garcia, N; Lanuza, M A; Tomàs, M; Besalduch, N; Tomàs, J

    2009-04-01

    We studied the relation among calcium inflows, voltage-dependent calcium channels (VDCC), presynaptic muscarinic acetylcholine receptors (mAChRs), and protein kinase C (PKC) activity in the modulation of synapse elimination. We used intracellular recording to determine the synaptic efficacy in dually innervated endplates of the levator auris longus muscle of newborn rats during axonal competition in the postnatal synaptic elimination period. In these dual junctions, the weak nerve terminal was potentiated by partially reducing calcium entry (P/Q-, N-, or L-type VDCC-specific block or 500 muM magnesium ions), M1- or M4-type selective mAChR block, or PKC block. Moreover, reducing calcium entry or blocking PKC or mAChRs results in unmasking functionally silent nerve endings that now recover neurotransmitter release. Our results show interactions between these molecules and indicate that there is a release inhibition mechanism based on an mAChR-PKC-VDCC intracellular cascade. When it is fully active in certain weak motor axons, it can depress ACh release and even disconnect synapses. We suggest that this mechanism plays a central role in the elimination of redundant neonatal synapses, because functional axonal withdrawal can indeed be reversed by mAChRs, VDCCs, or PKC block.

  11. A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

    PubMed

    Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

    2009-05-01

    Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

  12. [Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

    PubMed

    Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

    2010-01-01

    Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

  13. Adult presentation of Bartter syndrome type IV with erythrocytosis.

    PubMed

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

  14. Audiological findings in children with mucopolysaccharidoses type i-iv.

    PubMed

    Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

    The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

  15. An Analysis of Superintendent-CEO Evaluation as Compared to Executive Officer Evaluation in Private Education, Higher Education, Non-Profit Organizations, and For-Profit Corporations

    ERIC Educational Resources Information Center

    Hentze, Brandon T.

    2010-01-01

    The accountability movement of the early 1990s, along with the No Child Left Behind legislation of 2001, required a change in the role of the school district superintendent. The long-used model of superintendent-manager was no longer appropriate to lead school districts in this new era of accountability. A new model of the superintendency emerged…

  16. Coexistence of twitch potentiation and tetanic force decline in rat hindlimb muscle

    NASA Technical Reports Server (NTRS)

    Rankin, Lucinda L.; Enoka, Roger M.; Volz, Kathryn A.; Stuart, Douglas G.

    1988-01-01

    The effect of whole-muscle fatigue on the isometric twitch was investigated in various hindlimb muscles of anesthetized rats, using an experimental protocol designed to assess the levels of fatigability in motor units. The results of EMG and force measurements revealed the existence of a linear relationship between fatigability and the magnitude of the twitch force following the fatigue test in both soleus and extensor digitorum longus muscles.

  17. The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

    PubMed

    Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

    2002-04-02

    The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

  18. Risk evaluation for in-vehicle sign information.

    DOT National Transportation Integrated Search

    2016-05-01

    The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

  19. Nonstatic radiating spheres in general relativity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krori, K.D.; Borgohain, P.; Sarma, R.

    1985-02-15

    The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

  20. Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

    DTIC Science & Technology

    2010-05-01

    Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

  1. Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

    NASA Astrophysics Data System (ADS)

    Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

    2013-09-01

    Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

  2. Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

    PubMed

    Satya, Ramadass; Vijayakumar, Vani

    2006-10-01

    A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

  3. Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

    PubMed

    Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

    2014-06-01

    The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

  4. Biomarker for Glycogen Storage Diseases

    ClinicalTrials.gov

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  5. Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

    PubMed Central

    Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

    2014-01-01

    Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

  6. Self aligned hysteresis free carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

    2016-04-01

    Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

  7. The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

    PubMed

    Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

    2018-05-01

    Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

  8. Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

    PubMed

    Boos, A

    2000-01-01

    Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

  9. Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

    PubMed Central

    Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

    2017-01-01

    The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

  10. Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

    PubMed

    Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

    2016-01-01

    Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

  11. Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

    PubMed Central

    Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

    2016-01-01

    Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

  12. Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

    PubMed Central

    Harastani, Houda H.; Tokajian, Sima T.

    2014-01-01

    Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

  13. Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

    DTIC Science & Technology

    1983-12-01

    2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

  14. Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

    PubMed

    Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

    2017-01-01

    Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

  15. AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasanth, V.; Chen, Yao; Feng, Shiwei

    2016-10-10

    Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

  16. Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

    PubMed

    Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

    2015-07-01

    In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

  17. [Alcohol-related cognitive impairment and the DSM-5].

    PubMed

    Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

    2016-01-01

    It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

  18. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

    PubMed Central

    Luvan, M; Roshan, G; Saw, A

    2015-01-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

  19. The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

    PubMed Central

    Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

    2012-01-01

    In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

  20. Evaluation of clinical methods for peroneal muscle testing.

    PubMed

    Sarig-Bahat, Hilla; Krasovsky, Andrei; Sprecher, Elliot

    2013-03-01

    Manual muscle testing of the peroneal muscles is well accepted as a testing method in musculoskeletal physiotherapy for the assessment of the foot and ankle. The peroneus longus and brevis are primary evertors and secondary plantar flexors of the ankle joint. However, some international textbooks describe them as dorsi flexors, when instructing peroneal muscle testing. The identified variability raised a question whether these educational texts are reflected in the clinical field. The purposes of this study were to investigate what are the methods commonly used in the clinical field for peroneal muscle testing and to evaluate their compatibility with functional anatomy. A cross-sectional study was conducted, using an electronic questionnaire sent to 143 Israeli physiotherapists in the musculoskeletal field. The survey questioned on the anatomical location of manual resistance and the combination of motions resisted. Ninety-seven responses were received. The majority (69%) of respondents related correctly to the peronei as evertors, but asserted that resistance should be located over the dorsal aspect of the fifth metatarsus, thereby disregarding the peroneus longus. Moreover, 38% of the respondents described the peronei as dorsi flexors, rather than plantar flexors. Only 2% selected the correct method of resisting plantarflexion and eversion at the base of the first metatarsus. We consider this technique to be the most compatible with the anatomy of the peroneus longus and brevis. The Fisher-Freeman-Halton test indicated that there was a significant relationship between responses on the questions (P = 0.0253, 95% CI 0.0249-0.0257), thus justifying further correspondence analysis. The correspondence analysis found no clustering of the answers that were compatible with anatomical evidence and were applied in the correct technique, but did demonstrate a common error, resisting dorsiflexion rather than plantarflexion, which was in agreement with the described frequencies. Inconsistencies were identified between the instruction method commonly provided for peroneal muscle testing in textbook and the functional anatomy of these muscles. Results reflect the lack of accuracy in applying functional anatomy to peroneal testing. This may be due to limited use of peroneal muscle testing or to inadequate investigation of the existing evaluation methods and their validity. Accordingly, teaching materials and clinical methods used for this test should be re-evaluated. Further research should investigate the value of peroneal muscle testing in clinical ankle evaluation. Copyright © 2012 John Wiley & Sons, Ltd.

  1. The behaviour of the long-latency stretch reflex in patients with Parkinson's disease

    PubMed Central

    Rothwell, Jc; Obeso, Ja; Traub, Mm; Marsden, Cd

    1983-01-01

    The size of the long-latency stretch reflex was measured in a proximal (triceps) and distal (flexor pollicis longus) muscle in 47 patients with Parkinson's disease, and was compared with that seen in a group of 12 age-matched normal control subjects. The patients were classified clinically into four groups according to the degree of rigidity at the elbow or tremor. Stretch reflexes were evaluated while the subject was exerting a small force against a constant preload supplied by a torque motor, and the size of the reflex response was measured as fractional increase over basal levels of activity. When stretches were given at random intervals by increasing the force exerted by the motor by a factor of 2 or 3, there was a clear trend for the more severely affected patients to have larger long latency responses in the triceps muscle, although there was no change in the size of the short-latency, spinal component of the response. In contrast, there was no change in the size of the long-latency response of the flexor pollicis longus in any group of patients with Parkinson's disease. Despite any differences in reflex size, the inherent muscle stiffness of both muscles appeared to be normal in all groups of patients with Parkinson's disease, since the displacement trajectory of the limb following the force increase was the same as control values in the short (25 ms) period before reflex compensation could intervene. In 20 of the patients and in seven of the control subjects, servo-controlled, ramp positional disturbances were given to the thumb. Up to a velocity of 300°/s, the size of the long-latency stretch reflex was proportional to the log velocity of stretch. This technique revealed, in both moderately and severely rigid patients, increases in the reflex sensitivity of the flexor pollicis longus, which had not been clear using step torque stretches alone. However, whether using ramp or step displacements, long latency stretch reflex gain was not closely related to rigidity; reflex size was within the normal range in many patients with severe rigidity. Enhanced long latency stretch reflexes thus contribute to, but may not be solely responsible for, rigidity in Parkinson's disease. PMID:6842198

  2. Motor-neuron pool excitability of the lower leg muscles after acute lateral ankle sprain.

    PubMed

    Klykken, Lindsey W; Pietrosimone, Brian G; Kim, Kyung-Min; Ingersoll, Christopher D; Hertel, Jay

    2011-01-01

    Neuromuscular deficits in leg muscles that are associated with arthrogenic muscle inhibition have been reported in people with chronic ankle instability, yet whether these neuromuscular alterations are present in individuals with acute sprains is unknown. To compare the effect of acute lateral ankle sprain on the motor-neuron pool excitability (MNPE) of injured leg muscles with that of uninjured contralateral leg muscles and the leg muscles of healthy controls. Case-control study. Laboratory. Ten individuals with acute ankle sprains (6 females, 4 males; age= 19.2 ± 3.8 years, height= 169.4 ± 8.5 cm, mass= 66.3 ± 11.6 kg) and 10 healthy individuals(6 females,4 males; age= 20.6 ± 4.0 years, height = 169.9 ± 10.6 cm, mass= 66.3 ± 10.2 kg) participated. The independent variables were group (acute ankle sprain, healthy) and limb (injured, uninjured). Separate dependent t tests were used to determine differences in MNPE between legs. The MNPE of the soleus, fibularis longus, and tibialis anterior was measured by the maximal Hoffmann reflex (H(max)) and maximal muscle response (M(max)) and was then normalized using the H(max):M(max) ratio. The soleus MNPE in the ankle-sprain group was higher in the injured limb (H(max):M(max) = 0.63; 95% confidence interval [Cl],0.46, 0.80) than the uninjured limb (H(max):M(max) = 0.47; 95%Cl, 0.08, 0.93)(t(6) = 3.62,P =.01).In the acute ankle-sprain group, tibialis anterior MNPE tended to be lower in the injured ankle (H(max):M(max) =0.06; 95% Cl, 0.01, 0.10) than in the uninjured ankle (H(max):M(max) =0.22; 95%Cl, 0.09, 0.35),but this finding was not different (t(9) =-2.01, P =.07). No differences were detected between injured (0.22; 95% Cl, 0.14, 0.29) and uninjured (0.25; 95%Cl, 0.12, 0.38) ankles for the fibularis longus in the ankle-sprain group (t(9) =-0.739, P =.48). We found no side-to-side differences in any muscle among the healthy group. Facilitated MNPE was present in the involved soleus muscle of patients with acute ankle sprains, but no differences were found in the fibularis longus or tibialis anterior muscles.

