Sample records for lung gene expression

  1. Differential Gene Expression in Chemically Induced Mouse Lung Adenomas1

    PubMed Central

    Yao, Ruisheng; Wang, Yian; Lubet, Ronald A; You, Ming


    Abstract Because of similarities in histopathology and tumor progression stages between mouse and human lung adenocarcinomas, the mouse lung tumor model with lung adenomas as the endpoint has been used extensively to evaluate the efficacy of putative lung cancer chemopreventive agents. In this study, a competitive cDNA library screening (CCLS) was employed to determine changes in the expression of mRNA in chemically induced lung adenomas compared with paired normal lung tissues. A total of 2555 clones having altered expression in tumors were observed following competitive hybridization between normal lung and lung adenomas after primary screening of over 160,000 clones from a mouse lung cDNA library. Among the 755 clones confirmed by dot blot hybridization, 240 clones were underexpressed, whereas 515 clones were overexpressed in tumors. Sixty-five clones with the most frequently altered expression in six individual tumors were confirmed by semiquantitative RT-PCR. When examining the 58 known genes, 39 clones had increased expression and 19 had decreased expression, whereas the 7 novel genes showed overexpression. A high percentage (>60%) of overexpressed or underexpressed genes was observed in at least two or three of the lesions. Reproducibly overexpressed genes included ERK-1, JAK-1, surfactant proteins A, B, and C, NFAT1, α-1 protease inhibitor, helix-loop-helix ubiquitous kinase (CHUK), α-adaptin, α-1 PI2, thioether S-methyltransferase, and CYP2C40. Reproducibly underexpressed genes included paroxanase, ALDH II, CC10, von Ebner salivary gland protein, and α- and β-globin. In addition, CCLS identified several novel genes or genes not previously associated with lung carcinogenesis, including a hypothetical protein (FLJ11240) and a guanine nucleotide exchange factor homologue. This study shows the efficacy of this methodology for identifying genes with altered expression. These genes may prove to be helpful in our understanding of the genetic basis of lung

  2. Gene expression profiling of non-small cell lung cancer.


    Singhal, Sunil; Miller, Daniel; Ramalingam, Suresh; Sun, Shi-Yong


    Functional genomics has emerged over the past 10 years as a novel technology to study genetic alterations. Gene expression arrays are one genomic technique employed to discover changes in the DNA expression that occur in neoplastic transformation. Microarrays have been applied to investigating lung cancer. Specific applications include discovering novel genetic changes that occur in lung tumors. Microarrays can also be applied to improve diagnosis, staging and discover prognostic markers. The eventual goal of this technology is to discover new markers for therapy and to customize therapy based on an individual tumor genetic composition. In this review, we present the current state of gene expression array technology in its application to lung cancer.

  3. Impact of Statins on Gene Expression in Human Lung Tissues

    PubMed Central

    Lane, Jérôme; van Eeden, Stephan F.; Obeidat, Ma’en; Sin, Don D.; Tebbutt, Scott J.; Timens, Wim; Postma, Dirkje S.; Laviolette, Michel; Paré, Peter D.; Bossé, Yohan


    Statins are 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitors that alter the synthesis of cholesterol. Some studies have shown a significant association of statins with improved respiratory health outcomes of patients with asthma, chronic obstructive pulmonary disease and lung cancer. Here we hypothesize that statins impact gene expression in human lungs and may reveal the pleiotropic effects of statins that are taking place directly in lung tissues. Human lung tissues were obtained from patients who underwent lung resection or transplantation. Gene expression was measured on a custom Affymetrix array in a discovery cohort (n = 408) and two replication sets (n = 341 and 282). Gene expression was evaluated by linear regression between statin users and non-users, adjusting for age, gender, smoking status, and other covariables. The results of each cohort were combined in a meta-analysis and biological pathways were studied using Gene Set Enrichment Analysis. The discovery set included 141 statin users. The lung mRNA expression levels of eighteen and three genes were up-regulated and down-regulated in statin users (FDR < 0.05), respectively. Twelve of the up-regulated genes were replicated in the first replication set, but none in the second (p-value < 0.05). Combining the discovery and replication sets into a meta-analysis improved the significance of the 12 up-regulated genes, which includes genes encoding enzymes and membrane proteins involved in cholesterol biosynthesis. Canonical biological pathways altered by statins in the lung include cholesterol, steroid, and terpenoid backbone biosynthesis. No genes encoding inflammatory, proteases, pro-fibrotic or growth factors were altered by statins, suggesting that the direct effect of statin in the lung do not go beyond its antilipidemic action. Although more studies are needed with specific lung cell types and different classes and doses of statins, the improved health outcomes and survival observed in statin

  4. Gene Expression Profiling of Non-Small Cell Lung Cancer

    PubMed Central

    Miller, Daniel; Ramalingam, Suresh; Sun, Shi-Yong


    Functional genomics has emerged over the past ten years as a novel technology to study genetic alterations. Gene expression arrays are one genomic technique employed to discover changes in the DNA expression that occur in neoplastic transformation. Microarrays have been applied to investigating lung cancer. Specific applications include discovering novel genetic changes that occur in lung tumors. Microarrays can also be applied to improve diagnosis, staging, and discover prognostic markers. The eventual goal of this technology is to discover new markers for therapy and to customize therapy based on an individual tumor genetic composition. In this review, we present the current state of gene expression array technology in its application to lung cancer. PMID:18440087

  5. Epigenetic Control of Gene Expression in the Lung

    PubMed Central

    Yang, Ivana V.; Schwartz, David A.


    Epigenetics is traditionally defined as the study of heritable changes in gene expression caused by mechanisms other than changes in the underlying DNA sequence. There are three main classes of epigenetic marks—DNA methylation, modifications of histone tails, and noncoding RNAs—each of which may be influenced by the environment, diet, diseases, and ageing. Importantly, epigenetic marks have been shown to influence immune cell maturation and are associated with the risk of developing various forms of cancer, including lung cancer. Moreover, there is emerging evidence that these epigenetic marks affect gene expression in the lung and are associated with benign lung diseases, such as asthma, chronic obstructive pulmonary disease, and interstitial lung disease. Technological advances have made it feasible to study epigenetic marks in the lung, and it is anticipated that this knowledge will enhance our understanding of the dynamic biology in the lung and lead to the development of novel diagnostic and therapeutic approaches for our patients with lung disease. PMID:21596832

  6. Epigenetic Regulation of Caveolin-1 Gene Expression in Lung Fibroblasts.


    Sanders, Yan Y; Liu, Hui; Scruggs, Anne M; Duncan, Steven R; Huang, Steven K; Thannickal, Victor J


