Science.gov

Sample records for lung cancer growth

  1. Neuropeptides as lung cancer growth factors.

    PubMed

    Moody, Terry W; Moreno, Paola; Jensen, Robert T

    2015-10-01

    This manuscript is written in honor of the Festschrift for Abba Kastin. I met Abba at a Society for Neuroscience meeting and learned that he was Editor-in-Chief of the Journal Peptides. I submitted manuscripts to the journal on "Neuropeptides as Growth Factors in Cancer" and subsequently was named to the Editorial Advisory Board. Over the past 30 years I have published dozens of manuscripts in Peptides and reviewed hundreds of submitted manuscripts. It was always rewarding to interact with Abba, a consummate professional. When I attended meetings in New Orleans I would sometimes go out to dinner with him at the restaurant "Commanders Palace". When I chaired the Summer Neuropeptide Conference we were honored to have him receive the Fleur Strand Award one year in Israel. I think that his biggest editorial contribution has been the "Handbook of Biologically Active Peptides." I served as a Section Editor on "Cancer/Anticancer Peptides" and again found that it was a pleasure working with him. This review focuses on the mechanisms by which bombesin-like peptides, neurotensin and vasoactive intestinal peptide regulate the growth of lung cancer. Published by Elsevier Inc.

  2. Quercetin suppresses lung cancer growth by targeting Aurora B kinase.

    PubMed

    Xingyu, Zhu; Peijie, Ma; Dan, Peng; Youg, Wang; Daojun, Wang; Xinzheng, Chen; Xijun, Zhang; Yangrong, Song

    2016-11-01

    aurora B kinase is highly expressed in several cancer cells and promotes tumorigenesis and progression, and therefore, it is an important target for drug to treat tumors. Quercetin was identified to be an antitumor agent. Herein, we report for the first time that quercetin inhibited aurora B activities by directly binding with aurora B in vitro and in vivo. Ex vivo studies showed that quercetin inhibited aurora B activities in JB6 Cl41 cells and A549 lung cancer cells. Moreover, knockdown of aurora B in A549 cells decreased their sensitivities to quercetin. In vivo study demonstrated that injection of quercetin in A549 tumor-bearing mice effectively suppressed cancer growth. The phosphorylation of histone 3 in tumor tissues was also decreased after quercetin treatment. In short, quercetin can suppress growth of lung cancer cells as an aurora B inhibitor both in vitro and in vivo.

  3. Lung cancer

    SciTech Connect

    Aisner, J.

    1985-01-01

    This book contains 13 chapters. Some of the chapter titles are: The Pathology of Lung Cancer; Radiotherapy for Non-Small-Cell Cancer of the Lung; Chemotherapy for Non-Small-Cell Lung Cancer; Immunotherapy in the Management of Lung Cancer; Preoperative Staging and Surgery for Non-Small-Cell Lung Cancer; and Prognostic Factors in Lung Cancer.

  4. Lung Cancer

    MedlinePlus

    ... version of this page please turn Javascript on. Lung Cancer What is Lung Cancer? How Tumors Form The body is made ... button on your keyboard.) Two Major Types of Lung Cancer There are two major types of lung ...

  5. Epidermal growth factor receptor mutation enhances expression of vascular endothelial growth factor in lung cancer.

    PubMed

    Hung, Ming-Szu; Chen, I-Chuan; Lin, Paul-Yann; Lung, Jr-Hau; Li, Ya-Chin; Lin, Yu-Ching; Yang, Cheng-Ta; Tsai, Ying-Huang

    2016-12-01

    Epidermal growth factor receptor (EGFR) activation has been demonstrated to have a critical role in tumor angiogenesis. In the present study, the correlation between EGFR mutations and vascular endothelial growth factor (VEGF) was investigated in lung cancer cell lines and non-small-cell lung cancer (NSCLC) tumor tissues. VEGF levels were significantly increased in culture medium of lung cancer cells and NSCLC tissues with EGFR mutations (H1650 vs. A549, P=0.0399; H1975 vs. A549, P<0.0001). Stable lung cancer cell lines expressing mutant (exon 19 deletion, E746-A750; exon 21 missense mutation, L858R) and wild-type EGFR genes were established. Significantly increased expression of VEGF and stronger inhibitory effects of gefitinib to VEGF expression were observed in exon 19 deletion stable lung cancer cells (exon 19 deletion vs. wild-type EGFR, P=0.0005). The results of the present study may provide an insight into the association of mutant EGFR and VEGF expression in lung cancer, and may assist with further development of targeted therapy for NSCLC in the future.

  6. Differential roles of STAT3 in the initiation and growth of lung cancer.

    PubMed

    Zhou, J; Qu, Z; Yan, S; Sun, F; Whitsett, J A; Shapiro, S D; Xiao, G

    2015-07-01

    Signal transducer and activator of transcription 3 (STAT3) is linked to multiple cancers, including pulmonary adenocarcinoma. However, the role of STAT3 in lung cancer pathogenesis has not been determined. Using lung epithelial-specific inducible knockout strategies, we demonstrate that STAT3 has contrasting roles in the initiation and growth of both chemically and genetically induced lung cancers. Selective deletion of lung epithelial STAT3 in mice before cancer induction by the smoke carcinogen, urethane, resulted in increased lung tissue damage and inflammation, K-Ras oncogenic mutations and tumorigenesis. Deletion of lung epithelial STAT3 after establishment of lung cancer inhibited cancer cell proliferation. Simultaneous deletion of STAT3 and expression of oncogenic K-Ras in mouse lung elevated pulmonary injury, inflammation and tumorigenesis, but reduced tumor growth. These studies indicate that STAT3 prevents lung cancer initiation by maintaining pulmonary homeostasis under oncogenic stress, whereas it facilitates lung cancer progression by promoting cancer cell growth. These studies also provide a mechanistic basis for targeting STAT3 to lung cancer therapy.

  7. Opioid and nicotine receptors affect growth regulation of human lung cancer cell lines

    SciTech Connect

    Maneckjee, R.; Minna, J.D. Uniformed Services Univ. of the Health Sciences, Bethesda, MD )

    1990-05-01

    Using specific radioactively-labeled ligands, the authors find that lung cancer cell lines of diverse histologic types express multiple, high-affinity membrane receptors for {mu}, {delta}, and {kappa} opioid agonists and for nicotine and {alpha}-bungarotoxin. These receptors are biologically active because cAMP levels decreased in lung cancer cells after opioid and nicotine application. Nicotine at concentrations found in the blood of smokers had no effect on in vitro lung cancer cell growth, whereas {mu}, {delta}, and {kappa} opioid agonists at low concentrations inhibited lung cancer growth in vitro. They also found that lung cancer cells expressed various combinations of immunoreactive opioid peptides ({beta}-endorphin, enkephalin, or dynorphin), suggesting the participation of opioids in a negative autocrine loop or tumor-suppressing system. Due to the almost universal exposure of patients with lung cancer to nicotine, they tested whether nicotine affected the response of lung cancer cell growth to opioids and found that nicotine at concentrations of 100-200 nM partially or totally reversed opioid-induced growth inhibition in 9/14 lung cancer cell lines. These in vitro results for lung cancer cells suggest that opioids could function as part of a tumor suppressor system and that nicotine can function to circumvent this system in the pathogenesis of lung cancer.

  8. Knockdown of cullin 4A inhibits growth and increases chemosensitivity in lung cancer cells.

    PubMed

    Hung, Ming-Szu; Chen, I-Chuan; You, Liang; Jablons, David M; Li, Ya-Chin; Mao, Jian-Hua; Xu, Zhidong; Lung, Jr-Hau; Yang, Cheng-Ta; Liu, Shih-Tung

    2016-07-01

    Cullin 4A (Cul4A) has been observed to be overexpressed in various cancers. In this study, the role of Cul4A in the growth and chemosensitivity in lung cancer cells were studied. We showed that Cul4A is overexpressed in lung cancer cells and tissues. Knockdown of the Cul4A expression by shRNA in lung cancer cells resulted in decreased cellular proliferation and growth in lung cancer cells. Increased sensitivity to gemcitabine, a chemotherapy drug, was also noted in those Cul4A knockdown lung cancer cells. Moreover, increased expression of p21, transforming growth factor (TGF)-β inducible early gene-1 (TIEG1) and TGF beta-induced (TGFBI) was observed in lung cancer cells after Cul4A knockdown, which may be partially related to increased chemosensitivity to gemcitabine. G0/G1 cell cycle arrest was also noted after Cul4A knockdown. Notably, decreased tumour growth and increased chemosensitivity to gemcitabine were also noted after Cul4A knockdown in lung cancer xenograft nude mice models. In summary, our study showed that targeting Cul4A with RNAi or other techniques may provide a possible insight to the development of lung cancer therapy in the future.

  9. A novel anticancer agent SNG1153 inhibits growth of lung cancer stem/progenitor cells

    PubMed Central

    Wang, Jing; Zhu, Hai; Han, Yuqing; Jin, Mingji; Wang, Jun; Zhou, Congya; Ma, Junfeng; Lin, Qingcong; Wang, Zhaoyi; Meng, Kun; Fu, Xueqi

    2016-01-01

    Lung cancer is the leading cause of cancer-related death in both men and women. Lung cancer contains a small population of cancer cells with stem-like features known as cancer stem cells (CSCs). CSCs are often more resistant to current therapeutic treatments. Thus, it is urgent to develop a novel agent that is able to inhibit CSCs growth. In this study, we examined the ability of SNG1153, a novel chemical agent to inhibit the growth of lung CSCs. We found that SNG1153 inhibited growth and induced apoptosis in established lung cancer cells. We also found that SNG1153 inhibited the tumorsphere formation and decreased CD133-positive (lung CSC marker) cancer cells. SNG1153 was able to attenuate tumor formation in NOD/SCID (non-obese diabetic/severe combined immunodeficient) mice injected with lung tumorsphere cells. We further demonstrated that SNG1153 induced β-catenin phosphorylation and down-regulated β-catenin. Our results thus demonstrate that SNG1153 effectively inhibits the growth of lung CSCs and suggest that SNG1153 may be a novel therapeutic agent to treat human lung cancer. PMID:27281614

  10. Lung Cancer

    MedlinePlus

    Lung cancer is one of the most common cancers in the world. It is a leading cause of cancer death in men and women in the United States. Cigarette smoking causes most lung cancers. The more cigarettes you smoke per day and ...

  11. Trifluoperazine, an antipsychotic agent, inhibits cancer stem cell growth and overcomes drug resistance of lung cancer.

    PubMed

    Yeh, Chi-Tai; Wu, Alexander T H; Chang, Peter M-H; Chen, Kuan-Yu; Yang, Chia-Ning; Yang, Shuenn-Chen; Ho, Chao-Chi; Chen, Chun-Chi; Kuo, Yu-Lun; Lee, Pei-Ying; Liu, Yu-Wen; Yen, Chueh-Chuan; Hsiao, Michael; Lu, Pei-Jung; Lai, Jin-Mei; Wang, Liang-Shun; Wu, Chih-Hsiung; Chiou, Jeng-Fong; Yang, Pan-Chyr; Huang, Chi-Ying F

    2012-12-01

    Cancer stem cell (CSC) theory has drawn much attention, with evidence supporting the contribution of stem cells to tumor initiation, relapse, and therapy resistance. To screen drugs that target CSCs to improve the current treatment outcome and overcome drug resistance in patients with lung cancer. We used publicly available embryonic stem cell and CSC-associated gene signatures to query the Connectivity Map for potential drugs that can, at least in part, reverse the gene expression profile of CSCs. High scores were noted for several phenothiazine-like antipsychotic drugs, including trifluoperazine. We then treated lung CSCs with different EGFR mutation status with trifluoperazine to examine its anti-CSC properties. Lung CSCs resistant to epidermal growth factor receptor-tyrosine kinase inhibitor or cisplatin were treated with trifluoperazine plus gefitinib or trifluoperazine plus cisplatin. Animal models were used for in vivo validation of the anti-CSC effect and synergistic effect of trifluoperazine with gefitinib. We demonstrated that trifluoperazine inhibited CSC tumor spheroid formation and down-regulated the expression of CSC markers (CD44/CD133). Trifluoperazine inhibited Wnt/β-catenin signaling in gefitinib-resistant lung cancer spheroids. The combination of trifluoperazine with either gefitinib or cisplatin overcame drug resistance in lung CSCs. Trifluoperazine inhibited the tumor growth and enhanced the inhibitory activity of gefitinib in lung cancer metastatic and orthotopic CSC animal models. Using in silico drug screening by Connectivity Map followed by empirical validations, we repurposed an existing phenothiazine-like antipsychotic drug, trifluoperazine, as a potential anti-CSC agent that could overcome epidermal growth factor receptor-tyrosine kinase inhibitor and chemotherapy resistance.

  12. Lung Cancer Prevention

    MedlinePlus

    ... Treatment Lung Cancer Prevention Lung Cancer Screening Research Lung Cancer Prevention (PDQ®)–Patient Version What is prevention? ... to keep cancer from starting. General Information About Lung Cancer Key Points Lung cancer is a disease ...

  13. Epidermal growth factor receptor localized to exosome membranes as a possible biomarker for lung cancer diagnosis.

    PubMed

    Yamashita, T; Kamada, H; Kanasaki, S; Maeda, Y; Nagano, K; Abe, Y; Inoue, M; Yoshioka, Y; Tsutsumi, Y; Katayama, S; Inoue, M; Tsunoda, S

    2013-12-01

    Detection of drug-target proteins and biomarkers that are expressed in cancer tissue has significant potential for both diagnosis and treatment of cancer. However, current immuno-histochemical and cytogenetic analyses of biopsy specimens for pre-operational diagnosis are highly invasive and often difficult to apply to lung cancer patients. The purpose of this study was to evaluate the possible utility of determining epidermal growth factor receptor (EGFR) expression on exosomal membranes using a targeted ELISA with an anti-CD81 antibody as a capture antibody for lung cancer diagnosis. While soluble EGFR (sEGFR) levels in plasma were not remarkably different between lung cancer patients and normal controls, significantly higher exosomal EGFR expression levels were observed in 5/9 cancer cases compared to normal controls. These results suggest that measurement of exosomal protein levels could be useful for in vitro diagnosis, and that exosomal EGFR is a possible biomarker for characterization of lung cancer.

  14. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells.

    PubMed

    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

    2016-01-01

    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future.

  15. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells

    PubMed Central

    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

    2016-01-01

    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future. PMID:27362942

  16. Correlation of genetic polymorphism of vascular endothelial growth factor gene with susceptibility to lung cancer.

    PubMed

    Liu, C; Zhou, X; Gao, F; Qi, Z; Zhang, Z; Guo, Y

    2015-06-01

    The aim of the study is to study the correlation of genetic polymorphism of vascular endothelial growth factor (VEGF) gene with susceptibility to primary lung cancer. A total of 414 patients with primary lung cancer and 338 healthy volunteers were enrolled in this case-control study from September 2008 to October 2011. Gene identification with PCR-RFLP (polymerase chain reaction-based restriction fragment length polymorphism) was used to detect in white blood cells from the subjects the single-nucleotide polymorphisms (SNP) of VEGF gene, including +405G/C, -460 T/C, -1154G/A, -2578C/A sites. Association of genotypes or haplotypes with susceptibility of lung cancer was analyzed with unconditional logistic regression adjusted by gender and age. Smoking was significantly associated with increased risk of lung cancer. Gene phenotypic analysis demonstrated that C allele of +405G/C in VEGF gene was significantly associated increased risk of lung cancer in males (P=0.0094, odds ratio=1.634.3), as that with carrying GCTC haplotype (odds ratio=1.349), whereas carrying GACG had decreased risk for lung cancer (odds ratio=0.044). No relationship existed between 460 T/C, -1154G/A, -2578C/A alleles of VEGF gene and risk of lung cancer. VEGF gene polymorphism may have a role in the development of lung cancer.

  17. Regulation of brachyury by fibroblast growth factor receptor 1 in lung cancer

    PubMed Central

    Hu, Yunping; Feng, Xin; Mintz, Akiva; Petty, W. Jeffrey; Hsu, Wesley

    2016-01-01

    Recent evidence suggests that T-box transcription factor brachyury plays an important role in lung cancer development and progression. However, the mechanisms underlying brachyury-driven cellular processes remain unclear. Here we found that fibroblast growth factor receptor 1/mitogen-activated protein kinase (FGFR1/MAPK) signaling regulated brachyury in lung cancer. Analysis of FGFR1-4 and brachyury expression in human lung tumor tissue and cell lines found that only expression of FGFR1 was positively correlated with brachyury expression. Specific knockdown of FGFR1 by siRNA suppressed brachyury expression and epithelial–mesenchymal transition (EMT) (upregulation of E-cadherin and β-catenin and downregulation of Snail and fibronectin), whereas forced overexpression of FGFR1 induced brachyury expression and promoted EMT in lung cancer cells. Activation of fibroblast growth factor (FGF)/FGFR1 signaling promoted phosphorylated MAPK extracellular signal-regulated kinase (ERK) 1/2 translocation from cytoplasm to nucleus, upregulated brachyury expression, and increased cell growth and invasion. In addition, human lung cancer cells with higher brachyury expression were more sensitive to inhibitors targeting FGFR1/MAPK pathway. These findings suggest that FGFR1/MAPK may be important for brachyury activation in lung cancer, and this pathway may be an appealing therapeutic target for a subset of brachyury-driven lung cancer. PMID:27893433

  18. Role of epidermal growth factor receptor in lung cancer and targeted therapies

    PubMed Central

    Liu, Tie-Cheng; Jin, Xin; Wang, Yan; Wang, Ke

    2017-01-01

    Lung cancer is the foremost cause of cancer-related deaths world-wide. Both, the major forms of lung cancer, Non-small cell lung cancer (NSCLC) and Small cell lung cancers (SCLC), have responded effectively to chemo-, radiation and adjuvant-therapies. Tumor removal through surgery also appeared as a good therapeutic strategy. However, these therapies demonstrated unfavourable side-effects, and hence novel drugs targeting lung cancer emerged essential. Activation of epidermal growth factor receptor (EGFR)-tyrosine kinases is a key reason for lung cancer progression. Two important strategies that have attenuated lung cancers were through treatments with EGFR-tyrosine kinase-inhibitors, erlotinib and gefitinib, or EGFR-neutralizing antibodies, cetuximab and bevacizumab. A major advantage with erlotinib and gefitinib was their role in second and third-line treatments following chemotherapies. Phase II/III clinical trials showed that combinatorial treatment of tyrosine kinase (TK)-inhibitors with chemotherapeutics, such as docetaxel and pemetrexed, caused significant improvements in progression-free survival and overall survival.Phase I and II clinical studies also revealed that combination of tyrosine kinase-inhibitors with the EGFR-targeted antibodies was an effective approach for treating lung cancer. However, patients having T790M-mutations within EGFR gene were resistant to erlotinib and gefitinib. Alternatively, another second-generation EGFR-tyrosine kinase-inhibitor, afatinib, that could circumvent the problem of drug resistance has been developed as lung cancer therapy. The current review focuses on the role of EGFR in lung cancer progression and apprises about the EGFR-targeted therapies. The review also informs on the adverse side-effects of these therapies and enlightens the need for safer therapeutic regimens to eradicate this dreaded disease. PMID:28337370

  19. CUL4A overexpression enhances lung tumor growth and sensitizes lung cancer cells to Erlotinib via transcriptional regulation of EGFR

    SciTech Connect

    Wang, Yunshan; Zhang, Pengju; Liu, Ziming; Wang, Qin; Wen, Mingxin; Wang, Yuli; Yuan, Hongtu; Mao, Jian-Hua; Wei, Guangwei

    2014-11-21

    CUL4A has been proposed as oncogene in several types of human cancer, but its clinical significance and functional role in human non-small cell lung cancer (NSCLC) remain unclear. Expression level of CUL4A was examined by RT-PCR and Western blot. Forced expression of CUL4A was mediated by retroviruses, and CUL4A silencing by shRNAs expressing lentiviruses. Growth capacity of lung cancer cells was measured by MTT in vitro and tumorigenesis in vivo, respectively. We found that CUL4A was highly expressed in human lung cancer tissues and lung cancer cell lines, and this elevated expression positively correlated with disease progression and prognosis. Overexpression of CUL4A in human lung cancer cell lines increased cell proliferation, inhibited apoptosis, and subsequently conferred resistance to chemotherapy. On other hand, silencing CUL4A expression in NSCLC cells reduced proliferation, promoted apoptosis and resulted in tumor growth inhibition in cancer xenograft model. Mechanistically, we revealed CUL4A regulated EGFR transcriptional expression and activation, and subsequently activated AKT. Targeted inhibition of EGFR activity blocked these CUL4A induced oncogenic activities. In conclusion, our results highlight the significance of CUL4A in NSCLC and suggest that CUL4A could be a promising therapy target and a potential biomarker for prognosis and EGFR target therapy in NSCLC patients.

  20. CUL4A overexpression enhances lung tumor growth and sensitizes lung cancer cells to Erlotinib via transcriptional regulation of EGFR

    DOE PAGES

    Wang, Yunshan; Zhang, Pengju; Liu, Ziming; ...

    2014-11-21

    CUL4A has been proposed as oncogene in several types of human cancer, but its clinical significance and functional role in human non-small cell lung cancer (NSCLC) remain unclear. Expression level of CUL4A was examined by RT-PCR and Western blot. Forced expression of CUL4A was mediated by retroviruses, and CUL4A silencing by shRNAs expressing lentiviruses. Growth capacity of lung cancer cells was measured by MTT in vitro and tumorigenesis in vivo, respectively. We found that CUL4A was highly expressed in human lung cancer tissues and lung cancer cell lines, and this elevated expression positively correlated with disease progression and prognosis. Overexpressionmore » of CUL4A in human lung cancer cell lines increased cell proliferation, inhibited apoptosis, and subsequently conferred resistance to chemotherapy. On other hand, silencing CUL4A expression in NSCLC cells reduced proliferation, promoted apoptosis and resulted in tumor growth inhibition in cancer xenograft model. Mechanistically, we revealed CUL4A regulated EGFR transcriptional expression and activation, and subsequently activated AKT. Targeted inhibition of EGFR activity blocked these CUL4A induced oncogenic activities. In conclusion, our results highlight the significance of CUL4A in NSCLC and suggest that CUL4A could be a promising therapy target and a potential biomarker for prognosis and EGFR target therapy in NSCLC patients.« less

  1. What Is Lung Cancer?

    MedlinePlus

    ... Graphics Infographic Stay Informed Cancer Home What Is Lung Cancer? Language: English Español (Spanish) Recommend on Facebook Tweet ... cancer starts in the lungs, it is called lung cancer. Lung cancer begins in the lungs and may ...

  2. Lung Cancer Screening

    MedlinePlus

    ... Treatment Lung Cancer Prevention Lung Cancer Screening Research Lung Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Lung Cancer Key Points Lung cancer is a disease ...

  3. Epidermal growth factor receptor and KRAS mutations in Brazilian lung cancer patients

    PubMed Central

    Bacchi, Carlos E.; Ciol, Heloísa; Queiroga, Eduardo M.; Benine, Lucimara C.; Silva, Luciana H.; Ojopi, Elida B.

    2012-01-01

    OBJECTIVE: Epidermal growth factor receptor is involved in the pathogenesis of non-small cell lung cancer and has recently emerged as an important target for molecular therapeutics. The KRAS oncogene also plays an important role in the development of lung cancer. The aim of this study was to evaluate the frequency of epidermal growth factor receptor and KRAS mutations in a population of Brazilian patients with non-small cell lung cancer. METHODS: A total of 207 specimens from Brazilian patients with non-small cell lung cancer were analyzed for activating epidermal growth factor receptor and KRAS somatic mutations, and their associations with clinicopathological characteristics (including age, gender, ethnicity, smoking habits, and histological subtype) were examined. RESULTS: We identified 63 cases (30.4%) with epidermal growth factor receptor mutations and 30 cases (14.6%) with KRAS mutations. The most frequent epidermal growth factor receptor mutation we detected was a deletion in exon 19 (60.3%, 38 patients), followed by an L858R amino acid substitution in exon 21 (27%, 17 patients). The most common types of KRAS mutations were found in codon 12. There were no significant differences in epidermal growth factor receptor or KRAS mutations by gender or primary versus metastatic lung cancer. There was a higher prevalence of KRAS mutations in the non-Asian patients. Epidermal growth factor receptor mutations were more prevalent in adenocarcinomas than in non-adenocarcinoma histological types. Being a non-smoker was significantly associated with the prevalence of epidermal growth factor receptor mutations, but the prevalence of KRAS mutations was significantly associated with smoking. CONCLUSIONS: This study is the first to examine the prevalence of epidermal growth factor receptor and KRAS mutations in a Brazilian population sample with non-small cell lung cancer. PMID:22666783

  4. WWOX gene restoration prevents lung cancer growth in vitro and in vivo.

    PubMed

    Fabbri, Muller; Iliopoulos, Dimitrios; Trapasso, Francesco; Aqeilan, Rami I; Cimmino, Amelia; Zanesi, Nicola; Yendamuri, Sai; Han, Shuang-Yin; Amadori, Dino; Huebner, Kay; Croce, Carlo M

    2005-10-25

    The WWOX (WW domain containing oxidoreductase) gene at the common fragile site, FRA16D, is altered in many types of cancer, including lung cancer. We have examined the tumor suppressor function of WWOX in preclinical lung cancer models. The WWOX gene was expressed in lung cancer cell lines through recombinant adenovirus (Ad) infection (Ad-WWOX), and through a drug [ponasterone A, (ponA)]-inducible system. After WWOX restoration in vitro, endogenous Wwox protein-negative cell lines (A549, H460, and H1299) underwent apoptosis through activation of the intrinsic apoptotic caspase cascade in A549 and H460 cells. Ectopic expression of Wwox caused dramatic suppression of tumorigenicity of A549, H460, and H1299 cells in nude mice after Ad-WWOX infection and after ponA induction of Wwox expression in H1299 lung cancer cells. Tumorigenicity and in vitro growth of U2020 (Wwox-positive) lung cancer cells was unaffected by Wwox overexpression. This study confirms that WWOX is a tumor suppressor gene and is highly effective in preventing growth of lung cancer xenografts, whether introduced through viral infection or by induction of a silent WWOX transgene.

  5. Modulation of lung cancer growth arrest and apoptosis by Phellinus Linteus.

    PubMed

    Guo, Jinjin; Zhu, Tongbo; Collins, Leaann; Xiao, Zhi-Xiong J; Kim, Sung-Hoon; Chen, Chang-Yan

    2007-02-01

    The Phellinus Linteus (PL) mushroom has been shown to possess anti-tumor properties. Through influencing lymphocytes, PL indirectly augments the host's immune system against cancer cells. PL has also been demonstrated to reduce tumor proliferation. However, the mechanisms of PL against malignant growth have not yet been fully explored. In this study, we report that PL mediates the following two activities in mouse and human lung cancer cells: cell-cycle arrest at a low concentration of PL and apoptosis in response to a high dose of PL. After exposure to a low dose of PL, G(1) growth arrest occurred in the lung cancer cells. The negative growth control mediated by PL is evidenced by the decrease of the activities of cyclin-dependent kinases CDK2, 4, and 6. In contrast, at high doses, PL-induced lung cancer cells to undergo apoptosis in a dose-dependent fashion. This was evidenced by DNA fragmentation, caspase activation, and loss of clonogenecity in the lung cancer cells, all of which were lacking in the lung cancer cells treated with low concentrations of PL as well as the normal mouse lung epithelial cells exposed to either low or high concentrations of PL. The addition of the caspase inhibitor Z-VADfmk completely suppressed PL-induced apoptosis. Furthermore, the low dose of PL was able to synergize with doxorubicin to induce apoptosis in the lung cancer cells. Thus, our findings suggest that PL regulates two responses in the lung cancer cells: cell-cycle arrest and apoptosis. 2006 Wiley-Liss, Inc.

  6. Lung cancer

    MedlinePlus

    ... Sputum test to look for cancer cells Thoracentesis (sampling of fluid buildup around the lung) In most ... quitting, talk with your provider. There are many methods to help you quit, from support groups to ...

  7. A Combined PD-1/C5a Blockade Synergistically Protects against Lung Cancer Growth and Metastasis.

    PubMed

    Ajona, Daniel; Ortiz-Espinosa, Sergio; Moreno, Haritz; Lozano, Teresa; Pajares, María J; Agorreta, Jackeline; Bértolo, Cristina; Lasarte, Juan J; Vicent, Silvestre; Hoehlig, Kai; Vater, Axel; Lecanda, Fernando; Montuenga, Luis M; Pio, Ruben

    2017-07-01

    Disruption of the programmed cell death protein 1 (PD-1) pathway with immune checkpoint inhibitors represents a major breakthrough in the treatment of non-small cell lung cancer. We hypothesized that combined inhibition of C5a/C5aR1 and PD-1 signaling may have a synergistic antitumor effect. The RMP1-14 antibody was used to block PD-1, and an L-aptamer was used to inhibit signaling of complement C5a with its receptors. Using syngeneic models of lung cancer, we demonstrate that the combination of C5a and PD-1 blockade markedly reduces tumor growth and metastasis and leads to prolonged survival. This effect is accompanied by a negative association between the frequency of CD8 T cells and myeloid-derived suppressor cells within tumors, which may result in a more complete reversal of CD8 T-cell exhaustion. Our study provides support for the clinical evaluation of anti-PD-1 and anti-C5a drugs as a novel combination therapeutic strategy for lung cancer.Significance: Using a variety of preclinical models of lung cancer, we demonstrate that the blockade of C5a results in a substantial improvement in the efficacy of anti-PD-1 antibodies against lung cancer growth and metastasis. This study provides the preclinical rationale for the combined blockade of PD-1/PD-L1 and C5a to restore antitumor immune responses, inhibit tumor cell growth, and improve outcomes of patients with lung cancer. Cancer Discov; 7(7); 694-703. ©2017 AACR.This article is highlighted in the In This Issue feature, p. 653. ©2017 American Association for Cancer Research.

  8. Fei-Liu-Ping ointment inhibits lung cancer growth and invasion by suppressing tumor inflammatory microenvironment

    PubMed Central

    2014-01-01

    Background Lung cancer is one of the leading causes of cancer-related mortality worldwide. Conventional chemotherapy and radiotherapy are the primary therapeutic methods for lung cancer with the use of combination therapies gaining popularity. The frequency and duration of treatment, as well as, managing lung cancer by targeting multiple aspects of cancer biology is often limited by toxicity to the patient. There are many naturally occurring anticancer agents that have a high degree of efficacy and low toxicity, offering a viable and safe approach for the treatment of lung cancer. The herbs traditionally used in Chinese medicine for anticancer treatment offer great potential to enhance the efficacy of conventional therapy. In this study, we evaluated the synergistic effects of Fei-Liu-Ping (FLP) ointment in treating lung cancer; a known anticancer Chinese herbal based formula. Methods In this study, A549 human lung carcinoma cell line and Lewis lung carcinoma xenograft mouse model were used. In addition, we utilized an in vitro co-culture system to simulate the tumor microenvironment in order to evaluate the molecular mechanisms of FLP treatment. Results FLP treatment significantly inhibited tumor growth in the Lewis lung xenograft by 40 percent, compared to that of cyclophosphamide (CTX) of 62.02 percent. Moreover, combining FLP and CTX inhibited tumor growth by 83.23 percent. Upon evaluation, we found that FLP treatment reduced the concentration of serum pro-inflammatory cytokines IL-6, TNF-α, and IL-1β. In addition, we also found an improvement in E-cadherin expression and inhibition of N-cadherin and MMP9. We found similar findings in vitro when we co-cultured A549 cells with macrophages. FLP treatment inhibited A549 cell growth, invasion and metastasis, in part, through the regulation of NF-κB and altering the expression of E-cadherin, N-cadherin, MMP2 and MMP9. Conclusions FLP exerts anti-inflammatory properties in the tumor microenvironment, which may

  9. RFPL3 and CBP synergistically upregulate hTERT activity and promote lung cancer growth

    PubMed Central

    Yu, Wendan; Cai, Xin; Dai, Meng; Xu, Tingting; Huang, Wenlin; Guo, Wei; Deng, Wuguo; Wu, Taihua

    2015-01-01

    hTERT is the key component of telomerase and its overactivation contributes to maintaining telomere length and cell immortalization. Previously, we identified RFPL3 as a new transcription activator of hTERT in lung cancers. However, the exact mechanism of RFPL3 in mediating hTERT activation and its associated signal regulatory network remain unclear. In this study, we found that RFPL3 colocalized and interacted directly with CBP in the nucleus of lung cancer cells. Immunohistochemical analysis of tissue microarrays of lung cancers revealed the simultaneous overexpression of both RFPL3 and CBP predicted relatively poor prognosis. Furthermore, we confirmed their synergistic stimulation on hTERT expression and tumor cell growth. The binding of RFPL3 to hTERT promoter was reduced markedly when CBP was knocked down by its specific siRNA or suppressed by its inhibitor in lung cancer cells with stable overexpression of RFPL3. When one of the two proteins RFPL3 and CBP was upregulated or downregulated, whereas the another remains unchanged, hTERT expression and telomerase activity were activated or repressed accordingly. In the meantime, the growth of lung cancer cells was also promoted or attenuated accordingly. Furthermore, we also found that RFPL3 coordinated with CBP to upregulate hTERT through the CBP-induced acetylation of RFPL3 protein and their co-anchoring at hTERT promoter region. Collectively, our results reveal a new mechanism of hTERT regulation in lung cancer cells and suggest the RFPL3/CBP/hTERT signaling pathway may be a new targets for lung cancer treatment. PMID:26318425

  10. Lung Cancer Screening

    MedlinePlus

    Lung cancer screening Overview By Mayo Clinic Staff Lung cancer screening is a process that's used to detect the presence ... with a high risk of lung cancer. Lung cancer screening is recommended for older adults who are longtime ...

  11. Lung cancer - small cell

    MedlinePlus

    Cancer - lung - small cell; Small cell lung cancer; SCLC ... About 15% of all lung cancer cases are SCLC. Small cell lung cancer is slightly more common in men than women. Almost all cases of SCLC are ...

  12. Epidermal growth factor gene polymorphism is different between schizophrenia and lung cancer patients in Korean population.

    PubMed

    Lim, Yun Jeong; Kim, Jong-Woo; Song, Ji Young; Hong, Mee-Suk; Jin, Sheng-Yu; Yoon, Seo Hyun; Park, Hae Jeong; Choe, Bong-Keun; Lee, Jung Joo; Yim, Sung-Vin; Hong, Seok-Il; Baik, Hyung Hwan; Ha, Eunyoung; Park, Yeon Hee

    2005-02-21

    Low incidence of cancer in schizophrenia is one of the interesting puzzles in psychiatric field over decades. Analysis of genetic difference between schizophrenia and lung cancer might provide us with possible clues to understand molecular mechanisms of pathophysiology of schizophrenia. Epidermal growth factor (EGF), one of the potent growth promoting factors, has been studied for its roles in cancer development. EGF is also known to be involved in cognitive function. In order to analyze the genetic difference between schizophrenia and lung cancer, polymorphism of EGF gene was studied from 174 schizophrenia patients, 122 lung cancer patients and 132 controls in Korean population. Genotype frequency analysis of EGF gene (AluI restriction site, 5'-UTR, rs4444903) in the EGF gene was studied. The genotype and allele frequencies of the AluI polymorphism showed significant differences between schizophrenia and lung cancer patients [p<0.0001; p<0.0001, odds ratio (95% CI), 0.3690 (0.2600-0.5236)]. When compared with controls, schizophrenia patients showed no significant differences from controls in genotype and allele frequencies [p=0.5151; p=0.3516, odds ratio (95% CI), 0.8589 (0.6235-1.1830)]. However, lung cancer patients showed significant differences from controls in genotype and allele frequencies [p<0.0001; p<0.0001, odds ratio (95% CI), 2.3275 (1.6082-3.3687)]. These results indicate that schizophrenia is not associated with AluI polymorphism of EGF gene and EGF gene polymorphism is different between schizophrenia and lung cancer patients.

  13. Fas signal promotes lung cancer growth by recruiting myeloid-derived suppressor cells via cancer cell-derived PGE2.

    PubMed

    Zhang, Yongliang; Liu, Qiuyan; Zhang, Minggang; Yu, Yizhi; Liu, Xia; Cao, Xuetao

    2009-03-15

    Fas/FasL system has been extensively investigated with respect to its capacity to induce cellular apoptosis. However, accumulated evidences show that Fas signaling also exhibits nonapoptotic functions, such as induction of cell proliferation and differentiation. Lung cancer is one of cancer's refractory to the immunotherapy, however, the underlying mechanisms remain to be fully understood. In this study, we show that Fas overexpression does not affect in vitro growth of 3LL cells, but promotes lung cancer growth in vivo. However, such tumor-promoting effect is not observed in FasL-deficient (gld) mice, and also not observed in the immune competent mice once inoculation with domain-negative Fas-overexpressing 3LL cells, suggesting the critical role of Fas signal in the promotion of lung cancer growth in vivo. More accumulation of myeloid-derived suppressor cells (MDSC) and Foxp3(+) regulatory T cells is found in tumors formed by inoculation with Fas-overexpressing 3LL cells, but not domain-negative Fas-overexpressing 3LL cells. Accordingly, Fas-ligated 3LL lung cancer cells can chemoattract more MDSC but not regulatory T cells in vitro. Furthermore, Fas ligation induces 3LL lung cancer cells to produce proinflammatory factor PGE(2) by activating p38 pathway, and in turn, 3LL cells-derived PGE(2) contribute to the Fas ligation-induced MDSC chemoattraction. Furthermore, in vivo administration of cyclooxygenase-2 inhibitor can significantly reduce MDSC accumulation in the Fas-overexpressing tumor. Therefore, our results demonstrate that Fas signal can promote lung cancer growth by recruiting MDSC via cancer cell-derived PGE(2), thus providing new mechanistic explanation for the role of inflammation in cancer progression and immune escape.

  14. Teroxirone inhibited growth of human non-small cell lung cancer cells by activating p53

    SciTech Connect

    Wang, Jing-Ping; Lin, Kai-Han; Liu, Chun-Yen; Yu, Ya-Chu; Wu, Pei-Tsun; Chiu, Chien-Chih; Su, Chun-Li; Chen, Kwun-Min; Fang, Kang

    2013-11-15

    In this work, we demonstrated that the growth of human non-small-cell-lung-cancer cells H460 and A549 cells can be inhibited by low concentrations of an epoxide derivative, teroxirone, in both in vitro and in vivo models. The cytotoxicity was mediated by apoptotic cell death through DNA damage. The onset of ultimate apoptosis is dependent on the status of p53. Teroxirone caused transient elevation of p53 that activates downstream p21 and procaspase-3 cleavage. The presence of caspase-3 inhibitor reverted apoptotic phenotype. Furthermore, we showed the cytotoxicity of teroxirone in H1299 cells with stable ectopic expression of p53, but not those of mutant p53. A siRNA-mediated knockdown of p53 expression attenuated drug sensitivity. The in vivo experiments demonstrated that teroxirone suppressed growth of xenograft tumors in nude mice. Being a potential therapeutic agent by restraining cell growth through apoptotic death at low concentrations, teroxirone provides a feasible perspective in reversing tumorigenic phenotype of human lung cancer cells. - Highlights: • Teroxirone repressed tumor cell growth in nude mice of human lung cancer cells. • The apoptotic cell death reverted by caspase-3 inhibitor is related to p53 status. • Teroxirone provides a good candidate for lung cancer treatment.

  15. IL-15/sIL-15Rα gene transfer suppresses Lewis lung cancer growth in the lungs, liver and kidneys.

    PubMed

    Sun, H; Liu, D

    2016-01-01

    Nearly 40% of people with lung cancer have tumor growth in other organs at the time of diagnosis. Current treatment strategies for patients with late-stage lung cancer are primarily palliative and only showed modest efficacy. The current study takes advantage of the hydrodynamic gene delivery technique to evaluate the antitumor activity of interleukin (IL)-15/sIL-15Rα on lung tumors growing in the lungs, liver and kidneys. We demonstrate that hydrodynamic tail vein injection of 2 μg of AG209 DP muIL-15sRα+IL-15 plasmid resulted in serum IL-15/sIL-15Rα reaching a peak level of ~10 μg ml(-1) 1 day after the injection and gradually declined to ~5 ng ml(-1) within 3 days. Quantitative PCR analysis revealed that overexpression of IL-15/sIL-15Rα induced the activation of natural killer and T cells, evidenced by increased mRNA levels of marker genes including granzyme B, perforin, Ifn-γ, T-bet and Cd8 in the lungs, liver and kidneys. Importantly, transfer of the Il-15/sIl-15Rα gene alone, or in combination with gemcitabine chemotherapy, significantly inhibited the tumor growth in these three organs and prolonged median survival time of treated mice by 1.7- and 3.3-fold, respectively. The therapeutic benefits are principally blockade and elimination of tumor growth in the liver and kidneys. Taken together, these results suggest that IL-15/sIL-15Rα-based gene therapy could be an effective approach to treat late-stage lung cancer with metastases in other organs.

  16. Vav1 promotes lung cancer growth by instigating tumor-microenvironment cross-talk via growth factor secretion.

    PubMed

    Sebban, Shulamit; Farago, Marganit; Rabinovich, Shiran; Lazer, Galit; Idelchuck, Yulia; Ilan, Lena; Pikarsky, Eli; Katzav, Shulamit

    2014-10-15

    Vav1 is a signal transducer that functions as a scaffold protein and a regulator of cytoskeleton organization in the hematopoietic system, where it is exclusively expressed. Recently, Vav1 was shown to be involved in diverse human cancers, including lung cancer. We demonstrate that lung cancer cells that abnormally express Vav1 secrete growth factors in a Vav1-dependent manner. Transcriptome analysis demonstrated that Vav1 depletion results in a marked reduction in the expression of colony-stimulating-factor-1 (CSF1), a hematopoietic growth factor. The association between Vav1 expression and CSF1 was further supported by signal transduction experiments, supporting involvement of Vav1 in regulating lung cancer secretome. Blocking of ERK phosphorylation, led to a decrease in CSF1 transcription, thus suggesting a role for ERK, a downstream effector of Vav1, in CSF1 expression. CSF1-silenced cells exhibited reduced focus formation, proliferation abilities, and growth in NOD/SCID mice. CSF1-silenced H358 cells resulted in significantly smaller tumors, showing increased fibrosis and a decrease in tumor infiltrating macrophages. Finally, immunohistochemical analysis of primary human lung tumors revealed a positive correlation between Vav1 and CSF1 expression, which was associated with tumor grade. Additional results presented herein suggest a potential cross-talk between cancer cells and the microenvironment controlled by CSF1/Vav1 signaling pathways.

  17. Vav1 promotes lung cancer growth by instigating tumor-microenvironment cross-talk via growth factor secretion

    PubMed Central

    Rabinovich, Shiran; Lazer, Galit; Idelchuck, Yulia; Ilan, Lena; Pikarsky, Eli; Katzav, Shulamit

    2014-01-01

    Vav1 is a signal transducer that functions as a scaffold protein and a regulator of cytoskeleton organization in the hematopoietic system, where it is exclusively expressed. Recently, Vav1 was shown to be involved in diverse human cancers, including lung cancer. We demonstrate that lung cancer cells that abnormally express Vav1 secrete growth factors in a Vav1-dependent manner. Transcriptome analysis demonstrated that Vav1 depletion results in a marked reduction in the expression of colony-stimulating-factor-1 (CSF1), a hematopoietic growth factor. The association between Vav1 expression and CSF1 was further supported by signal transduction experiments, supporting involvement of Vav1 in regulating lung cancer secretome. Blocking of ERK phosphorylation, led to a decrease in CSF1 transcription, thus suggesting a role for ERK, a downstream effector of Vav1, in CSF1 expression. CSF1-silenced cells exhibited reduced focus formation, proliferation abilities, and growth in NOD/SCID mice. CSF1-silenced H358 cells resulted in significantly smaller tumors, showing increased fibrosis and a decrease in tumor infiltrating macrophages. Finally, immunohistochemical analysis of primary human lung tumors revealed a positive correlation between Vav1 and CSF1 expression, which was associated with tumor grade. Additional results presented herein suggest a potential cross-talk between cancer cells and the microenvironment controlled by CSF1/Vav1 signaling pathways. PMID:25313137

  18. 6 Common Cancers - Lung Cancer

    MedlinePlus

    ... Home Current Issue Past Issues 6 Common Cancers - Lung Cancer Past Issues / Spring 2007 Table of Contents ... for Desperate Housewives. (Photo ©2005 Kathy Hutchins / Hutchins) Lung Cancer Lung cancer causes more deaths than the ...

  19. [Mechanisms for quercetin in prevention of lung cancer cell growth and metastasis].

    PubMed

    Zhao, Xin; Zhang, Jian

    2015-06-01

    To study the effect of quercetin, an inhibitor of matrix metalloproteinases 9 (MMP-9), on the growth and metastasis of lung cancer cells and the underlying mechanisms.
 We evaluated the inhibitory effect and the inhibitory kinetics of quercetin on MMP-9 by ELISA and enzyme inhibition kinetics, and the inhibitory effect of quercetin on the growth of lung cancer cell (A549) by MTT. The effect of quercetin on levels of MMP-9 (mRNA and protein) and TGF-β1 (protein) in A549 were measured by RT-PCR and Western blot, respectively. The synergistic inhibition effect of quercetin plus TIMP-1 on the growth of lung cancer cell A549 was discussed.
 Quercetin induced the apoptosis of A549. It was a reversible competitive inhibitor of MMP-9 (half inhibition rate IC50 of 5.25 μmol/L, inhibition constant Ki was 2.18 μmol/L). With the increase in quercetin concentration, the levels of MMP-9 (mRNA and protein) and TGF-β1 (protein) were decreased, and the number of tumor cells on wear filter membrane was reduced. The combination of quercetin (at low concentrations) with TIMP-1 showed synergistic inhibitory effect on the growth of A549 cells. 
 Quercetin is a competitive inhibitor of MMP-9 and could downregulate the expression of MMP-9 and TGF-β1, which plays an important role in A549 apoptosis.

  20. Epidermal Growth Factor Receptor Mutated Advanced Non-Small Cell Lung Cancer: A Changing Treatment Paradigm.

    PubMed

    Pakkala, Suchita; Ramalingam, Suresh S

    2017-02-01

    Activating mutations in the epidermal growth factor receptor (EGFR) are present in approximately 15% of US patients with lung adenocarcinoma. EGFR tyrosine kinase inhibitors are associated with high response rate and progression-free survival for patients with non-small cell lung cancer with this genotype. Gefitinib, erlotinib, and afatinib are the EGFR tyrosine kinase inhibitors that are presently in clinical use. Understanding resistance mechanisms has led to the identification of a secondary mutational target, T790M, in more than half of patients, for which osimertinib has been approved. This article reviews the current treatments, resistance mechanisms, and strategies to overcome resistance.

  1. [Effects of green tea on growth inhibition and immune regulation of Lewis lung cancer in mice].

    PubMed

    Zhu, M; Gong, Y; Ge, G

    1997-11-01

    C57/BL6J mice were inoculated with Lewis lung cancer cells as an experimental model to study the effects of green tea on cancer prevention, inhibition of tumor growth and immune regulation in mice with tumor. Results showed that weight of thymus in C57/BL6J mice and its index declined, proportion of positive CD4 subgroup of T lymphocyte and ratio of CD4+, to CD8+ reduced, baseline chemilumi-nescence decreased in peripheral white blood cells, yeast zymosan stimulated chemiluminescence increased, and number of immunoglobulin M formation cells decreased. It indicated that green tea had obvious inhibition in Lewis lung cancer and protective effects, to various extent, on adverse changes of above indices.

  2. Hiwi knockdown inhibits the growth of lung cancer in nude mice.

    PubMed

    Liang, Dong; Dong, Min; Hu, Lin-Jie; Fang, Ze-Hui; Xu, Xia; Shi, En-Hui; Yang, Yi-Ju

    2013-01-01

    Hiwi, a human homologue of the Piwi family, plays an important role in stem cell self-renewal and is overexpressed in various human tumors. This study aimed to determine whether an RNA interference-based strategy to suppress Hiwi expression could inhibit tumor growth in a xenograft mouse model. A rare population of SSCloAldebr cells was isolated and identified as lung cancer stem cells in our previous study. Plasmids containing U6 promoter-driven shRNAs against Hiwi or control plasmids were successfully established. The xenograft tumor model was generated by subcutaneously inoculating with lung cancer stem cell SSCloAldebr cells. After the tumor size reached about 8 mm in diameter, shRNA plasmids were injected into the mice via the tail vein three times a week for two weeks, then xenograft tumor growth was assessed. In nude mice, intravenously delivery of Hiwi shRNA plasmids significantly inhibited tumor growth compared to treatment with control scrambled shRNA plasmids or the vehicle PBS. No mice died during the experiment and no adverse events were observed in mice administered the plasmids. Moreover, delivery of Hiwi shRNA plasmids resulted in a significant suppressed expression of Hiwi and ALDH-1 in xenograft tumor samples, based on immunohistochemical analysis. Thus, shRNA-mediated Hiwi gene silencing in lung cancer stem cells by an effective in vivo gene delivery strategy appeared to be an effective therapeutic approach for lung cancer, and may provide some useful clues for RNAi gene therapy in solid cancers.

  3. Nutrition for Lung Cancer

    MedlinePlus

    ... by zip code or Select your state State Lung Cancer www.lung.org > Lung Health and Diseases > ... I Stay Healthy Share this page: Nutrition for Lung Cancer Key Points There is no prescribed diet ...

  4. Cholinergic Targets in Lung Cancer.

    PubMed

    Spindel, Eliot R

    2016-01-01

    Lung cancers express an autocrine cholinergic loop in which secreted acetylcholine can stimulate tumor growth through both nicotinic and muscarinic receptors. Because activation of mAChR and nAChR stimulates growth; tumor growth can be stimulated by both locally synthesized acetylcholine as well as acetylcholine from distal sources and from nicotine in the high percentage of lung cancer patients who are smokers. The stimulation of lung cancer growth by cholinergic agonists offers many potential new targets for lung cancer therapy. Cholinergic signaling can be targeted at the level of choline transport; acetylcholine synthesis, secretion and degradation; and nicotinic and muscarinic receptors. In addition, the newly describe family of ly-6 allosteric modulators of nicotinic signaling such as lynx1 and lynx2 offers yet another new approach to novel lung cancer therapeutics. Each of these targets has their potential advantages and disadvantages for the development of new lung cancer therapies which are discussed in this review.

  5. TIPE2 Inhibits Lung Cancer Growth Attributing to Promotion of Apoptosis by Regulating Some Apoptotic Molecules Expression

    PubMed Central

    Liu, Qing-Qing; Zhang, Feng-Feng; Wang, Fang; Qiu, Jing-Hua; Luo, Chun-Hua; Zhu, Guo-Yong; Liu, Ying-Fu

    2015-01-01

    Recent studies found that TIPE2 was involved in cancer development. However, little is known about TIPE2 in lung cancer. Our study aims to clarify the role of TIPE2 in lung carcinogenesis. We examined the expression of TIPE2 in lung squamous cancer (LSC), small cell lung cancer and lung adenocarcinoma (AdC) tissues and found that TIPE2 expression was lost in small cell lung cancer, compared with adjacent non-tumor tissues. Overexpression of TIPE2 significantly inhibited the growth of lung cancer cell H446 in vitro and even suppressed tumor formation in vivo. Flow cytometry analysis found TIPE2 overexpression promoted apoptosis of H446. In TIPE2 over-expression cells, caspase-3, caspase-9, and Bax were significantly up-regulated while Bcl-2 was down-regulated. Moreover, coincident results were shown by immunohistochemistry in tumors from nude mice. TIPE2 inhibited the phosphorylation of Akt, while promoting the phosphorylation of P38, but had no effect on IκBα and ERK pathway. Taken together, TIPE2 promoted lung cancer cell apoptosis through affecting apoptosis-related molecules caspase-3, caspase-9, Bcl-2 and Bax, possibly via regulating P38 and Akt pathways, indicating that TIPE2 might be a novel marker for lung cancer diagnosis and therapy. PMID:25946186

  6. MicroRNA-221 promotes human non-small cell lung cancer cell H460 growth.

    PubMed

    Xu, Yiming; Zhong, Chongjun; Ding, Shengguang; Huang, Haitao; Shen, Zhenya

    2015-01-01

    MicroRNA (miRNA-221) has been reported to be a regulator of cell proliferation. Here we intended to investigate the role of miRNA-221 in regulating the growth of human non-small cell lung cancer cell line H460. H460 cells were transfected with miRNA-221 mimics/inhibitors or their respective negative controls. Real-time quantitative PCRs (qRT-PCRs) were used to confirm the effects of miRNA-221 mimics and inhibitors in H460 cells while Cell Counting Kit 8 (CCK-8) and 5-Ethynyl-2'-deoxyuridine (EdU) assay were used to access the cell viability and proliferation. P27 and P57, as putative targets of miRNA-221, were determined by qRT-PCRs in H460 cells. We found that overexpression of miRNA-221 led to increased proliferative rate and cell viability in H460 cells while down-regulation of miRNA-221 decreased those effects. P27 but not P57 was identified as a potential target gene of miRNA-221 in H460 as P27 was negatively regulated by miRNA-221 in the protein level. In conclusion, this study suggests that miRNA-221 controls human non-small cell lung cancer cell H460 growth potentially by targeting P57. Inhibition of miRNA-221 represents a novel potential treatment for human non-small cell lung cancer.

  7. Risks of Lung Cancer Screening

    MedlinePlus

    ... Treatment Lung Cancer Prevention Lung Cancer Screening Research Lung Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Lung Cancer Key Points Lung cancer is a disease ...

  8. Early Growth Response-1 Induces and Enhances Vascular Endothelial Growth Factor-A Expression in Lung Cancer Cells

    PubMed Central

    Shimoyamada, Hiroaki; Yazawa, Takuya; Sato, Hanako; Okudela, Koji; Ishii, Jun; Sakaeda, Masashi; Kashiwagi, Korehito; Suzuki, Takehisa; Mitsui, Hideaki; Woo, Tetsukan; Tajiri, Michihiko; Ohmori, Takahiro; Ogura, Takashi; Masuda, Munetaka; Oshiro, Hisashi; Kitamura, Hitoshi

    2010-01-01

    Vascular endothelial growth factor-A (VEGF-A) is crucial for angiogenesis, vascular permeability, and metastasis during tumor development. We demonstrate here that early growth response-1 (EGR-1), which is induced by the extracellular signal–regulated kinase (ERK) pathway activation, activates VEGF-A in lung cancer cells. Increased EGR-1 expression was found in adenocarcinoma cells carrying mutant K-RAS or EGFR genes. Hypoxic culture, siRNA experiment, luciferase assays, chromatin immunoprecipitation, electrophoretic mobility shift assays, and quantitative RT-PCR using EGR-1–inducible lung cancer cells demonstrated that EGR-1 binds to the proximal region of the VEGF-A promoter, activates VEGF-A expression, and enhances hypoxia inducible factor 1α (HIF-1α)-mediated VEGF-A expression. The EGR-1 modulator, NAB-2, was rapidly induced by increased levels of EGR-1. Pathology samples of human lung adenocarcinomas revealed correlations between EGR-1/HIF-1α and VEGF-A expressions and relative elevation of EGR-1 and VEGF-A expression in mutant K-RAS- or EGFR-carrying adenocarcinomas. Both EGR-1 and VEGF-A expression increased as tumors dedifferentiated, whereas HIF-1α expression did not. Although weak correlation was found between EGR-1 and NAB-2 expressions on the whole, NAB-2 expression decreased as tumors dedifferentiated, and inhibition of DNA methyltransferase/histone deacetylase increased NAB-2 expression in lung cancer cells despite no epigenetic alteration in the NAB-2 promoter. These findings suggest that EGR-1 plays important roles on VEGF-A expression in lung cancer cells, and epigenetic silencing of transactivator(s) associated with NAB-2 expression might also contribute to upregulate VEGF-A expression. PMID:20489156

  9. Polydatin inhibits growth of lung cancer cells by inducing apoptosis and causing cell cycle arrest.

    PubMed

    Zhang, Yusong; Zhuang, Zhixiang; Meng, Qinghui; Jiao, Yang; Xu, Jiaying; Fan, Saijun

    2014-01-01

    Polydatin (PD), a small natural compound from Polygonum cuspidatum, has a number of biological functions. However, the anticancer activity of PD has been poorly investigated. In the present study, thiazolyl blue tetrazolium bromide assay was used to evaluate the inhibitory effect of PD on cell growth. Cell cycle distribution and apoptosis were investigated by flow cytometry. In addition, the expression of several proteins associated with apoptosis and cell cycle were analyzed by western blot analysis. The results demonstrated that PD significantly inhibits the proliferation of A549 and NCI-H1975 lung cancer cell lines and causes dose-dependent apoptosis. Cell cycle analysis revealed that PD induces S phase cell cycle arrest. Western blot analysis showed that the expression of Bcl-2 decreased as that of Bax increased, and the expression of cyclin D1 was also suppressed. The results suggest that PD has potential therapeutic applications in the treatment of lung cancer.

  10. Polydatin inhibits growth of lung cancer cells by inducing apoptosis and causing cell cycle arrest

    PubMed Central

    ZHANG, YUSONG; ZHUANG, ZHIXIANG; MENG, QINGHUI; JIAO, YANG; XU, JIAYING; FAN, SAIJUN

    2014-01-01

    Polydatin (PD), a small natural compound from Polygonum cuspidatum, has a number of biological functions. However, the anticancer activity of PD has been poorly investigated. In the present study, thiazolyl blue tetrazolium bromide assay was used to evaluate the inhibitory effect of PD on cell growth. Cell cycle distribution and apoptosis were investigated by flow cytometry. In addition, the expression of several proteins associated with apoptosis and cell cycle were analyzed by western blot analysis. The results demonstrated that PD significantly inhibits the proliferation of A549 and NCI-H1975 lung cancer cell lines and causes dose-dependent apoptosis. Cell cycle analysis revealed that PD induces S phase cell cycle arrest. Western blot analysis showed that the expression of Bcl-2 decreased as that of Bax increased, and the expression of cyclin D1 was also suppressed. The results suggest that PD has potential therapeutic applications in the treatment of lung cancer. PMID:24348867

  11. Bone Morphogenetic Protein Type I Receptor Antagonists Decrease Growth and Induce Cell Death of Lung Cancer Cell Lines

    PubMed Central

    Langenfeld, Elaine; Hong, Charles C.; Lanke, Gandhi; Langenfeld, John

    2013-01-01

    Bone morphogenetic proteins (BMPs) are highly conserved morphogens that are essential for normal development. BMP-2 is highly expressed in the majority of non-small cell lung carcinomas (NSCLC) but not in normal lung tissue or benign lung tumors. The effects of the BMP signaling cascade on the growth and survival of cancer cells is poorly understood. We show that BMP signaling is basally active in lung cancer cell lines, which can be effectively inhibited with selective antagonists of the BMP type I receptors. Lung cancer cell lines express alk2, alk3, and alk6 and inhibition of a single BMP receptor was not sufficient to decrease signaling. Inhibition of more than one type I receptor was required to decrease BMP signaling in lung cancer cell lines. BMP receptor antagonists and silencing of BMP type I receptors with siRNA induced cell death, inhibited cell growth, and caused a significant decrease in the expression of inhibitor of differentiation (Id1, Id2, and Id3) family members, which are known to regulate cell growth and survival in many types of cancers. BMP receptor antagonists also decreased clonogenic cell growth. Knockdown of Id3 significantly decreased cell growth and induced cell death of lung cancer cells. H1299 cells stably overexpressing Id3 were resistant to growth suppression and induction of cell death induced by the BMP antagonist DMH2. These studies suggest that BMP signaling promotes cell growth and survival of lung cancer cells, which is mediated through its regulation of Id family members. Selective antagonists of the BMP type I receptors represents a potential means to pharmacologically treat NSCLC and other carcinomas with an activated BMP signaling cascade. PMID:23593444

  12. Inhibition of Lung Cancer Growth in Mice by Dietary Mixed Tocopherols

    PubMed Central

    Lambert, Joshua D.; Lu, Gang; Lee, Mao-Jung; Hu, Jennifer; Ju, Jihyeung; Yang, Chung S.

    2009-01-01

    Tocopherols are lipophilic antioxidants found in vegetable oils. Here, we examined the growth inhibitory effect of a γ-tocopherol-enriched tocopherol mixture (γTmT) against CL13 murine lung cancer cells grown in culture and as subcutaneous tumors in A/J mice. We found γTmT had no effect after 2 d and weakly inhibited the growth of CL13 in culture after 5 d (28% growth inhibition at 80 µM). Dietary treatment with 0.1% and 0.3% γTmT for 50 d inhibited the growth of CL13 tumors in A/J mice by 53.9 and 80.5%, respectively. Histopathological analysis revealed an increase in tumor necrosis compared to control tumors (80% and 240% increase by 0.1% and 0.3% γTmT, respectively). Dietary treatment with γTmT dose-dependently increased γ- (10.0 – 37.6-fold) and δ-tocopherol (8.9 – 26.7-fold) in the tumors of treated mice compared to controls. Dietary treatment with γTmT also increased plasma γ- (5.4 – 6.7-fold) and δ-tocopherol (5.5 – 7-fold). Whereas others have demonstrated the cancer preventive activity of γTmT against mammary and colon cancer, this is the first report of growth inhibitory activity against lung cancer. Further studies are needed to determine the underlying mechanisms for this anticancer activity, and to determine if such activity occurs in other models of cancer. PMID:19557822

  13. [Effects of pigment epithelial derived factor gene on growth of lung cancer cell and neovascularization: experiments with lung cancer cells and chick embryos].

    PubMed

    Chen, Jin-Feng; Zhao, Wei; Zhang, Jian-Zhi; Jiang, Wen G; Zhang, Li-Jian

    2009-02-24

    To investigate the effect of pigment epithelium derived factor (PEDF) on the growth of lung cancer cells and the cancer-related neovascularization. The full length of human PEDF gene was amplified by polymerase chain reaction (PCR). Human lung cancer cells of the line SKEMS1 were cultured and transfected with PEDF(exp), An eukaryotic expression vector constructed by recombinant DNA technology, so as to construct the SKMES1(PEDFexp) cells over-expressing PEDF protein. RT-PCR and Western blotting were used to confirm the mRNA and protein expression of PEDF in these cells. Another SKMES1 lung cancer cells were transfected with blank plasmids (SKMES1(pEF/His) cells). The SKMES1 cells not transfected were called SKMES1(WT) cells. The 3 kinds of SKMES1 cells were inoculated in the chorio-allantoic membrane (CAM) of chick embryo hatched for 7 days respectively. The size and weigh of the tumor were measured. The vessels density was examined. The tumor volume of the SKMES1(PEDFexp) group was (0.10 +/- 0.05) cm(3), significantly smaller than that of the control group [(0.17 +/- 0.07) cm(3), P = 0.016], and the mass of the SKME(SPEDFexp) group was (0.008 +/- 0.004) mg, significantly smaller than that of the control group too [(0.024 +/- 0.009) mg, P = 0.006]. The amount of first class neo-vessels of the SKMES1(PEDFexp) group was (15 +/- 3), significantly fewer than that of the control group [(41 +/- 9), P < 0.001]. The amount of second class neo-vessels of the SKMES1(PEDFexp) group was (75 +/- 22), also significantly fewer than that of the control group [(175 +/- 39), P = 0.001]. Inhibiting the growth of lung cancer cells and neovascularization, PEDF protein may be used as a potential biological drug to treat lung cancer.

  14. Lentivirus-mediated knockdown of NLK inhibits small-cell lung cancer growth and metastasis

    PubMed Central

    Lv, Mutian; Li, Yaming; Tian, Xin; Dai, Shundong; Sun, Jing; Jin, Guojiang; Jiang, Shenyi

    2016-01-01

    Nemo-like kinase (NLK), an evolutionarily conserved serine/threonine kinase, has been recognized as a critical regulator of various cancers. In this study, we investigated the role of NLK in human small-cell lung cancer (SCLC), which is the most aggressive form of lung cancer. NLK expression was evaluated by quantitative real-time polymerase chain reaction in 20 paired fresh SCLC tissue samples and found to be noticeably elevated in tumor tissues. Lentivirus-mediated RNAi efficiently suppressed NLK expression in NCI-H446 cells, resulting in a significant reduction in cell viability and proliferation in vitro. Moreover, knockdown of NLK led to cell cycle arrest at the S-phase via suppression of Cyclin A, CDK2, and CDC25A, which could contribute to cell growth inhibition. Furthermore, knockdown of NLK decreased the migration of NCI-H446 cells and downregulated matrix metalloproteinase 9. Treatment with NLK short hairpin RNA significantly reduced SCLC tumor growth in vivo. In conclusion, this study suggests that NLK plays an important role in the growth and metastasis of SCLC and may serve as a potential therapeutic target for the treatment of SCLC. PMID:27895463

  15. Growth Suppression of Lung Cancer Cells by Targeting Cyclic AMP Response Element-Binding Protein

    PubMed Central

    Aggarwal, Sita; Kim, Seung-Wook; Ryu, Seung-Hee; Chung, Wen-Cheng; Koo, Ja Seok

    2010-01-01

    Genes regulated by cyclic AMP response element-binding protein (CREB) have been reported to suppress apoptosis, induce cell proliferation, and mediate inflammation and tumor metastasis. However, it is not clear whether CREB is critically involved in the carcinogenesis of lung cancer. We found that non-small cell lung cancer (NSCLC) cell lines exhibited elevated constitutive activity in CREB; in its immediate upstream kinases, ribosomal s6 kinase and extracellular signal kinase; and in the CREB-regulated cell survival proteins, Bcl-2 and Bcl-xL. We hypothesized that constitutively active CREB is important to lung cancer cell growth and survival and therefore could be a potential therapeutic target for NSCLC. Ectopic expression of dominant-repressor CREB and transfection with small interfering RNA against CREB suppressed the growth and survival of NSCLC cells and induced apoptotic cell death. Furthermore, treating H1734 NSCLC cells with an inhibitor of the CREB signaling pathway, Ro-31-8220, inhibited CREB activation by blocking the activity of extracellular signal kinase and ribosomal s6 kinase, arrested the cell cycle at the G2/M phase, and subsequently induced apoptosis with the suppression of Bcl-2 and Bcl-xL expression. Ro-31-8220 suppressed both the anchorage-dependent and the independent growth of NSCLC cells, but its cytotoxic effect was much less prominent in normal bronchial epithelial cells. Our results indicate that active CREB plays an important role in NSCLC cell growth and survival. Thus, agents that suppress CREB activation could have potential therapeutic value for NSCLC treatment. PMID:18281471

  16. Knockdown of Aurora-B inhibits the growth of non-small cell lung cancer A549 cells.

    PubMed

    Yu, Jing Jing; Zhou, Long Dian; Zhao, Tian Tian; Bai, Wei; Zhou, Jing; Zhang, Wei

    2015-09-01

    Elevated expression of Aurora-B affects cell apoptosis and proliferation in a variety of solid tumors. However, the role of Aurora-B has been poorly evaluated in non-small cell lung cancer (NSCLC). In the present study, it was found that Aurora-B was overexpressed in tissue specimens obtained from 174 patients with lung cancer. It was also demonstrated that knockdown of Aurora-B induces apoptosis and inhibits the growth of lung cancer A549 cells in vitro and in vivo. Furthermore, it was found that silencing Aurora-B decreased the activity of the phosphoinositide 3-kinase (PI3K)/AKT pathway. Therefore, it was concluded that knockdown of Aurora-B induces apoptosis and inhibits growth in NSCLC A549 cells, in addition to inhibiting the activity of the PI3K/AKT signaling pathway. Targeting Aurora-B may provide a novel target for lung cancer therapy.

  17. Ceftriaxone, an FDA-approved cephalosporin antibiotic, suppresses lung cancer growth by targeting Aurora B

    PubMed Central

    Li, Xiang; Li, Haitao; Li, Shengqing; Zhu, Feng; Dong, Zigang

    2012-01-01

    Ceftriaxone, an FDA-approved third-generation cephalosporin antibiotic, has antimicrobial activity against both gram-positive and gram-negative organisms. Generally, ceftriaxone is used for a variety of infections such as community-acquired pneumonia, meningitis and gonorrhea. Its primary molecular targets are the penicillin-binding proteins. However, other activities of ceftriaxone remain unknown. Herein, we report for the first time that ceftriaxone has antitumor activity in vitro and in vivo. Kinase profiling results predicted that Aurora B might be a potential ‘off’ target of ceftriaxone. Pull-down assay data confirmed that ceftriaxone could bind with Aurora B in vitro and in A549 cells. Furthermore, ceftriaxone (500 µM) suppressed anchorage-independent cell growth by targeting Aurora B in A549, H520 and H1650 lung cancer cells. Importantly, in vivo xenograft animal model results showed that ceftriaxone effectively suppressed A549 and H520 lung tumor growth by inhibiting Aurora B. These data suggest the anticancer efficacy of ceftriaxone for the treatment of lung cancers through its inhibition of Aurora B. PMID:22962305

  18. Salvianolic acid A positively regulates PTEN protein level and inhibits growth of A549 lung cancer cells

    PubMed Central

    BI, LEI; CHEN, JIANPING; YUAN, XIAOJING; JIANG, ZEQUN; CHEN, WEIPING

    2013-01-01

    Salvianolic acid A (Sal A) is an effective compound extracted from Salvia miltiorrhiza which has been used in the treatment of various diseases. Preliminary data indicate that Sal A treatment has a specific anti-lung cancer effect. However, the manner in which Sal A regulates cancer growth remains unknown. In this study, the A549 lung cancer cell line and its response to Sal A treatment was examined. Results showed that Sal A treatment significantly decreased A549 cell growth, promoted partial apoptosis and increased mitochondrial membrane permeability. Western blot analysis showed that Sal A upregulated the phosphatase and tensin homolog (PTEN) protein level, while consistently downregulating Akt phosphorylation. These results indicate that Sal A negatively mediates A549 lung cancer cell line growth or apoptosis, most likely by positively regulating PTEN protein level. PMID:24648921

  19. Fibroblast Growth Factor Receptor (FGFR): A New Target for Non-small Cell Lung Cancer Therapy.

    PubMed

    Biello, Federica; Burrafato, Giovanni; Rijavec, Erika; Genova, Carlo; Barletta, Giulia; Truini, Anna; Coco, Simona; Bello, Maria Giovanna Dal; Alama, Angela; Boccardo, Francesco; Grossi, Francesco

    2016-01-01

    Lung cancer is still the leading cause of cancer related death worldwide. Fibroblast growth factor receptor (FGFR) is a tirosine-kinase receptor that is seen to be amplified or mutated in non-small cell lung cancer (NSCLC) and it plays a crucial role in tumour development and maintenance. The authors analyzed the state of the art of FGFR by reviewing the current literature. Fibroblast growth factor (FGF)-FGFR pathway and their aberrations are described, with the evaluation of their possible prognostic role in NSCLC and in particular in squamous cell carcinomas, in which FGFR is more often amplified. New therapeutic agents targeting FGFR signaling have been developed and are now in clinical evaluation. Dysregulation of FGF signaling in tumour cells is related to FGFR gene amplification or mutation, although it is still uncertain which of these aberrations represents a real predictor of response to specific inhibitors. However, recent evidence has questioned whether FGFR is a real target in squamous cell histology. The effectiveness of FGFR inhibitors is also still unclear since there are no clinical data on selected patients. Moreover, the management of specific side effects related to inhibition of the physiological role of FGF should be more thorough.

  20. Silymarin suppressed lung cancer growth in mice via inhibiting myeloid-derived suppressor cells.

    PubMed

    Wu, Tiancong; Liu, Wen; Guo, Wenjie; Zhu, Xixu

    2016-07-01

    In this study, we investigated the antitumor activity of Silymarin in a mouse model of colon cancer xenograft of Lewis lung cancer (LLC) cells. Silymarin significantly suppressed tumor growth and induced apoptosis of cells in tumor tissues at a dose of 25 and 50mg/kg. Silymarin treatment enhanced the infiltration and function of CD8(+) T cells. In the meantime, Silymarin decreased the level of IL-10 while elevated the level of IL-2 and IFN-γ in the serum of tumor-bearing mice. Finally, Silymarin reduced the proportion of myeloid-derived suppressor cells (MDSC) in the tumor tissue and also the mRNA expressions of inducible nitric oxide synthases-2 (iNOS2), arginase-1 (Arg-1) and MMP9, which indicated that the function of MDSC in tumor tissues were suppressed. Altogether, our data here showed that Silymarin inhibited the MDSC and promoted the infiltration and function of CD8(+) T cells thus suppressed the growth of LLC xenografts, which provides evidence for the possible use of Silymarin against lung cancer. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  1. Growth suppressive efficacy of human lak cells against human lung-cancer implanted into scid mice.

    PubMed

    Teraoka, S; Kyoizumi, S; Suzuki, T; Yamakido, M; Akiyama, M

    1995-06-01

    The purpose of our study was to determine the efficacy of immunotherapy using human lymphokine activated killer (LAK) cells against a human-lung squamous-cell carcinoma cell line (RERF-LC-AI) implanted into severe combined immunodeficient (SCID) mice. A statistically significant growth suppressive effect on RERF-LC-AI implanted into SCID mice was observed when human LAK cells were administered into the caudal vein of the mice treated with a continuous supply (initiated prior to LAK cells injection) of rIL-2. The human LAK cells stained with PKH 2, a fluorescent dye, for later detection using flow cytometry were administered into the caudal vein of RERF-LC-AI bearing SCID mice; the cells persisted for 7 days in the implanted lung cancer tissue and in the mouse peripheral blood, but for 5 days in the mouse spleen. The number of infiltrated human LAK cells in each tissue increased dose-dependently with the number of injected cells. The results indicate that the antitumor effect most likely occurred during the early implantation period of the human LAK cells. These results demonstrate the applicability of this model to the in vivo study of human lung cancer therapy.

  2. Endophytic fungi from mangrove inhibit lung cancer cell growth and angiogenesis in vitro.

    PubMed

    Liu, Xin; Wu, Xin; Ma, Yuefan; Zhang, Wenzhang; Hu, Liang; Feng, Xiaowei; Li, Xiangyong; Tang, Xudong

    2017-03-01

    The secondary metabolites of mangrove-derived endophytic fungi contain multiple substances with novel structures and biological activities. In the present study, three types of mangrove plants, namely Kandelia candel, Rhizophora stylosa and Rhizophoraceae from Zhanjiang region including the leaves, roots and stems were collected, and endophytic fungi were isolated, purified and identified from these mangrove plants. MTT assay was used to observe the effects of the isolated endophytic fungi on the growth of A549 and NCI-H460 lung cancer cells. The effect of the endophytic fungi on lung cancer angiogenesis in vitro induced by the HPV-16 E7 oncoprotein was observed. Our results showed that 28 strains of endophytic fungi were isolated, purified and identified from the three types of mangrove plants. Ten strains of endophytic fungi significantly suppressed the growth of A549 and NCI-H460 cells. The average inhibitory rates in the A549 cells were 64.4, 59.5, 81.9, 43.9, 58.3, 56.2, 48.3, 42.4, 93.0 and 49.7%, respectively. The average inhibitory rates in the NCI-H460 cells were 41.2, 49.3, 82.7, 40.7, 53.9, 52.6, 56.8, 64.3, 91.0 and 45.6%, respectively. Particularly, three strains of endophytic fungi markedly inhibited HPV-16 E7 oncoprotein‑induced lung cancer angiogenesis in vitro. These findings contribute to the further screening of potential chemotherapeutic agents from mangrove-derived endophytic fungi.