  3. Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

    PubMed

    Madabhushi, Ram; Marians, Kenneth J

    2009-01-30

    In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

  4. Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

    PubMed

    Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

    2015-01-01

    A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

  5. Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

    PubMed

    Hardie, Andrew D; Kereshi, Borko

    2014-06-01

    Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

  6. Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

    DTIC Science & Technology

    2017-05-17

    490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

  7. Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

    PubMed

    Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

    2017-01-01

    The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

  8. Adult presentation of Bartter syndrome type IV with erythrocytosis

    PubMed Central

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

  9. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

    PubMed Central

    MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

    2012-01-01

    SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

  10. "Fast" and "slow" muscle fibres in hindlimb muscles of adult rats regenerate from intrinsically different satellite cells.

    PubMed

    Kalhovde, J M; Jerkovic, R; Sefland, I; Cordonnier, C; Calabria, E; Schiaffino, S; Lømo, T

    2005-02-01

    Myosin heavy chain (MyHC) expression was examined in regenerating fast extensor digitorum longus (EDL) and slow soleus (SOL) muscles of adult rats. Myotoxic bupivacaine was injected into SOL and EDL and the muscles were either denervated or neuromuscularly blocked by tetrodotoxin (TTX) on the sciatic nerve. Three to 10 or 30 days later, denervated SOL or EDL, or innervated but neuromuscularly blocked EDL received a slow 20 Hz stimulus pattern through electrodes implanted on the muscles or along the fibular nerve to EDL below the TTX block. In addition, denervated SOL and EDL received a fast 100 Hz stimulus pattern. Denervated EDL and SOL stimulated with the same slow stimulus pattern expressed different amounts of type 1 MyHC protein (8% versus 35% at 10 days, 13% versus 87% at 30 days). Stimulated denervated and stimulated innervated (TTX blocked) EDL expressed the same amounts of type 1, 2A, 2X and 2B MyHC proteins. Cross-sections treated for in situ hybridization and immunocytochemistry showed expression of type 1 MyHC in all SOL fibres but only in some scattered single or smaller groups of fibres in EDL. The results suggest that muscle fibres regenerate from intrinsically different satellite cells in EDL and SOL and within EDL. However, induction by different extrinsic factors arising in extracellular matrix or from muscle position and usage in the limb has not been excluded. No evidence for nerve-derived trophic influences was obtained.

  11. High-fat diet induces skeletal muscle oxidative stress in a fiber type-dependent manner in rats.

    PubMed

    Pinho, Ricardo A; Sepa-Kishi, Diane M; Bikopoulos, George; Wu, Michelle V; Uthayakumar, Abinas; Mohasses, Arta; Hughes, Meghan C; Perry, Christopher G R; Ceddia, Rolando B

    2017-09-01

    This study investigated the effects of high-fat (HF) diet on parameters of oxidative stress among muscles with distinct fiber type composition and oxidative capacities. To accomplish that, male Wistar rats were fed either a low-fat standard chow (SC) or a HF diet for 8 weeks. Soleus, extensor digitorum longus (EDL), and epitrochlearis muscles were collected and mitochondrial H 2 O 2 (mtH 2 O 2 ) emission, palmitate oxidation, and gene expression and antioxidant system were measured. Chronic HF feeding enhanced fat oxidation in oxidative and glycolytic muscles. It also caused a significant reduction in mtH 2 O 2 emission in the EDL muscle, although a tendency towards a reduction was also found in the soleus and epitrochlearis muscles. In the epitrochlearis, HF diet increased mRNA expression of the NADPH oxidase complex; however, this muscle also showed an increase in the expression of antioxidant proteins, suggesting a higher capacity to generate and buffer ROS. The soleus muscle, despite being highly oxidative, elicited H 2 O 2 emission rates equivalent to only 20% and 35% of the values obtained for EDL and epitrochlearis muscles, respectively. Furthermore, the Epi muscle with the lowest oxidative capacity was the second highest in H 2 O 2 emission. In conclusion, it appears that intrinsic differences related to the distribution of type I and type II fibers, rather than oxidative capacity, drove the activity of the anti- and pro-oxidant systems and determine ROS production in different skeletal muscles. This also suggests that the impact of potentially deleterious effects of ROS production on skeletal muscle metabolism/function under lipotoxic conditions is fiber type-specific. Copyright © 2017. Published by Elsevier Inc.

  12. Arthroscopic pubic symphysis debridement and adductor enthesis repair in athletes with athletic pubalgia: technical note and video illustration.

    PubMed

    Hopp, Sascha; Tumin, Masjudin; Wilhelm, Peter; Pohlemann, Tim; Kelm, Jens

    2014-11-01

    We elaborately describe our novel arthroscopic technique of the symphysis pubis in athletes with osteitis pubis and concomitant adductor enthesopathy who fail to conservative treatment modalities. The symphysis pubis is debrided arthroscopically and the degenerated origin of adductor tendon (enthesis) is excised and reattached. With our surgical procedure the stability of the symphysis pubis is successfully preserved and the adductor longus enthesopathy simultaneously addressed in the same setting.

  13. Nomenclatural review of long digital forelimb flexors in carnivores.

    PubMed

    Spoor, C F; Badoux, D M

    1986-12-01

    A hitherto-unknown atavistic muscle in the dog initiated a review of the literature on the homologies and nomenclature of the forelimb flexors in carnivores and man. A consequence is that we recommend a revision of the nomenclature in the Nomina Anatomica Veterinaria (Ithaca, New York, 1983) so that it is in agreement with the Nomina Anatomica (Wilkins, Baltimore, 1983). This revision mainly consists of the incorporation of the terms M. palmaris longus and Mm. flexores breves manus.

  14. [N. thoracicus longus lesion--a rare injury in weight lifting].

    PubMed

    Zander, D; Perlick, L; Diedrich, O

    2000-12-01

    The case of long thoracic mononeuropathy associated with sport participation a presented. The diagnosis was confirmed with electromyography. It is suggested that the athletic activity caused a stretch injury to the long thoracic nerve. Degenerative changes and infections were excluded. Conservative management, consisting of range of motion exercises for the shoulder and strengthening of the serratus anterior muscle, resulted in a forable outcome. The 12 month follow-up showed only slight changes in EMG and clinical examination.

  15. Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

    PubMed

    Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

    2018-01-09

    Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

  16. Effects of spaceflight in the adductor longus muscle of rats flown in the Soviet Biosatellite COSMOS 2044. A study employing neural cell adhesion molecule (N-CAM) immunocytochemistry and conventional morphological techniques (light and electron microscopy)

    NASA Technical Reports Server (NTRS)

    D'Amelio, F.; Daunton, N. G.

    1992-01-01

    The effects of spaceflight upon the "slow" muscle adductor longus were examined in rats flown in the Soviet Biosatellite COSMOS 2044. The techniques employed included standard methods for light microscopy, neural cell adhesion molecule (N-CAM) immunocytochemistry and electron microscopy. Light microscopic observations revealed myofiber atrophy and segmental necrosis accompanied by cellular infiltrates composed of macrophages, leukocytes and mononuclear cells. Neural cell adhesion molecule immunoreactivity (N-CAM-IR) was seen on the myofiber surface and in regenerating myofibers. Ultrastructural alterations included Z band streaming, disorganization of myofibrillar architecture, sarcoplasmic degradation, extensive segmental necrosis with apparent preservation of the basement membrane, degenerative phenomena of the capillary endothelium and cellular invasion of necrotic areas. Regenerating myofibers were identified by the presence of increased amounts of ribosomal aggregates and chains of polyribosomes associated with myofilaments. The principal electron microscopic changes of the neuromuscular junctions showed axon terminals with a decrease or absence of synaptic vesicles replaced by microtubules and neurofilaments, degeneration of axon terminals, vacant axonal spaces and changes suggestive of axonal sprouting. The present observations suggest that alterations such as myofibrillar disruption and necrosis, muscle regeneration and denervation and synaptic remodeling at the level of the neuromuscular junction may take place during spaceflight.

  17. Z-plasty of the flexor hallucis longus tendon at tarsal tunnel for checkrein deformity.

    PubMed

    Lee, Jae Hoon; Kim, Young Jun; Baek, Jong Hun; Kim, Dong Hee

    2016-12-01

    To review the outcome of Z-plasty of the flexor hallucis longus (FHL) tendon at the tarsal tunnel for checkrein deformity in 8 patients. Records of 6 males and 2 females aged 14 to 67 (mean, 39.5) years who underwent Z-plasty (lengthening) of the FHL tendon at the tarsal tunnel for checkrein deformity in the first and second toes by a single surgeon were reviewed. All patients had undergone 3 months of conservative treatment. The mean time from injury to surgical treatment was 8.4 (range, 5-12) months. All patients had associated injuries including distal tibiofibular fracture (n=6), distal fibular fracture (n=1), and crush injury aroundthe ankle (n=1); they were treated with intramedullary nailing (n=6), long leg splinting (n=1), and short leg splinting (n=1). After a mean follow-up of 3.4 (range, 1-7) years, the FHL tendon was lengthened by a mean of 1.7 (range, 1.6-1.8) cm, and the mean American Orthopedic Foot and Ankle Society hallux score increased from 59 (range, 52-67) to 89 (range, 80-90). No patient had recurrence, nerve injury, or tarsal tunnel syndrome, although one patient had sensory disturbance of the posterior tibial nerve in the forefoot, which resolved spontaneously at week 2. Z-plasty of the FHL tendon at the tarsal tunnel is a viable option for correction of checkrein deformity.