    Fibrotic disorders are associated with tissue accumulation of fibroblasts. We recently showed that caveolin (Cav)-1 gene suppression by a profibrotic cytokine, transforming growth factor (TGF)-β1, contributes to fibroblast proliferation and apoptosis resistance. Cav-1 has been shown to be constitutively suppressed in idiopathic pulmonary fibrosis (IPF), but mechanisms for this suppression are incompletely understood. We hypothesized that epigenetic processes contribute to Cav-1 down-regulation in IPF lung fibroblasts, and after fibrogenic stimuli. Cav-1 expression levels, DNA methylation status, and histone modifications associated with the Cav-1 promoter were examined by PCR, Western blots, pyrosequencing, or chromatin immunoprecipitation assays in IPF lung fibroblasts, normal fibroblasts after TGF-β1 stimulation, or in murine lung fibroblasts after bleomycin injury. Methylation-specific PCR demonstrated methylated and unmethylated Cav-1 DNA copies in all groups. Despite significant changes in Cav-1 expression, no changes in DNA methylation were observed in CpG islands or CpG island shores of the Cav-1 promoter by pyrosequencing of lung fibroblasts from IPF lungs, in response to TGF-β1, or after bleomycin-induced murine lung injury, when compared with respective controls. In contrast, the association of Cav-1 promoter with the active histone modification mark, H3 lysine 4 trimethylation, correlated with Cav-1 down-regulation in activated/fibrotic lung fibroblasts. Our data indicate that Cav-1 gene silencing in lung fibroblasts is actively regulated by epigenetic mechanisms that involve histone modifications, in particular H3 lysine 4 trimethylation, whereas DNA methylation does not appear to be a primary mechanism. These findings support therapeutic strategies that target histone modifications to restore Cav-1 expression in fibroblasts participating in pathogenic tissue remodeling.

  7. Circadian disruption alters mouse lung clock gene expression and lung mechanics.


    Hadden, Hélène; Soldin, Steven J; Massaro, Donald


    Most aspects of human physiology and behavior exhibit 24-h rhythms driven by a master circadian clock in the brain, which synchronizes peripheral clocks. Lung function and ventilation are subject to circadian regulation and exhibit circadian oscillations. Sleep disruption, which causes circadian disruption, is common in those with chronic lung disease, and in the general population; however, little is known about the effect on the lung of circadian disruption. We tested the hypothesis circadian disruption alters expression of clock genes in the lung and that this is associated with altered lung mechanics. Female and male mice were maintained on a 12:12-h light/dark cycle (control) or exposed for 4 wk to a shifting light regimen mimicking chronic jet lag (CJL). Airway resistance (Rn), tissue damping (G), and tissue elastance (H) did not differ between control and CJL females. Rn at positive end-expiratory pressure (PEEP) of 2 and 3 cmH(2)O was lower in CJL males compared with controls. G, H, and G/H did not differ between CJL and control males. Among CJL females, expression of clock genes, Bmal1 and Rev-erb alpha, was decreased; expression of their repressors, Per2 and Cry 2, was increased. Among CJL males, expression of Clock was decreased; Per 2 and Rev-erb alpha expression was increased. We conclude circadian disruption alters lung mechanics and clock gene expression and does so in a sexually dimorphic manner.

  8. Bitumen fume-induced gene expression profile in rat lung

    SciTech Connect

    Gate, Laurent . E-mail:; Langlais, Cristina; Micillino, Jean-Claude; Nunge, Herve; Bottin, Marie-Claire; Wrobel, Richard; Binet, Stephane


    Exposure to bitumen fumes during paving and roofing activities may represent an occupational health risk. To date, most of the studies performed on the biological effect of asphalt fumes have been done with regard to their content in carcinogenic polycyclic aromatic hydrocarbons (PAH). In order to gain an additional insight into the mechanisms of action of bitumen fumes, we studied their pulmonary effects in rodents following inhalation using the microarray technology. Fisher 344 rats were exposed for 5 days, 6 h/day to bitumen fumes generated at road paving temperature (170 {sup o}C) using a nose-only exposition device. With the intention of studying the early transcriptional events induced by asphalt fumes, lung tissues were collected immediately following exposure and gene expression profiles in control and exposed rats were determined by using oligonucleotide microarrays. Data analysis revealed that genes involved in lung inflammatory response as well as genes associated with PAH metabolization and detoxification were highly expressed in bitumen-exposed animals. In addition, the expression of genes related to elastase activity and its inhibition which are associated with emphysema was also modulated. More interestingly genes coding for monoamine oxidases A and B involved in the metabolism of neurotransmitters and xenobiotics were downregulated in exposed rats. Altogether, these data give additional information concerning the bitumen fumes biological effects and would allow to better review the health effects of occupational asphalt fumes exposure.

  9. Bitumen fume-induced gene expression profile in rat lung.


    Gate, Laurent; Langlais, Cristina; Micillino, Jean-Claude; Nunge, Hervé; Bottin, Marie-Claire; Wrobel, Richard; Binet, Stéphane


    Exposure to bitumen fumes during paving and roofing activities may represent an occupational health risk. To date, most of the studies performed on the biological effect of asphalt fumes have been done with regard to their content in carcinogenic polycyclic aromatic hydrocarbons (PAH). In order to gain an additional insight into the mechanisms of action of bitumen fumes, we studied their pulmonary effects in rodents following inhalation using the microarray technology. Fisher 344 rats were exposed for 5 days, 6 h/day to bitumen fumes generated at road paving temperature (170 degrees C) using a nose-only exposition device. With the intention of studying the early transcriptional events induced by asphalt fumes, lung tissues were collected immediately following exposure and gene expression profiles in control and exposed rats were determined by using oligonucleotide microarrays. Data analysis revealed that genes involved in lung inflammatory response as well as genes associated with PAH metabolization and detoxification were highly expressed in bitumen-exposed animals. In addition, the expression of genes related to elastase activity and its inhibition which are associated with emphysema was also modulated. More interestingly genes coding for monoamine oxidases A and B involved in the metabolism of neurotransmitters and xenobiotics were downregulated in exposed rats. Altogether, these data give additional information concerning the bitumen fumes biological effects and would allow to better review the health effects of occupational asphalt fumes exposure.