  3. Frondoside A Suppressive Effects on Lung Cancer Survival, Tumor Growth, Angiogenesis, Invasion, and Metastasis

    PubMed Central

    Attoub, Samir; Arafat, Kholoud; Gélaude, An; Al Sultan, Mahmood Ahmed; Bracke, Marc; Collin, Peter; Takahashi, Takashi; Adrian, Thomas E.; De Wever, Olivier

    2013-01-01

    A major challenge for oncologists and pharmacologists is to develop less toxic drugs that will improve the survival of lung cancer patients. Frondoside A is a triterpenoid glycoside isolated from the sea cucumber, Cucumaria frondosa and was shown to be a highly safe compound. We investigated the impact of Frondoside A on survival, migration and invasion in vitro, and on tumor growth, metastasis and angiogenesis in vivo alone and in combination with cisplatin. Frondoside A caused concentration-dependent reduction in viability of LNM35, A549, NCI-H460-Luc2, MDA-MB-435, MCF-7, and HepG2 over 24 hours through a caspase 3/7-dependent cell death pathway. The IC50 concentrations (producing half-maximal inhibition) at 24 h were between 1.7 and 2.5 µM of Frondoside A. In addition, Frondoside A induced a time- and concentration-dependent inhibition of cell migration, invasion and angiogenesis in vitro. Frondoside A (0.01 and 1 mg/kg/day i.p. for 25 days) significantly decreased the growth, the angiogenesis and lymph node metastasis of LNM35 tumor xenografts in athymic mice, without obvious toxic side-effects. Frondoside A (0.1–0.5 µM) also significantly prevented basal and bFGF induced angiogenesis in the CAM angiogenesis assay. Moreover, Frondoside A enhanced the inhibition of lung tumor growth induced by the chemotherapeutic agent cisplatin. These findings identify Frondoside A as a promising novel therapeutic agent for lung cancer. PMID:23308143

  4. AAV-Mediated angiotensin 1-7 overexpression inhibits tumor growth of lung cancer in vitro and in vivo

    PubMed Central

    Mao, Yingying; Wang, Shengyao; Yan, Renhe; Bai, Na; Li, Andrew; Zhang, Yanling; Du, Hongyan; Chen, Baihong; Sumners, Colin; Li, Jinlong; Li, Hongwei

    2017-01-01

    Ang-(1-7) inhibits lung cancer cell growth both in vitro and in vivo. However, the molecular mechanism of action is unclear and also the rapid degradation of Ang-(1-7) in vivo limits its clinical application. Here, we have demonstrated that Ang- (1-7) inhibits lung cancer cell growth by interrupting pre-replicative complex assembly and restrains epithelial-mesenchymal transition via Cdc6 inhibition. Furthermore, we constructed a mutant adeno-associated viral vector AAV8 (Y733F) that produced stable and high efficient Ang-(1-7) expression in a xenograft tumor model. The results show that AAV8-mediated Ang-(1-7) over-expression can remarkably suppress tumor growth in vivo by down-regulating Cdc6 and anti-angiogenesis. Ang-(1-7) over-expression via the AAV8 method may be a promising strategy for lung cancer treatment. PMID:27861149

  5. Biosynthesized Platinum Nanoparticles Inhibit the Proliferation of Human Lung-Cancer Cells in vitro and Delay the Growth of a Human Lung-Tumor Xenograft in vivo

    PubMed Central

    Yogesh, Bendale; Vineeta, Bendale; Rammesh, Natu; Saili, Paul

    2016-01-01

    Objectives: Lung cancer remains a deadly disease with unsatisfactory overall survival. Cisplatin, a standard platinum (Pt)-based chemotherapeutic agent, has the potential to inhibit the growth of lung cancer. Its use, however, is occasionally limited by severe organ toxicity. However, until now, no systematic study has been conducted to verify its efficacy with proper experimental support in vivo. Therefore, we examined whether biosynthesized Pt nanoparticles (NPs) inhibited human lung cancer in vitro and in vivo to validate their use in alternative and complementary medicine. Methods: We evaluated the in vitro and the in vivo anticancer efficiencies of biosynthesized Pt NPs in a subcutaneous xenograft model with A549 cells. Severe combined immune deficient mice (SCID) were divided into four groups: group 1 being the vehicle control group and groups 2, 3 and 4 being the experimental groups. Once the tumor volume had reached 70 ─ 75 mm3, the progression profile of the tumor growth kinetics and the body weights of the mice were measured every week for 6 weeks after oral administration of Pt NPs. Doses of Pt NPs of 500, 1,000 and 2,000 mg/kg of body weight were administered to the experimental groups and a dose of honey was administered to the vehicle control group. The efficacy was quantified by using the delay in tumor growth following the administration of Pt NPs of A549 human-lung-cancer xenografts growing in SCID mice. Results: The in vitro cytotoxicity evaluation indicated that Pt NPs, in a dose-dependent manner, inhibited the growth of A549 cells, and the in vivo evaluation showed that Pt NPs at the mid and high doses effectively inhibited and delayed the growth of lung cancer in SCID mice. Conclusion: These findings confirm the antitumor properties of biosynthesized Pt NPs and suggest that they may be a cost-effective alternative for the treatment of patients with lung cancer. PMID:27386144

  6. Association between thyroid cancer and epidermal growth factor receptor mutation in female with nonsmall cell lung cancer

    PubMed Central

    Kim, Seo Yun; Kim, Hye-Ryoun; Kim, Cheol Hyeon; Koh, Jae Soo; Baek, Hee Jong; Choi, Chang-Min; Song, Joon Seon; Lee, Jae Cheol; Na, Im II

    2017-01-01

    BACKGROUND: The aim of this study was to investigate the association between epidermal growth factor receptor (EGFR) mutation and thyroid cancer in female patients with nonsmall-cell lung cancer (NSCLC). METHODS: In a retrospective study, we examined 835 female patients who were diagnosed with NSCLC and underwent an EGFR mutation test between June 2003 and August 2013. The associations of EGFR mutation with thyroid cancer and a family history of thyroid cancer were evaluated using logistic regression models. RESULTS: EGFR mutation was found in 378 of 835 patients. In addition to adenocarcinoma (P < 0.001), EGFR mutations were positively associated with a personal history of thyroid cancer (5.8% versus 2.6%; P = 0.020), while showing a trend toward inverse association with a personal history of nonthyroid cancer (5.8% vs. 9.0%; P = 0.086). Likewise, the incidence of EGFR mutations was associated with a family history of thyroid cancer (2.9% vs. 0.9%; P = 0.028), while showing a trend toward inverse association with a family history of nonthyroid cancer (27.8% vs. 33.7%; P = 0.066). Multivariate logistic regression showed that the incidence of EGFR mutations was different in women with thyroid or nonthyroid cancer (P = 0.035) and in women with a family history of thyroid or nonthyroid cancer (P = 0.023). CONCLUSIONS: Our data suggest that thyroid cancer and a family history of thyroid cancer are associated with EGFR-mutated NSCLC in female patients. The differences in the incidence of thyroid cancer and a family history of thyroid cancer by EGFR mutational status provide new insight into pathogenesis of this genetic change. PMID:28197220

  7. Radiation Therapy for Lung Cancer

    MedlinePlus

    ... are available to help. HELPFUL WEB SITES ON LUNG CANCER American Lung Association www.lung.org Lungcancer.org www.lungcancer.org Lung Cancer Alliance www.lungcanceralliance.org Lung Cancer Online www. ...

  8. Lung cancer screening update

    PubMed Central

    Dhillon, Samjot Singh; Loewen, Gregory; Jayaprakash, Vijayvel; Reid, Mary E.

    2013-01-01

    Lung cancer is the leading cause of cancer-related mortality globally and the American cancer society estimates approximately 226,160 new cases and 160,340 deaths from lung cancer in the USA in the year 2012. The majority of lung cancers are diagnosed in the later stages which impacts the overall survival. The 5-year survival rate for pathological st age IA lung cancer is 73% but drops to only 13% for stage IV. Thus, early detection through screening and prevention are the keys to reduce the global burden of lung cancer. This article discusses the current state of lung cancer screening, including the results of the National Lung Cancer Screening Trial, the consideration of implementing computed tomography screening, and a brief overview of the role of bronchoscopy in early detection and potential biomarkers that may aid in the early diagnosis of lung cancer. PMID:23599684

  9. Lung cancer prevention.

    PubMed

    Slatore, Christopher; Sockrider, Marianna

    2014-11-15

    Lung cancer is a common form of cancer.There are things you can do to lower your risk of lung cancer. Stop smoking tobacco. Ask your health care provider for help in quitting, including use of medicines to help with nicotine dependence. discuss with your healthcare provider,what you are taking or doing to decrease your risk for lung cancer

  10. Thoc1 inhibits cell growth via induction of cell cycle arrest and apoptosis in lung cancer cells.

    PubMed

    Wan, Jianmei; Zou, Shitao; Hu, Mengshang; Zhu, Ran; Xu, Jiaying; Jiao, Yang; Fan, Saijun

    2014-06-01

    THO complex 1 (Thoc1) is a human nuclear matrix protein that binds to the retinoblastoma tumor suppressor retinoblastoma protein (pRb). While some studies suggest that Thoc1 has characteristics of a tumor suppressor protein, whether Thoc1 can inhibit lung cancer cell growth is not clear. In the present study, we observed that Thoc1 is lowly expressed in the lung cancer cell lines SPC-A1 and NCI-H1975. Then, we investigated the potential effects of Thoc1 on lung cancer cell proliferation, cell cycle and apoptosis after stable transfection of these lines with a Thoc1 expression vector. We found that overexpression of Thoc1 can inhibit cell proliferation, induce G2/M cell cycle arrest and promote apoptosis. Further investigation indicated that overexpression of Thoc1 is involved in the inhibition of cell cycle-related proteins cyclin A1 and B1 and of pro-apoptotic factors Bax and caspase-3. In vivo experiments showed that tumors overexpressing Thoc1 display a slower growth rate than the control xenografts and show reduced expression of the protein Ki-67, which localized on the nuclear membrane. Taken together, our data show that in lung cancer cells, Thoc1 inhibits cell growth through induction of cell cycle arrest and apoptosis. These results indicate that Thoc1 may be used as a novel therapeutic target for human lung cancer treatment.

  11. Epidemiology of Lung Cancer

    PubMed Central

    Brock, Malcolm V.; Ford, Jean G.; Samet, Jonathan M.; Spivack, Simon D.

    2013-01-01

    Background: Ever since a lung cancer epidemic emerged in the mid-1900s, the epidemiology of lung cancer has been intensively investigated to characterize its causes and patterns of occurrence. This report summarizes the key findings of this research. Methods: A detailed literature search provided the basis for a narrative review, identifying and summarizing key reports on population patterns and factors that affect lung cancer risk. Results: Established environmental risk factors for lung cancer include smoking cigarettes and other tobacco products and exposure to secondhand tobacco smoke, occupational lung carcinogens, radiation, and indoor and outdoor air pollution. Cigarette smoking is the predominant cause of lung cancer and the leading worldwide cause of cancer death. Smoking prevalence in developing nations has increased, starting new lung cancer epidemics in these nations. A positive family history and acquired lung disease are examples of host factors that are clinically useful risk indicators. Risk prediction models based on lung cancer risk factors have been developed, but further refinement is needed to provide clinically useful risk stratification. Promising biomarkers of lung cancer risk and early detection have been identified, but none are ready for broad clinical application. Conclusions: Almost all lung cancer deaths are caused by cigarette smoking, underscoring the need for ongoing efforts at tobacco control throughout the world. Further research is needed into the reasons underlying lung cancer disparities, the causes of lung cancer in never smokers, the potential role of HIV in lung carcinogenesis, and the development of biomarkers. PMID:23649439

  12. A novel member of the NF2/ERM/4.1 superfamily with growth suppressing properties in lung cancer.

    PubMed

    Tran, Y K; Bögler, O; Gorse, K M; Wieland, I; Green, M R; Newsham, I F

    1999-01-01

    A novel putative tumor suppressor gene and member of the NF2/ERM/ 4.1 superfamily was isolated using Differential Display PCR (DDPCR) on primary lung tumors. When reintroduced into nonexpressing non-small cell lung carcinoma cell lines, this gene, named DAL-1 (for Differentially expressed in Adenocarcinoma of the Lung), was shown to suppress growth. In addition, significantly reduced expression (>50%) of DAL-1 was measured in 39 primary non-small cell lung carcinoma tumors as compared with patient-matched normal lung tissue. Immunocytochemical staining with a polyclonal anti-DAL-1 antibody localized the protein to the plasma membrane, particularly at cell-cell contact points, a pattern reminiscent of other members of the protein 4.1 superfamily including ezrin and NF2. The data suggest DAL-1 is a novel membrane-associated protein with potential to play an important role in the origin and progression of lung cancer.

  13. Hypodiploidy, Ki-67 growth fraction and prognosis of surgically resected lung cancers.

    PubMed Central

    Pujol, J. L.; Simony, J.; Jolimoy, G.; Jaffuel, D.; Demoly, P.; Quantin, X.; Marty-Ané, C.; Boher, J. M.; Charpentier, R.; Michel, F. B.

    1996-01-01

    One hundred and thirty-seven lung cancer patients (123 non-small-cell lung cancers (NSCLC), 10 small-cell lung cancers (SCLC) and four carcinoid tumours) who underwent surgery in an attempt at complete resection were prospectively entered in a study whose aim was to determine the prognostic significance of a hypodiploidy or a multiploidy pattern of tumour cell DNA content and a high immunohistochemical reactivity of Ki-67, a nuclear antigen related to the cell cycle. Indirect immunoperoxidase reactivity of Ki-67 on frozen tumour tissue sections was evaluated both visually, using a classical semiquantitative scale, and by means of a computer-assisted image processor. Cell DNA content analysis was done using static computer-assisted cytometry on tumour cytological prints stained by the pararosaline Feulgen-Schiff technique. The ploidy was characterised for each tumour by DNA index (DI), percentage of hypodiploid cells and type of DNA content histogram (near diploid, hyperdiploid, hypodiploid and multiploid). Ki-67 immunostaining was negative in 64 tumours (48%) and positive in 69 (52%). DNA histogram classification disclosed 57 (42%) near diploid tumours. Among the 80 (58%) aneuploid tumours, 16 were hypodiploid, 44 hyperdiploid and 20 multiploid. The prevalence of both a positive Ki-67 immunostaining and an aneuploid DNA histogram differed according to histology as SCLC demonstrated a higher frequency of both features when compared with NSCLC and carcinoid tumours. On the other hand, Ki-67 immunostaining and ploidy did not significantly differ according to degree of differentiation, nodal status and Mountain's stage grouping. The percentage of cells in the hypodiploid modal DNA was significantly higher for tumours which demonstrated a high Ki-67 immunostaining, suggesting a link between growth fraction and DNA content abnormalities. In univariate analysis, survival did not differ significantly according to either the Ki-67 immunohistochemical reactivity or the DNA

  14. FOXD3 suppresses tumor growth and angiogenesis in non-small cell lung cancer

    SciTech Connect

    Yan, Jun-Hai; Zhao, Chun-Liu; Ding, Lan-Bao; Zhou, Xi

    2015-10-09

    The transcription factor forkhead box D3 (FOXD3), widely studied as a transcriptional repressor in embryogenesis, participates in the carcinogenesis of many cancers. However, the expression pattern and role of FOXD3 in non-small cell lung cancer (NSCLC) have not been well characterized. We report that FOXD3 is significantly downregulated in NSCLC cell lines and clinical tissues. FOXD3 overexpression significantly inhibits cell growth and results in G1 cell cycle arrest in NSCLC A549 and H1299 cells. In a xenograft tumor model, FOXD3 overexpression inhibits tumor growth and angiogenesis. Remarkably, expression of vascular endothelial growth factor (VEGF) was reduced in FOXD3 overexpression models both in vitro and in vivo. These findings suggest that FOXD3 plays a potential tumor suppressor role in NSCLC progression and represents a promising clinical prognostic marker and therapeutic target for this disease. - Highlights: • FOXD3 is downregulated in NSCLC cell lines and tissues. • FOXD3 overexpression inhibited cell proliferation in NSCLC cells. • FOXD3 overexpression led to decreased angiogenesis in NSCLC cells in vitro and in vivo.

  15. Lung injury and lung cancer caused by cigarette smoke-induced oxidative stress: Molecular mechanisms and therapeutic opportunities involving the ceramide-generating machinery and epidermal growth factor receptor.

    PubMed

    Goldkorn, Tzipora; Filosto, Simone; Chung, Samuel

    2014-11-20

    Chronic obstructive pulmonary disease (COPD) and lung cancer are frequently caused by tobacco smoking. However, these diseases present opposite phenotypes involving redox signaling at the cellular level. While COPD is characterized by excessive airway epithelial cell death and lung injury, lung cancer is caused by uncontrolled epithelial cell proliferation. Notably, epidemiological studies have demonstrated that lung cancer incidence is significantly higher in patients who have preexisting emphysema/lung injury. However, the molecular link and common cell signaling events underlying lung injury diseases and lung cancer are poorly understood. This review focuses on studies of molecular mechanism(s) underlying smoking-related lung injury (COPD) and lung cancer. Specifically, the role of the ceramide-generating machinery during cigarette smoke-induced oxidative stress leading to both apoptosis and proliferation of lung epithelial cells is emphasized. Over recent years, it has been established that ceramide is a sphingolipid playing a major role in lung epithelia structure/function leading to lung injury in chronic pulmonary diseases. However, new and unexpected findings draw attention to its potential role in lung development, cell proliferation, and tumorigenesis. To address this dichotomy in detail, evidence is presented regarding several protein targets, including Src, p38 mitogen-activated protein kinase, and neutral sphingomyelinase 2, the major sphingomyelinase that controls ceramide generation during oxidative stress. Furthermore, their roles are presented not only in apoptosis and lung injury but also in enhancing cell proliferation, lung cancer development, and resistance to epidermal growth factor receptor-targeted therapy for treating lung cancer.

  16. Lung Cancer Biomarkers.

    PubMed

    Villalobos, Pamela; Wistuba, Ignacio I

    2017-02-01

    The molecular characterization of lung cancer has changed the classification and treatment of these tumors, becoming an essential component of pathologic diagnosis and oncologic therapy decisions. Through the recognition of novel biomarkers, such as epidermal growth factor receptor mutations and anaplastic lymphoma kinase translocations, it is possible to identify subsets of patients who benefit from targeted molecular therapies. The success of targeted anticancer therapies and new immunotherapy approaches has created a new paradigm of personalized therapy and has led to accelerated development of new drugs for lung cancer treatment. This article focuses on clinically relevant cancer biomarkers as targets for therapy and potential new targets for drug development. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Petroleum ether extract of Chenopodium album L. prevents cell growth and induces apoptosis of human lung cancer cells

    PubMed Central

    Zhao, Ting; Pan, Hui; Feng, Yang; Li, Haizhou; Zhao, Yang

    2016-01-01

    Chenopodium album L. is a common edible herb distributed in China that has been used as a traditional Chinese medicine for antiviral, antifungal, anti-inflammatory and cancer treatment. However, to the best of our knowledge no previous reports have investigated its the function of its phytochemical extracts in lung cancer cells. The purpose of the present study was to assess the anticancer activities of the phytochemical extracts of C. album L. on human non-small cell lung cancer A549 cells. The present findings demonstrated that the petroleum ether (PE) extract of C. album L. exhibited significant growth inhibitory effects on A549 with an IC50 value of 33.31±2.79 µg/ml. As determined by MTT and colony formation assays, its growth inhibitory effects were dose- and time-dependent. Furthermore, PE extract-treated A549 cells exhibited dose-dependent cell growth arrest at the G1 phase of the cell cycle and cell apoptosis was induced. These results provide useful data on the anticancer activities of C. album L. in human lung cancer and demonstrated the novel possibilities of this plant in developing lung cancer therapies. PMID:27882153

  18. Smoking, green tea consumption, genetic polymorphisms in the insulin-like growth factors and lung cancer risk.

    PubMed

    Lin, I-Hsin; Ho, Ming-Lin; Chen, Hsuan-Yu; Lee, Hong-Shen; Huang, Chia-Chen; Chu, Yin-Hung; Lin, Shiau-Yun; Deng, Ya-Ru; He, Yu-Hao; Lien, Yu-Hui; Hsu, Chi-Wen; Wong, Ruey-Hong

    2012-01-01

    Insulin-like growth factors (IGFs) are mediators of growth hormones; they have an influence on cell proliferation and differentiation. In addition, IGF-binding protein (IGFBP)-3 could suppress the mitogenic action of IGFs. Interestingly, tea polyphenols could substantially reduce IGF1 and increase IGFBP3. In this study, we evaluated the effects of smoking, green tea consumption, as well as IGF1, IGF2, and IGFBP3 polymorphisms, on lung cancer risk. Questionnaires were administered to obtain the subjects' characteristics, including smoking habits and green tea consumption from 170 primary lung cancer cases and 340 healthy controls. Genotypes for IGF1, IGF2, and IGFBP3 were identified by polymerase chain reaction. Lung cancer cases had a higher proportion of smoking, green tea consumption of less than one cup per day, exposure to cooking fumes, and family history of lung cancer than controls. After adjusting the confounding effect, an elevated risk was observed in smokers who never drank green tea, as compared to smokers who drank green tea more than one cup per day (odds ratio (OR) = 13.16, 95% confidence interval (CI) = 2.96-58.51). Interaction between smoking and green tea consumption on lung cancer risk was also observed. Among green tea drinkers who drank more than one cup per day, IGF1 (CA)(19)/(CA)(19) and (CA)(19)/X genotypes carriers had a significantly reduced risk of lung cancer (OR = 0.06, 95% CI = 0.01-0.44) compared with IGF1 X/X carriers. Smoking-induced pulmonary carcinogenesis could be modulated by green tea consumption and their growth factor environment.

  19. Thiazolidinediones enhance vascular endothelial growth factor expression and induce cell growth inhibition in non-small-cell lung cancer cells

    PubMed Central

    2010-01-01

    Background It is known that thiazolidinediones are involved in regulating the expression of various genes, including the vascular endothelial growth factor (VEGF) gene via peroxisome proliferator-activated receptor γ (PPARγ); VEGF is a prognostic biomarker for non-small-cell lung cancer (NSCLC). Methods In this study, we investigated the effects of troglitazone and ciglitazone on the mRNA expression of VEGF and its receptors in human NSCLC cell lines, RERF-LC-AI, SK-MES-1, PC-14, and A549. These mRNA expressions were evaluated by quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) analysis. We also studied the effect of Je-11, a VEGF inhibitor, on the growth of these cells. Results In NSCLC cells, thiazolidinediones increased the mRNA expression of VEGF and neuropilin-1, but not that of other receptors such as fms-like tyrosine kinase and kinase insert domain receptor-1. Furthermore, the PPARγ antagonist GW9662 completely reversed this thiazolidinedione-induced increase in VEGF expression. Furthermore, the addition of VEGF inhibitors into the culture medium resulted in the reversal of thiazolidinedione-induced growth inhibition. Conclusions Our results indicated that thiazolidinediones enhance VEGF and neuropilin-1 expression and induce the inhibition of cell growth. We propose the existence of a pathway for arresting cell growth that involves the interaction of thiazolidinedione-induced VEGF and neuropilin-1 in NSCLC. PMID:20214829

  20. Expression of a TGF-beta1 inducible gene, TSC-36, causes growth inhibition in human lung cancer cell lines.

    PubMed

    Sumitomo, K; Kurisaki, A; Yamakawa, N; Tsuchida, K; Shimizu, E; Sone, S; Sugino, H

    2000-07-03

    TSC-36 (TGF-beta1-stimulated clone 36) is a TGF-beta1 inducible gene whose product is an extracellular glycoprotein that contains a single follistatin module. TSC-36 is highly expressed in the lung, but its physiological function is unknown. In an attempt to elucidate it, we investigated the effect of TSC-36 on proliferation of human lung cancer cell lines. We found a correlation between expression of TSC-36 and cell growth: TSC-36 mRNA was not detected in cells derived from small cell lung cancer (SCLC) cells, a highly aggressive neoplasm, but was detected in some non-small cell lung cancer (NSCLC) cells, a moderately aggressive neoplasm. This suggested an antiproliferative function for TSC-36. To address this question, NSCLC PC-14 cells, which express very low level of TSC-36 protein, were transfected with TSC-36 cDNA and the proliferative capacity of stable transfectants was determined by measuring the doubling time, colony forming activity in soft agar and the level of incorporation of (3)H-thymidine into DNA. Under normal culture conditions, the transfected cells showed a longer doubling time, lower plating efficiency and lower rate of DNA synthesis than the parental cells and the control neo transfectant cells. These findings suggested that expression of TSC-36 caused growth inhibition in human lung cancer cells.

  1. Third-Generation Tyrosine Kinase Inhibitors Targeting Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer.

    PubMed

    Barnes, Tristan A; O'Kane, Grainne M; Vincent, Mark David; Leighl, Natasha B

    2017-01-01

    Sensitizing mutations in the epidermal growth factor receptor (EGFR) predict response to EGFR tyrosine kinase inhibitors (TKIs) and both first- and second-generation TKIs are available as first-line treatment options in patients with advanced EGFR-mutant non-small cell lung cancer. Eventual resistance develops with multiple mechanisms identifiable both upon repeat biopsy and in plasma circulating tumor DNA. The T790M gatekeeper mutation is responsible for almost 60% of cases. A number of third-generation TKIs are in clinical development, and osimertinib has been approved by the US Food and Drug Administration for the treatment of patients with EGFR T790M mutant lung cancer after failure of initial EGFR kinase therapy. Resistance mechanisms are being identified to these novel agents, and the treatment landscape of EGFR-mutant lung cancer continues to evolve. The sequence of EGFR TKIs may change in the future and combination therapies targeting resistance appear highly promising.

  2. Celecoxib-erlotinib combination delays growth and inhibits angiogenesis in EGFR-mutated lung cancer

    PubMed Central

    Li, Yi Xiao; Wang, Jia Le; Gao, Meng; Tang, Hao; Gui, Rong; Fu, Yun Feng

    2016-01-01

    Combination treatment for non-small cell lung cancer (NSCLC) is becoming more popular due to the anticipation that it may be more effective than single drug treatment. In addition, there are efforts to genetically screen patients for specific mutations in light of attempting to administer specific anticancer agents that are most effective. In this study, we evaluate the anticancer and anti-angiogenic effects of low dose celecoxib-erlotinib combination in NSCLC in vitro and in vivo. In NSCLC cells harboring epidermal growth factor receptor (EGFR) mutations, combination celecoxib-erlotinib treatment led to synergistic cell death, but there was minimal efficacy in NSCLC cells with wild-type EGFR. In xenograft models, combination treatment also demonstrated greater inhibition of tumor growth compared to individual treatment. The anti-tumor effect observed was secondary to the targeting of angiogenesis, evidenced by decreased vascular endothelial growth factor A (VEGFA) levels and decreased levels of CD31 and microvessel density. Combination treatment targets angiogenesis through the modulation of of the PI3K/AKT and ERK/Raf1-1 pathway in NSCLC with EGFR exon 19 deletions. These findings may have significant clinical implications in patients with tumors harboring EGFR exon 19 deletions as they may be particularly sensitive to this regimen. PMID:27508092

  3. [Lung cancer screening].

    PubMed

    Sánchez González, M

    2014-01-01

    Lung cancer is a very important disease, curable in early stages. There have been trials trying to show the utility of chest x-ray or computed tomography in Lung Cancer Screening for decades. In 2011, National Lung Screening Trial results were published, showing a 20% reduction in lung cancer mortality in patients with low dose computed tomography screened for three years. These results are very promising and several scientific societies have included lung cancer screening in their guidelines. Nevertheless we have to be aware of lung cancer screening risks, such as: overdiagnosis, radiation and false positive results. Moreover, there are many issues to be solved, including choosing the appropriate group to be screened, the duration of the screening program, intervals between screening and its cost-effectiveness. Ongoing trials will probably answer some of these questions. This article reviews the current evidence on lung cancer screening.

  4. 1-o-acetylbritannilactone (ABL) inhibits angiogenesis and lung cancer cell growth through regulating VEGF-Src-FAK signaling

    SciTech Connect

    Zhengfu, He; Hu, Zhang; Huiwen, Miao; Zhijun, Li; Jiaojie, Zhou; Xiaoyi, Yan; Xiujun, Cai

    2015-08-21

    The search for safe, effective and affordable therapeutics against non-small cell lung cancer (NSCLC) and other lung cancers is important. Here we explored the potential effect of 1-o-acetylbritannilactone (ABL), a novel extract from Inula britannica-F, on angiogenesis and lung cancer cell growth. We demonstrated that ABL dose-dependently inhibited vascular endothelial growth factor (VEGF)-induced proliferation, migration, and capillary structure formation of cultured human umbilical vascular endothelial cells (HUVECs). In vivo, ABL administration suppressed VEGF-induced new vasculature formation in Matrigel plugs. For the mechanism investigations, we found that ABL largely inhibited VEGF-mediated activation of Src kinase and focal adhesion kinase (FAK) in HUVECs. Furthermore, treatment of A549 NSCLC cells with ABL resulted in cell growth inhibition and Src-FAK in-activation. Significantly, administration of a single dose of ABL (12 mg/kg/day) remarkably suppressed growth of A549 xenografts in nude mice. In vivo microvessels formation and Src activation were also significantly inhibited in ABL-treated xenograft tumors. Taken together, our findings suggest that ABL suppresses angiogenesis and lung cancer cell growth possibly via regulating the VEGFR-Src-FAK signaling. - Highlights: • 1-o-acetylbritannilactone (ABL) inhibits VEGF-induced angiogenesis in vivo. • ABL inhibits VEGF-induced HUVEC migration, proliferation, capillary tube formation. • ABL inhibits VEGF-mediated activation of Src and FAK in HUVECs. • ABL inhibits growth and Src-FAK activation in A549 cells. • ABL administration inhibits A549 tumor angiogenesis and growth in nude mice.

  5. Immune-Modulation by Epidermal Growth Factor Receptor Inhibitors: Implication on Anti-Tumor Immunity in Lung Cancer

    PubMed Central

    Herrmann, Amanda C.; Bernatchez, Chantale; Haymaker, Cara; Molldrem, Jeffrey J.; Hong, Waun Ki; Perez-Soler, Roman

    2016-01-01

    Skin toxicity is the most common toxicity caused by Epidermal Growth Factor Receptor (EGFR) inhibitors, and has been associated with clinical efficacy. As EGFR inhibitors enhance the expression of antigen presenting molecules in affected skin keratinocytes, they may concurrently facilitate neo-antigen presentation in lung cancer tumor cells contributing to anti-tumor immunity. Here, we investigated the modulatory effect of the EGFR inhibitor, erlotinib on antigen presenting molecules and PD-L1, prominent immune checkpoint protein, of skin keratinocytes and lung cancer cell lines to delineate the link between EGFR signaling pathway inhibition and potential anti-tumor immunity. Erlotinib up-regulated MHC-I and MHC-II proteins on IFNγ treated keratinocytes but abrogated IFNγ-induced expression of PD-L1, suggesting the potential role of infiltrating autoreactive T cells in the damage of keratinocytes in affected skin. Interestingly, the surface expression of MHC-I, MHC-II, and PD-L1 was up-regulated in response to IFNγ more often in lung cancer cell lines sensitive to erlotinib, but only expression of PD-L1 was inhibited by erlotinib. Further, erlotinib significantly increased T cell mediated cytotoxicity on lung cancer cells. Lastly, the analysis of gene expression dataset of 186 lung cancer cell lines from Cancer Cell Line Encyclopedia demonstrated that overexpression of PD-L1 was associated with sensitivity to erlotinib and higher expression of genes related to antigen presenting pathways and IFNγ signaling pathway. Our findings suggest that the EGFR inhibitors can facilitate anti-tumor adaptive immune responses by breaking tolerance especially in EGFR driven lung cancer that are associated with overexpression of PD-L1 and genes related to antigen presentation and inflammation. PMID:27467256

  6. Immune-Modulation by Epidermal Growth Factor Receptor Inhibitors: Implication on Anti-Tumor Immunity in Lung Cancer.

    PubMed

    Im, Jin S; Herrmann, Amanda C; Bernatchez, Chantale; Haymaker, Cara; Molldrem, Jeffrey J; Hong, Waun Ki; Perez-Soler, Roman

    2016-01-01

    Skin toxicity is the most common toxicity caused by Epidermal Growth Factor Receptor (EGFR) inhibitors, and has been associated with clinical efficacy. As EGFR inhibitors enhance the expression of antigen presenting molecules in affected skin keratinocytes, they may concurrently facilitate neo-antigen presentation in lung cancer tumor cells contributing to anti-tumor immunity. Here, we investigated the modulatory effect of the EGFR inhibitor, erlotinib on antigen presenting molecules and PD-L1, prominent immune checkpoint protein, of skin keratinocytes and lung cancer cell lines to delineate the link between EGFR signaling pathway inhibition and potential anti-tumor immunity. Erlotinib up-regulated MHC-I and MHC-II proteins on IFNγ treated keratinocytes but abrogated IFNγ-induced expression of PD-L1, suggesting the potential role of infiltrating autoreactive T cells in the damage of keratinocytes in affected skin. Interestingly, the surface expression of MHC-I, MHC-II, and PD-L1 was up-regulated in response to IFNγ more often in lung cancer cell lines sensitive to erlotinib, but only expression of PD-L1 was inhibited by erlotinib. Further, erlotinib significantly increased T cell mediated cytotoxicity on lung cancer cells. Lastly, the analysis of gene expression dataset of 186 lung cancer cell lines from Cancer Cell Line Encyclopedia demonstrated that overexpression of PD-L1 was associated with sensitivity to erlotinib and higher expression of genes related to antigen presenting pathways and IFNγ signaling pathway. Our findings suggest that the EGFR inhibitors can facilitate anti-tumor adaptive immune responses by breaking tolerance especially in EGFR driven lung cancer that are associated with overexpression of PD-L1 and genes related to antigen presentation and inflammation.

  7. Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-Small Cell Lung Cancer.

    PubMed

    Hammerman, Peter S; Jänne, Pasi A; Johnson, Bruce E

    2009-12-15

    Gefitinib and erlotinib are ATP competitive inhibitors of the epidermal growth factor receptor (EGFR) tyrosine kinase and are approved around the world for the treatment of patients with non-small cell lung cancer (NSCLC). Somatic mutations in the EGFR are found in 10 to 40% of patients with NSCLC. Patients with sensitizing somatic mutations of EGFR treated with gefitinib or erlotinib have an initial clinical response of 60 to 80%, approximately twice as high as the responses associated with the administration of conventional platinum-based chemotherapy. However, the efficacy of EGFR tyrosine kinase inhibitors (TKI) is limited by either primary (de novo) or acquired resistance after therapy and investigations to define the mechanisms of resistance are active areas of ongoing preclinical and clinical studies. Primary resistance is typically caused by other somatic mutations in genes such as KRAS, which also have an impact on the EGFR signaling pathway or by mutations in the EGFR gene that are not associated with sensitivity to EGFR-TKIs. Two established mechanisms of acquired resistance are caused by additional mutations in the EGFR gene acquired during the course of treatment that change the protein-coding sequence or by amplification of another oncogene signaling pathway driven by the MET oncogene. This review focuses on characterized mechanisms of resistance to the EGFR TKIs and efforts to overcome the problem of resistance aimed at improving the therapy of patients with NSCLC. (Clin Cancer Res 2009;15(24):7502-9).

  8. Exome sequencing deciphers a germline MET mutation in familial epidermal growth factor receptor-mutant lung cancer.

    PubMed

    Tode, Naoki; Kikuchi, Toshiaki; Sakakibara, Tomohiro; Hirano, Taizou; Inoue, Akira; Ohkouchi, Shinya; Tamada, Tsutomu; Okazaki, Tatsuma; Koarai, Akira; Sugiura, Hisatoshi; Niihori, Tetsuya; Aoki, Yoko; Nakayama, Keiko; Matsumoto, Kunio; Matsubara, Yoichi; Yamamoto, Masayuki; Watanabe, Akira; Nukiwa, Toshihiro; Ichinose, Masakazu

    2017-03-13

    Lung cancer accompanied by somatic activating mutations in the epidermal growth factor receptor (EGFR) gene, which is associated with a significant clinical response to the targeted therapy, is frequently found in never-smoking Asian women with adenocarcinoma. Although this implies genetic factors underlying the carcinogenesis, the etiology remains unclear. To gain insight into the pathogenic mechanisms, we sequenced the exomes in the peripheral-blood DNA from six siblings, four affected and two unaffected siblings, of a kindred with familial EGFR-mutant lung adenocarcinoma. We identified a heterozygous missense mutation in MET proto-oncogene, p.Asn375Lys, in all four affected siblings. Combined with somatic loss of heterozygosity for MET, the higher allele frequency in a Japanese sequencing database supports a causative role of the MET mutation in EGFR-mutant lung cancer. Functional assays showed that the mutation reduces the binding affinity of MET for its ligand, hepatocyte growth factor, and damages the subsequent cellular processes including proliferation, clonogenicity, motility, and tumorigenicity. The MET mutation was further observed to abrogate the ERBB3-mediated AKT signal transduction, which is shared downstream by EGFR. These findings provide an etiological view that the MET mutation is involved in the pathogenesis of EGFR-mutant lung cancer because it generates oncogenic stress that induces compensatory EGFR activation. The identification of MET in a kindred with familial EGFR-mutant lung cancer is insightful to explore the pathogenic mechanism of not only familial, but also sporadic EGFR-mutant lung cancer by underscoring MET-related signaling molecules. This article is protected by copyright. All rights reserved.

  9. Synergistic inhibition of lung cancer cell invasion, tumor growth and angiogenesis using aptamer-siRNA chimeras.

    PubMed

    Lai, Wei-Yun; Wang, Wei-Ya; Chang, Yi-Chung; Chang, Cheng-Ju; Yang, Pan-Chyr; Peck, Konan

    2014-03-01

    Early metastasis is one of the major causes of mortality among patient with lung cancer. The process of tumor metastasis involves a cascade of events, including epithelial-mesenchymal transition, tumor cell migration and invasion, and angiogenesis. To specifically suppress tumor invasion and angiogenesis, two nucleolin aptamer-siRNA chimeras (aptNCL-SLUGsiR and aptNCL-NRP1siR) were used to block key signaling pathways involved in lung cancer metastasis that are pivotal to metastatic tumor cells but not to normal cells under ordinary physiologic conditions. Through nucleolin-mediated endocytosis, the aptNCL-siRNA chimeras specifically and significantly knocked down the expressions of SLUG and NRP1 in nucleolin-expressing cancer cells. Furthermore, simultaneous suppression of SLUG and NRP1 expressions by the chimeras synergistically retarded cancer cell motility and invasive ability. The synergistic effect was also observed in a xenograft mouse model, wherein the combined treatment using two chimeras suppressed tumor growth, the invasiveness, circulating tumor cell amount, and angiogenesis in tumor tissue without affecting liver and kidney functions. This study demonstrates that combined treatment of aptNCL-SLUGsiR and aptNCL-NRP1siR can synergistically suppress lung cancer cell invasion, tumor growth and angiogenesis by cancer-specific targeting combined with gene-specific silencing. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Characterization of fibroblast growth factor receptor 1 in small-cell lung cancer.

    PubMed

    Thomas, Anish; Lee, Jih-Hsiang; Abdullaev, Zied; Park, Kang-Seo; Pineda, Marbin; Saidkhodjaeva, Lola; Miettinen, Markku; Wang, Yisong; Pack, Svetlana D; Giaccone, Giuseppe

    2014-04-01

    There remains a significant therapeutic need for small-cell lung cancer (SCLC). We and others have reported high frequency of copy number gains in cytogenetic bands encoding fibroblast growth factor receptor 1 (FGFR1) in SCLC tumors and cell lines. Thirteen SCLC cell lines and 68 SCLC patient tumor samples were studied for FGFR1 amplification. Growth inhibition assays were performed using PD173074, a pan-FGFR inhibitor to determine the correlation between FGFR1 expression and drug sensitivity. We did not detect FGFR1 mutations in SCLC cell lines. Focal amplification of FGFR1 gene was found in five tumor samples (7%), with high-level focal amplification in only one tumor sample (1%). Amplification owing to polysomy of chromosome 8, where FGFR1 locates, was observed in 22 tumor samples (32%). There was no correlation between FGFR1 gene copy number and messenger RNA expression or protein expression in SCLC cells. FGFR inhibitor sensitivity correlated with FGFR1 copy number determined by real-time polymerase chain reaction assay (r= -0.79; p = 0.01). FGFR1 gene mutations and focal amplification are rare in SCLC, but polysomy of chromosome 8 is relatively common. FGFR1 copy number gain predicts sensitivity to FGFR inhibition, and FGFR expression correlates inversely with chemosensitivity.

  11. Combining chemotherapy with epidermal growth factor receptor inhibition in advanced non-small cell lung cancer

    PubMed Central

    Leung, Linda; Loong, Herbert

    2012-01-01

    Treatment of advanced stage lung cancer is changing rapidly. With the new found knowledge on molecular targets such as the epidermal growth factor receptor (EGFR), effective therapy is now available in a selected population with the target mutation. Single-agent epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI) is a standard first-line therapy for patients with activating-EGFR mutation such as base-pair deletion in exon 19 or point mutation at exon 21. At the same time, this class of drugs may be combined with chemotherapy. Studies on the concurrent combination of chemotherapy and EGFR-TKI confirmed a lack of efficacy. A phase II study on sequential intercalated combination has demonstrated an improvement in progression-free survival (PFS), but this needs to be validated by the ongoing phase III study. The third approach is to combine EGFR-TKI as maintenance therapy after tumour response or stable disease to cytotoxic chemotherapy. Two phase III studies have shown improvement in PFS, but the use of biomarkers for the selection of maintenance therapy remains debatable. Cetuximab is a monoclonal antibody against EGFR and its combination with chemotherapy was shown to improve overall survival in an unselected population. A new biomarker using the H-score will help to select patients for this combination. PMID:22754591

  12. Aerosolised 5-azacytidine suppresses tumour growth and reprogrammes the epigenome in an orthotopic lung cancer model

    PubMed Central

    Reed, M D; Tellez, C S; Grimes, M J; Picchi, M A; Tessema, M; Cheng, Y S; March, T H; Kuehl, P J; Belinsky, S A

    2013-01-01

    Background: Epigenetic silencing by promoter methylation and chromatin remodelling affects hundreds of genes and is a causal event for lung cancer. Treatment of patients with low doses of the demethylating agent 5-azacytidine in combination with the histone deacetylase inhibitor entinostat has yielded clinical responses. The subcutaneous dosing route for consecutive days and reduced bioavailability of 5-azacytidine because of inactivation by cytidine deaminase may limit the expansion of epigenetic therapy into Phase III trials. To mitigate these barriers, an aerosol of 5-azacytidine was generated and characterised. Methods: The effect of aerosol vs systemic delivery of 5-azacytidine on tumour burden and molecular response of engrafted lung tumours in the nude rat was compared. Results: Pharmacokinetics revealed major improvement in the half-life of 5-azacytidine in lung tissue with aerosol delivery. Aerosolised 5-azacytidine significantly reduced lung tumour burden and induced global demethylation of the epigenome at one-third of the comparable effective systemic dose. High commonality for demethylation of genes was seen in tumours sampled throughout lung lobes and across treated animals receiving the aerosolised drug. Conclusion: Collectively, these findings show that aerosolised 5-azacytidine targets the lung, effectively reprogrammes the epigenome of tumours, and is a promising approach to combine with other drugs for treating lung cancer. PMID:24045660

  13. Molecular Determinants of AHPN (CD437)-Induced Growth Arrest and Apoptosis in Human Lung Cancer Cell Lines

    PubMed Central

    Li, Yin; Lin, Bingzhen; Agadir, Anissa; Liu, Ru; Dawson, Marcia I.; Reed, John C.; Fontana, Joseph A.; Bost, Frédéric; Hobbs, Peter D.; Zheng, Yun; Chen, Guo-quan; Shroot, Braham; Mercola, Dan; Zhang, Xiao-kun

    1998-01-01

    6-[3-(1-Adamantyl)-4-hydroxyphenyl]-2-naphthalene carboxylic acid (AHPN or CD437), originally identified as a retinoic acid receptor γ-selective retinoid, was previously shown to induce growth inhibition and apoptosis in human breast cancer cells. In this study, we investigated the role of AHPN/CD437 and its mechanism of action in human lung cancer cell lines. Our results demonstrated that AHPN/CD437 effectively inhibited lung cancer cell growth by inducing G0/G1 arrest and apoptosis, a process that is accompanied by rapid induction of c-Jun, nur77, and p21WAF1/CIP1. In addition, we found that expression of p53 and Bcl-2 was differentially regulated by AHPN/CD437 in different lung cancer cell lines and may play a role in regulating AHPN/CD437-induced apoptotic process. On constitutive expression of the c-JunAla(63,73) protein, a dominant-negative inhibitor of c-Jun, in A549 cells, nur77 expression and apoptosis induction by AHPN/CD437 were impaired, whereas p21WAF1/CIP1 induction and G0/G1 arrest were not affected. Furthermore, overexpression of antisense nur77 RNA in A549 and H460 lung cancer cell lines largely inhibited AHPN/CD437-induced apoptosis. Thus, expression of c-Jun and nur77 plays a critical role in AHPN/CD437-induced apoptosis. Together, our results reveal a novel pathway for retinoid-induced apoptosis and suggest that AHPN/CD437 or analogs may have a better therapeutic efficacy against lung cancer. PMID:9671482

  14. Lung Cancer Indicators Recurrence

    Cancer.gov

    This study describes prognostic factors for lung cancer spread and recurrence, as well as subsequent risk of death from the disease. The investigators observed that regardless of cancer stage, grade, or type of lung cancer, patients in the study were more

  15. Monocyte to macrophage differentiation-associated (MMD) targeted by miR-140-5p regulates tumor growth in non-small cell lung cancer

    SciTech Connect

    Li, Weina; He, Fei

    2014-07-18

    Highlights: • Expression of MMD is increased in lung cancer tissues. • Knockdown of MMD inhibits growth of A549 and LLC cells in vitro and in vivo. • MMD is a direct functional target of miR-140-5p. • MiR-140-5p/MMD axis regulates Erk1/2 signaling. - Abstract: Monocyte to macrophage differentiation-associated (MMD) is identified in macrophages as a gene associated with the differentiation from monocytes to macrophages. Recent microarray analysis for non-small cell lung cancer (NSCLC) suggests that MMD is an important signature associated with relapse and survival among patients with NSCLC. Therefore, we speculate that MMD likely plays a role in lung cancer. In this study, we found that the protein level of MMD was increased in lung cancer compared to benign lung tissues, and knockdown of MMD inhibited the growth of A549 and Lewis lung cancer cells (LLC) in vitro and in vivo. Integrated analysis demonstrated that MMD was a direct functional target of miR-140-5p. Furthermore, we found that miR-140-5p/MMD axis could affect the cell proliferation of lung cancer cells by regulating Erk signaling. Together, our results highlight the significance of miR-140-5p/MMD axis in lung cancer, and miR-140-5p/MMD axis could serve as new molecular targets for the therapy against lung cancer.

  16. Transforming Growth Factor-β-Induced RBFOX3 Inhibition Promotes Epithelial-Mesenchymal Transition of Lung Cancer Cells

    PubMed Central

    Kim, Yong-Eun; Kim, Jong Ok; Park, Ki-Sun; Won, Minho; Kim, Kyoon Eon; Kim, Kee K.

    2016-01-01

    The RNA-binding protein Rbfox3 is a well-known splicing regulator that is used as a marker for post-mitotic neurons in various vertebrate species. Although recent studies indicate a variable expression of Rbfox3 in non-neuronal tissues, including lung tissue, its cellular function in lung cancer remains largely unknown. Here, we report that the number of RBFOX3-positive cells in tumorous lung tissue is lower than that in normal lung tissue. As the transforming growth factor-β (TGF-β) signaling pathway is important in cancer progression, we investigated its role in RBFOX3 expression in A549 lung adenocarcinoma cells. TGF-β1 treatment inhibited RBFOX3 expression at the transcriptional level. Further, RBFOX3 depletion led to a change in the expression levels of a subset of proteins related to epithelial-mesenchymal transition (EMT), such as E-cadherin and Claudin-1, during TGF-β1-induced EMT. In immunofluorescence microscopic analysis, mesenchymal morphology was more prominent in RBFOX3-depleted cells than in control cells. These findings show that TGF-β-induced RBFOX3 inhibition plays an important role in EMT and propose a novel role for RBFOX3 in cancer progression. PMID:27432190

  17. Immunotherapy for lung cancer.

    PubMed

    Steven, Antonius; Fisher, Scott A; Robinson, Bruce W

    2016-07-01

    Treatment of lung cancer remains a challenge, and lung cancer is still the leading cause of cancer-related mortality. Immunotherapy has previously failed in lung cancer but has recently emerged as a very effective new therapy, and there is now growing worldwide enthusiasm in cancer immunotherapy. We summarize why immune checkpoint blockade therapies have generated efficacious and durable responses in clinical trials and why this has reignited interest in this field. Cancer vaccines have also been explored in the past with marginal success. Identification of optimal candidate neoantigens may improve cancer vaccine efficacy and may pave the way to personalized immunotherapy, alone or in combination with other immunotherapy such as immune checkpoint blockade. Understanding the steps in immune recognition and eradication of cancer cells is vital to understanding why previous immunotherapies failed and how current therapies can be used optimally. We hold an optimistic view for the future prospect in lung cancer immunotherapy.

  18. Genetics Home Reference: lung cancer

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions lung cancer lung cancer Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Lung cancer is a disease in which certain cells ...

  19. Lung cancer in women

    PubMed Central

    Barrera-Rodriguez, Raúl; Morales-Fuentes, Jorge

    2012-01-01

    Recent biological advances in tumor research provide clear evidence that lung cancer in females is different from that in males. These differences appear to have a direct impact on the clinical presentation, histology, and outcomes of lung cancer. Women are more likely to present with lung adenocarcinoma, tend to receive a diagnosis at an earlier age, and are more likely to be diagnosed with localized disease. Women may also be more predisposed to molecular aberrations resulting from the carcinogenic effects of tobacco, but do not appear to be more susceptible than men to developing lung cancer. The gender differences found in female lung cancer make it mandatory that gender stratification is used in clinical trials in order to improve the survival rates of patients with lung cancer. PMID:28210127

  20. Splenectomy inhibits non-small cell lung cancer growth by modulating anti-tumor adaptive and innate immune response.

    PubMed

    Levy, Liran; Mishalian, Inbal; Bayuch, Rachel; Zolotarov, Lida; Michaeli, Janna; Fridlender, Zvi G

    2015-04-01

    It has been shown that inhibitors of the immune system reside in the spleen and inhibit the endogenous antitumor effects of the immune system. We hypothesized that splenectomy would inhibit the growth of relatively large non-small lung cancer (NSCLC) tumors by modulating the systemic inhibition of the immune system, and in particular Myeloid Derived Suppressor Cells (MDSC). The effect of splenectomy was evaluated in several murine lung cancer models. We found that splenectomy reduces tumor growth and the development of lung metastases, but only in advanced tumors. In immune-deficient NOD-SCID mice the effect of splenectomy on tumor growth and metastatic spread disappeared. Splenectomy significantly reduced the presence of MDSC, and especially monocytic-MDSC in the circulation and inside the tumor. Specific reduction of the CCR2+ subset of monocytic MDSC was demonstrated, and the importance of the CCL2-CCR2 axis was further shown by a marked reduction in CCL2 following splenectomy. These changes were followed by changes in the macrophages contents of the tumors to become more antitumorigenic, and by increased activation of CD8(+) Cytotoxic T-cells (CTL). By MDSC depletion, and adoptive transfer of MDSCs, we demonstrated that the effect of splenectomy on tumor growth was substantially mediated by MDSC cells. We conclude that the spleen is an important contributor to tumor growth and metastases, and that splenectomy can blunt this effect by depletion of MDSC, changing the amount and characteristics of myeloid cells and enhancing activation of CTL.

  1. miR-1207-5p suppresses lung cancer growth and metastasis by targeting CSF1

    PubMed Central

    Fan, Songqing; Wen, Qiuyuan; Lu, Yuanjun; Wang, Jia; Zhang, Xuemei; Wei, Lingyu; He, Wei; Ye, Qiurong; Yan, Qun; Li, Guiyuan; Ma, Jian

    2016-01-01

    We previously reported that miR-1207-5p can inhibit epithelial-mesenchymal transition (EMT) induced by growth factors such as EGF and TGF-β, but the exact mechanism is unclear. Here we identified that Colony stimulating factor 1 (CSF1) is a target gene of miR-1207-5p. CSF1 controls the production, differentiation and function of macrophage and promotes the release of proinflammatory chemokines. We showed that miR-1207-5p inhibited lung cancer cell A549 proliferation, migration and invasion in vitro, and suppressed the STAT3 and AKT signalings. miR-1207-5p overexpression can increase HUVEC angiogenesis, and can modulate the M2 phenotype of macrophage. miR-1207-5p also significantly inhibited A549 cells metastasis in a nude mouse xenograft model. miR-1207-5p and CSF1 expression levels and their relationship with lung cancer survival and metastasis status were assayed by means of a lung cancer tissue microarray. Macrophage is an essential part of the tumor microenvironment, thus the miR-1207-5p-CSF1 axis maybe a new regulator of lung cancer development through modulating the tumor microenvironment. PMID:27107415

  2. Genetic profiling and epidermal growth factor receptor-directed therapy in nonsmall cell lung cancer.

    PubMed

    Cadranel, J; Zalcman, G; Sequist, L

    2011-01-01

    The principle of preferentially selecting patients most likely to benefit from therapy according to their genetic profile has led to substantial clinical benefit in some tumour types, and has potential to considerably refine treatment in advanced nonsmall cell lung cancer (NSCLC). Effective, reliable use of molecular biomarkers to inform clinical practice requires the standardisation of testing methods and careful assessment of biomarkers' predictive and prognostic value. Although a number of studies have shown that patients with activating mutations in exons 18-21 of the epidermal growth factor receptor (EGFR) gene respond particularly well to gefitinib and erlotinib, a prospective, randomised study was needed to differentiate between the prognostic and predictive value of EGFR mutations. From one such study, it appeared that mutational testing should become standard at diagnosis, at least for adenocarcinoma patients with a never or low smoking history, as clinical predictors are insufficient to optimise treatment. However, outstanding questions remain: what are the treatment options for patients with tumours resistant to erlotinib/gefitinib? What conclusions about treatment can we draw from EGFR copy number or KRAS mutation status? What role should anti-EGFR antibodies play in NSCLC treatment, and in which patients? This review considers current evidence linking biomarker profile to efficacy of EGFR-targeted therapy in NSCLC, and clinical implications of recent findings.

  3. Addressing epidermal growth factor receptor tyrosine kinase inhibitor resistance in non-small cell lung cancer.

    PubMed

    Noda, Shoko; Kanda, Shintaro

    2016-01-01

    Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) have significantly improved the survival of patients with advanced non-small cell lung cancer (NSCLC) harboring EGFR activating mutations. However, nearly all EGFR-mutant NSCLC tumors eventually acquire resistance to the currently used EGFR-TKIs and subsequently progress clinically. Acquired resistance to EGFR-TKIs is thus a huge issue in the treatment of EGFR-mutant NSCLC at present. On one hand, T790M second-site mutation has been recognized as a key mechanism of EGFR-TKI resistance, and third generation EGFR-TKIs such as osimertinib and rociletinib have been developed to overcome tumor cells harboring the T790M mutation. On the other hand, combination with cytotoxic chemotherapy is also expected as another strategy for preventing the acquired resistance to current EGFR-TKIs and prolonging the survival benefits by EGFR-TKIs. Here, we review updated strategies for preventing or overcoming acquired resistance to EGFR-TKIs.

  4. Third-generation epidermal growth factor receptor tyrosine kinase inhibitors in advanced nonsmall cell lung cancer.

    PubMed

    Pirker, Robert

    2016-03-01

    Patients with epidermal growth factor receptor (EGFR) mutation-positive nonsmall cell lung cancer (NSCLC) develop resistance during therapy with EGFR tyrosine kinase inhibitors (TKIs). In about half of the patients, this resistance is because of the emergence of the T790M mutation. Third-generation TKIs are active against EGFR-activating mutations and the T790M resistance mutation and have only limited efficacy against wild-type EGFR. Here we review the current status of the clinical development of these novel TKIs. Third-generation TKIs in clinical development include osimertinib, rociletinib, and HM61713. Osimertinib and rociletinib have shown clinical efficacy in phase I/II trials in patients who had acquired resistance to first- or second-generation TKIs. Both TKIs are currently further evaluated in phase III trials as first-line or second-line therapy in patients with advanced EGFR mutation-positive NSCLC. HM61713 is in early clinical development. Third-generation EGFR TKIs have shown activity in patients with acquired resistance to first- and second-generation EGFR TKIs and may further improve clinical outcome in patients with advanced EGFR mutation-positive NSCLC.

  5. Role of Insulin-Like Growth Factor-1 Signaling Pathway in Cisplatin-Resistant Lung Cancer Cells

    SciTech Connect

    Sun Yunguang; Zheng Siyuan; Torossian, Artour; Speirs, Christina K.; Schleicher, Stephen; Giacalone, Nicholas J.; Carbone, David P.; Zhao Zhongming; Lu Bo

    2012-03-01

    Purpose: The development of drug-resistant phenotypes has been a major obstacle to cisplatin use in non-small-cell lung cancer. We aimed to identify some of the molecular mechanisms that underlie cisplatin resistance using microarray expression analysis. Methods and Materials: H460 cells were treated with cisplatin. The differences between cisplatin-resistant lung cancer cells and parental H460 cells were studied using Western blot, MTS, and clonogenic assays, in vivo tumor implantation, and microarray analysis. The cisplatin-R cells were treated with human recombinant insulin-like growth factor (IGF) binding protein-3 and siRNA targeting IGF-1 receptor. Results: Cisplatin-R cells illustrated greater expression of the markers CD133 and aldehyde dehydrogenase, more rapid in vivo tumor growth, more resistance to cisplatin- and etoposide-induced apoptosis, and greater survival after treatment with cisplatin or radiation than the parental H460 cells. Also, cisplatin-R demonstrated decreased expression of insulin-like growth factor binding protein-3 and increased activation of IGF-1 receptor signaling compared with parental H460 cells in the presence of IGF-1. Human recombinant IGF binding protein-3 reversed cisplatin resistance in cisplatin-R cells and targeting of IGF-1 receptor using siRNA resulted in sensitization of cisplatin-R-cells to cisplatin and radiation. Conclusions: The IGF-1 signaling pathway contributes to cisplatin-R to cisplatin and radiation. Thus, this pathway represents a potential target for improved lung cancer response to treatment.

  6. Combined MET inhibition and topoisomerase I inhibition block cell growth of small cell lung cancer.

    PubMed

    Rolle, Cleo E; Kanteti, Rajani; Surati, Mosmi; Nandi, Suvobroto; Dhanasingh, Immanuel; Yala, Soheil; Tretiakova, Maria; Arif, Qudsia; Hembrough, Todd; Brand, Toni M; Wheeler, Deric L; Husain, Aliya N; Vokes, Everett E; Bharti, Ajit; Salgia, Ravi

    2014-03-01

    Small cell lung cancer (SCLC) is a devastating disease, and current therapies have not greatly improved the 5-year survival rates. Topoisomerase (Top) inhibition is a treatment modality for SCLC; however, the response is short lived. Consequently, our research has focused on improving SCLC therapeutics through the identification of novel targets. Previously, we identified MNNG HOS transforming gene (MET) to be overexpressed and functional in SCLC. Herein, we investigated the therapeutic potential of combinatorial targeting of MET using SU11274 and Top1 using 7-ethyl-10-hydroxycamptothecin (SN-38). MET and TOP1 gene copy numbers and protein expression were determined in 29 patients with limited (n = 11) and extensive (n = 18) disease. MET gene copy number was significantly increased (>6 copies) in extensive disease compared with limited disease (P = 0.015). Similar TOP1 gene copy numbers were detected in limited and extensive disease. Immunohistochemical staining revealed a significantly higher Top1 nuclear expression in extensive (0.93) versus limited (0.15) disease (P = 0.04). Interestingly, a significant positive correlation was detected between MET gene copy number and Top1 nuclear expression (r = 0.5). In vitro stimulation of H82 cells revealed hepatocyte growth factor (HGF)-induced nuclear colocalization of p-MET and Top1. Furthermore, activation of the HGF/MET axis enhanced Top1 activity, which was abrogated by SU11274. Combination of SN-38 with SU11274 dramatically decreased SCLC growth as compared with either drug alone. Collectively, these findings suggest that the combinatorial inhibition of MET and Top1 is a potentially efficacious treatment strategy for SCLC. ©2013 AACR.

  7. A novel long noncoding RNA AK001796 acts as an oncogene and is involved in cell growth inhibition by resveratrol in lung cancer

    SciTech Connect

    Yang, Qiaoyuan; Xu, Enwu; Dai, Jiabin; Liu, Binbin; Han, Zhiyuan; Wu, Jianjun; Zhang, Shaozhu; Peng, Baoying; Zhang, Yajie; Jiang, Yiguo

    2015-06-01

    Lung cancer is the most common form of cancer throughout the world. The specific targeting of long noncoding RNAs (lncRNAs) by resveratrol opened a new avenue for cancer chemoprevention. In this study, we found that 21 lncRNAs were upregulated and 19 lncRNAs were downregulated in lung cancer A549 cells with 25 μmol/L resveratrol treatment determined by microarray analysis. AK001796, the lncRNA with the most clearly altered expression, was overexpressed in lung cancer tissues and cell lines, but its expression was downregulated in resveratrol-treated lung cancer cells. By monitoring cell proliferation and growth in vitro and tumor growth in vivo, we observed a significant reduction in cell viability in lung cancer cells and a slow growth in the tumorigenesis following AK001796 knockdown. We also found that AK001796 knockdown caused a cell-cycle arrest, with significant increases in the percentage of cells in G{sub 0}/G{sub 1} in lung cancer cells. By using cell cycle pathway-specific PCR arrays, we detected changes in a number of cell cycle-related genes related to lncRNA AK001796 knockdown. We further investigated whether AK001796 participated in the anticancer effect of resveratrol and the results showed that reduced lncRNA AK001796 level potentially impaired the inhibitory effect of resveratrol on cell proliferation. To our knowledge, this is the first study to report the changes in an lncRNA expression profile induced by resveratrol in lung cancer. - Highlights: • LncRNA AK001796 played an oncogenic role in lung carcinogenesis. • LncRNA AK001796 was downregulated in resveratrol-treated lung cancer cells. • LncRNA AK001796 was involved in the inhibition of cell growth by resveratrol.

  8. Inhibition of Calcium-Activated Chloride Channel ANO1/TMEM16A Suppresses Tumor Growth and Invasion in Human Lung Cancer

    PubMed Central

    Jia, Linghan; Liu, Wen; Guan, Lizhao; Lu, Min; Wang, KeWei

    2015-01-01

    Lung cancer or pulmonary carcinoma is primarily derived from epithelial cells that are thin and line on the alveolar surfaces of the lung for gas exchange. ANO1/TMEM16A, initially identified from airway epithelial cells, is a member of Ca2+-activated Cl- channels (CaCCs) that function to regulate epithelial secretion and cell volume for maintenance of ion and tissue homeostasis. ANO1/TMEM16A has recently been shown to be highly expressed in several epithelium originated carcinomas. However, the role of ANO1 in lung cancer remains unknown. In this study, we show that inhibition of calcium-activated chloride channel ANO1/TMEM16A suppresses tumor growth and invasion in human lung cancer. ANO1 is upregulated in different human lung cancer cell lines. Knocking-down ANO1 by small hairpin RNAs inhibited proliferation, migration and invasion of GLC82 and NCI-H520 cancel cells evaluated by CCK-8, would-healing, transwell and 3D soft agar assays. ANO1 protein is overexpressed in 77.3% cases of human lung adenocarcinoma tissues detected by immunohistochemistry. Furthermore, the tumor growth in nude mice implanted with GLC82 cells was significantly suppressed by ANO1 silencing. Taken together, our findings provide evidence that ANO1 overexpression contributes to tumor growth and invasion of lung cancer; and suppressing ANO1 overexpression may have therapeutic potential in lung cancer therapy. PMID:26305547

  9. Inhibition of Calcium-Activated Chloride Channel ANO1/TMEM16A Suppresses Tumor Growth and Invasion in Human Lung Cancer.

    PubMed

    Jia, Linghan; Liu, Wen; Guan, Lizhao; Lu, Min; Wang, KeWei

    2015-01-01

    Lung cancer or pulmonary carcinoma is primarily derived from epithelial cells that are thin and line on the alveolar surfaces of the lung for gas exchange. ANO1/TMEM16A, initially identified from airway epithelial cells, is a member of Ca2+-activated Cl- channels (CaCCs) that function to regulate epithelial secretion and cell volume for maintenance of ion and tissue homeostasis. ANO1/TMEM16A has recently been shown to be highly expressed in several epithelium originated carcinomas. However, the role of ANO1 in lung cancer remains unknown. In this study, we show that inhibition of calcium-activated chloride channel ANO1/TMEM16A suppresses tumor growth and invasion in human lung cancer. ANO1 is upregulated in different human lung cancer cell lines. Knocking-down ANO1 by small hairpin RNAs inhibited proliferation, migration and invasion of GLC82 and NCI-H520 cancel cells evaluated by CCK-8, would-healing, transwell and 3D soft agar assays. ANO1 protein is overexpressed in 77.3% cases of human lung adenocarcinoma tissues detected by immunohistochemistry. Furthermore, the tumor growth in nude mice implanted with GLC82 cells was significantly suppressed by ANO1 silencing. Taken together, our findings provide evidence that ANO1 overexpression contributes to tumor growth and invasion of lung cancer; and suppressing ANO1 overexpression may have therapeutic potential in lung cancer therapy.

  10. Justice and lung cancer.

    PubMed

    Wilson, Aaron

    2013-04-01

    Lung cancer is the leading cause of cancer deaths, yet research funding is by far the lowest for lung cancer than for any other cancer compared with respective death rates. Although this discrepancy should appear alarming, one could argue that lung cancer deserves less attention because it is more attributable to poor life choices than other common cancers. Accordingly, the general question that I ask in this article is whether victims of more avoidable diseases, such as lung cancer, deserve to have their needs taken into less consideration than those of less avoidable diseases, on the grounds of either retributive or distributive justice. Such unequal treatment may be the "penalty" one incurs for negligent or reckless behavior. However, I hope to show that such unequal treatment cannot be supported by any coherent accounts of retributive or distributive justice.

  11. Epidermal growth factor receptor derived peptide vaccination to prevent lung adenocarcinoma formation: An in vivo study in a murine model of EGFR mutant lung cancer.

    PubMed

    Ebben, Johnathan D; Lubet, Ronald A; Gad, Ekram; Disis, Mary L; You, Ming

    2016-11-01

    The ability to prevent disease is the holy grail of medicine. For decades, efforts have been made to extend the successes seen with vaccination against infectious diseases to cancer. In some instances, preventive vaccination against viruses (prototypically HPV) has successfully prevented tumorigenesis and will make a major impact on public health in the decades to come. However, the majority of cancers that arise are a result of genetic mutation within the host, or non-viral environmental exposures. We present compelling evidence that vaccination against an overexpressed self-tumor oncoprotein has the potential to prevent tumor development. Vaccination against the Epidermal Growth Factor Receptor (EGFR) using a multipeptide vaccine in a preventive setting decreased EGFR-driven lung carcinogenesis by 76.4% in a mouse model of EGFR-driven lung cancer. We also demonstrate that anti-EGFR vaccination primes the development of a robust immune response in vivo. This study provides proof of concept for the first time that targeting tumor drivers in a preventive setting in lung cancer using peptide vaccination can inhibit tumorigenesis and may provide useful clinical insights into the development of strategies to vaccinate against EGFR in populations where EGFR-mutant disease is highly prevalent. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  12. Immunotherapy in Lung Cancer.

    PubMed

    Castellanos, Emily H; Horn, Leora

    2016-01-01

    Lung cancer has not traditionally been viewed as an immune-responsive tumor. However, it is becoming evident that tumor-induced immune suppression is vital to malignant progression. Immunotherapies act by enhancing the patient's innate immune response and hold promise for inducing long-term responses in select patients with non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC). Immune checkpoint inhibitors, in particular, inhibitors to cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 (PD-1) and programmed death receptor ligand 1 (PD-L1) have shown promise in early studies and are currently in clinical trials in both small cell lung cancer and non-small cell lung cancer patients. Two large randomized phase III trials recently demonstrated superior overall survival (OS) in patients treated with anti-PD-1 therapy compared to chemotherapy in the second-line setting.

  13. Occupational lung cancer

    SciTech Connect

    Coultas, D.B.; Samet, J.M. )

    1992-06-01

    The overall importance of occupational agents as a cause of lung cancer has been a controversial subject since the 1970s. A federal report, released in the late 1970s, projected a surprisingly high burden of occupational lung cancer; for asbestos and four other agents, from 61,000 to 98,000 cases annually were attributed to these agents alone. Many estimates followed, some much more conservative. For example, Doll and Peto estimated that 15% of lung cancer in men and 5% in women could be attributed to occupational exposures. A number of population-based case-control studies also provide relevant estimates. In a recent literature review, Vineis and Simonato cited attributable risk estimates for occupation and lung cancer that ranged from 4% to 40%; for asbestos alone, the estimates ranged from 1% to 5%. These estimates would be expected to vary across locations and over time. Nevertheless, these recent estimates indicate that occupation remains an important cause of lung cancer. Approaches to Prevention. Prevention of lung cancer mortality among workers exposed to agents or industrial processes that cause lung cancer may involve several strategies, including eliminating or reducing exposures, smoking cessation, screening, and chemo-prevention. For example, changes in industrial processes that have eliminated or reduced exposures to chloromethyl ethers and nickel compounds have provided evidence of reduced risk of lung cancer following these changes. Although occupational exposures are important causes of lung cancer, cigarette smoking is the most important preventable cause of lung cancer. For adults, the work site offers an important location to target smoking cessation efforts. In fact, the work site may be the only place to reach many smokers.

  14. Crosstalk with cancer-associated fibroblasts induces resistance of non-small cell lung cancer cells to epidermal growth factor receptor tyrosine kinase inhibition

    PubMed Central

    Choe, Chungyoul; Shin, Yong-Sung; Kim, Changhoon; Choi, So-Jung; Lee, Jinseon; Kim, So Young; Cho, Yong Beom; Kim, Jhingook

    2015-01-01

    Although lung cancers with activating mutations in the epidermal growth factor receptor (EGFR) are highly sensitive to selective EGFR tyrosine kinase inhibitors (TKIs), these tumors invariably develop acquired drug resistance. Host stromal cells have been found to have a considerable effect on the sensitivity of cancer cells to EGFR TKIs. Little is known, however, about the signaling mechanisms through which stromal cells contribute to the response to EGFR TKI in non-small cell lung cancer. This work examined the role of hedgehog signaling in cancer-associated fibroblast (CAF)-mediated resistance of lung cancer cells to the EGFR TKI erlotinib. PC9 cells, non-small cell lung cancer cells with EGFR-activating mutations, became resistant to the EGFR TKI erlotinib when cocultured in vitro with CAFs. Polymerase chain reaction and immunocytochemical assays showed that CAFs induced epithelial to mesenchymal transition phenotype in PC9 cells, with an associated change in the expression of epithelial to mesenchymal transition marker proteins including vimentin. Importantly, CAFs induce upregulation of the 7-transmembrane protein smoothened, the central signal transducer of hedgehog, suggesting that the hedgehog signaling pathway is active in CAF-mediated drug resistance. Indeed, downregulation of smoothened activity with the smoothened antagonist cyclopamine induces remodeling of the actin cytoskeleton independently of Gli-mediated transcriptional activity in PC9 cells. These findings indicate that crosstalk with CAFs plays a critical role in resistance of lung cancer to EGFR TKIs through induction of the epithelial to mesenchymal transition and may be an ideal therapeutic target in lung cancer. PMID:26676152

  15. Lung Cancer Screening.

    PubMed

    Hoffman, Richard M; Sanchez, Rolando

    2017-07-01

    Lung cancer is the leading cause of cancer death in the United States. More than 80% of these deaths are attributed to tobacco use, and primary prevention can effectively reduce the cancer burden. The National Lung Screening Trial showed that low-dose computed tomography (LDCT) screening could reduce lung cancer mortality in high-risk patients by 20% compared with chest radiography. The US Preventive Services Task Force recommends annual LDCT screening for persons aged 55 to 80 years with a 30-pack-year smoking history, either currently smoking or having quit within 15 years. Published by Elsevier Inc.

  16. Cyclooxygenase-2 modulates the insulin-like growth factor axis in non-small-cell lung cancer.

    PubMed

    Põld, Mehis; Krysan, Kostyantyn; Põld, Anu; Dohadwala, Mariam; Heuze-Vourc'h, Nathalie; Mao, Jenny T; Riedl, Karen L; Sharma, Sherven; Dubinett, Steven M

    2004-09-15

    Constitutive overexpression of cyclooxygenase-2 (COX-2) occurs frequently in several different malignancies, including lung, colon, breast, and prostate cancer. Clinical studies have established elevated serum insulin-like growth factor (IGF-I) content and IGF-I:IGF-binding protein 3 (IGFBP-3) ratio as risk factors for these same malignancies. Therefore, we sought to determine the link between COX-2 expression and the IGF axis in COX-2 gene-modified human non-small-cell lung cancer (NSCLC) cells. Overexpression of COX-2 in NSCLC cells enhanced the antiapoptotic and mitogenic effects of IGF-I and IGF-II, facilitated the autophosphorylation of the type 1 IGF receptor, increased class IA phosphatidylinositol 3'-kinase activity, and decreased expression of IGFBP-3. Thus, these findings show that COX-2 augments the stimulatory arm of the IGF axis.

  17. Growth suppression by MYC inhibition in small cell lung cancer cells with TP53 and RB1 inactivation

    PubMed Central

    Fiorentino, Francesco Paolo; Tokgün, Elvan; Solé-Sánchez, Sònia; Giampaolo, Sabrina; Tokgün, Onur; Jauset, Toni; Kohno, Takashi; Perucho, Manuel; Soucek, Laura; Yokota, Jun

    2016-01-01

    Small cell lung cancer (SCLC) is the most aggressive type of lung cancer with high mortality. One of the MYC family genes, MYC, MYCL or MYCN, is amplified in ~20% of the SCLCs; therefore, MYC proteins are potential therapeutic targets in SCLC patients. We investigated the therapeutic impact of Omomyc, a MYC dominant negative, in a panel of SCLC cell lines. Strikingly, Omomyc suppressed the growth of all tested cell lines by inducing cell cycle arrest and/or apoptosis. Induction of G1 arrest by Omomyc was found to be dependent on the activation of CDKN1A, in part, through the TP73 pathway. Our results strongly indicate that SCLC cells carrying amplification of MYC, MYCL or MYCN are addicted to MYC function, suggesting that MYC targeting would be an efficient therapeutic option for SCLC patients. PMID:27105536

  18. Overexpression of Inhibitor of Growth 4 Enhances Radiosensitivity in Non-Small Cell Lung Cancer Cell Line SPC-A1.

    PubMed

    Pan, Xuan; Wang, Rui; Bian, Haibo; De, Wei; Zhang, Ping; Wei, Chenchen; Wang, Zhaoxia

    2017-10-01

    Inhibitor of growth 4 is a member of the inhibitor of growth family proteins, which is involved in cell apoptosis, migration, invasion, and cell cycle progress. In this study, we investigated the inhibitor of growth 4 level in non-small cell lung cancer tissues and explored the antitumor activity of inhibitor of growth 4 in vitro and in vivo using non-small cell lung cancer cell line SPC-A1 and its underlying molecular mechanisms. We also explored its role on the radiosensitivity in SPC-A1 cells. The level of inhibitor of growth 4 protein was significantly decreased in 28 cases of non-small cell lung cancer tissues in comparison with corresponding noncancerous lung epithelial tissues. Upregulation of inhibitor of growth 4 by plasmid pcDNA3.1-ING4 delivery could suppress proliferation and increase apoptosis of SPC-A1 cells both in vitro and in vivo. Additionally, we found that overexpression of inhibitor of growth 4 in SPC-A1 cell line could lead to a higher Bcl-2/Bax ratio, which might be an important factor in the apoptosis regulation. Furthermore, overexpression of inhibitor of growth 4 enhanced the radiosensitivity of SPC-A1 cells to irradiation. Inhibitor of growth 4 upregulation plus radiotherapy induced synergistic tumor suppression in SPC-A1 xenografts implanted in athymic nude mice. Thus, the restoration of inhibitor of growth 4 function might provide a potential strategy for non-small cell lung cancer radiosensitization.