  18. Half-peroneus-longus-tendon graft augmentation for unqualified hamstring tendon graft of anterior cruciate ligament reconstruction.

    PubMed

    Liu, Chung-Ting; Lu, Yung-Chang; Huang, Chang-Hung

    2015-09-01

    In some situations, harvested hamstring tendon grafts are not qualified for anterior cruciate ligament (ACL) reconstruction. This study aimed to present a reinforcing method with additional half peroneus longus tendon (half-PLT) graft augmentation. Eight cases underwent ACL reconstruction with unqualified hamstring tendon grafts (diameter <7 mm) and were salvaged by additional half-PLT graft augmentation. The pivot shift test and KT-1000 tests were performed 3 years after surgery. Functional evaluation of subjective International Knee Documentation Committee (IKDC) and Lysholm scores was also done. In addition, Foot and Ankle Disability Index (FADI) scores were used to evaluate the function of the ankle donor site. The diameter of unqualified four-strand hamstring tendon grafts was 6.2 mm on average (range, 6.0-6.5 mm). The average diameter of hamstring grafts with half-PLT augmentation was 9.6 mm (range, 9.5-10.0 mm). The pivot shift test was negative in all patients. No significant differences between normal and abnormal knees were found by KT-1000. The average IKDC score was 86.0 (range, 83 to 89), and the average Lysholm score was 84.4 (range, 80-90). The average FADI score for the donor sites of half-PLT was 135.8 (range, 134-136). Additional half-PLT can successfully and safely reinforce unqualified hamstring tendon grafts for ACL reconstruction.

  19. The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

    PubMed Central

    Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

    2017-01-01

    Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

  20. Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

    PubMed Central

    Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

    2004-01-01

    NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

  1. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

    PubMed Central

    Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

    2015-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

  2. Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

    PubMed Central

    Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

    2013-01-01

    DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

  3. Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

    PubMed

    Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

    2013-11-01

    The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

  4. Influence of hospital type on survival in stage IV colorectal cancer.

    PubMed

    Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

    2016-08-01

    Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

  5. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  6. Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

    PubMed Central

    Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

    2018-01-01

    Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

  7. Optimization of Spinal Muscular Atrophy subject's muscle activity during gait

    NASA Astrophysics Data System (ADS)

    Umat, Gazlia; Rambely, Azmin Sham

    2014-06-01

    Spinal Muscular Atrophy (SMA) is a hereditary disease related muscle nerve disorder caused by degeneration of the anterior cells of the spinal cord. SMA is divided into four types according to the degree of seriousness. SMA patients show different gait with normal people. Therefore, this study focused on the effects of SMA patient muscle actions and the difference that exists between SMA subjects and normal subjects. Therefore, the electromyography (EMG) test will be used to track the behavior of muscle during walking and optimization methods are used to get the muscle stress that is capable of doing the work while walking. Involved objective function is non-linear function of the quadratic and cubic functions. The study concludes with a comparison of the objective function using the force that sought to use the moment of previous studies and the objective function using the data obtained from EMG. The results shows that the same muscles, peroneus longus and bisepsfemoris, were used during walking activity by SMA subjects and control subjects. Muscle stress force best solution achieved from part D in simulation carried out.

  8. Comparison of lower limb muscle activation with ballet movements (releve and demi-plie) and general movements (heel rise and squat) in healthy adults.

    PubMed

    Kim, Min-Ju; Kim, Joong-Hwi

    2016-01-01

    [Purpose] The aim of this study was to demonstrate therapeutic grounds for rehabilitation exercise approach by comparing and analyzing muscular activities of Ballet movements: the releve movement (RM) and the demi-plie movement (DM). [Methods] Four types of movements such as RM vs. heel rise (HM) and DM vs. squat movement (SM) were randomized and applied in 30 healthy male and female individuals while measuring 10-s lower limb muscular activities (gluteus maximus [GMa], gluteus medius [GMe], rectus femoris [RF], adductor longus [AL], medial gastrocnemius [MG], and lateral gastrocnemius [LG]) by using surface electromyography (EMG). [Results] Significant differences were found in GMa, GMe, AL and MG activities for DM and in all of the six muscles for RM, in particular when the two groups were compared (RM vs HM and DM vs SM). [Conclusion] The RM and DM have a greater effect on lower limb muscular force activities compared to HM and SM and could be recommended as clinical therapeutic exercises for lower limb muscle enhancement.

  9. Comparison of lower limb muscle activation with ballet movements (releve and demi-plie) and general movements (heel rise and squat) in healthy adults

    PubMed Central

    Kim, Min-Ju; Kim, Joong-Hwi

    2016-01-01

    [Purpose] The aim of this study was to demonstrate therapeutic grounds for rehabilitation exercise approach by comparing and analyzing muscular activities of Ballet movements: the releve movement (RM) and the demi-plie movement (DM). [Methods] Four types of movements such as RM vs. heel rise (HM) and DM vs. squat movement (SM) were randomized and applied in 30 healthy male and female individuals while measuring 10-s lower limb muscular activities (gluteus maximus [GMa], gluteus medius [GMe], rectus femoris [RF], adductor longus [AL], medial gastrocnemius [MG], and lateral gastrocnemius [LG]) by using surface electromyography (EMG). [Results] Significant differences were found in GMa, GMe, AL and MG activities for DM and in all of the six muscles for RM, in particular when the two groups were compared (RM vs HM and DM vs SM). [Conclusion] The RM and DM have a greater effect on lower limb muscular force activities compared to HM and SM and could be recommended as clinical therapeutic exercises for lower limb muscle enhancement. PMID:26957762

  10. Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

    PubMed Central

    SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

    1998-01-01

    Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

  11. Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

    PubMed

    Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

    2005-01-01

    The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

  12. Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

    PubMed

    Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

    2015-08-01

    Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

  13. Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

    PubMed Central

    Charvin, G.; Bensimon, D.; Croquette, V.

    2003-01-01

    Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

  14. L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

    PubMed Central

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

    2012-01-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

  15. L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

    PubMed

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

    2012-10-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

  16. [Joint endoprosthesis pathology. Histopathological diagnostics and classification].

    PubMed

    Krenn, V; Morawietz, L; Jakobs, M; Kienapfel, H; Ascherl, R; Bause, L; Kuhn, H; Matziolis, G; Skutek, M; Gehrke, T

    2011-05-01

    Prosthesis durability has steadily increased with high 10-year rates of 88-95%. However, four pathogenetic groups of diseases can decrease prosthesis durability: (1) periprosthetic wear particle disease (aseptic loosening) (2) bacterial infection (septic loosening) (3) periprosthetic ossification, and (4) arthrofibrosis. The histopathological "extended consensus classification of periprosthetic membranes" includes four types of membranes, arthrofibrosis, and osseous diseases of endoprosthetics: The four types of neosynovia are: wear particle-induced type (type I), mean prosthesis durability (MPD) in years 12.0; infectious type (type II), MPD 2.5; combined type (type III) MPD 4.2; and indeterminate type (type IV), MPD 5.5. Arthrofibrosis can be determined in three grades: grade 1 needs clinical information to be differentiated from a type IV membrane, and grades 2 & 3 can be diagnosed histopathologically. Periprosthetic ossification, osteopenia-induced fractures, and aseptic osteonecrosis can be histopathologically diagnosed safely with clinical information. The extended consensus classification of periprosthetic membranes may be a diagnostic groundwork for a future national endoprosthesis register.

  17. NATIONAL COASTAL CONDITION REPORT IV | Science ...

    EPA Pesticide Factsheets

    The National Coastal Condition Report IV (NCCR IV) is the fourth in a series of environmental assessments of U.S. coastal waters and the Great Lakes. The report includes assessments of all the nation’s estuaries in the contiguous 48 states and Puerto Rico, south-eastern Alaska, Hawaii, the U.S. Virgin Islands, Guam, and American Samoa. The NCCR IV presents four main types of data: (1) coastal monitoring data, (2) coastal ocean/ offshore monitoring data, (3) offshore fisheries data, and (4) assessment and advisory data (new to NCCR IV). The NCCR IV relies heavily on coastal monitoring data from EPA’s National Coastal Assessment (NCA) to assess coastal condition by evaluating five indicators of condition—water quality, sediment quality, benthic community condition, coastal habitat loss, and fish tissue contaminants. To assess and report on the condition of the nation's coastal resources

  18. 2- and 3-substituted imidazo[1,2-a]pyrazines as inhibitors of bacterial type IV secretion

    PubMed Central

    Sayer, James R.; Walldén, Karin; Pesnot, Thomas; Campbell, Frederick; Gane, Paul J.; Simone, Michela; Koss, Hans; Buelens, Floris; Boyle, Timothy P.; Selwood, David L.; Waksman, Gabriel; Tabor, Alethea B.

    2014-01-01

    A novel series of 8-amino imidazo[1,2-a]pyrazine derivatives has been developed as inhibitors of the VirB11 ATPase HP0525, a key component of the bacterial type IV secretion system. A flexible synthetic route to both 2- and 3-aryl substituted regioisomers has been developed. The resulting series of imidazo[1,2-a]pyrazines has been used to probe the structure–activity relationships of these inhibitors, which show potential as antibacterial agents. PMID:25438770

  19. Sfg

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume E `Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes RON to STI' of Volume 14 `Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV `Physical Chemistry'.

  20. Vet

    NASA Astrophysics Data System (ADS)

    Fischer, R. X.; Baur, W. H.