  10. Using epigenomics data to predict gene expression in lung cancer

    PubMed Central


    Background Epigenetic alterations are known to correlate with changes in gene expression among various diseases including cancers. However, quantitative models that accurately predict the up or down regulation of gene expression are currently lacking. Methods A new machine learning-based method of gene expression prediction is developed in the context of lung cancer. This method uses the Illumina Infinium HumanMethylation450K Beadchip CpG methylation array data from paired lung cancer and adjacent normal tissues in The Cancer Genome Atlas (TCGA) and histone modification marker CHIP-Seq data from the ENCODE project, to predict the differential expression of RNA-Seq data in TCGA lung cancers. It considers a comprehensive list of 1424 features spanning the four categories of CpG methylation, histone H3 methylation modification, nucleotide composition, and conservation. Various feature selection and classification methods are compared to select the best model over 10-fold cross-validation in the training data set. Results A best model comprising 67 features is chosen by ReliefF based feature selection and random forest classification method, with AUC = 0.864 from the 10-fold cross-validation of the training set and AUC = 0.836 from the testing set. The selected features cover all four data types, with histone H3 methylation modification (32 features) and CpG methylation (15 features) being most abundant. Among the dropping-off tests of individual data-type based features, removal of CpG methylation feature leads to the most reduction in model performance. In the best model, 19 selected features are from the promoter regions (TSS200 and TSS1500), highest among all locations relative to transcripts. Sequential dropping-off of CpG methylation features relative to different regions on the protein coding transcripts shows that promoter regions contribute most significantly to the accurate prediction of gene expression. Conclusions By considering a comprehensive list of

  11. Gene expression profile of androgen modulated genes in the murine fetal developing lung

    PubMed Central


    Background Accumulating evidences suggest that sex affects lung development. Indeed, a higher incidence of respiratory distress syndrome is observed in male compared to female preterm neonates at comparable developmental stage and experimental studies demonstrated an androgen-related delay in male lung maturation. However, the precise mechanisms underlying these deleterious effects of androgens in lung maturation are only partially understood. Methods To build up a better understanding of the effect of androgens on lung development, we analyzed by microarrays the expression of genes showing a sexual difference and those modulated by androgens. Lungs of murine fetuses resulting from a timely mating window of 1 hour were studied at gestational day 17 (GD17) and GD18, corresponding to the period of surge of surfactant production. Using injections of the antiandrogen flutamide to pregnant mice, we hunted for genes in fetal lungs which are transcriptionally modulated by androgens. Results Results revealed that 1844 genes were expressed with a sexual difference at GD17 and 833 at GD18. Many genes were significantly modulated by flutamide: 1597 at GD17 and 1775 at GD18. Datasets were analyzed by using in silico tools for reconstruction of cellular pathways. Between GD17 and GD18, male lungs showed an intensive transcriptional activity of proliferative pathways along with the onset of lung differentiation. Among the genes showing a sex difference or an antiandrogen modulation of their expression, we specifically identified androgen receptor interacting genes, surfactant related genes in particularly those involved in the pathway leading to phospholipid synthesis, and several genes of lung development regulator pathways. Among these latter, some genes related to Shh, FGF, TGF-beta, BMP, and Wnt signaling are modulated by sex and/or antiandrogen treatment. Conclusion Our results show clearly that there is a real delay in lung maturation between male and female in this period

  12. Gene Expression Analysis to Assess the Relevance of Rodent Models to Human Lung Injury.


    Sweeney, Timothy E; Lofgren, Shane; Khatri, Purvesh; Rogers, Angela J


    The relevance of animal models to human diseases is an area of intense scientific debate. The degree to which mouse models of lung injury recapitulate human lung injury has never been assessed. Integrating data from both human and animal expression studies allows for increased statistical power and identification of conserved differential gene expression across organisms and conditions. We sought comprehensive integration of gene expression data in experimental acute lung injury (ALI) in rodents compared with humans. We performed two separate gene expression multicohort analyses to determine differential gene expression in experimental animal and human lung injury. We used correlational and pathway analyses combined with external in vitro gene expression data to identify both potential drivers of underlying inflammation and therapeutic drug candidates. We identified 21 animal lung tissue datasets and three human lung injury bronchoalveolar lavage datasets. We show that the metasignatures of animal and human experimental ALI are significantly correlated despite these widely varying experimental conditions. The gene expression changes among mice and rats across diverse injury models (ozone, ventilator-induced lung injury, LPS) are significantly correlated with human models of lung injury (Pearson r = 0.33-0.45, P < 1E(-16)). Neutrophil signatures are enriched in both animal and human lung injury. Predicted therapeutic targets, peptide ligand signatures, and pathway analyses are also all highly overlapping. Gene expression changes are similar in animal and human experimental ALI, and provide several physiologic and therapeutic insights to the disease.

  13. Identification of feature genes for smoking-related lung adenocarcinoma based on gene expression profile data

    PubMed Central

    Liu, Ying; Ni, Ran; Zhang, Hui; Miao, Lijun; Wang, Jing; Jia, Wenqing; Wang, Yuanyuan


    This study aimed to identify the genes and pathways associated with smoking-related lung adenocarcinoma. Three lung adenocarcinoma associated datasets (GSE43458, GSE10072, and GSE50081), the subjects of which included smokers and nonsmokers, were downloaded to screen the differentially expressed feature genes between smokers and nonsmokers. Based on the identified feature genes, we constructed the protein–protein interaction (PPI) network and optimized feature genes using closeness centrality (CC) algorithm. Then, the support vector machine (SVM) classification model was constructed based on the feature genes with higher CC values. Finally, pathway enrichment analysis of the feature genes was performed. A total of 213 down-regulated and 83 up-regulated differentially expressed genes were identified. In the constructed PPI network, the top ten nodes with higher degrees and CC values included ANK3, EPHA4, FGFR2, etc. The SVM classifier was constructed with 27 feature genes, which could accurately identify smokers and nonsmokers. Pathways enrichment analysis for the 27 feature genes revealed that they were significantly enriched in five pathways, including proteoglycans in cancer (EGFR, SDC4, SDC2, etc.), and Ras signaling pathway (FGFR2, PLA2G1B, EGFR, etc.). The 27 feature genes, such as EPHA4, FGFR2, and EGFR for SVM classifier construction and cancer-related pathways of Ras signaling pathway and proteoglycans in cancer may play key roles in the progression and development of smoking-related lung adenocarcinoma. PMID:27994470

  14. Multi-walled carbon nanotube-induced gene expression in the mouse lung: Association with lung pathology

    SciTech Connect

    Pacurari, M.; Qian, Y.; Porter, D.W.; Wolfarth, M.; Wan, Y.; Luo, D.; Ding, M.; Castranova, V.; Guo, N.L.


    Due to the fibrous shape and durability of multi-walled carbon nanotubes (MWCNT), concerns regarding their potential for producing environmental and human health risks, including carcinogenesis, have been raised. This study sought to investigate how previously identified lung cancer prognostic biomarkers and the related cancer signaling pathways are affected in the mouse lung following pharyngeal aspiration of well-dispersed MWCNT. A total of 63 identified lung cancer prognostic biomarker genes and major signaling biomarker genes were analyzed in mouse lungs (n = 80) exposed to 0, 10, 20, 40, or 80 {mu}g of MWCNT by pharyngeal aspiration at 7 and 56 days post-exposure using quantitative PCR assays. At 7 and 56 days post-exposure, a set of 7 genes and a set of 11 genes, respectively, showed differential expression in the lungs of mice exposed to MWCNT vs. the control group. Additionally, these significant genes could separate the control group from the treated group over the time series in a hierarchical gene clustering analysis. Furthermore, 4 genes from these two sets of significant genes, coiled-coil domain containing-99 (Ccdc99), muscle segment homeobox gene-2 (Msx2), nitric oxide synthase-2 (Nos2), and wingless-type inhibitory factor-1 (Wif1), showed significant mRNA expression perturbations at both time points. It was also found that the expression changes of these 4 overlapping genes at 7 days post-exposure were attenuated at 56 days post-exposure. Ingenuity Pathway Analysis (IPA) found that several carcinogenic-related signaling pathways and carcinogenesis itself were associated with both the 7 and 11 gene signatures. Taken together, this study identifies that MWCNT exposure affects a subset of lung cancer biomarkers in mouse lungs. - Research Highlights: > Multi-Walled Carbon Nanotubes affect lung cancer biomarkers in mouse lungs. > The results suggest potentially harmful effects of MWCNT exposure on human lungs. > The results could potentially be used for