  19. Three generations of epidermal growth factor receptor tyrosine kinase inhibitors developed to revolutionize the therapy of lung cancer

    PubMed Central

    Zhang, Haijun

    2016-01-01

    Lung cancer, ~80%–85% of which is non-small-cell lung cancer (NSCLC), is the leading cause of cancer-related mortality worldwide. Sensitizing mutations in epidermal growth factor receptor (EGFR) gene (EGFRm+), such as exon 19 deletions and exon 21 L858R point mutations, are the most important drivers in NSCLC patients. In this respect, small-molecule EGFR tyrosine kinase inhibitors (TKIs) have been designed and developed, which launched the era of targeted, personalized and precise medicine for lung cancer. Patients with EGFRm+ could achieve good responses to the treatment with the first-generation EGFR TKIs, such as erlotinib and gefitinib. However, most patients develop acquired drug resistance mostly driven by the T790M mutation occurring within exon 20. Although the second-generation EGFR TKIs, such as afatinib, dacomitinib and neratinib, demonstrated promising activity against T790M in preclinical models, they have failed to overcome resistance in patients due to dose-limiting toxicity. Recently, the third-generation EGFR TKIs have shown to be effective against cell lines and murine models harboring T790M mutations while sparing wild-type EGFR, which represents a promising breakthrough approach in overcoming T790M-mediated resistance in NSCLC patients. This article provides a comprehensive review of the therapy revolution for NSCLC with three generations of EGFR TKIs. PMID:27920501

  20. Epidermal Growth Factor Receptor Mutational Status and Brain Metastases in Non-Small-Cell Lung Cancer.

    PubMed

    Bhatt, Vijaya Raj; D'Souza, Sanyo P; Smith, Lynette M; Cushman-Vokoun, Allison M; Noronha, Vanita; Verma, Vivek; Joshi, Amit; Chougule, Anuradha; Jambhekar, Nirmala; Kessinger, Anne; Marr, Alissa; Patil, Vijay; Banavali, Sripad D; Ganti, Apar Kishor; Prabhash, Kumar

    2017-06-01

    Epidermal growth factor receptor (EGFR) mutations in non-small-cell lung cancers (NSCLC) may be more common in patients with brain metastases. Previous studies, however, did not adjust for effects of confounding variables. This retrospective study included 1,522 consecutive patients with NSCLC, whose tumors were diagnosed and tested for EGFR mutations at the University of Nebraska Medical Center (Omaha, NE) and Tata Memorial Hospital (Mumbai, India). Multivariate logistic regression was used to identify any association between EGFR status and clinical factors. EGFR mutations were more common in females than males (38.7% v 24.8%), Asians than whites (31.3% v 13.4%), nonsmokers than smokers (40.2% v 14.6%), alcohol nonconsumers than users (32.4% v 15.8%), adenocarcinoma than other histology types (32.7% v 10.3%), and patients with brain metastases than extracranial or no metastases (39.4% v 29.8% v 15.1%; P < .001 for all comparisons). There was a higher likelihood of an EGFR mutation among patients with brain metastases (odds ratio, 1.8; P < .001). The median overall survival (OS) was 19.8 months. Patients with brain metastases had a shorter median OS (15 v 20.6 months; P = .02). However, in the cohort of EGFR mutation-positive patients, there was no difference in median OS between patients with and without brain metastases (20.8 v 25.1 months; P = .11). There is a nearly two-fold higher incidence of EGFR mutations in NSCLC among patients with brain metastases at diagnosis. EGFR mutations did not predict for outcomes from brain metastases.

  1. Epidermal Growth Factor Receptor Mutational Status and Brain Metastases in Non–Small-Cell Lung Cancer

    PubMed Central

    Bhatt, Vijaya Raj; D’Souza, Sanyo P.; Smith, Lynette M.; Cushman-Vokoun, Allison M.; Noronha, Vanita; Verma, Vivek; Joshi, Amit; Chougule, Anuradha; Jambhekar, Nirmala; Kessinger, Anne; Marr, Alissa; Patil, Vijay; Banavali, Sripad D.; Prabhash, Kumar

    2017-01-01

    Introduction Epidermal growth factor receptor (EGFR) mutations in non–small-cell lung cancers (NSCLC) may be more common in patients with brain metastases. Previous studies, however, did not adjust for effects of confounding variables. Methods This retrospective study included 1,522 consecutive patients with NSCLC, whose tumors were diagnosed and tested for EGFR mutations at the University of Nebraska Medical Center (Omaha, NE) and Tata Memorial Hospital (Mumbai, India). Multivariate logistic regression was used to identify any association between EGFR status and clinical factors. Results EGFR mutations were more common in females than males (38.7% v 24.8%), Asians than whites (31.3% v 13.4%), nonsmokers than smokers (40.2% v 14.6%), alcohol nonconsumers than users (32.4% v 15.8%), adenocarcinoma than other histology types (32.7% v 10.3%), and patients with brain metastases than extracranial or no metastases (39.4% v 29.8% v 15.1%; P < .001 for all comparisons). There was a higher likelihood of an EGFR mutation among patients with brain metastases (odds ratio, 1.8; P < .001). The median overall survival (OS) was 19.8 months. Patients with brain metastases had a shorter median OS (15 v 20.6 months; P = .02). However, in the cohort of EGFR mutation–positive patients, there was no difference in median OS between patients with and without brain metastases (20.8 v 25.1 months; P = .11). Conclusion There is a nearly two-fold higher incidence of EGFR mutations in NSCLC among patients with brain metastases at diagnosis. EGFR mutations did not predict for outcomes from brain metastases. PMID:28717762

  2. Lung cancer screening.

    PubMed

    Tanoue, Lynn T; Tanner, Nichole T; Gould, Michael K; Silvestri, Gerard A

    2015-01-01

    The United States Preventive Services Task Force recommends lung cancer screening with low-dose computed tomography (LDCT) in adults of age 55 to 80 years who have a 30 pack-year smoking history and are currently smoking or have quit within the past 15 years. This recommendation is largely based on the findings of the National Lung Screening Trial. Both policy-level and clinical decision-making about LDCT screening must consider the potential benefits of screening (reduced mortality from lung cancer) and possible harms. Effective screening requires an appreciation that screening should be limited to individuals at high risk of death from lung cancer, and that the risk of harm related to false positive findings, overdiagnosis, and unnecessary invasive testing is real. A comprehensive understanding of these aspects of screening will inform appropriate implementation, with the objective that an evidence-based and systematic approach to screening will help to reduce the enormous mortality burden of lung cancer.

  3. Familial risk for lung cancer

    PubMed Central

    Kanwal, Madiha; Ding, Xiao-Ji; Cao, Yi

    2017-01-01

    Lung cancer, which has a low survival rate, is a leading cause of cancer-associated mortality worldwide. Smoking and air pollution are the major causes of lung cancer; however, numerous studies have demonstrated that genetic factors also contribute to the development of lung cancer. A family history of lung cancer increases the risk for the disease in both smokers and never-smokers. This review focuses on familial lung cancer, in particular on the familial aggregation of lung cancer. The development of familial lung cancer involves shared environmental and genetic factors among family members. Familial lung cancer represents a good model for investigating the association between environmental and genetic factors, as well as for identifying susceptibility genes for lung cancer. In addition, studies on familial lung cancer may help to elucidate the etiology and mechanism of lung cancer, and may identify novel biomarkers for early detection and diagnosis, targeted therapy and improved prevention strategies. This review presents the aetiology and molecular biology of lung cancer and then systematically introduces and discusses several aspects of familial lung cancer, including the characteristics of familial lung cancer, population-based studies on familial lung cancer and the genetics of familial lung cancer. PMID:28356926

  4. Targeted Therapies for Lung Cancer

    PubMed Central

    Larsen, Jill E.; Cascone, Tina; Gerber, David E.; Heymach, John V.; Minna, John D.

    2012-01-01

    Although lung cancer remains the leading cancer killer in the United States, recently a number of developments indicate future clinical benefit. These include evidence that computed tomography–based screening decreases lung cancer mortality, the use of stereotactic radiation for early-stage tumors, the development of molecular methods to predict chemotherapy sensitivity, and genome-wide expression and mutation analysis data that have uncovered oncogene “addictions” as important therapeutic targets. Perhaps the most significant advance in the treatment of this challenging disease is the introduction of molecularly targeted therapies, a term that currently includes monoclonal antibodies and small-molecule tyrosine kinase inhibitors. The development of effective targeted therapeutics requires knowledge of the genes and pathways involved and how they relate to the biologic behavior of lung cancer. Drugs targeting the epidermal growth factor receptor, anaplastic lymphoma kinase, and vascular endothelial growth factor are now U.S. Food and Drug Administration approved for the treatment of advanced non-small cell lung cancer. These agents are generally better tolerated than conventional chemotherapy and show dramatic efficacy when their use is coupled with a clear understanding of clinical data, mechanism, patient selection, drug interactions, and toxicities. Integrating genome-wide tumor analysis with drug- and targeted agent-responsive phenotypes will provide a wealth of new possibilities for lung cancer–targeted therapeutics. Ongoing research efforts in these areas as well as a discussion of emerging targeted agents being evaluated in clinical trials are the subjects of this review. PMID:22157296

  5. Lung Cancer Biomarkers.

    PubMed

    I, Hoseok; Cho, Je-Yoel

    2015-01-01

    Lung cancer is the most frequently occurring cancer in the world and continually leads in mortality among cancers. The overall 5-year survival rate for lung cancer has risen only 4% (from 12% to 16%) over the past 4 decades, and late diagnosis is a major obstacle in improving lung cancer prognosis. Survival of patients undergoing lung resection is greater than 80%, suggesting that early detection and diagnosis of cancers before they become inoperable and lethal will greatly improve mortality. Lung cancer biomarkers can be used for screening, detection, diagnosis, prognosis, prediction, stratification, therapy response monitoring, and so on. This review focuses on noninvasive diagnostic and prognostic biomarkers. For that purpose, our discussion in this review will focus on biological fluid-based biomarkers. The body fluids include blood (serum or plasma), sputum, saliva, BAL, pleural effusion, and VOC. Since it is rich in different cellular and molecular elements and is one of the most convenient and routine clinical procedures, serum or plasma is the main source for the development and validation of many noninvasive biomarkers. In terms of molecular aspects, the most widely validated ones are proteins, some of which are used in the clinical sector, though in limited accessory purposes. We will also discuss the lung cancer (protein) biomarkers in clinical trials and currently in the validation phase with hundreds of samples. After proteins, we will discuss microRNAs, methylated DNA, and circulating tumor cells, which are being vigorously developed and validated as potential lung cancer biomarkers. The main aim of this review is to provide researchers and clinicians with an understanding of the potential noninvasive lung cancer biomarkers in biological fluids that have recently been discovered.

  6. Study of lung-metastasized prostate cancer cell line chemotaxis to epidermal growth factor with a BIOMEMS device

    NASA Astrophysics Data System (ADS)

    Tata, Uday; Rao, Smitha M. N.; Sharma, Akash; Pabba, Krishna; Pokhrel, Kushal; Adhikari, Bandita; Lin, Victor K.; Chiao, J.-C.

    2012-09-01

    Understanding the effects of different growth factors on cancer metastasis will enable researchers to develop effective post-surgery therapeutic strategies to stop the spread of cancer. Conventional Boyden chamber assays to evaluate cell motility in metastasis studies require high volumes of reagents and are impractical for high-throughput analysis. A microfluidic device was designed for arrayed assaying of prostate cancer cell migration towards different growth factors. The device was created with polydimethylsiloxane (PDMS) and featured two wells connected by 10 micro channels. One well was for cell seeding and the other well for specific growth factors. Each channel has a width of 20 μm, a length of 1 mm and a depth of 10 μm. The device was placed on a culture dish and primed with growth media. Lung-metastasized cells in suspension of RPMI 1640 media1 supplemented with 2% of fetal bovine serum (FBS) were seeded in the cell wells. Cell culture media with epidermal growth factor (EGF) of 25, 50, 75, 100 and 125 ng ml-1 concentrations were individually added in the respective growth factor wells. A 5-day time-lapsed study of cell migration towards the chemoattractant was performed. The average numbers of cells per device in the microchannels were obtained for each attractant condition. The results indicated migration of cells increased from 50 to 100 ng ml-1 of EGF and significantly decreased at 125 ng ml-1 of EGF, as compared to control.

  7. Expression profile, clinical significance, and biological function of insulin-like growth factor 2 messenger RNA-binding proteins in non-small cell lung cancer.

    PubMed

    Shi, Run; Yu, Xinnian; Wang, Yajing; Sun, Jing; Sun, Qi; Xia, Wenjie; Dong, Gaochao; Wang, Anpeng; Gao, Zhaojia; Jiang, Feng; Xu, Lin

    2017-04-01

    Insulin-like growth factor 2 messenger RNA-binding proteins have been described to associate with malignant process in many cancers. However, the role of insulin-like growth factor 2 messenger RNA-binding protein family has not been thoroughly elucidated in non-small cell lung cancer. This study was to investigate the expression profile, clinical significance, and biological function of insulin-like growth factor 2 messenger RNA-binding proteins family in non-small cell lung cancer. The expression levels of IGF2BP1-IGF2BP3 in tumor and adjacent normal tissues were determined, and association with clinicopathological features and overall survival was investigated by analyzing The Cancer Genome Atlas lung cancer database. Proliferation, migration, invasion assays, and flow-cytometry analysis were used to investigate the biological function in vitro. Insulin-like growth factor 2 messenger RNA-binding protein expression levels were significantly increased in non-small cell lung cancer compared to adjacent normal lung tissues. Chi-square test indicated that IGF2BP1 and IGF2BP3 expressions correlated with some meaningful clinical characteristics in non-small cell lung cancer. Kaplan-Meier analysis showed that high-level expression of IGF2BP1 or IGF2BP3 predicted poor overall survival in lung adenocarcinoma patients. Multivariate regression analysis showed that high level of IGF2BP3 was an independent risk factor for poor prognosis in lung adenocarcinoma patients (hazard ratio = 1.616, p = 0.017). In vitro, knockdown of IGF2BP3 inhibited lung adenocarcinoma cell proliferation by inducing cell cycle arrest and apoptosis, and undermined abilities of migration and invasion, and overexpression of IGF2BP3 could promote malignant phenotypes in lung adenocarcinoma cells. Our study revealed that expression of insulin-like growth factor 2 messenger RNA-binding proteins was widely upregulated and correlated with some certain clinicopathological features in non-small cell

  8. Lung Cancer Screening Update.

    PubMed

    Ruchalski, Kathleen L; Brown, Kathleen

    2016-07-01

    Since the release of the US Preventive Services Task Force and Centers for Medicare and Medicaid Services recommendations for lung cancer screening, low-dose chest computed tomography screening has moved from the research arena to clinical practice. Lung cancer screening programs must reach beyond image acquisition and interpretation and engage in a multidisciplinary effort of clinical shared decision-making, standardization of imaging and nodule management, smoking cessation, and patient follow-up. Standardization of radiologic reports and nodule management will systematize patient care, provide quality assurance, further reduce harm, and contain health care costs. Although the National Lung Screening Trial results and eligibility criteria of a heavy smoking history are the foundation for the standard guidelines for low-dose chest computed tomography screening in the United States, currently only 27% of patients diagnosed with lung cancer would meet US lung cancer screening recommendations. Current and future efforts must be directed to better delineate those patients who would most benefit from screening and to ensure that the benefits of screening reach all socioeconomic strata and racial and ethnic minorities. Further optimization of lung cancer screening program design and patient eligibility will assure that lung cancer screening benefits will outweigh the potential risks to our patients.

  9. Integrin β3 and CD44 levels determine the effects of the OPN-a splicing variant on lung cancer cell growth

    PubMed Central

    Sheu, Gwo-Tarng; Chang, Hui-Yi; Chen, Mei-Yu; Lin, Yu-Ying; Chuang, Cheng-Yen; Hsu, Shih-Lan; Chang, Jinghua Tsai

    2016-01-01

    Osteopontin (OPN), a phosphorylated glycoprotein, is frequently overexpressed in cancer. Among the three OPN isoforms, OPN-a is the most highly expressed in lung cancer cell lines and lung tumors. Overexpression of OPN-a greatly reduced CL1-5 lung adenocarcinoma cell growth, but had no effect on growth in A549 lung adenocarcinoma cells. Examination of the expression of integrins and CD44, which are possible OPN-a receptors, revealed that differences in integrin β3 levels might explain this discrepancy between CL1-5 and A549 cells. When integrin β3 was ectopically expressed in A549 cells, OPN-a inhibited their growth, whereas OPN-a increased cell growth following integrin β3 knockdown in CL1-5 cells. This OPN-a-induced increase in growth appeared to result from activation of the CD44/NFκB pathway. Our results demonstrated that OPN-a inhibits growth of cells with high integrin β3 levels and increases growth via activation of the CD44/NFκB pathway in cells with low integrin β3 levels. Thus, OPN-a, integrin β3, and CD44 interact to affect lung cancer cell growth, and this study may aid in the development of cancer treatment strategies involving these molecules. PMID:27487131

  10. Targeted therapy in non-small cell lung cancer: a focus on epidermal growth factor receptor mutations.

    PubMed

    Milano, Gérard A

    2015-12-01

    The main molecular targeting of lung cancer [non-small cell lung cancer (NSCLC)] concerns mutations of epidermal growth factor receptor (EGFR). The awaited responsiveness of tumors carrying these mutations is high with for instance 60% to 80% with tyrosine kinase inhibitors hitting EGFR mutations. The EGFR T790M as a secondary mutation is responsible for the occurrence of a resistance phenomenon. A multitude of drugs have been produced and tested with the property of a specific binding at the EGFR T790M site. There is currently an evolution oriented to a robust genotyping methods allowing the identification of given molecular anomalies (pyrosequencing for instance) towards the consideration of a much larger set of molecular anomalies under the form of a global genotyping realized with the use of next-generation sequencing (NGS). This phase of whole genome analysis necessitates the introduction of a specialized staff for data treatment. A possible substitution plasma/tumor for the mutation analyses is perceptible in lung cancer, a preference being however given to the intratumoral direct investigation when this is feasible. EGFR mutations as targetable anomalies are illustrative examples, that the management of NSCLC is currently drawing a significant benefit from personalized therapy.

  11. Lycopene and Lung Cancer

    USDA-ARS?s Scientific Manuscript database

    Although epidemiological studies have shown dietary intake of lycopene is associated with decreased risk of lung cancer, the effect of lycopene on lung carcinogenesis has not been well studied. A better understanding of lycopene metabolism and the mechanistic basis of lycopene chemoprevention must ...

  12. Women and Lung Cancer

    MedlinePlus

    ... Horrigan Conners Center for Women’s Health and Gender Biology, Brigham and Women’s Hospital, Harvard Medical School, April, ... Lung Cancer in Women: The Differences in Epidemiology, Biology and Treatment Outcomes, Maria Patricia Rivera MD Expert ...

  13. Expression of Sonic Hedgehog (SHH) in human lung cancer and the impact of YangZheng XiaoJi on SHH-mediated biological function of lung cancer cells and tumor growth.

    PubMed

    Jiang, Wen G; Ye, Lin; Ruge, Fiona; Sun, Ping-Hui; Sanders, Andrew J; Ji, Ki; Lane, Jane; Zhang, Lijian; Satherley, Lucy; Weeks, Hoi P; Zhi, Xiuyi; Gao, Yong; Wei, Cong; Wu, Yiling; Mason, Malcolm D

    2015-03-01

    Sonic Hedgehog (SHH) is a protein that is aberrantly expressed in various human tumors. SHH and its signaling molecules have been indicated as potential therapeutic targets. In the present study, we evaluated the expression of SHH transcript in human non-small cell lung cancer (NSCLC) tissues and investigated the impact of inhibiting SHH together with a traditional Chinese medicine formula, YangZheng XiaoJi (YZXJ), on the function and growth of lung cancer cells. Human NSCLC tissues had significantly higher levels of the SHH transcript compared matched normal lung tissues (n=83). TNM2 tumors and tumors with pleural invasion had higher levels than TNM1 and non-invasive tumors. High SHH levels were associated with a shorter overall survival (OS) of the patients. A SHH inhibitor, cyclopamine, and YZXJ alone or in combination had a marked inhibitory effect on cellular invasion and cellular migration of human lung cancer cells, A549 and SKMES1. YangZheng XiaoJi and its combination with cyclopamine also significantly reduced the growth of lung tumors in vivo together with a reduction of SHH and smoothened (Smo) proteins in the lung tumors. The present study provides evidence that blocking SHH by way of small inhibitor and by YangZheng XiaoJi has a profound influence on lung cancer cells as seen by in vitro invasion and cell migration and in vivo tumor growth. Together with the aberrant expression of SHH in NSCLC tumors in the patients, it is suggested that SHH is a potential target for therapies for NSCLC.

  14. Lung Cancer Rates by State

    MedlinePlus

    ... HPV-Associated Ovarian Prostate Skin Uterine Cancer Home Lung Cancer Rates by State Language: English Español (Spanish) ... incidence data are currently available. Rates of Getting Lung Cancer by State The number of people who ...

  15. Recent advances in lung cancer biology

    SciTech Connect

    Lechner, J.

    1995-12-31

    This paper provides an overview of carcinogenesis, especially as related to lung cancers. Various growth factors and their mutated forms as oncogenes are discussed with respect to gene location and their role in the oncogenic process. Finally the data is related to lung cancer induction in uranium miners and exposure to radon.

  16. IL-6 promotes growth and epithelial-mesenchymal transition of CD133+ cells of non-small cell lung cancer.

    PubMed

    Lee, Soo Ok; Yang, Xiaodong; Duan, Shanzhou; Tsai, Ying; Strojny, Laura R; Keng, Peter; Chen, Yuhchyau

    2016-02-09

    We examined IL-6 effects on growth, epithelial-mesenchymal transition (EMT) process, and metastatic ability of CD133+ and CD133- cell subpopulations isolated from three non-small cell lung cancer (NSCLC) cell lines: A549, H157, and H1299. We developed IL-6 knocked-down and scramble (sc) control cells of A549 and H157 cell lines by lentiviral infection system, isolated CD133+ and CD133- sub-populations, and investigated the IL-6 role in self-renewal/growth of these cells. IL-6 showed either an inhibitory or lack of effect in modulating growth of CD133- cells depending on intracellular IL-6 levels, but there was higher self-renewal ability of IL-6 expressing CD133+ cells than IL-6 knocked down cells, confirming the promoter role of IL-6 in CD133+ cells growth. We then examined tumor growth of xenografts developed from CD133+ cells of A549IL-6si vs. A549sc cell lines. Consistently, there was retarded growth of tumors developed from A549IL-6si, CD133+ cells compared to tumors originating from A549sc, CD133+ cells. The effect of IL-6 in promoting CD133+ self-renewal was due to hedgehog (Hhg) and Erk signaling pathway activation and higher Bcl-2/Bcl-xL expression. We also investigated whether IL-6 regulates the EMT process of CD133- and CD133+ cells differently. Expression of the EMT/metastasis-associated molecules in IL-6 expressing cells was higher than in IL-6 knocked down cells. Together, we demonstrated dual roles of IL-6 in regulating growth of CD133- and CD133+ subpopulations of lung cancer cells and significant regulation of IL-6 on EMT/metastasis increase in CD133+ cells, not in CD133- cells.

  17. Lung Cancer-derived Galectin-1 Enhances Tumorigenic Potentiation of Tumor-associated Dendritic Cells by Expressing Heparin-binding EGF-like Growth Factor*

    PubMed Central

    Kuo, Po-Lin; Huang, Ming-Shyan; Cheng, Da-En; Hung, Jen-Yu; Yang, Chih-Jen; Chou, Shah-Hwa

    2012-01-01

    The interaction between cancer cells and their microenvironment is a vicious cycle that enhances the survival and progression of cancer, resulting in metastasis. This study is the first to indicate that lung cancer-derived galectin-1 secretion is responsible for stimulating tumor-associated dendritic cells (TADCs) production of mature heparin-binding EGF-like growth factor (HB-EGF), which, in turn, increases cancer progression. Treatment of galectin-1, present in large amounts in lung cancer conditioned medium and lung cancer patient sera, mimicked the inductive effect of lung cancer conditioned medium on the expression and ectodomain shedding of HB-EGF by TNFα-converting enzyme/a disintegrin and metalloproteinase 9 (ADAM9) and ADAM17. Significant up-regulation of HB-EGF has been seen in tumor-infiltrating CD11c+ dendritic cells in human lung cancer samples. Active cleavage of HB-EGF in TADCs by ADAM9 and ADAM17 is associated with increased protein kinase C δ and Lyn signaling. Enhancement of HB-EGF production in TADCs increased the proliferation, migration, and epithelial-to-mesenchymal transition abilities of lung cancer. In contrast, inhibiting HB-EGF by siRNA suppressed TADC-mediated cancer progression. Moreover, mice injected with galectin-1 knockdown Lewis lung carcinoma showed decreased expression and ectodomain shedding of HB-EGF and reduced incidence of cancer development, resulting in increased survival rates. We demonstrate here for the first time that human and mouse DCs are a source of HB-EGF, an EGFR ligand with tumorigenic properties. Antagonists of the effect of lung cancer-derived galectin-1 on DCs and anti-HB-EGF blocking antibodies could, therefore, have therapeutic potential as antitumor agents. PMID:22291012

  18. Tetramethylpyrazine inhibits tumor growth of lung cancer through disrupting angiogenesis via BMP/Smad/Id-1 signaling.

    PubMed

    Jia, Youchao; Wang, Zhigang; Zang, Aimin; Jiao, Shunchang; Chen, Sumei; Fu, Yan

    2016-05-01

    The underlying mechanisms of inhibitory effects induced by tetramethylpyrazine (TMP) on angiogenesis and tumor growth of lung cancer were investigated. In vitro cell proliferation, migration, and tube formation of human microvascular endothelial cells (HMEC-1) were evaluated by a 3-(4,5-dimethylthiazol-2-yl)-2,5-dephenyltetrazolium bromide (MTT), wound healing, Transwell, and Matrigel assays. The expression of BMP/Smad/Id-1 signals was detected by RT-PCR and western blotting. In an A549 xenograft tumor model, TMP (40 and 80 mg/kg/day) was intraperitoneally injected into mice. The expressions of CD31, phosphorylated Smad1/5/8, and Id-1 were measured by immunohistochemistry. We demonstrated that TMP inhibited proliferation, migration, and capillary tube formation of HMEC-1 in a dose- and time-dependent manner. Furthermore, treatment of HMEC-1 cells with TMP (0.4 mg/ml) significantly upregulated BMP2 expression and downregulated BMPRIA, BMPRII, phosphorylated Smad1/5/8, and Id-1 expression. In addition, administrations of TMP remarkably inhibited tumor growth of A549 xenograft in nude mice. The CD31, phosphorylated Smad1/5/8, and Id-1 expression were significantly inhibited in TMP-treated xenograft tumors compared with the vehicle. In conclusion, our results indicated that TMP suppressed angiogenesis and tumor growth of lung cancer via blocking the BMP/Smad/Id-1 signaling.

  19. GZD856, a novel potent PDGFRα/β inhibitor, suppresses the growth and migration of lung cancer cells in vitro and in vivo.

    PubMed

    Zhang, Zhang; Ren, Xiaomei; Lu, Xiaoyun; Wang, Deping; Hu, Xianjing; Zheng, Yi; Song, Liyan; Pang, Hongwen; Yu, Rongmin; Ding, Ke

    2016-05-28

    Platelet-derived growth factor receptors (PDGFRα/β) play critical roles in the autocrine-stimulated growth and recruitment of cancer-associated fibroblasts (CAFs) of human lung cancer cells. We have identified GZD856 as a new PDGFR inhibitor that potently inhibits PDGFRα/β kinase activity and blocks this signaling pathway in lung cancer cells both in vitro and in vivo. GZD856 strongly suppresses the proliferation of PDGFRα-amplified H1703 (PDGFRβ(-)) human lung cancer cells and demonstrates significant in vivo antitumor efficacy in a xenograft mouse model. Although GZD856 displays only limited in vitro antiproliferative efficiency against PDGFRα(-)/PDGFRβ(+) A549 lung cancer cells, it efficiently inhibits the in vivo growth and metastasis of A549 cancer cells in xenograft and orthotopic models, respectively. The promising in vivo antitumor activity of GZD856 in A549 models may result from its suppression of PDGFR-related microenvironment factors, such as recruitment of CAFs and collagen content in stromal cells. GZD856 may be considered as a promising new candidate for anti-lung cancer drug development. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. The aqueous extract of Brucea javanica suppresses cell growth and alleviates tumorigenesis of human lung cancer cells by targeting mutated epidermal growth factor receptor

    PubMed Central

    Kim, Seung-Hun; Liu, Chun-Yen; Fan, Po-Wei; Hsieh, Chang-Heng; Lin, Hsuan-Yuan; Lee, Ming-Chung; Fang, Kang

    2016-01-01

    As a practical and safe herbal medicine, the seeds of Brucea javanica (L.) Merr., were used to cure patients suffering from infectious diseases such as malaria. Recent advances revealed that the herb could also be a useful cancer therapy agent. The study demonstrated that aqueous B. javanica (BJ) extract attenuated the growth of human non-small-lung cancer cells bearing mutant L858R/T790M epidermal growth factor receptor (EGFR). The reduced cell viability in H1975 cells was attributed to apoptosis. Transfection of EGFR small hairpin RNA reverted the sensitivities. When nude mice were fed BJ extract, the growth of xenograft tumors, as established by H1975 cells, was suppressed. Additional histological examination and fluorescence analysis of the resected tissues proved that the induced apoptosis mitigated tumor growth. The work proved that the BJ extract exerted its effectiveness by targeting lung cancer cells carrying mutated EGFR while alleviating tumorigenesis. Aqueous BJ extract is a good candidate to overcome drug resistance in patients undergoing target therapy. PMID:27843300

  1. Interleukin-8 stimulates cell proliferation in non-small cell lung cancer through epidermal growth factor receptor transactivation.

    PubMed

    Luppi, F; Longo, A M; de Boer, W I; Rabe, K F; Hiemstra, P S

    2007-04-01

    Interleukin-8 (IL-8; CXCL8) is a cytokine of the CXC chemokine family that is involved in neutrophil recruitment and activation. In addition, IL-8 has been implicated in a wide variety of other processes, including angiogenesis and metastasis in lung cancer. Lung adenocarcinoma and muco-epidermoid carcinoma cells produce substantial amounts of IL-8, and express both CXCR1 and CXCR2 IL-8 receptors. We hypothesized that IL-8 stimulates proliferation of non-small cell lung cancer cells, involving transactivation of the epidermal growth factor receptor (EGFR). The EGFR plays a central role in regulating cell proliferation and it has been therefore implicated in lung cancer. Both EGFR ligands and transactivation of the receptor may lead to downstream signalling events, including mitogen-activated protein kinase (MAPK) activation. Transactivation of the EGFR has been shown to occur in response to ligands of various G-protein coupled receptors (GPCRs) and involves metalloproteinase-mediated release of membrane bound EGFR ligands. The aim of the present study was to investigate the effect of IL-8 on proliferation of lung adenocarcinoma and muco-epidermoid carcinoma cells, and to explore the mechanisms leading to this proliferation in two different non-small cell lung cancer cell lines (A549 and NCI-H292). In both NSCLC cell lines, we observed that IL-8 stimulates epithelial cell proliferation in a dose-dependent manner. The ability of IL-8 to increase cell proliferation was blocked both by an inhibitor of EGFR tyrosine kinase, by a specific anti-EGFR blocking antibody and by a panmetalloproteinase inhibitor. Similar results were obtained using the GPCR inhibitor pertussis toxin. Inhibition of the MAPK p42/44 (ERK1/2) also blocked the mitogenic effect of IL-8, while a p38 MAPK inhibitor did not affect IL-8-induced cell proliferation. These results suggest that IL-8 increases cell proliferation in NSCLC cell lines via transactivation of the EGFR and that this mechanism

  2. Is there a role for epidermal growth factor receptor tyrosine kinase inhibitors in epidermal growth factor receptor wild-type non-small cell lung cancer?

    PubMed Central

    Arriola, Edurne; Taus, Álvaro; Casadevall, David

    2015-01-01

    Non-small cell lung cancer (NSCLC) is the most common type of lung cancer with a world-wide annual incidence of around 1.3 million. The majority of patients are diagnosed with advanced disease and survival remains poor. However, relevant advances have occurred in recent years through the identification of biomarkers that predict for benefit of therapeutic agents. This is exemplified by the efficacy of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors for the treatment of EGFR mutant patients. These drugs have also shown efficacy in unselected populations but this point remains controversial. Here we have reviewed the clinical data that demonstrate a small but consistent subgroup of EGFR wild-type patients with NSCLC that obtain a clinical benefit from these drugs. Moreover, we review the biological rationale that may explain this benefit observed in the clinical setting. PMID:26266101

  3. Screening for Lung Cancer

    PubMed Central

    Mazzone, Peter J.; Naidich, David P.; Bach, Peter B.

    2013-01-01

    Background: Lung cancer is by far the major cause of cancer deaths largely because in the majority of patients it is at an advanced stage at the time it is discovered, when curative treatment is no longer feasible. This article examines the data regarding the ability of screening to decrease the number of lung cancer deaths. Methods: A systematic review was conducted of controlled studies that address the effectiveness of methods of screening for lung cancer. Results: Several large randomized controlled trials (RCTs), including a recent one, have demonstrated that screening for lung cancer using a chest radiograph does not reduce the number of deaths from lung cancer. One large RCT involving low-dose CT (LDCT) screening demonstrated a significant reduction in lung cancer deaths, with few harms to individuals at elevated risk when done in the context of a structured program of selection, screening, evaluation, and management of the relatively high number of benign abnormalities. Whether other RCTs involving LDCT screening are consistent is unclear because data are limited or not yet mature. Conclusions: Screening is a complex interplay of selection (a population with sufficient risk and few serious comorbidities), the value of the screening test, the interval between screening tests, the availability of effective treatment, the risk of complications or harms as a result of screening, and the degree with which the screened individuals comply with screening and treatment recommendations. Screening with LDCT of appropriate individuals in the context of a structured process is associated with a significant reduction in the number of lung cancer deaths in the screened population. Given the complex interplay of factors inherent in screening, many questions remain on how to effectively implement screening on a broader scale. PMID:23649455

  4. M867, a novel selective inhibitor of caspase-3 enhances cell death and extends tumor growth delay in irradiated lung cancer models.

    PubMed

    Kim, Kwang Woon; Moretti, Luigi; Lu, Bo

    2008-05-28

    Lung cancer remains the leading cause of cancer death worldwide. Radioresistance of lung cancer cells results in unacceptable rate of loco-regional failure. Although radiation is known to induce apoptosis, our recent study showed that knockdown of pro-apoptotic proteins Bak and Bax resulted in an increase in autophagic cell death and lung cancer radiosensitivity in vitro. To further explore the potential of apoptosis inhibition as a way to sensitize lung cancer for therapy, we tested M867, a novel chemical and reversible caspase-3 inhibitor, in combination with ionizing radiation in vivo and in vitro. M867 reduced clonogenic survival in H460 lung cancer cells (DER = 1.27, p = 0.007) compared to the vehicle-treated treated cells. We found that administration of M867 with ionizing radiation in an in vivo mouse hind limb lung cancer model was well tolerated, and produced a significant tumor growth delay compared to radiation alone. A dramatic decrease in tumor vasculature was observed with M867 and radiation using von Willebrand factor staining. In addition, Ki67 index showed >5-fold reduction of tumor proliferation in the combination therapy group, despite the reduced levels of apoptosis observed with terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling staining. Radiosensitizing effect of M867 through inhibiting caspases was validated using caspase-3/-7 double-knockout (DKO) mouse embryonic fibroblasts (MEF) cell model. Consistent with our previous study, autophagy contributed to the mechanism of increased cell death, following inhibition of apoptosis. In addition, matrigel assay showed a decrease in in vitro endothelial tubule formation during the M867/radiation combination treatment. M867 enhances the cytotoxic effects of radiation on lung cancer and its vasculature both in vitro and in vivo. M867 has the potential to prolong tumor growth delay by inhibiting tumor proliferation. Clinical trials are needed to determine the potential of this

  5. XCR1 promotes cell growth and migration and is correlated with bone metastasis in non-small cell lung cancer

    SciTech Connect

    Wang, Ting; Han, Shuai; Wu, Zhipeng; Han, Zhitao; Yan, Wangjun; Liu, Tielong; Wei, Haifeng; Song, Dianwen; Zhou, Wang Yang, Xinghai Xiao, Jianru

    2015-08-21

    Bone metastasis occurs in approximately 30–40% patients with advanced non-small cell lung cancer (NSCLC), but the mechanism underlying this bone metastasis remains poorly understood. The chemokine super family is believed to play an important role in tumor metastasis in lung cancer. The chemokine receptor XCR1 has been identified to promote cell proliferation and migration in oral cancer and ovarian carcinoma, but the role of XCR1 in lung cancer has not been reported. In this study, we demonstrated for the first time that XCR1 was overexpressed in lung cancer bone metastasis as compared with that in patients with primary lung cancer. In addition, the XCR1 ligand XCL1 promoted the proliferation and migration of lung cancer cells markedly, and knockdown of XCR1 by siRNA abolished the effect of XCL1 in cell proliferation and migration. Furthermore, we identified JAK2/STAT3 as a novel downstream pathway of XCR1, while XCL1/XCR1 increased the mRNA level of the downstream of JAK2/STAT3 including PIM1, JunB, TTP, MMP2 and MMP9. These results indicate that XCR1 is a new potential therapeutic target for the treatment of lung cancer bone metastasis. - Highlights: • XCR1 is overexpressed in bone metastasis compared with primary NSCLC. • XCR1 activation by XCL1 promotes lung cancer cell proliferation and migration. • JAK2/STAT3 is a novel potential downstream pathway of XCR1.

  6. Lung cancer - non-small cell

    MedlinePlus

    Cancer - lung - non-small cell; Non-small cell lung cancer; NSCLC; Adenocarcinoma - lung; Squamous cell carcinoma - lung ... Smoking causes most cases (around 90%) of lung cancer. The risk depends on the number of cigarettes ...

  7. Molecular biology of lung cancer.

    PubMed

    Cooper, Wendy A; Lam, David C L; O'Toole, Sandra A; Minna, John D

    2013-10-01

    Lung cancers are characterised by abundant genetic diversity with relatively few recurrent mutations occurring at high frequency. However, the genetic alterations often affect a common group of oncogenic signalling pathways. There have been vast improvements in our understanding of the molecular biology that underpins lung cancer in recent years and this has led to a revolution in the diagnosis and treatment of lung adenocarcinomas (ADC) based on the genotype of an individual's tumour. New technologies are identifying key and potentially targetable genetic aberrations not only in adenocarcinoma but also in squamous cell carcinoma (SCC) of the lung. Lung cancer mutations have been identified in v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS), epidermal growth factor receptor (EGFR), BRAF and the parallel phosphatidylinositol 3-kinase (PI3K) pathway oncogenes and more recently in MEK and HER2 while structural rearrangements in ALK, ROS1 and possibly rearranged during transfection (RET) provide new therapeutic targets. Amplification is another mechanism of activation of oncogenes such as MET in adenocarcinoma, fibroblastgrowth factor receptor 1 (FGFR1) and discoidin domain receptor 2 (DDR2) in SCC. Intriguingly, many of these genetic alternations are associated with smoking status and with particular racial and gender differences, which may provide insight into the mechanisms of carcinogenesis and role of host factors in lung cancer development and progression. The role of tumour suppressor genes is increasingly recognised with aberrations reported in TP53, PTEN, RB1, LKB11 and p16/CDKN2A. Identification of biologically significant genetic alterations in lung cancer that lead to activation of oncogenes and inactivation of tumour suppressor genes has the potential to provide further therapeutic opportunities. It is hoped that these discoveries may make a major contribution to improving outcome for patients with this poor prognosis disease.

  8. Identification of a long non-coding RNA gene, growth hormone secretagogue receptor opposite strand, which stimulates cell migration in non-small cell lung cancer cell lines.

    PubMed

    Whiteside, Eliza J; Seim, Inge; Pauli, Jana P; O'Keeffe, Angela J; Thomas, Patrick B; Carter, Shea L; Walpole, Carina M; Fung, Jenny N T; Josh, Peter; Herington, Adrian C; Chopin, Lisa K

    2013-08-01

    The molecular mechanisms involved in non‑small cell lung cancer tumourigenesis are largely unknown; however, recent studies have suggested that long non-coding RNAs (lncRNAs) are likely to play a role. In this study, we used public databases to identify an mRNA-like, candidate long non-coding RNA, GHSROS (GHSR opposite strand), transcribed from the antisense strand of the ghrelin receptor gene, growth hormone secretagogue receptor (GHSR). Quantitative real-time RT-PCR revealed higher expression of GHSROS in lung cancer tissue compared to adjacent, non-tumour lung tissue. In common with many long non-coding RNAs, GHSROS is 5' capped and 3' polyadenylated (mRNA-like), lacks an extensive open reading frame and harbours a transposable element. Engineered overexpression of GHSROS stimulated cell migration in the A549 and NCI-H1299 non-small cell lung cancer cell lines, but suppressed cell migration in the Beas-2B normal lung-derived bronchoepithelial cell line. This suggests that GHSROS function may be dependent on the oncogenic context. The identification of GHSROS, which is expressed in lung cancer and stimulates cell migration in lung cancer cell lines, contributes to the growing number of non-coding RNAs that play a role in the regulation of tumourigenesis and metastatic cancer progression.

  9. S100A4 is frequently overexpressed in lung cancer cells and promotes cell growth and cell motility

    SciTech Connect

    Chen, Na; Sato, Daisuke; Saiki, Yuriko; Sunamura, Makoto; Fukushige, Shinichi; Horii, Akira

    2014-05-09

    Highlights: • We observed frequent overexpression of S100A4 in lung cancer cell lines. • Knockdown of S100A4 suppressed proliferation in lung cancer cells. • Forced expression of S100A4 accelerated cell motility in lung cancer cells. • PRDM2 was found to be one of the downstream suppressed genes of S100A4. - Abstract: S100A4, a small calcium-binding protein belonging to the S100 protein family, is commonly overexpressed in a variety of tumor types and is widely accepted to associate with metastasis by regulating the motility and invasiveness of cancer cells. However, its biological role in lung carcinogenesis is largely unknown. In this study, we found that S100A4 was frequently overexpressed in lung cancer cells, irrespective of histological subtype. Then we performed knockdown and forced expression of S100A4 in lung cancer cell lines and found that specific knockdown of S100A4 effectively suppressed cell proliferation only in lung cancer cells with S100A4-overexpression; forced expression of S100A4 accelerated cell motility only in S100A4 low-expressing lung cancer cells. PRDM2 and VASH1, identified as novel upregulated genes by microarray after specific knockdown of S100A4 in pancreatic cancer, were also analyzed, and we found that PRDM2 was significantly upregulated after S100A4-knockdown in one of two analyzed S100A4-overexpressing lung cancer cells. Our present results suggest that S100A4 plays an important role in lung carcinogenesis by means of cell proliferation and motility by a pathway similar to that in pancreatic cancer.

  10. cAMP/CREB-regulated LINC00473 marks LKB1-inactivated lung cancer and mediates tumor growth

    PubMed Central

    Chen, Zirong; Lin, Shuibin; Cao, Chunxia; Gimbrone, Nicholas T.; Yang, Rongqiang; Fu, Dongtao A.; Carper, Miranda B.; Haura, Eric B.; Schabath, Matthew B.; Cress, W. Douglas; Kaye, Frederic J.

    2016-01-01

    The LKB1 tumor suppressor gene is frequently mutated and inactivated in non–small cell lung cancer (NSCLC). Loss of LKB1 promotes cancer progression and influences therapeutic responses in preclinical studies; however, specific targeted therapies for lung cancer with LKB1 inactivation are currently unavailable. Here, we have identified a long noncoding RNA (lncRNA) signature that is associated with the loss of LKB1 function. We discovered that LINC00473 is consistently the most highly induced gene in LKB1-inactivated human primary NSCLC samples and derived cell lines. Elevated LINC00473 expression correlated with poor prognosis, and sustained LINC00473 expression was required for the growth and survival of LKB1-inactivated NSCLC cells. Mechanistically, LINC00473 was induced by LKB1 inactivation and subsequent cyclic AMP–responsive element–binding protein (CREB)/CREB-regulated transcription coactivator (CRTC) activation. We determined that LINC00473 is a nuclear lncRNA and interacts with NONO, a component of the cAMP signaling pathway, thereby facilitating CRTC/CREB-mediated transcription. Collectively, our study demonstrates that LINC00473 expression potentially serves as a robust biomarker for tumor LKB1 functional status that can be integrated into clinical trials for patient selection and treatment evaluation, and implicates LINC00473 as a therapeutic target for LKB1-inactivated NSCLC. PMID:27140397

  11. Rig-G is a growth inhibitory factor of lung cancer cells that suppresses STAT3 and NF-κB.

    PubMed

    Li, Dong; Sun, Junjun; Liu, Wenfang; Wang, Xuan; Bals, Robert; Wu, Junlu; Quan, Wenqiang; Yao, Yiwen; Zhang, Yu; Zhou, Hong; Wu, Kaiyin

    2016-10-04

    The expression of the retinoic acid-induced G (Rig-G) gene, an all trans retinoic acid (ATRA)-inducible gene, was observed in multiple cancer cells, including lung cancer cells. However, whether Rig-G is a tumor suppressor in lung cancer is unknown. Here, we found that ectopic expression of Rig-G can lead to a significant decrease in proliferation of lung cancer cells, resulting in an inhibition of tumor growth. Rig-G knockdown results in a modest increase in cell proliferation, as well as confers an increase in colony formation. Furthermore, transcriptome and pathway analyses of cancer cells revealed a fundamental impact of Rig-G on various growth signaling pathways, including the NF-κB pathway. Rig-G inhibits NF-κB activity by suppressing STAT3 in lung cancer cells. The downregulation of miR21 and miR181b-1 and subsequent activation of PTEN/Akt and CYLD/IκB signaling axis leading to decreased NF-κB activity required to maintain the tumor-inhibiting effect of Rig-G.. Our findings contribute to a better understanding of the antitumor effect mechanism of Rig-G, as well as offer a novel strategy for lung cancer therapy.

  12. Rig-G is a growth inhibitory factor of lung cancer cells that suppresses STAT3 and NF-κB

    PubMed Central

    Wang, Xuan; Bals, Robert; Wu, Junlu; Quan, Wenqiang; Yao, Yiwen; Zhang, Yu; Zhou, Hong; Wu, Kaiyin

    2016-01-01

    The expression of the retinoic acid-induced G (Rig-G) gene, an all trans retinoic acid (ATRA)-inducible gene, was observed in multiple cancer cells, including lung cancer cells. However, whether Rig-G is a tumor suppressor in lung cancer is unknown. Here, we found that ectopic expression of Rig-G can lead to a significant decrease in proliferation of lung cancer cells, resulting in an inhibition of tumor growth. Rig-G knockdown results in a modest increase in cell proliferation, as well as confers an increase in colony formation. Furthermore, transcriptome and pathway analyses of cancer cells revealed a fundamental impact of Rig-G on various growth signaling pathways, including the NF-κB pathway. Rig-G inhibits NF-κB activity by suppressing STAT3 in lung cancer cells. The downregulation of miR21 and miR181b-1 and subsequent activation of PTEN/Akt and CYLD/IκB signaling axis leading to decreased NF-κB activity required to maintain the tumor-inhibiting effect of Rig-G.. Our findings contribute to a better understanding of the antitumor effect mechanism of Rig-G, as well as offer a novel strategy for lung cancer therapy. PMID:27602766

  13. miR-22 inhibits tumor growth and metastasis by targeting ATP citrate lyase: evidence in osteosarcoma, prostate cancer, cervical cancer and lung cancer

    PubMed Central

    Liu, Jianjun; Song, Shaoli; Zhao, Xiaoping; Miao, Ping; Tang, Tingting; Wang, Lei; Liu, Weichun; Yang, Xiaodi; Dai, Kerong; Huang, Gang

    2016-01-01

    MicroRNAs (miRNAs) are non-coding small RNAs that function as negative regulators of gene expression involving in the tumor biology. ATP citrate lyase (ACLY), a key enzyme initiating de novo lipid synthesis, has been found to be upregulated in cancer cells, and its inhibition causes suppressive effects in a variety of tumors. At present, although several ACLY inhibitors have been reported, the potential role of miRNAs in interfering ACLY still needs further clarification. Herein, four different types of tumor cells including osteosarcoma, prostate, cervical and lung cancers were adopted in our study, and we have demonstrated that miR-22 directly downregulated ACLY. Moreover, miR-22 was proved to attenuate cancer cell proliferation and invasion, as well as promote cell apoptosis via inhibiting ACLY. Additionally, we confirmed the higher ACLY protein levels and the lower miR-22 expressions in hundreds of clinical samples of the four primary tumors, and a negative correlation relationship between ACLY and miR-22 was clarified. Finally, in the four animal models, we found that along with the loss of the ACLY expression, the miR-22-treated mice developed rather smaller tumors, less probabilities of distant metastasis, and fairly longer survivals. De novo lipogenesis suppression triggered by miR-22-ACLY axis may contribute to the inhibition of tumor growth and metastasis. These findings provide unequivocal proofs that miR-22 is responsible for the posttranscriptional regulation of ACLY, which yields promising therapeutic effects in osteosarcoma, prostate, cervical and lung cancers. PMID:27317765

  14. miR-22 inhibits tumor growth and metastasis by targeting ATP citrate lyase: evidence in osteosarcoma, prostate cancer, cervical cancer and lung cancer.

    PubMed

    Xin, Mei; Qiao, Zhiguang; Li, Jing; Liu, Jianjun; Song, Shaoli; Zhao, Xiaoping; Miao, Ping; Tang, Tingting; Wang, Lei; Liu, Weichun; Yang, Xiaodi; Dai, Kerong; Huang, Gang

    2016-07-12

    MicroRNAs (miRNAs) are non-coding small RNAs that function as negative regulators of gene expression involving in the tumor biology. ATP citrate lyase (ACLY), a key enzyme initiating de novo lipid synthesis, has been found to be upregulated in cancer cells, and its inhibition causes suppressive effects in a variety of tumors. At present, although several ACLY inhibitors have been reported, the potential role of miRNAs in interfering ACLY still needs further clarification. Herein, four different types of tumor cells including osteosarcoma, prostate, cervical and lung cancers were adopted in our study, and we have demonstrated that miR-22 directly downregulated ACLY. Moreover, miR-22 was proved to attenuate cancer cell proliferation and invasion, as well as promote cell apoptosis via inhibiting ACLY. Additionally, we confirmed the higher ACLY protein levels and the lower miR-22 expressions in hundreds of clinical samples of the four primary tumors, and a negative correlation relationship between ACLY and miR-22 was clarified. Finally, in the four animal models, we found that along with the loss of the ACLY expression, the miR-22-treated mice developed rather smaller tumors, less probabilities of distant metastasis, and fairly longer survivals. De novo lipogenesis suppression triggered by miR-22-ACLY axis may contribute to the inhibition of tumor growth and metastasis. These findings provide unequivocal proofs that miR-22 is responsible for the posttranscriptional regulation of ACLY, which yields promising therapeutic effects in osteosarcoma, prostate, cervical and lung cancers.

  15. Growth inhibitory effects of miR-221 and miR-222 in non-small cell lung cancer cells

    PubMed Central

    Yamashita, Ryo; Sato, Mitsuo; Kakumu, Tomohiko; Hase, Tetsunari; Yogo, Naoyuki; Maruyama, Eiichi; Sekido, Yoshitaka; Kondo, Masashi; Hasegawa, Yoshinori

    2015-01-01

    Both pro- and anti-oncogenic roles of miR-221 and miR-222 microRNAs are reported in several types of human cancers. A previous study suggested their oncogenic role in invasiveness in lung cancer, albeit only one cell line (H460) was used. To further evaluate involvement of miR-221 and miR-222 in lung cancer, we investigated the effects of miR-221 and miR-222 overexpression on six lung cancer cell lines, including H460, as well as one immortalized normal human bronchial epithelial cell line, HBEC4. miR-221 and miR-222 induced epithelial-to-mesenchymal transition (EMT)-like changes in a minority of HBEC4 cells but, unexpectedly, both the microRNAs rather suppressed their invasiveness. Consistent with the prior report, miR-221 and miR-222 promoted growth in H460; however, miR-221 suppressed growth in four other cell lines with no effects in one, and miR-222 suppressed growth in three cell lines but promoted growth in two. These are the first results to show tumor-suppressive effects of miR-221 and miR-222 in lung cancer cells, and we focused on clarifying the mechanisms. Cell cycle and apoptosis analyses revealed that growth suppression by miR-221 and miR-222 occurred through intra-S-phase arrest and/or apoptosis. Finally, lung cancer cell lines transfected with miR-221 or miR-222 became more sensitive to the S-phase targeting drugs, possibly due to an increased S-phase population. In conclusion, our data are the first to show tumor-suppressive effects of miR-221 and miR-222 on lung cancer, warranting testing their potential as therapeutics for the disease. PMID:25641933

  16. Growth inhibitory effects of miR-221 and miR-222 in non-small cell lung cancer cells.

    PubMed

    Yamashita, Ryo; Sato, Mitsuo; Kakumu, Tomohiko; Hase, Tetsunari; Yogo, Naoyuki; Maruyama, Eiichi; Sekido, Yoshitaka; Kondo, Masashi; Hasegawa, Yoshinori

    2015-04-01

    Both pro- and anti-oncogenic roles of miR-221 and miR-222 microRNAs are reported in several types of human cancers. A previous study suggested their oncogenic role in invasiveness in lung cancer, albeit only one cell line (H460) was used. To further evaluate involvement of miR-221 and miR-222 in lung cancer, we investigated the effects of miR-221 and miR-222 overexpression on six lung cancer cell lines, including H460, as well as one immortalized normal human bronchial epithelial cell line, HBEC4. miR-221 and miR-222 induced epithelial-to-mesenchymal transition (EMT)-like changes in a minority of HBEC4 cells but, unexpectedly, both the microRNAs rather suppressed their invasiveness. Consistent with the prior report, miR-221 and miR-222 promoted growth in H460; however, miR-221 suppressed growth in four other cell lines with no effects in one, and miR-222 suppressed growth in three cell lines but promoted growth in two. These are the first results to show tumor-suppressive effects of miR-221 and miR-222 in lung cancer cells, and we focused on clarifying the mechanisms. Cell cycle and apoptosis analyses revealed that growth suppression by miR-221 and miR-222 occurred through intra-S-phase arrest and/or apoptosis. Finally, lung cancer cell lines transfected with miR-221 or miR-222 became more sensitive to the S-phase targeting drugs, possibly due to an increased S-phase population. In conclusion, our data are the first to show tumor-suppressive effects of miR-221 and miR-222 on lung cancer, warranting testing their potential as therapeutics for the disease.

  17. Alterations of tumor microenvironment by carbon monoxide impedes lung cancer growth

    PubMed Central

    Nemeth, Zsuzsanna; Csizmadia, Eva; Vikstrom, Lisa; Li, Mailin; Bisht, Kavita; Feizi, Alborz; Otterbein, Sherrie; Zuckerbraun, Brian; Costa, Daniel B.; Pandolfi, Pier Paolo; Fillinger, Janos; Döme, Balazs; Otterbein, Leo E.; Wegiel, Barbara

    2016-01-01

    We hypothesized that tumor-associated macrophages (TAMs) are controlled by the diffusible gas carbon monoxide (CO). We demonstrate that induction of apoptosis in lung tumors treated with low doses of CO is associated with increased CD86 expression and activation of mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinases (Erk) 1/2 pathway in tumor microenvironment. Presence of CD86-positive cells was required for the anti-tumoral effects of CO in established A549 xenografts. We show that the effects of CO on tumor stroma and reprogramming of macrophages towards the anti-tumoral phenotype is mediated by reactive oxygen species (ROS)-dependent activation of MAPK/Erk1/2-c-myc pathway as well as Notch 1-dependent negative feedback on the metabolic enzyme heme oxygenase-1 (HO-1). We find a similar negative correlation between HO-1 and active MAPK-Erk1/2 levels in human lung cancer specimens. In summary, we describe novel non-cell autonomous mechanisms by which the diffusible gas CO dictates changes in the tumor microenvironment through the modulation of macrophages. PMID:26993595

  18. A Specific Mixture of Nutrients Suppresses Ovarian Cancer A-2780 Tumor Incidence, Growth, and Metastasis to Lungs

    PubMed Central

    Roomi, Mohd Waheed; Kalinovsky, Tatiana; Rath, Matthias; Niedzwiecki, Aleksandra

    2017-01-01

    with EPQ, and H & E staining showed no morphological changes below 500 μg/mL EPQ. These results suggest that EPQ has therapeutic potential in the treatment of ovarian cancer by significantly suppressing ovarian tumor incidence and growth and lung metastasis, and by inhibiting MMP-9 secretion and invasion of A-2780 ovarian cancer cells. PMID:28335466

  19. A Specific Mixture of Nutrients Suppresses Ovarian Cancer A-2780 Tumor Incidence, Growth, and Metastasis to Lungs.

    PubMed

    Roomi, Mohd Waheed; Kalinovsky, Tatiana; Rath, Matthias; Niedzwiecki, Aleksandra

    2017-03-18

    proliferation with EPQ, and H & E staining showed no morphological changes below 500 μg/mL EPQ. These results suggest that EPQ has therapeutic potential in the treatment of ovarian cancer by significantly suppressing ovarian tumor incidence and growth and lung metastasis, and by inhibiting MMP-9 secretion and invasion of A-2780 ovarian cancer cells.

  20. Effective growth-suppressive activity of maternal embryonic leucine-zipper kinase (MELK) inhibitor against small cell lung cancer

    PubMed Central

    Inoue, Hiroyuki; Kato, Taigo; Olugbile, Sope; Tamura, Kenji; Chung, Suyoun; Miyamoto, Takashi; Matsuo, Yo; Salgia, Ravi; Nakamura, Yusuke; Park, Jae-Hyun

    2016-01-01

    Maternal embryonic leucine zipper kinase (MELK), that plays a critical role in maintenance of cancer stem cells (CSCs), is predominantly expressed in various types of human cancer including small cell lung cancer (SCLC). SCLC usually acquires resistance to anti-cancer drugs and portends dismal prognosis. We have delineated roles of MELK in development/progression of SCLC and examined anti-tumor efficacy of OTS167, a highly potent MELK inhibitor, against SCLC. MELK expression was highly upregulated in both SCLC cell lines and primary tumors. siRNA-mediated MELK knockdown induced significant growth inhibition in SCLC cell lines. Concordantly, treatment with OTS167 exhibited strong cytotoxicity against eleven SCLC cell lines with IC50 of < 10 nM. As similar to siRNA knockdown, OTS167 treatment induced cytokinetic defects with intercellular bridges, and in some cell lines we observed formation of neuronal protrusions accompanied with increase of a neuronal differentiation marker (CD56), indicating that the compound induced differentiation of cancer cells to neuron-like cells. Furthermore, the MELK inhibition decreased its downstream FOXM1 activity and Akt expression in SCLC cells, and led to apoptotic cell death. OTS167 appeared to be more effective to CSCs as measured by the sphere formation assay, thus MELK inhibition might become a promising treatment modality for SCLC. PMID:26871945

  1. The ALCHEMIST Lung Cancer Trial

    Cancer.gov

    A collection of material about the ALCHEMIST lung cancer trial that will examine tumor tissue from patients with early-stage, completely resected lung cancer for gene mutations in the EGFR and ALK genes, and a

  2. Stanniocalcin-2 (STC2): A potential lung cancer biomarker promotes lung cancer metastasis and progression.

    PubMed

    Na, Sang-su; Aldonza, Mark Borris; Sung, Hye-Jin; Kim, Yong-In; Son, Yeon Sung; Cho, Sukki; Cho, Je-Yoel

    2015-06-01

    The homodimeric glycoprotein, stanniocalcin 2 (STC2) is previously known to be involved in the regulation of calcium and phosphate transport in the kidney and also reported to play multiple roles in several cancers. However, its function and clinical significance in lung cancer have never been reported and still remain uncertain. Here, we investigated the possibility of STC2 as a lung cancer biomarker and identified its potential role in lung cancer cell growth, metastasis and progression. Proteomic analysis of secretome of primary cultured lung cancer cells revealed higher expression of STC2 in cancers compared to that of adjacent normal cells. RT-PCR and Western blot analyses showed higher mRNA and protein expressions of STC2 in lung cancer tissues compared to the adjacent normal tissues. Knockdown of STC2 in H460 lung cancer cells slowed down cell growth progression and colony formation. Further analysis revealed suppression of migration, invasion and delayed G0/G1 cell cycle progression in the STC2 knockdown cells. STC2 knockdown also attenuated the H202-induced oxidative stress on H460 cell viability with a subsequent increase in intracellular ROS levels, which suggest a protective role of STC2 in redox regulatory system of lung cancer. These findings suggest that STC2 can be a potential lung cancer biomarker and plays a positive role in lung cancer metastasis and progression. This article is part of a Special Issue entitled: Medical Proteomics. Copyright © 2015. Published by Elsevier B.V.

  3. Frequency of Epidermal Growth Factor Receptor Mutation in Smokers with Lung Cancer Without Pulmonary Emphysema.

    PubMed

    Takeda, Kenichi; Yamasaki, Akira; Igishi, Tadashi; Kawasaki, Yuji; Ito-Nishii, Shizuka; Izumi, Hiroki; Sakamoto, Tomohiro; Touge, Hirokazu; Kodani, Masahiro; Makino, Haruhiko; Yanai, Masaaki; Tanaka, Natsumi; Matsumoto, Shingo; Araki, Kunio; Nakamura, Hiroshige; Shimizu, Eiji

    2017-02-01

    Chronic obstructive pulmonary disease is a smoking-related disease, and is categorized into the emphysema and airway dominant phenotypes. We examined the relationship between emphysematous changes and epidermal growth factor receptor (EGFR) mutation status in patients with lung adenocarcinoma. The medical records for 250 patients with lung adenocarcinoma were retrospectively reviewed. All patients were categorized into the emphysema or non-emphysema group. Wild-type EGFR was detected in 136 (54%) and mutant EGFR in 48 (19%). Emphysematous changes were observed in 87 (36%) patients. EGFR mutation was highly frequent in the non-emphysema group (p=0.0014). Multivariate logistic regression analysis showed that emphysema was an independent risk factor for reduced frequency of EGFR mutation (Odds Ratio=3.47, p=0.005). Our data showed a relationship between emphysematous changes and EGFR mutation status. There might be mutually exclusive genetic risk factors for carcinogenesis and development of emphysematous changes. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  4. Targeted Expression of miR-7 Operated by TTF-1 Promoter Inhibited the Growth of Human Lung Cancer through the NDUFA4 Pathway.

    PubMed

    Lei, Liangyu; Chen, Chao; Zhao, Juanjuan; Wang, HaiRong; Guo, Mengmeng; Zhou, Ya; Luo, Junming; Zhang, Jidong; Xu, Lin

    2017-03-17

    Targeted expression of gene technique is an important therapeutic strategy for lung cancer. MicroRNA-7 has been well documented as a promising tumor suppressor but never been test in specific gene-promoter-targeted expression in cancer gene therapy. Here, we first evaluated the efficacy of miR-7 expression operated by the promoter of TTF-1, a lineage-specific oncogene in lung cancer, in vitro using an eukaryotic vector of TTF-1-promoter-operated expression of miR-7 (termed as p-T-miR-7). Interestingly, using a nude mice model, the growth and metastasis of human lung cancer cells in vivo were significantly reduced in remote hypodermic injection of the p-T-miR-7 group, accompanied by increased expression of miR-7 and reduced transduction of the Akt and Erk pathway in situ. Mechanism aspect, global gene expression analysis showed that downregulation of NDUFA4, a novel target of miR-7, contributed to the effects of miR-7 expression operated by TTF-1 promoter on the growth and metastasis of human lung cancer cells, as well as altered transduction of the Akt and Erk pathway. Finally, there was no significant difference in weight or histopathology of other organs. These data provided a basis for development of novel modality of miRNA-based targeted expression therapy against clinical lung cancer.

  5. Small Cell Lung Cancer

    PubMed Central

    Kalemkerian, Gregory P.; Akerley, Wallace; Bogner, Paul; Borghaei, Hossein; Chow, Laura QM; Downey, Robert J.; Gandhi, Leena; Ganti, Apar Kishor P.; Govindan, Ramaswamy; Grecula, John C.; Hayman, James; Heist, Rebecca Suk; Horn, Leora; Jahan, Thierry; Koczywas, Marianna; Loo, Billy W.; Merritt, Robert E.; Moran, Cesar A.; Niell, Harvey B.; O’Malley, Janis; Patel, Jyoti D.; Ready, Neal; Rudin, Charles M.; Williams, Charles C.; Gregory, Kristina; Hughes, Miranda

    2013-01-01

    Neuroendocrine tumors account for approximately 20% of lung cancers; most (≈15%) are small cell lung cancer (SCLC). These NCCN Clinical Practice Guidelines in Oncology for SCLC focus on extensive-stage SCLC because it occurs more frequently than limited-stage disease. SCLC is highly sensitive to initial therapy; however, most patients eventually die of recurrent disease. In patients with extensive-stage disease, chemotherapy alone can palliate symptoms and prolong survival in most patients; however, long-term survival is rare. Most cases of SCLC are attributable to cigarette smoking; therefore, smoking cessation should be strongly promoted. PMID:23307984

  6. Small cell lung cancer.

    PubMed

    Kalemkerian, Gregory P; Akerley, Wallace; Bogner, Paul; Borghaei, Hossein; Chow, Laura Qm; Downey, Robert J; Gandhi, Leena; Ganti, Apar Kishor P; Govindan, Ramaswamy; Grecula, John C; Hayman, James; Heist, Rebecca Suk; Horn, Leora; Jahan, Thierry; Koczywas, Marianna; Loo, Billy W; Merritt, Robert E; Moran, Cesar A; Niell, Harvey B; O'Malley, Janis; Patel, Jyoti D; Ready, Neal; Rudin, Charles M; Williams, Charles C; Gregory, Kristina; Hughes, Miranda

    2013-01-01

    Neuroendocrine tumors account for approximately 20% of lung cancers; most (≈15%) are small cell lung cancer (SCLC). These NCCN Clinical Practice Guidelines in Oncology for SCLC focus on extensive-stage SCLC because it occurs more frequently than limited-stage disease. SCLC is highly sensitive to initial therapy; however, most patients eventually die of recurrent disease. In patients with extensive-stage disease, chemotherapy alone can palliate symptoms and prolong survival in most patients; however, long-term survival is rare. Most cases of SCLC are attributable to cigarette smoking; therefore, smoking cessation should be strongly promoted.

  7. Radiotherapy for lung cancer

    SciTech Connect

    Bleehen, N.M.; Cox, J.D.

    1985-05-01

    The role of radiation therapy in the management of lung cancer was reviewed at a workshop held in Cambridge, England, in June 1984. It was concluded that there was a continuing role for radiation therapy in the primary management of small cell lung cancer, including the loco-regional treatment for patients with limited disease. Radical radiotherapy for patients with non-small cell carcinoma could be curative for a proportion of patients with limited disease. Careful planning and quality control was essential. Palliative radiotherapy provided useful treatment for many other patients. Other related aspects of treatment are also presented.

  8. Sepia ink oligopeptide induces apoptosis and growth inhibition in human lung cancer cells

    PubMed Central

    Zhou, Guoren; Xie, Peng; Ye, Jinjun

    2017-01-01

    Sepia ink oligopeptide (SIO), as a tripeptide extracted from Sepia ink, could be used as an inducer of apoptosis in human prostate cancer cells. We designed a cyclo-mimetic peptide of SIO by introducing a disulfide bond to stabilize the native peptide into beta turn structure, and produced a peptide with higher cell permeability and stability. Through labeling an FITC to the N-terminus of the peptide, the cell permeability was examined. Stabilized peptide showed enhanced cellular uptake than linear tripeptide as indicated by flow cytometry and cell fluorescent imaging. The high intracellular delivery of stable SIO could more efficiently inhibit cell proliferation and induce apoptosis. Furthermore, the expression of the anti-apoptotic protein Bcl-2 was down-regulated, whereas pro-apoptotic proteins P53 and caspase-3 were up-regulated by stable SIO. In conclusion, our study is the first to use stable SIO to induce apoptosis in two lung cancer cells A549 and H1299. PMID:28423568

  9. Lung Cancer Brain Metastases.

    PubMed

    Goldberg, Sarah B; Contessa, Joseph N; Omay, Sacit B; Chiang, Veronica

    2015-01-01

    Brain metastases are common among patients with lung cancer and have been associated with significant morbidity and limited survival. However, the treatment of brain metastases has evolved as the field has advanced in terms of central nervous system imaging, surgical technique, and radiotherapy technology. This has allowed patients to receive improved treatment with less toxicity and more durable benefit. In addition, there have been significant advances in systemic therapy for lung cancer in recent years, and several treatments including chemotherapy, targeted therapy, and immunotherapy exhibit activity in the central nervous system. Utilizing systemic therapy for treating brain metastases can avoid or delay local therapy and often allows patients to receive effective treatment for both intracranial and extracranial disease. Determining the appropriate treatment for patients with lung cancer brain metastases therefore requires a clear understanding of intracranial disease burden, tumor histology, molecular characteristics, and overall cancer prognosis. This review provides updates on the current state of surgery and radiotherapy for the treatment of brain metastases, as well as an overview of systemic therapy options that may be effective in select patients with intracranial metastases from lung cancer.

  10. Silencing survivin expression inhibits the tumor growth of non-small-cell lung cancer cells in vitro and in vivo.

    PubMed

    Zhang, Kejian; Li, Yang; Liu, Wei; Gao, Xinliang; Zhang, Kewei

    2015-01-01

    Survivin is a promising anticancer therapeutic target due to its important role in the inhibition of apoptosis of tumor cells. However, little is currently known about its role in non small cell lung cancer (NSCLC). The present study evaluated whether the downregulation of survivin expression would affect cell proliferation, cell cycle distribution, apoptosis and colony formation of NSCLC. A recombinant lentiviral small hairpin RNA (shRNA) expression vector, which specifically targeted survivin, was constructed and transfected into the A549 human NSCLC cell line. Quantitative polymerase chain reaction and western blotting were used to determine the mRNA and protein expression levels of survivin, 48 h following the knockdown of survivin expression. Cell proliferation, apoptosis, cell cycle distribution and colony formation were determined following the downregulation of survivin by shRNA. In addition, A549 cells were injected into nude mice, and the effects of shRNA targeting the survivin gene on tumor growth were assessed. Downregulation of survivin expression, using the RNA silencing approach in A549 tumor cells, significantly suppressed the proliferation and colony formation ability of the cells, and induced tumor apoptosis in vitro. The nude mice inoculated with A549 cells developed cancer, and treatment with shRNA targeting survivin markedly inhibited the growth of these cancers, with no obvious side effects. The results of the present study suggest that suppression of survivin expression by RNA interference may induce NSCLC apoptosis, and provide a novel approach for anticancer gene therapy.

  11. Epidermal growth factor receptor polymorphisms and clinical outcomes in non-small-cell lung cancer patients treated with gefitinib.

    PubMed

    Liu, G; Gurubhagavatula, S; Zhou, W; Wang, Z; Yeap, B Y; Asomaning, K; Su, L; Heist, R; Lynch, T J; Christiani, D C

    2008-04-01

    The-216G/T, -191C/A, intron 1 and Arg497Lys epidermal growth factor receptor (EGFR) polymorphisms were evaluated in 92 advanced non-small-cell lung cancer patients treated with gefitinib, an EGFR tyrosine-kinase inhibitor. Improved progression free survival (PFS) was found in patients homozygous for the shorter lengths of intron 1 polymorphism (S/S; S=16 or fewer CA repeats; log-rank test (LRT) P=0.03) and for patients carrying any T allele of the -216G/T polymorphism (LRT, P=0.005). When considered together, patients with intron 1 S/S genotype and at least one T allele of -216G/T had improved PFS (LRT P=0.0006; adjusted hazard ratio (AHR), 0.60 (95% confidence interval, 0.36-0.98)) and overall survival (LRT P=0.02; AHR, 0.60 (0.36-1.00)) when compared with all others. The T allele of -216G/T was also associated with significantly higher rates of stable disease/partial response (P=0.01) and a significantly higher risk of treatment-related rash/diarrhea (P=0.004, multivariate model). EGFR intron 1 and -216G/T polymorphisms influence clinical outcomes in gefitinib-treated non-small-cell lung cancer patients.

  12. miR-203 enhances let-7 biogenesis by targeting LIN28B to suppress tumor growth in lung cancer

    PubMed Central

    Zhou, Yong; Liang, Hongwei; Liao, Zhicong; Wang, Yanbo; Hu, Xiuting; Chen, Xi; Xu, Lin; Hu, Zhibin

    2017-01-01

    Human cancers often exhibit increased microRNA (miRNA) biogenesis and global aberrant expression of miRNAs; thus, targeting the miRNA biogenesis pathway represents a novel strategy for cancer therapy. Here, we report that miR-203 enhances the biogenesis of tumor suppressor let-7 in lung cancer by directly targeting LIN28B. Specially, we found that the LIN28B protein levels were dramatically increased in lung cancer tissues, but its mRNA levels did not differ significantly, suggesting that a post-transcriptional mechanism is involved in LIN28B regulation. Interestingly, miR-203 overexpression was accompanied by massive upregulation of a group of miRNAs, especially let-7, and the let-7 expression level was concordant with the miR-203 expression in lung cancer tissues, implying its biological relevance. Furthermore, we showed that miR-203 played a critical role in inhibiting the proliferation and promoting the apoptosis of lung cancer cells by suppressing LIN28B and enhancing let-7 biogenesis. In summary, our results establish a novel mechanism by which miR-203, LIN28B and let-7 are tightly linked to form a regulatory network in lung cancer cells. The findings shed light on the role of a specific miRNA as a modulator of miRNA biogenesis and provide basis for developing new strategies for lung cancer therapy. PMID:28218277

  13. miR-203 enhances let-7 biogenesis by targeting LIN28B to suppress tumor growth in lung cancer.