    This document is part of Subvolume F 'Zeolite-Type Crystal Structures and their Chemistry. Framework Type Codes STO to ZON' of Volume 14 'Microporous and other Framework Materials with Zeolite-Type Structures' of Landolt-Börnstein Group IV 'Physical Chemistry'.

  1. Juvenile pityriasis rubra pilaris: report of 28 cases in Taiwan.

    PubMed

    Yang, Chao-Chun; Shih, I-Hsin; Lin, Wan-Lung; Yu, Yi-Sheng; Chiu, Hsien-Ching; Huang, Po-Han; Cheng, Yu-Wen; Lee, Julia Yu-Yun; Chen, WenChieh

    2008-12-01

    Pityriasis rubra pilaris (PRP) is a papulosquamous dermatosis uncommon in juveniles. Large-scale studies are limited, especially from Asian countries. We sought to analyze the clinical manifestations of juvenile PRP in Taiwanese patients and compare them with reported series in the literature. The diagnosis of juvenile PRP was made based on clinical-histopathologic correlation. The therapeutic response and disease course were followed up by re-examination of the patients or by telephone. A total of 47 patients were identified, with histopathologic confirmation of the clinical diagnosis of juvenile PRP in 28 cases. A preponderance of Griffiths' type IV PRP (85.7%) rather than type III PRP (14.3%) was found. Palmoplantar hyperkeratosis appeared to be a cardinal feature. In patients with type IV PRP, skin lesions in areas other than the elbows/knees and palms/soles were common. Treatment with systemic acitretin in 6 patients failed to effect a dose- or time-dependent improvement. In contrast with other studies, two thirds of our patients with type III and IV juvenile PRP had a protracted course lasting more than 3 years. This study was a retrospective review. Patient compliance with treatment was frequently poor. Type IV juvenile PRP predominated but our cases showed a wider distribution of skin lesions than is typically described. When children present with an acute onset of diffuse palmoplantar hyperkeratosis, a diagnosis of juvenile PRP should be considered. Because of the divergent clinical manifestations of juvenile PRP in different populations, there is a need to modify and re-evaluate classification systems based on regional differences.

  2. Alternative Neisseria spp. type IV pilin glycosylation with a glyceramido acetamido trideoxyhexose residue

    PubMed Central

    Chamot-Rooke, Julia; Rousseau, Benoit; Lanternier, Fanny; Mikaty, Guillain; Mairey, Emilie; Malosse, Christian; Bouchoux, Guy; Pelicic, Vladimir; Camoin, Luc; Nassif, Xavier; Duménil, Guillaume

    2007-01-01

    The importance of protein glycosylation in the interaction of pathogenic bacteria with their host is becoming increasingly clear. Neisseria meningitidis, the etiological agent of cerebrospinal meningitis, crosses cellular barriers after adhering to host cells through type IV pili. Pilin glycosylation genes (pgl) are responsible for the glycosylation of PilE, the major subunit of type IV pili, with the 2,4-diacetamido-2,4,6-trideoxyhexose residue. Nearly half of the clinical isolates, however, display an insertion in the pglBCD operon, which is anticipated to lead to a different, unidentified glycosylation. Here the structure of pilin glycosylation was determined in such a strain by “top-down” MS approaches. MALDI-TOF, nanoelectrospray ionization Fourier transform ion cyclotron resonance, and nanoelectrospray ionization quadrupole TOF MS analysis of purified pili preparations originating from N. meningitidis strains, either wild type or deficient for pilin glycosylation, revealed a glycan mass inconsistent with 2,4-diacetamido-2,4,6-trideoxyhexose or any sugar in the databases. This unusual modification was determined by in-source dissociation of the sugar from the protein followed by tandem MS analysis with collision-induced fragmentation to be a hexose modified with a glyceramido and an acetamido group. We further show genetically that the nature of the sugar present on the pilin is determined by the carboxyl-terminal region of the pglB gene modified by the insertion in the pglBCD locus. We thus report a previously undiscovered monosaccharide involved in posttranslational modification of type IV pilin subunits by a MS-based approach and determine the molecular basis of its biosynthesis. PMID:17804791

  3. Failure mechanisms and closed reduction of a constrained tripolar acetabular liner.

    PubMed

    Robertson, William J; Mattern, Christopher J; Hur, John; Su, Edwin P; Pellicci, Paul M

    2009-02-01

    Unlike traditional bipolar constrained liners, the Osteonics Omnifit constrained acetabular insert is a tripolar device, consisting of an inner bipolar bearing articulating within an outer, true liner. Every reported failure of the Omnifit tripolar implant has been by failure at the shell-bone interface (Type I failure), failure at the shell-liner interface (Type II failure), or failure of the locking mechanism resulting in dislocation of the bipolar-liner interface (Type III failure). In this report we present two cases of failure of the Omnifit tripolar at the bipolar-femoral head interface. To our knowledge, these are the first reported cases of failure at the bipolar-femoral head interface (Type IV failure). In addition, we described the first successful closed reduction of a Type IV failure.

  4. Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

    PubMed Central

    Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

    2014-01-01

    We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

  5. Two-View Gravity Stress Imaging Protocol for Nondisplaced Type II Supination External Rotation Ankle Fractures: Introducing the Gravity Stress Cross-Table Lateral View.

    PubMed

    Boffeli, Troy J; Collier, Rachel C; Gervais, Samuel J

    Assessing ankle stability in nondisplaced Lauge-Hansen supination external rotation type II injuries requires stress imaging. Gravity stress mortise imaging is routinely used as an alternative to manual stress imaging to assess deltoid integrity with the goal of differentiating type II from type IV injuries in cases without a posterior or medial fracture. A type II injury with a nondisplaced fibula fracture is typically treated with cast immobilization, and a type IV injury is considered unstable and often requires operative repair. The present case series (two patients) highlights a standardized 2-view gravity stress imaging protocol and introduces the gravity stress cross-table lateral view. The gravity stress cross-table lateral view provides a more thorough evaluation of the posterior malleolus owing to the slight external rotation and posteriorly directed stress. External rotation also creates less bony overlap between the tibia and fibula, allowing for better visualization of the fibula fracture. Gravity stress imaging confirmed medial-sided injury in both cases, confirming the presence of supination external rotation type IV or bimalleolar equivalent fractures. Open reduction and internal fixation was performed, and both patients achieved radiographic union. No further treatment was required at 21 and 33 months postoperatively. Copyright © 2017 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  6. Fine typing of methicillin-resistant Staphylococcus aureus isolates using direct repeat unit and staphylococcal interspersed repeat unit typing methods.

    PubMed

    Ho, Cheng-Mao; Ho, Mao-Wang; Li, Chi-Yuan; Lu, Jang-Jih

    2015-08-01

    Methicillin-resistant Staphylococcus aureus (MRSA) typing is an important epidemiologic tool for monitoring trends and preventing outbreaks. However, the efficiency of various MRSA typing methods for each SCCmec MRSA isolate is rarely evaluated. A total of 157 MRSA isolates from four different regions in Taiwan were typed with five different molecular methods, including SCCmec typing, multilocus sequence typing (MLST), spa typing, mec-associated direct repeat unit (dru) copy number determination, and staphylococcal interspersed repeat unit (SIRU) profiling. There were four SCCmec types, eight MLST types, 15 spa types, 11 dru types, and 31 SIRU profiles. The most common type determined by each molecular typing method was SCCmec III (115 isolates, 73.2%), ST239 (99 isolates, 63.1%), t037 (107 isolates, 68.2%), 14 dru copies (76 isolates, 48.4%), and SIRU profile 3013722 (102 isolates, 65%), respectively. When using the combination of MLST, spa typing, and dru copy number, ST5-t002-4 (n = 8), ST239-t037-14 (n = 68), ST59-t437-9 (n = 9), and ST59-t437-11 (n = 6) were found to be the most common types of SCCmec types II (n = 9), III (n = 115), IV (n = 21), and VT (n = 11) isolates, respectively. SCCmec type III isolates were further classified into 11 dru types. Of the 21 SCCmec type IV isolates, 14 SIRU profiles were found. Seven SIRU patterns were observed in the 11 SCCmec type VT isolates. Different typing methods showed a similar Hunter-Gaston discrimination index among the 157 MRSA isolates. However, dru and SIRU typing methods had a better discriminatory power for SCCmec type III and SCCmec types IV and VT isolates, respectively, suggesting that dru and SIRU can be used to further type these isolates. Copyright © 2013. Published by Elsevier B.V.

  7. Malleolar fractures and their ligamentous injury equivalents have similar outcomes in supination-external rotation type IV fractures of the ankle treated by anatomical internal fixation.

    PubMed

    Berkes, M B; Little, M T M; Lazaro, L E; Sculco, P K; Cymerman, R M; Daigl, M; Helfet, D L; Lorich, D G

    2012-11-01

    It has previously been suggested that among unstable ankle fractures, the presence of a malleolar fracture is associated with a worse outcome than a corresponding ligamentous injury. However, previous studies have included heterogeneous groups of injury. The purpose of this study was to determine whether any specific pattern of bony and/or ligamentous injury among a series of supination-external rotation type IV (SER IV) ankle fractures treated with anatomical fixation was associated with a worse outcome. We analysed a prospective cohort of 108 SER IV ankle fractures with a follow-up of one year. Pre-operative radiographs and MRIs were undertaken to characterise precisely the pattern of injury. Operative treatment included fixation of all malleolar fractures. Post-operative CT was used to assess reduction. The primary and secondary outcome measures were the Foot and Ankle Outcome Score (FAOS) and the range of movement of the ankle. There were no clinically relevant differences between the four possible SER IV fracture pattern groups with regard to the FAOS or range of movement. In this population of strictly defined SER IV ankle injuries, the presence of a malleolar fracture was not associated with a significantly worse clinical outcome than its ligamentous injury counterpart. Other factors inherent to the injury and treatment may play a more important role in predicting outcome.