  15. Alterations in Gene Expression and DNA Methylation during Murine and Human Lung Alveolar Septation

    PubMed Central

    Cuna, Alain; Halloran, Brian; Faye-Petersen, Ona; Kelly, David; Crossman, David K.; Cui, Xiangqin; Pandit, Kusum; Kaminski, Naftali; Bhattacharya, Soumyaroop; Ahmad, Ausaf; Mariani, Thomas J.


    DNA methylation, a major epigenetic mechanism, may regulate coordinated expression of multiple genes at specific time points during alveolar septation in lung development. The objective of this study was to identify genes regulated by methylation during normal septation in mice and during disordered septation in bronchopulmonary dysplasia. In mice, newborn lungs (preseptation) and adult lungs (postseptation) were evaluated by microarray analysis of gene expression and immunoprecipitation of methylated DNA followed by sequencing (MeDIP-Seq). In humans, microarray gene expression data were integrated with genome-wide DNA methylation data from bronchopulmonary dysplasia versus preterm and term lung. Genes with reciprocal changes in expression and methylation, suggesting regulation by DNA methylation, were identified. In mice, 95 genes with inverse correlation between expression and methylation during normal septation were identified. In addition to genes known to be important in lung development (Wnt signaling, Angpt2, Sox9, etc.) and its extracellular matrix (Tnc, Eln, etc.), genes involved with immune and antioxidant defense (Stat4, Sod3, Prdx6, etc.) were also observed. In humans, 23 genes were differentially methylated with reciprocal changes in expression in bronchopulmonary dysplasia compared with preterm or term lung. Genes of interest included those involved with detoxifying enzymes (Gstm3) and transforming growth factor-β signaling (bone morphogenetic protein 7 [Bmp7]). In terms of overlap, 20 genes and three pathways methylated during mouse lung development also demonstrated changes in methylation between preterm and term human lung. Changes in methylation correspond to altered expression of a number of genes associated with lung development, suggesting that DNA methylation of these genes may regulate normal and abnormal alveolar septation. PMID:25387348

  16. Cancer-associated loss of TARSH gene expression in human primary lung cancer.


    Terauchi, Kunihiko; Shimada, Junichi; Uekawa, Natsuko; Yaoi, Takeshi; Maruyama, Mitsuo; Fushiki, Shinji


    We have previously identified mouse Tarsh as one of the cellular senescence-related genes and showed the loss of expression of TARSH mRNA in four human lung cancer cell lines. TARSH is a presumptive signal transduction molecule interacting with NESH, which is implicated to have some roles in lung cancer metastasis. The amplification of complete ORF-encoding TARSH cDNA was done with reverse transcription-PCR. Northern blotting was carried out using TARSH cDNA probes. To clarify the relationship between TARSH and lung cancer, we quantified TARSH mRNA expression in 15 human lung cancer cell lines and 32 primary non-small cell lung cancers. We first determined the complete ORF-encoding cDNA sequence which is expressed in the human lung. On the Northern hybridization analysis, TARSH was strongly expressed in the human lung. The expression of TARSH mRNA is remarkably downregulated in all the lung cancer cell lines examined. Furthermore, TARSH expression was significantly low in all of the tumor specimens when compared to the expression in corresponding non-neoplastic lung tissue specimens. The cancer-associated transcriptional inactivation of TARSH suggests that TARSH could be used as a biomarker for lung cancer development as well as a molecular adjunct for lung carcinogenesis in human.

  17. Gene insertion and long-term expression in lung mediated by the Sleeping Beauty transposon system.


    Belur, Lalitha R; Frandsen, Joel L; Dupuy, Adam J; Ingbar, David H; Largaespada, David A; Hackett, Perry B; Scott McIvor, R


    Gene transfer to the lung could provide important new treatments for chronic and acquired lung diseases such as cystic fibrosis, alpha1-antitrypsin deficiency, emphysema, and cancer. DNA-mediated gene transfer to the lung has been previously demonstrated, but anticipated effectiveness has been limited by low gene transfer efficiencies and by transient expression of the transgene. Here, we combine plasmid-based gene transfer with the integrating capacity of the nonviral Sleeping Beauty (SB) transposon vector system to mediate gene insertion and long-term gene expression in mouse lung. We observed transgene expression after 24 h in lungs of all animals injected with the luciferase transposon (pT/L), but expression for up to 3 months required codelivery of a plasmid encoding the Sleeping Beauty transposase. We also observed long-term expression in pT/L-injected animals transgenic for SB transposase. Transgene expression was localized to the alveolar region of the lung, with transfection including mainly type II pneumocytes. We used a linker-mediated PCR technique to recover transposon flanking sequences, demonstrating transposition of pT/L into mouse chromosomal DNA of the lung.

  18. Shared Gene Expression Alterations in Nasal and Bronchial Epithelium for Lung Cancer Detection.



    We previously derived and validated a bronchial epithelial gene expression biomarker to detect lung cancer in current and former smokers. Given that bronchial and nasal epithelial gene expression are similarly altered by cigarette smoke exposure, we sought to determine if cancer-associated gene expression might also be detectable in the more readily accessible nasal epithelium. Nasal epithelial brushings were prospectively collected from current and former smokers undergoing diagnostic evaluation for pulmonary lesions suspicious for lung cancer in the AEGIS-1 (n = 375) and AEGIS-2 (n = 130) clinical trials and gene expression profiled using microarrays. All statistical tests were two-sided. We identified 535 genes that were differentially expressed in the nasal epithelium of AEGIS-1 patients diagnosed with lung cancer vs those with benign disease after one year of follow-up ( P  < .001). Using bronchial gene expression data from the AEGIS-1 patients, we found statistically significant concordant cancer-associated gene expression alterations between the two airway sites ( P  < .001). Differentially expressed genes in the nose were enriched for genes associated with the regulation of apoptosis and immune system signaling. A nasal lung cancer classifier derived in the AEGIS-1 cohort that combined clinical factors (age, smoking status, time since quit, mass size) and nasal gene expression (30 genes) had statistically significantly higher area under the curve (0.81; 95% confidence interval [CI] = 0.74 to 0.89, P  = .01) and sensitivity (0.91; 95% CI = 0.81 to 0.97, P  = .03) than a clinical-factor only model in independent samples from the AEGIS-2 cohort. These results support that the airway epithelial field of lung cancer-associated injury in ever smokers extends to the nose and demonstrates the potential of using nasal gene expression as a noninvasive biomarker for lung cancer detection.