    PubMed

    Zhou, Yong; Liang, Hongwei; Liao, Zhicong; Wang, Yanbo; Hu, Xiuting; Chen, Xi; Xu, Lin; Hu, Zhibin

    2017-02-20

    Human cancers often exhibit increased microRNA (miRNA) biogenesis and global aberrant expression of miRNAs; thus, targeting the miRNA biogenesis pathway represents a novel strategy for cancer therapy. Here, we report that miR-203 enhances the biogenesis of tumor suppressor let-7 in lung cancer by directly targeting LIN28B. Specially, we found that the LIN28B protein levels were dramatically increased in lung cancer tissues, but its mRNA levels did not differ significantly, suggesting that a post-transcriptional mechanism is involved in LIN28B regulation. Interestingly, miR-203 overexpression was accompanied by massive upregulation of a group of miRNAs, especially let-7, and the let-7 expression level was concordant with the miR-203 expression in lung cancer tissues, implying its biological relevance. Furthermore, we showed that miR-203 played a critical role in inhibiting the proliferation and promoting the apoptosis of lung cancer cells by suppressing LIN28B and enhancing let-7 biogenesis. In summary, our results establish a novel mechanism by which miR-203, LIN28B and let-7 are tightly linked to form a regulatory network in lung cancer cells. The findings shed light on the role of a specific miRNA as a modulator of miRNA biogenesis and provide basis for developing new strategies for lung cancer therapy.

  14. [Epidemiology of lung cancer].

    PubMed

    Becker, N

    2010-08-01

    Lung cancer is by far the most common form of cancer worldwide and in Germany is now "only" still the commonest cause of death from cancer. The most important single risk factor is smoking but in selected population groups, for example in the professional area, other factors can also play a role which cannot be ignored and open up a corresponding potential for prevention. Effective early detection procedures are at present unknown. The most promising, however, is multislice computed tomography (MSCT) which for this reason is presently being tested for effectiveness in several large research projects. The results are not expected for some years. Until then the early detection of lung cancer with MSCT cannot be considered suitable for routine use but can only be justified within the framework of research studies.

  15. MicroRNA-222 promotes human non-small cell lung cancer H460 growth by targeting p27.

    PubMed

    Zhong, Chongjun; Ding, Shengguang; Xu, Yiming; Huang, Haitao

    2015-01-01

    Two highly homologous microRNAs (miRNAs, miRs), miR-222 and miR-221, act as a cluster in cellular regulation. We have previously reported that miR-221 promoted the growth of human non-small cell lung cancer cell line H460. However, the role of miR-222 in regulating the growth of H460 is unclear. H460 cells were transfected with miR-222 mimics, inhibitors or their negative controls and their effects were confirmed by Real-time quantitative reverse transcription polymerase chain reactions (qRT-PCRs). Cell viability was assessed by Cell Counting Kit-8 (CCK-8) while cell proliferation was determined by 5-Ethynyl-2'-deoxyuridine (EdU) assay. P27 and P57, two putative targets of miR-222, were checked by qRT-PCRs. We found that miR-222 overexpression increased cell viability and proliferative rate in H460 cells while opposite effects were obtained by down-regulation of miR-222. P27 but not P57 was identified as a potential target of miR-222 in H460 cells as P27 was negatively regulated by miR-222 in the protein level. In summary, the present study indicates that miR-222 controls the growth of H460 likely by targeting P27. Inhibition of miR-222 might be a novel therapy for human non-small cell lung cancer.

  16. Bioinformatics Analyses of the Role of Vascular Endothelial Growth Factor in Patients with Non-Small Cell Lung Cancer.

    PubMed

    Wang, Ying; Huang, Lu; Wu, Shuqiang; Jia, Yongshi; Yang, Yunmei; Luo, Limin; Bi, Aihong; Fang, Min

    2015-01-01

    This study was aimed to identify the expression pattern of vascular endothelial growth factor (VEGF) in non-small cell lung cancer (NSCLC) and to explore its potential correlation with the progression of NSCLC. Gene expression profile GSE39345 was downloaded from the Gene Expression Omnibus database. Twenty healthy controls and 32 NSCLC samples before chemotherapy were analyzed to identify the differentially expressed genes (DEGs). Then pathway enrichment analysis of the DEGs was performed and protein-protein interaction networks were constructed. Particularly, VEGF genes and the VEGF signaling pathway were analyzed. The sub-network was constructed followed by functional enrichment analysis. Total 1666 up-regulated and 1542 down-regulated DEGs were identified. The down-regulated DEGs were mainly enriched in the pathways associated with cancer. VEGFA and VEGFB were found to be the initiating factor of VEGF signaling pathway. In addition, in the epidermal growth factor receptor (EGFR), VEGFA and VEGFB associated sub-network, kinase insert domain receptor (KDR), fibronectin 1 (FN1), transforming growth factor beta induced (TGFBI) and proliferating cell nuclear antigen (PCNA) were found to interact with at least two of the three hub genes. The DEGs in this sub-network were mainly enriched in Gene Ontology terms related to cell proliferation. EGFR, KDR, FN1, TGFBI and PCNA may interact with VEGFA to play important roles in NSCLC tumorigenesis. These genes and corresponding proteins may have the potential to be used as the targets for either diagnosis or treatment of patients with NSCLC.

  17. [Secondary lung cancers].

    PubMed

    Etienne-Mastroïanni, Bénédicte; Freyer, Gilles; Cordier, Jean-François

    2003-04-01

    Lung is the most common site of metastatic involvement for many malignant tumors. The most frequent abnormalities are solitary or multiple pulmonary nodules (large "cannonball" nodules or diffuse miliary pattern), and lymphangitic carcinomatosis. Pulmonary metastases usually occur in a context of a previously known tumour, but sometimes may reveal a latent tumour. Most patients receive palliative treatment with chemotherapy, or hormone therapy (for metastases of breast cancer, thyroid, endometrial carcinoma or prostatic cancer). Patients may rarely benefit from resection of pulmonary metastases.

  18. ROCK1 and ROCK2 are required for non-small cell lung cancer anchorage-independent growth and invasion.

    PubMed

    Vigil, Dominico; Kim, Tai Young; Plachco, Ana; Garton, Andrew J; Castaldo, Linda; Pachter, Jonathan A; Dong, Hanqing; Chen, Xin; Tokar, Brianna; Campbell, Sharon L; Der, Channing J

    2012-10-15

    Evidence is emerging that the closely related ROCK1 and ROCK2 serine/threonine kinases support the invasive and metastatic growth of a spectrum of human cancer types. Therefore, inhibitors of ROCK are under preclinical development. However, a key step in their development involves the identification of genetic biomarkers that will predict ROCK inhibitor antitumor activity. One identified mechanism for ROCK activation in cancer involves the loss of function of the DLC1 tumor suppressor gene, which encodes a GTPase activating protein (RhoGAP) for the RhoA and RhoC small GTPases. DLC-1 loss may lead to hyperactivation of RhoA/C and its downstream effectors, the ROCK kinases. We therefore determined whether loss of DLC-1 protein expression identifies non-small cell lung carcinoma (NSCLC) cell lines whose growth and invasion phenotypes are sensitive to ROCK inhibition. We identified and characterized a novel small molecule pharmacologic inhibitor of ROCK and additionally applied genetic approaches to impair ROCK1 and/or ROCK2 activity, and we determined that although NSCLC anchorage-dependent growth was ROCK-independent, both anchorage-independent growth and Matrigel invasion were ROCK-dependent. However, loss of DLC-1 expression did not correlate with ROCK activation or with OXA-06 sensitivity. Unexpectedly, suppression of ROCK1 or ROCK2 expression alone was sufficient to impair anchorage-independent growth, supporting their nonoverlapping roles in oncogenesis. Mechanistically, the block in anchorage-independent growth was associated with accumulation of cells in the G(0)-G(1) phase of the cell cycle, but not increased anoikis. We conclude that ROCK may be a useful therapeutic target for NSCLC.

  19. ROCK1 and ROCK2 are Required for Non-Small Cell Lung Cancer Anchorage-Independent Growth and Invasion

    PubMed Central

    Vigil, Dominico; Kim, Tai Young; Plachco, Ana; Garton, Andrew J.; Castaldo, Linda; Pachter, Jonathan A.; Dong, Hanqing; Chen, Xin; Tokar, Brianna; Campbell, Sharon L.; Der, Channing J.

    2013-01-01

    Evidence is emerging that the closely related ROCK1 and ROCK2 serine/threonine kinases support the invasive and metastatic growth of a spectrum of human cancer types. Therefore, inhibitors of ROCK are under preclinical development. However, a key step in their development involves the identification of genetic biomarkers that will predict ROCK inhibitor anti-tumor activity. One identified mechanism for ROCK activation in cancer involves the loss of function of the DLC1 tumor suppressor gene, which encodes a GTPase activating protein (RhoGAP) for the RhoA and RhoC small GTPases. DLC-1 loss may lead to hyperactivation of RhoA/C and its downstream effectors, the ROCK kinases. We therefore determined whether loss of DLC-1 protein expression identifies non-small cell lung carcinoma (NSCLC) cell lines whose growth and invasion phenotypes are sensitive to ROCK inhibition. We identified and characterized a novel small molecule pharmacologic inhibitor of ROCK and additionally applied genetic approaches to impair ROCK1 and/or ROCK2 activity, and we determined that although NSCLC anchorage-dependent growth was ROCK-independent, both anchorage-independent growth and Matrigel invasion were ROCK-dependent. However, loss of DLC-1 expression did not correlate with ROCK activation or with OXA-06 sensitivity. Unexpectedly, suppression of ROCK1 or ROCK2 expression alone was sufficient to impair anchorage-independent growth, supporting their non-overlapping roles in oncogenesis. Mechanistically, the block in anchorage-independent growth was associated with accumulation of cells in the G0/G1 phase of the cell cycle, but not increased anoikis. We conclude that ROCK may be a useful therapeutic target for NSCLC. PMID:22942252

  20. Stromal platelet-derived growth factor receptor α (PDGFRα) provides a therapeutic target independent of tumor cell PDGFRα expression in lung cancer xenografts

    PubMed Central

    Gerber, David E.; Gupta, Puja; Dellinger, Michael T.; Toombs, Jason E.; Peyton, Michael; Duignan, Inga; Malaby, Jennifer; Bailey, Timothy; Burns, Colleen; Brekken, Rolf A.; Loizos, Nick

    2012-01-01

    In lung cancer, platelet-derived growth factor receptor α (PDGFRα) is expressed frequently by tumor-associated stromal cells and by cancer cells in a subset of tumors. We sought to determine the effect of targeting stromal PDGFRα in preclinical lung tumor xenograft models (human tumor, mouse stroma). Effects of anti-human (IMC-3G3) and anti-mouse (1E10) PDGFRα mAbs on proliferation and PDGFRα signaling were evaluated in lung cancer cell lines and mouse fibroblasts. Therapy studies were performed using established PDGFRα-positive H1703 cells and PDGFRα-negative Calu-6, H1993, and A549 subcutaneous tumors in immunocompromised mice treated with vehicle, anti-PDGFRα mAbs, chemotherapy, or combination therapy. Tumors were analyzed for growth and levels of growth factors. IMC-3G3 inhibited PDGFRα activation and the growth of H1703 cells in vitro and tumor growth in vivo, but had no effect on PDGFRα-negative cell lines or mouse fibroblasts. 1E10 inhibited growth and PDGFRα activation of mouse fibroblasts, but had no effect on human cancer cell lines in vitro. In vivo, 1E10-targeted inhibition of murine PDGFRα reduced tumor growth as single-agent therapy in Calu-6 cells and enhanced the effect of chemotherapy in xenografts derived from A549 cells. We also identified that low expression cancer cell expression of VEGF-A and elevated expression of PDGF-AA were associated with response to stromal PDGFRα targeting. We conclude that stromal PDGFRα inhibition represents a means for enhancing control of lung cancer growth in some cases, independent of tumor cell PDGFRα expression. PMID:22933705

  1. Nutrition aspects of lung cancer.

    PubMed

    Cranganu, Andreea; Camporeale, Jayne

    2009-12-01

    Lung cancer is the most common type of cancer, excluding nonmelanoma skin cancer, and is the leading cause of cancer death in the United States. Notable carcinogens involved in the development of lung cancer include smoking, secondhand smoke, and radon. Lung cancer is divided into 2 major types: non-small-cell lung cancer, the most prevalent, and small-cell lung cancer. Treatment includes surgery, chemotherapy, radiation, or a combination of the same. Medical nutrition therapy is often required for nutrition-related side effects of cancer treatment, which include but are not limited to anorexia, nausea and vomiting, and esophagitis. The best protection against lung cancer is avoidance of airborne carcinogens and increased consumption of fruits and vegetables. Studies have shown that smokers taking large amounts of beta-carotene and vitamin A supplements had increased lung cancer incidence and mortality. However, ingestion of beta-carotene from foods, along with a diet rich in fruits and vegetables, has a protective role against lung disease. The use of complementary and alternative medicine by lung cancer patients is prevalent; therefore, clinicians should investigate whether complementary and alternative therapies are used by patients and advise them on the use of these therapies to avoid any potential side effects and interactions with conventional therapies. The article concludes with a case study of a patient with non-small-cell lung cancer and illustrates the use of medical nutrition therapy in relation to cancer treatment side effects.

  2. Chemoprevention of Lung Cancer

    PubMed Central

    Szabo, Eva; Mao, Jenny T.; Lam, Stephen; Reid, Mary E.

    2013-01-01

    Background: Lung cancer is the most common cause of cancer death in men and women in the United States. Cigarette smoking is the main risk factor. Former smokers are at a substantially increased risk of developing lung cancer compared with lifetime never smokers. Chemoprevention refers to the use of specific agents to reverse, suppress, or prevent the process of carcinogenesis. This article reviews the major agents that have been studied for chemoprevention. Methods: Articles of primary, secondary, and tertiary prevention trials were reviewed and summarized to obtain recommendations. Results: None of the phase 3 trials with the agents β-carotene, retinol, 13-cis-retinoic acid, α-tocopherol, N-acetylcysteine, acetylsalicylic acid, or selenium has demonstrated beneficial and reproducible results. To facilitate the evaluation of promising agents and to lessen the need for a large sample size, extensive time commitment, and expense, surrogate end point biomarker trials are being conducted to assist in identifying the most promising agents for later-stage chemoprevention trials. With the understanding of important cellular signaling pathways and the expansion of potentially important targets, agents (many of which target inflammation and the arachidonic acid pathway) are being developed and tested which may prevent or reverse lung carcinogenesis. Conclusions: By integrating biologic knowledge, additional early-phase trials can be performed in a reasonable time frame. The future of lung cancer chemoprevention should entail the evaluation of single agents or combinations that target various pathways while working toward identification and validation of intermediate end points. PMID:23649449

  3. Clinical significance of BIM deletion polymorphism in non-small-cell lung cancer with epidermal growth factor receptor mutation.

    PubMed

    Isobe, Kazutoshi; Hata, Yoshinobu; Tochigi, Naobumi; Kaburaki, Kyohei; Kobayashi, Hiroshi; Makino, Takashi; Otsuka, Hajime; Sato, Fumitomo; Ishida, Fumiaki; Kikuchi, Naoshi; Hirota, Nao; Sato, Keita; Sano, Go; Sugino, Keishi; Sakamoto, Susumu; Takai, Yujiro; Shibuya, Kazutoshi; Iyoda, Akira; Homma, Sakae

    2014-04-01

    Germline alterations in the proapoptotic protein Bcl-2-like 11 (BIM) can have a crucial role in tumor response to treatment. To determine the clinical utility of detecting BIM deletion polymorphism in non-small-cell lung cancer positive for epidermal growth factor receptor (EGFR) mutation, we examined outcomes of patients with and without BIM alterations. We studied 70 patients with EGFR mutation-positive non-small-cell lung cancer who were treated with an EGFR tyrosine kinase inhibitor between January 2008 and January 2013. BIM deletion was analyzed by polymerase chain reaction in 58 samples of peripheral blood and 24 formalin-fixed paraffin-embedded slides of surgical specimens (20 of lung tissue and four of brain tissue); both blood and tissue specimens were available for 12 patients. We retrospectively analyzed clinical characteristics, response rate, toxicity, and outcomes among patients with and without BIM deletion. BIM deletion was present in 13 of 70 patients (18.6%). There were no significant differences between patients with and without BIM deletion in clinical characteristics, rate of response to EGFR tyrosine kinase inhibitor, or incidence of adverse events. Patients with BIM deletion had significantly shorter progression-free survival (PFS) than those without BIM deletion (median, 227 versus 533 days; p < 0.001). Multivariate Cox regression analysis showed that BIM deletion was an independent indicator of shorter PFS (hazard ratio, 3.99; 95% confidence interval, 1.864-8.547; p < 0.001). Polymerase chain reaction successfully detected BIM deletion in samples of peripheral blood and formalin-fixed paraffin-embedded slides of surgical specimens. BIM deletion was the most important independent prognostic factor in shorter PFS.

  4. Neuroendocrine Cancer-Specific Up-Regulating Mechanism of Insulin-Like Growth Factor Binding Protein-2 in Small Cell Lung Cancer

    PubMed Central

    Yazawa, Takuya; Sato, Hanako; Shimoyamada, Hiroaki; Okudela, Koji; Woo, Tetsukan; Tajiri, Michihiko; Ogura, Takashi; Ogawa, Nobuo; Suzuki, Takehisa; Mitsui, Hideaki; Ishii, Jun; Miyata, Chie; Sakaeda, Masashi; Goto, Kazuya; Kashiwagi, Korehito; Masuda, Munetaka; Takahashi, Takashi; Kitamura, Hitoshi

    2009-01-01

    Small cell lung cancer (SCLC) exhibits insulin-like growth factor-dependent growth. SCLC is the most aggressive among known in vivo lung cancers, whereas in vitro growth of SCLC is paradoxically slow as compared with that of non-SCLC (NSCLC). In this study, we demonstrate that SCLC cells overexpress insulin-like growth factor binding protein (IGFBP)-2 via NeuroD, a neuroendocrine cell-specific transcription factor. Chromatin immunoprecipitation, electrophoretic mobility shift, and IGFBP-2 promoter assays all revealed that NeuroD binds to the E-box in the 5′-untranslated region of IGFBP-2. A NeuroD transgene in both airway epithelial and NSCLC cells up-regulated the transcription of IGFBP-2 and retarded cell growth. Recombinant IGFBP-2 repressed the growth of both airway epithelial and NSCLC cells in a dose-dependent manner. A NeuroD-specific small interfering RNA repressed IGFBP-2 expression in SCLC, and neutralization of IGFBP-2 and an IGFBP-2-specific small interfering RNA increased SCLC cell growth. Pathological samples of SCLC also expressed IGFBP-2 abundantly, as compared with NSCLC, and showed only rare (8%) IGFBP-2 promoter methylation, whereas the IGFBP-2 promoter was methylated in 71% of adenocarcinomas and 29% of squamous cell carcinomas. These findings suggest that 1) SCLC has an IGFBP-2 overexpression mechanism distinct from NSCLC, 2) secreted IGFBP-2 contributes to the slow growth of SCLC in vitro, and 3) the epigenetic alterations in the IGFBP-2 promoter contribute to the striking differences in IGFBP-2 expression between SCLC and NSCLC in vivo. PMID:19679880

  5. Vascular endothelial growth factor genotypes, haplotypes, gender, and the risk of non-small cell lung cancer.

    PubMed

    Zhai, Rihong; Liu, Geoffrey; Zhou, Wei; Su, Li; Heist, Rebecca Suk; Lynch, Thomas J; Wain, John C; Asomaning, Kofi; Lin, Xihong; Christiani, David C

    2008-01-15

    The vascular endothelial growth factor (VEGF) is a major mediator of angiogenesis involving tumor growth and metastasis. Polymorphisms in the VEGF gene may regulate VEGF production. In this large case-control study, we investigated whether functional polymorphisms (-460C/T, +405C/G, +936C/T) in the VEGF gene are associated with the risk of non-small cell lung cancer (NSCLC). VEGF genotypes and haplotypes were determined in 1,900 Caucasian patients with NSCLC and 1,458 healthy controls. The results were analyzed using logistic regression models, adjusting for age, gender, smoking status, pack-years of smoking, and years since smoking cessation (for ex-smokers). The false-positive report probability was estimated for the observed odds ratios (OR). There were no overall associations between individual VEGF genotypes and the risk of NSCLC. Stratified analysis suggested that the combined +405CC+CG genotype was significantly associated with increased risk of lung adenocarcinoma in males (adjusted OR, 1.40; 95% confidence interval, 1.03-1.87). In haplotype analysis, haplotypes were globally associated with differences between cases and controls in males (P = 0.03). Specifically, the -460T/+405G/+936C haplotype was significantly (P = 0.02) associated with decreased risk of adenocarcinoma in males when compared with the most common CGC haplotype (adjusted OR, 0.76; 95% confidence interval, 0.50-0.98). None of the VEGF genotypes and haplotypes studied significantly influenced the susceptibility to NSCLC in females. Polymorphisms of -460C/T, +405C/G, and +936C/T in the VEGF gene do not play a major role in NSCLC risk. However, we could not exclude a minor role for the +405CC+CG genotypes and the 460T/+405G/+936C haplotype in lung adenocarcinogenesis in male Caucasians.

  6. Lung cancer in Brazil.

    PubMed

    Algranti, E; Menezes, A M; Achutti, A C

    2001-04-01

    Lung cancer is the second leading cause of death in Brazil, after exclusion of external causes. Registries in the country are not reliable because of under-registration and limited coverage. Incidence rates for Brazil are less then half those for selected areas with good registries. Crude and adjusted incidence and mortality rates for lung cancer are rising, particularly among women. The main reason is the acceleration in tobacco consumption and the spread of smoking among women. At present, approximately 40% of men and 25% of women, 15 years of age or older, are current smokers. In the state of Rio Grande do Sul, where registries are reliable, incidence and mortality for males are similar to US data and the figures for women are rapidly approaching those for men. Occupations associated with risks of exposure to respiratory carcinogens show a rise in the incidence of lung cancer in the industrialized area of São Paulo. The main occupational risk in Brazil is exposure to mineral dusts, silica, or asbestos. Although about 15 million Brazilians are exposed to pesticides, agricultural workers were not a risk group for lung cancer in a case-control study. Pesticides containing arsenic and dichlorodiphenyltrichloroethane (DDT) are banned. In recent years, a trend towards a decrease in male smoking has been noted, but there is still a high tobacco exposure burden in both males and females, with a forecast of a further increase in rates of lung cancer incidence and deaths. Control of respiratory carcinogens at work continues to be a problem, particularly in the present scenario of economic and political pressures on Brazil and other developing nations. Semin Oncol 28:143-152. Copyright 2001 by W.B. Saunders Company.

  7. Therapeutic inhibition of TRF1 impairs the growth of p53-deficient K-RasG12V-induced lung cancer by induction of telomeric DNA damage.

    PubMed

    García-Beccaria, María; Martínez, Paula; Méndez-Pertuz, Marinela; Martínez, Sonia; Blanco-Aparicio, Carmen; Cañamero, Marta; Mulero, Francisca; Ambrogio, Chiara; Flores, Juana M; Megias, Diego; Barbacid, Mariano; Pastor, Joaquín; Blasco, Maria A

    2015-07-01

    Telomeres are considered anti-cancer targets, as telomere maintenance above a minimum length is necessary for cancer growth. Telomerase abrogation in cancer-prone mouse models, however, only decreased tumor growth after several mouse generations when telomeres reach a critically short length, and this effect was lost upon p53 mutation. Here, we address whether induction of telomere uncapping by inhibition of the TRF1 shelterin protein can effectively block cancer growth independently of telomere length. We show that genetic Trf1 ablation impairs the growth of p53-null K-Ras(G12V)-induced lung carcinomas and increases mouse survival independently of telomere length. This is accompanied by induction of telomeric DNA damage, apoptosis, decreased proliferation, and G2 arrest. Long-term whole-body Trf1 deletion in adult mice did not impact on mouse survival and viability, although some mice showed a moderately decreased cellularity in bone marrow and blood. Importantly, inhibition of TRF1 binding to telomeres by small molecules blocks the growth of already established lung carcinomas without affecting mouse survival or tissue function. Thus, induction of acute telomere uncapping emerges as a potential new therapeutic target for lung cancer.

  8. Highly sensitive detection of epidermal growth factor receptor in lung cancer cells by aptamer-based target-/probe-mediated cyclic signal amplification.

    PubMed

    Zhang, Dandan; Ma, Fei; Zhang, Qianyi; Zhang, Chun-Yang

    2017-10-09

    We develop an antibody-free fluorescence method for the epidermal growth factor receptor (EGFR) assay using aptamer-based target-/probe-mediated cyclic signal amplification. The method is highly sensitive with a detection limit of 0.16 fM, and it can be applied to detect EGFR in lung cancer cells, holding great potential in clinical diagnosis.

  9. The P21-activated kinase expression pattern is different in non-small cell lung cancer and affects lung cancer cell sensitivity to epidermal growth factor receptor tyrosine kinase inhibitors.

    PubMed

    Liu, Yang; Wang, Si; Dong, Qian-Ze; Jiang, Gui-Yang; Han, Yong; Wang, Liang; Wang, En-Hua

    2016-03-01

    Exploring methods for increasing epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI) sensitivity has become a major focus in non-small cell lung cancer (NSCLC). Major downstream effectors of the Rho family small guanosine triphosphatases, P21-activated kinases (PAKs) activate the main signaling pathways downstream of EGFR and thus promote tumor cell proliferation. In this study, we explored the expression pattern of phosphorylated PAKs in NSCLC and their potential value as drug targets for treating cancer. The expression and prognostic significance of phosphorylated group I and II PAKs were evaluated in 182 patients with NSCLC. Immunohistochemical analysis revealed low group I PAK expression in normal lung tissues and increased expressed in the cytoplasm, particularly in lung squamous cell carcinoma. Abnormal group I PAK expression was associated with lymph node metastases and high tumor-node-metastases (TNM) stage in NSCLC patients and correlated with poor prognosis. We used group I PAK inhibitor (IPA3) to specifically decrease group I PAK activity in human lung cancer cell lines. Decreased group I PAK activity inhibited cell proliferation and combined IPA3 and EGFR-TKI (gefitinib) treatment inhibited cell proliferation in an obvious manner. Together, our results revealed the PAK expression pattern in NSCLC, and a role for group I PAK in cell proliferation, which provides evidence that decreased PAK activity may have a potential application as a molecular targeted therapy in advanced NSCLC.

  10. The role of posttraumatic growth and timing of quitting smoking as moderators of the relationship between stigma and psychological distress among lung cancer survivors who are former smokers

    PubMed Central

    Shen, Megan Johnson; Coups, Elliot J.; Li, Yuelin; Holland, Jimmie C.; Hamann, Heidi A.; Ostroff, Jamie S.

    2015-01-01

    Objective Patients diagnosed with lung cancer report high levels of stigma and psychological distress. This study examined posttraumatic growth among lung cancer survivors as a potential buffer against this relationship between stigma and psychological distress and examined how these relationships differed by the timing of quitting smoking (pre versus post-diagnosis). Methods Stages IA and IB non-small-cell lung cancer survivors (N= 141) who were former smokers, 1–6 years post-treatment, and had no evidence of disease completed standardized questionnaires assessing stigma, posttraumatic growth, timing of quitting smoking history, and psychological distress. Results Hierarchical linear regression and simple slope analyses indicated that among those who quit smoking prior to diagnosis (pre-diagnosis quitters), stigma had a positive association with psychological distress at high levels of posttraumatic growth (p = 0.003) and had a positive (but non-significant) association with psychological distress among those with low levels of posttraumatic growth (p = 0.167). Among those who quit smoking after diagnosis (post-diagnosis quitters), stigma had a positive association with psychological distress among those with low levels of posttraumatic growth (p = 0.004) but had no relationship among those with high levels of posttraumatic growth (p = 0.880). Conclusions Findings indicate that posttraumatic growth buffers against the negative effects of stigma on psychological distress but only among post-diagnosis quitters. Future interventions could focus on fostering posttraumatic growth as a way to decrease the negative effects of stigma. PMID:25345591

  11. γ-Glutamylcyclotransferase Knockdown Inhibits Growth of Lung Cancer Cells Through G0/G1 Phase Arrest.

    PubMed

    Lin, Zhifeng; Xiong, Liwen; Zhou, Jianhua; Wang, Jin; Li, Zhao; Hu, Haiyang; Lin, Qiang

    2015-06-01

    Lung cancer as an aggressive type tumor is rapidly growing and has become the leading cause of cancer-related death worldwide. γ-Glutamylcyclotransferase (GGCT) has been shown as a diagnostic marker in various cancers. To reveal whether there is a correlation between GGCT and lung cancer, GGCT expression in human lung cancer cell lines was first determined by real-time quantitative PCR and western blot. GGCT is expressed in all tested lung cancer cell lines, A549, H1299, and H460. Then, a lentivirus-based system was applied to knock down GGCT in A549 cells, which were thus divided into Lv-shGGCT, Lv-shCon, and Con (noninfected) groups. Methylthiazol tetrazolium assay showed that the cell proliferation was decreased by over 50% in the Lv-shGGCT group compared with controls. The size and number of colonies were dramatically reduced in the GGCT knockdown group, as measured by colony formation assay. Moreover, A549 cells infected with Lv-shGGCT were arrested in the G0/G1 phase as assayed by flow cytometry. Furthermore, the expression levels of CDK4, CDK6, and cyclin D1 were decreased and the cleaved level of PARP was increased in GGCT knockdown cells. In conclusion, GGCT plays a critical role in lung cancer cell proliferation and may be a potential cancer therapeutic target.

  12. Japonicone A inhibits the growth of non-small cell lung cancer cells via mitochondria-mediated pathways.

    PubMed

    Du, Yan; Gong, Jiannan; Tian, Xinrui; Yan, Xiaomei; Guo, Tao; Huang, Min; Zhang, Bingtai; Hu, Xiaoyun; Liu, Hui; Wang, Yinping; Li, Jianqiang; Li, Maolan

    2015-09-01

    Japonicone A, which is a natural product isolated from the aerial part of Inula japonica Thunb., has a wide range of clinical applications, including anti-inflammation and anti-oxidation. This study investigated the effects of japonicone A on the growth of non-small cell lung cancer (NSCLC) cell lines. The results showed that japonicone A significantly inhibited the growth of NSCLC cell lines in a dose- and time-dependent manner. This product also blocked cell cycle progression at S phase and induced mitochondrial-related apoptosis by upregulating Bax, cleaved caspase-9, cleaved caspase-3, and cleaved poly(ADP-ribose) polymerase (PARP) protein levels and by downregulating Bcl-2, cyclin D1, CDC25A, and CDK2 protein levels. In vivo, japonicone A suppressed tumor growth via the same mechanism as that observed in vitro. In conclusion, our study is the first to report that japonicone A has an inhibitory effect on the growth of NSCLC cells, indicating that japonicone A administration is a potential therapeutic approach for future NSCLC treatments.

  13. Inhibition of human lung cancer cell growth by the peroxisome proliferator-activated receptor-gamma agonists through induction of apoptosis.

    PubMed

    Tsubouchi, Y; Sano, H; Kawahito, Y; Mukai, S; Yamada, R; Kohno, M; Inoue, K; Hla, T; Kondo, M

    2000-04-13

    Peroxisome proliferator-activated receptors (PPARs), members of the nuclear hormone receptors superfamily, have an important regulatory role in adipogenesis and inflammation. PPAR-gamma ligands induce terminal differentiation and growth inhibition of human breast cancer cells and prostatic cancer cells. In this study, we demonstrated that PPAR-gamma, but not PPAR-alpha, was expressed in human lung cancer cell lines by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis. We also found that the synthetic PPAR-gamma agonist thiazolidinedione compounds (troglitazone) and the endogenous PPAR-gamma ligand, 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)), inhibited the growth of human lung cancer cells through the induction of apoptosis. However, PPAR-alpha agonist (bezafibrate) and other prostanoids (PGE(2), PGF(2alpha)) did not induce apoptosis. These findings suggest that PPAR-gamma may play an important role in the pathogenesis of lung cancer and that PPAR-gamma agonist may be useful therapeutic agents in the treatment of human lung cancer. Copyright 2000 Academic Press.

  14. Partial characterization of insulin-like growth factor I in primary human lung cancers using immunohistochemical and receptor autoradiographic techniques

    SciTech Connect

    Shigematsu, K.; Kataoka, Y.; Kamio, T.; Kurihara, M.; Niwa, M.; Tsuchiyama, H. )

    1990-04-15

    We investigated primary human lung cancers resected surgically or obtained at autopsy. Included were squamous cell carcinoma (SQC) (five cases), adenocarcinoma (ADC) (six cases), large cell carcinoma (LCC) (four cases), and small cell carcinoma (SCC) (two cases). The objective of the study was to search for the presence of insulin-like growth factor I (IGF-I)-like immunoreactivity using immunohistochemical staining and for the localization of IGF-I binding sites, using in vitro quantitative receptor autoradiographic techniques. IGF-I-like immunostaining was present in all cases of SQC, ADC, and LCC, but not in cases of SCC. Strong immunostaining was observed in cases of SQC. On the other hand, ADC and LCC tissues showed a moderate or weak staining. Specific binding sites for IGF-I were present in all cases of SQC, ADC, LCC, and SCC examined. High densities of 125I-IGF-I binding sites were localized in cases of SQC and SCC. Low to high densities of the binding sites were found in LCC. Cases of ADC showed low densities of 125I-IGF-I binding sites. Specific binding obtained at a concentration of 80 pM 125I-IGF-I was competitively displaced by unlabeled IGF-I, with a 50% inhibitory concentration value of 1.84 +/- 0.31 x 10(-10) mol, whereas human insulin was much less potent in displacing the binding. This specificity profile is consistent with characteristics of IGF-I receptors. Scatchard analysis showed the presence of a single class of high affinity binding sites for IGF-I, with a Kd of approximately 1 nmol. Thus, the possibility that IGF-I may play a role in the growth of human lung cancers would have to be considered.

  15. Metformin inhibits growth and enhances radiation response of non-small cell lung cancer (NSCLC) through ATM and AMPK

    PubMed Central

    Storozhuk, Y; Hopmans, S N; Sanli, T; Barron, C; Tsiani, E; Cutz, J-C; Pond, G; Wright, J; Singh, G; Tsakiridis, T

    2013-01-01

    Background: We examined the potential of metformin (MET) to enhance non-small cell lung cancer (NSCLC) responses to ionising radiation (IR). Methods: Human NSCLC cells, mouse embryonic fibroblasts from wild-type and AMP-activated kinase (AMPK) α1/2-subunit−/− embryos (AMPKα1/2−/−-MEFs) and NSCLC tumours grafted into Balb/c-nude mice were treated with IR and MET and subjected to proliferation, clonogenic, immunoblotting, cell cycle and apoptosis assays and immunohistochemistry (IHC). Results: Metformin (2.5 μℳ–5 mℳ) inhibited proliferation and radio-sensitised NSCLC cells. Metformin (i) activated the ataxia telengiectasia-mutated (ATM)–AMPK–p53/p21cip1 and inhibited the Akt–mammalian target of rapamycin (mTOR)–eIF4E-binding protein 1 (4EBP1) pathways, (ii) induced G1 cycle arrest and (iii) enhanced apoptosis. ATM inhibition blocked MET and IR activation of AMPK. Non-small cell lung cancer cells with inhibited AMPK and AMPKα1/2−/−-MEFs were resistant to the antiproliferative effects of MET and IR. Metformin or IR inhibited xenograft growth and combined treatment enhanced it further than each treatment alone. Ionising radiation and MET induced (i) sustained activation of ATM–AMPK–p53/p21cip1 and inhibition of Akt–mTOR–4EBP1 pathways in tumours, (ii) reduced expression of angiogenesis and (iii) enhanced expression of apoptosis markers. Conclusion: Clinically achievable MET doses inhibit NSCLC cell and tumour growth and sensitise them to IR. Metformin and IR mediate their action through an ATM–AMPK-dependent pathway. Our results suggest that MET can be a clinically useful adjunct to radiotherapy in NSCLC. PMID:23632475

  16. Transforming growth factor-β1 induces EMT by the transactivation of epidermal growth factor signaling through HA/CD44 in lung and breast cancer cells

    PubMed Central

    LI, LINGMEI; QI, LISHA; LIANG, ZHIJIE; SONG, WANGZHAO; LIU, YANXUE; WANG, YALEI; SUN, BAOCUN; ZHANG, BIN; CAO, WENFENG

    2015-01-01

    Epithelial-mesenchymal transition (EMT), a process closely related to tumor development, is regulated by a variety of signaling pathways and growth factors, such as transforming growth factor-β1 (TGF-β1) and epidermal growth factor (EGF). Hyaluronan (HA) has been shown to induce EMT through either TGF-β1 or EGF signaling and to be a regulator of the crosstalk between these two pathways in fibroblasts. In this study, in order to clarify whether HA has the same effect in tumor cells, we utilized the lung cancer cell line, A549, and the breast cancer cell line, MCF-7, and found that the effects of stimulation with TGF-β1 were more potent than those of EGF in regulating the expression of EMT-associated proteins and in enhancing cell migration and invasion. In addition, we observed that TGF-β1 activated EGF receptor (EGFR) and its downstream AKT and extracellular signal-regulated kinase (ERK) pathways. Furthermore, we found that TGF-β1 upregulated the expression of hyaluronan synthases (HAS1, HAS2 and HAS3) and promoted the expression of CD44, a cell surface receptor for HA, which interacts with EGFR, resulting in the activation of the downstream AKT and ERK pathways. Conversely, treatment with 4-methylumbelliferone (4-MU; an inhibitor of HAS) prior to stimulation with TGF-β1, inhibited the expression of CD44 and EGFR, abolished the interaction between CD44 and EGFR. Furthermore, the use of shRNA targeting CD44 impaired the expression of EGFR, deactivated the AKT and ERK pathways, reversed EMT and decreased the migration and invasion ability of cells. In conclusion, our data demonstrate that TGF-β1 induces EMT by the transactivation of EGF signaling through HA/CD44 in lung and breast cancer cells. PMID:26005723

  17. Inhibition of lung cancer cell growth and induction of apoptosis after reexpression of 3p21.3 candidate tumor suppressor gene SEMA3B

    PubMed Central

    Tomizawa, Yoshio; Sekido, Yoshitaka; Kondo, Masashi; Gao, Boning; Yokota, Jun; Roche, Joëlle; Drabkin, Harry; Lerman, Michael I.; Gazdar, Adi F.; Minna, John D.

    2001-01-01

    Semaphorins SEMA3B and its homologue SEMA3F are 3p21.3 candidate tumor suppressor genes (TSGs), the expression of which is frequently lost in lung cancers. To test the TSG candidacy of SEMA3B and SEMA3F, we transfected them into lung cancer NCI-H1299 cells, which do not express either gene. Colony formation of H1299 cells was reduced 90% after transfection with wild-type SEMA3B compared with the control vector. By contrast, only 30–40% reduction in colony formation was seen after the transfection of SEMA3F or SEMA3B variants carrying lung cancer-associated single amino acid missense mutations. H1299 cells transfected with wild-type but not mutant SEMA3B underwent apoptosis. We found that lung cancers (n = 34) always express the neuropilin-1 receptor for secreted semaphorins, whereas 82% expressed the neuropilin-2 receptor. Because SEMA3B and SEMA3F are secreted proteins, we tested conditioned medium from COS-7 cells transfected with SEMA3B and SEMA3F and found that medium from wild-type SEMA3B transfectants reduced the growth of several lung cancer lines 30–90%, whereas SEMA3B mutants or SEMA3F had little effect in the same assay. Sequencing of sodium bisulfite-treated DNA showed dense methylation of CpG sites in the SEMA3B 5′ region of lung cancers not expressing SEMA3B but no methylation in SEMA3B-expressing tumors. These results are consistent with SEMA3B functioning as a TSG, the expression of which is inactivated frequently in lung cancers by allele loss and promoter region methylation. PMID:11717452

  18. Lung cancer susceptibility among atomic bomb survivors in relation to CA repeat number polymorphism of epidermal growth factor receptor gene and radiation dose.

    PubMed

    Yoshida, Kengo; Nakachi, Kei; Imai, Kazue; Cologne, John B; Niwa, Yasuharu; Kusunoki, Yoichiro; Hayashi, Tomonori

    2009-12-01

    Lung cancer is a leading cause of cancer death worldwide. Prevention could be improved by identifying susceptible individuals as well as improving understanding of interactions between genes and etiological environmental agents, including radiation exposure. The epidermal growth factor receptor (EGFR)-signaling pathway, regulating cellular radiation sensitivity, is an oncogenic cascade involved in lung cancer, especially adenocarcinoma. The cytosine adenine (CA) repeat number polymorphism in the first intron of EGFR has been shown to be inversely correlated with EGFR production. It is hypothesized that CA repeat number may modulate individual susceptibility to lung cancer. Thus, we carried out a case-cohort study within the Japanese atomic bomb (A-bomb) survivor cohort to evaluate a possible association of CA repeat polymorphism with lung cancer risk in radiation-exposed or negligibly exposed (<5 mGy) A-bomb survivors. First, by dividing study subjects into Short and Long genotypes, defined as the summed CA repeat number of two alleles < or = 37 and > or = 38, respectively, we found that the Short genotype was significantly associated with an increased risk of lung cancer, specifically adenocarcinoma, among negligibly exposed subjects. Next, we found that prior radiation exposure significantly enhanced lung cancer risk of survivors with the Long genotype, whereas the risk for the Short genotype did not show any significant increase with radiation dose, resulting in indistinguishable risks between these genotypes at a high radiation dose. Our findings imply that the EGFR pathway plays a crucial role in assessing individual susceptibility to lung adenocarcinoma in relation to radiation exposure.

  19. Stages of Small Cell Lung Cancer

    MedlinePlus

    ... Cancer Prevention Lung Cancer Screening Research Small Cell Lung Cancer Treatment (PDQ®)–Patient Version General Information About Small Cell Lung Cancer Go to Health Professional Version Key Points ...

  20. Treatment Option Overview (Small Cell Lung Cancer)

    MedlinePlus

    ... Cancer Prevention Lung Cancer Screening Research Small Cell Lung Cancer Treatment (PDQ®)–Patient Version General Information About Small Cell Lung Cancer Go to Health Professional Version Key Points ...

  1. General Information about Small Cell Lung Cancer

    MedlinePlus

    ... Cancer Prevention Lung Cancer Screening Research Small Cell Lung Cancer Treatment (PDQ®)–Patient Version General Information About Small Cell Lung Cancer Go to Health Professional Version Key Points ...

  2. Nutritional aspects regarding lung cancer chemoprevention.

    PubMed

    Thanopoulou, E; Baltayiannis, N; Lykogianni, V

    2006-01-01

    Lung cancer is still one of the major causes of cancer-related deaths and its mortality figures argue powerfully for new approaches to control this leading cancer threat. Chemoprevention can be defined as the use of specific agents to reverse, or prevent premalignancy from progressing to invasive cancer. The use of foods and dietary supplements present a safe chemopreventive strategy. Data for this review were identified by searches of PubMed and references from relevant articles. Articles were identified by use of the search terms "lung cancer", "chemoprevention", "carcinogenesis", and "retinoids". Only papers published in English were included. Trials in lung cancer chemoprevention have so far produced either neutral or harmful primary endpoint results, whether in the primary, secondary, or tertiary settings. Lung cancer was not prevented by beta-carotene, alpha-tocopherol, retinol, retinyl palmitate, N-acetylcysteine, or isotretinoin in smokers. Ongoing trials may help define new avenues for chemoprevention. The concept of chemoprevention in lung cancer is still in its infancy, but in the future it may have a significant impact on the incidence and mortality of lung cancer. In addition to epidemiologic studies, basic science research to detect mechanisms and evaluate the chemopreventive potential of food components is necessary. The overwhelming evidence of a major role of nutrition in carcinogenesis, the many leads that nutritional intervention may reduce cancer incidence, and the growth and increasing sophistication of clinical trials networks point to a very promising future for nutritional intervention trials leading to substantial public benefit.

  3. Phospho-sulindac (OXT-328) Inhibits the Growth of Human Lung Cancer Xenografts in Mice: Enhanced Efficacy and Mitochondria Targeting by Its Formulation in Solid Lipid Nanoparticles

    PubMed Central

    Zhu, Rongrong; Cheng, Ka-Wing; Mackenzie, Gerardo; Huang, Liqun; Sun, Yu; Xie, Gang; Vrankova, Kveta; Rigas, Basil; Constantinides, Panayiotis P.

    2013-01-01

    Purpose To evaluate the antitumor efficacy of solid lipid nanoparticle–encapsulated phospho-sulindac (SLN-PS) in human lung cancer. Methods PS was incorporated into SLNs using the emulsion evaporation technique. We determined the antitumor activity of SLN-PS in cultured lung cancer cells. The performance of SLN-PS was further evaluated by pharmacokinetic studies in mice and in a model of human lung cancer xenografts in nude mice. Results SLN-PS was >4-fold more potent than PS in inhibiting the growth of A549 and H510 cells in vitro. SLN-PS enhanced cellular uptake and facilitated PS accumulation in mitochondria, leading to oxidative stress and apoptosis via the mitochondrial-apoptosis pathway. SLN-PS was highly effective in suppressing the growth of A549 xenografts (78% inhibition compared to control, p < 0.01); while PS had no significant effect. Formulation of PS in SLNs resulted in improved pharmacokinetics in mice and an enhanced (~14-fold) accumulation of PS and its metabolites in A549 xenografts. Finally, SLN-PS enhanced urinary F2-isoprostane uniquely in mice bearing A549 xenografts compared to untreated controls, suggesting that SLN-PS specifically induced oxidative stress in tumors. Conclusions Our results show that SLN-PS is efficacious in suppressing the growth of lung cancer and merits further evaluation. PMID:22723123

  4. Phospho-sulindac (OXT-328) inhibits the growth of human lung cancer xenografts in mice: enhanced efficacy and mitochondria targeting by its formulation in solid lipid nanoparticles.

    PubMed

    Zhu, Rongrong; Cheng, Ka-Wing; Mackenzie, Gerardo; Huang, Liqun; Sun, Yu; Xie, Gang; Vrankova, Kveta; Constantinides, Panayiotis P; Rigas, Basil

    2012-11-01

    To evaluate the antitumor efficacy of solid lipid nanoparticle-encapsulated phospho-sulindac (SLN-PS) in human lung cancer. PS was incorporated into SLNs using the emulsion evaporation technique. We determined the antitumor activity of SLN-PS in cultured lung cancer cells. The performance of SLN-PS was further evaluated by pharmacokinetic studies in mice and in a model of human lung cancer xenografts in nude mice. SLN-PS was >4-fold more potent than PS in inhibiting the growth of A549 and H510 cells in vitro. SLN-PS enhanced cellular uptake and facilitated PS accumulation in mitochondria, leading to oxidative stress and apoptosis via the mitochondrial-apoptosis pathway. SLN-PS was highly effective in suppressing the growth of A549 xenografts (78% inhibition compared to control, p < 0.01); while PS had no significant effect. Formulation of PS in SLNs resulted in improved pharmacokinetics in mice and an enhanced (≈ 14-fold) accumulation of PS and its metabolites in A549 xenografts. Finally, SLN-PS enhanced urinary F2-isoprostane uniquely in mice bearing A549 xenografts compared to untreated controls, suggesting that SLN-PS specifically induced oxidative stress in tumors. Our results show that SLN-PS is efficacious in suppressing the growth of lung cancer and merits further evaluation.

  5. Pulmonary Rehabilitation in Lung Cancer.

    PubMed

    Wang, Hongmei; Liu, Xin; Rice, Shawn J; Belani, Chandra P

    2016-10-01

    Lung cancer remains a challenging disease with high morbidity and mortality despite targeted therapy. Symptom burden related to cancer impairs quality of life and functional status in patients with lung cancer and in survivors. Pulmonary rehabilitation has been recognized as an effective, noninvasive intervention for patients with chronic respiratory disease. It is well established that pulmonary rehabilitation benefits patients with chronic obstruction pulmonary disease through improved exercise capacity and symptoms. Evidence is increasing that the benefit of pulmonary rehabilitation can be applied to patients with lung cancer. Comprehensive pulmonary rehabilitation has made its way as a cornerstone of integrated care for patients with lung cancer.

  6. Immunotherapy in Lung Cancer.

    PubMed

    Du, Lingling; Herbst, Roy S; Morgensztern, Daniel

    2017-02-01

    The treatment of patients with good performance status and advanced stage non-small cell lung cancer has been based on the use of first-line platinum-based doublet and second-line docetaxel. Immunotherapy represents a new therapeutic approach with the potential for prolonged benefit. Although the vaccines studied have not shown benefit in patients with non-small cell lung cancer, immune checkpoint inhibitors against the PD-1/PD-L1 axis showed increased overall survival compared with docetaxel in randomized clinical trials, which led to the approval of nivolumab and pembrolizumab. Because only a minority of patients benefit from this class of drugs, there has been an intense search for biomarkers.

  7. M867, a Novel Selective Inhibitor of Caspase-3 Enhances Cell Death and Extends Tumor Growth Delay in Irradiated Lung Cancer Models

    PubMed Central

    Lu, Bo

    2008-01-01

    Background Lung cancer remains the leading cause of cancer death worldwide. Radioresistance of lung cancer cells results in unacceptable rate of loco-regional failure. Although radiation is known to induce apoptosis, our recent study showed that knockdown of pro-apoptotic proteins Bak and Bax resulted in an increase in autophagic cell death and lung cancer radiosensitivity in vitro. To further explore the potential of apoptosis inhibition as a way to sensitize lung cancer for therapy, we tested M867, a novel chemical and reversible caspase-3 inhibitor, in combination with ionizing radiation in vivo and in vitro. Methods and Findings M867 reduced clonogenic survival in H460 lung cancer cells (DER = 1.27, p = 0.007) compared to the vehicle-treated treated cells. We found that administration of M867 with ionizing radiation in an in vivo mouse hind limb lung cancer model was well tolerated, and produced a significant tumor growth delay compared to radiation alone. A dramatic decrease in tumor vasculature was observed with M867 and radiation using von Willebrand factor staining. In addition, Ki67 index showed >5-fold reduction of tumor proliferation in the combination therapy group, despite the reduced levels of apoptosis observed with terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling staining. Radiosensitizing effect of M867 through inhibiting caspases was validated using caspase-3/-7 double-knockout (DKO) mouse embryonic fibroblasts (MEF) cell model. Consistent with our previous study, autophagy contributed to the mechanism of increased cell death, following inhibition of apoptosis. In addition, matrigel assay showed a decrease in in vitro endothelial tubule formation during the M867/radiation combination treatment. Conclusions M867 enhances the cytotoxic effects of radiation on lung cancer and its vasculature both in vitro and in vivo. M867 has the potential to prolong tumor growth delay by inhibiting tumor proliferation. Clinical trials

  8. Enhanced suppression of tumor growth by concomitant treatment of human lung cancer cells with suberoylanilide hydroxamic acid and arsenic trioxide

    SciTech Connect

    Chien, Chia-Wen; Yao, Ju-Hsien; Chang, Shih-Yu; Lee, Pei-Chih; Lee, Te-Chang

    2011-11-15

    The efficacy of arsenic trioxide (ATO) against acute promyelocytic leukemia (APL) and relapsed APL has been well documented. ATO may cause DNA damage by generating reactive oxygen intermediates. Suberoylanilide hydroxamic acid (SAHA), a histone deacetylase inhibitor, modulates gene and protein expression via histone-dependent or -independent pathways that may result in chromatin decondensation, cell cycle arrest, differentiation, and apoptosis. We investigated whether ATO and SAHA act synergistically to enhance the death of cancer cells. Our current findings showed that combined treatment with ATO and SAHA resulted in enhanced suppression of non-small-cell lung carcinoma in vitro in H1299 cells and in vivo in a xenograft mouse model. Flow cytometric analysis of annexin V+ cells showed that apoptotic cell death was significantly enhanced after combined treatment with ATO and SAHA. At the doses used, ATO did not interfere with cell cycle progression, but SAHA induced p21 expression and led to G1 arrest. A Comet assay demonstrated that ATO, but not SAHA, induced DNA strand breaks in H1299 cells; however, co-treatment with SAHA significantly increased ATO-induced DNA damage. Moreover, SAHA enhanced acetylation of histone H3 and sensitized genomic DNA to DNase I digestion. Our results suggest that SAHA may cause chromatin relaxation and increase cellular susceptibility to ATO-induced DNA damage. Combined administration of SAHA and ATO may be an effective approach to the treatment of lung cancer. -- Highlights: Black-Right-Pointing-Pointer ATO and SAHA are therapeutic agents with different action modes. Black-Right-Pointing-Pointer Combination of ATO and SAHA synergistically inhibits tumor cell growth. Black-Right-Pointing-Pointer SAHA loosens chromatin structure resulting in increased sensitivity to DNase I. Black-Right-Pointing-Pointer ATO-induced DNA damage and apoptosis are enhanced by co-treatment with SAHA.

  9. In vitro invasion of small-cell lung cancer cell lines correlates with expression of epidermal growth factor receptor.

    PubMed Central

    Damstrup, L.; Rude Voldborg, B.; Spang-Thomsen, M.; Brünner, N.; Skovgaard Poulsen, H.

    1998-01-01

    Formation of metastasis is a multistep process involving attachment to the basement membrane, local proteolysis and migration into surrounding tissues, lymph or bloodstream. In the present study, we have analysed the correlation between in vitro invasion and presence of the epidermal growth factor receptor (EGFR) in a panel of 21 small-cell lung cancer (SCLC) cell lines. We have previously reported that ten of these cell lines expressed EGFR protein detected by radioreceptor and affinity labelling assays. In 11 small-cell lung cancer (SCLC) cell lines, EGFR mRNA was detected by Northern blot analysis. In vitro invasion in a Boyden chamber assay was found in all EGFR-positive cell lines, whereas no invasion was detected in the EGFR-negative cell lines. Quantification of the in vitro invasion in 12 selected SCLC cell lines demonstrated that, in the EGFR-positive cell lines, between 5% and 16% of the cells added to the upper chamber were able to traverse the Matrigel membrane. Expression of several matrix metalloproteases (MMP), of tissue inhibitor of MMP (TIMP) and of cathepsin B was evaluated by immunoprecipitation, Western blot analysis and reverse transcriptase polymerase chain reaction (RT-PCR). However, in vitro invasive SCLC cell lines could not be distinguished from non-invasive cell lines based on the expression pattern of these molecules. In six SCLC cell lines, in vitro invasion was also determined in the presence of the EGFR-neutralizing monoclonal antibody mAb528. The addition of this antibody resulted in a significant reduction of the in vitro invasion in three selected EGFR-positive cell lines. Our results show that only EGFR-positive SCLC cell lines had the in vitro invasive phenotype, and it is therefore suggested that the EGFR might play an important role for the invasion potential of SCLC cell lines. Images Figure 1 Figure 3 Figure 4 PMID:9744504

  10. Clinical definition of acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors in non-small-cell lung cancer.

    PubMed

    Jackman, David; Pao, William; Riely, Gregory J; Engelman, Jeffrey A; Kris, Mark G; Jänne, Pasi A; Lynch, Thomas; Johnson, Bruce E; Miller, Vincent A

    2010-01-10

    Ten percent of North American patients with non-small-cell lung cancer have tumors with somatic mutations in the gene for the epidermal growth factor receptor (EGFR). Approximately 70% of patients whose lung cancers harbor somatic mutations in exons encoding the tyrosine kinase domain of EGFR experience significant tumor regressions when treated with the EGFR tyrosine kinase inhibitors (TKIs) gefitinib or erlotinib. However, the overwhelming majority of these patients inevitably acquire resistance to either drug. Currently, the clinical definition of such secondary or acquired resistance is not clear. We propose the following criteria be used to define more precisely acquired resistance to EGFR TKIs. All patients should have the following criteria: previous treatment with a single-agent EGFR TKI (eg, gefitinib or erlotinib); either or both of the following: a tumor that harbors an EGFR mutation known to be associated with drug sensitivity or objective clinical benefit from treatment with an EGFR TKI; systemic progression of disease (Response Evaluation Criteria in Solid Tumors [RECIST] or WHO) while on continuous treatment with gefitinib or erlotinib within the last 30 days; and no intervening systemic therapy between cessation of gefitinib or erlotinib and initiation of new therapy. The relatively simple definition proposed here will lead to a more uniform approach to investigating the problem of acquired resistance to EGFR TKIs in this unique patient population. These guidelines should minimize reporting of false-positive and false-negative activity in these clinical trials and would facilitate the identification of agents that truly overcome acquired resistance to gefitinib and erlotinib.

  11. Bioinformatics Analyses of the Role of Vascular Endothelial Growth Factor in Patients with Non-Small Cell Lung Cancer

    PubMed Central

    Wang, Ying; Huang, Lu; Wu, Shuqiang; Jia, Yongshi; Yang, Yunmei; Luo, Limin; Bi, Aihong; Fang, Min

    2015-01-01

    Purpose This study was aimed to identify the expression pattern of vascular endothelial growth factor (VEGF) in non-small cell lung cancer (NSCLC) and to explore its potential correlation with the progression of NSCLC. Methods Gene expression profile GSE39345 was downloaded from the Gene Expression Omnibus database. Twenty healthy controls and 32 NSCLC samples before chemotherapy were analyzed to identify the differentially expressed genes (DEGs). Then pathway enrichment analysis of the DEGs was performed and protein-protein interaction networks were constructed. Particularly, VEGF genes and the VEGF signaling pathway were analyzed. The sub-network was constructed followed by functional enrichment analysis. Results Total 1666 up-regulated and 1542 down-regulated DEGs were identified. The down-regulated DEGs were mainly enriched in the pathways associated with cancer. VEGFA and VEGFB were found to be the initiating factor of VEGF signaling pathway. In addition, in the epidermal growth factor receptor (EGFR), VEGFA and VEGFB associated sub-network, kinase insert domain receptor (KDR), fibronectin 1 (FN1), transforming growth factor beta induced (TGFBI) and proliferating cell nuclear antigen (PCNA) were found to interact with at least two of the three hub genes. The DEGs in this sub-network were mainly enriched in Gene Ontology terms related to cell proliferation. Conclusion EGFR, KDR, FN1, TGFBI and PCNA may interact with VEGFA to play important roles in NSCLC tumorigenesis. These genes and corresponding proteins may have the potential to be used as the targets for either diagnosis or treatment of patients with NSCLC. PMID:26422603

  12. Growth status significantly affects the response of human lung cancer cells to antitumor polyamine-analogue exposure.

    PubMed

    Carlisle, Diane L; Devereux, Wendy L; Hacker, Amy; Woster, Patrick M; Casero, Robert A

    2002-08-01

    Human solid tumors frequently have a relatively small growth fraction,which interferes with the action of many chemotherapeutic agents that target actively cycling cells. Several polyamine analogues are currently being developed for clinical application against human solid tumors including N1,N11-bis(ethyl)norspermine. Therefore, an effort was made to examine the effects of growth rate on polyamine-analogue efficacy. Low growth fraction (LGF) cell cultures of the human non-small cell lung cancer cell line NCI-H157 were generated to partially mimic solid tumors with low mitotic indices. Log-phase cells were compared with LGF cells with respect to cell survival and biochemical effects after exposure to polyamine analogues. The results demonstrate generally that LGF NCI-H157 cells were sensitive to analogue treatment. However, the dose necessary to elicit a response in LGF cells was an order of magnitude higher than the dose needed in log-phase cells. Additionally, the biochemical effects of analogues were similar between log phase and LGF cells with regard to a down-regulation of polyamine biosynthesis as measured by ornithine decarboxylase activity and an increase in polyamine catabolism as indicated by an increase in spermidine/spermine N1-acetyltransferase activity. However, biochemical effects were less dramatic in the LGF cells than those observed in the log-phase cells. The overall results of these studies suggest that the growth status of solid tumors can significantly affect the response to antitumor polyamine analogues, and growth fraction must be considered in the continued development and use of the polyamine analogues.

  13. Small molecular peptide-ScFv αvβ3 conjugates specifically inhibit lung cancer cell growth in vitro and in vivo

    PubMed Central

    Qiu, Qianqian; Wang, Qiongyao; Deng, Changxu; Sun, Yanqin; Chen, Taoliang; Guo, Linlang; Zhang, Fan

    2016-01-01

    Integrin αvβ3 (ITG) is highly expressed in various cancers and is considered a major target for anti-angiogensis cancer therapy. The single chain fragment variable of which (ScFv αvβ3) has been reported to inhibit tumor growth both in vitro and in vivo. Here, we conjugated cdGIGPQc which can exclusively bind to NSCLC cells according to our previous study synthesized by SPPS with ScFv αvβ3 expressed in E. coli BL21 (DE3) to develop a novel lung cancer specific targeted drug. Specific cell targeting of cdGIGPQc-ScFv was assessed in parallel with the single ScFv and a control nonspecific peptide-ScFv through immunofluorescence and flow cytometry while the αvβ3-binding property was examined by Western blot. Our results showed that cdGIGPQc-ScFv retained both the lung cancer-binding activity of cdGIGPQc and the antigen-recognizing ability of ScFv αvβ3 in vitro. CCK8 assays and in animal experiments suggested that cdGIGPQc-ScFv possessed a superior antitumor effect than ScFv and nonspecific peptide-ScFv both in vitro and vivo. Further immunohistochemical staining revealed that cdGIGPQc-ScFv retarded lung cancer growth through inhibiting tumor angiogensis and proliferation. Therefore, cdGIGPQc delivery of ScFv αvβ3 to lung cancer may be a hopeful new strategy for enhancing specific antitumor efficacy and cdGIGPQc-ScFv could be a potential drug for lung cancer targeted treatment. PMID:28042504

  14. Erythromycin and clarithromycin modulation of growth factor-induced expression of heparanase mRNA on human lung cancer cells in vitro.

    PubMed Central

    Sasaki, M; Ito, T; Kashima, M; Fukui, S; Izumiyama, N; Watanabe, A; Sano, M; Fujiwara, Y; Miura, M

    2001-01-01

    Heparanase activity is correlated with the metastatic potential of several cancer cells and is a key enzyme in the breakdown of tissue barriers. It is also involved in the regulation of growth factor and cytokine activity. However, little is known about the factors that induce heparanase in cancer cells. We investigated the effect of three growth factors, platelet-derived growth factor (PDGF), hepatocyte growth factor (HGF) and basic fibroblast growth factor (bFGF), on heparanase mRNA induction in lung cancer cells in vitro. In addition, we examined the effect of erythromycin (EM) and clarithromycin (CAM), which are 14-membered ring macrolide antibiotics that act as biological response modifiers, on the expression of heparanase mRNA induced by growth factors. PDGF, HGF and bFGF stimulated cell migration activity and enhanced the expression of heparanase mRNA in the human lung adenocarcinoma cell line A549. Via different mechanisms, EM and CAM modulate the induction by these factors of heparanase mRNA expression on A549 cells. EM also significantly suppressed A549 cell migration induced by PDGF and HGF, and CAM significantly suppressed A549cell migration induced by bFGF. The results suggest that the growth factors PDGF, HGF and bFGF are important inducers of heparanase in potentially invasive and metastatic cancer cells. The suppressive effect of heparanase mRNA expression by EM and CAM may have interestingtherapeutic applications in the prevention of metastasis. PMID:11759110

  15. Optimizing the use of epidermal growth factor receptor inhibitors in advanced non-small-lung cancer (NSCLC)

    PubMed Central

    Shash, Emad; Peccatori, Fedro Alessandro; Azim, Hatem A

    2011-01-01

    Lung cancer is the leading cause of cancer-related death in US and Europe. Treatment with a platinum-based chemotherapy remains the standard of care, however with modest effect on quality of life and overall survival which seldom reaches 1 year. Recently, several classes of targeted agents have emerged showing promising results. In particular, agents targeting the epidermal growth factor receptor (EGFR) showed impressive clinical activity both in the first line and salvage settings. However, it is evident that these drugs are not effective in all patients. Putting into consideration the very high cost of these agents, there is an urgent need to provide reliable tools to identify those patients that would derive the maximum benefit from these drugs. Several predictive biomarkers were developed to identify those patients who would derive the maximal benefit of these drugs. In this review we will discuss the recent updates on the role of EGFR inhibitors in the treatment of advanced NSCLC and the role of predictive bio-markers in patient selection. PMID:22263061

  16. Expression of nerve growth factor and hypoxia inducible factor-1α and its correlation with angiogenesis in non-small cell lung cancer.

    PubMed

    Lu, Qing-li; Liu, Jian; Zhu, Xiao-li; Xu, Wen-jia

    2014-06-01

    In order to investigate the expression of nerve growth factor (NGF) and hypoxia inducible factor-1α (HIF-1α) and its correlation with angiogenesis in non-small cell lung cancer (NSCLC), paraffin-embedded tissue blocks from 20 patients with NSCLC were examined. Twenty corresponding para-cancerous lung tissue specimens were obtained to serve as a control. The expression of NGF, HIF-1α, and vascular endothelial growth factor (VEGF) in the NSCLC tissues was detected by using immunohistochemistry. The microvascular density (MVD) was determined by CD31 staining. The results showed that the expression levels of NGF, HIF-1α and VEGF in the NSCLC tissues were remarkably higher than those in the para-cancerous lung tissues (P<0.05). There was significant difference in the MVD between the NSCLC tissues (9.19±1.43) and para-cancerous lung tissues (2.23±1.19) (P<0.05). There were positive correlations between NGF and VEGF, between HIF-1α and VEGF, and between NGF and HIF-1α in NSCLC tissues, with the spearman correlation coefficient being 0.588, 0.519 and 0.588, respectively. In NSCLC tissues, the MVD had a positive correlation with the three factors (P<0.05). Theses results suggest that NGF and HIF-1α are synergically involved in the angiogenesis of NSCLC.

  17. Blocking M2 muscarinic receptor signaling inhibits tumor growth and reverses epithelial-mesenchymal transition (EMT) in non-small cell lung cancer (NSCLC).

    PubMed

    Zhao, Qingnan; Gu, Xiajing; Zhang, Chun; Lu, Qin; Chen, Hongzhuan; Xu, Lu

    2015-01-01

    Lung cancers express non-neuronal, cholinergic autoparacrine loop, which facilitates tumor growth. Interruption of M3 muscarinic cholinergic signaling has been reported to inhibit small cell lung cancer (SCLC) growth. The purpose of this study is to investigate if blocking autoparacrine muscarinic cholinergic signaling could inhibit non-small cell lung cancer (NSCLC) growth and possible underlying mechanisms. Our results showed that PC9 and A549 cells expressed all 5 subtypes of muscarinic receptor (mAChR) and blocking M2 mAChR (M2R) signaling using selective antagonist methoctramine or short hairpin RNA (shRNA) inhibited tumor cell proliferation in vitro and in vivo. Consistent with AChR agonists stimulating p44/42 MAPK (Erk1/2) and Akt phosphorylation, blocking M2R signaling decreased MAPK and Akt phosphorylation, indicating that non-neuronal ACh functions as an autoparacrine growth factor signaling in part through activation of M2R and downstream MAPK and Akt pathways. Importantly, further studies revealed that blocking M2R signaling also reversed epithelial-mesenchymal transition (EMT) in vitro and in vivo, indicating that non-neuronal ACh promotes EMT partially through activation of M2R. These findings demonstrate that M2R plays a role in the growth and progression of NSCLC and suggest M2R antagonists may be an efficacious adjuvant therapy for NSCLC.

  18. Pain management in lung cancer.

    PubMed

    Nurwidya, Fariz; Syahruddin, Elisna; Yunus, Faisal

    2016-01-01

    Lung cancer is the leading cause of cancer-related mortality worldwide. Not only burdened by the limited overall survival, lung cancer patient also suffer from various symptoms, such as pain, that implicated in the quality of life. Cancer pain is a complicated and transiently dynamic symptom that results from multiple mechanisms. This review will describe the pathophysiology of cancer pain and general approach in managing a patient with lung cancer pain. The use of opioids, nonsteroidal anti-inflammatory drugs (NSAIDs), and adjuvant analgesia, as part of the pharmacology therapy along with interventional strategy, will also be discussed.

  19. Effect of macrophage-modulating agents on in vivo growth of transplantable Lewis lung cancer in mice.

    PubMed

    Nowicki, A; Ostrowska, G; Aukerman, S L; Wiktor-Jedrzejczak, W

    1994-01-01

    C57Bl/6 mice, bearing transplantable Lewis lung cancer (non-metastatic subline) implanted either subcutaneously or intraperitoneally were treated with macrophage colony stimulating factor (M-CSF, 10(6) units per mouse, per day for 19 days), Escherichia coli lipopolysaccharide or both. Lipopolysaccharide (5 micrograms per mouse) administered daily once a day for up to 30 days impaired both subcutaneous and intraperitoneal tumor growth and prolonged survival of tumor bearing mice. Macrophage colony stimulating factor, administered daily, inhibited only subcutaneous tumor growth, both when administered alone and in combination with with lipopolysaccharide, and had no effect on intraperitoneal tumor. Moreover, it did not prolong survival of tumor bearing mice, when administered alone, and nullified the effects of lipopolysaccharide when administered concomitantly. These data suggest that macrophage colony stimulating factor, at least in this tumor model and in this dose schedule, offers little benefit. In contrast, the present data confirm earlier suggestions on therapeutic usefulness of bacterial lipopolysaccharide in neoplastic disease, which makes this compound an interesting candidate for future clinical trials.

  20. Fibroblast growth factor signaling and inhibition in non-small cell lung cancer and their role in squamous cell tumors

    PubMed Central

    Salgia, Ravi

    2014-01-01

    With the introduction of targeted agents primarily applicable to non-small cell lung cancer (NSCLC) of adenocarcinoma histology, there is a heightened unmet need in the squamous cell carcinoma population. Targeting the angiogenic fibroblast growth factor (FGF)/FGF receptor (FGFR) signaling pathway is among the strategies being explored in squamous NSCLC; these efforts are supported by growth-promoting effects of FGF signaling in preclinical studies (including interactions with other pathways) and observations suggesting that FGF/FGFR-related aberrations may be more common in squamous versus adenocarcinoma and other histologies. A number of different anti-FGF/FGFR approaches have shown promise in preclinical studies. Clinical trials of two multitargeted tyrosine kinase inhibitors are restricting enrollment to patients with squamous NSCLC: a phase I/II trial of nintedanib added to first-line gemcitabine/cisplatin and a phase II trial of ponatinib for previously treated advanced disease, with the latter requiring not only squamous disease but also a confirmed FGFR kinase amplification or mutation. There are several ongoing clinical trials of multitargeted agents in general NSCLC populations, including but not limited to patients with squamous disease. Other FGF/FGFR-targeted agents are in earlier clinical development. While results are awaited from these clinical investigations in squamous NSCLC and other disease settings, additional research is needed to elucidate the role of FGF/FGFR signaling in the biology of NSCLC of different histologies. PMID:24711160

  1. Production of insulin-like growth factor binding proteins by small-cell lung cancer cell lines

    SciTech Connect

    Jaques, G.; Kiefer, P.; Rotsch, M.; Hennig, C.; Goeke, R.; Richter, G.; Havemann, K. )

    1989-10-01

    Conditioned serum-free media (CM) from small-cell lung cancer (SCLC) cell lines were examined for the presence of insulin-like growth-factor-binding proteins (IGF-BP). 6/9 SCLC cell lines secreted binding proteins with high affinity for IGFs. When ({sup 125}I)IGF-1 or ({sup 125}I)IGF-II was incubated with the CMs, complexes of tracer with proteins could be demonstrated by gel filtration, by precipitation with polyethylenglycol, and after adsorption of unbound tracer with activated charcoal. Analysis of binding data according to the method of Scatchard resulted in linear plots for IGF-I and IGF-II. Cross-linking of ({sup 125}I)IGF-I or ({sup 125}I)IGF-II to the CMs followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under nonreducing conditions revealed the presence of IGF-BPs with molecular masses in the range of 24-32 kDa. Northern blot hybridization with an IGF-BP cDNA probe encoding a low-molecular-weight IGF-BP from a human placenta cDNA library and Western blot analysis with a corresponding polyclonal antibody showed no expression of this gene. These data demonstrate that SCLC cell lines release IGF-BPs in culture supernatants, which differ from IGF-BPs detected in liver and placenta. These IGF-BPs might be important mediators in the autocrine/paracrine growth regulation of IGFs in SCLC.

  2. PKCδ regulates integrin αVβ3 expression and transformed growth of K-ras dependent lung cancer cells

    PubMed Central

    Symonds, Jennifer M.; Ohm, Angela M.; Tan, Aik-Choon; Reyland, Mary E.

    2016-01-01

    We have previously shown that Protein Kinase C delta (PKCδ) functions as a tumor promoter in non-small cell lung cancer (NSCLC), specifically in the context of K-ras addiction. Here we define a novel PKCδ -> integrin αVβ3->Extracellular signal-Regulated Kinase (ERK) pathway that regulates the transformed growth of K-ras dependent NSCLC cells. To explore how PKCδ regulates tumorigenesis, we performed mRNA expression analysis in four KRAS mutant NSCLC cell lines that stably express scrambled shRNA or a PKCδ targeted shRNA. Analysis of PKCδ-dependent mRNA expression identified 3183 regulated genes, 210 of which were specifically regulated in K-ras dependent cells. Genes that regulate extracellular matrix and focal adhesion pathways were most highly represented in this later group. In particular, expression of the integrin pair, αVβ3, was specifically reduced in K-ras dependent cells with depletion of PKCδ, and correlated with reduced ERK activation and reduced transformed growth as assayed by clonogenic survival. Re-expression of PKCδ restored ITGAV and ITGB3 mRNA expression, ERK activation and transformed growth, and this could be blocked by pretreatment with a αVβ3 function-blocking antibody, demonstrating a requirement for integrin αVβ3 downstream of PKCδ. Similarly, expression of integrin αV restored ERK activation and transformed growth in PKCδ depleted cells, and this could also be inhibited by pretreatment with PD98059. Our studies demonstrate an essential role for αVβ3 and ERK signalingdownstream of PKCδ in regulating the survival of K-ras dependent NSCLC cells, and identify PKCδ as a novel therapeutic target for the subset of NSCLC patients with K-ras dependent tumors. PMID:26918447

  3. American Cancer Society lung cancer screening guidelines.

    PubMed

    Wender, Richard; Fontham, Elizabeth T H; Barrera, Ermilo; Colditz, Graham A; Church, Timothy R; Ettinger, David S; Etzioni, Ruth; Flowers, Christopher R; Gazelle, G Scott; Kelsey, Douglas K; LaMonte, Samuel J; Michaelson, James S; Oeffinger, Kevin C; Shih, Ya-Chen Tina; Sullivan, Daniel C; Travis, William; Walter, Louise; Wolf, Andrew M D; Brawley, Otis W; Smith, Robert A

    2013-01-01

    Findings from the National Cancer Institute's National Lung Screening Trial established that lung cancer mortality in specific high-risk groups can be reduced by annual screening with low-dose computed tomography. These findings indicate that the adoption of lung cancer screening could save many lives. Based on the results of the National Lung Screening Trial, the American Cancer Society is issuing an initial guideline for lung cancer screening. This guideline recommends that clinicians with access to high-volume, high-quality lung cancer screening and treatment centers should initiate a discussion about screening with apparently healthy patients aged 55 years to 74 years who have at least a 30-pack-year smoking history and who currently smoke or have quit within the past 15 years. A process of informed and shared decision-making with a clinician related to the potential benefits, limitations, and harms associated with screening for lung cancer with low-dose computed tomography should occur before any decision is made to initiate lung cancer screening. Smoking cessation counseling remains a high priority for clinical attention in discussions with current smokers, who should be informed of their continuing risk of lung cancer. Screening should not be viewed as an alternative to smoking cessation. Copyright © 2013 American Cancer Society, Inc.

  4. Suppression of tumor growth in lung cancer xenograft model mice by poly(sorbitol-co-PEI)-mediated delivery of osteopontin siRNA.