  8. Genetics of Lesch's typology of alcoholism.

    PubMed

    Samochowiec, Jerzy; Kucharska-Mazur, Jolanta; Grzywacz, Anna; Pelka-Wysiecka, Justyna; Mak, Monika; Samochowiec, Agnieszka; Bienkowski, Przemyslaw

    2008-02-15

    It is widely accepted that dopamine and serotonin (5-HT) neurotransmission can be critically involved in the development of alcohol abuse and alcohol dependence. Lesch's typology of alcoholism has been gaining increasing popularity as it qualitatively differentiates patients into different treatment response subgroups. The aim of the present study was to evaluate a possible genetic background of Lesch's typology with special emphasis placed on dopamine- and serotonin-related genes. 122 alcoholics (the mean age: 35+/-9 years) were investigated. According to Lesch's typology, 58 patients were of type I, 36 patients of type II, 11 patients of type III, and 17 patients of type IV. Alcohol drinking and family history was assessed by means of a structured interview, based on the Semi-Structured Assessment for the Genetics of Alcoholism. 150 control subjects without psychiatric disorders were also recruited. The control group was ethnically-, age- and gender-matched to the patients. The DRD2 TaqIA, exon 8, and promoter -141C ins/del polymorphisms as well as COMT Val158Met, 5HTT 44 bp del in promoter, and DAT 40 bp VNTR polymorphisms were detected by means of PCR. No significant differences were observed when the whole group of alcoholics and the controls were compared. Similarly, there were no differences between either the Lesch type I or type II alcoholics and the control subjects. No significant differences were observed between type I and type II alcoholics. Alleles frequencies were not calculated for the Lesch type III and type IV alcoholics since the number of patients was too small. The present results argue against any major role of the investigated polymorphisms in either Lesch type I or type II alcoholism. More comprehensive studies are needed to define the role of the investigated polymorphisms in Lesch type III and type IV alcoholism.

  9. Mechanisms and implications of a type IV functional response for short-term intake rate of dry matter in large mammalian herbivores.

    PubMed

    Mezzalira, Jean C; Bonnet, Olivier J F; Carvalho, Paulo C de F; Fonseca, Lidiane; Bremm, Carolina; Mezzalira, Carlos C; Laca, Emilio A

    2017-09-01

    The functional response (i.e. the relationship between consumers' intake rate and resource density) is central in plant-herbivore interactions. Its shape and the biological processes leading to it have significant implications for both foraging theory and ecology of grazing systems. A type IV functional response (i.e. dome-shaped relationship) of short-term intake rate of dry matter (intake while grazing) has rarely been reported for large herbivores and the conditions that can lead to it are poorly understood. We report a type IV functional response observed in heifers grazing monocultures of Cynodon sp. and Avena strigosa. The mechanisms and consequences of this type of functional response for grazed system dynamics are discussed. Intake rate was higher at intermediate than at short or tall sward heights in both grass species. The type IV functional response resulted from changes in bite mass instead of a longer time needed to encounter and process bites. Thus, the decrease of intake rate of dry matter in tall swards is not explained by a shift from process 3 (potential bites are concentrated and apparent) to process 2 (potential bites are apparent but dispersed, Spalinger & Hobbs 1992). Bite mass was smaller in tall than in intermediate swards due to a reduction of bite volume possibly caused by the greater proportion of stem and sheath acting as a physical barrier to bite formation. It is generally accepted that potential bites are abundant and apparent in most grassland and meadow systems, as they were in the present experiments. Therefore, a type IV response of intake rate not directly related to digestive constraints may determine the dynamics of intake and defoliation under a much larger set of conditions than previously thought. These results have implications for foraging theory and stability of grazing systems. For example, if animals prefer patches of intermediate stature that yield the highest intake rate, grazing should lead to the widely observed bimodal distribution of plant mass per unit area, even when tall patches are not of significantly lower digestive quality than the pasture average. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

  10. Slope Stability of Geosynthetic Clay Liner Test Plots

    EPA Science Inventory

    Fourteen full-scale field test plots containing five types of geosynthetic clay liners (GCLs) were constructed on 2H:IV and 3H:IV slopes for the purpose of assessing slope stability. The test plots were designed to simulate typical final cover systems for landfill. Slides occurr...

  11. A novel GBE1 gene variant in a child with glycogen storage disease type IV.

    PubMed

    Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

    2016-08-01

    Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

    PubMed

    Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

    2002-06-01

    Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

  13. Diagnostic efficiency of amylase and type IV collagen in predicting chronic pancreatitis.

    PubMed

    Das, Subir Kumar; Varadhan, Sowmya; Dhanya, L; Mukherjee, Sukhes; Mohana, S; Balakrishnan, V; Vasudevan, D M

    2009-01-01

    Chronic pancreatitis, an irreversible inflammatory disease of the pancreas, is associated with the replacement of the destroyed parenchyma by extended development of fibrosis. Despite marked progress in diagnostic tools, no consensus has been reached in diagnosis of chronic pancreatitis. In this study we examined the hematological and biochemical parameters among 40 chronic pancreatitis patients within 18 to 67 yrs. ESR level and ALP activity was elevated in 40% cases. Serum amylase activity increased in 32 patients and it showed significant correlation with ALP (r=0.458, p=0.003), CA-19.9 (r=0.556, p<0.001), and calcium level (r=-0.472, p=0.002). Type IV collagen level in chronic pancreatitis also elevated (164.4 ± 55.5 ng/ml) and showed negative significant correlation with calcium level (r= -0.505, p=0.001). However, no significant correlation was observed between amylase activity and type IV collagen (r=0.289, p= 0.07).

  14. Adhesion and host cell modulation: critical pathogenicity determinants of Bartonella henselae

    PubMed Central

    2011-01-01

    Bartonella henselae, the agent of cat scratch disease and the vasculoproliferative disorders bacillary angiomatosis and peliosis hepatis, contains to date two groups of described pathogenicity factors: adhesins and type IV secretion systems. Bartonella adhesin A (BadA), the Trw system and possibly filamentous hemagglutinin act as promiscous or specific adhesins, whereas the virulence locus (Vir)B/VirD4 type IV secretion system modulates a variety of host cell functions. BadA mediates bacterial adherence to endothelial cells and extracellular matrix proteins and triggers the induction of angiogenic gene programming. The VirB/VirD4 type IV secretion system is responsible for, e.g., inhibition of host cell apoptosis, bacterial persistence in erythrocytes, and endothelial sprouting. The Trw-conjugation system of Bartonella spp. mediates host-specific adherence to erythrocytes. Filamentous hemagglutinins represent additional potential pathogenicity factors which are not yet characterized. The exact molecular functions of these pathogenicity factors and their contribution to an orchestral interplay need to be analyzed to understand B. henselae pathogenicity in detail. PMID:21489243

  15. Effect of microwave disinfection on compressive and tensile strengths of dental stones.

    PubMed

    Robati Anaraki, Mahmood; Moslehifard, Elnaz; Aminifar, Soran; Ghanati, Hamed

    2013-01-01

    Although microwave irradiation has been used for disinfection of dental stone casts, there are concerns regarding mechanical damage to casts during the process. The aim of this study was to evaluate the effect of microwave irradiation on the compressive strength (CS) and diametral tensile strength (DTS) of stone casts. In this in vitro study, 80 cylindrical type III and IV stone models (20 × 40 mm) were prepared and divided into 8 groups of 10. The DTS and CS of the specimens were measured by a mechanical testing machine at a crosshead speed of 0.5 cm/min after 7 times of frequent wetting, irradiating at an energy level of 600 W for 3 minutes and cooling. Data were analyzed by Student's t-test. Microwave irradiation significantly increased DTS of type III and IV to 5.23 ± 0.64 and 8.17 ± 0.94, respectively (P < 0.01). According to the results, microwave disinfection increases DTS of type III and IV stone casts without any effects on their CS.

  16. Identification of another module involved in the horizontal transfer of the Haemophilus genomic island ICEHin1056.

    PubMed

    Juhas, Mario; Dimopoulou, Ioanna; Robinson, Esther; Elamin, Abdel; Harding, Rosalind; Hood, Derek; Crook, Derrick

    2013-09-01

    A significant part of horizontal gene transfer is facilitated by genomic islands. Haemophilus influenzae genomic island ICEHin1056 is an archetype of a genomic island that accounts for pandemic spread of antibiotics resistance. ICEHin1056 has modular structure and harbors modules involved in type IV secretion and integration. Previous studies have shown that ICEHin1056 encodes a functional type IV secretion system; however, other modules have not been characterized yet. Here we show that the module on the 5' extremity of ICEHin1056 consists of 15 genes that are well conserved in a number of related genomic islands. Furthermore by disrupting six genes of the investigated module of ICEHin1056 by site-specific mutagenesis we demonstrate that in addition to type IV secretion system module, the investigated module is also important for the successful conjugal transfer of ICEHin1056 from donor to recipient cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Exome sequencing establishes a gelsolin mutation as the cause of inherited bulbar-onset neuropathy.

    PubMed

    Caress, James B; Johnson, Janel O; Abramzon, Yevgeniya A; Hawkins, Gregory A; Gibbs, J Raphael; Sullivan, Elizabeth A; Chahal, Chamanpreet S; Traynor, Bryan J

    2017-11-01

    Progressive bulbar motor neuropathy is primarily caused by bulbar-onset ALS. Hereditary amyloidosis type IV also presents with a bulbar neuropathy that mimics motor neuron disease. The disease is prevalent in Finland only and is not commonly included in the differential diagnosis of ALS. We studied 18 members of a family in which some had bulbar motor neuropathy, and we performed exome sequencing. Five affected family members were found to have a D187Y substitution in the GSN gene known to cause hereditary amyloidosis type IV. This American family presented with progressive bulbar neuropathy due to a gelsolin mutation not found in Finland. Hereditary amyloidosis type IV presents with bulbar motor neuropathy and not with peripheral neuropathy as occurs with common forms of amyloidosis. This report demonstrates the power of exome sequencing to determine the cause of rare hereditary diseases with incomplete or atypical phenotypes. Muscle Nerve 56: 1001-1005, 2017. © 2016 Wiley Periodicals, Inc.