  19. Ion Channel Gene Expression in Lung Adenocarcinoma: Potential Role in Prognosis and Diagnosis

    PubMed Central

    Ko, Jae-Hong; Gu, Wanjun; Lim, Inja; Bang, Hyoweon; Ko, Eun A.; Zhou, Tong


    Ion channels are known to regulate cancer processes at all stages. The roles of ion channels in cancer pathology are extremely diverse. We systematically analyzed the expression patterns of ion channel genes in lung adenocarcinoma. First, we compared the expression of ion channel genes between normal and tumor tissues in patients with lung adenocarcinoma. Thirty-seven ion channel genes were identified as being differentially expressed between the two groups. Next, we investigated the prognostic power of ion channel genes in lung adenocarcinoma. We assigned a risk score to each lung adenocarcinoma patient based on the expression of the differentially expressed ion channel genes. We demonstrated that the risk score effectively predicted overall survival and recurrence-free survival in lung adenocarcinoma. We also found that the risk scores for ever-smokers were higher than those for never-smokers. Multivariate analysis indicated that the risk score was a significant prognostic factor for survival, which is independent of patient age, gender, stage, smoking history, Myc level, and EGFR/KRAS/ALK gene mutation status. Finally, we investigated the difference in ion channel gene expression between the two major subtypes of non-small cell lung cancer: adenocarcinoma and squamous-cell carcinoma. Thirty ion channel genes were identified as being differentially expressed between the two groups. We suggest that ion channel gene expression can be used to improve the subtype classification in non-small cell lung cancer at the molecular level. The findings in this study have been validated in several independent lung cancer cohorts. PMID:24466154

  20. Ion channel gene expression in lung adenocarcinoma: potential role in prognosis and diagnosis.


    Ko, Jae-Hong; Gu, Wanjun; Lim, Inja; Bang, Hyoweon; Ko, Eun A; Zhou, Tong


    Ion channels are known to regulate cancer processes at all stages. The roles of ion channels in cancer pathology are extremely diverse. We systematically analyzed the expression patterns of ion channel genes in lung adenocarcinoma. First, we compared the expression of ion channel genes between normal and tumor tissues in patients with lung adenocarcinoma. Thirty-seven ion channel genes were identified as being differentially expressed between the two groups. Next, we investigated the prognostic power of ion channel genes in lung adenocarcinoma. We assigned a risk score to each lung adenocarcinoma patient based on the expression of the differentially expressed ion channel genes. We demonstrated that the risk score effectively predicted overall survival and recurrence-free survival in lung adenocarcinoma. We also found that the risk scores for ever-smokers were higher than those for never-smokers. Multivariate analysis indicated that the risk score was a significant prognostic factor for survival, which is independent of patient age, gender, stage, smoking history, Myc level, and EGFR/KRAS/ALK gene mutation status. Finally, we investigated the difference in ion channel gene expression between the two major subtypes of non-small cell lung cancer: adenocarcinoma and squamous-cell carcinoma. Thirty ion channel genes were identified as being differentially expressed between the two groups. We suggest that ion channel gene expression can be used to improve the subtype classification in non-small cell lung cancer at the molecular level. The findings in this study have been validated in several independent lung cancer cohorts.

  1. Gene Expression-Based Survival Prediction in Lung Adenocarcinoma: A Multi-Site, Blinded Validation Study

    PubMed Central

    Shedden, Kerby; Taylor, Jeremy M.G.; Enkemann, Steve A.; Tsao, Ming S.; Yeatman, Timothy J.; Gerald, William L.; Eschrich, Steve; Jurisica, Igor; Venkatraman, Seshan E.; Meyerson, Matthew; Kuick, Rork; Dobbin, Kevin K.; Lively, Tracy; Jacobson, James W.; Beer, David G.; Giordano, Thomas J.; Misek, David E.; Chang, Andrew C.; Zhu, Chang Qi; Strumpf, Dan; Hanash, Samir; Shepherd, Francis A.; Ding, Kuyue; Seymour, Lesley; Naoki, Katsuhiko; Pennell, Nathan; Weir, Barbara; Verhaak, Roel; Ladd-Acosta, Christine; Golub, Todd; Gruidl, Mike; Szoke, Janos; Zakowski, Maureen; Rusch, Valerie; Kris, Mark; Viale, Agnes; Motoi, Noriko; Travis, William; Sharma, Anupama


    Although prognostic gene expression signatures for survival in early stage lung cancer have been proposed, for clinical application it is critical to establish their performance across different subject populations and in different laboratories. Here we report a large, training-testing, multi-site blinded validation study to characterize the performance of several prognostic models based on gene expression for 442 lung adenocarcinomas. The hypotheses proposed examined whether microarray measurements of gene expression either alone or combined with basic clinical covariates (stage, age, sex) can be used to predict overall survival in lung cancer subjects. Several models examined produced risk scores that substantially correlated with actual subject outcome. Most methods performed better with clinical data, supporting the combined use of clinical and molecular information when building prognostic models for early stage lung cancer. This study also provides the largest available set of microarray data with extensive pathological and clinical annotation for lung adenocarcinomas. PMID:18641660

  2. The expression of p73 is increased in lung cancer, independent of p53 gene alteration

    PubMed Central

    Tokuchi, Y; Hashimoto, T; Kobayashi, Y; Hayashi, M; Nishida, K; Hayashi, S; Imai, K; Nakachi, K; Ishikawa, Y; Nakagawa, K; Kawakami, Y; Tsuchiya, E


    p73 gene, a new p53 homologue, has been identified: it supposedly acts as tumour suppressor gene in neuroblastoma. To clarify whether p73 might be involved in lung carcinogenesis, we examined p73 expression in resected lung cancer and paired normal lung in 60 cases using semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR). We also examined p73 gene status in three representative cases using Southern blot, and p53 gene alteration in 49 cases using PCR-single-strand conformation polymorphism (PCR-SSCP) and direct sequence. In 87% of the cases (52/60) p73 expression in tumour was more than twice as high as that in paired normal lung tissues, and the difference between p73 expression in tumour and normal lung tissue was significant (P < 0.0001). However, Southern blot analysis revealed that none of the cases showed p73 gene amplification. Compared with clinicopathological characteristics, p73 expression correlates significantly with histological differences and age of patient, independently (P < 0.05). Concerning p53 gene status, 43% (21/49) showed p53 gene alteration, but there was no correlation between p73 overexpression and p53 gene alteration. Our results suggest that need for further functional analysis of the role of p73 in lung carcinogenesis. © 1999 Cancer Research Campaign PMID:10408409