    PubMed

    Cho, Won-Young; Hong, Seong-Ho; Singh, Bijay; Islam, Mohammad Ariful; Lee, Somin; Lee, Ah Young; Gankhuyag, Nomundelger; Kim, Ji-Eun; Yu, Kyeong-Nam; Kim, Kwang-Ho; Park, Young-Chan; Cho, Chong-Su; Cho, Myung-Haing

    2015-08-01

    Small interfering RNA (siRNA)-mediated gene silencing represents a promising strategy for treating diseases such as cancer; however, specific gene silencing requires an effective delivery system to overcome the instability and low transfection efficiency of siRNAs. To address this issue, a polysorbitol-based transporter (PSOT) was prepared by low molecular weight branched polyethylenimine (bPEI) crosslinked with sorbitol diacrylate (SDA). Osteopontin (OPN) gene, which is highly associated with non-small cell lung cancer (NSCLC) was targeted by siRNA therapy using siRNA targeting OPN (siOPN). Characterization study confirmed that PSOT formed compact complexes with siOPN and protected siOPN against degradation by RNase. PSOT/siOPN complexes demonstrated low cytotoxicity and enhanced transfection efficiency in vitro, suggesting that this carrier may be suitable for gene silencing. In the A549 and H460 lung cancer cell lines, PSOT/siOPN complexes demonstrated significant silencing efficiency at both RNA and protein levels. To study in vivo tumor growth suppression, two lung cancer cell-xenograft mouse models were prepared and PSOT/siOPN complexes were delivered into the mice through intravenous injection. The siOPN-treated groups demonstrated significantly reduced OPN expression at both the RNA and protein levels as well as suppression of tumor volume and weight. Taken together, siOPN delivery using PSOT may present an effective and novel therapeutic system for lung cancer treatment.

  5. Dexamethasone suppresses the growth of human non-small cell lung cancer via inducing estrogen sulfotransferase and inactivating estrogen

    PubMed Central

    Wang, Li-jie; Li, Jian; Hao, Fang-ran; Yuan, Yin; Li, Jing-yun; Lu, Wei; Zhou, Tian-yan

    2016-01-01

    Aim: Dexamethasone (DEX) is a widely used synthetic glucocorticoid, which has shown anti-cancer efficacy and anti-estrogenic activity. In this study we explored the possibility that DEX might be used as an endocrine therapeutic agent to treat human non-small cell lung cancer (NSCLC). Methods: The viability and proliferation of human NSCLC cell lines A549 and H1299 were assessed in vitro. Anti-tumor action was also evaluated in A549 xenograft nude mice treated with DEX (2 or 4 mg·kg−1·d−1, ig) or the positive control tamoxifen (50 mg·kg−1·d−1, ig) for 32 d. The expression of estrogen sulfotransferase (EST) in tumor cells and tissues was examined. The intratumoral estrogen levels and uterine estrogen responses were measured. Results: DEX displayed mild cytotoxicity to the NSCLC cells (IC50 >500 μmol/L) compared to tamoxifen (IC50 <50 μmol/L), but it was able to inhibit the cell proliferation at low micromolar ranges. Furthermore, DEX (0.1–10 μmol/L) dose-dependently up-regulated EST expression in the cells, and inhibited the cell migration in vitro. Triclosan, a sulfation inhibitor, was able to diminish DEX-caused inhibition on the cell viability. In A549 xenograft nude mice, DEX or tamoxifen administration remarkably suppressed the tumor growth. Moreover, DEX administration dose-dependently increased EST expression in tumor tissues, and reduced intratumoral estrogen levels as well as the volumes and weights of uterine. Conclusion: DEX suppresses the growth of A549 xenograft tumors via inducing EST and decreasing estradiol levels in tumor tissues, suggesting that DEX may be used as anti-estrogenic agent for the treatment of NSCLC. PMID:27133297

  6. Expression Levels of Some Antioxidant and Epidermal Growth Factor Receptor Genes in Patients with Early-Stage Non-Small Cell Lung Cancer

    PubMed Central

    De Palma, Giuseppe; Mozzoni, Paola; Acampa, Olga; Internullo, Eveline; Carbognani, Paolo; Rusca, Michele; Goldoni, Matteo; Corradi, Massimo; Tiseo, Marcello; Apostoli, Pietro; Mutti, Antonio

    2010-01-01

    This study was aimed at: (i) investigating the expression profiles of some antioxidant and epidermal growth factor receptor genes in cancerous and unaffected tissues of patients undergoing lung resection for non-small cell lung cancer (NSCLC) (cross-sectional phase), (ii) evaluating if gene expression levels at the time of surgery may be associated to patients' survival (prospective phase). Antioxidant genes included heme oxygenase 1 (HO-1), superoxide dismutase-1 (SOD-1), and -2 (SOD-2), whereas epidermal growth factor receptor genes consisted of epidermal growth factor receptor (EGFR) and v-erb-b2 erythroblastic leukaemia viral oncogene homolog 2 (HER-2). Twenty-eight couples of lung biopsies were obtained and gene transcripts were quantified by Real Time RT-PCR. The average follow-up of patients lasted about 60 months. In the cancerous tissues, antioxidant genes were significantly hypo-expressed than in unaffected tissues. The HER-2 transcript levels prevailed in adenocarcinomas, whereas EGFR in squamocellular carcinomas. Patients overexpressing HER-2 in the cancerous tissues showed significantly lower 5-year survival than the others. PMID:20700416

  7. Inhibitors of the arachidonic acid pathway and peroxisome proliferator-activated receptor ligands have superadditive effects on lung cancer growth inhibition.

    PubMed

    Avis, Ingalill; Martínez, Alfredo; Tauler, Jordi; Zudaire, Enrique; Mayburd, Anatoly; Abu-Ghazaleh, Raed; Ondrey, Frank; Mulshine, James L

    2005-05-15

    Arachidonic acid (AA) metabolizing enzymes and peroxisome proliferator-activated receptors (PPARs) have been shown to regulate the growth of epithelial cells. We have previously reported that exposure to the 5-lipoxygenase activating protein-directed inhibitor MK886 but not the cyclooxygenase inhibitor, indomethacin, reduced growth, increased apoptosis, and up-regulated PPARalpha and gamma expression in breast cancer cell lines. In the present study, we explore approaches to maximizing the proapoptotic effects of PPARgamma on lung cancer cell lines. Non-small-cell cancer cell line A549 revealed dose-dependent PPARgamma reporter activity after treatment with MK886. The addition of indomethacin in combination with MK886 further increases reporter activity. We also show increased growth inhibition and up-regulation of apoptosis after exposure to MK886 alone, or in combination with indomethacin and the PPAR ligand, 15-deoxy-Delta12,14-prostaglandin J2 compared with single drug exposures on the adenocarcinoma cell line A549 and small-cell cancer cell lines H345, N417, and H510. Real-time PCR analyses showed increased PPAR mRNA and retinoid X receptor (RXR)alpha mRNA expression after exposure to MK886 and indomethacin in a time-dependent fashion. The results suggest that the principal proapoptotic effect of these drugs may be mediated through the known antiproliferative effects of the PPARgamma-RXR interaction. We therefore explored a three-drug approach to attempt to maximize this effect. The combination of low-dose MK886, ciglitazone, and 13-cis-retinoic acid interacted at least in a superadditive fashion to inhibit the growth of lung cancer cell lines A549 and H1299, suggesting that targeting PPARgamma and AA action is a promising approach to lung cancer growth with a favorable therapeutic index.

  8. [Influence of MSA on cell growth and spontaneousn metastasis of L9981-Luc lung cancer transplanted model in nude mice by bioluminescence imaging].

    PubMed

    Ren, Yuanrong; Wang, Yuli; Liu, Hongyu; Yan, Huiqin; Chen, Jun; Hou, Mei; Li, Weimin; Fan, Yaguang; Zhou, Qinghua

    2013-02-01

    Methylseleninic acid (MSA) is an artificially developed selenium compound. It has been proven that MSA could inhibit growth and metastasis on many tumor cells. This study investigated whether MSA has an impact on the growth and metastasis of L9981-Luc lung cancer transplanted model in nude mice or not. A transplantated tumor model was established in nude mice. Fifteen nude mice were randomly divided into three groups: the control group treated with normal saline (0.2 mL/d), the MSA group treated with MSA solution (0.2 mL), and the cisplatin (DDP) group injected intraperitoneally with DDP (4 mg/kg/w). Inhibition of MSA on tumor growth and tumor metastasis was observed using the IVIS Imaging System 200 Series. A significant difference was obserced in the primary tumor bioluminescence among the three groups (P=0.002) on 21 days post-inoculation. Primary tumor bioluminescence in the DDP group (P=0.001) and in the MSA group (P=0.031) was significantly lower than that in the control group (P=0.001). No significant difference in the metastasis bioluminescence of the thoracic area was indicated among the three groups (P>0.05). MSA can inhibit the growth of planted tumor of transgenic lung cancer cell lines L9981-Luc in nude mice. MSA may also suppress the distant metastasis of the transplanted tumor of transgenic lung cancer cell lines L9981-Luc in nude mice.

  9. American Cancer Society Lung Cancer Screening Guidelines

    PubMed Central

    Wender, Richard; Fontham, Elizabeth T. H.; Barrera, Ermilo; Colditz, Graham A.; Church, Timothy R.; Ettinger, David S.; Etzioni, Ruth; Flowers, Christopher R.; Gazelle, G. Scott; Kelsey, Douglas K.; LaMonte, Samuel J.; Michaelson, James S.; Oeffinger, Kevin C.; Shih, Ya-Chen Tina; Sullivan, Daniel C.; Travis, William; Walter, Louise; Wolf, Andrew M. D.; Brawley, Otis W.; Smith, Robert A.

    2013-01-01

    Findings from the National Cancer Institute’s National Lung Screening Trial established that lung cancer mortality in specific high-risk groups can be reduced by annual screening with low-dose computed tomography. These findings indicate that the adoption of lung cancer screening could save many lives. Based on the results of the National Lung Screening Trial, the American Cancer Society is issuing an initial guideline for lung cancer screening. This guideline recommends that clinicians with access to high-volume, high-quality lung cancer screening and treatment centers should initiate a discussion about screening with apparently healthy patients aged 55 years to 74 years who have at least a 30-pack-year smoking history and who currently smoke or have quit within the past 15 years. A process of informed and shared decision-making with a clinician related to the potential benefits, limitations, and harms associated with screening for lung cancer with low-dose computed tomography should occur before any decision is made to initiate lung cancer screening. Smoking cessation counseling remains a high priority for clinical attention in discussions with current smokers, who should be informed of their continuing risk of lung cancer. Screening should not be viewed as an alternative to smoking cessation. PMID:23315954

  10. Drugs Approved for Lung Cancer

    Cancer.gov

    This page lists cancer drugs approved by the Food and Drug Administration (FDA) for lung cancer. The list includes generic names, brand names, and common drug combinations, which are shown in capital letters.

  11. Radiation Therapy for Lung Cancer

    MedlinePlus

    ... of the lung cancer and your overall health. Radiation Therapy Radiation is a high-energy X-ray that can ... surgery, chemotherapy or both depending upon the circumstances. Radiation therapy works within cancer cells by damaging their ...

  12. Not all epidermal growth factor receptor mutations in lung cancer are created equal: Perspectives for individualized treatment strategy.

    PubMed

    Kobayashi, Yoshihisa; Mitsudomi, Tetsuya

    2016-09-01

    Somatic mutations in the epidermal growth factor receptor (EGFR) gene are present in approximately 20% (in Caucasians) to 40% (in East Asians) of adenocarcinomas of the lung. Targeted therapy for these lung cancers has been established based on evidence regarding mainly common mutations; that is, exon 19 deletions (Del19) and L858R. EGFR-tyrosine kinase inhibitors (TKI), gefitinib, erlotinib or afatinib showed high objective response rates (ORR) of approximately 60%. Several studies suggested that Del19 might be more sensitive to EGFR-TKI than L858R. On the other hand, it has been difficult to establish evidence for other less common mutations, accounting for 12% of all EGFR mutations, because there are many variants and many studies have excluded patients with these uncommon mutations. However, recent studies revealed that these rare genotypes could be targetable if appropriate TKI are selected. For example, G719X (X denotes A, S, C and so on), Del18, E709K, insertions in exon 19 (Ins19), S768I or L861Q showed moderate sensitivities to gefitinib or erlotinb with ORR of 30%-50%. However, afatinib appeared to be especially effective for these tumors. Although Ins20s (except for insFQEA) have been regarded as resistant mutations, osimertinib may be effective for rare subtypes of them and nazartinib (EGF816) is promising for the majority of them. For the further development of targeted therapy in all EGFR mutations, it is important to precisely detect targetable mutations, to select the most appropriate TKI for each mutation, and to continue investigating in vitro studies and collecting clinical data on even rare mutations.

  13. Physical activity and lung cancer prevention.

    PubMed

    Emaus, Aina; Thune, Inger

    2011-01-01

    Since lung cancer is among the cancers with the highest incidence and has the highest mortality rate of cancer worldwide, the means of reducing its impact are urgently needed. Emerging evidence shows that physical activity plays an etiological role in lung cancer risk reduction. The majority of studies support the fact that total and recreational physical activity reduces lung cancer risk by 20-30% for women and 20-50% for men, and there is evidence of a dose-response effect. The biological mechanisms operating between physical activity and lung cancer are likely complex and influenced by many factors including inherited or acquired susceptibility genes, gender, smoking, and other environmental factors. Several plausible biological factors and mechanisms have been hypothesized linking physical activity to reduced lung cancer risk including: improved pulmonary function, reduced concentrations of carcinogenic agents in the lungs, enhanced immune function, reduced inflammation, enhanced DNA repair capacity, changes in growth factor levels and possible gene-physical activity interactions. Future research should target the possible subgroup effects and the biologic mechanisms that may be involved.

  14. Tumor growth affects the metabonomic phenotypes of multiple mouse non-involved organs in an A549 lung cancer xenograft model

    PubMed Central

    Xu, Shan; Tian, Yuan; Hu, Yili; Zhang, Nijia; Hu, Sheng; Song, Dandan; Wu, Zhengshun; Wang, Yulan; Cui, Yanfang; Tang, Huiru

    2016-01-01

    The effects of tumorigenesis and tumor growth on the non-involved organs remain poorly understood although many research efforts have already been made for understanding the metabolic phenotypes of various tumors. To better the situation, we systematically analyzed the metabolic phenotypes of multiple non-involved mouse organ tissues (heart, liver, spleen, lung and kidney) in an A549 lung cancer xenograft model at two different tumor-growth stages using the NMR-based metabonomics approaches. We found that tumor growth caused significant metabonomic changes in multiple non-involved organ tissues involving numerous metabolic pathways, including glycolysis, TCA cycle and metabolisms of amino acids, fatty acids, choline and nucleic acids. Amongst these, the common effects are enhanced glycolysis and nucleoside/nucleotide metabolisms. These findings provided essential biochemistry information about the effects of tumor growth on the non-involved organs. PMID:27329570

  15. Cullin7 is required for lung cancer cell proliferation and is overexpressed in lung cancer.

    PubMed

    Men, Xuelin; Wang, Lingcheng; Yu, Wenfei; Ju, Yuanrong

    2015-01-01

    Ubiquitin ligase Cullin7 has been identified as an oncogene in some malignant diseases such as choriocarcinoma and neuroblastoma. However, the role of Cullin7 in lung cancer carcinogenesis remains unclear. In this study, we explored the functional role of Cullin7 in lung cancer cell proliferation and tumorigenesis and determined its expression profile in lung cancer. Knocking down Cullin7 expression by small interfering RNA (siRNA) in lung cancer cells inhibited cell proliferation and elevated the expression of p53, p27, and p21 proteins. The enhanced p53 expression resulted from activation of the DNA damage response pathway. Cullin7 knockdown markedly suppressed xenograft tumor growth in vivo in mice. Moreover, Cullin7 expression was increased in primary lung cancer tissues of humans. Thus, Cullin7 is required for sustained proliferation and survival of tumor cells in vitro and in vivo, and its aberrant expression may contribute to the pathogenesis of lung cancer. Thus, our study provided evidence that Cullin7 functions as a novel oncogene in lung cancer and may be a potential therapeutic target for lung cancer management.

  16. Expression and autoregulation of transforming growth factor beta receptor mRNA in small-cell lung cancer cell lines.

    PubMed Central

    Nørgaard, P.; Spang-Thomsen, M.; Poulsen, H. S.

    1996-01-01

    In small-cell lung cancer cell lines resistance to growth inhibition by transforming growth factor (TGF)-beta 1, was previously shown to correlate with lack of TGF-beta receptor I (RI) and II (RII) proteins. To further investigate the role of these receptors, the expression of mRNA for RI, RII and beta-glycan (RIII) was examined. The results showed that loss of RII mRNA correlated with TGF-beta 1 resistance. In contrast, RI-and beta-glycan mRNA was expressed by all cell lines, including those lacking expression of these proteins. According to Southern blot analysis, the loss of type II mRNA was not due to gross structural changes in the gene. The effect of TGF-beta 1 on expression of TGF-beta receptor mRNA (receptor autoregulation) was examined by quantitative Northern blotting in four cell lines with different expression of TGF-beta receptor proteins. In two cell lines expressing all three TGF-beta receptor proteins beta-glycan mRNA was rapidly down-regulated and this effect was sustained throughout the 24 h observation period. RI and RII mRNAs were slightly increased 24 h after treatment. In one cell line sensitive to growth inhibition by TGF-beta, 1 but lacking beta-glycan expression, and one cell line expressing only beta-glycan and thus TGF-beta 1 -resistant, no autoregulation of mRNA of either TGF-beta receptor was demonstrated. The results suggest that TGF-beta 1 regulates the expression of its receptors, in particular beta-glycan, and that this effect is dependent on co-expression of beta-glycan, RI and RII. Images Figure 1 Figure 2 Figure 4 PMID:8624260

  17. Association between survivin genetic polymorphisms and epidermal growth factor receptor mutation in non-small-cell lung cancer

    PubMed Central

    Liu, Tu-Chen; Hsieh, Ming-Ju; Wu, Wen-Jun; Chou, Ying-Erh; Chiang, Whei-Ling; Yang, Shun-Fa; Su, Shih-Chi; Tsao, Thomas Chang-Yao

    2016-01-01

    Survivin is an anti-apoptotic protein that is implicated in the regulation of apoptosis and cell cycle in various types of cancers. The current study explored the effect of survivin gene polymorphisms and EGFR mutations in non-small-cell lung carcinoma (NSCLC) patients. A total of 360 participants, including 291 adenocarcinoma lung cancer and 69 squamous cell carcinoma lung cancer patients, were selected for the analysis of three survivin genetic variants (survivin -31, +9194, and +9809) by using real-time PCR genotyping. The results indicated that GC+CC genotypes of survivin -31 were significant association with EGFR mutation in lung adenocarcinoma patients (adjusted odds ratio=3.498, 95% CI = 1.171-10.448; p<0.01). Moreover, The GC+CC genotypes of survivin -31 were associated with EGFR L858R mutation but not in exon 19 in-frame deletions. Furthermore, among patients in exon 19 in-frame deletions, those who have at least one polymorphic G allele of survivin -31 have an increased incidence to develop late-stage when compared with those patients homozygous for C/C (OR, 4.800; 95% CI, 1.305-17.658). In conclusion, our results showed that survivin genetic variants were related to EGFR mutation in lung adenocarcinoma patients and might contribute to pathological development to NSCLC. PMID:27994498

  18. Cigarette smoke radioactivity and lung cancer risk.

    PubMed

    Karagueuzian, Hrayr S; White, Celia; Sayre, James; Norman, Amos

    2012-01-01

    To determine the tobacco industry's policy and action with respect to radioactive polonium 210 ((210)Po) in cigarette smoke and to assess the long-term risk of lung cancer caused by alpha particle deposits in the lungs of regular smokers. Analysis of major tobacco industries' internal secret documents on cigarette radioactivity made available online by the Master Settlement Agreement in 1998. The documents show that the industry was well aware of the presence of a radioactive substance in tobacco as early as 1959. Furthermore, the industry was not only cognizant of the potential "cancerous growth" in the lungs of regular smokers but also did quantitative radiobiological calculations to estimate the long-term (25 years) lung radiation absorption dose (rad) of ionizing alpha particles emitted from the cigarette smoke. Our own calculations of lung rad of alpha particles match closely the rad estimated by the industry. According to the Environmental Protection Agency, the industry's and our estimate of long-term lung rad of alpha particles causes 120-138 lung cancer deaths per year per 1,000 regular smokers. Acid wash was discovered in 1980 to be highly effectively in removing (210)Po from the tobacco leaves; however, the industry avoided its use for concerns that acid media would ionize nicotine converting it into a poorly absorbable form into the brain of smokers thus depriving them of the much sought after instant "nicotine kick" sensation. The evidence of lung cancer risk caused by cigarette smoke radioactivity is compelling enough to warrant its removal.

  19. Translation initiation factor eIF3b expression in human cancer and its role in tumor growth and lung colonization.

    PubMed

    Wang, Hong; Ru, Yuanbin; Sanchez-Carbayo, Marta; Wang, Xuejiao; Kieft, Jeffrey S; Theodorescu, Dan

    2013-06-01

    Discovery transcriptomic analyses suggest eukaryotic initiation factor 3b (eIF3b) is elevated in human bladder and prostate cancer, yet its role as a prognostic factor or its requirement in the maintenance or progression of human cancer is not established. Here, we determine the therapeutic potential of eIF3b by examining the clinical relevance of its expression in human cancer tissues and its role in experimental tumor models. We examined mRNA expression of eIF3b in bladder (N = 317) and prostate (N = 566) tissue samples and protein expression by immunohistochemistry in 143 bladder tumor samples as a function of clinicopathologic features. The impact of eIF3b depletion by siRNA in human cancer lines was evaluated in regard to in vitro cell growth, cell cycle, migration, in vivo subcutaneous tumor growth, and lung colonization. eIF3b mRNA expression correlated to tumor grade, stage, and survival in human bladder and prostate cancer. eIF3b protein expression stratified survival in human bladder cancer. eIF3b depletion reduced in vitro cancer cell growth; inhibited G1-S cell-cycle transition by changing protein but not RNA expression of cyclin A, E, Rb, and p27Kip1; inhibited migration; and disrupted actin cytoskeleton and focal adhesions. These changes were associated with decreased protein expression of integrin α5. Integrin α5 depletion phenocopied effects observed with eIF3b. eIF3b-depleted bladder cancer cells formed fewer subcutaneous tumors that grew more slowly and had reduced lung colonization. eIF3b expression relates to human bladder and prostate cancer prognosis, is required for tumor growth, and thus a candidate therapeutic target. ©2013 AACR

  20. [Asbestos-related lung cancer].

    PubMed

    Lotti, M

    2010-01-01

    Lung cancer is the leading cause of tumour death and a large percentage of it is associated with tobacco smoking. Epidemiology has shown that asbestos cumulative exposures increase the risk of lung cancer to a variable extent, depending on the manufacturing process and the specific job. The risk appears relatively small (< or = 2) and is detectable after massive exposures only. Clinical diagnosis of asbestos-related lung cancer is based upon medical history (exposures > 25 ff.ml years double the risk), possible lung fibrosis and counts of asbestos bodies and fibers in bronchoalveolar lavage and lung tissues. Pleural plaques do not correlate with the cumulative exposures that are associated with lung cancer. The multiplicative interaction between smoke and asbestos is only detectable when the risk associated with asbestos exposure is increased, i.e. after high exposures.

  1. Nimotuzumab, a novel monoclonal antibody to the epidermal growth factor receptor, in the treatment of non-small cell lung cancer

    PubMed Central

    Takeda, Masayuki; Okamoto, Isamu; Nishimura, Yasumasa; Nakagawa, Kazuhiko

    2011-01-01

    The epidermal growth factor receptor (EGFR) is a promising therapeutic target in non-small cell lung cancer, and several therapeutic agents that target this receptor, including EGFR tyrosine kinase inhibitors and monoclonal antibodies to EGFR, have been developed. Such monoclonal antibodies have shown efficacy in combination with chemotherapy and radiotherapy. Nimotuzumab (h-R3) is a humanized monoclonal antibody to EGFR, and its effects in combination with radiation have been sufficiently promising to warrant further investigation in several types of cancer. Furthermore, the typical severe dermatologic toxicities associated with other monoclonal antibodies to EGFR have not been observed with nimotuzumab. We here summarize the results of preclinical studies as well as of previous and ongoing clinical trials of nimotuzumab for the treatment of non-small cell lung cancer. PMID:28210119

  2. CCL21/CCR7 up-regulate vascular endothelial growth factor-D expression via ERK pathway in human non-small cell lung cancer cells.

    PubMed

    Sun, Limei; Zhang, Qingfu; Li, Yang; Tang, Na; Qiu, Xueshan

    2015-01-01

    Lymphangiogenesis has received considerable attention and become a new research hotspot of tumor metastasis. Recently, C-C chemokine receptor 7 (CCR7) is known to promote metastasis of non-small cell lung cancer (NSCLC) cells into lymph nodes. In this study, we investigated the relationship between CCL21/CCR7 and the lymphangiogenic factor vascular endothelial growth factor (VEGF)-D in human lung cancer cells and its impact on patients' prognosis. We found that CCL21/CCR7 increase the expression of VEGF-D in NSCLC Cell Lines through induced ERK1/2 and Akt phosphorylation. In addition, our study found that the expression levels of CCR7 and CCL21 were correlated with VEGF-D, lymphatic vessels density (LVD), clinical stages, lymph node metastasis, and patient Survival in 90 human non-small cell lung cancer (NSCLC) specimens. Taken together, our results provide evidence that CCL21/CCR7 induce VEGF-D up-regulation and promote lymphangiogenesis via ERK/Akt pathway in lung cancer.

  3. LUNG CANCER AND PULMONARY THROMBOEMBOLISM

    PubMed Central

    Cukic, Vesna; Ustamujic, Aida

    2015-01-01

    Introduction: Malignant diseases including lung cancer are the risk for development of pulmonary thromboembolism (PTE). Objective: To show the number of PTE in patients with lung cancer treated in Clinic for pulmonary diseases and TB “Podhrastovi” in three-year period: from 2012-2014. Material and methods: This is the retrospective study in which we present the number of various types of lung cancer treated in three-year period, number and per cent of PTE in different types of lung carcinoma, number and per cent of PTE of all diagnosed PTE in lung carcinoma according to the type of carcinoma. Results: In three-year period (from 2012 to 2014) 1609 patients with lung cancer were treated in Clinic for pulmonary diseases and TB “Podhrastovi” Clinical Centre of Sarajevo University. 42 patients: 25 men middle –aged 64.4 years and 17 women middle- aged 66.7 or 2.61% of all patients with lung cancer had diagnosed PTE. That was the 16. 7% of all patients with PTE treated in Clinic “Podhrastovi “in that three-year period. Of all 42 patients with lung cancer and diagnosed PTE 3 patients (7.14%) had planocellular cancer, 4 patients (9.53%) had squamocellular cancer, 9 (21.43%) had adenocarcinoma, 1 (2.38%) had NSCLC, 3 (7.14 %) had microcellular cancer, 1 (2.38%) had neuroendocrine cancer, 2 (4.76%) had large cell-macrocellular and 19 (45.24%) had histological non-differentiated lung carcinoma. Conclusion: Malignant diseases, including lung cancer, are the risk factor for development of PTE. It is important to consider the including anticoagulant prophylaxis in these patients and so to slow down the course of diseases in these patients. PMID:26622205

  4. Osimertinib for the Treatment of Metastatic Epidermal Growth Factor T970M Positive Non-Small Cell Lung Cancer.

    PubMed

    Khozin, Sean; Weinstock, Chana; Blumenthal, Gideon M; Cheng, Joyce; He, Kun; Zhuang, Luning; Zhao, Hong; Orbach, Rosane Charlab; Fan, Ingrid; Keegan, Patricia; Pazdur, Richard

    2016-12-06

    On November 13, 2015, FDA granted accelerated approval to osimertinib (TAGRISSO™; AstraZeneca), a breakthrough therapy-designated drug for the treatment of patients with metastatic epidermal growth factor receptor (EGFR) T790M-positive non-small cell lung cancer (NSCLC), as detected by an FDA-approved test, with progression on or after EGFR tyrosine kinase inhibitor therapy. Approval was based on durable tumor response rates in two single-arm, multicenter trials: the dose extension cohort of a first-in-human trial (AURA extension; n=201) and a fixed-dose, activity-estimating trial (AURA2; n=210). Osimertinib was administered at 80 mg orally once daily. The objective response rates (ORR) per blinded independent committee review were 57% (95% CI: 50%, 64%) in AURA extension and 61% (95% CI: 54%, 68%) in AURA2. Median duration of response (DOR) could not be estimated. Supportive efficacy data from 63 patients in the dose-finding part of the FIH trial demonstrated ORR of 51% (95% CI: 38%, 64%) with median DOR of 12.4 months. Common adverse events (AEs) evaluated in 411 patients included diarrhea (42%), rash (41%), dry skin (31%), and nail toxicity (25%). Grade 3-4 AEs occurred in 28% of patients and 6% discontinued treatment due to AEs.

  5. Second and third-generation epidermal growth factor receptor tyrosine kinase inhibitors in advanced nonsmall cell lung cancer.

    PubMed

    Liao, Bin-Chi; Lin, Chia-Chi; Yang, James Chih-Hsin

    2015-03-01

    The first-generation epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs), gefitinib and erlotinib, are effective as first-line treatment of advanced nonsmall cell lung cancer (NSCLC) harboring activating EGFR mutations (deletions in exon 19 and exon 21 L858R mutation). EGFR T790 M resistance mutation (EGFR T790 M) ultimately emerged in most of these patients. The second and third-generation EGFR-TKIs were designed to have more potent inhibition of EGFR and to overcome EGFR T790 M. This review describes the recent developments of these novel EGFR-TKIs. The second-generation EGFR-TKIs, afatinib and dacomitinib, irreversibly bind to the tyrosine kinase of EGFR and other ErbB-family members. Afatinib has been approved as first-line treatment of advanced NSCLC harboring activating EGFR mutations. Dacomitinib is under development. Third-generation EGFR-TKIs, AZD9291, CO-1686, and HM61713, inhibit both EGFR activating and resistance mutations, while sparing wild-type EGFR. In early-phase studies, these drugs demonstrated promising response rates against tumors with acquired EGFR T790 M. Second-generation EGFR-TKI, afatinib, is available as first-line treatment of advanced NSCLC harboring activating EGFR mutations. Third-generation EGFR-TKIs are under development for tumors harboring acquired EGFR T790 M.

  6. Epidermal Growth Factor Receptor targeting in non-small cell lung cancer: revisiting different strategies against the same target.

    PubMed

    Castañón, Eduardo; Martín, Patricia; Rolfo, Christian; Fusco, Juan P; Ceniceros, Lucía; Legaspi, Jairo; Santisteban, Marta; Gil-Bazo, Ignacio

    2014-01-01

    Epidermal Growth Factor Receptor (EGFR) tyrosine kinase inhibitors (TKIs) have changed the paradigm of treatment in non-small cell lung cancer (NSCLC). The molecular biology study of EGFR has led to clinical trials that select patients more accurately, regarding the presence of EGFR activating mutations. Nonetheless, a lack of response or a temporary condition of the response has been detected in patients on EGFR TKIs. This has urged to study potential resistance mechanisms underneath. The most important ones are the presence of secondary mutations in EGFR, such as T790M, or the overexpression of mesenchymal-epithelial transition factor (MET) that may explain why patients who initially respond to EGFR TKIs, may ultimately become refractory. Several approaches have been taken and new drugs both targeting EGFR resistance-mutation or MET are currently being developed. Here we review and update the EGFR biological pathway as well as the clinical data leading to approval of the EGFR TKIs currently in the market. New compounds under investigation targeting resistance mutations or dually targeting EGFR and other relevant receptors are also reviewed and discussed.

  7. Glucocorticoid receptor over-expression promotes human small cell lung cancer apoptosis in vivo and thereby slows tumor growth.

    PubMed

    Sommer, Paula; Cowen, Rachel L; Berry, Andrew; Cookson, Ann; Telfer, Brian A; Williams, Kaye J; Stratford, Ian J; Kay, Paul; White, Anne; Ray, David W

    2010-03-01

    Small cell lung cancer (SCLC) is an aggressive tumor, associated with ectopic ACTH syndrome. We have shown that SCLC cells are glucocorticoid receptor (GR) deficient, and that restoration of GR expression confers glucocorticoid sensitivity and induces apoptosis in vitro. To determine the effects of GR expression in vivo, we characterized a mouse SCLC xenograft model that secretes ACTH precursor peptides, and so drives high circulating corticosterone concentrations (analogous to the ectopic ACTH syndrome). Infection of SCLC xenografts with GR-expressing adenovirus significantly slowed tumor growth compared with control virus infection. Time to fourfold initial tumor volume increased from a median of 9 days to 16 days (P=0.05; n=7 per group). Post-mortem analysis of GR-expressing tumors revealed a threefold increase in apoptotic (TUNEL positive) cells (P<0.01). Infection with the GR-expressing adenovirus caused a significant reduction in Bcl-2 and Bcl-xL transcripts. Furthermore, in both the GR-expressing adenovirus-infected cells and tumors, a significant number of uninfected cells underwent apoptosis, supporting a bystander cell killing effect. Therefore, GR expression is pro-apoptotic for human SCLCs in vivo, as well as in vitro, suggesting that loss of GR confers a survival advantage to SCLCs.

  8. Tyrosine kinase inhibitors for epidermal growth factor receptor gene mutation-positive non-small cell lung cancers: an update for recent advances in therapeutics.

    PubMed

    Chung, Clement

    2016-06-01

    The presence of activating gene mutations in the epidermal growth factor receptor of non-small cell lung cancer patients is predictive (improved progression-free survival and improved response rate) when treated with small molecule tyrosine kinase inhibitors such as gefitinib, erlotinib and afatinib. The two most common mutations that account for greater than 85% of all EGFR gene mutations are in-frame deletions in exon 19 (LREA deletions) and substitution in exon 21 (L858R). Exon 18 mutations occur much less frequently at about 4% of all EGFR gene mutations. Together, exon 19 deletion and exon 21 L858R gene substitution are present in about 10% of Caucasian patients and 20-40% of Asian patients with non-small cell lung cancer. T790M gene mutation at exon 20 is associated with acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors. Early studies showed that activating EGFR gene mutations are most common in patients with adenocarcinoma histology, women, never smokers and those of Asian ethnicity. A recent multi-center phase III trial suggested that frontline epidermal growth factor receptor tyrosine kinase inhibitor therapy with afatinib is associated with improved progression-free survival compared to chemotherapy regardless of race. Moreover, guidelines now suggest EGFR gene mutation testing should be conducted in all patients with lung adenocarcinoma or mixed lung cancers with an adenocarcinoma component, regardless of characteristics such as smoking status, gender or race. The success of targeted therapies in non-small cell lung cancer patients has changed the treatment paradigm in metastatic non-small cell lung cancer. However, despite a durable response of greater than a year, resistance to epidermal growth factor receptor tyrosine kinase inhibitors inevitably occurs. This mini-review describes the clinically relevant EGFR gene mutations and the efficacy/toxicity of small molecule epidermal growth factor receptor tyrosine kinase

  9. Lung Cancer and Hispanics: Know the Facts

    MedlinePlus

    Lung Cancer and Hispanics: Know the Facts By the National Cancer Institute First, the good news: the number of lung cancer cases diagnosed in ... myth from fact when it comes to lung cancer. So what are the facts?  Smoking is the primary cause of lung cancer. ...

  10. The role of posttraumatic growth and timing of quitting smoking as moderators of the relationship between stigma and psychological distress among lung cancer survivors who are former smokers.

    PubMed

    Shen, Megan Johnson; Coups, Elliot J; Li, Yuelin; Holland, Jimmie C; Hamann, Heidi A; Ostroff, Jamie S

    2015-06-01

    Patients diagnosed with lung cancer report high levels of stigma and psychological distress. This study examined posttraumatic growth among lung cancer survivors as a potential buffer against this relationship between stigma and psychological distress and examined how these relationships differed by the timing of quitting smoking (pre versus post-diagnosis). Stages IA and IB non-small-cell lung cancer survivors (N = 141) who were former smokers, 1-6 years post-treatment, and had no evidence of disease completed standardized questionnaires assessing stigma, posttraumatic growth, timing of quitting smoking history, and psychological distress. Hierarchical linear regression and simple slope analyses indicated that among those who quit smoking prior to diagnosis (pre-diagnosis quitters), stigma had a positive association with psychological distress at high levels of posttraumatic growth (p = 0.003) and had a positive (but non-significant) association with psychological distress among those with low levels of posttraumatic growth (p = 0.167). Among those who quit smoking after diagnosis (post-diagnosis quitters), stigma had a positive association with psychological distress among those with low levels of posttraumatic growth (p = 0.004) but had no relationship among those with high levels of posttraumatic growth (p = 0.880). Findings indicate that posttraumatic growth buffers against the negative effects of stigma on psychological distress but only among post-diagnosis quitters. Future interventions could focus on fostering posttraumatic growth as a way to decrease the negative effects of stigma. Copyright © 2014 John Wiley & Sons, Ltd.

  11. Second lung cancers in patients successfully treated for lung cancer.

    PubMed

    Johnson, B E; Cortazar, P; Chute, J P

    1997-08-01

    The rate of developing second lung cancers and other aerodigestive tumors in patients who have been treated for both small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) is approximately 10-fold higher than other adult smokers. The risk of second lung cancers in patients surviving resection of NSCLC is approximately 1% to 2% per year. The series reported show that the patients who develop second NSCLCs tend to have early-stage NSCLC (predominantly stage I and II). The survival of patients after the second resection of lung cancer is similar to that of patients presenting with initial NSCLC. The risk of second lung cancers in patients surviving SCLC is 2% to 14% per patient per year and increases two- to seven-fold with the passage of time from 2 to 10 years. The risk of second lung cancers in patients treated for SCLC appears to be higher than that found in patients with NSCLC who were treated only with surgical resection. In addition, the chances of successful resection of second primary NSCLCs in patients who were treated for SCLC is much less than that for patients with metachronous lung cancers after an initial NSCLC. Patients treated for SCLC who continue to smoke cigarettes increase their rate of developing second lung cancers. The contribution of chest radiation and chemotherapy administration to the risk of developing second lung tumors remain to be defined but may be responsible for some of the increased risk in patients treated for SCLC compared to patients undergoing a surgical resection for NSCLC.

  12. MicroRNA-19 triggers epithelial-mesenchymal transition of lung cancer cells accompanied by growth inhibition.

    PubMed

    Li, Jing; Yang, Sheng; Yan, Wen; Yang, Jie; Qin, Yu-Juan; Lin, Xiao-Lin; Xie, Rao-Ying; Wang, Sheng-Chun; Jin, Wen; Gao, Fei; Shi, Jun-Wen; Zhao, Wen-Tao; Jia, Jun-Shuang; Shen, Hong-Fen; Ke, Jie-Rong; Liu, Bin; Zhao, Yi-Qiao; Huang, Wen-Hua; Yao, Kai-Tai; Li, Dan-Juan; Xiao, Dong

    2015-09-01

    The miR-19 family (miR-19a and miR-19b-1) are key oncogenic components of the miR-17-92 cluster. Overexpression of miR-19 is strongly associated with cancer invasion and metastasis, and poor prognosis of cancer patients. However, the underlying mechanisms remain largely unknown. In the present study, we found that enforced expression of miR-19 including miR-19a and miR-19b-1 triggered epithelial-mesenchymal transition (EMT) of lung cancer cells A549 and HCC827 as shown by mesenchymal-like morphological conversion, downregulation of epithelial proteins (e.g., E-cadherin, ZO-1 (zona occludens 1), and α-catenin), upregulation of mesenchymal proteins (e.g., vimentin, fibronectin 1, N-cadherin, and snail1), formation of stress fibers, and reduced cell adhesion. In addition, enhanced migration and invasion were observed in the cancer cells A549 and HCC827 undergoing EMT. In contrast, silencing of endogenous miR-19 reversed EMT and reduced the migration and invasion abilities of A549 and HCC827 cells. DNA microarray results revealed significant changes of the expression of genes related to EMT, migration, and metastasis of miR-19-expressing A549 cells. Moreover, siRNA-mediated knockdown of PTEN, a target of miR-19, also resulted in EMT, migration, and invasion of A549 and HCC827 cells, suggesting that PTEN is involved in miR-19-induced EMT, migration and invasion of lung cancer cells. Furthermore, lung cancer cells undergoing EMT induced by miR-19 demonstrated reduced proliferation in vitro and in vivo, and enhanced resistance to apoptosis caused by TNF-α. Taken together, these findings suggest that miR-19 triggers EMT, which has an important role in the invasion and migration of lung cancer cells, accompanied by the reduced proliferation of cells.

  13. Expression of pleiotrophin in small cell lung cancer.

    PubMed

    Wang, H Q; Wang, J

    2015-01-01

    Pleiotrophin (PTN) is a kind of heparin binding growth factor closely related to tumor progression. This study aimed to discuss the significance of the expression of PTN in benign and malignant lung cancer tissues, especially small cell lung cancer. Lung cancer samples were collected for study and lung tissue samples with benign lesions were taken as controls. The expression of PTN was detected using tissue chip combined with the immunohistochemical method, and the differences of small cell lung cancer with non-small cell lung cancer and benign lesion tissue were compared. It was found that PTN expression was mainly located in the cytoplasm and membrane of cells; PTN expression in the lung cancer group was higher than that in the control group (p < 0.01), and PTN expression in the small cell cancer group was higher than that in the squamous carcinoma group and glandular cancer group (p < 0.05). In addition, PTN expression quantity in patients with lung cancer were in close correlation with TNM staging, pathological type and tumor differentiation degree (p < 0.05). PTN was found to express abnormally high in lung cancer, especially small cell lung cancer tissue. PTN is most likely to be a new tumor marker for diagnosis and prognosis of lung cancer.

  14. Enhanced tumor growth in the remaining lung after major lung resection.

    PubMed

    Sano, Fumiho; Ueda, Kazuhiro; Murakami, Junichi; Hayashi, Masataro; Nishimoto, Arata; Hamano, Kimikazu

    2016-05-01

    Pneumonectomy induces active growth of the remaining lung in order to compensate for lost lung tissue. We hypothesized that tumor progression is enhanced in the activated local environment. We examined the effects of mechanical strain on the activation of lung growth and tumor progression in mice. The mechanical strain imposed on the right lung after left pneumonectomy was neutralized by filling the empty space that remained after pneumonectomy with a polypropylene prosthesis. The neutralization of the strain prevented active lung growth. According to an angiogenesis array, stronger monocyte chemoattractant protein-1 (MCP-1) expression was found in the strain-induced growing lung. The neutralization of the strain attenuated the release of MCP-1 from the lung cells. The intravenous injection of Lewis lung cancer cells resulted in the enhanced development of metastatic foci in the strain-induced growing lung, but the enhanced development was canceled by the neutralization of the strain. An immunohistochemical analysis revealed the prominent accumulation of tumor-associated macrophages in tumors arising in the strain-induced growing lung, and that there was a relationship between the accumulation and the MCP-1 expression status. Our results suggested that mechanical lung strain, induced by pulmonary resection, triggers active lung growth, thereby creating a tumor-friendly environment. The modification of that environment, as well as the minimizing of surgical stress, may be a meaningful strategy to improve the therapeutic outcome after lung cancer surgery. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer.

    PubMed

    Choi, Sul Ki; Kim, Hoe Suk; Jin, Tiefeng; Moon, Woo Kyung

    2017-01-02

    Lysyl oxidase (LOX) family genes catalyze collagen cross-link formation. To determine the effects of lysyl oxidase-like 4 (LOXL4) expression on breast tumor formation and metastasis, we evaluated primary tumor growth and lung metastasis in mice injected with LOXL4-knockdown MDA-MB-231 triple-negative human breast cancer cells. In addition, we analyzed overall survival in breast cancer patients based on LOXL4 expression using a public online database. In the mouse xenograft model, LOXL4 knockdown increased primary tumor growth and lung colonization as well as collagen I and IV, lysine hydroxylase 1 and 2, and prolyl 4-hydroxylase subunit alpha 1 and 2 levels. Second harmonic generation imaging revealed that LOXL4 knockdown resulted in the thickening of collagen bundles within tumors. In addition, weak LOXL4 expression was associated with poor overall survival in breast cancer patients from the BreastMark dataset, and this association was strongest in triple-negative breast cancer patients. These results demonstrate that weak LOXL4 expression leads to remodeling of the extracellular matrix through induction of collagen synthesis, deposition, and structural changes. These alterations in turn promote tumor growth and metastasis and are associated with poor clinical outcomes in triple-negative breast cancer.

  16. Polonium and Lung Cancer

    PubMed Central

    Zagà, Vincenzo; Lygidakis, Charilaos; Chaouachi, Kamal; Gattavecchia, Enrico

    2011-01-01

    The alpha-radioactive polonium 210 (Po-210) is one of the most powerful carcinogenic agents of tobacco smoke and is responsible for the histotype shift of lung cancer from squamous cell type to adenocarcinoma. According to several studies, the principal source of Po-210 is the fertilizers used in tobacco plants, which are rich in polyphosphates containing radio (Ra-226) and its decay products, lead 210 (Pb-210) and Po-210. Tobacco leaves accumulate Pb-210 and Po-210 through their trichomes, and Pb-210 decays into Po-210 over time. With the combustion of the cigarette smoke becomes radioactive and Pb-210 and Po-210 reach the bronchopulmonary apparatus, especially in bifurcations of segmental bronchi. In this place, combined with other agents, it will manifest its carcinogenic activity, especially in patients with compromised mucous-ciliary clearance. Various studies have confirmed that the radiological risk from Po-210 in a smoker of 20 cigarettes per day for a year is equivalent to the one deriving from 300 chest X-rays, with an autonomous oncogenic capability of 4 lung cancers per 10000 smokers. Po-210 can also be found in passive smoke, since part of Po-210 spreads in the surrounding environment during tobacco combustion. Tobacco manufacturers have been aware of the alpha-radioactivity presence in tobacco smoke since the sixties. PMID:21772848

  17. Epidermal growth factor activates telomerase activity by direct binding of Ets-2 to hTERT promoter in lung cancer cells.

    PubMed

    Hsu, Chung-Ping; Lee, Li-Wen; Tang, Sheau-Chung; Hsin, I-Lun; Lin, Yu-Wen; Ko, Jiunn-Liang

    2015-07-01

    Growth signals are directly or indirectly involved in telomerase regulation. In this study, we investigated molecular mechanisms of the effect of EGF (epidermal growth factor) on regulating hTERT (human telomerase reverse transcriptase) expression. To elucidate specific transcription factors involved in EGF-stimulated hTERT transcription in A549 and H1299 lung cancer cells, transcription factors drives hTERT promoter activity, such as Myc, Mad, and Ets-2, was evaluated on luciferase reporter assay. The upregulation of hTERT promoter by Ets-2 and Myc were abolished by Mad. Using DAPA (DNA affinity precipitation assay), Ets-2 binding to SNP (T) was stronger than Ets-2 binding to SNP (C) at -245 bp upstream of the transcription start site within the core promoter of hTERT. Ets-2 silence by siRNA decreased hTERT expression at mRNA and protein levels. The regulation of hTERT promoter by EGF/Ets-2 was diminished via the EGFR kinase signal pathway-specific inhibitors AG1478 and Iressa. Inhibitors of Erk and Akt inhibited Ets-2-activated hTERT promoter activity. These data suggested that Ets-2, a genuine cancer-specific transcription factor, is actively involved in EGFR kinase-induced hTERT overexpression pathway in lung cancer cells. Blockage of this pathway may contribute to targeted gene therapy in lung cancer.

  18. Fibroblast-led cancer cell invasion is activated by epithelial-mesenchymal transition through platelet-derived growth factor BB secretion of lung adenocarcinoma.

    PubMed

    Neri, Shinya; Miyashita, Tomoyuki; Hashimoto, Hiroko; Suda, Yoshitaka; Ishibashi, Masayuki; Kii, Hiroaki; Watanabe, Hirotada; Kuwata, Takeshi; Tsuboi, Masahiro; Goto, Koichi; Menju, Toshi; Sonobe, Makoto; Date, Hiroshi; Ochiai, Atsushi; Ishii, Genichiro

    2017-06-01

    Cancer-associated fibroblast (CAF)-dependent local invasion is the process by which cancer cells invade the extracellular matrix using tracks that have been physically remodeled by CAFs. In the present study, we investigated the process by which the epithelial-mesenchymal transition (EMT) of cancer cells affect CAF-dependent local invasion. Using an in vitro collagen invasion assay, we showed cancer cells undergoing EMT to promote the matrix-remodeling ability of CAFs and thereby enhance CAF-dependent local cancer cell invasion. Platelet-derived growth factor (PDGF)-BB secretion was significantly elevated in cancer cells undergoing EMT, and this induced an increase in the invasion ability of both CAFs and cancer cells. Conversely, knockdown of PDGF-B expression in cancer cells undergoing EMT, or treatment with a PDGF-receptor inhibitor, decreased the invasion ability of both CAFs and cancer cells. By analyzing the gene expression profiles of 442 patients with lung adenocarcinomas, we established that high expression of PDGF-B and presentation of mesenchymal-like tumors were significantly associated with a high rate of disease recurrence and poor patient prognosis. Thus, cancer cells undergoing EMT may accelerate their own ability to invade local tissues via PDGF-BB secretion to promote CAF matrix remodeling. Therefore, targeting PDGF signaling between cancer cells undergoing EMT and CAFs is a promising therapeutic target to inhibit cancer progression and improve patient prognosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Amphiregulin triggered epidermal growth factor receptor activation confers in vivo crizotinib-resistance of EML4-ALK lung cancer and circumvention by epidermal growth factor receptor inhibitors.

    PubMed

    Taniguchi, Hirokazu; Takeuchi, Shinji; Fukuda, Koji; Nakagawa, Takayuki; Arai, Sachiko; Nanjo, Shigeki; Yamada, Tadaaki; Yamaguchi, Hiroyuki; Mukae, Hiroshi; Yano, Seiji

    2017-01-01

    Crizotinib, a first-generation anaplastic lymphoma kinase (ALK) tyrosine-kinase inhibitor, is known to be effective against echinoderm microtubule-associated protein-like 4 (EML4)-ALK-positive non-small cell lung cancers. Nonetheless, the tumors subsequently become resistant to crizotinib and recur in almost every case. The mechanism of the acquired resistance needs to be deciphered. In this study, we established crizotinib-resistant cells (A925LPE3-CR) via long-term administration of crizotinib to a mouse model of pleural carcinomatous effusions; this model involved implantation of the A925LPE3 cell line, which harbors the EML4-ALK gene rearrangement. The resistant cells did not have the secondary ALK mutations frequently occurring in crizotinib-resistant cells, and these cells were cross-resistant to alectinib and ceritinib as well. In cell clone #2, which is one of the clones of A925LPE3-CR, crizotinib sensitivity was restored via the inhibition of epidermal growth factor receptor (EGFR) by means of an EGFR tyrosine-kinase inhibitor (erlotinib) or an anti-EGFR antibody (cetuximab) in vitro and in the murine xenograft model. Cell clone #2 did not have an EGFR mutation, but the expression of amphiregulin (AREG), one of EGFR ligands, was significantly increased. A knockdown of AREG with small interfering RNAs restored the sensitivity to crizotinib. These data suggest that overexpression of EGFR ligands such as AREG can cause resistance to crizotinib, and that inhibition of EGFR signaling may be a promising strategy to overcome crizotinib resistance in EML4-ALK lung cancer.

  20. Invasiveness and anchorage independent growth ability augmented by PTEN inactivation through the PI3K/AKT/NFkB pathway in lung cancer cells.

    PubMed

    Akca, Hakan; Demiray, Aydin; Tokgun, Onur; Yokota, Jun

    2011-09-01

    PTEN is inactivated in a subset of lung cancer; therefore, we investigated the involvement of PTEN inactivation in invasiveness of lung cancer cells. AKT at Ser473 was phosphorylated in several lung cancer cell lines with loss of PTEN expression. Therefore, we created a tetracycline inducible expression system of wild-type PTEN (PTEN-WT) as well as catalytically (PTEN-G129R) and lipid phosphatase (PTEN-G129E) inactive PTEN mutants using the PC14, PC9 and PC3 lung adenocarcinoma cell lines, in which endogenous PTEN expression was not detected and AKT at Ser473 was phosphorylated by Western blot analysis. Induction of PTEN-WT reduced phosphorylation of AKT and inhibited the transcriptional activity of NFkB, whereas PTEN mutants did not, suggesting that PTEN inactivation results in the activation of the AKT/NFkB pathway in PC14, PC9 and PC3 cells. Furthermore, overexpression of PTEN-WT suppressed anchorage independent growth in soft agar and reduced invasiveness in a trans-well chamber assay of PC14 cells. Neither PTEN-G129R nor PTEN-G129E had suppressive effects on anchorage independent growth and invasiveness. Augmentation of invasiveness by constitutively active AKT was also shown in mouse NIH3T3 cells. Therefore, it was strongly indicated that activation of the PI3K/AKT/NFkB pathway by PTEN inactivation results in augmented invasiveness in lung cancer cells and lipid phosphatase activity of PTEN plays a key role in this process. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  1. Discovery of 2'-hydroxychalcones as autophagy inducer in A549 lung cancer cells.

    PubMed

    Wang, Fang-Wu; Wang, Sheng-Qing; Zhao, Bao-Xiang; Miao, Jun-Ying

    2014-05-21

    A series of 2'-hydroxychalcone derivatives was synthesized and the effects of all the compounds on growth of A549 lung cancer cell were investigated. The results showed that all compounds had inhibitory effects on the growth of A549 lung cancer cells and compound possessed the highest growth inhibitory effect and induced autophagy of A549 lung cancer cells.

  2. Targeting SALL4 by entinostat in lung cancer

    PubMed Central

    Hong, Clarice Kit Yee; Zhao, Wenxiu; Wang, Fei; Tatetsu, Hiro; Yan, Benedict; Qi, Lihua; Fletcher, Jonathan A.; Yang, Henry; Soo, Ross

    2016-01-01

    The overall survival of lung cancer patients remains dismal despite the availability of targeted therapies. Oncofetal protein SALL4 is a novel cancer target. We herein report that SALL4 was aberrantly expressed in a subset of lung cancer patients with poor survival. SALL4 silencing by RNA interference or SALL4 peptide inhibitor treatment led to impaired lung cancer cell growth. Expression profiling of SALL4-knockdown cells demonstrated that both the EGFR and IGF1R signaling pathways were affected. Connectivity Map analysis revealed the HDAC inhibitor entinostat as a potential drug in treating SALL4-expressing cancers, and this was confirmed in 17 lung cancer cell lines. In summary, we report for the first time that entinostat can target SALL4-positive lung cancer. This lays the foundation for future clinical studies evaluating the therapeutic efficacy of entinostat in SALL4-positive lung cancer patients. PMID:27705911

  3. Safety, immunogenicity and preliminary efficacy of multiple-site vaccination with an Epidermal Growth Factor (EGF) based cancer vaccine in advanced non small cell lung cancer (NSCLC) patients

    PubMed Central

    2011-01-01

    The prognosis of patients with advanced non small cell lung (NSCLC) cancer remains dismal. Epidermal Growth Factor Receptor is over-expressed in many epithelial derived tumors and its role in the development and progression of NSCLC is widely documented. CimaVax-EGF is a therapeutic cancer vaccine composed by human recombinant Epidermal Growth Factor (EGF) conjugated to a carrier protein, P64K from Neisseria Meningitides. The vaccine is intended to induce antibodies against self EGF that would block EGF-EGFR interaction. CimaVax-EGF has been evaluated so far in more than 1000 advanced NSCLC patients, as second line therapy. Two separate studies were compared to assess the impact of high dose vaccination at multiple anatomic sites in terms of immunogenicity, safety and preliminary efficacy in stage IIIb/IV NSCLC patients. In both clinical trials, patients started vaccination 1 month after finishing first line chemotherapy. Vaccination at 4 sites with 2.4 mg of EGF (high dose) was very safe. The most frequent adverse events were grade 1 or 2 injection site reactions, fever, headache and vomiting. Patients had a trend toward higher antibody response. The percent of very good responders significantly augmented and there was a faster decrease of circulating EGF. All vaccinated patients and those classified as good responders immunized with high dose at 4 sites, had a large tendency to improved survival. PMID:22024351

  4. Oncolytic vaccine virus harbouring the IL-24 gene suppresses the growth of lung cancer by inducing apoptosis.

    PubMed

    Lv, Chunwei; Su, Qunshu; Liang, Yupei; Hu, Jinqing; Yuan, Sujing

    2016-07-15

    Lung cancer has an especially high incidence rate worldwide, and its resistance to cell death and chemotherapeutic drugs increases its intractability. The vaccinia virus has been shown to destroy neoplasm within a short time and disseminate rapidly and extensively as an enveloped virion throughout the circulatory system, and this virus has also demonstrated a strong ability to overexpress exogenous genes. Interleukin-24 (IL-24/mda-7) is an important cytokine that belongs to the activating caspase family and facilitates the inhibition of STAT3 when a cell enters the apoptosis pathway. In this study, we constructed a cancer-targeted vaccinia virus carrying the IL-24 gene knocked in the region of the viral thymidine kinase (TK) gene (VV-IL-24). Our results showed that VV-IL-24 efficiently infected and destroyed lung cancer cells via caspase-dependent apoptosis and decreased the expression of STAT3. In vivo, VV-IL-24 expressed IL-24 at a high level in the transplanted tumour, reduced STAT3 activity, and eventually led to apoptosis. In conclusion, we demonstrated that vv-IL-24 has the potential for use as a new human lung cancer treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Growth and Metastases of Human Lung Cancer Are Inhibited in Mouse Xenografts by a Transition State Analogue of 5′-Methylthioadenosine Phosphorylase*

    PubMed Central

    Basu, Indranil; Locker, Joseph; Cassera, Maria B.; Belbin, Thomas J.; Merino, Emilio F.; Dong, Xinyuan; Hemeon, Ivan; Evans, Gary B.; Guha, Chandan; Schramm, Vern L.

    2011-01-01

    The S-adenosylmethionine (AdoMet) salvage enzyme 5′-methylthioadenosine phosphorylase (MTAP) has been implicated as both a cancer target and a tumor suppressor. We tested these hypotheses in mouse xenografts of human lung cancers. AdoMet recycling from 5′-methylthioadenosine (MTA) was blocked by inhibition of MTAP with methylthio-DADMe-Immucillin-A (MTDIA), an orally available, nontoxic, picomolar transition state analogue. Blood, urine, and tumor levels of MTA increased in response to MTDIA treatment. MTDIA treatment inhibited A549 (human non-small cell lung carcinoma) and H358 (human bronchioloalveolar non-small cell lung carcinoma cells) xenograft tumor growth in immunodeficient Rag2−/−γC−/− and NCr-nu mice. Systemic MTA accumulation is implicated as the tumor-suppressive metabolite because MTDIA is effective for in vivo treatment of A549 MTAP−/− and H358 MTAP+/+ tumors. Tumors from treated mice showed increased MTA and decreased polyamines but little alteration in AdoMet, methionine, or adenine levels. Gene expression profiles of A549 tumors from treated and untreated mice revealed only modest alterations with 62 up-regulated and 63 down-regulated mRNAs (≥3-fold). MTDIA antitumor activity in xenografts supports MTAP as a target for lung cancer therapy. PMID:21135097

  6. LUNG CANCER IN NEVER SMOKERS: MOLECULAR PROFILES AND THERAPEUTIC IMPLICATIONS

    PubMed Central

    Rudin, Charles M.; Avila-Tang, Erika; Harris, Curtis C.; Herman, James G.; Hirsch, Fred R.; Pao, William; Schwartz, Ann G.; Vahakangas, Kirsi H.; Samet, Jonathan M.

    2010-01-01

    The majority of lung cancers are caused by long term exposure to the several classes of carcinogens present in tobacco smoke. While a significant fraction of lung cancers in never smokers may also be attributable to tobacco, many such cancers arise in the absence of detectable tobacco exposure, and may follow a very different cellular and molecular pathway of malignant transformation. Recent studies summarized here suggest that lung cancers arising in never smokers have a distinct natural history, profile of oncogenic mutations, and response to targeted therapy. The majority of molecular analyses of lung cancer have focused on genetic profiling of pathways responsible for metabolism of primary tobacco carcinogens. Limited research has been conducted evaluating familial aggregation and genetic linkage of lung cancer, particularly among never smokers in whom such associations might be expected to be strongest. Data emerging over the past several years demonstrates that lung cancers in never smokers are much more likely to carry activating mutations of the Epidermal Growth Factor Receptor (EGFR), a key oncogenic factor and direct therapeutic target of several newer anti-cancer drugs. EGFR mutant lung cancers may represent a distinct class of lung cancers, enriched in the never smoking population, and less clearly linked to direct tobacco carcinogenesis. These insights followed initial testing and demonstration of efficacy of EGFR-targeted drugs. Focused analysis of molecular carcinogenesis in lung cancers in never smokers is needed, and may provide additional biologic insight with therapeutic implications for lung cancers in both ever smokers and never smokers. PMID:19755392

  7. Lung cancer among Chinese women.

    PubMed

    Gao, Y T; Blot, W J; Zheng, W; Ershow, A G; Hsu, C W; Levin, L I; Zhang, R; Fraumeni, J F

    1987-11-15

    A case-control study involving interviews with 672 female lung cancer patients and 735 population-based controls was conducted to investigate the high rates of lung cancer, notably adenocarcinoma, among women in Shanghai. Cigarette smoking was a strong risk factor, but accounted for only about one-fourth of all newly diagnosed cases of lung cancer. Most patients, particularly with adenocarcinoma, were life-long non-smokers. The risks of lung cancer were higher among women reporting tuberculosis and other pre-existing lung diseases. Hormonal factors were suggested by an increased risk associated with late menopause and by a gradient in the risk of adenocarcinoma with decreasing menstrual cycle length, with a 3-fold excess among women who had shorter cycles. Perhaps most intriguing were associations found between lung cancer and measures of exposure to cooking oil vapors. Risks increased with the numbers of meals cooked by either stir frying, deep frying or boiling; with the frequency of smokiness during cooking; and with the frequency of eye irritation during cooking. Use of rapeseed oil, whose volatiles following high-temperature cooking may be mutagenic, was also reported more often by the cancer patients. The findings thus confirm that factors other than smoking are responsible for the high risk of lung cancer among Chinese women and provide clues for further research, including the assessment of cooking practices.

  8. Congestive Heart Failure During Osimertinib Treatment for Epidermal Growth Factor Receptor (EGFR)-mutant Non-small Cell Lung Cancer (NSCLC).

    PubMed

    Watanabe, Hiromi; Ichihara, Eiki; Kano, Hirohisa; Ninomiya, Kiichiro; Tanimoto, Mitsune; Kiura, Katsuyuki

    2017-08-15

    We herein report a case of congestive heart failure which developed during osimertinib treatment. A 78-year-old woman presented with mild exertional dyspnea three weeks after starting osimertinib for the treatment of epidermal growth factor receptor (EGFR) T790M-positive non-small cell lung cancer. She was diagnosed with congestive heart failure caused by the osimertinib. In contrast to trastuzumab, a human epidermal growth factor receptor 2 (HER2) monoclonal antibody that often causes cardiac dysfunction, the causal relationship between osimertinib and cardiotoxicity has so far received little attention and thus remains unclear. However, it inhibits HER2 in addition to mutant EGFR, thereby potentially causing cardiotoxicity.

  9. Tumor growth inhibition with cetuximab and chemotherapy in non-small cell lung cancer xenografts expressing wild-type and mutated epidermal growth factor receptor.

    PubMed

    Steiner, Philipp; Joynes, Christopher; Bassi, Rajiv; Wang, Su; Tonra, James R; Hadari, Yaron R; Hicklin, Daniel J

    2007-03-01

    Targeting the epidermal growth factor receptor (EGFR) is a validated approach to treat cancer. In non-small cell lung cancer (NSCLC), EGFR contains somatic mutations in 10% of patients, which correlates with increased response rates to small molecule inhibitors of EGFR. We analyzed the effects of the monoclonal IgG1 antibody Erbitux (cetuximab) in NSCLC xenografts with wild-type (wt) or mutated EGFR. NSCLC cell lines were grown s.c. in nude mice. Dose-dependent efficacy was established for cetuximab. To determine whether combination therapy produces tumor regressions, cetuximab was dosed at half-maximal efficacy with chemotherapy used at maximum tolerated dose. Cetuximab showed antitumor activity in wt (A549, NCI-H358, NCI-H292) and mutated [HCC-827 (delE746-A750), NCI-H1975 (L858R, T790M)] EGFR-expressing xenografts. In the H292 model, cetuximab and docetaxel combination therapy was more potent to inhibit tumor growth than cetuximab or docetaxel alone. Cisplatin augmented efficacy of cetuximab to produce 6 of 10 regressions, whereas 1 of 10 regressions was found with cetuximab and no regression was found with cisplatin. Using H1975 xenografts, gemcitabine increased efficacy of cetuximab resulting in 12 of 12 regressions. Docetaxel with cetuximab was more efficacious with seven of nine regressions compared with single treatments. Cetuximab inhibited autophosphorylation of EGFR in both H292 and H1975 tumor lysates. Exploring the underlying mechanism for combination effects in the H1975 xenograft model, docetaxel in combination with cetuximab added to the antiproliferative effects of cetuximab but was the main component in this drug combination to induce apoptosis. Cetuximab showed antitumor activity in NSCLC models expressing wt and mutated EGFR. Combination treatments increased the efficacy of cetuximab, which may be important for the management of patients with chemorefractory NSCLC.

  10. Occupational exposure and lung cancer

    PubMed Central

    Spyratos, Dionysios; Porpodis, Konstantinos; Tsakiridis, Kosmas; Machairiotis, Nikolaos; Katsikogiannis, Nikolaos; Kougioumtzi, Ioanna; Dryllis, Georgios; Kallianos, Anastasios; Rapti, Aggeliki; Li, Chen; Zarogoulidis, Konstantinos

    2013-01-01

    Lung cancer is the leading cause of cancer death for male and the second most usual cancer for women after breast cancer. Currently there are available several non-specific cytotoxic agents and several targeted agents for lung cancer therapy. However; early stage diagnosis is still unavailable and several efforts are being made towards this direction. Novel biomarkers are being investigated along with new biopsy techniques. The occupational and environmental exposure to carcinogenic agents is an everyday phenomenon. Therefore until efficient early diagnosis is available, avoidance of exposure to carcinogenic agents is necessary. In the current mini-review occupational and environmental carcinogenic agents will be presented. PMID:24102018

  11. Complete remission through icotinib treatment in Non-small cell lung cancer epidermal growth factor receptor mutation patient with brain metastasis: A case report

    PubMed Central

    Wang, Tao; Wang, Ruimin; Dong, Zhouhuan; Liang, Naichao

    2016-01-01

    Abstract Brain metastasis (BM) has been universally recognized as a poor prognostic factor in non-small cell lung cancer (NSCLC). Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have shown efficacy in treating BM with an EGFR mutation. This paper reports a case of BM patient with EGFR-mutated NSCLC. According to the findings, a complete remission (CR) of the BM was achieved by icotinib treatment without conducting a radiotherapy, which was followed by a resection of the primary lung cancer lesion and lymph nodes. After one-year follow-up, the disease progressed to liver metastasis and liver lesion biopsy showed a T790M mutation. The patient responded well to the combination treatment of AZD9291 and icotinib after the failure of transcatheter arterial chemoembolization (TACE). This case report suggests that icotinib has a sustainable anticancer response to BM and the combination with icotinib and AZD9291 is effective for liver metastasis with T790M.

  12. [Lung cancer and epigenetic modifications].

    PubMed

    Darılmaz Yüce, Gülbahar; Ortaç Ersoy, Ebru

    2016-06-01

    Epigenetic alterations, including DNA methylation, histone modifications, and noncoding RNA expression, have been reported to play a major role in the genesis of lung cancer. DNA methylation, histone modifications, and RNA expression are epigenetic markers in assesment of early detection, prognosis and evaluation of treatment of lung cancer. In this rewiev we summarize the common epigenetic changes associated with lung cancer to give some clarity to its etiology, and to provide an overview of the potential translational applications of these changes, including applications for early detection, diagnosis, prognostication, and therapeutics.

  13. Impact of Pretreatment Tumor Growth Rate on Outcome of Early-Stage Lung Cancer Treated With Stereotactic Body Radiation Therapy

    SciTech Connect

    Atallah, Soha; Cho, B.C. John; Allibhai, Zishan; Taremi, Mojgan; Giuliani, Meredith; Le, Lisa W.; Brade, Anthony; Sun, Alexander; Bezjak, Andrea; Hope, Andrew J.

    2014-07-01

    Purpose: To determine the influence of pretreatment tumor growth rate on outcomes in patients with early-stage non-small cell lung cancer (NSCLC) treated with stereotactic body radiation therapy (SBRT). Methods and Materials: A review was conducted on 160 patients with T1-T2N0M0 NSCLC treated with SBRT at single institution. The patient's demographic and clinical data, time interval (t) between diagnostic and planning computed tomography (CT), vital status, disease status, and cause of death were extracted from a prospectively kept database. Differences in gross tumor volume between diagnostic CT (GTV1) and planning CT (GTV2) were recorded, and growth rate was calculated by use of specific growth rate (SGR). Kaplan-Meier curves were constructed for overall survival (OS). Differences between groups were compared with a log-rank test. Multivariate analyses were performed by use of the Cox proportional hazard model with SGR and other relevant clinical factors. Cumulative incidence was calculated for local, regional, and distant failures by use of the competing risk approach and was compared with Gray's test. Results: The median time interval between diagnostic and planning CT was 82 days. The patients were divided into 2 groups, and the median SGR was used as a cut-off. The median survival times were 38.6 and 27.7 months for the low and high SGR groups, respectively (P=.03). Eastern Cooperative Oncology Group performance status (P=.01), sex (P=.04), SGR (P=.03), and GTV2 (P=.002) were predictive for OS in multivariable Cox regression analysis and, except sex, were similarly predictive for failure-free survival (FFS). The 3-year cumulative incidences of regional failure were 19.2% and 6.0% for the high and low SGR groups, respectively (P=.047). Conclusion: High SGR was correlated with both poorer OS and FFS in patients with early-stage NSCLC treated with SBRT. If validated, this measurement may be useful in identifying patients most likely to benefit from adjuvant

  14. Targeting COX-2 and EP4 to control tumor growth, angiogenesis, lymphangiogenesis and metastasis to the lungs and lymph nodes in a breast cancer model.

    PubMed

    Xin, Xiping; Majumder, Mousumi; Girish, Gannareddy V; Mohindra, Vik; Maruyama, Takayuki; Lala, Peeyush K

    2012-08-01

    We reported that cyclo-oxygenase (COX)-2 expression in human breast cancer stimulated cancer cell migration and invasiveness, production of vascular endothelial growth factor (VEGF)-C and lymphangiogenesis in situ, largely from endogenous PGE2-mediated stimulation of prostaglandin E (EP)1 and EP4 receptors, presenting them as candidate therapeutic targets against lymphatic metastasis. As human breast cancer xenografts in immuno-compromised mice have limitations for preclinical testing, we developed a syngeneic murine breast cancer model of spontaneous lymphatic metastasis mimicking human and applied it for mechanistic and therapeutic studies. We tested the roles of COX-2 and EP receptors in VEGF-C and -D production by a highly metastatic COX-2 expressing murine breast cancer cell line C3L5. These cells expressed all EP receptors and produced VEGF-C and -D, both inhibited with COX-2 inhibitors or EP4 (but not EP1, EP2 or EP3) antagonists. C3H/HeJ mice, when implanted SC in both inguinal regions with C3L5 cells suspended in growth factor-reduced Matrigel, exhibited rapid tumor growth, tumor-associated angiogenesis and lymphangiogenesis (respectively measured with CD31 and LYVE-1 immunostaining), metastasis to the inguinal and axillary lymph nodes and the lungs. Chronic oral administration of COX-1/COX-2 inhibitor indomethacin, COX-2 inhibitor celecoxib and an EP4 antagonist ONO-AE3-208, but not an EP1 antagonist ONO-8713 at nontoxic doses markedly reduced tumor growth, lymphangiogenesis, angiogenesis, and metastasis to lymph nodes and lungs. Residual tumors in responding mice revealed reduced VEGF-C and -D proteins, AkT phosphorylation and increased apoptotic/proliferative cell ratios consistent with blockade of EP4 signaling. We suggest that EP4 antagonists deserve clinical testing for chemo-intervention of lymphatic metastasis in human breast cancer.

  15. Is it feasible to detect epidermal growth factor receptor mutations in circulating tumor cells in nonsmall cell lung cancer?

    PubMed Central

    Liu, Yafang; Xing, Ze; Zhan, Ping; Liu, Hongbing; Ye, Wei; Lv, Tangfeng; Song, Yong

    2016-01-01

    Abstract Background: The value of circulating tumor cells (CTCs) in detecting epidermal growth factor receptor (EGFR) mutations in patients with nonsmall cell lung cancer (NSCLC) is controversial. We performed a meta-analysis to investigate the diagnostic significance of CTCs with tumor tissues as the standard control. Methods: A systematic literature search, including papers published until November 26, 2015, was performed using PubMed, Medline, Embase, Web of Science, and the China National Knowledge Infrastructure, and the references of retrieved articles were screened. The pooled sensitivity, specificity, and diagnostic odds ratio (DOR) were calculated according to the data selection from the included studies. The evaluation indexes of the diagnostic performance were the summary receiver operating characteristic curve (SROC) and area under the SROC (AUSROC). Results: Eight eligible articles with a total of 170 participants were identified in our meta-analysis. The pooled sensitivity and specificity were 0.91 [95% CI: 0.55–0.99] and 0.99 [95% CI: 0.59–1.00]. The positive likelihood ratio and negative likelihood ratio were 68 [95% CI: 1.4–3364] and 0.09 [95% CI: 0.01–0.64], respectively. The DOR was 788 [95% CI: 9–71884]. The high diagnostic performance of CTCs in detecting EGFR mutations was indicated by the AUSROC of 0.99 [95% CI: 0.98–1.00]. Conclusions: CTCs are a feasible and highly specific biomarker for detecting the EGFR mutation status in NSCLC patients. PMID:27893656

  16. Structural, biochemical and clinical characterization of epidermal growth factor receptor (EGFR) exon 20 insertion mutations in lung cancer

    PubMed Central

    Yasuda, Hiroyuki; Park, Eunyoung; Yun, Cai-Hong; Sng, Natasha J.; Lucena-Araujo, Antonio R.; Yeo, Wee-Lee; Huberman, Mark S.; Cohen, David W.; Nakayama, Sohei; Ishioka, Kota; Yamaguchi, Norihiro; Hanna, Megan; Oxnard, Geoffrey R.; Lathan, Christopher S.; Moran, Teresa; Sequist, Lecia V.; Chaft, Jamie E.; Riely, Gregory J.; Arcila, Maria E.; Soo, Ross A.; Meyerson, Matthew; Eck, Michael J.; Kobayashi, Susumu S.; Costa, Daniel B.