  18. Gluteo-vaginal sinus formation complicating posterior intravaginal slingplasty followed by successful IVS removal. A case report and review of the literature.

    PubMed

    Mikos, Themistoklis; Tsalikis, Tryfon; Papanikolaou, Alexios; Pournaropoulos, Fotios; Bontis, John N

    2008-03-01

    Posterior intravaginal slingplasty (IVS) is a technique used for the treatment of apical prolapse. Type III meshes have been mostly used with this technique. In this article, a case of bilateral gluteo-vaginal sinus tract formation that complicated a posterior vaginal slingplasty with a type III mesh is presented. At 3 months follow-up, the patient complained for bulking through the vagina, continuous offensive vaginal discharge, and constant pain at the buttocks. She had prolapse recurrence, and there was defective healing at the gluteal entry points of the posterior IVS. Ten months after the initial surgery, she underwent a laparotomic subtotal hysterectomy and sacrocervicopexy with prolene type I mesh. At the same time, the posterior mesh was removed allowing the surgeon to discover communication of the canal of the mesh extending from gluteal incisions to the vagina epithelium. The sinus tract was managed surgically with excision of the surrounding tissues. There was no recurrence or other complications at 2 months follow-up.

  19. The Effects of Exercise on Pharmacokinetics and Pharmacodynamics of Physostigmine in Rats

    DTIC Science & Technology

    1991-02-15

    combination of the two, regulate the biosynthetic and degradative enzymes of ACh in EDL (extensor digitorum longus) - fast muscle and soleus - slow muscle...and trained exercise on ChAT activities in fast and slow muscles of rat 100 17. Effect of subacute Phy (70 4g/kg, i.m.) and endurance training on...AChE activities in EDL and soleus muscles of rat 100 18. ChAT and AChE activities (% of control) in fast (EDL) and slow (soleus) muscle in subacute Phy

  20. Summer Faculty Research Program (SFRP) (1992). Volume 1. Program Management Report.

    DTIC Science & Technology

    1992-12-01

    the side of the 1.5 meter telescope. The receiver has two optical channels and the lidar can be configured either as a two- color system or as long...using a coordinate measuring machine (CMM) was employed. The part and mold thickness data were computed and plotted in the form of color contours for ease...using wavelets is developed based on the principle of scattering centers. The adopted target representation is based on the colored bright spots approach

  1. In vivo imaging of cortical pathology in multiple sclerosis using ultra-high field MRI

    PubMed Central

    Mainero, C; Benner, T; Radding, A; van der Kouwe, A; Jensen, R; Rosen, B R.; Kinkel, R P.

    2009-01-01

    Objective: We used ultra-high field MRI to visualize cortical lesion types described by neuropathology in 16 patients with multiple sclerosis (MS) compared with 8 age-matched controls; to characterize the contrast properties of cortical lesions including T2*, T2, T1, and phase images; and to investigate the relationship between cortical lesion types and clinical data. Methods: We collected, on a 7-T scanner, 2-dimensional fast low-angle shot (FLASH)-T2*-weighted spoiled gradient-echo, T2-weighted turbo spin-echo (TSE) images (0.33 × 033 × 1 mm3), and a 3-dimensional magnetization-prepared rapid gradient echo. Results: Overall, 199 cortical lesions were detected in patients on both FLASH-T2* and T2-TSE scans. Seven-tesla MRI allowed for characterization of cortical plaques into type I (leukocortical), type II (intracortical), and type III/IV (subpial extending partly or completely through the cortical width) lesions as described histopathologically. Types III and IV were the most frequent type of cortical plaques (50.2%), followed by type I (36.2%) and type II (13.6%) lesions. Each lesion type was more frequent in secondary progressive than in relapsing–remitting MS. This difference, however, was significant only for type III/IV lesions. T2*-weighted images showed the highest, while phase images showed the lowest, contrast-to-noise ratio for all cortical lesion types. In patients, the number of type III/IV lesions was associated with greater disability (p < 0.02 by Spearman test) and older age (p < 0.04 by Spearman test). Conclusions: Seven-tesla MRI detected different histologic cortical lesion types in our small multiple sclerosis (MS) sample, suggesting, if validated in a larger population, that it may prove a valuable tool to assess the contribution of cortical MS pathology to clinical disability. GLOSSARY ANOVA = analysis of variance; BN = background noise; CNR = contrast-to-noise ratio; DIR = double-inversion recovery; EDSS = Expanded Disability Status Scale; FLAIR = fluid-attenuated inversion recovery; FLASH = fast low-angle shot; GM = gray matter; MPRAGE = magnetization-prepared rapid gradient echo; MR = magnetic resonance; MS = multiple sclerosis; NACGM = normal-appearing cortical gray matter; RF = radiofrequency; ROI = region of interest; RRMS = relapsing–remitting multiple sclerosis; SNR = signal-to-noise ratio; SPMS = secondary progressive multiple sclerosis; TA = time of acquisition; TE = echo time; TR = repetition time; TSE = turbo spin-echo; WM = white matter. PMID:19641168

  2. Transarterial treatment with Onyx of Cognard type IV anterior cranial fossa dural arteriovenous fistulas.

    PubMed

    Li, Chuanhui; Wu, Zhongxue; Yang, Xinjian; Li, Youxiang; Jiang, Chuhan; He, Hongwei

    2014-03-01

    Cognard type IV anterior cranial fossa dural arteriovenous fistulas (DAVFs) are rare lesions with a high risk of intracranial hemorrhage. We present our experience with the use of Onyx via the arterial route in these aggressive lesions. Between October 2009 and October 2011, six consecutive patients diagnosed with Cognard type IV anterior cranial fossa DAVFs were treated transarterially with Onyx in our department. All patients were male; mean age was 55 years (range 38-68). Four patients presented with intracranial hemorrhage as the initial manifestation; one patient presented with seizures at the time of diagnosis and experienced intracranial hemorrhage during the antiepileptic therapy; and the other patient was asymptomatic. In five patients, complete obliteration was achieved with transarterial Onyx injection in a single treatment session; in the remaining patient, subtotal occlusion was achieved and gamma knife treatment was followed. The average time of injection was 19 min (range 5-28) for every pedicle catheterized and the average amount of Onyx was 3.2 ml (range 0.4-6.3) for each lesion. All patients recovered uneventfully after embolization. No mortality or permanent morbidity was observed in this series. Follow-up digital subtraction or MR angiography confirmed durable obliteration of the fistulas in five cured cases. No patients suffered intracranial hemorrhage during the follow-up period. In this small series, our experience with the use of Onyx for arterial embolization of Cognard type IV DAVFs is encouraging, with durable complete cure in most lesions without severe complications.

  3. CT-based radiomics signature for differentiating Borrmann type IV gastric cancer from primary gastric lymphoma.

    PubMed

    Ma, Zelan; Fang, Mengjie; Huang, Yanqi; He, Lan; Chen, Xin; Liang, Cuishan; Huang, Xiaomei; Cheng, Zixuan; Dong, Di; Liang, Changhong; Xie, Jiajun; Tian, Jie; Liu, Zaiyi

    2017-06-01

    To evaluate the value of CT-based radiomics signature for differentiating Borrmann type IV gastric cancer (GC) from primary gastric lymphoma (PGL). 40 patients with Borrmann type IV GC and 30 patients with PGL were retrospectively recruited. 485 radiomics features were extracted and selected from the portal venous CT images to build a radiomics signature. Subjective CT findings, including gastric wall peristalsis, perigastric fat infiltration, lymphadenopathy below the renal hila and enhancement pattern, were assessed to construct a subjective findings model. The radiomics signature, subjective CT findings, age and gender were integrated into a combined model by multivariate analysis. The diagnostic performance of these three models was assessed with receiver operating characteristics curves (ROC) and were compared using DeLong test. The subjective findings model, the radiomics signature and the combined model showed a diagnostic accuracy of 81.43% (AUC [area under the curve], 0.806; 95% CI [confidence interval]: 0.696-0.917; sensitivity, 63.33%; specificity, 95.00%), 84.29% (AUC, 0.886 [95% CI: 0.809-0.963]; sensitivity, 86.67%; specificity, 82.50%), 87.14% (AUC, 0.903 [95%CI: 0.831-0.975]; sensitivity, 70.00%; specificity, 100%), respectively. There were no significant differences in AUC among these three models (P=0.051-0.422). Radiomics analysis has the potential to accurately differentiate Borrmann type IV GC from PGL. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  5. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  6. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  7. 43 CFR 10005.19 - Decision factors.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... value over the long term, and/or (iv) Encourage and facilitate economic efficiency among agencies. (2... impacts to other aspects of the environment, and/or (iv) Contribute to the social and/or economic well... serve to demonstrate the viability of a certain type of protection and restoration project, or to...

  8. Standard-Cell, Open-Architecture Power Conversion Systems

    DTIC Science & Technology

    2005-10-01

    TLmax Maximum junction temperature 423 OK Table 5. 9. PEBB average model description in VTB. Terminal Type Name - 4 -, A Power DC Bus + B Power AC Pole...5 A. Switching models ........................................................................................ 5 B. Average ...11-6 IV. Average Modeling of PEBB-Based Converters...................................................... 11-10 0 IV. 1.Voltage

  9. Vorinostat and Azacitidine in Treating Patients With Locally Recurrent or Metastatic Nasopharyngeal Cancer or Nasal Natural Killer T-Cell Lymphoma

    ClinicalTrials.gov

    2018-04-20

    Adult Nasal Type Extranodal NK/T-Cell Lymphoma; Recurrent Nasopharyngeal Keratinizing Squamous Cell Carcinoma; Recurrent Nasopharyngeal Undifferentiated Carcinoma; Stage IV Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7; Stage IV Nasopharyngeal Undifferentiated Carcinoma AJCC v7

  10. Effects of intravenous delivery systems on infused red blood cells.

    PubMed

    Gibson, J S; Leff, R D; Roberts, R J

    1984-03-01

    The effects of various intravenous delivery systems on the integrity of infused red blood cells (RBCs) were studied. Using a factorial design, whole blood and packed RBCs were infused through i.v. delivery systems employing various combinations of i.v. tubing diameter and length, needle gauge, infusion rate (5 and 50 ml/hr), type of infusion pump (piston, diaphragm, or peristaltic operation), and type of blood product. The age and temperature of the blood filter used were held constant. A 5-ml sample of the blood product obtained during each experimental run was analyzed for plasma free-hemoglobin to assess the degree of hemolysis. Osmotic fragility of the RBCs was evaluated by measuring the percentage of hemolysis in the blood products in various concentrations of sodium chloride solution. Type of blood product and i.v. pump were the only variables significantly influencing RBC hemolysis. In both blood products, a greater degree of hemolysis occurred with the peristaltic-type pump than with the other types of pumps. In packed RBCs, the diaphragm-type pump produced greater hemolysis than the piston-type pump, but hemolysis was similar in whole-blood samples. Regardless of the type of pump, more hemolysis occurred in whole blood at the 5-ml/hr infusion rate than at the 50-ml/hr rate, but the converse was true in packed RBCs. Samples of both blood products were less osmotically fragile than their respective controls at sodium chloride concentrations ranging from 0.30 to 0.50%.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Renal tubular acidosis type IV in hyperkalaemic patients--a fairy tale or reality?