  3. Gene and Protein Expression of Fibronectin and Tenascin-C in Lung Samples from COPD Patients.


    Muñoz-Esquerre, Mariana; Huertas, Daniel; Escobar, Ignacio; López-Sánchez, Marta; Penín, Rosa; Peinado, Victor; Barberà, Joan Albert; Molina-Molina, María; Manresa, Frederic; Dorca, Jordi; Santos, Salud


    Fibronectin (Fn) and tenascin-C (TnC) are two extracellular matrix proteins associated with remodeling changes. Fn and TnC gene and protein expression in lung tissue, including their predominant location in bronchial and pulmonary artery structures, have not yet been fully evaluated. The aim of the present study was to assess: (1) gene expression of Fn and TnC in lung samples from chronic obstructive pulmonary disease (COPD) and non-COPD subjects; and (2) protein content and location of Fn and TnC in both groups. Consecutive subjects requiring lung resection due to lung cancer surgery were included. Lung specimens were examined for gene expression by quantitative real-time PCR (values expressed as fold change ratio). The analysis of their protein content and location was performed by western blot and immunohistochemical studies, respectively. Patients were divided into two cohorts according to COPD status. A total of 41 patients (20 with COPD and 21 without COPD) were included. An enhanced Fn gene expression was observed in the COPD group compared to the non-COPD group (4.73 ± 0.54 vs. 2.65 ± 0.57; P = 0.012), whereas no differences in gene TnC expression were observed (2.91 ± 0.44 vs. 2.60 ± 0.48; P = 0.633). No differences in lung protein content and location were found between groups. Immunohistochemical evaluation showed a predominantly vascular and bronchial location of Fn and TnC in both groups. An enhanced lung gene expression of Fn was observed in COPD subjects compared to non-COPD subjects. No differences were found in Fn protein expression or in TnC gene or protein expression among groups.

  4. Lung Adenocarcinoma and Squamous Cell Carcinoma Gene Expression Subtypes Demonstrate Significant Differences in Tumor Immune Landscape.


    Faruki, Hawazin; Mayhew, Gregory M; Serody, Jonathan S; Hayes, D Neil; Perou, Charles M; Lai-Goldman, Myla


    Molecular subtyping of lung adenocarcinoma (AD) and lung squamous cell carcinoma (SCC) reveal biologically diverse tumors that vary in their genomic and clinical attributes. Published immune cell signatures and several lung AD and SCC gene expression data sets, including The Cancer Genome Atlas, were used to examine immune response in relation to AD and SCC expression subtypes. Expression of immune cell populations and other immune related genes, including CD274 molecule gene (CD274) (programmed death ligand 1), was investigated in the tumor microenvironment relative to the expression subtypes of the AD (terminal respiratory unit, proximal proliferative, and proximal inflammatory) and SCC (primitive, classical, secretory, and basal) subtypes. Lung AD and SCC expression subtypes demonstrated significant differences in tumor immune landscape. The proximal proliferative subtype of AD demonstrated low immune cell expression among ADs whereas the secretory subtype showed elevated immune cell expression among SCCs. Tumor expression subtype was a better predictor of immune cell expression than CD274 (programmed death ligand 1) in SCC tumors but was a comparable predictor in AD tumors. Nonsilent mutation burden was not correlated with immune cell expression across subtypes; however, major histocompatibility complex class II gene expression was highly correlated with immune cell expression. Increased immune and major histocompatibility complex II gene expression was associated with improved survival in the terminal respiratory unit and proximal inflammatory subtypes of AD and in the primitive subtype of SCC. Molecular expression subtypes of lung AD and SCC demonstrate key and reproducible differences in immune host response. Evaluation of tumor expression subtypes as potential biomarkers for immunotherapy should be investigated. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  5. [Differential expression of genes that encode glycolysis enzymes in kidney and lung cancer in humans].


    Oparina, N Yu; Snezhkina, A V; Sadritdinova, A F; Veselovskii, V A; Dmitriev, A A; Senchenko, V N; Mel'nikova, N V; Speranskaya, A S; Darii, M V; Stepanov, O A; Barkhatov, I M; Kudryavtseva, A V


    Glycolysis is a main catabolic pathway of glucose metabolism, accompanied by ATP synthesis. More than 30 enzymes are involved in glycolysis, and genes that encode them can be considered housekeeping genes due to the high conservatism and evolutionary antiquity of the process. We studied the expression of these genes in kidney papillary cancer and planocellular lung cancer via the bioinformatic analysis of transcriptome database and method of quantitative real time PCR. Quantitative analysis of mRNA level demonstrated that only a part ofgenes that encode glycolysis enzymes maintain relatively stable mRNA level, including the HK1, ADPGK, GPI, PGK1, and PKM2 genes in kidney papillary cancer and the ADPGK, ALDOA, GAPDH, PGK1, BPGM, ENO1, and PKM2 genes in planocellular lung cancer. The frequent increase in the mRNA expression of PFKP, ALDOA, and GAPDH genes in kidney cancer, as well as the GPI gene in lung cancer, were detected for the first time by real time PCR. For other genes, their differential expression was demonstrated; the cases of both a decrease and increase in the mRNA level were detected. Thus, several genes that can be used as control genes in transcriptome analysis by real time PCR in kidney and lung cancer, as well as a number of differentially expressed genes that can be potential oncomarkers, were identified.

  6. Gene expression profiling in mouse lung following polymeric hexamethylene diisocyanate exposure

    SciTech Connect

    Lee, C.-T.; Ylostalo, Joni; Friedman, Mitchell; Hoyle, Gary W. . E-mail:


    Isocyanates are a common cause of occupational lung disease. Hexamethylene diisocyanate (HDI), a component of polyurethane spray paints, can induce respiratory symptoms, inflammation, lung function impairment, and isocyanate asthma. The predominant form of HDI in polyurethane paints is a nonvolatile polyisocyanate known as HDI biuret trimer (HDI-BT). Exposure of mice to aerosolized HDI-BT results in pathological effects, including pulmonary edema, lung inflammation, cellular proliferation, and fibrotic lesions, which occur with distinct time courses following exposure. To identify genes that mediate lung pathology in the distinct temporal phases after exposure, gene expression profiles in HDI-BT-exposed C57BL/6J mouse lungs were analyzed. RNase protection assay (RPA) of genes involved in apoptosis, cell survival, and inflammation revealed increased expression of I{kappa}B{alpha}, Fas, Bcl-X{sub L}, TNF{alpha}, KC, MIP-2, IL-6, and GM-CSF following HDI-BT exposure. Microarray analysis of approximately 10 000 genes was performed on lung RNA collected from mice 6, 18, and 90 h after HDI-BT exposure and from unexposed mice. Classes of genes whose expression was increased 6 h after exposure included those involved in stress responses (particularly oxidative stress and thiol redox balance), growth arrest, apoptosis, signal transduction, and inflammation. Types of genes whose expression was increased at 18 h included proteinases, anti-proteinases, cytoskeletal molecules, and inflammatory mediators. Transcripts increased at 90 h included extracellular matrix components, transcription factors, inflammatory mediators, and cell cycle regulators. This characterization of the gene expression profile in lungs exposed to HDI-BT will provide a basis for investigating injury and repair pathways that are operative during isocyanate-induced lung disease.