    2014-01-01

    Epidermal growth factor receptor (EGFR) gene mutations (G719X, exon 19 deletions/insertions, L858R and L861Q) predict favorable responses to EGFR tyrosine kinase inhibitors (TKIs) in advanced non-small-cell lung cancer (NSCLC). However, EGFR exon 20 insertion mutations (∼10% of all EGFR mutations) are generally associated with insensitivity to available TKIs (gefitinib, erlotinib and afatinib). The basis of this primary resistance is poorly understood.  We study a broad subset of exon 20 insertion mutations, comparing in vitro TKI sensitivity with responses to gefitinib and erlotinib in NSCLC patients; and find that most are resistant to EGFR TKIs. The crystal structure of a representative TKI-insensitive mutant (D770_N771insNPG) reveals an unaltered ATP-binding pocket and the inserted residues form a wedge at the end of the C-helix that promotes the active kinase conformation. Unlike EGFR-L858R, D770_N771insNPG activates EGFR without increasing its affinity for EGFR TKIs. Unexpectedly, we find that EGFR-A763_Y764insFQEA is highly sensitive to EGFR TKIs in vitro; and patients whose NSCLCs harbor this mutation respond to erlotinib. Analysis of the A763_Y764insFQEA mutant indicates that the inserted residues shift the register of the C-helix in the N-terminal direction, altering the structure in the region that is also affected by the TKI-sensitive EGFR-L858R. Our studies reveal intricate differences between EGFR mutations, their biology and their response to EGFR TKIs. PMID:24353160

  17. Structural, biochemical, and clinical characterization of epidermal growth factor receptor (EGFR) exon 20 insertion mutations in lung cancer.

    PubMed

    Yasuda, Hiroyuki; Park, Eunyoung; Yun, Cai-Hong; Sng, Natasha J; Lucena-Araujo, Antonio R; Yeo, Wee-Lee; Huberman, Mark S; Cohen, David W; Nakayama, Sohei; Ishioka, Kota; Yamaguchi, Norihiro; Hanna, Megan; Oxnard, Geoffrey R; Lathan, Christopher S; Moran, Teresa; Sequist, Lecia V; Chaft, Jamie E; Riely, Gregory J; Arcila, Maria E; Soo, Ross A; Meyerson, Matthew; Eck, Michael J; Kobayashi, Susumu S; Costa, Daniel B

    2013-12-18

    Epidermal growth factor receptor (EGFR) gene mutations (G719X, exon 19 deletions/insertions, L858R, and L861Q) predict favorable responses to EGFR tyrosine kinase inhibitors (TKIs) in advanced non-small cell lung cancer (NSCLC). However, EGFR exon 20 insertion mutations (~10% of all EGFR mutations) are generally associated with insensitivity to available TKIs (gefitinib, erlotinib, and afatinib). The basis of this primary resistance is poorly understood. We studied a broad subset of exon 20 insertion mutations, comparing in vitro TKI sensitivity with responses to gefitinib and erlotinib in NSCLC patients, and found that most are resistant to EGFR TKIs. The crystal structure of a representative TKI-insensitive mutant (D770_N771insNPG) reveals an unaltered adenosine triphosphate-binding pocket, and the inserted residues form a wedge at the end of the C helix that promotes the active kinase conformation. Unlike EGFR-L858R, D770_N771insNPG activates EGFR without increasing its affinity for EGFR TKIs. Unexpectedly, we find that EGFR-A763_Y764insFQEA is highly sensitive to EGFR TKIs in vitro, and patients whose NSCLCs harbor this mutation respond to erlotinib. Analysis of the A763_Y764insFQEA mutant indicates that the inserted residues shift the register of the C helix in the N-terminal direction, altering the structure in the region that is also affected by the TKI-sensitive EGFR-L858R. Our studies reveal intricate differences between EGFR mutations, their biology, and their response to EGFR TKIs.

  18. Intercalated chemotherapy and erlotinib for non-small cell lung cancer (NSCLC) with activating epidermal growth factor receptor (EGFR) mutations

    PubMed Central

    Zwitter, Matjaz; Rajer, Mirjana; Stanic, Karmen; Vrankar, Martina; Doma, Andrej; Cuderman, Anka; Grmek, Marko; Kern, Izidor; Kovac, Viljem

    2016-01-01

    ABSTRACT Among attempts to delay development of resistance to tyrosine kinase inhibitors (TKIs) in patients with advanced non-small cell lung cancer (NSCLC) with activating mutations of epidermal growth factor receptor (EGFR), intercalated therapy has not been properly evaluated. In a phase II trial, 38 patients with EGFR mutated NSCLC in advanced stage were treated with 4 to 6 3-weekly cycles of intercalated schedule with gemcitabine (1250 mg/m2, days 1 and 4), cisplatin (75 mg/m2, day 2) and erlotinib (150 mg, days 5 – 15), followed by continuous erlotinib as maintenance. In addition to standard radiologic evaluation according to RECIST, PET/CT was done prior to treatment and at 6 months, using PERCIST as a method for assessment of response. The primary endpoint was progression-free survival (PFS). In general, tolerance to treatment was good, even among 8 patients with performance status 2–3 and 13 patients with brain metastases; grade 4 toxicity included 2 cases of neutropenia and 4 thrombo-embolic events. Complete response (CR) or partial response (PR) were seen in 15 (39.5%) and 17 (44.7%) cases, respectively. All cases of CR were confirmed also by PET/CT. Median PFS was 23.4 months and median overall survival (OS) was 38.3  months. After a median follow-up of 35 months, 8 patients are still in CR and on maintenance erlotinib. In conclusion, intercalated treatment for treatment-naive patients with EGFR activating mutations leads to excellent response rate and prolonged PFS and survival. Comparison of the intercalated schedule to monotherapy with TKIs in a randomized trial is warranted. PMID:27261103

  19. BAD overexpression inhibits cell growth and induces apoptosis via mitochondrial-dependent pathway in non-small cell lung cancer.

    PubMed

    Jiang, Li; Luo, Man; Liu, Dan; Chen, Bojiang; Zhang, Wen; Mai, Lin; Zeng, Jing; Huang, Na; Huang, Yi; Mo, Xianming; Li, Weimin

    2013-06-01

    The pro-apoptotic Bcl-2 protein BAD initiated apoptosis in human cells and has been identified as a prognostic marker in non-small cell lung cancer (NSCLC). In this study, we aimed to explore the functions of BAD in NSCLC. Overexpression of BAD was performed by transfecting different NSCLC cell lines with wild-type BAD. Cell proliferation, cell cycle, apoptosis, and invasion were characterized in vitro. Tumorigenicity was analyzed in vivo. Western blot was performed to determine the effects of BAD overexpression on the Bcl-2 family proteins and apoptosis-related proteins. Overexpression of BAD significantly inhibited cell proliferation in H1299, H292, and SPC-A1 but not in SK-MES-1 and H460 cell lines in vitro. BAD overexpression also reduced the tumorigenicity of H1299/SPC-A1 cell in vivo. However, no appreciable effects on cell cycle distribution and invasion were observed in all these cell lines. BAD overexpression also induced apoptosis in all cell types, in which process expression of mitochondrial cytochrom c (cyto-c) and caspase 3 were increased, whereas Bcl-xl, Bcl-2, Bax and caspase 8 expressions did not changed. These findings indicated that a mitochondrial pathway, in which process cyto-c was released from mitochondrial to activate caspase 3, was involved in BAD overexpression-mediated apoptosis. Our data suggested that increased expression of BAD enhance apoptosis and has negative influence on cell proliferation and tumor growth in NSCLC. Bad is a new potential target for tumor interventions.

  20. DLC-1 Suppresses Non-Small Cell Lung Cancer Growth and Invasion By RhoGAP-Dependent and Independent Mechanisms

    PubMed Central

    Healy, Kevin D.; Hodgson, Louis; Kim, Tai-Young; Shutes, Adam; Maddileti, Savitri; Juliano, Rudolph L.; Hahn, Klaus M.; Harden, T. Kendall; Bang, Yung-Jue; Der, Channing J.

    2009-01-01

    Expression of the tumor suppressor deleted in liver cancer-1 (DLC-1) is lost in non-small cell lung (NSCLC) and other human carcinomas, and ectopic DLC-1 expression dramatically reduces proliferation and tumorigenicity. DLC-1 is a multidomain protein that includes a Rho GTPase Activating Protein (RhoGAP) domain which has been hypothesized to be the basis of its tumor suppressive actions. To address the importance of the RhoGAP function of DLC-1 in tumor suppression, we performed biochemical and biological studies evaluating DLC-1 in NSCLC. Full length DLC-1 exhibited strong GAP activity for RhoA as well as RhoB and RhoC, but only very limited activity for Cdc42 in vitro. In contrast, the isolated RhoGAP domain showed 5- to 20-fold enhanced activity for RhoA, RhoB, RhoC and Cdc42. DLC-1 protein expression was absent in six of nine NSCLC cell lines. Restoration of DLC-1 expression in DLC-1-deficient NSCLC cell lines reduced RhoA activity, and experiments with a RhoA biosensor demonstrated that DLC-1 dramatically reduces RhoA activity at the leading edge of cellular protrusions. Furthermore, DLC-1 expression in NSCLC cell lines impaired both anchorage-dependent and -independent growth, as well as invasion in vitro. Surprisingly, we found that the anti-tumor activity of DLC-1 was due to both RhoGAP-dependent and -independent activities. Unlike the rat homologue p122RhoGAP, DLC-1 was not capable of activating the phospholipid hydrolysis activity of phospholipase C-δ1. Combined, these studies provide information on the mechanism of DLC-1 function and regulation, and further support the role of DLC-1 tumor suppression in NSCLC. PMID:17932950

  1. Evaluation of the Role of Invadopodia in Lung Cancer Cell Growth and Invasion

    DTIC Science & Technology

    2014-11-01

    attach to the assay cover slips. Two of the cell lines (H1792 and H1650) were judged to be the best at forming invadopodia. Infect NCI- H460 with...that the H460 cells would in fact not be a good choice for the assays, and we therefore did not perform these experiments. Months 4-6 Test control...and Tks5 knockdown NCI- H460 cells in in vitro assays of invasion and 3D growth. See above for why we chose not to work with this cell line

  2. Can we define the optimal sequence of epidermal growth factor receptor tyrosine kinase inhibitors for the treatment of epidermal growth factor receptor-mutant nonsmall cell lung cancer?

    PubMed

    Sun, Jong-Mu; Park, Keunchil

    2017-03-01

    The most common mechanism of resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) is acquisition of the T790M gatekeeper mutation. Third-generation EGFR TKIs irreversibly inhibit EGFR mutants (EGFRm), especially T790M, while sparing wild-type EGFR. There are several third-generation EGFR TKIs under development, including osimertinib, CO-1686 (rociletinib), HM61713 (olmutinib), ASP8273, and EGF816. These third-generation EGFR TKIs have shown promising efficacy with favorable toxicity profiles in the management of advanced nonsmall cell lung cancer (NSCLC) with an acquired T790M mutation (EGFR). In the present review, we will discuss the evolving treatment landscape of EGFRm NSCLC. The LUX-Lung 7 study demonstrated superior progression-free survival, time-to-treatment failure, and objective response rate with afatinib versus gefitinib, but no significant overall survival improvement in TKI-naïve EGFRm NSCLC patients. In EGFRm NSCLC patients harboring T790M after treatment with first-generation or second-generation EGFR TKIs, third-generation EGFR TKIs showed robust efficacy with tolerable toxicity. The updated results of phase I studies have demonstrated encouraging activity of first-line osimertinib in patients with EGFRm NSCLC. Following progression with first-generation or second-generation EGFR TKIs, osimertinib was recently approved for the treatment of EGFR NSCLC. Encouraging early results with osimertinib have sparked interest in first-line treatment of EGFRm NSCLC, and head-to-head comparison studies of third-generation versus first-generation EGFR TKIs are being developed.

  3. Vascular endothelial growth factor directly stimulates tumour cell proliferation in non-small cell lung cancer.

    PubMed

    Devery, Aoife M; Wadekar, Rekha; Bokobza, Sivan M; Weber, Anika M; Jiang, Yanyan; Ryan, Anderson J

    2015-09-01

    Vascular endothelial growth factor (VEGF) is a key stimulator of physiological and pathological angiogenesis. VEGF signals primarily through VEGF receptor 2 (VEGFR2), a receptor tyrosine kinase whose expression is found predominantly on endothelial cells. The purpose of this study was to determine the role of VEGFR2 expression in NSCLC cells. NSCLC cells and tissue sections were stained for VEGFR2 expression by immunohistochemistry (IHC). Immunoblotting and ELISA were used to determine the activation and inhibition of VEGFR2 and its downstream signalling pathways. Five-day proliferation assays were carried out in the presence or absence of VEGF. IHC analysis of NSCLC demonstrated tumour cell VEGFR2 expression in 20% of samples. Immunoblot analysis showed expression of VEGFR2 protein in 3/8 NSCLC cell lines that correlated with VEGFR2 mRNA expression levels. VEGF-dependent VEGFR2 activation was apparent in NSCLC cells, and was associated with increased tumor cell proliferation. Cediranib treatment or siRNA against VEGFR2 inhibited VEGF-dependent increases in cell proliferation. Inhibition of VEGFR2 tyrosine kinase activity using cediranib was more effective than inhibition of AKT (MK2206) or MEK (AZD6244) for overcoming VEGFR2-driven cell proliferation. VEGF treatment did not affect cell survival following treatment with radiation, cisplatin, docetaxel or gemcitabine. Our data suggest that a subset of NSCLC tumour cells express functional VEGFR2 which can act to promote VEGF-dependent tumour cell growth. In this tumour subset, therapies targeting VEGFR2 signalling, such as cediranib, have the potential to inhibit both tumour cell proliferation and angiogenesis.

  4. Small RNA combination therapy for lung cancer.

    PubMed

    Xue, Wen; Dahlman, James E; Tammela, Tuomas; Khan, Omar F; Sood, Sabina; Dave, Apeksha; Cai, Wenxin; Chirino, Leilani M; Yang, Gillian R; Bronson, Roderick; Crowley, Denise G; Sahay, Gaurav; Schroeder, Avi; Langer, Robert; Anderson, Daniel G; Jacks, Tyler

    2014-08-26

    MicroRNAs (miRNAs) and siRNAs have enormous potential as cancer therapeutics, but their effective delivery to most solid tumors has been difficult. Here, we show that a new lung-targeting nanoparticle is capable of delivering miRNA mimics and siRNAs to lung adenocarcinoma cells in vitro and to tumors in a genetically engineered mouse model of lung cancer based on activation of oncogenic Kirsten rat sarcoma viral oncogene homolog (Kras) and loss of p53 function. Therapeutic delivery of miR-34a, a p53-regulated tumor suppressor miRNA, restored miR-34a levels in lung tumors, specifically down-regulated miR-34a target genes, and slowed tumor growth. The delivery of siRNAs targeting Kras reduced Kras gene expression and MAPK signaling, increased apoptosis, and inhibited tumor growth. The combination of miR-34a and siRNA targeting Kras improved therapeutic responses over those observed with either small RNA alone, leading to tumor regression. Furthermore, nanoparticle-mediated small RNA delivery plus conventional, cisplatin-based chemotherapy prolonged survival in this model compared with chemotherapy alone. These findings demonstrate that RNA combination therapy is possible in an autochthonous model of lung cancer and provide preclinical support for the use of small RNA therapies in patients who have cancer.

  5. Cisplatin and photodynamic therapy exert synergistic inhibitory effects on small-cell lung cancer cell viability and xenograft tumor growth.

    PubMed

    Chen, You-Shuang; Peng, Yin-Bo; Yao, Min; Teng, Ji-Ping; Ni, Da; Zhu, Zhi-Jun; Zhuang, Bu-Feng; Yang, Zhi-Yin

    2017-06-03

    Lung cancer is the leading cause of cancer death worldwide. Small-cell lung cancer (SCLC) is an aggressive type of lung cancer that shows an overall 5-year survival rate below 10%. Although chemotherapy using cisplatin has been proven effective in SCLC treatment, conventional dose of cisplatin causes adverse side effects. Photodynamic therapy, a form of non-ionizing radiation therapy, is increasingly used alone or in combination with other therapeutics in cancer treatment. Herein, we aimed to address whether low dose cisplatin combination with PDT can effectively induce SCLC cell death by using in vitro cultured human SCLC NCI-H446 cells and in vivo tumor xenograft model. We found that both cisplatin and PDT showed dose-dependent cytotoxic effects in NCI-H446 cells. Importantly, co-treatment with low dose cisplatin (1 μM) and PDT (1.25 J/cm(2)) synergistically inhibited cell viability and cell migration. We further showed that the combined therapy induced a higher level of intracellular ROS in cultured NCI-H446 cells. Moreover, the synergistic effect by cisplatin and PDT was recapitulated in tumor xenograft as revealed by a more robust increase in the staining of TUNEL (a marker of cell death) and decrease in tumor volume. Taken together, our findings suggest that low dose cisplatin combination with PDT can be an effective therapeutic modality in the treatment of SCLC patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Metastatic cancer to the lung

    MedlinePlus

    ... lungs may include: Fluid between the lung and chest wall (pleural effusion), which can cause shortness of breath or pain when taking a deep breath Further spread of the cancer Side effects of chemotherapy or radiation therapy When to Contact a Medical Professional Call ...

  7. First-Line Afatinib versus Chemotherapy in Patients with Non-Small Cell Lung Cancer and Common Epidermal Growth Factor Receptor Gene Mutations and Brain Metastases.

    PubMed

    Schuler, Martin; Wu, Yi-Long; Hirsh, Vera; O'Byrne, Kenneth; Yamamoto, Nobuyuki; Mok, Tony; Popat, Sanjay; Sequist, Lecia V; Massey, Dan; Zazulina, Victoria; Yang, James C-H

    2016-03-01

    Metastatic spread to the brain is common in patients with non-small cell lung cancer (NSCLC), but these patients are generally excluded from prospective clinical trials. The studies, phase III study of afatinib or cisplatin plus pemetrexed in patients with metastatic lung adenocarcinoma with EGFR mutations (LUX-Lung 3) and a randomized, open-label, phase III study of BIBW 2992 versus chemotherapy as first-line treatment for patients with stage IIIB or IV adenocarcinoma of the lung harbouring an EGFR activating mutation (LUX-Lung 6) investigated first-line afatinib versus platinum-based chemotherapy in epidermal growth factor receptor gene (EGFR) mutation-positive patients with NSCLC and included patients with brain metastases; prespecified subgroup analyses are assessed in this article. For both LUX-Lung 3 and LUX-Lung 6, prespecified subgroup analyses of progression-free survival (PFS), overall survival, and objective response rate were undertaken in patients with asymptomatic brain metastases at baseline (n = 35 and n = 46, respectively). Post hoc analyses of clinical outcomes was undertaken in the combined data set (n = 81). In both studies, there was a trend toward improved PFS with afatinib versus chemotherapy in patients with brain metastases (LUX-Lung 3: 11.1 versus 5.4 months, hazard ratio [HR] = 0.54, p = 0.1378; LUX-Lung 6: 8.2 versus 4.7 months, HR = 0.47, p = 0.1060). The magnitude of PFS improvement with afatinib was similar to that observed in patients without brain metastases. In combined analysis, PFS was significantly improved with afatinib versus with chemotherapy in patients with brain metastases (8.2 versus 5.4 months; HR, 0.50; p = 0.0297). Afatinib significantly improved the objective response rate versus chemotherapy in patients with brain metastases. Safety findings were consistent with previous reports. These findings lend support to the clinical activity of afatinib in EGFR mutation-positive patients with NSCLC and asymptomatic

  8. Lung cancer and tobacco smoking.

    PubMed

    Boyle, P; Maisonneuve, P

    1995-06-01

    The dominant role of tobacco smoking in the causation of lung cancer has been repeatedly demonstrated over the past 50 years. Current lung cancer rates reflect cigarette smoking habits of men and women in the past decades, but not necessarily current smoking patterns, since there is an interval of several decades between the change in smoking habits in a population and its consequences on lung cancer rates. Over 90% of lung cancer may be avoidable simply through avoidance of cigarette smoking. There is at present a huge premature loss of life world-wide caused by smoking. Rates of lung cancer present in central and eastern Europe at the present time are higher than those ever before recorded elsewhere; lung cancer has increased 10-fold in men and eightfold in women in Japan since 1950. There is a world-wide epidemic of smoking among young women which will be translated into increasing rates of tobacco-related disease, including cancer, in the coming decades. There is another epidemic of lung cancer and tobacco-related deaths building up in China as the cohorts of men in whom tobacco smoking became popular reach ages where cancer is an important hazard. Many solutions have been attempted to reduce cigarette smoking and increasingly many countries are enacting legislation to curb this habit. Cigarette smoking remains the number one target for Public Health action aimed at reducing cancer risk in the general population. General practitioners, hospital physicians and everyone working in oncology have a particularly important exemplary role to play in this process.

  9. Early detection of COPD is important for lung cancer surveillance.

    PubMed

    Sekine, Yasuo; Katsura, Hideki; Koh, Eitetsu; Hiroshima, Kenzo; Fujisawa, Takehiko

    2012-05-01

    It is well known that chronic obstructive pulmonary disease (COPD) is a significant risk factor for lung cancer. Approximately 1% of COPD patients develop lung cancer every year, which may be associated with genetic susceptibility to cigarette smoke. Chronic inflammation caused by toxic gases can induce COPD and lung cancer. Inflammatory mediators may promote the growth of bronchioalveolar stem cells, and activation of nuclear factor-κB and signal transducer and activator of transcription 3 play crucial roles in the development of lung cancer from COPD. Low-dose computed tomography (LDCT) is an effective procedure for the early detection of lung cancer in high-risk patients. However, determining which patients should be screened for lung cancer in a primary care setting is difficult. In this article, we review the epidemiology and aetiology of lung cancer associated with COPD, verify the efficacy of lung cancer screening by LDCT, and discuss the importance of early detection of COPD for lung cancer surveillance. We propose that, for the prevention of both diseases, COPD screening in smokers should be initiated as early as possible, so they can stop smoking and so that candidates for an efficient lung cancer screening programme can be identified.

  10. Chlorella sorokiniana induces mitochondrial-mediated apoptosis in human non-small cell lung cancer cells and inhibits xenograft tumor growth in vivo.

    PubMed

    Lin, Ping-Yi; Tsai, Ching-Tsan; Chuang, Wan-Ling; Chao, Ya-Hsuan; Pan, I-Horng; Chen, Yu-Kuo; Lin, Chi-Chen; Wang, Bing-Yen

    2017-02-01

    Lung cancer is one of the leading causes of cancer related deaths worldwide. Marine microalgae are a source of biologically active compounds and are widely consumed as a nutritional supplement in East Asian countries. It has been reported that Chlorella or Chlorella extracts have various beneficial pharmacological compounds that modulate immune responses; however, no studies have investigated the anti-cancer effects of Chlorella sorokiniana (CS) on non-small cell lung cancer (NSCLC). In this study, we evaluated the anti-cancer effects of CS in two human NSCLC cell lines (A549 and CL1-5 human lung adenocarcinoma cells), and its effects on tumor growth in a subcutaneous xenograft tumor model. We also investigated the possible molecular mechanisms governing the pharmacological function of CS. Our results showed that exposure of the two cell lines to CS resulted in a concentration-dependent reduction in cell viability. In addition, the percentage of apoptotic cells increased in a dose-dependent manner, suggesting that CS might induce apoptosis in human NSCLC cells. Western blot analysis revealed that exposure to CS resulted in increased protein expression of the cleaved/activated forms of caspase-3, caspase-9, and PARP, except caspase-8. ZDEVD (caspase-3 inhibitor) and Z-LEHD (caspase-9 inhibitor) were sufficient at preventing apoptosis in both A549 and CL1-5 cells, proving that CS induced cell death via the mitochondria-mediated apoptotic pathway. Exposure of A549 and CL1-5 cells to CS for 24 h resulted in decreased expression of Bcl-2 protein and increased expression of Bax protein as well as decreased expression of two IAP family proteins, survivin and XIAP. We demonstrated that CS induces mitochondrial-mediated apoptosis in NSCLC cells via downregulation of Bcl-2, XIAP and survivin. In addition, we also found that the tumors growth of subcutaneous xenograft in vivo was markedly inhibited after oral intake of CS.

  11. Lung cancer: the immune system and radiation.

    PubMed

    Mendes, F; Antunes, C; Abrantes, A M; Gonçalves, A C; Nobre-Gois, I; Sarmento, A B; Botelho, M F; Rosa, M S

    2015-01-01

    Lung cancer has a known relationship with smoking and is one of the leading causes of cancer-related death worldwide. Although the number of studies discussing lung cancer is vast, treatment efficacy is still suboptimal due to the wide range of factors that affect patient outcome. This review aims to collect information on lung cancer treatment, specially focused on radiation therapy. It also compiles information regarding the influence of radiotherapy on the immune system and its response to tumour cells. It evaluates how immune cells react after radiation exposure and the influence of their cytokines in the tumour microenvironment. The literature analysis points out that the immune system is a very promising field of investigation regarding prognosis, mostly because the stromal microenvironment in the tumour can provide some information about what can succeed in the future concerning treatment choices and perspectives. T cells (CD4+ and CD8+), interleukin-8, vascular endothelial growth factor and transforming growth factor-β seem to have a key role in the immune response after radiation exposure. The lack of large scale studies means there is no common consensus in the scientific community about the role of the immune system in lung cancer patients treated with radiotherapy. Clarification of the mechanism behind the immune response after radiation can lead to better treatments and better quality life for patients.

  12. Silencing of advanced glycosylation and glycosylation and product-specific receptor (RAGE) inhibits the metastasis and growth of non-small cell lung cancer.

    PubMed

    Yu, Yan Xia; Pan, Wen Chong; Cheng, Yu Feng

    2017-01-01

    Non-small cell lung cancer (NSCLC) constitutes the main cases of lung cancer and is the world's most common and lethal cancer owing to regional invasion or distant metastasis. Growing morbidity and lethality demonstrates that valid molecular target in management of NSCLC metastasis is still absence. The receptor of advanced glycation end-products (RAGE) has been identified as an oncogenic gene and appears to promote the growth and metastasis of various cancers. Here, we investigated if RAGE targeted by RNA interference (RNAi) might have certain effect on the restraint of the growth of NSCLC and tumor metastasis. Wound healing and Transwell invasion assays indicated that RAGE favored the metastatic capabilities of NSCLC H1975 cells. Besides, soft-agar colony assay revealed that silencing RAGE significantly blocked colony-forming capability of H1975 cells in vitro. Furthermore, we observed that RAGE participated in H1975 cells growth, metastasis and epithelial-mesenchymal transition (EMT) by regulating interdict crux intracellular signaling pathways, including phosphatidylinositol-3 kinase/serine-threonine kinase (PI3K/AKT) and V-Ki-ras2 kirsten rat sarcoma viral oncogene homolog/RAF proto-oncogene serine/threonine-protein kinase (KRAS/RAF-1). In xenograft model, significantly reduction intumor growth and Ki67 expression was demonstrated in nude mice inoculation with RAGE down-regulation H1975 cells. To conclude, our study demonstrated that RAGE played a crucial role in the metastasis and growth of NSCLC by regulating PI3K/AKT and KRAS/RAF-1 signaling pathways, thereby might be a promising therapeutic target for NSCLC.

  13. Silencing of advanced glycosylation and glycosylation and product-specific receptor (RAGE) inhibits the metastasis and growth of non-small cell lung cancer

    PubMed Central

    Yu, Yan Xia; Pan, Wen Chong; Cheng, Yu Feng

    2017-01-01

    Non-small cell lung cancer (NSCLC) constitutes the main cases of lung cancer and is the world’s most common and lethal cancer owing to regional invasion or distant metastasis. Growing morbidity and lethality demonstrates that valid molecular target in management of NSCLC metastasis is still absence. The receptor of advanced glycation end-products (RAGE) has been identified as an oncogenic gene and appears to promote the growth and metastasis of various cancers. Here, we investigated if RAGE targeted by RNA interference (RNAi) might have certain effect on the restraint of the growth of NSCLC and tumor metastasis. Wound healing and Transwell invasion assays indicated that RAGE favored the metastatic capabilities of NSCLC H1975 cells. Besides, soft-agar colony assay revealed that silencing RAGE significantly blocked colony-forming capability of H1975 cells in vitro. Furthermore, we observed that RAGE participated in H1975 cells growth, metastasis and epithelial-mesenchymal transition (EMT) by regulating interdict crux intracellular signaling pathways, including phosphatidylinositol-3 kinase/serine-threonine kinase (PI3K/AKT) and V-Ki-ras2 kirsten rat sarcoma viral oncogene homolog/RAF proto-oncogene serine/threonine-protein kinase (KRAS/RAF-1). In xenograft model, significantly reduction intumor growth and Ki67 expression was demonstrated in nude mice inoculation with RAGE down-regulation H1975 cells. To conclude, our study demonstrated that RAGE played a crucial role in the metastasis and growth of NSCLC by regulating PI3K/AKT and KRAS/RAF-1 signaling pathways, thereby might be a promising therapeutic target for NSCLC. PMID:28670367

  14. Tumor-targeted SN38 inhibits growth of early stage non-small cell lung cancer (NSCLC) in a KRas/p53 transgenic mouse model.

    PubMed

    Deneka, Alexander Y; Haber, Leora; Kopp, Meghan C; Gaponova, Anna V; Nikonova, Anna S; Golemis, Erica A

    2017-01-01

    Non-small cell lung cancer (NSCLC) is the leading cause of cancer death worldwide, with a 5-year survival of only ~16%. Potential strategies to address NSCLC mortality include improvements in early detection and prevention, and development of new therapies suitable for use in patients with early and late stage diagnoses. Controlling the growth of early stage tumors could yield significant clinical benefits for patients with comorbidities that make them poor candidates for surgery: however, many drugs that limit cancer growth are not useful in the setting of long-term use or in comorbid patients, because of associated toxicities. In this study, we explored the use of a recently described small molecule agent, STA-8666, as a potential agent for controlling early stage tumor growth. STA-8666 uses a cleavable linker to merge a tumor-targeting moiety that binds heat shock protein 90 (HSP90) with the cytotoxic chemical SN38, and has been shown to have high efficacy and low toxicity, associated with efficient tumor targeting, in preclinical studies using patient-derived and other xenograft models for pancreatic, bladder, and small cell lung cancer. Using a genetically engineered model of NSCLC arising from induced mutation of KRas and knockout of Trp53, we continuously dosed mice with STA-8666 from immediately after tumor induction for 15 weeks. STA-8666 significantly slowed the rate of tumor growth, and was well tolerated over this extended dosing period. STA-8666 induced DNA damage and apoptosis, and reduced proliferation and phosphorylation of the proliferation-associated protein ERK1/2, selectively in tumor tissue. In contrast, STA-8666 did not affect tumor features, such as degree of vimentin staining, associated with epithelial-mesenchymal transition (EMT), or downregulate tumor expression of HSP90. These data suggest STA-8666 and other similar targeted compounds may be useful additions to control the growth of early stage NSCLC in patient populations.

  15. Inhibition of acetyl-CoA carboxylase suppresses fatty acid synthesis and tumor growth of non-small cell lung cancer in preclinical models

    PubMed Central

    Svensson, Robert U.; Parker, Seth J.; Eichner, Lillian J.; Kolar, Matthew J.; Wallace, Martina; Brun, Sonja N.; Lombardo, Portia S.; Van Nostrand, Jeanine L.; Hutchins, Amanda; Vera, Lilliana; Gerken, Laurie; Greenwood, Jeremy; Bhat, Sathesh; Harriman, Geraldine; Westlin, William F.; Harwood, H. James; Saghatelian, Alan; Kapeller, Rosana; Metallo, Christian M.; Shaw, Reuben J.

    2016-01-01

    Continuous de novo fatty acid synthesis is a common feature of cancer required to meet the biosynthetic demands of a growing tumor. This process is controlled by the rate-limiting enzyme acetyl-CoA carboxylase (ACC), an attractive but traditionally intractable drug target. Here, we provide genetic and pharmacological evidence that in preclinical models ACC is required to maintain de novo fatty acid synthesis needed for growth and viability of non-small cell lung cancer (NSCLC). We describe the ability of ND-646—an allosteric inhibitor of the ACC enzymes ACC1 and ACC2 that prevents ACC subunit dimerization—to suppress fatty acid synthesis in vitro and in vivo. Chronic ND-646 treatment of xenograft and genetically engineered mouse models of NSCLC inhibited tumor growth. When administered as a single agent or in combination with the standard-of-care drug carboplatin, ND-646 markedly suppressed lung tumor growth in the Kras;Trp53−/− (also known as KRAS p53) and Kras;Stk11−/− (also known as KRAS Lkb1) mouse models of NSCLC. These findings demonstrate that ACC mediates a metabolic liability of NSCLC and that ACC inhibition by ND-646 is detrimental to NSCLC growth, supporting further examination of the use of ACC inhibitors in oncology. PMID:27643638

  16. Inhibitory Effects of Salinomycin on Cell Survival, Colony Growth, Migration, and Invasion of Human Non-Small Cell Lung Cancer A549 and LNM35: Involvement of NAG-1.

    PubMed

    Arafat, Kholoud; Iratni, Rabah; Takahashi, Takashi; Parekh, Khatija; Al Dhaheri, Yusra; Adrian, Thomas E; Attoub, Samir

    2013-01-01

    A major challenge for oncologists and pharmacologists is to develop more potent and less toxic drugs that will decrease the tumor growth and improve the survival of lung cancer patients. Salinomycin is a polyether antibiotic used to kill gram-positive bacteria including mycobacteria, protozoans such as plasmodium falciparum, and the parasites responsible for the poultry disease coccidiosis. This old agent is now a serious anti-cancer drug candidate that selectively inhibits the growth of cancer stem cells. We investigated the impact of salinomycin on survival, colony growth, migration and invasion of the differentiated human non-small cell lung cancer lines LNM35 and A549. Salinomycin caused concentration- and time-dependent reduction in viability of LNM35 and A549 cells through a caspase 3/7-associated cell death pathway. Similarly, salinomycin (2.5-5 µM for 7 days) significantly decreased the growth of LNM35 and A549 colonies in soft agar. Metastasis is the main cause of death related to lung cancer. In this context, salinomycin induced a time- and concentration-dependent inhibition of cell migration and invasion. We also demonstrated for the first time that salinomycin induced a marked increase in the expression of the pro-apoptotic protein NAG-1 leading to the inhibition of lung cancer cell invasion but not cell survival. These findings identify salinomycin as a promising novel therapeutic agent for lung cancer.

  17. Early detection of lung cancer

    PubMed Central

    Midthun, David E.

    2016-01-01

    Most patients with lung cancer are diagnosed when they present with symptoms, they have advanced stage disease, and curative treatment is no longer an option. An effective screening test has long been desired for early detection with the goal of reducing mortality from lung cancer. Sputum cytology, chest radiography, and computed tomography (CT) scan have been studied as potential screening tests. The National Lung Screening Trial (NLST) demonstrated a 20% reduction in mortality with low-dose CT (LDCT) screening, and guidelines now endorse annual LDCT for those at high risk. Implementation of screening is underway with the desire that the benefits be seen in clinical practice outside of a research study format. Concerns include management of false positives, cost, incidental findings, radiation exposure, and overdiagnosis. Studies continue to evaluate LDCT screening and use of biomarkers in risk assessment and diagnosis in attempt to further improve outcomes for patients with lung cancer. PMID:27158468

  18. Impact of MET inhibition on small-cell lung cancer cells showing aberrant activation of the hepatocyte growth factor/MET pathway.

    PubMed

    Taniguchi, Hirokazu; Yamada, Tadaaki; Takeuchi, Shinji; Arai, Sachiko; Fukuda, Koji; Sakamoto, Shuichi; Kawada, Manabu; Yamaguchi, Hiroyuki; Mukae, Hiroshi; Yano, Seiji

    2017-07-01

    Small-cell lung cancer (SCLC) accounts for approximately 15% of all lung cancers, and is characterized as extremely aggressive, often displaying rapid tumor growth and multiple organ metastases. In addition, the clinical outcome of SCLC patients is poor due to early relapse and acquired resistance to standard chemotherapy treatments. Hence, novel therapeutic strategies for the treatment of SCLC are urgently required. Accordingly, several molecular targeted therapies were evaluated in SCLC; however, they failed to improve the clinical outcome. The receptor tyrosine kinase MET is a receptor for hepatocyte growth factor (HGF), and aberrant activation of HGF/MET signaling is known as one of the crucial mechanisms enabling cancer progression and invasion. Here, we found that the HGF/MET signaling was aberrantly activated in chemoresistant or chemorelapsed SCLC cell lines (SBC-5, DMS273, and DMS273-G3H) by the secretion of HGF and/or MET copy number gain. A cell-based in vitro assay revealed that HGF/MET inhibition, induced either by MET inhibitors (crizotinib and golvatinib), or by siRNA-mediated knockdown of HGF or MET, constrained growth of chemoresistant SCLC cells through the inhibition of ERK and AKT signals. Furthermore, treatment with either crizotinib or golvatinib suppressed the systemic metastasis of SBC-5 cell tumors in natural killer cell-depleted SCID mice, predominantly through cell cycle arrest. These findings reveal the therapeutic potential of targeting the HGF/MET pathway for inhibition, to constrain tumor progression of SCLC cells showing aberrant activation of HGF/MET signaling. We suggest that it would be clinically valuable to further investigate HGF/MET-mediated signaling in SCLC cells. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  19. Lung Cancer Risk Prediction Models

    Cancer.gov

    Developing statistical models that estimate the probability of developing lung cancer over a defined period of time will help clinicians identify individuals at higher risk of specific cancers, allowing for earlier or more frequent screening and counseling of behavioral changes to decrease risk.

  20. Carotenoids and lung cancer prevention

    USDA-ARS?s Scientific Manuscript database

    Understanding the molecular actions of carotenoids is critical for human studies involving carotenoids for prevention of lung cancer and cancers at other tissue sites. While the original hypothesis prompting the beta-carotene intervention trials was that beta-carotene exerts beneficial effects thro...

  1. Cigarette smoke and lung cancer

    SciTech Connect

    Martonen, T.B.; Hofmann, W.; Lowe, J.E.

    1987-01-01

    Cigarette smoke has been implicated in a causal relationship with carcinoma of the lung. An intriguing feature of the disease is the site-selectivity with which bronchogenic cancer manifests itself; most cancers are detected in the main, lobar and segmental bronchi, perhaps specifically at airway bifurcations. The elevated risk of lung cancer to smokers may result from a complex interplay between smoking and exposure to ambient Rn progeny, including the promotional-effect role (as opposed to being the initiating event) of cigarette smoke in tumor development. It has been determined that smokers exposed to average indoor Rn progency levels receive surprisingly high doses at hot spots within bronchial bifurcations.

  2. Drug Resistance to EGFR Inhibitors in Lung Cancer | Office of Cancer Genomics

    Cancer.gov

    The discovery of mutations in epidermal growth factor receptor (EGFR) has dramatically changed the treatment of patients with non-small-cell lung cancer (NSCLC), the leading cause of cancer deaths worldwide.

  3. Sprouty-4 inhibits transformed cell growth, migration and invasion, and EMT and is regulated by Wnt7A through PPARγ in non-small cell lung cancer

    PubMed Central

    Tennis, MA; Van Scoyk, MM; Freeman, SV; Vandervest, KM; Nemenoff, RA; Winn, RA

    2010-01-01

    Sprouty proteins are potent receptor tyrosine kinase inhibitors that antagonize growth factor signaling and are involved in lung development. However, little is known about the regulation or targets of Sprouty-4 (Spry4) in lung cancer. Our study aimed to determine the role of Spry4 in NSCLC. We found that Spry4 mRNA expression was decreased in NSCLC cell lines and in dysplastic lung cell lines compared to a non-transformed cell line, suggesting that Spry4 has tumor suppressing activity. When Spry4 was stably transfected into H157 and H2122 NSCLC cell lines, decreased migration and invasion were observed. MMP-9 activity was decreased and expression of MMP inhibitors TIMP1 and CD82 were increased. Stable expression of Spry4 led to reduced cell growth and reduced anchorage independent growth in NSCLC cell lines, along with upregulation of tumor suppressors p53 and p21. Changes in epithelial and mesenchymal markers indicated that Spry4 expression induces a reversal of the epithelial to mesenchymal transition characteristic of tumor cells. Treatment of a non-transformed lung epithelial cell line with shRNA to Spry4 led to decreased expression of epithelial markers and increased cell growth, supporting the concept of Spry4 acting as a tumor suppressor. We demonstrated that activity of the Spry4 promoter is increased by Wnt7A/Fzd9 signaling through peroxisome proliferator activated receptor γ. These data present previously undescribed targets of Spry4 and suggest that Spry4 is a downstream target of Wnt7A/Fzd 9 signaling. Spry4 may have efficacy in the treatment of NSCLC. PMID:20501643

  4. Functional imaging in lung cancer

    PubMed Central

    Harders, S W; Balyasnikowa, S; Fischer, B M

    2014-01-01

    Lung cancer represents an increasingly frequent cancer diagnosis worldwide. An increasing awareness on smoking cessation as an important mean to reduce lung cancer incidence and mortality, an increasing number of therapy options and a steady focus on early diagnosis and adequate staging have resulted in a modestly improved survival. For early diagnosis and precise staging, imaging, especially positron emission tomography combined with CT (PET/CT), plays an important role. Other functional imaging modalities such as dynamic contrast-enhanced CT (DCE-CT) and diffusion-weighted MR imaging (DW-MRI) have demonstrated promising results within this field. The purpose of this review is to provide the reader with a brief and balanced introduction to these three functional imaging modalities and their current or potential application in the care of patients with lung cancer. PMID:24289258

  5. Parthenolide suppresses non-small cell lung cancer GLC-82 cells growth via B-Raf/MAPK/Erk pathway

    PubMed Central

    Huang, Wenjing; Zhang, Guiping; Zhang, Genshui; Tang, Sili; Liu, Yun; Zhang, Lingling; Ma, Jinxiang; Zhang, Jianye

    2017-01-01

    Non-small cell lung cancer (NSCLC), one type of lung cancer, owns high rates of morbidity and mortality. B-Raf is one of the promising oncogenic drivers of NSCLC. Parthenolide, a natural product, is mainly extracted from the herbal plant Tanacetum parthenium. The effect of parthenolide on NSCLC cells and its potential as B-Raf inhibitor were studied in this study. It's shown that parthenolide exhibited the strong cytotoxicity against NSCLC cells with IC50 ranging from 6.07 ± 0.45 to 15.38 ± 1.13 μM. Parthenolide was also able to induce apoptosis, suppress proliferation and invasion in NSCLC cells. In terms of the involved mechanism, parthenolide suppressed GLC-82 cell response via targeting on B-Raf and inhibiting MAPK/Erk pathway signaling. The effect of parthenolide on B-Raf and MAPK/Erk pathway was further confirmed by RNA interference of B-Raf. Decreased expression of c-Myc in protein and mRNA level was also discovered, which is considered as the further downstream of the MAPK/Erk pathway. In addition, STAT3 activity inhibition by parthenolide contributed to its effect on GLC-82 cells, which is independent of PI3K pathway signaling and GSK3. All above provide an insight to understand the action of parthenolide as a potential B-Raf inhibitor in treatment of NSCLC. PMID:28423582

  6. Quality of Life in Patients Undergoing Radiation Therapy for Primary Lung Cancer, Head and Neck Cancer, or Gastrointestinal Cancer

    ClinicalTrials.gov

    2017-05-23

    Anal Cancer; Colorectal Cancer; Esophageal Cancer; Extrahepatic Bile Duct Cancer; Gallbladder Cancer; Gastric Cancer; Head and Neck Cancer; Liver Cancer; Lung Cancer; Pancreatic Cancer; Small Intestine Cancer

  7. Erythrocyte catalase and carbonic anhydrase activities in lung cancer.

    PubMed

    Cobanoglu, Ufuk; Demir, Halit; Duran, Memet; Şehitogullari, Abidin; Mergan, Duygu; Demir, Canan

    2010-01-01

    To study the relationship between the pathogenesis of lung cancer and antioxidant status and acidic media by measuring the activities of erythrocyte catalase (CAT) and carbonic anhydrase (CA). A total of 26 patients with lung cancer and 15 healthy individuals were included in the study. The CAT and CA activities of erythrocytes were defined. The catalase (CAT) activity of erythrocytes was measured using Aebi's method. Carbonic anhydrase (CA) activity was analyzed by CO2 hydration. It was found that erythrocyte CA and CAT activities were significantly lower in patients with lung cancer compared to controls (p<0.05). Of the 26 patients with lung cancer, seven (26.9%) had metastasis, and the CA and CAT levels in patients with metastasis were significantly decreased (p=0.0001). Development of oxidative stress due to lung cancer may be related to the balance between prooxidant and antioxidant reactions. Catalase may have a preventive effect for malignant lung cancers and the gene of the antioxidant enzymes may be one of the anti-oncogenes, and inactivation of one of these genes in the process of carcinogenesis may lead to tumor development. This may be an explanation for the very low levels of antioxidant CAT in patients with lung cancer compared to healthy individuals. Carbonic anhydrase (CA) in tumor cells may be an indicator of the acid-base balance in lung cancer. Decreased levels of CA in patients with lung cancer may provide a convenient media for tumor development, growth and metastasis by creating an acidic media.

  8. Impacts of Exercise on Prognostic Biomarkers in Lung Cancer Patients

    ClinicalTrials.gov

    2016-02-18

    Extensive Stage Small Cell Lung Cancer; Healthy, no Evidence of Disease; Limited Stage Small Cell Lung Cancer; Recurrent Non-small Cell Lung Cancer; Recurrent Small Cell Lung Cancer; Stage IA Non-small Cell Lung Cancer; Stage IB Non-small Cell Lung Cancer; Stage IIA Non-small Cell Lung Cancer; Stage IIB Non-small Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer

  9. [Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells].

    PubMed

    Yu, Yong; Shi, Min-Hua; Xu, Xun; Zhang, Zeng-Li; Hu, Hua-Cheng

    2010-06-01

    To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells. PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy. The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference. Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

  10. Lung Cancer Epidemiology in Korea.

    PubMed

    Shin, Aesun; Oh, Chang-Mo; Kim, Byung-Woo; Woo, Hyeongtaek; Won, Young-Joo; Lee, Jin-Soo

    2017-07-01

    The current study was undertaken to examine the trends in the lung cancer incidence, mortality, and survival after a diagnosis in Korea. Lung cancer incidence data according to the histologic type and mortality data were obtained from the Korea Central Cancer Registry and the Statistics Korea, respectively. The age-standardized incidence and mortality rates were calculated, and the Joinpoint model and age-period-cohort analyses were used to describe the trends in the rates. The 5-year relative survival rates of lung cancer were also calculated. Although the number of new lung cancer cases increased between 1999 and 2012, the age-standardized incidence rate decreased by 0.9% per year in men, whereas the incidence in women increased by 1.7% per year over the same time. Until 2010, the most common histologic type in men was squamous cell carcinoma, then adenocarcinoma prevailed thereafter. Since 1999, the most frequent histological type in women was adenocarcinoma. The lung cancer mortality started to decrease in 2002, with a more apparent decline for the younger age groups in both men and women. Overall, the 5-year relative survival rates have improved significantly from 11.2% for men and 14.7% for women among patients diagnosed between 1993 and 1997 to 19.3% for men and 28.2% for women among patients diagnosed between 2008 and 2012, respectively. An improvement in survival rate was observed for all major histology groups. The epidemiology of lung cancer in Korea has changed over a short time span, with decreasing mortality and improving survival rates. Further study is warranted to determine the cause of these changes.

  11. FGFR Signaling as a Target for Lung Cancer Therapy.

    PubMed

    Desai, Arpita; Adjei, Alex A

    2016-01-01

    Lung cancer is the leading cause of cancer-related death in developed countries. Recently, molecular targeted therapies have shown promising results in the management of lung cancer. These therapies require a clear understanding of the relevant pathways that drive carcinogenesis and maintenance of the malignant phenotype. The fibroblast growth factor receptor (FGFR) signaling axis is one such pathway that plays a central role in normal cellular function. Alterations in this pathway have been found in many cancers. In this review article, we focus on the role of this pathway in lung cancer. We present the molecular structure of FGFR, the interaction of the receptor with its ligands (the fibroblast growth factors), its downstream signaling, and aberrations in the FGFR pathway. We also discuss clinical trials involving selective and multikinase FGFR inhibitors in lung cancer treatment.

  12. Prostacyclin Inhibits Non-Small Cell Lung Cancer Growth by a Frizzled 9-Dependent Pathway That Is Blocked by Secreted Frizzled-Related Protein 112

    PubMed Central

    Tennis, Meredith A; Van Scoyk, Michelle; Heasley, Lynn E; Vandervest, Katherine; Weiser-Evans, Mary; Freeman, Scott; Keith, Robert L; Simpson, Pete; Nemenoff, Raphael A; Winn, Robert A

    2010-01-01

    The goal of this study was to assess the ability of iloprost, an orally active prostacyclin analog, to inhibit transformed growth of human non-small cell lung cancer (NSCLC) and to define the mechanism of iloprost's tumor suppressive effects. In a panel of NSCLC cell lines, the ability of iloprost to inhibit transformed cell growth was not correlated with the expression of the cell surface receptor for prostacyclin, but instead was correlated with the presence of Frizzled 9 (Fzd 9) and the activation of peroxisome proliferator-activated receptor-γ (PPARγ). Silencing of Fzd 9 blocked PPARγ activation by iloprost, and expression of Fzd 9 in cells lacking the protein resulted in iloprost's activation of PPARγ and inhibition of transformed growth. Interestingly, soluble Frizzled-related protein-1, a well-known inhibitor of Wnt/Fzd signaling, also blocked the effects of iloprost and Fzd 9. Moreover, mice treated with iloprost had reduced lung tumors and increased Fzd 9 expression. These studies define a novel paradigm, linking the eicosanoid pathway and Wnt signaling. In addition, these data also suggest that prostacyclin analogs may represent a new class of therapeutic agents in the treatment of NSCLC where the restoration of noncanonical Wnt signaling maybe important for the inhibition of transformed cell growth. PMID:20234818

  13. MicroRNA-1304 suppresses human non-small cell lung cancer cell growth in vitro by targeting heme oxygenase-1

    PubMed Central

    Li, Cheng-gang; Pu, Meng-fan; Li, Chun-zhu; Gao, Man; Liu, Ming-xia; Yu, Cun-zhi; Yan, Hong; Peng, Chun; Zhao, Yang; Li, Yu; Ma, Ze-long; Qi, Xin-ming; Wang, Yi-zheng; Miao, Ling-ling; Ren, Jin

    2017-01-01

    Previous studies have shown that microRNA-1304 (miR-1304) is dysregulated in certain types of cancers, including non-small cell lung cancer (NSCLC), and might be involved in tumor survival and/or growth. In this study we investigated the direct target of miR-1304 and its function in NSCLC in vitro. Human lung adenocarcinoma cell lines (A549 and NCI-H1975) were studied. The cell proliferation and survival were investigated via cell counting, MTT and colony-formation assays. Cell apoptosis and cell cycle were examined using annexin V-PE/7-AAD and PI staining assays, respectively. The dual-luciferase reporter assay was used to verify post-transcriptional regulation of heme oxygenase-1 (HO-1) by miR-1304. CRISPR/Cas9 was used to deplete endogenous miR-1304. Overexpression of MiR-1304 significantly decreased the number and viability of NSCLC cells and colony formation, and induced cell apoptosis and G0/G1 phase cell cycle arrest. HO-1 was demonstrated to be a direct target of miR-1304 in NSCLC cells. Restoration of HO-1 expression by hemin (20 μmol/L) abolished the inhibition of miR-1304 on cell growth and rescued miR-1304-induced apoptosis in A549 cells. Suppression of endogenous miR-1304 with anti-1304 significantly increased HO-1 expression and promoted cell growth and survival in A549 cells. In 17 human NSCLC tissue samples, miR-1304 expression was significantly decreased, while HO-1 expression was significantly increased as compared to normal lung tissues. MicroRNA-1304 is a tumor suppressor and HO-1 is its direct target in NSCLC. The results suggest the potential for miR-1304 as a therapeutic target for NSCLC. PMID:27641735

  14. MicroRNA-1304 suppresses human non-small cell lung cancer cell growth in vitro by targeting heme oxygenase-1.

    PubMed

    Li, Cheng-Gang; Pu, Meng-Fan; Li, Chun-Zhu; Gao, Man; Liu, Ming-Xia; Yu, Cun-Zhi; Yan, Hong; Peng, Chun; Zhao, Yang; Li, Yu; Ma, Ze-Long; Qi, Xin-Ming; Wang, Yi-Zheng; Miao, Ling-Ling; Ren, Jin

    2017-01-01

    Previous studies have shown that microRNA-1304 (miR-1304) is dysregulated in certain types of cancers, including non-small cell lung cancer (NSCLC), and might be involved in tumor survival and/or growth. In this study we investigated the direct target of miR-1304 and its function in NSCLC in vitro. Human lung adenocarcinoma cell lines (A549 and NCI-H1975) were studied. The cell proliferation and survival were investigated via cell counting, MTT and colony-formation assays. Cell apoptosis and cell cycle were examined using annexin V-PE/7-AAD and PI staining assays, respectively. The dual-luciferase reporter assay was used to verify post-transcriptional regulation of heme oxygenase-1 (HO-1) by miR-1304. CRISPR/Cas9 was used to deplete endogenous miR-1304. Overexpression of MiR-1304 significantly decreased the number and viability of NSCLC cells and colony formation, and induced cell apoptosis and G0/G1 phase cell cycle arrest. HO-1 was demonstrated to be a direct target of miR-1304 in NSCLC cells. Restoration of HO-1 expression by hemin (20 μmol/L) abolished the inhibition of miR-1304 on cell growth and rescued miR-1304-induced apoptosis in A549 cells. Suppression of endogenous miR-1304 with anti-1304 significantly increased HO-1 expression and promoted cell growth and survival in A549 cells. In 17 human NSCLC tissue samples, miR-1304 expression was significantly decreased, while HO-1 expression was significantly increased as compared to normal lung tissues. MicroRNA-1304 is a tumor suppressor and HO-1 is its direct target in NSCLC. The results suggest the potential for miR-1304 as a therapeutic target for NSCLC.

  15. p53 status is a major determinant of effects of decreasing peroxiredoxin I expression on tumor growth and response of lung cancer cells to treatment

    SciTech Connect

    Chen, M.-F. . E-mail: miaofen@adm.cgmh.org.tw; Chen, W.-C.; Wu, C.-T.; Lin, P.-Y.; Shau Hungyi; Liao, S.-K.; Yang, C.-T.; Lee, K.-D.

    2006-12-01

    Purpose: The potential roles of peroxiredoxin (Prx) I in carcinogenesis and treatment have been explored. Our previous study revealed differences between A549 (functional p53) and H1299 (null p53) Prx I antisense transfectants. The discrepancy might have resulted from the p53 status. In this study, we further investigated the role of Prx I and p53 on lung cancer growth and the response to treatment in vitro and in vivo. Methods: We established stable A549 and H1299 transfectants with Prx I antisense and p53, respectively. We then examined their characteristics in vitro and used nude mice xenografts of these cell lines to compare their capacity for tumor invasion and spontaneous metastasis and their sensitivity to radiotherapy. Results: Increased reactive oxygen species caused by lower Prx I activity induced p53 expression. In lethal stress, the augmentation of reactive oxygen species was partially reversed by blocking p53 in A549 with Prx I antisense. We demonstrated the potential contribution of p53-dependent mechanisms to inhibit lung tumor growth and increase radiosensitization using H1299 transfected with p53 in vitro and in vivo. An increased p53 level attenuated the capacity of the cells for metastasis by decreasing vascular endothelial growth factor and induced radiosensitization by increased apoptosis and cell senescence and by regulating intracellular reactive oxygen species. Conclusion: These results suggest that p53 status has an important role in the tumor-inhibiting and radiosensitizing effects of decreasing Prx I. Both Prx I and p53 may be powerful prognosticators for lung cancer.

  16. Tobacco Smoking and Lung Cancer

    PubMed Central

    Furrukh, Muhammad

    2013-01-01

    Tobacco smoking remains the most established cause of lung carcinogenesis and other disease processes. Over the last 50 years, tobacco refinement and the introduction of filters have brought a change in histology, and now adenocarcinoma has become the most prevalent subtype. Over the last decade, smoking also has emerged as a strong prognostic and predictive patient characteristic along with other variables. This article briefly reviews scientific facts about tobacco, and the process and molecular pathways involved in lung carcinogenesis in smokers and never-smokers. The evidence from randomised trials about tobacco smoking’s impact on lung cancer outcomes is also reviewed. PMID:23984018

  17. Risk Profiling May Improve Lung Cancer Screening

    Cancer.gov

    A new modeling study suggests that individualized, risk-based selection of ever-smokers for lung cancer screening may prevent more lung cancer deaths and improve the effectiveness and efficiency of screening compared with current screening recommendations

  18. Suicide Risk Quadruples After Lung Cancer Diagnosis

    MedlinePlus

    ... news/fullstory_165864.html Suicide Risk Quadruples After Lung Cancer Diagnosis Doctors, loved ones need to be on ... TUESDAY, May 23, 2017 (HealthDay News) -- People with lung cancer have a strikingly higher-than-normal risk of ...

  19. Inhibition of non-small cell lung cancer (NSCLC) growth by a novel small molecular inhibitor of EGFR.

    PubMed

    Li, Jinsong; Deng, Huayun; Hu, Meichun; Fang, Yuanzhang; Vaughn, Amanda; Cai, Xiaopan; Xu, Leqin; Wan, Wei; Li, Zhenxi; Chen, Shijie; Yang, Xinghai; Wu, Song; Xiao, Jianru

    2015-03-30

    The epidermal growth factor receptor (EGFR) is a therapeutic target (oncotarget) in NSCLC. Using in vitro EGFR kinase activity system, we identified a novel small molecule, WB-308, as an inhibitor of EGFR. WB-308 decreased NSCLC cell proliferation and colony formation, by causing G2/M arrest and apoptosis. Furthermore, WB-308 inhibited the engraft tumor growths in two animal models in vivo (lung orthotopic transplantation model and patient-derived engraft mouse model). WB-308 impaired the phosphorylation of EGFR, AKT, and ERK1/2 protein. WB-308 was less cytotoxic than Gefitinib. Our study suggests that WB-308 is a novel EGFR-TKI and may be considered to substitute for Gefitinib in clinical therapy for NSCLC.

  20. Biomarkers of erlotinib response in non-small cell lung cancer tumors that do not harbor the more common epidermal growth factor receptor mutations

    PubMed Central

    López-Ayllón, Blanca D; de Castro-Carpeño, Javier; Rodriguez, Carlos; Pernía, Olga; de Cáceres, Inmaculada Ibañez; Belda-Iniesta, Cristobal; Perona, Rosario; Sastre, Leandro

    2015-01-01

    Non-small cell lung cancer (NSCLC) represents approximately 85% of all lung cancers, which are the leading cause of cancer-related deaths in the world. Tyrosine kinase inhibitors such as erlotinib represent one therapeutic options presently recommended for tumors produced by activating mutations in the gene coding of epidermal growth factor receptor (EGFR). The aim of this study is the identification of possible biomarkers for tumor sensitivity to erlotinib in the absence of the main EGFR mutations. The erlotinib sensitivity of cells isolated from 41 untreated NSCLC patients was determined and compared with the presence of the more frequent EGFR mutations. Several patients had tumor cells highly sensitive to erlitinib in the absence of the EGFR mutations analyzed. The gene expression profile of 3 erlotinib-sensitive tumors was compared with that of 4 resistant tumors by DNA microarray hybridization. Sixteen genes were expressed at significantly higher levels in the resistant tumors than in the sensitive tumors. The possible correlation between erlotinib sensitivity and the expression of these genes was further analyzed using the data for the NSCLC, breast cancer and colon cancer cell lines of the NCI60 collection. The expression of these genes was correlated with the overall survival of 5 patients treated with erlotinib, according to The Cancer Genome Atlas (TCGA) database. Overlapping groups of 7, 5 and 3 genes, including UGT1A6, TRIB3, MET, MMP7, COL17A1, LCN2 and PTPRZ1, whose expression correlated with erlotinib activity was identified. In particular, low MET expression levels showed the strongest correlation. PMID:26045797

  1. Low-dose gefitinib treatment for patients with advanced non-small cell lung cancer harboring sensitive epidermal growth factor receptor mutations.

    PubMed

    Satoh, Hironori; Inoue, Akira; Kobayashi, Kunihiko; Maemondo, Makoto; Oizumi, Satoshi; Isobe, Hiroshi; Gemma, Akihiko; Saijo, Yasuo; Yoshizawa, Hirohisa; Hagiwara, Koichi; Nukiwa, Toshihiro

    2011-08-01

    Although standard schedule of gefitinib was the administration of 250 mg tablet every day, many patients need dose reduction because of toxicities. However, the efficacy of such low-dose gefitinib for patients with epidermal growth factor receptor-mutated non-small cell lung cancer has rarely been evaluated. A post hoc comparison of the efficacy (response rate and survival) in patients treated with gefitinib with or without any dose reduction in NEJ002 study was performed. Among 114 patients treated with first-line gefitinib in NEJ002, 61 (54%) continued gefitinib without any dose reduction until their diseases progressed, and 53 (46%) reduced their dose of gefitinib because of some toxicities. There was no significant difference of patient characteristics between the two groups. The progression-free survival of low-dose group tended to be better than that of standard-dose group (median progression-free survival, 11.8 versus 9.9 months; p = 0.144), and the overall survival of low-dose group was also better than that of standard-dose group (median survival time, 32.7 versus 25.3 months; p = 0.049). The results suggest that low-dose gefitinib may be clinically not inferior to standard-dose gefitinib for non-small cell lung cancer with sensitive epidermal growth factor receptor mutations. Prospective study of low-dose gefitinib is warranted especially for frail patients who need less toxic treatment.

  2. Overexpression of microRNA‑125a‑3p effectively inhibits the cell growth and invasion of lung cancer cells by regulating the mouse double minute 2 homolog/p53 signaling pathway.

    PubMed

    Li, Shenglei; Li, Xin; Zhao, Huasi; Gao, Ming; Wang, Feng; Li, Wencai

    2015-10-01

    MicroRNAs (miRs) are a family of small non-coding RNAs that are 21‑24 nucleotides in length. Decreased expression of hsa‑miR‑125a‑3p is observed in a number of patients with non‑small cell lung cancer; however, it is not clear how this miRNA regulates the growth and invasion of lung tumor cells. The aim of the present study was to identify the function of hsa‑miR‑125a‑3p in the growth and invasion of lung cancer cells. The expression of hsa‑miR‑125a‑3p in the A549, NCI‑H460 and SPCA‑1 lung cancer cell lines was analyzed by reverse transcription‑quantitative polymerase chain reaction and the human bronchiolar epithelium cell line (HBE) was used as a control. The results demonstrated that the expression of hsa‑miR‑125a‑3p was significantly lower in NCI‑H460, A549 and SPCA‑1 cells, compared with that in HBE cells. Overexpression of sense miR‑125a‑3p in the A549 lung cancer cell line inhibited cell proliferation for 5‑7 days (P<0.01), and transfection of antisense miR‑125a‑3p did not suppress the cell growth of the lung cancer cells. In addition, overexpression of miR‑125a‑3p in the NCI‑H460 lung cancer cell line markedly induced cell apoptosis, which was detected by fluorescence‑activated cell sorting with annexin V‑fluorescein isothiocyanate/propidium iodide staining. The results of the Transwell migration assay also revealed that transfection of miR‑125a‑3p resulted in decreased migration of lung cancer tumor cells. The pro‑apoptotic gene p53 expression was detected by western blot analysis. The results revealed that the expression of mouse double minute (MDM)‑2 homolog, the principal cellular antagonist of p53, was decreased and p53 expression was upregulated in sense has‑miR‑125a‑3p transfected A549 cells. This was consistent with that observed in NCI‑H460 cells, suggesting that hsa‑miR‑125a‑3p may be involved in the regulation of the MDM2/p53 signaling pathway in lung cancer cells. In

  3. Epidermal growth factor receptor tyrosine kinase inhibitors for the treatment of central nervous system metastases from non-small cell lung cancer: the present and the future.

    PubMed

    Proto, Claudia; Imbimbo, Martina; Gallucci, Rosaria; Brissa, Angela; Signorelli, Diego; Vitali, Milena; Macerelli, Marianna; Corrao, Giulia; Ganzinelli, Monica; Greco, Francesca Gabriella; Garassino, Marina Chiara; Lo Russo, Giuseppe

    2016-12-01

    Lung cancer is one of the major causes of cancer related mortality worldwide. Brain metastases (BM) complicate clinical evolution of non-small cell lung cancer (NSCLC) in approximately 25-40% of cases, adversely influencing quality of life (QoL) and overall survival (OS). Systemic therapy remains the standard strategy for metastatic disease. Nevertheless, the blood-brain barrier (BBB) makes central nervous system (CNS) a sanctuary site. To date, the combination of chemotherapy with whole brain radiation therapy (WBRT), surgery and/or stereotactic radiosurgery (SRS) represents the most used treatment for patients (pts) with intracranial involvement. However, due to their clinical conditions, many pts are not able to undergo local treatments. Targeted therapies directed against epidermal growth factor receptor (EGFR), such as gefitinib, erlotinib and afatinib, achieved important improvements in EGFR mutated NSCLC with favorable toxicity profile. Although their role is not well defined, the reported objective response rate (ORR) and the good tolerance make EGFR-tyrosine kinase inhibitors (TKIs) an interesting valid alternative for NSCLC pts with BM, especially for those harboring EGFR mutations. Furthermore, new-generation TKIs, such as osimertinib and rociletinib, have already shown important activity on intracranial disease and several trials are still ongoing to evaluate their efficacy. In this review we want to highlight literature data about the use and the effectiveness of EGFR-TKIs in pts with BM from NSCLC.

  4. Polymorphisms of the vascular endothelial growth factor gene and severe radiation pneumonitis in non-small cell lung cancer patients treated with definitive radiotherapy.

    PubMed

    Yin, Ming; Liao, Zhongxing; Yuan, Xianglin; Guan, Xiaoxiang; O'Reilly, Michael S; Welsh, James; Wang, Li-E; Wei, Qingyi

    2012-05-01

    Vascular endothelial growth factor (VEGF) is a major mediator of angiogenesis and lung cancer progression. We hypothesized that VEGF polymorphisms may modulate the risk of radiation pneumonitis (RP) in non-small cell lung cancer (NSCLC) patients treated with definitive radiotherapy. We genotyped three potentially functional VEGF single nucleotide polymorphisms (-460 T > C [rs833061], -634 G > C [rs2010963] and +936 C > T [rs3025039]) and estimated the associations of their genotypes and haplotypes with severe radiation pneumonitis (RP ≥grade 3) in 195 NSCLC patients. We found that the VEGF genotypes of rs2010963 and rs3025039 single nucleotide polymorphisms as well as the -460C/-634G/+936C haplotype were predictors of RP development (adjusted hazard ratio [adjHR] = 2.33, 95% confidence interval [CI], 1.01-5.37, P = 0.047 for CC vs GG genotypes; adjHR = 28.13, 95% CI, 5.24-151.02, P < 0.001 for TT vs CC genotypes; and adjHR = 2.51, 95% CI, 1.27-4.98, P = 0.008 for T-C-T vs C-G-C haplotypes). In addition, there was a trend towards reduced RP risk in patients carrying an increased number of protective VEGF genotypes. Our data suggest that VEGF polymorphisms can modulate the risk of radiation pneumonitis in NSCLC patients treated with definitive radiotherapy. Large and independent studies are needed to confirm our findings. © 2012 Japanese Cancer Association.

  5. Epidermal growth factor receptor tyrosine kinase inhibitors for the treatment of central nervous system metastases from non-small cell lung cancer: the present and the future

    PubMed Central

    Proto, Claudia; Imbimbo, Martina; Gallucci, Rosaria; Brissa, Angela; Signorelli, Diego; Vitali, Milena; Macerelli, Marianna; Corrao, Giulia; Ganzinelli, Monica; Greco, Francesca Gabriella; Garassino, Marina Chiara

    2016-01-01

    Lung cancer is one of the major causes of cancer related mortality worldwide. Brain metastases (BM) complicate clinical evolution of non-small cell lung cancer (NSCLC) in approximately 25–40% of cases, adversely influencing quality of life (QoL) and overall survival (OS). Systemic therapy remains the standard strategy for metastatic disease. Nevertheless, the blood-brain barrier (BBB) makes central nervous system (CNS) a sanctuary site. To date, the combination of chemotherapy with whole brain radiation therapy (WBRT), surgery and/or stereotactic radiosurgery (SRS) represents the most used treatment for patients (pts) with intracranial involvement. However, due to their clinical conditions, many pts are not able to undergo local treatments. Targeted therapies directed against epidermal growth factor receptor (EGFR), such as gefitinib, erlotinib and afatinib, achieved important improvements in EGFR mutated NSCLC with favorable toxicity profile. Although their role is not well defined, the reported objective response rate (ORR) and the good tolerance make EGFR-tyrosine kinase inhibitors (TKIs) an interesting valid alternative for NSCLC pts with BM, especially for those harboring EGFR mutations. Furthermore, new-generation TKIs, such as osimertinib and rociletinib, have already shown important activity on intracranial disease and several trials are still ongoing to evaluate their efficacy. In this review we want to highlight literature data about the use and the effectiveness of EGFR-TKIs in pts with BM from NSCLC. PMID:28149752

  6. Non-small-cell lung cancer.

    PubMed

    Gridelli, Cesare; Rossi, Antonio; Carbone, David P; Guarize, Juliana; Karachaliou, Niki; Mok, Tony; Petrella, Francesco; Spaggiari, Lorenzo; Rosell, Rafael

    2015-05-21

    Lung cancer is one of the most frequently diagnosed cancers and is the leading cause of cancer-related death worldwide. Non-small-cell lung cancer (NSCLC), a heterogeneous class of tumours, represents approximately 85% of all new lung cancer diagnoses. Tobacco smoking remains the main risk factor for developing this disease, but radon exposure and air pollution also have a role. Most patients are diagnosed with advanced-stage disease owing to inadequate screening programmes and late onset of clinical symptoms; consequently, patients have a very poor prognosis. Several diagnostic approaches can be used for NSCLC, including X-ray, CT and PET imaging, and histological examination of tumour biopsies. Accurate staging of the cancer is required to determine the optimal management strategy, which includes surgery, radiochemotherapy, immunotherapy and targeted approaches with anti-angiogenic monoclonal antibodies or tyrosine kinase inhibitors if tumours harbour oncogene mutations. Several of these driver mutations have been identified (for example, in epidermal growth factor receptor (EGFR) and anaplastic lymphoma kinase (ALK)), and therapy continues to advance to tackle acquired resistance problems. Also, palliative care has a central role in patient management and greatly improves quality of life. For an illustrated summary of this Primer, visit: http://go.nature.com/rWYFgg.

  7. Acromegalic pneumonomegaly: lung growth in the adult

    PubMed Central

    Brody, Jerome S.; Fisher, Aron B.; Gocmen, Ayhan; DuBois, Arthur B.

    1970-01-01

    Lung size was evaluated with pulmonary function tests in 10 patients with acromegaly, 1 pituitary giant, and 1 patient who had acromegaly but now has hypopituitarism. In the six acromegalic men all lung volumes were increased. The average values and per cent of predicted were total lung capacity 9.1 liters. 139%; functional residual capacity 5.2 liters, 145%; vital capacity 6.0 liters, 134%; and tissue volume 1.1 liters. There was no evidence of airflow obstruction or air trapping. Anatomic dead space was increased in proportion to the large lung volumes. Lung compliance was increased, averaging 0.43 liters/cm H2O, but lung elastic recoil was normal. These studies show that the lung is involved in the general visceromegaly of acromegaly and that lung size increases in acromegalic men as a result of actual lung growth. Despite the large lung volumes, diffusing capacity was normal suggesting that lung growth resulted from an increase in the size rather than from an increase in the number of alveoli. In contrast to the acromegalic men, lung volumes, anatomic dead space and tissue volume were normal in four acromegalic women, suggesting that sex hormones may modify the effect of growth hormone on the lung. Lung size was large in the pituitary giant but lung volumes were normal according to predicted values based on the patient's great height. Lung volumes were normal in the one male who had been acromegalic but who has been hypopituitary for 21 yr. The role of growth hormone in normal postnatal lung growth and in the maintainance of normal lung size remains to be defined. PMID:5422011

  8. PKM2 Thr454 phosphorylation increases its nuclear translocation and promotes xenograft tumor growth in A549 human lung cancer cells

    SciTech Connect

    Yu, Zhenhai; Huang, Liangqian; Qiao, Pengyun; Jiang, Aifang; Wang, Li; Yang, Tingting; Tang, Shengjian; Zhang, Wei; Ren, Chune

    2016-05-13

    Pyruvate kinase M2 (PKM2) is a key enzyme of glycolysis which is highly expressed in many tumor cells, and plays an important role in the Warburg effect. In previous study, we found PIM2 phosphorylates PKM2 at Thr454 residue (Yu, etl 2013). However, the functions of PKM2 Thr454 modification in cancer cells still remain unclear. Here we find PKM2 translocates into the nucleus after Thr454 phosphorylation. Replacement of wild type PKM2 with a mutant (T454A) enhances mitochondrial respiration, decreases pentose phosphate pathway, and enhances chemosensitivity in A549 cells. In addition, the mutant (T454A) PKM2 reduces xenograft tumor growth in nude mice. These findings demonstrate that PKM2 T454 phosphorylation is a potential therapeutic target in lung cancer.

  9. Usefulness of circulating free DNA for monitoring epidermal growth factor receptor mutations in advanced non-small cell lung cancer patients: a case report

    PubMed Central

    Gonzalez-Cao, Maria; Ramirez, Santiago Viteri; Ariza, Nuria Jordana; Balada, Ariadna; Garzón, Mónica; Teixidó, Cristina; Karachaliou, Niki; Morales-Espinosa, Daniela; Molina-Vila, Miguel Ángel; Rosell, Rafael

    2016-01-01

    Genomic analysis of circulating tumor DNA (ctDNA) released from cancer cells into the bloodstream has been proposed as a useful method to capture dynamic changes during the course of the disease. In particular, the ability to monitor epidermal growth factor receptor (EGFR) mutation status in cell-free circulating DNA (cfDNA) isolated from advanced non-small cell lung cancer (NSCLC) patients EGFR can help to the correct management of the disease and overcome the challenges associated with tumor heterogeneity and insufficient biopsied material to perform key molecular diagnosis. Here, we report a case of long term monitorization of EGFR mutation status in cfDNA from peripheral blood in an NSCLC patient in, with excellent correlation with clinical evolution. PMID:27826535

  10. miR-223 enhances the sensitivity of non-small cell lung cancer cells to erlotinib by targeting the insulin-like growth factor-1 receptor.