    PubMed

    Haas, Christian S; Pohlenz, Inga; Lindner, Ulrich; Muck, Philip M; Arand, Jovana; Suefke, Sven; Lehnert, Hendrik

    2013-05-01

    Hyperkalaemia is a common feature in hospitalized patients and often attributed to drugs antagonizing the renin-angiotensin-aldosterone system (RAAS) and/or acute kidney injury (AKI), despite significantly preserved glomerular filtration rate (GFR). The objective of this study was to determine the prevalence and role of renal tubular acidosis type IV (RTA IV) in the development of significant hyperkalaemia. A single-centre retrospective study. Patients admitted to a University Hospital over 12 months. Patients with a potassium value > 6·0 mm were identified. Clinical and laboratory data were revisited, and patients with a normal anion gap metabolic acidosis were evaluated for the existence of RTA IV. A total of 57 patients having significant hyperkalaemia (>6·0 mm) were identified. Twelve patients had end-stage renal disease, while 21 patients had solely AKI or progressive chronic renal failure. RTA IV was present in 24 patients (42%), of whom 71% had pre-existing renal insufficiency because of diabetic nephropathy or tubulointerstitial nephritis. All hyperkalaemic patients with urinary/serum electrolytes suggestive of RTA IV had evidence of AKI, but creatinine levels were significantly lower (P < 0·05), while the number of drugs antagonizing the RAAS was comparable. We demonstrated that RTA IV (i) is very common in patients with hyperkalaemia; (ii) should always be suspected in hyperkalaemic patients with only moderately impaired GFR; and (iii) may result in significant hyperkalaemia in the presence of both AKI and drugs antagonizing the RAAS. © 2012 Blackwell Publishing Ltd.

  12. A Comprehensive Functional Analysis of NTRK1 Missense Mutations Causing Hereditary Sensory and Autonomic Neuropathy Type IV (HSAN IV).

    PubMed

    Shaikh, Samiha S; Chen, Ya-Chun; Halsall, Sally-Anne; Nahorski, Michael S; Omoto, Kiyoyuki; Young, Gareth T; Phelan, Anne; Woods, Christopher Geoffrey

    2017-01-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV) is an autosomal recessive disorder characterized by a complete lack of pain perception and anhidrosis. Here, we studied a cohort of seven patients with HSAN IV and describe a comprehensive functional analysis of seven novel NTRK1 missense mutations, c.1550G >A, c.1565G >A, c.1970T >C, c.2096T >C, c.2254T >A, c.2288G >C, and c.2311C >T, corresponding to p.G517E, p.G522E, p.L657P, p.I699T, p.C752S, p.C763S, and p.R771C, all of which were predicted pathogenic by in silico analysis. The results allowed us to assess the pathogenicity of each mutation and to gain novel insights into tropomyosin receptor kinase A (TRKA) downstream signaling. Each mutation was systematically analyzed for TRKA glycosylation states, intracellular and cell membrane expression patterns, nerve growth factor stimulated TRKA autophosphorylation, TRKA-Y496 phosphorylation, PLCγ activity, and neurite outgrowth. We showed a diverse range of functional effects: one mutation appeared fully functional, another had partial activity in all assays, one mutation affected only the PLCγ pathway and four mutations were proved null in all assays. Thus, we conclude that complete abolition of TRKA kinase activity is not the only pathogenic mechanism underlying HSAN IV. By corollary, the assessment of the clinical pathogenicity of HSAN IV mutations is more complex than initially predicted and requires a multifaceted approach. © 2016 WILEY PERIODICALS, INC.

  13. Predicting DPP-IV inhibitors with machine learning approaches

    NASA Astrophysics Data System (ADS)

    Cai, Jie; Li, Chanjuan; Liu, Zhihong; Du, Jiewen; Ye, Jiming; Gu, Qiong; Xu, Jun

    2017-04-01

    Dipeptidyl peptidase IV (DPP-IV) is a promising Type 2 diabetes mellitus (T2DM) drug target. DPP-IV inhibitors prolong the action of glucagon-like peptide-1 (GLP-1) and gastric inhibitory peptide (GIP), improve glucose homeostasis without weight gain, edema, and hypoglycemia. However, the marketed DPP-IV inhibitors have adverse effects such as nasopharyngitis, headache, nausea, hypersensitivity, skin reactions and pancreatitis. Therefore, it is still expected for novel DPP-IV inhibitors with minimal adverse effects. The scaffolds of existing DPP-IV inhibitors are structurally diversified. This makes it difficult to build virtual screening models based upon the known DPP-IV inhibitor libraries using conventional QSAR approaches. In this paper, we report a new strategy to predict DPP-IV inhibitors with machine learning approaches involving naïve Bayesian (NB) and recursive partitioning (RP) methods. We built 247 machine learning models based on 1307 known DPP-IV inhibitors with optimized molecular properties and topological fingerprints as descriptors. The overall predictive accuracies of the optimized models were greater than 80%. An external test set, composed of 65 recently reported compounds, was employed to validate the optimized models. The results demonstrated that both NB and RP models have a good predictive ability based on different combinations of descriptors. Twenty "good" and twenty "bad" structural fragments for DPP-IV inhibitors can also be derived from these models for inspiring the new DPP-IV inhibitor scaffold design.

  14. Alport syndrome and thin glomerular basement membrane nephropathy: a practical approach to diagnosis.

    PubMed

    Haas, Mark

    2009-02-01

    Alport syndrome and thin glomerular basement membrane nephropathy (TBMN) are genetically heterogeneous conditions characterized by structural abnormalities in the glomerular basement membrane and an initial presentation that usually involves hematuria. Approximately 40% of patients with TBMN are heterozygous carriers for autosomal recessive Alport syndrome, with mutations at the genetic locus encoding type IV collagen alpha(3) [alpha(3)(IV)] and alpha(4) chains. However, although the clinical course of TBMN is usually benign, Alport syndrome, particularly the X-linked form with mutations in the locus encoding the alpha(5) chain of type IV collagen [alpha(5)(IV)], typically results in end-stage renal disease. Electron microscopy is essential to diagnosis of TBMN and Alport syndrome on renal biopsy, although electron microscopy alone is of limited value in distinguishing between TBMN, the heterozygous carrier state of X-linked Alport syndrome, autosomal recessive Alport syndrome, and even early stages of X-linked Alport syndrome. To review diagnostic pathologic features of each of the above conditions, emphasizing the need for immunohistology for alpha(3)(IV) and alpha(5)(IV) in addition to electron microscopy to resolve this differential diagnosis on a renal biopsy. The diagnostic value of immunofluorescence studies for alpha(5)(IV) on a skin biopsy in family members of patients with Alport syndrome also is reviewed. Original and comprehensive review articles on the diagnosis of Alport syndrome and TBMN from the past 35 years, primarily the past 2 decades, and experience in our own renal pathology laboratory. Although Alport syndrome variants and TBMN do not show characteristic light microscopic findings and can be difficult to differentiate from each other even by electron microscopy, using a combination of electron microscopy and immunohistology for alpha(3)(IV) and alpha(5)(IV) enables pathologists to definitively diagnose these disorders on renal biopsy in most cases.

  15. Clinical outcome in women with HER2-positive de novo or recurring stage IV breast cancer receiving trastuzumab-based therapy.

    PubMed

    Rossi, Valentina; Nolè, Franco; Redana, Stefania; Adamoli, Laura; Martinello, Rossella; Aurilio, Gaetano; Verri, Elena; Sapino, Anna; Viale, Giuseppe; Aglietta, Massimo; Montemurro, Filippo

    2014-02-01

    Five to 10% of women with newly diagnosed breast cancer have synchronous metastases (de novo stage IV). A further 20% will develop metastases during follow-up (recurring stage IV). We compared the clinical outcomes of women with HER2-positive metastatic breast cancer (MBC) receiving first-line trastuzumab-based therapy according to type of metastatic presentation. Retrospective analysis of 331 MBC patients receiving first-line trastuzumab-based treatment. Response rates (RR) were compared by the chi-square test. Time-to progression (TTP) and overall survival (OS) curves were compared by the log-rank test. Cox-proportional hazards models were used to study predictors of PFS and OS, including the type of metastatic presentation. Seventy-seven patients (23%) had de novo stage IV disease. Forty-six of these patients underwent surgery of the primary ("de novo/surgery"). Response rates to first-line trastuzumab-based therapy and median progression-free survival did not differ in patients with "recurring", "de novo/surgery" and "de novo" without surgery ("de novo/no surgery) stage IV breast cancer. However, women with "de novo/surgery" stage IV breast cancer had the longest median OS (60 months), and those with "de novo/no surgery" stage IV breast cancer the shortest (26 months). For women with recurring metastatic breast cancer median OS was 40 months (overall log-rank test, p < 0.01). Multivariate analysis confirmed these findings. Our analysis shows that response rates and PFS to first-line trastuzumab-based therapy do not differ significantly between de novo and recurring stage IV, HER2 positive breast cancer. The observed difference in OS favoring women with de novo stage IV disease submitted to surgery of the primary tumor could be the result of a selection bias. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Semitendinosus Tendon Autograft for Reconstruction of Large Defects in Chronic Achilles Tendon Ruptures.