  7. Smoking-Related Gene Expression in Laser Capture Microdissected Human Lung

    PubMed Central

    Tan, Xiang-Lin; Wang, Tao; Xiong, Shengli; Kumar, Shalini V.; Han, Weiguo; Spivack, Simon D.


    Purpose Inter-individual differences in quantitative expression could underlie a propensity for lung cancer. To determine precise individual gene expression signatures on a lung compartment-specific basis, we investigated the expression of carcinogen metabolism genes encoding cytochromes P450 (CYP) 1B1, 2A13, glutathione S-transferase (GST) P1, and a tumor suppressor gene p16 in laser capture microdissected samples of human alveolar compartment (AC) and bronchial epithelial compartment (BEC) lung tissue from 62 smokers and non-smokers. Experimental Design Tobacco exposure was determined by plasma nicotine, cotinine, and smoking history. Precise mRNA expression was determined using our RNA-specific qRT-PCR strategy, and correlated with detailed demographic and clinical characteristics. Results Several correlations of mRNA expression included: (a) CYP1B1 in AC (positively with plasma nicotine level, P = 0.008; plasma cotinine level, P = 0.001); (b) GSTP1 in AC (positively with plasma cotinine level, P = 0.003); (c) GSTP1 in BEC (negatively with smoke dose, P = 0.043; occupational risk, P = 0.019). CYP2A13 was rarely expressed in AC, and not expressed in BEC. p16 expression was not correlated with any measured factor. For each gene, subjects showed expression that was individually concordant between these compartments. No clear association of mRNA expression with lung cancer risk was observed in this pilot analysis. Conclusions The association between lung mRNA expression and tobacco exposure implies that gene-tobacco interaction is a measurable quantitative trait, albeit with wide inter-individual variation. Gene expression tends to be concordant for alveolar and bronchial compartments for these genes in an individual, controlling for proximate tobacco exposure. PMID:19996203

  8. Smoking-Related Gene Expression in Laser Capture-Microdissected Human Lung.


    Tan, Xiang-Lin; Wang, Tao; Xiong, Shengli; Kumar, Shalini V; Han, Weiguo; Spivack, Simon D


    PURPOSE: Interindividual differences in quantitative expression could underlie a propensity for lung cancer. To determine precise individual gene expression signatures on a lung compartment-specific basis, we investigated the expression of carcinogen metabolism genes encoding cytochromes P450 (CYP) 1B1, 2A13, GSTP1, and a tumor suppressor gene p16 in laser capture-microdissected samples of human alveolar compartment (AC) and bronchial epithelial compartment (BEC) lung tissue from 62 smokers and nonsmokers. EXPERIMENTAL DESIGN: Tobacco exposure was determined by plasma nicotine, cotinine, and smoking history. Precise mRNA expression was determined using our RNA-specific qRT-PCR strategy, and correlated with detailed demographic and clinical characteristics. RESULTS: Several correlations of mRNA expression included (a) CYP1B1 in AC (positively with plasma nicotine level, P = 0.008; plasma cotinine level, P = 0.001), (b) GSTP1 in AC (positively with plasma cotinine level, P = 0.003), and (c) GSTP1 in BEC (negatively with smoke dose, P = 0.043; occupational risk, P = 0.019). CYP2A13 was rarely expressed in AC and not expressed in BEC. p16 expression was not correlated with any measured factor. For each gene, subjects showed expression that was individually concordant between these compartments. No clear association of mRNA expression with lung cancer risk was observed in this pilot analysis. CONCLUSIONS: The association between lung mRNA expression and tobacco exposure implies that gene-tobacco interaction is a measurable quantitative trait, albeit with wide interindividual variation. Gene expression tends to be concordant for alveolar and bronchial compartments for these genes in an individual, controlling for proximate tobacco exposure. (Clin Cancer Res 2009;15(24):7562-70).

  9. Heme-related gene expression signatures of meat intakes in lung cancer tissues.


    Lam, Tram Kim; Rotunno, Melissa; Ryan, Brid M; Pesatori, Angela C; Bertazzi, Pier Alberto; Spitz, Margaret; Caporaso, Neil E; Landi, Maria Teresa


    Lung cancer causes more deaths worldwide than any other cancer. In addition to cigarette smoking, dietary factors may contribute to lung carcinogenesis. Epidemiologic studies, including the environment and genetics in lung cancer etiology (EAGLE), have reported increased consumption of red/processed meats to be associated with higher risk of lung cancer. Heme-iron toxicity may link meat intake with cancer. We investigated this hypothesis in meat-related lung carcinogenesis using whole genome expression. We measured genome-wide expression (HG-U133A) in 49 tumor and 42 non-involved fresh frozen lung tissues of 64 adenocarcinoma EAGLE patients. We studied gene expression profiles by high-versus-low meat consumption, with and without adjustment by sex, age, and smoking. Threshold for significance was a false discovery rate (FDR) ≤ 0.15. We studied whether the identified genes played a role in heme-iron related processes by means of manually curated literature search and gene ontology-based pathway analysis. We found that gene expression of 232 annotated genes in tumor tissue significantly distinguished lung adenocarcinoma cases who consumed above/below the median intake of fresh red meats (FDR = 0.12). Sixty-three (∼ 28%) of the 232 identified genes (12 expected by chance, P-value < 0.001) were involved in heme binding, absorption, transport, and Wnt signaling pathway (e.g., CYPs, TPO, HPX, HFE, SLCs, and WNTs). We also identified several genes involved in lipid metabolism (e.g., NCR1, TNF, and UCP3) and oxidative stress (e.g., TPO, SGK2, and MTHFR) that may be indirectly related to heme-toxicity. The study's results provide preliminary evidence that heme-iron toxicity might be one underlying mechanism linking fresh red meat intake and lung cancer.