    PubMed

    Zhao, Feng-Yi; Han, Jing; Chen, Xie-Wan; Wang, Jiang; Wang, Xu-Dong; Sun, Jian-Guo; Chen, Zheng-Tang

    2016-07-01

    Lung cancer is the leading cause of cancer-related fatalities worldwide, and non-small cell lung cancer (NSCLC) is the main pathological type. MicroRNAs (miRNAs or miRs) are a class of small non-coding RNAs, which are involved in tumor initiation and progression. miR‑223 is a tumor suppressor miRNA that has been reported in various types of cancer, including lung cancer. In the present study, to characterize the biological behavior of miR‑223 in NSCLC, we established an miR‑223 overexpression model in erlotinib-resistant PC‑9 (PC‑9/ER) cells by infection with lentivirus to induce the overexpression of miR‑223. As a result, miR‑223 enhanced the sensitivity of the PC‑9/ER cells to erlotinib by inducing apoptosis in vitro. Additionally, in vivo experiments were performed using nude mice which were injected with the cancer cells [either the PC‑9 (not resistant), PC‑9/ER, or the PC‑9/ER cells infected with miR‑223)]. We found that the tumor volumes were reduced in the rats injected with the cells infected with miR‑223. To further explore the underlying mechanisms, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis were used to identify the target molecules of miR‑223. miR‑223 was demonstrated to act as a local regulator of insulin-like growth factor-1 receptor (IGF-1R) in the acquired resistance to tyrosine kinase inhibitors (TKIs). Notably, the οverexpression of IGF-1R in NSCLC was downregulated by miR‑223, and the activation of Akt/S6, the downstream pathway, was also inhibited. The inhibition of IGF-1R by miR‑223 was attenuated by exogenous IGF-1 expression. Therefore, miR‑223 may regulate the acquired resistance of PC‑9/ER cells to erlotinib by targeting the IGF-1R/Akt/S6 signaling pathway. The overexpression of miR‑223 may partially reverse the acquired resistance to epidermal growth factor receptor-TKIs, thus, providing a potential therapeutic strategy for TKI

  11. Lung Cancer and Eye Metastases

    PubMed Central

    Lampaki, Sofia; Kioumis, Ioannis; Pitsiou, Georgia; Lazaridis, George; Syrigos, Konstantinos; Trakada, Georgia; Kakolyris, Stylianos; Zarogoulidis, Konstantinos; Mpoukovinas, Ioannis; Rapti, Aggeliki; Zarogoulidis, Paul

    2014-01-01

    It has been observed that lung cancer either non-small cell or small cell is responsible for eye metastases. This form of metastases in several cases was the first manifestation of the disease and further investigation led to the diagnosis of the underlying malignancy. Both types of lung cancer are equally responsible for this demonstration. Furthermore; both chemotherapy and tyrosine kinase inhibitors have shown equal positive results in treating the exophalmos manifestation. Up to date information will be presented in our current work. PMID:25738158

  12. Growth inhibition of non-small cell lung cancer cells by AP-1 blockade using a cJun dominant-negative mutant

    PubMed Central

    Shimizu, Y; Kinoshita, I; Kikuchi, J; Yamazaki, K; Nishimura, M; Birrer, M J; Dosaka-Akita, H

    2008-01-01

    cJun, a major constituent of AP-1 transcription factor transducing multiple mitogen growth signals, is frequently overexpressed in non-small cell lung cancers (NSCLCs). The purpose of this study is to determine the effects of AP-1 blockade on the growth of NSCLC cells using a cJun dominant-negative mutant, TAM67. Transiently transfected TAM67 inhibited AP-1 transcriptional activity in NSCLC cell lines, NCI-H1299 (H1299), A549 and NCI-H520 (H520). The colony-forming efficiency of H1299 and A549 was reduced by TAM67, while that of H520 was not. To elucidate the effects of TAM67 on the growth of H1299, we established H1299 clone cells that expressed TAM67 under the control of a doxycycline-inducible promoter. In the H1299 clone cells, the induced TAM67 inhibited anchorage-dependent growth by promoting G1 cell-cycle block, but not by apoptosis. The induced TAM67 decreased the expression of a cell-cycle regulatory protein, cyclin A. TAM67 also inhibited anchorage-independent growth of these cells. Furthermore, TAM67 reduced growth of established xenograft tumours from these cells in nude mice. These results suggest that AP-1 plays an essential role in the growth of at least some of NSCLC cells. PMID:18283312

  13. Science, medicine, and the future. Lung cancer.

    PubMed Central

    Sethi, T.

    1997-01-01

    Lung cancer, the most prevalent cancer in the Western world, is mainly caused by smoking. Nevertheless, only 20% of smokers develop lung cancer and while prevention is important, environmental factors are expected to contribute to the predicted rise in the incidence of lung cancer in the next 25 years. Survival of lung cancer is still poor, and new treatments are urgently needed. This review examines potential new therapeutic developments which have arisen from a greater understanding of the molecular and cellular biology of lung cancers. PMID:9066480

  14. Electrochemical treatment of lung cancer

    SciTech Connect

    Xin, Y.L.; Xue, F.Z.; Ge, B.S.; Zhao, F.R.; Shi, B.; Zhang, W.

    1997-03-01

    A pilot study of electrochemical treatment (ECT) as a therapy for 386 patients with nonsmall cell lung cancer was undertaken. There were 103 stage 2 cases, 89 stage 3a cases, 122 stage 3b cases, and 72 stage 4 cases. Two ECT methods were used. For peripherally located lung cancer, platinum electrodes were inserted transcutaneously into the tumor under x-ray or CT guidance. For central type lung cancer or for those inoperable during thoracotomy, electrodes were inserted intraoperatively directly into the cancer. Voltage was 6--8 V, current was 40--100 mA, and electric charge was 100 coulombs per cm of tumor diameter. The number of electrodes was determined from the size of cancer mass, because the diameter of effective area around each electrode is approximately 3 cm. The short-term (6 months after ECT) results of the 386 lung cancer cases were: complete response (CR), 25.6% (99/386); partial response (PR), 46.4% (179/386); no change (NC), 15.3% (59/386); and progressive disease (PD), 12.7% (49/386). The total effective rate (CR + PR) was 72% (278/386). The 1, 3, and 5 year overall survival rates were 86.3% (333/386), 58.8% (227/386), and 29.5% (114/386), respectively. The main complication was traumatic pneumothorax, with an incidence rate of 14.8% (57/386). These clinical results show that ECT is simple, safe, effective, and minimally traumatic. ECT provides an alternative method for treating lung cancers that are conventionally inoperable, that are not responsive to chemotherapy or radiotherapy, or that cannot be resected after thoracotomy. Long-term survival rates suggest that ECT warrants further investigation.

  15. A high-fat diet increases angiogenesis, solid tumor growth, and lung metastasis of CT26 colon cancer cells in obesity-resistant BALB/c mice.

    PubMed

    Park, Heesook; Kim, Minhee; Kwon, Gyoo Taik; Lim, Do Young; Yu, Rina; Sung, Mi-Kyung; Lee, Ki Won; Daily, James W; Park, Jung Han Yoon

    2012-11-01

    We evaluated whether high-fat diet (HFD), in the absence of increased calorie intake, increases colon cancer growth and metastasis. Four-week-old male BALB/c mice were fed on an HFD (60 kcal% fat) or control diet (10 kcal% fat) for 16 wk, after which CT26 colon cancer cells were subcutaneously injected into the right flank. Solid tumor growth and the number and volume of tumor nodules in the lung were increased markedly in the HFD group with only a slight increase in body weight (5.9%). HFD feeding increased tumor tissue levels of Ki67, cyclin A, cyclin D1, CDK2, Bcl-xL, and Bcl-2; reduced p53 levels and TUNEL-positive apoptotic cells; increased the levels of CD45, CD68, CD31, VEGF, P-VEGF receptor-2, iNOS, and COX-2 as well as hemoglobin content; and increased the levels of HIF-1α, P-STAT3-Y705, P-STAT3-S727, P-IκB-α, P-p65, p65, P-c-Jun, P-Akt, P-ERK1/2, P-p38, and P-SAPK/JNK. HFD feeding increased the serum levels of EGF, insulin, IGF-I, IFN-γ, leptin, RANTES, MCP-1, IL-1ra, and SDF-1α and media conditioned by epididymal fat tissue explants from HFD-fed mice caused an increase in microvessel outgrowth from the mouse aorta and tube formation of human umbilical vein endothelial cells. These results indicate that the chronic consumption of an HFD increases colon cancer cell proliferation, tumor angiogenesis, and lung metastasis in mice in the absence of discernible weight gain. HFD feeding increases the levels of growth factors which activate transcription factors, thereby inducing the expression of many genes involved in the stimulation of inflammation, angiogenesis, and cellular proliferation. Copyright © 2011 Wiley Periodicals, Inc.

  16. [6]-Shogaol inhibits growth and induces apoptosis of non-small cell lung cancer cells by directly regulating Akt1/2

    PubMed Central

    Kim, Myoung Ok; Lee, Mee-Hyun; Oi, Naomi; Kim, Sung-Hyun; Dong, Zigang

    2014-01-01

    Non-small cell lung cancer (NSCLC) is the leading cause of cancer mortality worldwide. Despite progress in developing chemotherapeutics for the treatment of NSCLC, primary and secondary resistance limits therapeutic success. NSCLC cells exhibit multiple mutations in the epidermal growth factor receptor (EGFR), which cause aberrant activation of diverse cell signaling pathways. Therefore, suppression of the inappropriate amplification of EGFR downstream signaling cascades is considered to be a rational therapeutic and preventive strategy for the management of NSCLC. Our initial molecular target–oriented virtual screening revealed that the ginger components, including [6]-shogaol, [6]-paradol and [6]-gingerol, seem to be potential candidates for the prevention and treatment of NSCLC. Among the compounds, [6]-shogaol showed the greatest inhibitory effects on the NSCLC cell proliferation and anchorage-independent growth. [6]-Shogaol induced cell cycle arrest (G1 or G2/M) and apoptosis. Furthermore, [6]-shogaol inhibited Akt kinase activity, a downstream mediator of EGFR signaling, by binding with an allosteric site of Akt. In NCI-H1650 lung cancer cells, [6]-shogaol reduced the constitutive phosphorylation of signal transducer and activator of transcription-3 (STAT3) and decreased the expression of cyclin D1/3, which are target proteins in the Akt signaling pathway. The induction of apoptosis in NCI-H1650 cells by [6]-shogaol corresponded with the cleavage of caspase-3 and caspase-7. Moreover, intraperitoneal administration of [6]-shogaol inhibited the growth of NCI-H1650 cells as tumor xenografts in nude mice. [6]-Shogaol suppressed the expression of Ki-67, cyclin D1 and phosphorylated Akt and STAT3 and increased terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling-positivity in xenograft tumors. The current study clearly indicates that [6]-shogaol can be exploited for the prevention and/or treatment of NSCLC. PMID:24282290

  17. The matricellular protein CCN1 suppresses lung cancer cell growth by inducing senescence via the p53/p21 pathway.

    PubMed

    Jim Leu, Shr-Jeng; Sung, Jung-Sung; Chen, Mei-Yu; Chen, Chih-Wei; Cheng, Jian-Yu; Wang, Tse-Yen; Wang, Jeng-Jung

    2013-09-01

    CCN1, a secreted matrix-associated molecule, is involved in multiple cellular processes. Previous studies have indicated that expression of CCN1 correlates inversely with the aggressiveness of non-small-cell lung carcinoma (NSCLC); however, the underlying mechanisms remain elusive. Using three NSCLC cell line systems, here we show that long-term treatment of cells with the recombinant CCN1 protein led to a permanent cell cycle arrest in G1 phase; cells remained viable as judged by apoptotic assays. CCN1-treated NSCLC cells acquired a phenotype characteristic of senescent cells, including an enlarged and flattened cell shape and expression of the senescence-associated β-galactosidase. Immunoblot analysis showed that addition of CCN1 increased the abundance of hypo-phosphorylated Rb, as well as accumulation of p53 and p21. Silencing the expression of p53 or p21 by lentivirus-mediated shRNA production in cells blocked the CCN1-induced senescence. Furthermore, a CCN1 mutant defective for binding integrin α6β1 and co-receptor heparan sulfate proteoglycans was incapable of senescence induction. Our finding that direct addition of CCN1 induces senescence in NSCLC cells provides a potential novel strategy for therapeutic intervention of lung cancers.

  18. In the hunt for therapeutic targets: mimicking the growth, metastasis, and stromal associations of early-stage lung cancer using a novel orthotopic animal model.

    PubMed

    Weiss, Ido D; Ella, Ezra; Dominsky, Omri; Smith, Yoav; Abraham, Michal; Wald, Hanna; Shlomai, Zippora; Zamir, Gideon; Feigelson, Sara W; Shezen, Elias; Bar-Shai, Amir; Alon, Ronen; Izhar, Uzi; Peled, Amnon; Shapira, Oz M; Wald, Ori

    2015-01-01

    The existing shortage of animal models that properly mimic the progression of early-stage human lung cancer from a solitary confined tumor to an invasive metastatic disease hinders accurate characterization of key interactions between lung cancer cells and their stroma. We herein describe a novel orthotopic animal model that addresses these concerns and consequently serves as an attractive platform to study tumor-stromal cell interactions under conditions that reflect early-stage lung cancer. Unlike previous methodologies, we directly injected small numbers of human or murine lung cancer cells into murine's left lung and longitudinally monitored disease progression. Next, we used green fluorescent protein-tagged tumor cells and immuno-fluorescent staining to determine the tumor's microanatomic distribution and to look for tumor-infiltrating immune cells and stromal cells. Finally, we compared chemokine gene expression patterns in the tumor and lung microenvironment. We successfully generated a solitary pulmonary nodule surrounded by normal lung parenchyma that grew locally and spread distally over time. Notably, we found that both fibroblasts and leukocytes are recruited to the tumor's margins and that distinct myeloid cell attracting and CCR2-binding chemokines are specifically induced in the tumor microenvironment. Our orthotopic lung cancer model closely mimics the pathologic sequence of events that characterizes early-stage human lung cancer propagation. It further introduces new means to monitor tumor-stromal cell interactions and offers unique opportunities to test therapeutic targets under conditions that reflect early-stage lung cancer. We argue that for such purposes our model is superior to lung cancer models that are based either on genetic induction of epithelial transformation or on ectopic transplantation of malignant cells.

  19. Interleukin-6 Prevents the Initiation but Enhances the Progression of Lung Cancer.

    PubMed

    Qu, Zhaoxia; Sun, Fan; Zhou, Jingjiao; Li, Liwen; Shapiro, Steven D; Xiao, Gutian

    2015-08-15

    Recent studies suggest that high expression of the proinflammatory cytokine IL6 is associated with poor survival of lung cancer patients. Accordingly, IL6 has been a target of great interest for lung cancer therapy. However, the role of IL6 in lung cancer has not been determined yet. Here, we demonstrate that IL6 plays opposite roles in the initiation and growth of lung cancer in a mouse model of lung cancer induced by the K-Ras oncogene. We find that compared with wild-type mice, IL6-deficient mice developed much more lung tumors after an activating mutant of K-Ras was induced in the lungs. However, lung tumors developed in IL6-deficient mice were significantly smaller. Notably, both the lung tumor-suppressing and -promoting functions of IL6 involve its ability in activating the transcription factor STAT3. IL6/STAT3 signaling suppressed lung cancer initiation through maintaining lung homeostasis, regulating lung macrophages, and activating cytotoxic CD8 T cells under K-Ras oncogenic stress, whereas it promoted lung cancer cell growth through inducing the cell proliferation regulator cyclin D1. These studies reveal a previously unexplored role of IL6/STAT3 signaling in maintaining lung homeostasis and suppressing lung cancer induction. These studies also significantly improve our understanding of lung cancer and provide a molecular basis for designing IL6/STAT3-targeted therapies for this deadliest human cancer.

  20. Interleukin-6 prevents the initiation but enhances the progression of lung cancer

    PubMed Central

    Qu, Zhaoxia; Sun, Fan; Zhou, Jingjiao; Li, Liwen; Shapiro, Steven D.; Xiao, Gutian

    2015-01-01

    Recent studies suggest that high expression of the pro-inflammatory cytokine interleukin-6 (IL-6) is associated with poor survival of lung cancer patients. Accordingly, IL-6 has been a target of great interest for lung cancer therapy. However, the role of IL-6 in lung cancer has not been determined yet. Here, we demonstrate that IL-6 plays opposite roles in the initiation and growth of lung cancer in a mouse model of lung cancer induced by the K-Ras oncogene. We find that compared to wild type mice, IL-6 deficient mice developed much more lung tumors after an activating mutant of K-Ras was induced in the lungs. However, lung tumors developed in IL-6 deficient mice were significantly smaller. Notably, both the lung tumor-suppressing and -promoting functions of IL-6 involve its ability in activating the transcription factor STAT3. IL-6/STAT3 signaling suppressed lung cancer initiation through maintaining lung homeostasis, regulating lung macrophages and activating cytotoxic CD8 T cells under K-Ras oncogenic stress, whereas it promoted lung cancer cell growth through inducing the cell proliferation regulator Cyclin D1. These studies reveal a previously unexplored role of IL-6/STAT3 signaling in maintaining lung homeostasis and suppressing lung cancer induction. These studies also significantly improve our understanding of lung cancer and provide a molecular basis for designing IL-6/STAT3-targeted therapies for this deadliest human cancer. PMID:26122841

  1. [Advances of molecular targeted therapy in squamous cell lung cancer].

    PubMed

    Ma, Li; Zhang, Shucai

    2013-12-01

    Squamous cell lung cancer (SQCLC) is one of the most prevalent subtypes of lung cancer worldwide, about 400,000 persons die from squamous-cell lung cancer around the world, and its pathogenesis is closely linked with tobacco exposure. Unfortunately, squamous-cell lung cancer patients do not benefit from major advances in the development of targeted therapeutics such as epidermal growth factor receptor (EGFR) inhibitors or anaplastic lymphoma kinase (ALK) inhibitors that show exquisite activity in lung adenocarcinomas with EGFR mutations or echinoderm microtubule associated protein like-4 (EML4)-ALK fusions, respectively. Major efforts have been launched to characterize the genomes of squamous-cell lung cancers. Among the new results emanating from these efforts are amplifications of the fibroblast growth factor receptor 1 (FGFR1) gene, the discoidin domain receptor 2 (DDR2) gene mutation as potential novel targets for the treatment of SQCLCs. Researchers find that there are many specific molecular targeted genes in the genome of squamous-cell lung cancer patients. These changes play a vital role in cell cycle regulation, oxidative stress, cell apoptosis, squamous epithelium differentiation, may be the candidate targeted moleculars in SQCLCs. Here, we provide a review on these discoveries and their implications for clinical trials in squamous-cell lung cancer assessing the value of novel therapeutics addressing these targets.

  2. Increased insulin-like growth factor 1 receptor (IGF1R) expression in small cell lung cancer and the effect of inhibition of IGF1R expression by RNAi on growth of human small cell lung cancer NCI-H446 cell.

    PubMed

    Wang, Zhigang; Lu, Pingfang; Liang, Zhu; Zhang, Zhanfei; Shi, Weicheng; Cai, Xiaobi; Chen, Chunyuan

    2015-01-01

    Insulin-like growth factor 1 receptor (IGF1R) is a tyrosine kinase receptor implicated in tumourigenesis that may be an attractive target for anti-cancer treatment. In this study, the expression and clinical significance of IGF1R were investigated in serum and lung cancer tissues from small cell lung cancinoma (SCLC). We also compared the effect of IGF1R up-regulation and IGF1R inhibition on viability and apoptosis of NCI-H446 cells. We found the concentration of IGF1R in blood serum was significantly increased and positive IGF1R protein in cancer tissue was more prevalent in SCLC. A statistically significant correlation among IGF1R-positve tumors, lymph node metastasis and local invasion was discussed. Furthermore, IGF1R overexpression lead to an increase of cell survival and suppressed cell apoptosis, IGF1R silencing mediated by RNAi abrogate this response of NCI-H446 cells. Our results further demonstrated that the effects of these treatments may be assigned to the effective inhibition of lung cancer cells from Akt/P27(Kip1) pathway in IGF-1R signaling. These features may have important implications for future anti-IGF1R therapeutic approaches.

  3. Suppressive effects of a proton beam on tumor growth and lung metastasis through the inhibition of metastatic gene expression in 4T1 orthotopic breast cancer model.

    PubMed

    Kwon, Yun-Suk; Lee, Kyu-Shik; Chun, So-Young; Jang, Tae Jung; Nam, Kyung-Soo

    2016-07-01

    A proton beam is a next generation tool to treat intractable cancer. Although the therapeutic effects of a proton beam are well known, the effect on tumor metastasis is not fully described. Here, we investigated the effects of a proton beam on metastasis in highly invasive 4T1 murine breast cancer cells and their orthotopic breast cancer model. Cells were irradiated with 2, 4, 8 or 16 Gy proton beam, and changes in cell proliferation, survival, and migration were observed by MTT, colony forming and wound healing assays. 4T1 breast cancer cell-implanted BALB/c mice were established and the animals were randomly divided into 4 groups when tumor size reached 200 mm3. Breast tumors were selectively irradiated with 10, 20 or 30 Gy proton beam. Breast tumor sizes were measured twice a week, and breast tumor and lung tissues were pathologically observed. Metastasis-regulating gene expression was assessed with quantitative RT-PCR. A proton beam dose-dependently decreased cell proliferation, survival and migration in 4T1 murine breast cancer cells. Also, growth of breast tumors in the 4T1 orthotopic breast cancer model was significantly suppressed by proton beam irradiation without significant change of body weight. Furthermore, fewer tumor nodules metastasized from breast tumor into lung in mice irradiated with 30 Gy proton beam, but not with 10 and 20 Gy, than in control. We observed correspondingly lower expression levels of urokinase plasminogen activator (uPA), uPA receptor, cyclooxygenase (COX)-2, and vascular endothelial growth factor (VEGF), which are important factors in cancer metastasis, in breast tumor irradiated with 30 Gy proton beam. Proton beam irradiation did not affect expressions of matrix metalloproteinase (MMP)-9 and MMP-2. Taken together, the data suggest that, although proton beam therapy is an effective tool for breast cancer treatment, a suitable dose is necessary to prevent metastasis-linked relapse and poor prognosis.

  4. Cytogenetic and molecular aspects of lung cancer.

    PubMed

    Panani, Anna D; Roussos, Charis

    2006-07-28

    Lung cancer is one of the most common cancers worldwide and its pathogenesis is closely associated with tobacco smoking. Continuous exposure of smoking carcinogens results in the accumulation of several alterations of tumorigenesis related genes leading to neoplastic bronchial lesions. Lung cancer is divided in two main histological groups, non-small cell lung carcinomas (NSCLCs) and small cell lung carcinomas (SCLCs). It seems that lung tumorigenesis is a multistep process in which a number of genetic events including alterations of oncogenes and tumor suppressor genes have been occurred. Cytogenetic abnormalities in lung cancer are very complex. However, a number of recurrent cytogenetic abnormalities have been identified. Many of these changes are common in both major histological groups of lung cancer while certain chromosomal abnormalities have been correlated with the stage or the grade of the tumors. In addition, several molecular alterations have been constantly found. Some of them are common in different histological subtypes of lung cancer and they appear to play an important role in the pathogenesis of lung cancer. A good understanding of the underlying genetic changes of lung tumorigenesis will provide new perspectives for early diagnosis and screening of high-risk individuals. In addition, a number of genetical prognostic factors have been identified as possibly helpful parameters in the evaluation of lung cancer patients. Further research is required in order to systematically investigate genetical alterations in lung cancer contributing to improvement of lung cancer classification and staging and to development of new molecular targeted therapies.

  5. Knockdown of oncogenic KRAS in non-small cell lung cancers suppresses tumor growth and sensitizes tumor cells to targeted therapy.

    PubMed

    Sunaga, Noriaki; Shames, David S; Girard, Luc; Peyton, Michael; Larsen, Jill E; Imai, Hisao; Soh, Junichi; Sato, Mitsuo; Yanagitani, Noriko; Kaira, Kyoichi; Xie, Yang; Gazdar, Adi F; Mori, Masatomo; Minna, John D

    2011-02-01

    Oncogenic KRAS is found in more than 25% of lung adenocarcinomas, the major histologic subtype of non-small cell lung cancer (NSCLC), and is an important target for drug development. To this end, we generated four NSCLC lines with stable knockdown selective for oncogenic KRAS. As expected, stable knockdown of oncogenic KRAS led to inhibition of in vitro and in vivo tumor growth in the KRAS-mutant NSCLC cells, but not in NSCLC cells that have wild-type KRAS (but mutant NRAS). Surprisingly, we did not see large-scale induction of cell death and the growth inhibitory effect was not complete. To further understand the ability of NSCLCs to grow despite selective removal of mutant KRAS expression, we conducted microarray expression profiling of NSCLC cell lines with or without mutant KRAS knockdown and isogenic human bronchial epithelial cell lines with and without oncogenic KRAS. We found that although the mitogen-activated protein kinase pathway is significantly downregulated after mutant KRAS knockdown, these NSCLCs showed increased levels of phospho-STAT3 and phospho-epidermal growth factor receptor, and variable changes in phospho-Akt. In addition, mutant KRAS knockdown sensitized the NSCLCs to p38 and EGFR inhibitors. Our findings suggest that targeting oncogenic KRAS by itself will not be sufficient treatment, but may offer possibilities of combining anti-KRAS strategies with other targeted drugs.

  6. EGFR targeted therapy in lung cancer; an evolving story.

    PubMed

    Bartholomew, C; Eastlake, L; Dunn, P; Yiannakis, D

    2017-01-01

    Specific oncogenes with driver mutations, such as the Epidermal Growth Factor Receptor (EGFR 1) gene can lead to non-small-cell lung cancer formation. Identification of these oncogenes, their driver mutations and downstream effects allow the targeting of these pathways by drugs. Such personalised therapy has become an important strategy in combating lung cancer and highlights the need to test for these mutations. Tyrosine Kinase Inhibitors (TKIs) against EGFR, such as Erlotinib, are able to halt these tumour promoting properties in non-small-cell lung cancers. Third generation EGFR TKIs, such as Osimertinib, are focussing on resulting acquired TKI resistance. Here we report the clinical course of a patient with metastatic non-small-cell lung cancer who has undergone EGFR targeted therapy and been further challenged by TKI acquired resistance. Her extended survival and maintained quality of life are a consequence of these modern, genotype-targeted, personalised metastatic non-small-cell lung cancer therapies.

  7. Vascular endothelial growth factor blockade alters magnetic resonance imaging biomarkers of vascular function and decreases barrier permeability in a rat model of lung cancer brain metastasis.

    PubMed

    Pishko, Gregory L; Muldoon, Leslie L; Pagel, Michael A; Schwartz, Daniel L; Neuwelt, Edward A

    2015-02-17

    Blockade of vascular endothelial growth factor (VEGF) to promote vascular normalization and inhibit angiogenesis has been proposed for the treatment of brain metastases; however, vascular normalization has not been well-characterized in this disease. We investigated the effect of treatment with bevacizumab anti-VEGF antibody on magnetic resonance imaging (MRI) biomarkers of brain tumor vascular characteristics in comparison to small molecule delivery in a rat model of human lung cancer brain metastasis. Athymic rats with A549 human lung adenocarcinoma intracerebral xenografts underwent MRI at 11.75 T before and one day after treatment with bevacizumab (n = 8) or saline control (n = 8) to evaluate tumor volume, free water content (edema), blood volume and vascular permeability (Ktrans). One day later, permeability to 14C-aminoisobutyric acid (AIB) was measured in tumor and brain to assess the penetration of a small drug-like molecule. In saline control animals, tumor volume, edema and permeability increased over the two day assessment period. Compared to controls, bevacizumab treatment slowed the rate of tumor growth (P = 0.003) and blocked the increase in edema (P = 0.033), but did not alter tumor blood volume. Bevacizumab also significantly reduced Ktrans (P = 0.033) and AIB passive permeability in tumor (P = 0.04), but not to peritumoral tissue or normal brain. Post-treatment Ktrans correlated with AIB levels in the bevacizumab-treated rats but not in the saline controls. The correlation of an MRI biomarker for decreased vascular permeability with decreased AIB concentration in tumor after antiangiogenic treatment suggests that bevacizumab partially restored the normal low permeability characteristics of the blood-brain barrier in a model of human lung cancer brain metastasis.

  8. Twice weekly pulse and daily continuous-dose erlotinib as initial treatment for patients with epidermal growth factor receptor-mutant lung cancers and brain metastases.

    PubMed

    Arbour, Kathryn C; Kris, Mark G; Riely, Gregory J; Ni, Ai; Beal, Kathryn; Daras, Mariza; Hayes, Sara A; Young, Robert J; Rodriguez, Christopher R; Ahn, Linda; Pao, William; Yu, Helena A

    2017-09-21

    In a phase 1 study of pulse/continuous-dose erlotinib, no patient had disease progression in the central nervous system (CNS). This expansion cohort of the phase 1 study tested the same regimen in a cohort of individuals with epidermal growth factor receptor (EGFR)-mutant lung cancers with untreated brain metastases. Patients had not received EGFR tyrosine kinase inhibitors or radiation for brain metastases. All received 1200 mg of erlotinib on days 1 and 2 and 50 mg on days 3 to 7 weekly. The primary endpoints were the overall and CNS response rates (according to version 1.1 of the Response Evaluation Criteria in Solid Tumors). Between May 2015 and August 2016, 19 patients were enrolled. Forty-two percent of the patients had target brain lesions, and the median size of the target brain lesions was 13 mm. Overall, 14 patients (74%; 95% confidence interval [CI], 51%-89%) had partial responses. The response rate in brain metastases was 75%. The overall median progression-free survival was 10 months (95% CI, 7 months to not reached). Only 3 patients (16%) had CNS progression. To date, 4 patients required CNS radiation at some time during their course. The adverse events (any grade) seen in 10% or more of the patients were rash, diarrhea, nausea, an increase in alanine aminotransferase, and fatigue. Pulse/continuous-dose erlotinib produced a 74% overall response rate and a 75% response rate in brain metastases in patients with EGFR-mutant lung cancers and untreated brain metastases. CNS control persisted even after progression elsewhere. Although this regimen did not improve progression-free survival or delay the emergence of EGFR T790M, it prevented progression in the brain and could be useful in situations in which CNS control is critical. Cancer 2017. © 2017 American Cancer Society. © 2017 American Cancer Society.

  9. Green tea polyphenol EGCG suppresses lung cancer cell growth through upregulating miR-210 expression caused by stabilizing HIF-1α.

    PubMed

    Wang, Hong; Bian, Shengjie; Yang, Chung S

    2011-12-01

    (-)-Epigallocatechin-3-gallate (EGCG) has been reported to affect many cellular regulatory pathways. This study aims to determine whether EGCG could target microRNA (miRNA), one of the mechanisms for cells to achieve subtle change in multiple targets. We found that, in both human and mouse lung cancer cells in culture, EGCG specifically upregulated the expression of miR-210, a major miRNA regulated by HIF-1α. Furthermore, we found that overexpression of miR-210 led to reduced cell proliferation rate and anchorage-independent growth as well as reduced sensitivity to EGCG. On the mechanisms of miR-210 regulation by EGCG, we demonstrated that the regulation was mediated through the hypoxia-response element in miR-210 promoter. Consistently, the upregulation of miR-210 was found to be correlated with the stabilized HIF-1α in lung cancer cell lines after EGCG treatment. This EGCG-induced stabilization of HIF-1α was further shown by the stabilization of HA-tagged HIF-1α but not the P402A/P564A-mutated HIF-1α by EGCG, suggesting that EGCG targets the oxygen-dependent degradation (ODD) domain. Direct evidence was obtained by affinity binding assay showing that EGCG specifically binds HIF-1α with a K(d) = 3.47 μM. This result suggests that EGCG binding interferes with the hydroxylation of key Pro residues in the ODD domain, preventing HIF-1α from the Pro hydroxylation-dependent ubiquitination and subsequent proteosome-mediated degradation. In summary, our results demonstrated, for the first time, the elevation of miR-210 by EGCG in lung cancer cell lines and this is mediated by the stabilization of HIF-1α. This event contributes to the anticancer activity of EGCG.

  10. Epidermal growth factor receptor T790M mutation-positive metastatic non-small-cell lung cancer: focus on osimertinib (AZD9291)

    PubMed Central

    Saad, Nibal; Poudel, Aarati; Basnet, Alina; Gajra, Ajeet

    2017-01-01

    Adenocarcinoma is the most common type of non-small-cell lung cancer (NSCLC). Adenocarcinoma with epidermal growth factor receptor (EGFR) mutations accounts for 8%–30% of all cases of NSCLC depending on the geography and ethnicity. EGFR-mutated NSCLC usually responds to first-line therapy with EGFR tyrosine kinase inhibitors (TKIs). However, there is eventual loss of efficacy to TKIs due to development of resistance. The most frequent cause for resistance is a second EGFR mutation in exon 20 (T790M), which is encountered in up to 62% of patients. Osimertinib is one of the third-generation EGFR TKIs with a high selective potency against T790M mutants. In Phase I trial of osimertinib in advanced lung cancer after progression on EGFR TKIs, the response rate and disease control rate were 61% and 95%, respectively. A subsequent Phase II (AURA2) trial demonstrated a disease control rate of 92%, a response rate of 71%, a median duration of response of 7.8 months, and a median progression-free survival of 8.6 months. Osimertinib was approved by the US Food & Drug Administration in November 2015 for patients whose tumors exhibited T790M mutation and for those with progressive disease on other EGFR TKIs. In this review, we address the role of EGFR TKIs in the management of EGFR mutation lung cancer and the mechanisms of resistance to TKIs with a focus on the role of osimertinib. Data from completed trials of osimertinib, ongoing trials, as well as novel diagnostic methods to detect EGFR T790M mutation are reviewed. PMID:28367058

  11. Tyrosine Kinase Inhibitors in Lung Cancer

    PubMed Central

    Thomas, Anish; Rajan, Arun; Giaccone, Giuseppe

    2012-01-01

    SYNOPSIS ‘Driver mutations’ are essential for carcinogenesis as well as tumor progression as they confer a selective growth advantage to cancer cells. Identification of driver mutations in growth related protein kinases, especially tyrosine kinases have led to clinical development of an array of tyrosine kinase inhibitors in various malignancies, including lung cancer. Inhibition of epidermal growth factor receptor and anaplastic lymphoma kinase tyrosine kinases have proven to be of meaningful clinical benefit, while inhibition of several other tyrosine kinases have been of limited clinical benefit, thus far. An improved understanding of tyrosine kinase biology has also led to faster drug development, identification of resistance mechanisms and ways to overcome resistance. In this review, we discuss the clinical data supporting the use and practical aspects of management of patients on epidermal growth factor receptor and anaplastic lymphoma kinase tyrosine kinase inhibitors. PMID:22520981

  12. Lung cancer in elderly patients

    PubMed Central

    Diso, Daniele; Onorati, Ilaria; Anile, Marco; Mantovani, Sara; Rendina, Erino A.

    2016-01-01

    There is a worldwide-accepted evidence of a population shift toward older ages. This shift favors an increased risk of developing lung cancer that is primarily a disease of older populations. Decision making is extremely difficult in elderly patients, since this group is under-represented in clinical trials with only 25% of them historically opening to patients older than 65 years. For all these reasons, a “customized” preoperative assessment to identify physiological or pathological frailty should be encouraged since standard tools may be less reliable. The work already done to improve patient selection for lung surgery in the elderly population clearly shows that surgical resection seems the treatment of choice for early stage lung cancer. Further studies are required to improve outcome by reducing postoperative morbidity and mortality. PMID:27942414

  13. Molecular Epidemiology of Female Lung Cancer

    PubMed Central

    Yim, Seon-Hee; Chung, Yeun-Jun

    2011-01-01

    Lung cancer is still a leading cause of cancer mortality in the world. The incidence of lung cancer in developed countries started to decrease mainly due to global anti-smoking campaigns. However, the incidence of lung cancer in women has been increasing in recent decades for various reasons. Furthermore, since the screening of lung cancer is not as yet very effective, clinically applicable molecular markers for early diagnosis are much required. Lung cancer in women appears to have differences compared with that in men, in terms of histologic types and susceptibility to environmental risk factors. This suggests that female lung cancer can be derived by carcinogenic mechanisms different from those involved in male lung cancer. Among female lung cancer patients, many are non-smokers, which could be studied to identify alternative carcinogenic mechanisms independent from smoking-related ones. In this paper, we reviewed molecular susceptibility markers and genetic changes in lung cancer tissues observed in female lung cancer patients, which have been validated by various studies and will be helpful to understand the tumorigenesis of lung cancer. PMID:24212786

  14. Lung Cancer Staging and Prognosis.

    PubMed

    Woodard, Gavitt A; Jones, Kirk D; Jablons, David M

    The seventh edition of the non-small cell lung cancer (NSCLC) TNM staging system was developed by the International Association for the Staging of Lung Cancer (IASLC) Lung Cancer Staging Project by a coordinated international effort to develop data-derived TNM classifications with significant survival differences. Based on these TNM groupings, current 5-year survival estimates in NSLCC range from 73 % in stage IA disease to 13 % in stage IV disease. TNM stage remains the most important prognostic factor in predicting recurrence rates and survival times, followed by tumor histologic grade, and patient sex, age, and performance status. Molecular prognostication in lung cancer is an exploding area of research where interest has moved beyond TNM stage and into individualized genetic tumor analysis with immunohistochemistry, microarray, and mutation profiles. However, despite intense research efforts and countless publications, no molecular prognostic marker has been adopted into clinical use since most fail in subsequent cross-validation with few exceptions. The recent interest in immunotherapy for NSCLC has identified new biomarkers with early evidence that suggests that PD-L1 is a predictive marker of a good response to new immunotherapy drugs but a poor prognostic indicator of overall survival. Future prognostication of outcomes in NSCLC will likely be based on a combination of TNM stage and molecular tumor profiling and yield more precise, individualized survival estimates and treatment algorithms.

  15. Lung cancer-a fractal viewpoint.

    PubMed

    Lennon, Frances E; Cianci, Gianguido C; Cipriani, Nicole A; Hensing, Thomas A; Zhang, Hannah J; Chen, Chin-Tu; Murgu, Septimiu D; Vokes, Everett E; Vannier, Michael W; Salgia, Ravi

    2015-11-01

    Fractals are mathematical constructs that show self-similarity over a range of scales and non-integer (fractal) dimensions. Owing to these properties, fractal geometry can be used to efficiently estimate the geometrical complexity, and the irregularity of shapes and patterns observed in lung tumour growth (over space or time), whereas the use of traditional Euclidean geometry in such calculations is more challenging. The application of fractal analysis in biomedical imaging and time series has shown considerable promise for measuring processes as varied as heart and respiratory rates, neuronal cell characterization, and vascular development. Despite the advantages of fractal mathematics and numerous studies demonstrating its applicability to lung cancer research, many researchers and clinicians remain unaware of its potential. Therefore, this Review aims to introduce the fundamental basis of fractals and to illustrate how analysis of fractal dimension (FD) and associated measurements, such as lacunarity (texture) can be performed. We describe the fractal nature of the lung and explain why this organ is particularly suited to fractal analysis. Studies that have used fractal analyses to quantify changes in nuclear and chromatin FD in primary and metastatic tumour cells, and clinical imaging studies that correlated changes in the FD of tumours on CT and/or PET images with tumour growth and treatment responses are reviewed. Moreover, the potential use of these techniques in the diagnosis and therapeutic management of lung cancer are discussed.

  16. Key roles for GRB2-associated-binding protein 1, phosphatidylinositol-3-kinase, cyclooxygenase 2, prostaglandin E2 and transforming growth factor alpha in linoleic acid-induced upregulation of lung and breast cancer cell growth

    PubMed Central

    Johnson, E.D.; Beck, K.L.; Pardini, R.S.

    2014-01-01

    SUMMARY The omega-6 polyunsaturated fatty acid linoleic acid (LA; C18:2 n-6) is prevalent in Western diets and has been shown to enhance tumorigenesis of several cancer models. However, the modes by which LA affects carcinogenesis have not been fully elucidated. In this study, a mechanism for LA-induced upregulation of cancer cell growth is defined. Cellular proliferation was enhanced with LA treatment in BT-474 human breast ductal carcinoma and A549 human lung adenocarcinoma cell lines. Enrichment of LA increased COX activity and led to increases in PGE2 production, followed by increases in MMP and TGF-α levels, which are all key elements involved in the enhancement of cancer cell growth. Further investigation revealed that LA supplementation in both BT-474 breast and A549 lung cancer cell lines greatly increased the association between the scaffolding protein Gab1 and EGFR, while at the same time dramatically decreasing Gab1 protein levels. These changes are concomitant with increases in activated Akt (pAkt), a downstream signaling component in the PI3K signaling pathway. Moreover, inhibitors of EGFR, PI3K and Gab1-specific siRNAs were capable of reversing LA-induced upregulation of pAkt, as well as observed increases in cell proliferation for these models. These data establish Gab1 as major target in LA-induced enhancement of tumorigenesis. PMID:24374147

  17. Commentary: Treatment Considerations for Patients With Epidermal Growth Factor Receptor-Mutated Non-Small Cell Lung Cancer Brain Metastases in the Era of Tyrosine Kinase Inhibitors.

    PubMed

    Vaca, Silvia Daniela; Connolly, Ian David; Ho, Clement; Neal, Joel; Hayden Gephart, Melanie

    2017-08-12

    Brain metastasis is a serious complication of non-small cell lung cancer (NSCLC) affecting up to 40% of NSCLC patients. A subset of NSCLC tumors has mutations in the epidermal growth factor receptor (EGFR) gene, and determination of tumor EGFR mutation status is essential in guiding treatment decisions, as it directly affects the treatment approach. Patients with EGFR-mutated NSCLC have a higher cumulative incidence of brain metastases, and are especially sensitive to EGFR tyrosine kinase inhibitors (TKIs). Patients with newly diagnosed EGFR-mutated lung cancer presenting to a neurosurgeon with a new diagnosis of brain metastases now have a variety of treatment options available, including whole brain radiation therapy, stereotactic radiosurgery, surgical resection, chemotherapy, and targeted therapeutics such as the EGFR TKIs. In this review, we discuss the impact of EGFR mutation status on brain and leptomeningeal metastasis treatment considerations. Additionally, we present clinical cases of patients treated with EGFR TKIs alone and in combination with other therapies to highlight treatment alternatives. Copyright © 2017 by the Congress of Neurological Surgeons.

  18. Knockdown of Long Noncoding RNA Small Nucleolar RNA Host Gene 12 Inhibits Cell Growth and Induces Apoptosis by Upregulating miR-138 in Nonsmall Cell Lung Cancer.

    PubMed

    Wang, Xiaoyan; Qi, Guanbin; Zhang, Juanjuan; Wu, Jingcan; Zhou, Nannan; Li, Lei; Ma, Jing

    2017-09-05

    Small nucleolar RNA host gene 12 (SNHG12) is a novel long noncoding RNA identified to be upregulated and functions as an oncogene in several cancers. However, the function of SNHG12 and its target genes in modulating nonsmall cell lung cancer (NSCLC) development are rarely reported. In the present study, we validated that SNHG12 was overexpressed, while miR-138 was low-expressed, in NSCLC cells compared with normal human lung epithelial cells. SNHG12 harbored the binding site of miR-138 and inversely regulated the expression miR-138. Knockdown of SNHG12 inhibited proliferation and colony-forming ability, induced apoptosis, and increased caspase-3 activity of NSCLC cells, whereas miR-138 downregulation restored these effects. Furthermore, SNHG12 knockdown decreased volumes and weight of xenograft tumors in a NSCLC mouse model. Taken together, these findings suggested that knockdown of SNHG12 suppressed cell growth and induced apoptosis by upregulating miR-138 in NSCLC.

  19. Targeting oncogenic KRAS in non-small cell lung cancer cells by phenformin inhibits growth and angiogenesis

    PubMed Central

    Wang, Zhi Dong; Wei, Sheng Quan; Wang, Qin Yi

    2015-01-01

    Tumors require a vascular supply to grow and can achieve this via the expression of pro-angiogenic growth factors. Many potential oncogenic mutations have been identified in tumor angiogenesis. Somatic mutations in the small GTPase KRAS are the most common activating lesions found in human cancer, and are generally associated with poor response to standard therapies. Biguanides, such as the diabetes therapeutics metformin and phenformin, have demonstrated anti-tumor activity both in vitro and in vivo. The extracellular regulated protein kinases (ERK) signaling is known to be a major cellular target of biguanides. Based on KRAS activates several down-stream effectors leading to the stimulation of the RAF/mitogen-activated protein kinase/extracellular signal-regulated kinase (RAF/MEK/ERK) and phosphatidylinositol-3-kinase (PI3K) pathways, we investigated the anti-tumor effects of biguanides on the proliferation of KRAS-mutated tumor cells in vitro and on KRAS-driven tumor growth in vivo. In cancer cells harboring oncogenic KRAS, phenformin switches off the ERK pathway and inhibit the expression of pro-angiogenic molecules. In tumor xenografts harboring the KRAS mutation, phenformin extensively modifies the tumor growth causing abrogation of angiogenesis. These results strongly suggest that significant therapeutic advantage may be achieved by phenformin anti-angiogenesis for the treatment of tumor. PMID:26807315

  20. Women and lung cancer: waiting to exhale.

    PubMed

    Baldini, E H; Strauss, G M

    1997-10-01

    Lung cancer is now the leading cause of cancer deaths among women. In the United States, 64,300 women are expected to die of lung cancer in 1996. Smoking is responsible for about 80% of lung cancer cases. Unfortunately, the prevalence of smoking among women remains unacceptably high at about 22% and is expected to surpass the rate in men by the year 2000. Smoking rates are highest among young girls and the less educated. Whether lung cancer represents a different disease in women than in men is unclear. Data are conflicting regarding the magnitude of the relative risk of developing lung cancer due to smoking between the genders. There appears to be a difference in the relative distribution of lung cancer histologic features between men and women that is not explained entirely by differences in smoking patterns. Women who smoke appear to be at higher risk of developing small cell lung cancer than squamous cell lung cancer, whereas men who smoke have a similar risk for the two histologic conditions. Furthermore, women smokers are more likely to develop adenocarcinoma of the lung, and estrogens may play a causative role in this phenomenon. Data are unclear regarding whether the outcome of lung cancer treatment differs between genders. Solutions to the lung cancer epidemic among US women include (1) prevention of the disease by reducing smoking rates, (2) improving early detection methods, and (3) exploring new therapeutic strategies.

  1. Thromboprophylaxis in ambulatory lung cancer treatment.

    PubMed

    Cavaliere, Loretta

    2013-02-01

    Venous thromboembolism (VTE), including deep vein thrombosis and pulmonary embolism, are common problems experienced by patients with lung cancer that can impact treatment plans, prognoses, and survival. Patients with lung cancer are at greatest risk for development of VTE in the ambulatory care treatment setting. Literature does exist on VTE management for medical and surgical oncology inpatients, as well as clinical guidelines for inpatient prophylaxis; however, published evidence is lacking on outpatient risk and thromboprophylaxis in medical oncology outpatients, particularly patients with lung cancer. Because patients with lung cancer treated in the ambulatory setting have established risks for VTE, they may benefit from thromboprophylaxis. Clinical guidelines for outpatient thromboprophylaxis direct the clinical practice for thromboprophylaxis in lung cancer treatment. The purpose of the current article is to explore the VTE risks associated with ambulatory lung cancer treatment and to review the recommended guidelines for thromboprophylaxis to guide clinical decision making for patients with lung cancer.

  2. Guidance molecules in lung cancer

    PubMed Central

    Nasarre, Patrick; Potiron, Vincent; Drabkin, Harry

    2010-01-01

    Guidance molecules were first described in the nervous system to control axon outgrowth direction. They are also widely expressed outside the nervous system where they control cell migration, tissue development and establishment of the vascular network. In addition, they are involved in cancer development, tumor angiogenesis and metastasis. This review is primarily focused on their functions in lung cancer and their involvement in lung development is also presented. Five guidance molecule families and their corresponding receptors are described, including the semaphorins/neuropilins/plexins, ephrins and Eph receptors, netrin/DCC/UNC5, Slit/Robo and Notch/Delta. In addition, the possibility to target these molecules as a therapeutic approach in cancer is discussed. PMID:20139699

  3. v-rasH induces non-small cell phenotype, with associated growth factors and receptors, in a small cell lung cancer cell line.

    PubMed Central

    Falco, J P; Baylin, S B; Lupu, R; Borges, M; Nelkin, B D; Jasti, R K; Davidson, N E; Mabry, M

    1990-01-01

    Small cell lung cancer (SCLC) tumor progression can involve partial or complete conversion to a more treatment-resistant non-small cell (NSCLC) phenotype. In a cell culture model of this phenomenon, we have previously demonstrated that insertion of the viral Harvey ras gene (v-Ha-ras) into SCLC cell lines with amplification and overexpression of the c-myc gene induced many NSCLC phenotypic features. We now report that the v-Ha-ras gene can also induce morphologic, biochemical, and growth characteristics consistent with the NSCLC phenotype in an N-myc amplified SCLC cell line, NCI-H249. We show that v-Ha-ras has novel effects on these cells, abrogating an SCLC-specific growth requirement for gastrin-releasing peptide, and inducing mRNA expression of three NSCLC-associated growth factors and receptors, platelet-derived growth factor B chain, transforming growth factor-alpha (TGF-alpha), and epidermal growth factor receptor (EGF-R). TGF-alpha secretion and EGF-R also appear, consistent with the induction of an autocrine loop previously shown to be growth stimulatory for NSCLC in culture. These data suggest that N-myc and v-Ha-ras represent functional classes of genes that may complement each other in bringing about the phenotypic alterations seen during SCLC tumor progression, and suggest that such alterations might include the appearance of growth factors and receptors of potential importance for the growth of the tumor and its surrounding stroma. Images PMID:2161428

  4. Knockdown of Oncogenic KRAS in Non-Small Cell Lung Cancers Suppresses Tumor Growth and Sensitizes Tumor Cells to Targeted Therapy

    PubMed Central

    Sunaga, Noriaki; Shames, David S.; Girard, Luc; Peyton, Michael; Larsen, Jill E.; Imai, Hisao; Soh, Junichi; Sato, Mitsuo; Yanagitani, Noriko; Kaira, Kyoichi; Xie, Yang; Gazdar, Adi F.; Mori, Masatomo; Minna, John D.

    2011-01-01

    Oncogenic KRAS is found in >25% of lung adenocarcinomas, the major histologic subtype of non-small cell lung cancer (NSCLC), and is an important target for drug development. To this end, we generated four NSCLC lines with stable knockdown selective for oncogenic KRAS. As expected, stable knockdown of oncogenic KRAS led to inhibition of in vitro and in vivo tumor growth in the KRAS mutant NSCLC cells, but not in NSCLC cells that have wild-type KRAS (but mutant NRAS). Surprisingly, we did not see large-scale induction of cell death and the growth inhibitory effect was not complete. To further understand the ability of NSCLCs to grow despite selective removal of mutant KRAS expression, we performed microarray expression profiling of NSCLC cell lines with or without mutant KRAS knockdown and isogenic human bronchial epithelial cell lines (HBECs) with and without oncogenic KRAS. We found that while the MAPK pathway is significantly down-regulated after mutant KRAS knockdown, these NSCLCs showed increased levels of phospho-STAT3 and phospho-EGFR, and variable changes in phospho-Akt. In addition, mutant KRAS knockdown sensitized the NSCLCs to p38 and EGFR inhibitors. Our findings suggest that targeting oncogenic KRAS by itself will not be sufficient treatment but may offer possibilities of combining anti-KRAS strategies with other targeted drugs. PMID:21306997

  5. GLI pathogenesis-related 1 functions as a tumor-suppressor in lung cancer.

    PubMed

    Sheng, Xiumei; Bowen, Nathan; Wang, Zhengxin

    2016-03-18

    GLI pathogenesis-related 1 (GLIPR1) was originally identified in glioblastomas and its expression was also found to be down-regulated in prostate cancer. Functional studies revealed both growth suppression and proapoptotic activities for GLIPR1 in multiple cancer cell lines. GLIPR1's role in lung cancer has not been investigated. Protein arginine methyltransferase 5 (PRMT5) is a protein arginine methyltransferase and forms a stoichiometric complex with the WD repeat domain 77 (WDR77) protein. Both PRMT5 and WDR77 are essential for growth of lung epithelial and cancer cells. But additional gene products that interact genetically or biochemichally with PRMT5 and WDR77 in the control of lung cancer cell growth are not characterized. DNA microarray and immunostaining were used to detect GLIPR1 expression during lung development and lung tumorigenesis. GLIPR1 expression was also analyzed in the TCGA lung cancer cohort. The consequence of GLIPR1 on growth of lung cancer cells in the tissue culture and lung tumor xenografts in the nude mice was observed. We found that GLIPR1 expression is negatively associated with PRMT5/WDR77. GLIPR1 is absent in growing epithelial cells at the early stages of mouse lung development and highly expressed in the adult lung. Expression of GLIPR1 was down-regulated during lung tumorigenesis and its expression suppressed growth of lung cancer cells in the tissue culture and lung tumor xenografts in mice. GLIPR1 regulates lung cancer growth through the V-Erb-B avian erythroblastic leukemia viral oncogene homolog 3 (ErbB3). This study reveals a novel pathway that PRMT5/WDR77 regulates GLIPR1 expression to control lung cancer cell growth and GLIPR1 as a potential therapeutic agent for lung cancer.

  6. MicroRNA-134 regulates lung cancer cell H69 growth and apoptosis by targeting WWOX gene and suppressing the ERK1/2 signaling pathway

    SciTech Connect

    Chen, Tianjun; Gao, Fei; Feng, Sifang; Yang, Tian; Chen, Mingwei

    2015-08-28

    MicroRNAs have been shown to act as crucial modulators during carcinogenesis. Recent studies have implied that miR-134 expression associated with epithelial-to-mesenchymal transition phenotype and invasive potential of NSCLC cells. Our study investigated the pathogenic implications of miR-134 in small cell lung cancer (SCLC). Overexpression or inhibition MiR-134 expression by miR-134 mimics or miR-134 inhibitors (anti-miR-134) in SCLC cell lines was detected using qRT-PCR. Lactate dehydrogenase (LDH) assay, MTT assays and flow cytometry were performed in order to clarify the growth and apoptosis of SCLC cells which had been transfected with miR-134 mimics or anti-miR-134. WWOX expression in H69 cells was detected by qRT-PCR and western blot, respectively. The results showed that overexpression miR-134 was significantly promoting SCLC cells growth and inhibit its apoptosis. In addition, reduced miR-134 expression was significantly correlated with cell growth inhibition and apoptosis promotion. Furthermore, transfection of miR-134 mimics into the SCLC cells markedly down-regulated the level of WWOX, whereas, anti-miR-134 up-regulated WWOX expression. We also found that overexpression WWOX attenuate miR-134 induced H69 cells growth, and promote cell apoptosis. Moreover, miR-134 promoted cell proliferation and inhibit apoptosis via the activation of ERK1/2 pathway. These findings suggest that miR-134 may be an ideal diagnostic and prognostic marker, and may be attributed to the molecular therapy of SCLC. - Highlights: • MiR-134 play roles in small cell lung cancer cell growth and apoptosis. • MiR-134 negative regulated the level of WWOX in H69 cells. • WWOX overexpression attenuate miR-134 induced H69 cells growth. • MiR-134 promotes cell growth via the activation of ERK1/2 pathway.

  7. Ultrasonography-Guided Core Biopsy of Supraclavicular Lymph Nodes for Diagnosis of Metastasis and Identification of Epidermal Growth Factor Receptor (EGFR) Mutation in Advanced Lung Cancer.

    PubMed

    Choe, Jooae; Kim, Mi Young; Baek, Jung Hwan; Choi, Chang-Min; Kim, Hwa Jung

    2015-07-01

    The aim of this study was to evaluate the diagnostic performance of ultrasonography (US)-guided core biopsy of a supraclavicular lymph node (SCN) for detecting metastasis and epidermal growth factor receptor (EGFR) mutations. We included 229 patients who underwent US-guided core biopsy of SCN with lung cancer from January 2011 to December 2013. We evaluated the morphologic characteristics and measured the sizes of SCNs on US and chest computed tomography (CT). The clinical stage, maximum standardized uptake value (SUV max) on 18F-fluorodeoxyglucose positron emission tomography, and the morphology on US and CT in the positive metastasis were compared with those in the negative metastasis. The prevalence of EGFR mutations of the adenocarcinoma and procedure-related complication was investigated. The accuracy of US-guided core biopsy of SCN diagnosing metastasis was 97.8% (224/229). The cutoff values (sensitivity; specificity; area under the receiver operating characteristic curve, 95% confidence interval [CI]) of the short-axis dimension of SCN on CT were 0.85 cm (72.3%; 80.6%; 0.808, 95% CI: 0.740-0.875), on US 0.75 cm (73.5%; 84.8%; 0.843, 95% CI: 0.788-0.897), and that of SUV max 4.05 (79.1%; 81.8%; 0.853, 95% CI: 0.780-0.925). The mutations were positive in 35.8% with adenocarcinoma. There were no procedure-related complications of US-guided SCN core biopsy. US-guided SCN core biopsy is a reliable and safe method for detecting metastasis, histologic subtyping, and identifying the EGFR mutation in the advanced lung cancers. It may be a substitute for more invasive lung biopsy as an initial tissue confirmation in the advanced disease.

  8. Ultrasonography-Guided Core Biopsy of Supraclavicular Lymph Nodes for Diagnosis of Metastasis and Identification of Epidermal Growth Factor Receptor (EGFR) Mutation in Advanced Lung Cancer

    PubMed Central

    Choe, Jooae; Kim, Mi Young; Baek, Jung Hwan; Choi, Chang-Min; Kim, Hwa Jung

    2015-01-01

    Abstract The aim of this study was to evaluate the diagnostic performance of ultrasonography (US)-guided core biopsy of a supraclavicular lymph node (SCN) for detecting metastasis and epidermal growth factor receptor (EGFR) mutations. We included 229 patients who underwent US-guided core biopsy of SCN with lung cancer from January 2011 to December 2013. We evaluated the morphologic characteristics and measured the sizes of SCNs on US and chest computed tomography (CT). The clinical stage, maximum standardized uptake value (SUVmax) on 18F-fluorodeoxyglucose positron emission tomography, and the morphology on US and CT in the positive metastasis were compared with those in the negative metastasis. The prevalence of EGFR mutations of the adenocarcinoma and procedure-related complication was investigated. The accuracy of US-guided core biopsy of SCN diagnosing metastasis was 97.8% (224/229). The cutoff values (sensitivity; specificity; area under the receiver operating characteristic curve, 95% confidence interval [CI]) of the short-axis dimension of SCN on CT were 0.85 cm (72.3%; 80.6%; 0.808, 95% CI: 0.740–0.875), on US 0.75 cm (73.5%; 84.8%; 0.843, 95% CI: 0.788–0.897), and that of SUVmax 4.05 (79.1%; 81.8%; 0.853, 95% CI: 0.780–0.925). The mutations were positive in 35.8% with adenocarcinoma. There were no procedure-related complications of US-guided SCN core biopsy. US-guided SCN core biopsy is a reliable and safe method for detecting metastasis, histologic subtyping, and identifying the EGFR mutation in the advanced lung cancers. It may be a substitute for more invasive lung biopsy as an initial tissue confirmation in the advanced disease. PMID:26200642

  9. Targeting Tyrosine Kinase Inhibitor-Resistant Non-Small Cell Lung Cancer by Inducing Epidermal Growth Factor Receptor Degradation via Methionine 790 Oxidation

    PubMed Central

    Leung, Elaine Lai-Han; Fan, Xing-Xing; Wong, Maria Pik; Jiang, Zhi-Hong; Liu, Zhong-Qiu; Yao, Xiao-Jun; Lu, Lin-Lin; Zhou, Yan-Ling; Yau, Li-Fong; Tin, Vicky Pui-Chi

    2016-01-01

    Abstract Aims: Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been developed to treat non-small cell lung cancer (NSCLC) patients with EGFR mutation, but TKI resistance is common. Almost half of the acquired resistance patients are due to additional T790M mutation on EGFR (EGFRT790M), thus overcoming TKI resistance is important. In this study, we aim to investigate the role of reactive oxygen species (ROS) in TKI resistance as well as the molecular and biological effects of EGFRT790M after redox manipulation. Results: The basal ROS levels in EGFRT790M-containing TKI-resistant NSCLC cell lines were substantially high. Sixty-three human lung tumors showed higher NADPH oxidase isoform 2 (NOX2) expression than normal lung tissues, which may contribute to high basal ROS in cancer and poor survival. Interestingly, only NOX3 was upregulated by sanguinarine, a pharmacological agent to elevate ROS, and resulted in EGFR overoxidation, degradation, and apoptosis. By contrast, such responses were lacking in EGFRWT cells. Selective EGFRT790M degradation was manipulated by redox imbalance between NOX3 and methionine reductase A (MsrA). Furthermore, the in vivo tumor suppression effect of sanguinarine, NOX3 upregulation, and EGFR degradation were confirmed. Innovation: We have found a new treatment strategy to overcome TKI resistance by selectively inducing EGFRT790M degradation via specific stimulation of methionine 790 (M790) oxidation. It can be achieved via manipulating redox imbalance between NOX3 and MsrA. Conclusion: Targeting EGFR by elevating ROS and redox imbalance is a potential new strategy to develop a new EGFR inhibitor for TKI-resistant patients with a wide therapeutic window between EGFRT790M and EGFRWT. Antioxid. Redox Signal. 24, 263–279. PMID:26528827

  10. Lung Cancer: Glossary

    MedlinePlus

    ... used to fight cancer Chromosome: A strand of DNA and related proteins that carries the genes and ... structure, function and pathology ^ back to top D DNA (deoxyribonucleic acid): The part of the cell that ...

  11. Practical use of advanced mouse models for lung cancer.

    PubMed

    Safari, Roghaiyeh; Meuwissen, Ralph

    2015-01-01

    recombinase activity into pulmonary tissues, and we discuss here the different techniques underlying these applications. Concomitant with Cre/Flp recombinase-based models are the tetracycline (Tet)-inducible bitransgenic systems in which presence or absence of doxycycline can turn the expression of a specific oncogene on or off. The use of several Tet-inducible lung cancer models for NSCLC is presented here in which the reversal of oncogene expression led to complete tumor regression and provided us with important insight of how oncogene dependence influence lung cancer survival and growth. As alternative to Tet-inducible models, we discuss the application of reversible expressed, transgenic mutant estrogen receptor (ER) fusion proteins, which are regulated via systemic tamoxifen administration. Most of the various lung cancer models can be combined through the generation of transgenic compound mice so that the use of these somatic mouse models can be even more enhanced for the study of specific molecular pathways that facilitate growth and maintenance of lung cancer. Finally, this description of the practical application and methodology of mouse models for lung cancer should be helpful in assisting researchers to make the best choices and optimal use of (existing) somatic models that suits the specific experimental needs in their study of lung cancer.

  12. DNA-damaging imidazoacridinone C-1311 induces autophagy followed by irreversible growth arrest and senescence in human lung cancer cells.

    PubMed

    Polewska, Joanna; Skwarska, Anna; Augustin, Ewa; Konopa, Jerzy

    2013-09-01

    Imidazoacridinone 5-diethylaminoethylamino-8-hydroxyimidazoacridinone (C-1311) is an antitumor inhibitor of topoisomerase II and FMS-like tyrosine kinase 3 receptor. In this study, we describe the unique sequence of cellular responses to C-1311 in human non-small cell lung cancer (NSCLC) cell lines, A549 and H460. In A549 cells, C-1311 (IC80 = 0.08 µM) induced G1 and G2/M arrests, whereas H460 cells (IC80 = 0.051 µM) accumulated predominantly in the G1 phase. In both cell lines, cell cycle arrest was initiated by overexpression of p53 but was sustained for an extended time by elevated levels of p21. Despite prolonged drug exposure (up to 192 hours), no apoptotic response was detected in either cell line. Instead, cells developed a senescent phenotype and did not resume proliferation even after 2 weeks of post-treatment, indicating that C-1311-triggered senescence was permanent. When cell cycle arrest was evident but there were no signs of senescence, C-1311 significantly induced autophagic cells. Pharmacological inhibition of autophagy by 3-methyladenine profoundly reduced the senescent phenotype and slightly sensitized cancer cells to C-1311 by increasing cell death, suggesting a link between both autophagy and senescence. However, a small interfering RNA-mediated knockdown of the autophagy-associated Beclin 1 and ATG5 genes attenuated but failed to block development of senescence. Taken together, our studies suggest that in NSCLC, a C-1311-induced senescence program is preceded and corroborated but not exclusively determined by the induction of autophagy.

  13. Treatment Options by Stage (Small Cell Lung Cancer)

    MedlinePlus

    ... Cancer Prevention Lung Cancer Screening Research Small Cell Lung Cancer Treatment (PDQ®)–Patient Version General Information About Small Cell Lung Cancer Go to Health Professional Version Key Points ...

  14. Clinical and experimental pathology of lung cancer

    SciTech Connect

    McVie, J.G.; Bakker, W.; Wagenaar, S.C.; Carney, D.

    1986-01-01

    This book contains 17 selections. Some of the titles are: Flow cytometric DNA analysis in the study of small cell carcinoma of the lung; Mechanisms of oncogenesis; Adhesion mechanisms in liver metastasis; Current concepts in the therapy of small cell lung cancer; Application of monoclonal antibodies in imaging and therapy; and Clinical applications of the biologic properties of small cell lung cancer.

  15. Lung cancer screening and management.

    PubMed

    Jones, G S; Baldwin, D R

    2015-12-01

    Deaths from lung cancer are greater than for any other type of malignancy. Many people present with advanced stage cancer at diagnosis and survival is limited. Low radiation dose CT (LDCT) screening appears to offer part of the solution to this. The US National Lung Screening Trial (NLST) showed a 20% reduction in cancer related mortality and a 6.7% reduction in all cause mortality in patients who had LDCT compared to chest X-ray. Lung Cancer screening is now being implemented in the US using the NLST screening criteria but many questions remain about the details of the methodology of screening and its cost effectiveness. Many of these questions are being answered by ongoing European trials that are reporting their findings. In this review we objectively analyse current research evidence and explore the issues that need to be resolved before implementation, including technical considerations, selection criteria and effective nodule management protocols. We discuss the potential barriers that will be faced when beginning a national screening programme and possible solutions to them.

  16. Pleural involvement in lung cancer.

    PubMed

    Agalioti, Theodora; Giannou, Anastasios D; Stathopoulos, Georgios T

    2015-06-01

    The pleural space, a sterile secluded environment in the thoracic cavity, represents an attractive metastatic site for various cancers of lung, breast and gastrointestinal origins. Whereas lung and breast adenocarcinomas could invade the pleural space because of their anatomic proximity, "distant" cancers like ovarian or gastrointestinal tract adenocarcinomas may employ more active mechanisms to the same end. A pleural metastasis is often accompanied by a malignant pleural effusion (MPE), an unfavorable complication that severely restricts the quality of life and expectancy of the cancer patient. MPE is the net "product" of three different processes, namely inflammation, enhanced angiogenesis and vascular leakage. Current efforts are focusing on the identification of cancer cell autocrine (specific mutation spectra and biochemical pathways) and paracrine (cytokine and chemokine signals) characteristics as well as host features (immunological or other) that underlie the MPE phenotype. Herein we examine the pleural histology, cytology and molecular characteristics that make the pleural cavity an attractive metastasis destination for lung adenocarcinoma. Mesothelial and tumor features that may account for the tumor's ability to invade the pleural space are highlighted. Finally, possible therapeutic interventions specifically targeting MPE are discussed.

  17. Pleural involvement in lung cancer

    PubMed Central

    Giannou, Anastasios D.; Stathopoulos, Georgios T.

    2015-01-01

    The pleural space, a sterile secluded environment in the thoracic cavity, represents an attractive metastatic site for various cancers of lung, breast and gastrointestinal origins. Whereas lung and breast adenocarcinomas could invade the pleural space because of their anatomic proximity, “distant” cancers like ovarian or gastrointestinal tract adenocarcinomas may employ more active mechanisms to the same end. A pleural metastasis is often accompanied by a malignant pleural effusion (MPE), an unfavorable complication that severely restricts the quality of life and expectancy of the cancer patient. MPE is the net “product” of three different processes, namely inflammation, enhanced angiogenesis and vascular leakage. Current efforts are focusing on the identification of cancer cell autocrine (specific mutation spectra and biochemical pathways) and paracrine (cytokine and chemokine signals) characteristics as well as host features (immunological or other) that underlie the MPE phenotype. Herein we examine the pleural histology, cytology and molecular characteristics that make the pleural cavity an attractive metastasis destination for lung adenocarcinoma. Mesothelial and tumor features that may account for the tumor’s ability to invade the pleural space are highlighted. Finally, possible therapeutic interventions specifically targeting MPE are discussed. PMID:26150915

  18. Overcoming resistance to first/second generation epidermal growth factor receptor tyrosine kinase inhibitors and ALK inhibitors in oncogene-addicted advanced non-small cell lung cancer

    PubMed Central

    Romanidou, Ourania; Landi, Lorenza; Cappuzzo, Federico; Califano, Raffaele

    2016-01-01

    Epidermal growth factor receptor (EGFR) activating mutations and anaplastic lymphoma kinase (ALK) gene rearrangement in advanced non-small cell lung cancer (NSCLC) represent the two oncogenic events with an impact on current clinical practice. EGFR tyrosine kinase inhibitors (TKIs) and crizotinib are the standard of care for the treatment of EGFR mutant and ALK gene rearranged advanced NSCLC patients. Unfortunately, despite initial clinical benefit, acquired resistance to EGFR-TKIs or crizotinib usually develops after an average of 10–12 months of treatment. The aim of this review is to describe the mechanisms of resistance to first/second generation EGFR-TKIs and crizotinib. In particular, we focus on strategies to overcome resistance due to secondary EGFR T790M mutation and mutations of the ALK domain. PMID:27239236

  19. Fyn mediates transforming growth factor-beta1-induced down-regulation of E-cadherin in human A549 lung cancer cells.

    PubMed

    Kim, An Na; Jeon, Woo-Kwang; Lim, Kyu-Hyoung; Lee, Hui-Young; Kim, Woo Jin; Kim, Byung-Chul

    2011-04-01

    Transforming growth factor-beta (TGF-β) signaling positively contributes to the regulation of tumor metastasis. However, the underlying molecular mechanisms are less well defined. We here show that Fyn, a member of Src family tyrosine kinases, plays a critical role in mediating TGF-β1-induced down-regulation of E-cadherin in human A549 lung cancer cells. Blockade of Fyn with siRNA knockdown or ligand-binding defective mutant significantly lowered the ability of TGF-β1 to repress E-cadherin expression. Furthermore, our results demonstrated that Fyn facilitates TGF-β1-mediated suppression of E-cadherin through p38 kinase-dependent induction of Snail. Collectively, our findings identify a Fyn-p38-Snail cascade as a new signaling pathway mediating oncogenic TGF-β function.

  20. Detection of epidermal growth factor receptor mutations in formalin fixed paraffin embedded biopsies in Malaysian non-small cell lung cancer patients

    PubMed Central

    2013-01-01

    Background Somatic mutations of the epidermal growth factor receptor (EGFR) are reportedly associated with various responses in non-small cell lung cancer (NSCLC) patients receiving the anti-EGFR agents. Detection of the mutation therefore plays an important role in therapeutic decision making. The aim of this study was to detect EGFR mutations in formalin fixed paraffin embedded (FFPE) samples using both Scorpion ARMS and high resolution melt (HRM) assay, and to compare the sensitivity of these methods. Results All of the mutations were found in adenocarcinoma, except one that was in squamous cell carcinoma. The mutation rate was 45.7% (221/484). Complex mutations were also observed, wherein 8 tumours carried 2 mutations and 1 tumour carried 3 mutations. Conclusions Both methods detected EGFR mutations in FFPE samples. HRM assays gave more EGFR positive results compared to Scorpion ARMS. PMID:23590575

  1. Detection of epidermal growth factor receptor mutations in formalin fixed paraffin embedded biopsies in Malaysian non-small cell lung cancer patients.

    PubMed

    Shi Yeen, Tiffany Ng; Pathmanathan, Rajadurai; Shiran, Mohd Sidik; Ahmad Zaid, Fattah Azman; Cheah, Yoke Kqueen

    2013-04-16

    Somatic mutations of the epidermal growth factor receptor (EGFR) are reportedly associated with various responses in non-small cell lung cancer (NSCLC) patients receiving the anti-EGFR agents. Detection of the mutation therefore plays an important role in therapeutic decision making. The aim of this study was to detect EGFR mutations in formalin fixed paraffin embedded (FFPE) samples using both Scorpion ARMS and high resolution melt (HRM) assay, and to compare the sensitivity of these methods. All of the mutations were found in adenocarcinoma, except one that was in squamous cell carcinoma. The mutation rate was 45.7% (221/484). Complex mutations were also observed, wherein 8 tumours carried 2 mutations and 1 tumour carried 3 mutations. Both methods detected EGFR mutations in FFPE samples. HRM assays gave more EGFR positive results compared to Scorpion ARMS.

  2. Lung carcinogenesis from chronic obstructive pulmonary disease: characteristics of lung cancer from COPD and contribution of signal transducers and lung stem cells in the inflammatory microenvironment.

    PubMed

    Sekine, Yasuo; Hata, Atsushi; Koh, Eitetsu; Hiroshima, Kenzo

    2014-07-01

    Chronic obstructive pulmonary disease (COPD) and lung cancer are closely related. The annual incidence of lung cancer arising from COPD has been reported to be 0.8-1.7 %. Treatment of lung cancer from COPD is very difficult due to low cardiopulmonary function, rapid tumor growth, and resistance to molecularly targeted therapies. Chronic inflammation caused by toxic gases can induce COPD and lung cancer. Carcinogenesis in the inflammatory microenvironment occurs during cycles of tissue injury and repair. Cellular damage can induce induction of necrotic cell death and loss of tissue integrity. Quiescent normal stem cells or differentiated progenitor cells are introduced to repair injured tissues. However, inflammatory mediators may promote the growth of bronchioalveolar stem cells, and activation of NF-κB and signal transducer and activator of transcription 3 (STAT3) play crucial roles in the development of lung cancer from COPD. Many of the protumorgenic effects of NF-κB and STAT3 activation in immune cells are mediated through paracrine signaling. NF-κB and STAT3 also contribute to epithelial-mesenchymal transition. To improve lung cancer treatment outcomes, lung cancer from COPD must be overcome. In this article, we review the characteristics of lung cancer from COPD and the mechanisms of carcinogenesis in the inflammatory microenvironment. We also propose the necessity of identifying the mechanisms underlying progression of COPD to lung cancer, and comment on the clinical implications with respect to lung cancer prevention, screening, and therapy.

  3. Chinese Herbal Medicine Fuzheng Kang-Ai Decoction Inhibited Lung Cancer Cell Growth through AMPKα-Mediated Induction and Interplay of IGFBP1 and FOXO3a

    PubMed Central

    Zheng, Fang; Wu, Jingjing; Li, Xiong; Tang, Qing; Yang, LiJun; Yang, Xiaobing; Wu, WanYin

    2016-01-01

    The aim of this study is to investigate the actions of Chinese herbal medicine, called “Fuzheng Kang-Ai” (FZKA for short) decoction, against non-small cell lung cancer (NSCLC) and its mechanisms in vitro and in vivo. We showed that the effect of FZKA decoction significantly inhibited growth of A549 and PC9 cells. Furthermore, FZKA increased phosphorylation of AMP-activated protein kinase alpha (AMPKα) and induced protein expression of insulin-like growth factor (IGF) binding protein 1 (IGFBP1) and forkhead homeobox type O3a (FOXO3a). The specific inhibitor of AMPKα (Compound C) blocked FZKA-induced protein expression of IGFBP1 and FOXO3a. Interestingly, silencing of IGFBP1 and FOXO3a overcame the inhibitory effect of FZKA on cell growth. Moreover, silencing of IGFBP1 attenuated the effect of FZKA decoction on FOXO3a expression, and exogenous expression of FOXO3a enhanced the FZKA-stimulated phosphorylation of AMPKα. Accordingly, FZKA inhibited the tumor growth in xenograft nude mice model. Collectively, our results show that FZKA decoction inhibits proliferation of NSCLC cells through activation of AMPKα, followed by induction of IGFBP1 and FOXO3a proteins. Exogenous expression of FOXO3a feedback enhances FZKA decoction-stimulated IGFBP1 expression and phosphorylation of AMPKα. The reciprocal interplay of IGFBP1 and FOXO3a contribute to the overall responses of FAKA decoction. PMID:27057199

  4. Cryotherapy in Treating Patients With Lung Cancer That Has Spread to the Other Lung or Parts of the Body

    ClinicalTrials.gov

    2017-01-17

    Advanced Malignant Mesothelioma; Extensive Stage Small Cell Lung Cancer; Lung Metastases; Recurrent Malignant Mesothelioma; Recurrent Non-small Cell Lung Cancer; Recurrent Small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer

  5. Bortezomib in Treating Patients With Stage IIIB or Stage IV Lung Cancer

    ClinicalTrials.gov

    2014-08-04

    Adenocarcinoma of the Lung; Bronchoalveolar Cell Lung Cancer; Non-small Cell Lung Cancer; Recurrent Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Non-small Cell Lung Cancer

  6. Mer or Axl receptor tyrosine kinase inhibition promotes apoptosis, blocks growth and enhances chemosensitivity of human non-small cell lung cancer.