    PubMed

    Dumbre Patil, Sampat Shivajirao; Dumbre Patil, Vaishali Sampat; Basa, Vikas Rajeshwarrao; Dombale, Ajay Birappa

    2014-07-01

    Chronic Achilles tendon ruptures are associated with considerable functional morbidity. When treated operatively, debridement of degenerated tendon ends may create large defects. Various procedures to reconstruct large defects have been described. We present a simple technique in which an autologous semitendinosus tendon graft is used to reconstruct defects larger than 5 cm in chronic Achilles tendon ruptures. The purpose of this study was to describe our operative technique and its functional outcome. Achilles ruptures of more than 6 weeks duration were considered for the study. We treated 35 patients (20 males, 15 females) with symptomatic chronic Achilles tendon ruptures. The mean age was 47.4 years (range, 30 to 59). The smallest defect that we had reconstructed was 5 cm, and the largest was 9 cm in length. The average follow-up duration was 30.7 months (range, 20 to 42). Postoperatively, the strength of gastrocsoleus was measured by manual muscle testing (MMT) in non-weight-bearing and weight-bearing positions. All operated patients showed satisfactory functional outcome, good soft tissue healing, and no reruptures. The preoperative weight-bearing MMT of 2/5 improved to 4/5 or 5/5 postoperatively. In all patients, postoperative non-weight-bearing MMT was 5/5. All patients returned to their prerupture daily activity. We present a technique that is simple, with low morbidity. We believe it is a valuable option especially when allografts are not available. It is inexpensive as suture anchors or tenodesis screws are not used. This can be a useful option if other tendons (flexor hallucis longus, peroneus brevis, etc) are not available for transfer. Level IV, retrospective case series. © The Author(s) 2014.

  17. Gestational undernourishment modifies the composition of skeletal muscle transverse tubule membranes and the mechanical properties of muscles in newborn rats.

    PubMed

    Ramírez-Oseguera, Ricardo Tonathiu; Jiménez-Garduño, Aura Matilde; Alvarez, Rocío; Heine, Katharina; Pinzón-Estrada, Enrique; Torres-Saldaña, Ismael; Ortega, Alicia

    2013-01-01

    [corrected] Skeletal muscle (SM) constitutes more than 40% of the body weight in adulthood. Transports dietary glucose mainly through the insulin-dependent glucose transporter (Glut-4) located in the Transverse tubule membrane system (TT). The TT development ends shortly after birth. The TT membrane hosts the proteins involved in excitation-contraction coupling and glucose uptake. Glycaemic regulation through movement is a key function of fully developed skeletal muscle. In this study, we aimed to characterize the effect of gestational undernourishment (GUN) in rats GLUT-4 expression and on the protein/lipid content of the TT membranes. We also examined the effect of GUN on the mechanical properties of muscles as an indication of the metabolic condition of the SM at birth. Isolated TT membrane from SM of GUN rats were used to study lipid/protein content and protein stability by differential scanning calorimetry. The effect of GUN on the SM mechanical properties was determined in isolated Extensor Digitorum Longus (EDL) muscle. We demonstrate that compared to control, GUN in the new-born produces; i) decreases body weight; ii) diminution in SM mass; iii) decreases the formation of TT membranes; iv) expresses TT membrane proteins with higher thermal stability. The TT membrane expression of GLUT-4 in GUN offspring was twice that of controls. The isolated EDL of GUN offspring was 20% stronger as measured by contractile force and more resistant to fatigue relative to controls. These results provide the first evidence of adaptive changes of the SM in new-borns exposed to severe gestational food restriction. The effects of GUN on muscle at birth are the first step toward detrimental SM metabolic function, contributing to the physiopathology of metabolic diseases in adulthood. © 2013 S. Karger AG, Basel

  18. Peroneal tendinosis as a predisposing factor for the acute lateral ankle sprain in runners.

    PubMed

    Ziai, Pejman; Benca, Emir; Wenzel, Florian; Schuh, Reinhard; Krall, Christoph; Auffahrt, Alexander; Hofstetter, Martin; Windhager, Reinhard; Buchhorn, Tomas

    2016-04-01

    A painful episode in the region of the peroneal tendons, within the retromalleolar groove, is a common precipitating event of an acute lateral ankle sprain. A forefoot striking pattern is suspected to cause peroneal tendinosis. The aim of this study is to analyse the role of peroneal tendinosis as a predisposing factor for ankle sprain trauma in runners. Fifty-eight runners who had experienced acute ankle sprain trauma, with pre-existing pain episodes for up to 4 weeks in the region of the peroneal tendons, were assessed clinically. Fractures were excluded by conventional radiography. An magnetic resonance imaging (MRI) scan had been performed within 14 days after the traumatic event and was subsequently evaluated by two experienced radiologists. MRI revealed peroneal tendinosis in 55 patients (95% of the total study population). Peroneus brevis (PB) tendinosis was found in 48 patients (87% of all patients with peroneal tendinosis), and peroneus longus (PL) tendinosis was observed in 42 cases (76%). Thirty-five patients (64%) had combined PB and PL tendinosis. A lesion of the anterior talofibular ligament was found to be the most common ligament injury associated with peroneal tendinosis (29 cases; 53%), followed by a lesion of the calcaneofibular ligament (16 cases; 29%) and a lesion of the posterior tibiofibular ligament (13 cases; 24%). The results of this study reflect the correlation between peroneal tendinosis and ankle sprain trauma. Injuries of one or more ligaments are associated with further complications. A period of rest or forbearance of sports as well as adequate treatment of the peroneal tendinosis is essential to prevent subsequent ankle injuries, especially in runners. Modification of the running technique would also be beneficial. IV.

  19. Cadaver study of anatomic landmark identification for placing ankle arthroscopy portals.

    PubMed

    Scheibling, B; Koch, G; Clavert, P

    2017-05-01

    Arthroscopy-assisted surgery is now widely used at the ankle for osteochondral lesions of the talus, anterior and posterior impingement syndromes, talocrural or subtalar fusion, foreign body removal, and ankle instability. Injuries to the vessels and nerves may occur during these procedures. To determine whether ultrasound topographic identification of vulnerable structures decreased the risk of iatrogenic injuries to vessels, nerves, and tendons and influenced the distance separating vulnerable structures from the arthroscope introduced through four different portals. Ultrasonography to identify vulnerable structures before or during arthroscopic surgery on the ankle may be useful. Twenty fresh cadaver ankles from body donations to the anatomy institute in Strasbourg, France, were divided into two equal groups. Preoperative ultrasonography to mark the trajectories of vessels, nerves, and tendons was performed in one group but not in the other. The portals were created using a 4-mm trocar. Each portal was then dissected. The primary evaluation criterion was the presence or absence of injuries to vessels, nerves, and tendons. The secondary evaluation criterion was the distance between these structures and the arthroscope. No tendon injuries occurred with ultrasonography. Without ultrasonography, there were two full-thickness tendon lesions, one to the extensor hallucis longus and the other to the Achilles tendon. Furthermore, with the anterolateral, anteromedial, and posteromedial portals, the distance separating the vessels and nerves from the arthroscope was greater with than without ultrasonography (P=0.041, P=0.005, and P=0.002), respectively; no significant difference was found with the anterior portal. Preoperative ultrasound topographic identification decreases the risk of iatrogenic injury to the vessels, nerves, and tendons during ankle arthroscopy and places these structures at a safer distance from the arthroscope. Our hypothesis was confirmed. IV, cadaver study. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. Results of Treatment of Posterior Ankle Impingement Syndrome and Flexor Hallucis Longus Tendinopathy in Dancers: A Systematic Review.

    PubMed

    Rietveld, A B M Boni; Hagemans, F M T; Haitjema, S; Vissers, T; Nelissen, R G H H

    2018-03-15

    Dancing on pointe and relevé requires extreme plantar flexion of the talo-crural joint. Hence, these positions may lead to posterior ankle impingement syndrome (PAIS). PAIS often coincides with flexor hallucis longus tendinopathy (FHL tendinopathy, or "dancers' tendinitis"). Both injuries can appear in isolation as well. The goal of this review is to evaluate the results and the available levels of evidence of conservative and operative treatment (both open and endoscopic) of PAIS and FHL tendinopathy in dancers. It also offers an insight into the history of dance medical publications on this subject. In October 2016, a systematic search of PubMed, Embase, Cochrane, CINAHL, Web of Science, and (in French) ScienceDirect databases was undertaken. Five hundred and seventy-six publications were found, of which a total of 27 reported the results of operative treatment in 376 ankles (344 open, 32 endoscopic) in 324 dancers. The outcome was good to excellent in most cases (89%). The mean period of return to dance for all surgeries combined (PAIS and FHL tendinopathy, open and endo) was 11 weeks (range: 4 to 36 weeks), and for isolated FHL tendinopathy 16 weeks (range: 8 to 36 weeks). Only six publications reported the results of conservative treatment in 33 ankles (13 PAIS, 20 FHL tendinopathy) of 28 dancers, which does not allow for any evidence-based recommendations. Most studies failed to include dance-specific baseline characteristics, like dance style and level of participation. We concluded that only retrospective studies with levels of evidence four and five show that operative treatment for PAIS and FHL tendinopathy is successful with few complications. Since isolated PAIS, PAIS combined with FHL tendinopathy, and isolated FHL injuries appear to be different pathological entities, more research taking into account demography, dance type, and level of participation is needed to find out in which cases early operative management should be considered or avoided. The same applies to defining the place of endoscopic surgery in dancers and being able better to predict which pathology is likely to produce worse outcomes or delay the return to dance. Future research should have a prospective design, including dance-specific outcome scores both preand post-treatment. Furthermore, preferably a prospective randomized controlled design should be used to compare different conservative and operative treatment options.

Top