    PubMed

    Linger, R M A; Cohen, R A; Cummings, C T; Sather, S; Migdall-Wilson, J; Middleton, D H G; Lu, X; Barón, A E; Franklin, W A; Merrick, D T; Jedlicka, P; DeRyckere, D; Heasley, L E; Graham, D K

    2013-07-18

    Non-small cell lung cancer (NSCLC) is a prevalent and devastating disease that claims more lives than breast, prostate, colon and pancreatic cancers combined. Current research suggests that standard chemotherapy regimens have been optimized to maximal efficiency. Promising new treatment strategies involve novel agents targeting molecular aberrations present in subsets of NSCLC. We evaluated 88 human NSCLC tumors of diverse histology and identified Mer and Axl as receptor tyrosine kinases (RTKs) overexpressed in 69% and 93%, respectively, of tumors relative to surrounding normal lung tissue. Mer and Axl were also frequently overexpressed and activated in NSCLC cell lines. Ligand-dependent Mer or Axl activation stimulated MAPK, AKT and FAK signaling pathways indicating roles for these RTKs in multiple oncogenic processes. In addition, we identified a novel pro-survival pathway-involving AKT, CREB, Bcl-xL, survivin, and Bcl-2-downstream of Mer, which is differentially modulated by Axl signaling. We demonstrated that short hairpin RNA (shRNA) knockdown of Mer or Axl significantly reduced NSCLC colony formation and growth of subcutaneous xenografts in nude mice. Mer or Axl knockdown also improved in vitro NSCLC sensitivity to chemotherapeutic agents by promoting apoptosis. When comparing the effects of Mer and Axl knockdown, Mer inhibition exhibited more complete blockade of tumor growth while Axl knockdown more robustly improved chemosensitivity. These results indicate that Mer and Axl have complementary and overlapping roles in NSCLC and suggest that treatment strategies targeting both RTKs may be more effective than singly-targeted agents. Our findings validate Mer and Axl as potential therapeutic targets in NSCLC and provide justification for development of novel therapeutic compounds that selectively inhibit Mer and/or Axl.

  7. Mer or Axl Receptor Tyrosine Kinase Inhibition Promotes Apoptosis, Blocks Growth, and Enhances Chemosensitivity of Human Non-Small Cell Lung Cancer

    PubMed Central

    Linger, Rachel M.A.; Cohen, Rebecca A.; Cummings, Christopher T.; Sather, Susan; Migdall-Wilson, Justine; Middleton, Deryck H.G.; Lu, Xian; Barón, Anna E.; Franklin, Wilbur A.; Merrick, Daniel T.; Jedlicka, Paul; DeRyckere, Deborah; Heasley, Lynn E.; Graham, Douglas K.

    2012-01-01

    Non-small cell lung cancer (NSCLC) is a prevalent and devastating disease that claims more lives than breast, prostate, colon, and pancreatic cancers combined. Current research suggests that standard chemotherapy regimens have been optimized to maximal efficiency. Promising new treatment strategies involve novel agents targeting molecular aberrations present in subsets of NSCLC. We evaluated 88 human NSCLC tumors of diverse histology and identified Mer and Axl as receptor tyrosine kinases (RTKs) overexpressed in 69% and 93%, respectively, of tumors relative to surrounding normal lung tissue. Mer and Axl were also frequently overexpressed and activated in NSCLC cell lines. Ligand-dependent Mer or Axl activation stimulated MAPK, AKT, and FAK signaling pathways indicating roles for these RTKs in multiple oncogenic processes. In addition, we identified a novel pro-survival pathway—involving AKT, CREB, Bcl-xL, survivin, and Bcl-2—downstream of Mer, which is differentially modulated by Axl signaling. We demonstrated that shRNA knockdown of Mer or Axl significantly reduced NSCLC colony formation and growth of subcutaneous xenografts in nude mice. Mer or Axl knockdown also improved in vitro NSCLC sensitivity to chemotherapeutic agents by promoting apoptosis. When comparing the effects of Mer and Axl knockdown, Mer inhibition exhibited more complete blockade of tumor growth while Axl knockdown more robustly improved chemosensitivity. These results indicate that Mer and Axl play complementary and overlapping roles in NSCLC and suggest that treatment strategies targeting both RTKs may be more effective than singly-targeted agents. Our findings validate Mer and Axl as potential therapeutic targets in NSCLC and provide justification for development of novel therapeutic compounds that selectively inhibit Mer and/or Axl. PMID:22890323

  8. Lung cancer: biology and treatment options

    PubMed Central

    Hassan, Omer; Yang, Yi-Wei; Buchanan, Petra

    2015-01-01

    Lung cancer remains the leading cause of cancer mortality in men and women in the U.S. and worldwide. About 90% of lung cancer cases are caused by smoking and the use of tobacco products. However, other factors such as radon gas, asbestos, air pollution exposures, and chronic infections can contribute to lung carcinogenesis. In addition, multiple inherited and acquired mechanisms of susceptibility to lung cancer have been proposed. Lung cancer is divided into two broad histologic classes, which grow and spread differently: small-cell lung carcinomas (SCLC) and non-small cell lung carcinomas (NSCLC). Treatment options for lung cancer include surgery, radiation therapy, chemotherapy, and targeted therapy. Therapeutic-modalities recommendations depend on several factors, including the type and stage of cancer. Despite the improvements in diagnosis and therapy made during the past 25 years, the prognosis for patients with lung cancer is still unsatisfactory. The responses to current standard therapies are poor except for the most localized cancers. However, a better understanding of the biology pertinent to these challenging malignancies, might lead to the development of more efficacious and perhaps more specific drugs. The purpose of this review is to summarize the recent developments in lung cancer biology and its therapeutic strategies, and discuss the latest treatment advances including therapies currently under clinical investigation. PMID:26297204

  9. Lung cancer: Biology and treatment options.

    PubMed

    Lemjabbar-Alaoui, Hassan; Hassan, Omer Ui; Yang, Yi-Wei; Buchanan, Petra

    2015-12-01

    Lung cancer remains the leading cause of cancer mortality in men and women in the U.S. and worldwide. About 90% of lung cancer cases are caused by smoking and the use of tobacco products. However, other factors such as radon gas, asbestos, air pollution exposures, and chronic infections can contribute to lung carcinogenesis. In addition, multiple inherited and acquired mechanisms of susceptibility to lung cancer have been proposed. Lung cancer is divided into two broad histologic classes, which grow and spread differently: small-cell lung carcinomas (SCLCs) and non-small cell lung carcinomas (NSCLCs). Treatment options for lung cancer include surgery, radiation therapy, chemotherapy, and targeted therapy. Therapeutic-modalities recommendations depend on several factors, including the type and stage of cancer. Despite the improvements in diagnosis and therapy made during the past 25 years, the prognosis for patients with lung cancer is still unsatisfactory. The responses to current standard therapies are poor except for the most localized cancers. However, a better understanding of the biology pertinent to these challenging malignancies, might lead to the development of more efficacious and perhaps more specific drugs. The purpose of this review is to summarize the recent developments in lung cancer biology and its therapeutic strategies, and discuss the latest treatment advances including therapies currently under clinical investigation.

  10. Multifaceted roles of cyclooxygenase-2 in lung cancer.

    PubMed

    Riedl, Karen; Krysan, Kostyantyn; Põld, Mehis; Dalwadi, Harnisha; Heuze-Vourc'h, Nathalie; Dohadwala, Mariam; Liu, Ming; Cui, Xiaoyan; Figlin, Robert; Mao, Jenny T; Strieter, Robert; Sharma, Sherven; Dubinett, Steven M

    2004-06-01

    Lung cancer is the leading cause of cancer death in the United States. Although the low 5-year survival rate (under 15%) has changed minimally in the last 25 years, new agents and combinations of agents that target tumor proliferation, invasion, and survival may lead to improvement in patient outcomes. There is evidence that cyclooxygenase-2 (COX-2) is overexpressed in lung cancer and promotes tumor proliferation, invasion, angiogenesis, and resistance to apoptosis. COX-2 inhibitors have been found to inhibit tumor growth in animal models and have demonstrated responses when combined with conventional therapy in phase II clinical trials. Further understanding of the mechanisms involved in COX-2-mediated tumorigenesis and its interaction with other molecules in lung cancer may lead to improved therapeutic strategies for this disease. In addition, delineation of how COX-2-dependent genes modulate the malignant phenotype will provide novel insights in lung cancer pathogenesis.

  11. KLF4 regulates adult lung tumor-initiating cells and represses K-Ras-mediated lung cancer.

    PubMed

    Yu, T; Chen, X; Zhang, W; Liu, J; Avdiushko, R; Napier, D L; Liu, A X; Neltner, J M; Wang, C; Cohen, D; Liu, C

    2016-02-01

    Lung cancer is the leading cause of cancer-related mortality in both men and women worldwide. To identify novel factors that contribute to lung cancer pathogenesis, we analyzed a lung cancer database from The Cancer Genome Atlas and found that Krüppel-like Factor 4 (KLF4) expression is significantly lower in patients' lung cancer tissue than in normal lung tissue. In addition, we identified seven missense mutations in the KLF4 gene. KLF4 is a transcription factor that regulates cell proliferation and differentiation as well as the self-renewal of stem cells. To understand the role of KLF4 in the lung, we generated a tamoxifen-induced Klf4 knockout mouse model. We found that KLF4 inhibits lung cancer cell growth and that depletion of Klf4 altered the differentiation pattern in the developing lung. To understand how KLF4 functions during lung tumorigenesis, we generated the K-ras(LSL-G12D/+);Klf4(fl/fl) mouse model, and we used adenovirus-expressed Cre to induce K-ras activation and Klf4 depletion in the lung. Although Klf4 deletion alone or K-ras mutation alone can trigger lung tumor formation, Klf4 deletion combined with K-ras mutation significantly enhanced lung tumor formation. We also found that Klf4 deletion in conjunction with K-ras activation caused lung inflammation. To understand the mechanism whereby KLF4 is regulated during lung tumorigenesis, we analyzed KLF4 promoter methylation and the profiles of epigenetic factors. We found that Class I histone deacetylases (HDACs) are overexpressed in lung cancer and that HDAC inhibitors induced expression of KLF4 and inhibited proliferation of lung cancer cells, suggesting that KLF4 is probably repressed by histone acetylation and that HDACs are valuable drug targets for lung cancer treatment.

  12. The HLJ1-targeting drug screening identified Chinese herb andrographolide that can suppress tumour growth and invasion in non-small-cell lung cancer.

    PubMed

    Lai, Yi-Hua; Yu, Sung-Liang; Chen, Hsuan-Yu; Wang, Chi-Chung; Chen, Huei-Wen; Chen, Jeremy J W

    2013-05-01

    HLJ1 is a novel tumour suppressor and is a potential druggable target for non-small-cell lung cancer (NSCLC). In this report, using a promoter-containing enhancer region as the HLJ1-targeting drug-screening platform, we identified several herbal compounds from a Chinese herbal bank with the capacity to enhance HLJ1 promoter activity and suppress tumour growth and invasion of NSCLC. Among the herbal drugs identified, the andrographolide (from Andrographis paniculata [Burm. f.] Nees.) most significantly induced HLJ1 expression and suppressed tumorigenesis both in vitro and in vivo. The andrographolide upregulates HLJ1 via JunB activation, which modulates AP-2α binding at the MMP-2 promoter and represses the expression of MMP-2. In addition, silencing of HLJ1 partially reverses the inhibition of cancer-cell invasion by andrographolide. Microarray transcriptomic analysis was performed to comprehensively depict the andrographolide-regulated signalling pathways. We showed that andrographolide can affect 939 genes (analysis of variance, false discovery rate < 0.05) that are dominantly involved in the cell cycle, apoptosis and adhesion-related biological signalling, including mitogen-activated protein kinase, focal adhesion and tight junction pathways, indicating the diverse effects of andrographolide on anticancer invasion and proliferation. In conclusion, the HLJ1-targeting drug-screening platform is useful for screening of novel anticancer compounds. Using this platform, we identified andrographolide is a promising new anticancer agent that could suppress tumour growth and invasion in NSCLC.

  13. Lung cancer stem cells—characteristics, phenotype

    PubMed Central

    George, Rachel; Sethi, Tariq

    2016-01-01

    Lung cancer remains a major cause of cancer-related deaths worldwide with unfavourable prognosis mainly due to the late stage of disease at presentation. High incidence and disease recurrence rates are a fact despite advances in treatment. Ongoing experimental and clinical observations suggest that the malignant phenotype in lung cancer is sustained by lung cancer stem cells (CSCs) which are putative stem cells situated throughout the airways that have the potential of initiating lung cancer formation. These cells share the common characteristic of increased proliferation and differentiation, long life span and resistance to chemotherapy and radiation therapy. This review summarises the current knowledge on their characteristics and phenotype. PMID:27413709

  14. Adaptive Radiation for Lung Cancer

    PubMed Central

    Gomez, Daniel R.; Chang, Joe Y.

    2011-01-01

    The challenges of lung cancer radiotherapy are intra/inter-fraction tumor/organ anatomy/motion changes and the need to spare surrounding critical structures. Evolving radiotherapy technologies, such as four-dimensional (4D) image-based motion management, daily on-board imaging and adaptive radiotherapy based on volumetric images over the course of radiotherapy, have enabled us to deliver higher dose to target while minimizing normal tissue toxicities. The image-guided radiotherapy adapted to changes of motion and anatomy has made the radiotherapy more precise and allowed ablative dose delivered to the target using novel treatment approaches such as intensity-modulated radiation therapy, stereotactic body radiation therapy, and proton therapy in lung cancer, techniques used to be considered very sensitive to motion change. Future clinical trials using real time tracking and biological adaptive radiotherapy based on functional images are proposed. PMID:20814539

  15. [Cannabis smoking and lung cancer].

    PubMed

    Underner, M; Urban, T; Perriot, J; de Chazeron, I; Meurice, J-C

    2014-06-01

    Cannabis is the most commonly smoked illicit substance in the world. It can be smoked alone in plant form (marijuana) but it is mainly smoked mixed with tobacco. The combined smoking of cannabis and tobacco is a common-place phenomenon in our society. However, its use is responsible for severe pulmonary consequences. The specific impact of smoking cannabis is difficult to assess precisely and to distinguish from the effect of tobacco. Marijuana smoke contains polycyclic aromatic hydrocarbons and carcinogens at higher concentration than tobacco smoke. Cellular, tissue, animal and human studies, and also epidemiological studies, show that marijuana smoke is a risk factor for lung cancer. Cannabis exposure doubles the risk of developing lung cancer. This should encourage clinicians to identify cannabis use and to offer patients support in quitting.

  16. FOXP4 modulates tumor growth and independently associates with miR-138 in non-small cell lung cancer cells.

    PubMed

    Yang, Tian; Li, Hong; Thakur, Asmitananda; Chen, Tianjun; Xue, Jing; Li, Dan; Chen, Mingwei

    2015-09-01

    Family of forkhead box transcription factors, including forkhead box P4 (FOXP4), plays an important role in oncogenesis. The current study is to evaluate the role of FOXP4 in regulating human non-small cell lung cancer (NSCLC). Quantitative RT-PCR and Western blot were performed to evaluate the gene and protein expressions of FOXP4 in six NSCLC cell lines and 55 NSCLC patients. Lentivirus of small hairpin RNA (FOXP4-shRNA) was used to downregulate FOXP4 in NSCLC cell lines A549 and H1703 cells. Its effect on NSCLC growth, invasion, and cell cycle were evaluated by cell proliferation assay, migration assay, and cell cycle assay, respectively. Dual luciferase assay and Western blot were used to examine whether microRNA-138 (miR-138) was an upstream regulator of FOXP4. The dependence of FOXP4 on miR-138 associated signaling pathway was evaluated by ectopically overexpressing enhancer of zeste homolog 2 (EZH2), a known miR-138 target in NSCLC. FOXP4 was highly expressed in both NSCLC cell lines and NSCLC patients. FOXP4 downregulation by FOXP4-shRNA markedly reduced cancer cell growth and invasion, as well as induced cell cycle arrest in A549 and H1703 cells. MiR-138 was confirmed to be an upstream regulator of FOXP4 and directly regulated FOXP4 expression in A549 and H1703 cells. FOXP4 downregulation-mediated inhibition on cancer cell growth and invasion was independent on overexpressing EZH2, another direct target of miR-138 in NSCLC. Our data demonstrated that FOXP4 was a critical regulator in NSCLC and independently associated with miR-138 regulation.

  17. Lung Cancer Awareness Week

    ERIC Educational Resources Information Center

    Glennon, Catherine; Laczko, Lori

    2003-01-01

    Smoking is the most preventable cause of death in our society. Tobacco use is responsible for nearly one in five deaths in the United States and the cause of premature death of approximately 2 million individuals in developed countries. Smoking accounts for at least 30% of all cancer deaths and is a major cause of heart disease, cerebrovascular…

  18. Lung Cancer Awareness Week

    ERIC Educational Resources Information Center

    Glennon, Catherine; Laczko, Lori

    2003-01-01

    Smoking is the most preventable cause of death in our society. Tobacco use is responsible for nearly one in five deaths in the United States and the cause of premature death of approximately 2 million individuals in developed countries. Smoking accounts for at least 30% of all cancer deaths and is a major cause of heart disease, cerebrovascular…

  19. Vaccine Therapy and Sargramostim With or Without Docetaxel in Treating Patients With Metastatic Lung Cancer or Metastatic Colorectal Cancer

    ClinicalTrials.gov

    2014-03-28

    Extensive Stage Small Cell Lung Cancer; Recurrent Colon Cancer; Recurrent Non-small Cell Lung Cancer; Recurrent Rectal Cancer; Recurrent Small Cell Lung Cancer; Stage IV Colon Cancer; Stage IV Non-small Cell Lung Cancer; Stage IV Rectal Cancer

  20. Mad2 Checkpoint Gene Silencing Using Epidermal Growth Factor Receptor-Targeted Chitosan Nanoparticles in Non-Small Cell Lung Cancer Model

    PubMed Central

    2015-01-01

    RNA interference has emerged as a powerful strategy in cancer therapy because it allows silencing of specific genes associated with tumor progression and resistance. Mad2 is an essential mitotic checkpoint component required for accurate chromosome segregation during mitosis, and its complete abolition leads to cell death. We have developed an epidermal growth factor receptor (EGFR)-targeted chitosan system for silencing the Mad2 gene as a strategy to efficiently induce cell death in EGFR overexpressing human A549 non-small cell lung cancer cells. Control and EGFR-targeted chitosan nanoparticles loaded with small interfering RNAs (siRNAs) against Mad2 were formulated and characterized for size, charge, morphology, and encapsulation efficiency. Qualitative and quantitative intracellular uptake studies by confocal imaging and flow cytometry, respectively, showed time-dependent enhanced and selective intracellular internalization of EGFR-targeted nanoparticles compared to nontargeted system. Targeted nanoparticles showed nearly complete depletion of Mad2 expression in A549 cells contrasting with the partial depletion in the nontargeted system. Accordingly, Mad2-silencing-induced apoptotic cell death was confirmed by cytotoxicity assay and flow cytometry. Our results demonstrate that EGFR-targeted chitosan loaded with Mad2 siRNAs is a potent delivery system for selective killing of cancer cells. PMID:25256346

  1. Blockade of Hedgehog Signaling Synergistically Increases Sensitivity to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-Small-Cell Lung Cancer Cell Lines

    PubMed Central

    Bai, Xiao-Yan; Zhang, Xu-Chao; Yang, Su-Qing; An, She-Juan; Chen, Zhi-Hong; Su, Jian; Xie, Zhi; Gou, Lan-Ying; Wu, Yi-Long

    2016-01-01

    Aberrant activation of the hedgehog (Hh) signaling pathway has been implicated in the epithelial-to-mesenchymal transition (EMT) and cancer stem-like cell (CSC) maintenance; both processes can result in tumor progression and treatment resistance in several types of human cancer. Hh cooperates with the epidermal growth factor receptor (EGFR) signaling pathway in embryogenesis. We found that the Hh signaling pathway was silenced in EGFR-TKI-sensitive non-small-cell lung cancer (NSCLC) cells, while it was inappropriately activated in EGFR-TKI-resistant NSCLC cells, accompanied by EMT induction and ABCG2 overexpression. Upregulation of Hh signaling through extrinsic SHH exposure downregulated E-cadherin expression and elevated Snail and ABCG2 expression, resulting in gefitinib tolerance (P < 0.001) in EGFR-TKI-sensitive cells. Blockade of the Hh signaling pathway using the SMO antagonist SANT-1 restored E-cadherin expression and downregulate Snail and ABCG2 in EGFR-TKI-resistant cells. A combination of SANT-1 and gefitinib markedly inhibited tumorigenesis and proliferation in EGFR-TKI-resistant cells (P < 0.001). These findings indicate that hyperactivity of Hh signaling resulted in EGFR-TKI resistance, by EMT introduction and ABCG2 upregulation, and blockade of Hh signaling synergistically increased sensitivity to EGFR-TKIs in primary and secondary resistant NSCLC cells. E-cadherin expression may be a potential biomarker of the suitability of the combined application of an Hh inhibitor and EGFR-TKIs in EGFR-TKI-resistant NSCLCs. PMID:26943330

  2. The β-TrCP-FBXW2-SKP2 axis regulates lung cancer cell growth with FBXW2 acting as a tumour suppressor

    PubMed Central

    Xu, Jie; Zhou, Weihua; Yang, Fei; Chen, Guoan; Li, Haomin; Zhao, Yongchao; Liu, Pengyuan; Li, Hua; Tan, Mingjia; Xiong, Xiufang; Sun, Yi

    2017-01-01

    β-TrCP and SKP2 are two well-studied F-box proteins, which often act as oncogenes. Whether and how they communicate with each other is unknown. Here we report that FBXW2, a poorly characterized F-box, is a substrate of β-TrCP1 and an E3 ligase for SKP2. While β-TrCP1 promotes FBXW2 ubiquitylation and shortens its half-life, FBXW2 does the same to SKP2. FBXW2 has tumour suppressor activity against lung cancer cells and blocks oncogenic function of both β-TrCP1 and SKP2. The levels of β-TrCP1-FBXW2-SKP2 are inversely correlated during cell cycle with FBXW2 and β-TrCP/SKP2 being high or low, respectively, in arrested cells, whereas the opposite is true in proliferating cells. Consistently, FBXW2 predicts a better patient survival, whereas β-TrCP1 and SKP2 predict a worse survival. Finally, the gain- and loss-of-function mutations of FBXW2 are found in various human cancers. Collectively, our data show that the β-TrCP-FBXW2-SKP2 axis forms an oncogene-tumour suppressor-oncogene cascade to control cancer cell growth with FBXW2 acting as a tumour suppressor by promoting SKP2 degradation. PMID:28090088

  3. LUCIS: lung cancer imaging studies.

    PubMed

    Harders, Stefan Walbom

    2012-11-01

    Pulmonary nodules are of high clinical importance, as they may prove to be an early manifestation of lung cancer. Pulmonary nodules are small, focal opacities that may be solitary or multiple. A solitary pulmonary nodule (SPN) is a single, small (= 30 mm in diameter) radiographic opacity. Larger opacities are called masses and are often malignant. As imaging techniques improve and more nodules are detected, the optimal management of SPNs remains unclear. Current strategies include tissue sampling or CT follow-up. The aim of this PhD was to examine current non-invasive methods used to characterise pulmonary nodules and masses in patients with suspected lung cancer and to stage NSCLC. In doing so, this PhD helps to validate the existing methods used to diagnose and stage lung cancer correctly and, hopefully, aids in the development of new methods. In the first study, 213 participants with pulmonary nodules on CT were examined with an additional HRCT. In this study, it was concluded that HRCT of a solitary pulmonary nodule, assessed using attenuation and morphological criteria is a fast, widely available and effective method for diagnosing lung cancer correctly, and especially for ruling out cancer. In the second study, 168 patients with pulmonary lesions on CT were examined with an additional F-18-FDG PET/CT. It was concluded that when used early in the work-up of the lesions, CT raised the prevalence of lung cancer in the population to the point at which further diagnostic imaging examination could be considered redundant. Standard contrast-enhanced CT seems better suited to identify patients with lung cancer than to rule out cancer. Finally, the overall diagnostic accuracy as well as the classification probabilities and predictive values of the two modalities were not significantly different. The reproducibility of the above results was substantial. In the third study, 59 patients with pulmonary nodules or masses on chest radiography were examined with an

  4. Downregulation of miR-497 promotes tumor growth and angiogenesis by targeting HDGF in non-small cell lung cancer

    SciTech Connect

    Zhao, Wen-yan; Wang, Yan; An, Zhong-jun; Shi, Chang-guo; Zhu, Guang-ai; Wang, Bin; Lu, Ming-yan; Pan, Chang-kun; Chen, Peng

    2013-06-07

    Highlights: •MiR-497 is down-regulated in NSCLC cells and tissues. •MiR-497 inhibits NSCLC cell growth in vitro. •HDGF is a target gene of miR-497. •MiR-497 inhibits NSCLC cell growth by downregulating HDGF. •miR-497 inhibits tumor growth and angiogenesis in vivo. -- Abstract: MicroRNAs (miRNAs) play important roles in the development of various cancers. MiRNA-497 functions as a tumor-suppressor that is downregulated in several malignancies; however, its role in non-small cell lung cancer (NSCLC) has not been examined in detail. Here, we showed that miR-497 is downregulated in NSCLC tumors and cell lines and its ectopic expression significantly inhibits cell proliferation and colony formation. Integrated analysis identified HDGF as a downstream target of miR-497, and the downregulation of HDGF by miR-497 overexpression confirmed their association. Rescue experiments showed that the inhibitory effect of miR-497 on cell proliferation and colony formation is predominantly mediated by the modulation of HDGF levels. Furthermore, tumor samples from NSCLC patients showed an inverse relationship between miR-497 and HDGF levels, and ectopic expression of miR-497 significantly inhibited tumor growth and angiogenesis in a SCID mouse xenograft model. Our results suggest that miR-497 may serve as a biomarker in NSCLC, and the modulation of its activity may represent a novel therapeutic strategy for the treatment of NSCLC patients.

  5. Lung Cancer and Interstitial Lung Diseases: A Systematic Review

    PubMed Central

    Archontogeorgis, Kostas; Steiropoulos, Paschalis; Tzouvelekis, Argyris; Nena, Evangelia; Bouros, Demosthenes

    2012-01-01

    Interstitial lung diseases (ILDs) represent a heterogeneous group of more than two hundred diseases of either known or unknown etiology with different pathogenesis and prognosis. Lung cancer, which is the major cause of cancer death in the developed countries, is mainly attributed to cigarette smoking and exposure to inhaled carcinogens. Different studies suggest a link between ILDs and lung cancer, through different pathogenetic mechanisms, such as inflammation, coagulation, dysregulated apoptosis, focal hypoxia, activation, and accumulation of myofibroblasts as well as extracellular matrix accumulation. This paper reviews current evidence on the association between lung cancer and interstitial lung diseases such as idiopathic pulmonary fibrosis, sarcoidosis, systemic sclerosis, dermatomyositis/polymyositis, rheumatoid arthritis, systemic lupus erythematosus, and pneumoconiosis. PMID:22900168

  6. Hyperspectral imaging of skin and lung cancers

    NASA Astrophysics Data System (ADS)

    Zherdeva, Larisa A.; Bratchenko, Ivan A.; Alonova, Marina V.; Myakinin, Oleg O.; Artemyev, Dmitry N.; Moryatov, Alexander A.; Kozlov, Sergey V.; Zakharov, Valery P.

    2016-04-01

    The problem of cancer control requires design of new approaches for instrumental diagnostics, as the accuracy of cancer detection on the first step of diagnostics in clinics is slightly more than 50%. In this study, we present a method of visualization and diagnostics of skin and lung tumours based on registration and processing of tissues hyperspectral images. In a series of experiments registration of hyperspectral images of skin and lung tissue samples is carried out. Melanoma, basal cell carcinoma, nevi and benign tumours are studied in skin ex vivo and in vivo experiments; adenocarcinomas and squamous cell carcinomas are studied in ex vivo lung experiments. In a series of experiments the typical features of diffuse reflection spectra for pathological and normal tissues were found. Changes in tissues morphology during the tumour growth lead to the changes of blood and pigments concentration, such as melanin in skin. That is why tumours and normal tissues maybe differentiated with information about spectral response in 500-600 nm and 600 - 670 nm areas. Thus, hyperspectral imaging in the visible region may be a useful tool for cancer detection as it helps to estimate spectral properties of tissues and determine malignant regions for precise resection of tumours.

  7. Signaling pathways modulating dependence of lung cancer on mutant epidermal growth factor receptor and mechanisms of intrinsic and acquired resistance to tyrosine kinase inhibitors.

    PubMed

    Wannesson, Luciano; Viteri, Santiago; Costa, Carlota; Karachaliou, Niki; Molina-Vila, Miguel Angel; Rosell, Rafael

    2014-01-01

    A new era in lung cancer targeted therapy arrived with the discovery of a subset of lung adenocarcinomas harboring activating mutations of the epidermal growth factor receptor (EGFR), whose tyrosine kinase activity can be selectively blocked by small molecule pharmaceuticals referred as tyrosine kinase inhibitors (TKIs). This was the starting point for a less toxic and more effective treatment strategy for a disease that has historically presented as chemorefractory and highly lethal. In spite of this progress, only 80% of the patients treated with this class of compounds will obtain a clinical benefit, of variable magnitude and duration, with remaining patients being primarily refractory to the treatment. Moreover, responding tumors will eventually develop acquired resistance to TKIs and progress to more advanced stages. In this review we summarize the current knowledge with regard to the mechanisms leading to tumor regression and the modifiers of this primary response that determine significant variability in sensitivity of tumors harboring EGFR activating mutations, ranging from complete remission to primary refractoriness. We also analyze the mechanisms of secondary resistance and the strategies the scientific community is exploring in order to overcome these barriers.

  8. Antisense oligonucleotide targeting eukaryotic translation initiation factor 4E reduces growth and enhances chemosensitivity of non-small-cell lung cancer cells.

    PubMed

    Thumma, S C; Jacobson, B A; Patel, M R; Konicek, B W; Franklin, M J; Jay-Dixon, J; Sadiq, A; De, A; Graff, J R; Kratzke, R A

    2015-08-01

    Elevated levels of eukaryotic translation initiation factor 4E (eIF4E) enhance translation of many malignancy-related proteins, such as vascular endothelial growth factor (VEGF), c-Myc and osteopontin. In non-small-cell lung cancer (NSCLC), levels of eIF4E are significantly increased compared with normal lung tissue. Here, we used an antisense oligonucleotide (ASO) to inhibit the expression of eIF4E in NSCLC cell lines. eIF4E levels were significantly reduced in a dose-dependent manner in NSCLC cells treated with eIF4E-specific ASO (4EASO) compared with control ASO. Treatment of NSCLC cells with the 4EASO resulted in decreased cap-dependent complex formation, decreased cell proliferation and increased sensitivity to gemcitabine. At the molecular level, repression of eIF4E with ASO resulted in decreased expression of the oncogenic proteins VEGF, c-Myc and osteopontin, whereas expression of β-actin was unaffected. Based on these findings, we conclude that eIF4E-silencing therapy alone or in conjunction with chemotherapy represents a promising approach deserving of further investigation in future NSCLC clinical trials.

  9. A translational view of the molecular pathogenesis of lung cancer.

    PubMed

    Sato, Mitsuo; Shames, David S; Gazdar, Adi F; Minna, John D

    2007-04-01

    Molecular genetic studies of lung cancer have revealed that clinically evident lung cancers have multiple genetic and epigenetic abnormalities, including DNA sequence alterations, copy number changes, and aberrant promoter hypermethylation. Together, these abnormalities result in the activation of oncogenes and inactivation of tumor-suppressor genes. In many cases these abnormalities can be found in premalignant lesions and in histologically normal lung bronchial epithelial cells. Findings suggest that lung cancer develops through a stepwise process from normal lung epithelial cells towards frank malignancy, which usually occurs as a result of cigarette smoking. Lung cancer has a high morbidity because it is difficult to detect early and is frequently resistant to available chemotherapy and radiotherapy. New, rationally designed early detection, chemoprevention, and therapeutic strategies based on the growing understanding of the molecular changes important to lung cancer are under investigation. For example, methylated tumor DNA sequences in sputum or blood are being investigated for early detection screening, and new treatments that specifically target molecules such as vascular endothelial growth factor and the epidermal growth factor receptor are becoming available. Meanwhile, global gene expression signatures from individual tumors are showing potential as prognostic and therapeutic indicators, such that molecular typing of individual tumors for therapy selection is not far away. Finally, the recent development of a model system of immortalized human bronchial epithelial cells, along with a paradigm shift in the conception of cancer stem cells, promises to improve the situation for patients with lung cancer. These advances highlight the translation of molecular discoveries on lung cancer pathogenesis from the laboratory to the clinic.

  10. Isoliquiritigenin Induces Apoptosis and Inhibits Xenograft Tumor Growth of Human Lung Cancer Cells by Targeting Both Wild Type and L858R/T790M Mutant EGFR*

    PubMed Central

    Jung, Sung Keun; Lee, Mee-Hyun; Lim, Do Young; Kim, Jong Eun; Singh, Puja; Lee, Sung-Young; Jeong, Chul-Ho; Lim, Tae-Gyu; Chen, Hanyong; Chi, Young-In; Kundu, Joydeb Kumar; Lee, Nam Hyouck; Lee, Charles C.; Cho, Yong-Yeon; Bode, Ann M.; Lee, Ki Won; Dong, Zigang

    2014-01-01

    Non-small-cell lung cancer (NSCLC) is associated with diverse genetic alterations including mutation of epidermal growth factor receptor (EGFR). Isoliquiritigenin (ILQ), a chalcone derivative, possesses anticancer activities. In the present study, we investigated the effects of ILQ on the growth of tyrosine kinase inhibitor (TKI)-sensitive and -resistant NSCLC cells and elucidated its underlying mechanisms. Treatment with ILQ inhibited growth and induced apoptosis in both TKI-sensitive and -resistant NSCLC cells. ILQ-induced apoptosis was associated with the cleavage of caspase-3 and poly-(ADP-ribose)-polymerase, increased expression of Bim, and reduced expression of Bcl-2. In vitro kinase assay results revealed that ILQ inhibited the catalytic activity of both wild type and double mutant (L858R/T790M) EGFR. Treatment with ILQ inhibited the anchorage-independent growth of NIH3T3 cells stably transfected with either wild type or double-mutant EGFR with or without EGF stimulation. ILQ also reduced the phosphorylation of Akt and ERK1/2 in both TKI-sensitive and -resistant NSCLC cells, and attenuated the kinase activity of Akt1 and ERK2 in vitro. ILQ directly interacted with both wild type and double-mutant EGFR in an ATP-competitive manner. A docking model study showed that ILQ formed two hydrogen bonds (Glu-762 and Met-793) with wild type EGFR and three hydrogen bonds (Lys-745, Met-793, and Asp-855) with mutant EGFR. ILQ attenuated the xenograft tumor growth of H1975 cells, which was associated with decreased expression of Ki-67 and diminished phosphorylation of Akt and ERK1/2. Taken together, ILQ suppresses NSCLC cell growth by directly targeting wild type or mutant EGFR. PMID:25368326

  11. Isoliquiritigenin induces apoptosis and inhibits xenograft tumor growth of human lung cancer cells by targeting both wild type and L858R/T790M mutant EGFR.

    PubMed

    Jung, Sung Keun; Lee, Mee-Hyun; Lim, Do Young; Kim, Jong Eun; Singh, Puja; Lee, Sung-Young; Jeong, Chul-Ho; Lim, Tae-Gyu; Chen, Hanyong; Chi, Young-In; Kundu, Joydeb Kumar; Lee, Nam Hyouck; Lee, Charles C; Cho, Yong-Yeon; Bode, Ann M; Lee, Ki Won; Dong, Zigang

    2014-12-26

    Non-small-cell lung cancer (NSCLC) is associated with diverse genetic alterations including mutation of epidermal growth factor receptor (EGFR). Isoliquiritigenin (ILQ), a chalcone derivative, possesses anticancer activities. In the present study, we investigated the effects of ILQ on the growth of tyrosine kinase inhibitor (TKI)-sensitive and -resistant NSCLC cells and elucidated its underlying mechanisms. Treatment with ILQ inhibited growth and induced apoptosis in both TKI-sensitive and -resistant NSCLC cells. ILQ-induced apoptosis was associated with the cleavage of caspase-3 and poly-(ADP-ribose)-polymerase, increased expression of Bim, and reduced expression of Bcl-2. In vitro kinase assay results revealed that ILQ inhibited the catalytic activity of both wild type and double mutant (L858R/T790M) EGFR. Treatment with ILQ inhibited the anchorage-independent growth of NIH3T3 cells stably transfected with either wild type or double-mutant EGFR with or without EGF stimulation. ILQ also reduced the phosphorylation of Akt and ERK1/2 in both TKI-sensitive and -resistant NSCLC cells, and attenuated the kinase activity of Akt1 and ERK2 in vitro. ILQ directly interacted with both wild type and double-mutant EGFR in an ATP-competitive manner. A docking model study showed that ILQ formed two hydrogen bonds (Glu-762 and Met-793) with wild type EGFR and three hydrogen bonds (Lys-745, Met-793, and Asp-855) with mutant EGFR. ILQ attenuated the xenograft tumor growth of H1975 cells, which was associated with decreased expression of Ki-67 and diminished phosphorylation of Akt and ERK1/2. Taken together, ILQ suppresses NSCLC cell growth by directly targeting wild type or mutant EGFR. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Diet-derived 25-hydroxyvitamin D3 activates vitamin D receptor target gene expression and suppresses EGFR mutant non-small cell lung cancer growth in vitro and in vivo

    PubMed Central

    Verone-Boyle, Alissa R.; Shoemaker, Suzanne; Attwood, Kristopher; Morrison, Carl D.; Makowski, Andrew J.; Battaglia, Sebastiano; Hershberger, Pamela A.

    2016-01-01

    Epidemiologic studies implicate vitamin D status as a factor that influences growth of EGFR mutant lung cancers. However, laboratory based evidence of the biological effect of vitamin D in this disease is lacking. To fill this knowledge gap, we determined vitamin D receptor (VDR) expression in human lung tumors using a tissue microarray constructed of lung cancer cases from never-smokers (where EGFR gene mutations are prevalent). Nuclear VDR was detected in 19/19 EGFR mutant tumors. Expression tended to be higher in tumors with EGFR exon 19 deletions than those with EGFR L858R mutations. To study anti-proliferative activity and signaling, EGFR mutant lung cancer cells were treated with the circulating metabolite of vitamin D, 25-hydroxyvitamin D3 (25D3). 25D3 inhibited clonogenic growth in a dose-dependent manner. CYP27B1 encodes the 1α-hydroxylase (1αOHase) that converts 25D3 to the active metabolite, 1,25-dihydroxyvitamin D3 (1,25D3). Studies employing VDR siRNA, CYP27B1 zinc finger nucleases, and pharmacologic inhibitors of the vitamin D pathway indicate that 25D3 regulates gene expression in a VDR-dependent manner but does not strictly require 1αOHase-mediated conversion of 25D3 to 1,25D3. To determine the effects of modulating serum 25D3 levels on growth of EGFR mutant lung tumor xenografts, mice were fed diets containing 100 or 10,000 IU vitamin D3/kg. High dietary vitamin D3 intake resulted in elevated serum 25D3 and significant inhibition of tumor growth. No toxic effects of supplementation were observed. These results identify EGFR mutant lung cancer as a vitamin D-responsive disease and diet-derived 25D3 as a direct VDR agonist and therapeutic agent. PMID:26654942

  13. Study of the Effects of Betaine and/or C-Phycocyanin on the Growth of Lung Cancer A549 Cells In Vitro and In Vivo

    PubMed Central

    Pichon, Chantal; Pigeon, Lucie

    2016-01-01

    We investigated the effects of betaine, C-phycocyanin (C-PC), and their combined use on the growth of A549 lung cancer both in vitro and in vivo. When cells were coincubated with betaine and C-PC, an up to 60% decrease in viability was observed which is significant compared to betaine (50%) or C-PC treatment alone (no decrease). Combined treatment reduced the stimulation of NF-κB expression by TNF-α and increased the amount of the proapoptotic p38 MAPK. Interestingly, combined treatment induced a cell cycle arrest in G2/M phase for ~60% of cells. In vivo studies were performed in pathogen-free male nude rats injected with A549 cells in their right flank. Their daily food was supplemented with either betaine, C-PC, both, or neither. Compared to the control group, tumour weights and volumes were significantly reduced in either betaine- or C-PC-treated groups and no additional decrease was obtained with the combined treatment. This data indicates that C-PC and betaine alone may efficiently inhibit tumour growth in rats. The synergistic activity of betaine and C-PC on A549 cells growth observed in vitro remains to be further confirmed in vivo. The reason behind the nature of their interaction is yet to be sought. PMID:27635139

  14. Study of the Effects of Betaine and/or C-Phycocyanin on the Growth of Lung Cancer A549 Cells In Vitro and In Vivo.

    PubMed

    Bingula, Rea; Dupuis, Carmen; Pichon, Chantal; Berthon, Jean-Yves; Filaire, Marc; Pigeon, Lucie; Filaire, Edith

    2016-01-01

    We investigated the effects of betaine, C-phycocyanin (C-PC), and their combined use on the growth of A549 lung cancer both in vitro and in vivo. When cells were coincubated with betaine and C-PC, an up to 60% decrease in viability was observed which is significant compared to betaine (50%) or C-PC treatment alone (no decrease). Combined treatment reduced the stimulation of NF-κB expression by TNF-α and increased the amount of the proapoptotic p38 MAPK. Interestingly, combined treatment induced a cell cycle arrest in G2/M phase for ~60% of cells. In vivo studies were performed in pathogen-free male nude rats injected with A549 cells in their right flank. Their daily food was supplemented with either betaine, C-PC, both, or neither. Compared to the control group, tumour weights and volumes were significantly reduced in either betaine- or C-PC-treated groups and no additional decrease was obtained with the combined treatment. This data indicates that C-PC and betaine alone may efficiently inhibit tumour growth in rats. The synergistic activity of betaine and C-PC on A549 cells growth observed in vitro remains to be further confirmed in vivo. The reason behind the nature of their interaction is yet to be sought.

  15. Alteration of the serum levels of the epidermal growth factor receptor and its ligands in patients with non-small cell lung cancer and head and neck carcinoma.

    PubMed

    Lemos-González, Y; Rodríguez-Berrocal, F J; Cordero, O J; Gómez, C; Páez de la Cadena, M

    2007-05-21

    Serum levels of the soluble epidermal growth factor receptor (sEGFR) and its ligands epidermal growth factor (EGF), transforming growth factor-alpha (TGF-alpha) and amphiregulin (AR) were measured in healthy donors and patients with non-small cell lung cancer (NSCLC) and head and neck carcinoma (HNC). In NSCLC, we found sEGFR and EGF levels significantly lowered in patients with respect to healthy donors. In HNC patients, significantly diminished levels were found in the case of sEGFR, EGF and also AR. In both malignancies, no significant association was found between the serum levels of the molecules and the patients' gender, age or smoking habit. Only a significant association was found between the decrease of sEGFR and the absence of distant metastasis in NSCLC and the tumour stage in HNC. The most interesting result was that combining sEGFR and EGF, sensitivities of 88% in NSCLC and 100% in HNC were reached without losing specificity (97.8% in both cases). The use of discriminant analysis and logistic regression improved the sensitivity for NSCLC and the specificity for HNC. These data demonstrate a potentially interesting value of the serum levels of sEGFR and EGF, especially when combined, as markers for NSCLC and HNC.

  16. Lung and Upper Aerodigestive Cancer | Division of Cancer Prevention

    Cancer.gov

    [[{"fid":"180","view_mode":"default","fields":{"format":"default","field_file_image_alt_text[und][0][value]":"Lung and Upper Aerodigestive Cancer Research Group Homepage Logo","field_file_image_title_text[und][0][value]":"Lung and Upper Aerodigestive Cancer Research Group Homepage Logo","field_folder[und]":"15"},"type":"media","attributes":{"alt":"Lung and Upper Aerodigestive Cancer Research Group Homepage Logo","title":"Lung and Upper Aerodigestive Cancer Research Group Homepage Logo","heigh | Conducts and supports research on the prevention and early detection of lung and head and neck cancers.

  17. Curbing the burden of lung cancer.

    PubMed

    Urman, Alexandra; Hosgood, H Dean

    2016-06-01

    Lung cancer contributes substantially to the global burden of disease and healthcare costs. New screening modalities using low-dose computerized tomography are promising tools for early detection leading to curative surgery. However, the screening and follow-up diagnostic procedures of these techniques may be costly. Focusing on prevention is an important factor to reduce the burden of screening, treatment, and lung cancer deaths. The International Agency for Research on Cancer has identified several lung carcinogens, which we believe can be considered actionable when developing prevention strategies. To curb the societal burden of lung cancer, healthcare resources need to be focused on early detection and screening and on mitigating exposure(s) of a person to known lung carcinogens, such as active tobacco smoking, household air pollution (HAP), and outdoor air pollution. Evidence has also suggested that these known lung carcinogens may be associated with genetic predispositions, supporting the hypothesis that lung cancers attributed to differing exposures may have developed from unique underlying genetic mechanisms attributed to the exposure of interest. For instance, smokingattributed lung cancer involves novel genetic markers of risk compared with HAP-attributed lung cancer. Therefore, genetic risk markers may be used in risk stratification to identify subpopulations that are at a higher risk for developing lung cancer attributed to a given exposure. Such targeted prevention strategies suggest that precision prevention strategies may be possible in the future; however, much work is needed to determine whether these strategies will be viable.

  18. Prognosis of Lung Cancer: Heredity or Environment

    DTIC Science & Technology

    2015-06-01

    AWARD NUMBER: W81XWH-12-1-0547 TITLE: Prognosis of Lung Cancer: Heredity or Environment? PRINCIPAL INVESTIGATOR: Melinda Aldrich...0547 Prognosis of Lung Cancer: Heredity or Environment? 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Aldrich...DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT Lung cancer is the

  19. Attitudes and Stereotypes in Lung Cancer versus Breast Cancer

    PubMed Central

    Sriram, N.

    2015-01-01

    Societal perceptions may factor into the high rates of nontreatment in patients with lung cancer. To determine whether bias exists toward lung cancer, a study using the Implicit Association Test method of inferring subconscious attitudes and stereotypes from participant reaction times to visual cues was initiated. Participants were primarily recruited from an online survey panel based on US census data. Explicit attitudes regarding lung and breast cancer were derived from participants’ ratings (n = 1778) regarding what they thought patients experienced in terms of guilt, shame, and hope (descriptive statements) and from participants’ opinions regarding whether patients ought to experience such feelings (normative statements). Participants’ responses to descriptive and normative statements about lung cancer were compared with responses to statements about breast cancer. Analyses of responses revealed that the participants were more likely to agree with negative descriptive and normative statements about lung cancer than breast cancer (P<0.001). Furthermore, participants had significantly stronger implicit negative associations with lung cancer compared with breast cancer; mean response times in the lung cancer/negative conditions were significantly shorter than in the lung cancer/positive conditions (P<0.001). Patients, caregivers, healthcare providers, and members of the general public had comparable levels of negative implicit attitudes toward lung cancer. These results show that lung cancer was stigmatized by patients, caregivers, healthcare professionals, and the general public. Further research is needed to investigate whether implicit and explicit attitudes and stereotypes affect patient care. PMID:26698307

  20. Attitudes and Stereotypes in Lung Cancer versus Breast Cancer.

    PubMed

    Sriram, N; Mills, Jennifer; Lang, Edward; Dickson, Holli K; Hamann, Heidi A; Nosek, Brian A; Schiller, Joan H

    2015-01-01

    Societal perceptions may factor into the high rates of nontreatment in patients with lung cancer. To determine whether bias exists toward lung cancer, a study using the Implicit Association Test method of inferring subconscious attitudes and stereotypes from participant reaction times to visual cues was initiated. Participants were primarily recruited from an online survey panel based on US census data. Explicit attitudes regarding lung and breast cancer were derived from participants' ratings (n = 1778) regarding what they thought patients experienced in terms of guilt, shame, and hope (descriptive statements) and from participants' opinions regarding whether patients ought to experience such feelings (normative statements). Participants' responses to descriptive and normative statements about lung cancer were compared with responses to statements about breast cancer. Analyses of responses revealed that the participants were more likely to agree with negative descriptive and normative statements about lung cancer than breast cancer (P<0.001). Furthermore, participants had significantly stronger implicit negative associations with lung cancer compared with breast cancer; mean response times in the lung cancer/negative conditions were significantly shorter than in the lung cancer/positive conditions (P<0.001). Patients, caregivers, healthcare providers, and members of the general public had comparable levels of negative implicit attitudes toward lung cancer. These results show that lung cancer was stigmatized by patients, caregivers, healthcare professionals, and the general public. Further research is needed to investigate whether implicit and explicit attitudes and stereotypes affect patient care.

  1. The Current and Evolving Role of PET in Personalized Management of Lung Cancer.

    PubMed

    Mena, Esther; Yanamadala, Anusha; Cheng, Gang; Subramaniam, Rathan M

    2016-07-01

    Using tumor genomic profiling information has revolutionized the landscape of personalized treatment of lung cancer. The management of lung cancer and non-small cell lung cancer particularly is influenced by discoveries of activating mutations in epidermal growth factor receptor and targeted therapies with tyrosine kinase inhibitors, fusion genes involving anaplastic lymphoma kinase, and targeted therapies for Kristen-Rat-Sarcoma and MET protooncogenes. PET imaging plays an important role in assessing the biologic behavior of lung cancer and defining response to therapy. This review summarizes genomic discoveries in lung cancer and their implications for functional PET imaging.

  2. Lung cancer: epidemiology, etiology, and prevention.

    PubMed

    Dela Cruz, Charles S; Tanoue, Lynn T; Matthay, Richard A

    2011-12-01

    Lung cancer is the leading cause of cancer death in the United States and around the world. A vast majority of lung cancer deaths are attributable to cigarette smoking, and curbing the rates of cigarette smoking is imperative. Understanding the epidemiology and causal factors of lung cancer can provide additional foundation for disease prevention. This article focuses on modifiable risk factors, including tobacco smoking, occupational carcinogens, diet, and ionizing radiation. It also discusses briefly the molecular and genetic aspects of lung carcinogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Combination Chemotherapy, Radiation Therapy, and Gefitinib in Treating Patients With Stage III Non-Small Cell Lung Cancer

    ClinicalTrials.gov

    2013-06-04

    Adenocarcinoma of the Lung; Adenosquamous Cell Lung Cancer; Bronchoalveolar Cell Lung Cancer; Large Cell Lung Cancer; Squamous Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer

  4. MicroRNA-92a promotes growth, metastasis, and chemoresistance in non-small cell lung cancer cells by targeting PTEN.

    PubMed

    Ren, Ping; Gong, Fangchao; Zhang, Yan; Jiang, Jindong; Zhang, Hong

    2016-03-01

    MicroRNA-92a (miR-92a) has been reported to play important roles in tumorigenesis of human various cancers. However, the roles and underlying molecular mechanism of miR-92a in non-small cell lung cancer (NSCLC) have not been totally elucidated. Therefore, the aims of this study were to determine the role of miR-92a and to elucidate its regulatory mechanism in NSCLC. We found that miR-92a was significantly upregulated in NSCLC tissues compared to matched adjacent normal lung tissues, and its expression is significantly associated with clinical characteristics of patients, including tumor, node, and metastasis (TNM) stage; tumor size; and lymph node metastasis (all P < 0.01). Function assays demonstrated that upregulation of miR-92a in NSCLC cells promoted cell proliferation, migration, and invasion, decreased apoptosis and caspase-3 activity, and enhanced chemoresistance of NSCLC cells, whereas downregulation of miR-92a showed the opposite effects. Moreover, phosphatase and tensin homolog (PTEN), a unique tumor suppressor gene, was confirmed as a direct target of miR-92a, and PTEN messenger RNA (mRNA) expression was decreased in NSCLC tissues and was inversely correlated with miR-92a. Downregulation of PTEN could mimic the same effects of miR-92a mimic in NSCLC cells and rescue the effects on NSCLC cells induced by miR-92a inhibitor. Taken together, these findings suggested that miR-92a could promote growth, metastasis, and chemoresistance in NSCLC cells at least partially by targeting PTEN.

  5. Functions and mechanisms of long noncoding RNAs in lung cancer

    PubMed Central

    Peng, Zhenzi; Zhang, Chunfang; Duan, Chaojun

    2016-01-01

    Lung cancer is a heterogeneous disease, and there is a lack of adequate biomarkers for diagnosis. Long noncoding RNAs (lncRNAs) are emerging as an important set of molecules because of their roles in various key pathophysiological pathways, including cell growth, apoptosis, and metastasis. We review the current knowledge of the lncRNAs in lung cancer. In-depth analyses of lncRNAs in lung cancer have increased the number of potential effective biomarkers, thus providing options to increase the therapeutic benefit. In this review, we summarize the functions, mechanisms, and regulatory networks of lncRNAs in lung cancer, providing a basis for further research in this field. PMID:27499635

  6. [Lung cancer and lymph drainage].

    PubMed

    Riquet, M

    2007-01-01

    Lung cancer is lymphophile and may involve lymph nodes (LN) belonging to lung lymph drainage. LN metastases are figured within stations numbered 1 to 14. These stations are located along lymph vessels. The lymph vessels and the LN are forming together anatomical chains. Lymph vessels are valved and pulsatile and travel to the cervical venous confluence where they pour the lung lymph into the blood circulation. They may be totally or partly nodeless along their travel, anastomose with each other around the trachea, and connect with the thoracic duct within the mediastinum. Within the anatomical LN chains, LN are variable in number and in size from one individual to another. They may be absent from one or several stations of the international mapping. Stations are located along the anatomical chains: pulmonary ligament (9), tracheal bifurcation(8 and 7), right paratracheal (4R, 2R and 1), preaortic (5 and 6), left paratracheal (4L, 2L and 1). Station 3 is located on 2 differents chains (phrenic and right esophagotracheal). Station 10 are located at the beginning of the mediastinal lymph nodes chains. Each chain connects with the blood circulation, anastomoses with he neighbouring chains and behave as an own entity whatever the number of its LN. International station mapping misknowns this anatomy and occults the true pronostic value of lung lymph drainage.

  7. Imaging Primary Lung Cancers in Mice to Study Radiation Biology

    SciTech Connect

    Kirsch, David G.; Grimm, Jan; Guimaraes, Alexander R.; Wojtkiewicz, Gregory R.; Perez, Bradford A.; Santiago, Philip M.; Anthony, Nikolas K.; Forbes, Thomas; Doppke, Karen

    2010-03-15

    Purpose: To image a genetically engineered mouse model of non-small-cell lung cancer with micro-computed tomography (micro-CT) to measure tumor response to radiation therapy. Methods and Materials: The Cre-loxP system was used to generate primary lung cancers in mice with mutation in K-ras alone or in combination with p53 mutation. Mice were serially imaged by micro-CT, and tumor volumes were determined. A comparison of tumor volume by micro-CT and tumor histology was performed. Tumor response to radiation therapy (15.5 Gy) was assessed with micro-CT. Results: The tumor volume measured with free-breathing micro-CT scans was greater than the volume calculated by histology. Nevertheless, this imaging approach demonstrated that lung cancers with mutant p53 grew more rapidly than lung tumors with wild-type p53 and also showed that radiation therapy increased the doubling time of p53 mutant lung cancers fivefold. Conclusions: Micro-CT is an effective tool to noninvasively measure the growth of primary lung cancers in genetically engineered mice and assess tumor response to radiation therapy. This imaging approach will be useful to study the radiation biology of lung cancer.

  8. [Development of the lung cancer diagnostic system].

    PubMed

    Lv, You-Jiang; Yu, Shou-Yi

    2009-07-01

    To develop a lung cancer diagnosis system. A retrospective analysis was conducted in 1883 patients with primary lung cancer or benign pulmonary diseases (pneumonia, tuberculosis, or pneumonia pseudotumor). SPSS11.5 software was used for data processing. For the relevant factors, a non-factor Logistic regression analysis was used followed by establishment of the regression model. Microsoft Visual Studio 2005 system development platform and VB.Net corresponding language were used to develop the lung cancer diagnosis system. The non-factor multi-factor regression model showed a goodness-of-fit (R2) of the model of 0.806, with a diagnostic accuracy for benign lung diseases of 92.8%, a diagnostic accuracy for lung cancer of 89.0%, and an overall accuracy of 90.8%. The model system for early clinical diagnosis of lung cancer has been established.

  9. Antioxidants accelerate lung cancer progression in mice.

    PubMed

    Sayin, Volkan I; Ibrahim, Mohamed X; Larsson, Erik; Nilsson, Jonas A; Lindahl, Per; Bergo, Martin O

    2014-01-29

    Antioxidants are widely used to protect cells from damage induced by reactive oxygen species (ROS). The concept that antioxidants can help fight cancer is deeply rooted in the general population, promoted by the food supplement industry, and supported by some scientific studies. However, clinical trials have reported inconsistent results. We show that supplementing the diet with the antioxidants N-acetylcysteine (NAC) and vitamin E markedly increases tumor progression and reduces survival in mouse models of B-RAF- and K-RAS-induced lung cancer. RNA sequencing revealed that NAC and vitamin E, which are structurally unrelated, produce highly coordinated changes in tumor transcriptome profiles, dominated by reduced expression of endogenous antioxidant genes. NAC and vitamin E increase tumor cell proliferation by reducing ROS, DNA damage, and p53 expression in mouse and human lung tumor cells. Inactivation of p53 increases tumor growth to a similar degree as antioxidants and abolishes the antioxidant effect. Thus, antioxidants accelerate tumor growth by disrupting the ROS-p53 axis. Because somatic mutations in p53 occur late in tumor progression, antioxidants may accelerate the growth of early tumors or precancerous lesions in high-risk populations such as smokers and patients with chronic obstructive pulmonary disease who receive NAC to relieve mucus production.

  10. Mangosenone F, A Furanoxanthone from Garciana mangostana, Induces Reactive Oxygen Species-Mediated Apoptosis in Lung Cancer Cells and Decreases Xenograft Tumor Growth.

    PubMed

    Seo, Kyung Hye; Ryu, Hyung Won; Park, Mi Jin; Park, Ki Hun; Kim, Jin Hyo; Lee, Mi-Ja; Kang, Hyeon Jung; Kim, Sun Lim; Lee, Jin Hwan; Seo, Woo Duck

    2015-11-01

    Mangosenone F (MSF), a natural xanthone, was isolated form Carcinia mangotana, and a few studies have reported its glycosidase inhibitor effect. In this study we investigated the anti lung cancer effect of MSF both in vitro and in vivo. MSF inhibited cancer cell cytotoxicity and induced and induced apoptosis via reactive oxygen species (ROS) generation in NCI-H460. MSF treatment also showed in pronounced release of apoptogenic cytochrome c from the mitochondria to the cytosol, downregulation of Bcl-2 and Bcl-xL, and upregulation of Bax, suggesting that caspase-mediated pathways were involved in MSF-induced apoptosis. ROS activation of the mitogen-activated protein kinase signaling pathway was shown to play a predominant role in the apoptosis mechanism of MSF. Compared with cisplatin treatment, MSF treatment showed significantly increased inhibition of the growth of NCI-H460 cells xenografted in nude mice. Together, these results indicate the potential of MSF as a candidate natural anticancer drug by promoting ROS production. Copyright © 2015 John Wiley & Sons, Ltd.

  11. Biomarkers of clinical benefit for anti-epidermal growth factor receptor agents in patients with non-small-cell lung cancer

    PubMed Central

    Pallis, A G; Fennell, D A; Szutowicz, E; Leighl, N B; Greillier, L; Dziadziuszko, R

    2011-01-01

    Non-small-cell lung cancer (NSCLC) remains by far the major cause of cancer-related death in the Western world in both men and women. The majority of patients will be diagnosed with metastatic disease, and chemotherapy doublets remain the cornerstone of treatment for these patients. However, chemotherapy has a minimal impact on long-term survival and prognosis remains poor for these patients. Further improvement in treatment is likely to require incorporation of novel targeted therapies. Among these agents, inhibitors of the epidermal growth factor receptor (EGFR) have demonstrated significant activity in the first-, second- or third-line treatment of NSCLC. The purpose of current paper is to present the evidence for using several proposed molecular biomarkers as a tool for selection of NSCLC patients for anti-EGFR treatment. According to current data, EGFR mutation status appears to be the strongest predictor for the selection of NSCLC patients to first-line treatment with EGFR tyrosine kinase inhibitors vs chemotherapy. Use of other biomarkers remains investigational. PMID:21654681

  12. Dichloroacetate alters Warburg metabolism, inhibits cell growth, and increases the X-ray sensitivity of human A549 and H1299 NSC lung cancer cells.

    PubMed

    Allen, Kah Tan; Chin-Sinex, Helen; DeLuca, Thomas; Pomerening, Joseph R; Sherer, Jeremy; Watkins, John B; Foley, John; Jesseph, Jerry M; Mendonca, Marc S

    2015-12-01

    We investigated whether altering Warburg metabolism (aerobic glycolysis) by treatment with the metabolic agent dichloroacetate (DCA) could increase the X-ray-induced cell killing of the radiation-resistant human non-small-cell lung cancer (NSCLC) cell lines A549 and H1299. Treatment with 50mM DCA decreased lactate production and glucose consumption in both A549 and H1299, clear indications of attenuated aerobic glycolysis. In addition, we found that DCA treatment also slowed cell growth, increased population-doubling time, and altered cell cycle distribution. Furthermore, we report that treatment with 50mM DCA significantly increased single and fractionated X-ray-induced cell killing of A549 and H1299 cells. Assay of DNA double-strand break repair by neutral comet assays demonstrated that DCA inhibited both the fast and the slow kinetics of X-ray-induced DSB repair in both A549 and H1299 NSCL cancer cells. Taken together the data suggest a correlation between an attenuated aerobic glycolysis and enhanced cytotoxicity and radiation-induced cell killing in radiation-resistant NSCLC cells.

  13. Lung Cancer in Never Smokers

    PubMed Central

    Yang, Ping

    2012-01-01

    Lung cancer in never smokers (LCINS) has lately been recognized as a unique disease based on rapidly gained knowledge from genomic changes to treatment responses. The focus of this article is on current knowledge and challenges with regard to LCINS expanded from recent reviews highlighting five areas: (1) distribution of LCINS by temporal trends, geographic regions, and populations; (2) three well-recognized environmental risk factors; (3) other plausible environmental risk factors; (4) prior chronic lung diseases and infectious diseases as risk factors; and (5) lifestyles as risk or protective factors. This article will also bring attention to recently published literature in two pioneering areas: (1) histological characteristics, clinical features with emerging new effective therapies, and social and psychological stigma; and (2) searching for susceptibility genes using integrated genomic approaches. PMID:21500120

  14. β-Escin inhibits NNK-induced lung adenocarcinoma and ALDH1A1 and RhoA/Rock expression in A/J mice and growth of H460 human lung cancer cells.

    PubMed

    Patlolla, Jagan M R; Qian, Li; Biddick, Laura; Zhang, Yuting; Desai, Dhimant; Amin, Shantu; Lightfoot, Stan; Rao, Chinthalapally V

    2013-10-01

    Lung cancer is the leading cause of cancer-related deaths. β-Escin, a triterpene saponin isolated from horse chestnut seeds, was tested for inhibition of lung adenoma and adenocarcinoma induced by the tobacco carcinogen 4-(methyl-nitrosamino)-1-(3-pyridyl)-1-butanone (NNK) in female A/J mice; and its possible mode of action was evaluated using the H460 human lung cancer cell line. At 6 weeks of age, 35 mice were fed AIN-76A-modified diet, and one week later, lung tumors were induced with a single intraperitoneal (i.p.) injection of 10 μmol NNK/mouse. Three weeks after the NNK treatment, groups of mice were fed either control or experimental diets containing 500 ppm for 20 weeks (10 control, 5 β-escin) or 36 weeks (15 control, 5 β-escin) and evaluated for lung tumor via histopathologic methods. Administration of 500 ppm β-escin significantly suppressed lung tumor (adenoma + adenocarcinoma) formation by more than 40% (P < 0.0015) at 20 weeks and by 53.3% (P < 0.0001) at 37 weeks. β-Escin inhibited NNK-induced lung adenocarcinoma formation by 65% (P < 0.001) at 20 weeks and by 53% (P < 0.0001) at 37 weeks. Immunohistochemical analysis revealed that lung tumors from mice exposed to β-escin showed significantly reduced aldehyde dehydrogenase (ALDH)1A1 and phospho-Akt (p-Akt) expression when compared with those in mice fed control diet. Aldefluor assay for ALDH revealed that among H460 lung cancer cells treated with different concentrations of β-escin (0-40 μmol/L), the subpopulation of cells with elevated ALDH activity was inhibited significantly. Our findings suggest that β-escin inhibits tobacco carcinogen-induced lung tumor formation by modulating ALDH1A1-positive cells and RhoA/Rock signaling.

  15. Enhanced Quitline Intervention in Smoking Cessation for Patients With Non-Metastatic Lung Cancer

    ClinicalTrials.gov

    2017-02-20

    Limited Stage Small Cell Lung Cancer; Recurrent Small Cell Lung Cancer; Stage IA Non-small Cell Lung Cancer; Stage IB Non-small Cell Lung Cancer; Stage IIA Non-small Cell Lung Cancer; Stage IIB Non-small Cell Lung Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Non-small Cell Lung Cancer; Tobacco Use Disorder

  16. Screening and early detection of lung cancer.

    PubMed

    Van't Westeinde, Susan C; van Klaveren, Rob J

    2011-01-01

    Lung cancer with an estimated 342,000 deaths in 2008 (20% of total) is the most common cause of death from cancer, followed by colorectal cancer (12%), breast cancer (8%), and stomach cancer (7%) in Europe. In former smokers, the absolute lung cancer risk remains higher than in never-smokers; these data therefore call for effective secondary preventive measures for lung cancer in addition to smoking cessation programs. This review presents and discusses the most recent advances in the early detection and screening of lung cancer.An overview of randomized controlled computerized tomography-screening trials is given, and the role of bronchoscopy and new techniques is discussed. Finally, the approach of (noninvasive) biomarker testing in the blood, exhaled breath, sputum, and bronchoscopic specimen is reviewed.

  17. Epigenetic regulation of ANKRD18B in lung cancer.

    PubMed

    Liu, Wen-Bin; Han, Fei; Jiang, Xiao; Yin, Li; Chen, Hong-Qiang; Li, Yong-Hong; Liu, Yong; Cao, Jia; Liu, Jin-Yi

    2015-04-01

    The identification of the key genetic and epigenetic changes underlying lung carcinogenesis would aid effective early diagnosis and targeted therapies for lung cancer. In this study, we screened a novel hypermethylated gene ankyrin repeat domain 18B (ANKRD18B), to determine whether it is regulated by DNA methylation and clarify its biological and clinical implications in lung cancer. Methylation status and expression level were analyzed by methylation-specific PCR, bisulfite genomic sequencing, and quantitative reverse transcription-polymerase chain reaction (qRT-PCR). We detected ANKRD18B hypermethylation in 52 of 98 (53.1%) primary lung cancer tissues and in nine of 10 (90%) cell lines, whereas no methylation was seen in 10 normal lung tissue samples. ANKRD18B methylation was more frequently observed in patients with poor differentiation (P < 0.05). Notably, 62 pairs of samples from patients whose tumor tissue showed hypermethylation of ANKRD18B exhibited the same aberrant methylation in 72.7% and 69.7% of their corresponding plasma and sputum samples, respectively; whereas no hypermethylation of ANKRD18B was detected in the sputum and plasma from patients whose tumor sample lacked this alteration. In addition, ANKRD18B mRNA expression was significantly decreased or silenced in lung cancer tissues and cell lines associated with hypermethylation of the ANKRD18B region. Demethylation agent 5-aza-2'-deoxycytidine significantly increased ANKRD18B mRNA expression in lung cancer cell lines. Furthermore, overexpression of ANKRD18B suppressed lung cancer cell growth. These results suggest that the expression of ANKRD18B is regulated by CpG island hypermethylation in lung cancer. Our findings confirm the importance of the identification of new markers of epigenetic dysregulation in cancer.

  18. Fascin 1 promoted the growth and migration of non-small cell lung cancer cells by activating YAP/TEAD signaling.

    PubMed

    Liang, Zhigang; Wang, Ying; Shen, Zhenya; Teng, Xiaomei; Li, Xinjian; Li, Chenwei; Wu, Weijie; Zhou, Zenghui; Wang, Zishan

    2016-08-01

    Fascin 1 (Fascin actin-bundling protein 1) is an actin-binding protein. Although several studies have reported the dysregulation of Fascin 1 in non-small cell lung cancer (NSCLC), its functions in the progression of NSCLC and the related molecular mechanism were not fully understood. In this study, the expression of Fascin 1 in NSCLC tissues was determined using quantitative PCR (qPCR), and the roles of Fascin 1 in the progression of NSCLC were investigated. It was found that both the messenger RNA (mRNA) level and the protein level of Fascin 1 were upregulated in NSCLC tissues. Forced expression of Fascin 1 promoted the growth and migration of NSCLC cells, while knocking down the expression of Fascin 1 inhibited the growth, migration, and tumorigenesis of NSCLC cells. Mechanism studies showed that Fascin 1 increased the transcriptional activity of the YAP/TEAD (Yes-associated protein/TEA domain transcriptional factor) complex, and knocking down the expression of Fascin 1 attenuated the expression of target genes downstream the YAP/TEAD complex. In addition, MST1 interacted with Fascin 1. Taken together, Fascin 1 plays an oncogenic role in NSCLC by activating the transcriptional activity of the YAP/TEAD complex.

  19. Progesterone receptor (PR) polyproline domain (PPD) mediates inhibition of epidermal growth factor receptor (EGFR) signaling in non-small cell lung cancer cells.

    PubMed

    Kawprasertsri, Sornsawan; Pietras, Richard J; Marquez-Garban, Diana C; Boonyaratanakornkit, Viroj

    2016-05-01

    Recent evidence has suggested a possible role for progesterone receptor (PR) in the progression of non-small cell lung cancer (NSCLC). However, little is known concerning roles of PR in NSCLC. PR contains a polyproline domain (PPD), which directly binds to the SH3 domain of signaling molecules. Because PPD-SH3 interactions are essential for EGFR signaling, we hypothesized that the presence of PR-PPD interfered with EGFR-mediated signaling and cell proliferation. We examined the role of PR-PPD in cell proliferation and signaling by stably expressing PR-B, or PR-B with disrupting mutations in the PPD (PR-BΔSH3), from a tetracycline-regulated promoter in A549 NSCLC cells. PR-B dose-dependently inhibited cell growth in the absence of ligand, and progestin (R5020) treatment further suppressed the growth. Treatment with RU486 abolished PR-B- and R5020-mediated inhibition of cell proliferation. Expression of PR-BΔSH3 and treatment with R5020 or RU486 had no effect on cell proliferation. Furthermore, PR-B expression but not PR-BΔSH3 expression reduced EGF-induced A549 proliferation and activation of ERK1/2, in the absence of ligand. Taken together, our data demonstrated the significance of PR extranuclear signaling through PPD interactions in EGFR-mediated proliferation and signaling in NSCLC.

  20. Lung cancer stem cells: An epigenetic perspective.

    PubMed

    Shukla, Samriddhi; Khan, Sajid; Sinha, Sonam; Meeran, Syed Musthapa

    2017-02-05

    Lung cancer remains the major cause of human mortality among all the cancer types despite the colossal amount of efforts to prevent the cancer onset and to provide the appropriate cure. Recent reports have identified that important contributors of lung cancer-related mortality are the drug resistance and aggressive tumor relapse, the characteristics contributed by the presence of lung cancer stem cells (CSCs). The identification of lung CSCs is inherently complex due to the quiescent nature of lung epithelium, which makes the distinction between the normal lung epithelium and lung CSCs difficult. Recently, multiple researches have helped in the identification of lung CSCs based on the presence or absence of certain specific types of stem cell markers. Maintenance of lung CSCs is chiefly mediated through the epigenetic modifications of their genome. In this review, we will discuss about the origin of lung CSCs and the role of epigenetic modifications in their maintenance. We will also discuss in brief the major lung CSC markers and the therapeutic approaches to selectively target this population of cells.

  1. Rubus idaeus L Inhibits Invasion Potential of Human A549 Lung Cancer Cells by Suppression Epithelial-to-Mesenchymal Transition and Akt Pathway In Vitro and Reduces Tumor Growth In Vivo.

    PubMed

    Chu, Shu-Chen; Hsieh, Yih-Shou; Hsu, Li-Sung; Chen, Kuo-Shuen; Chiang, Chien-Cheng; Chen, Pei-Ni

    2014-05-01

    The metastasis of lung cancer is the most prevalent cause of patient death. Various treatment strategies have targeted the prevention of the occurrence of metastasis. The epithelial-mesenchymal transition (EMT) in lung cancer cells is considered a prerequisite to acquire the invasive/migratory phenotype and to subsequently achieve metastasis. However, the effects ofRubus idaeuson cancer invasion and the EMT of the human lung carcinoma remain unclear. In this article, we test the hypothesis thatR idaeusethyl acetate (RIAE) possesses an antimetastatic effect and reverses the EMT potential of human lung A549 cells. We extract the raspberryR idaeuswith methanol (RIME), chloroform (RICE), ethyl acetate (RIAE),n-butanol (RIBE), and water (RIWE). The RIAE treatment obviously inhibits the invasive (P< .001), motility (P< .001), spreading, and migratory potential (P< .001) of highly metastatic human lung cancer A549 cells. The zymography and promoter luciferase analysis reveals that RIAE decreases the proteinase and transcription activities of MMP-2 and u-PA. Molecular analyses show that RIAE increases the E-cadherin level that is mainly localized at the cellular membrane. This result was also verified through confocal analyses. RIAE also induces the upregulation of an epithelial marker, such as α-catenin, and decreases mesenchymal markers, such as snail-1 and N-cadherin, that promote cell invasion and metastasis. RIAE inhibits MMP-2 and u-PA by attenuating the NF-κB and p-Akt expression. The inhibition of RIAE on the growth of A549 cells in vivo was also verified using a cancer cell xenograft nude mice model. Our results show the anti-invasive/antitumor effects of RIAE and associated mechanisms, which suggest that RIAE should be further tested in clinically relevant models to exploit its potential benefits against metastatic lung cancer cells.

  2. Molecular biology of lung cancer: clinical implications.

    PubMed

    Larsen, Jill E; Minna, John D

    2011-12-01

    Lung cancer is a heterogeneous disease clinically, biologically, histologically, and molecularly. Understanding the molecular causes of this heterogeneity, which might reflect changes occurring in different classes of epithelial cells or different molecular changes occurring in the same target lung epithelial cells, is the focus of current research. Identifying the genes and pathways involved, determining how they relate to the biological behavior of lung cancer, and their utility as diagnostic and therapeutic targets are important basic and translational research issues. This article reviews current information on the key molecular steps in lung cancer pathogenesis, their timing, and clinical implications. Published by Elsevier Inc.

  3. Cancer Stem Cells in Lung Tumorigenesis

    PubMed Central

    Kratz, Johannes R.; Yagui-Beltrán, Adam; Jablons, David M.

    201