  10. SEGEL: A Web Server for Visualization of Smoking Effects on Human Lung Gene Expression.


    Xu, Yan; Hu, Brian; Alnajm, Sammy S; Lu, Yin; Huang, Yangxin; Allen-Gipson, Diane; Cheng, Feng


    Cigarette smoking is a major cause of death worldwide resulting in over six million deaths per year. Cigarette smoke contains complex mixtures of chemicals that are harmful to nearly all organs of the human body, especially the lungs. Cigarette smoking is considered the major risk factor for many lung diseases, particularly chronic obstructive pulmonary diseases (COPD) and lung cancer. However, the underlying molecular mechanisms of smoking-induced lung injury associated with these lung diseases still remain largely unknown. Expression microarray techniques have been widely applied to detect the effects of smoking on gene expression in different human cells in the lungs. These projects have provided a lot of useful information for researchers to understand the potential molecular mechanism(s) of smoke-induced pathogenesis. However, a user-friendly web server that would allow scientists to fast query these data sets and compare the smoking effects on gene expression across different cells had not yet been established. For that reason, we have integrated eight public expression microarray data sets from trachea epithelial cells, large airway epithelial cells, small airway epithelial cells, and alveolar macrophage into an online web server called SEGEL (Smoking Effects on Gene Expression of Lung). Users can query gene expression patterns across these cells from smokers and nonsmokers by gene symbols, and find the effects of smoking on the gene expression of lungs from this web server. Sex difference in response to smoking is also shown. The relationship between the gene expression and cigarette smoking consumption were calculated and are shown in the server. The current version of SEGEL web server contains 42,400 annotated gene probe sets represented on the Affymetrix Human Genome U133 Plus 2.0 platform. SEGEL will be an invaluable resource for researchers interested in the effects of smoking on gene expression in the lungs. The server also provides useful information

  11. Gene expression profile in newborn rat lungs after two days of recovery of mechanical ventilation.


    Dénervaud, Valérie; Gremlich, Sandrine; Trummer-Menzi, Eliane; Schittny, Johannes C; Roth-Kleiner, Matthias


    Preterm infants having immature lungs often require respiratory support, potentially leading to bronchopulmonary dysplasia (BPD). Conventional BPD rodent models based on mechanical ventilation (MV) present outcome measured at the end of the ventilation period. A reversible intubation and ventilation model in newborn rats recently allowed discovering that different sets of genes modified their expression related to time after MV. In a newborn rat model, the expression profile 48 h after MV was analyzed with gene arrays to detect potentially interesting candidates with an impact on BPD development. Rat pups were injected P4-5 with 2 mg/kg lipopolysaccharide (LPS). One day later, MV with 21 or 60% oxygen was applied during 6 h. Animals were sacrified 48 h after end of ventilation. Affymetrix gene arrays assessed the total gene expression profile in lung tissue. In fully treated animals (LPS + MV + 60% O(2)) vs. controls, 271 genes changed expression significantly. All modified genes could be classified in six pathways: tissue remodeling/wound repair, immune system and inflammatory response, hematopoiesis, vasodilatation, and oxidative stress. Major alterations were found in the MMP and complement system. MMPs and complement factors play a central role in several of the pathways identified and may represent interesting targets for BPD treatment/prevention.Bronchopulmonary dysplasia (BPD) is a chronic lung disease occurring in ~30% of preterm infants born less than 30 wk of gestation (1). Its main risk factors include lung immaturity due to preterm delivery, mechanical ventilation (MV), oxygen toxicity, chorioamnionitis, and sepsis. The main feature is an arrest of alveolar and capillary formation (2). Models trying to decipher genes involved in the pathophysiology of BPD are mainly based on MV and oxygen application to young mammals with immature lungs of different species (3). In newborn rodent models, analyses of lung structure and gene and protein

  12. Gene expression profiling allows distinction between primary and metastatic squamous cell carcinomas in the lung.


    Talbot, Simon G; Estilo, Cherry; Maghami, Ellie; Sarkaria, Inderpal S; Pham, Duy Khanh; O-charoenrat, Pornchai; Socci, Nicholas D; Ngai, Ivan; Carlson, Diane; Ghossein, Ronald; Viale, Agnes; Park, Bernard J; Rusch, Valerie W; Singh, Bhuvanesh


    Lung neoplasms commonly develop in patients previously treated for head and neck carcinomas. The derivation of these tumors, either as new primary lung cancers or as metastatic head and neck cancers, is difficult to establish based on clinical or histopathologic criteria since both are squamous cell carcinomas and have identical features under light microscopy. However, this distinction has significant treatment and prognostic implications. Gene expression profiling was performed on a panel of 52 sequentially collected patients with either primary lung (n = 21) or primary head and neck (n = 31) carcinomas using the Affymetrix HG_U95Av2 high-density oligonucleotide microarray. Unsupervised hierarchical clustering with Ward linkage and the Pearson correlation metric was performed. To assess robustness, bootstrap resampling was performed with 1,000 iterations. A t test of the normalized values for each gene was used to determine the genes responsible for segregating head and neck from lung primary carcinomas, and those with the most differential expression were used for later analyses. In the absence of a large "test" set of tumors, we used a supervised leave-one-out cross-validation to test how well we could predict the tumor origin. Once a gene expression profile was established, 12 lung lesions taken from patients with previously treated head and neck cancers were similarly analyzed by gene expression profiling to determine their sites of origin. Unsupervised clustering analysis separated the study cohort into two distinct groups which reliably remained segregated with bootstrap resampling. Group 1 consisted of 30 tongue carcinomas. Group 2 consisted of 21 lung cancers and 1 tongue carcinoma. The clustering was not changed even when normal lung or tongue profiles were subtracted from the corresponding carcinomatous lesions, and a leave-one-out cross-validation showed a 98% correct prediction (see Supplementary Data 1). A minimum set of 500 genes required to

  13. Insulin-like growth factor-I gene expression in three models of accelerated lung growth.


    Nobuhara, K K; DiFiore, J W; Ibla, J C; Siddiqui, A M; Ferretti, M L; Fauza, D O; Schnitzer, J J; Wilson, J M


    We have learned previously that in utero tracheal ligation reverses the structural and physiological effects of surgically created congenital diaphragmatic hernia. In addition, we have discovered that postnatal lung growth similarly can be accelerated using liquid-based airway distension with perfluorocarbon. Another model of accelerated lung growth is that of compensatory growth seen after neonatal pneumonectomy. In all of these models, growth has occurred because of an increase in alveolar number rather than enlargement of preexisting alveoli. However, the molecular mechanisms underlying these processes remain unknown. The purpose of this study was to determine if gene expression could be altered by changes in physical forces in the prenatal and postnatal lung. The three models of accelerated lung growth studied were the following: (1) The prenatal group, consisted of fetal lambs (n = 12) that underwent the surgical creation of a left diaphragmatic hernia at 90 days' gestation. Six of these animals also underwent simultaneous tracheal ligation. (2) The PFC group consisted of five neonatal animals that underwent isolation of the superior segment of the right upper lobe, with intrabronchial distension with perfluorocarbon to 7 to 10 mm Hg pressure for a 3-week period. (3) The postpneumonectomy group consisted of four neonatal animals that underwent left pneumonectomy. In the fetal study, lungs were retrieved at term (130 days), and in the postnatal study, lungs were retrieved 3 weeks after initial intervention. In all cases, RNA was extracted from snap-frozen lung samples and Northern blot analysis performed. Insulinlike growth factor-I, insulinlike growth factor-II, and vascular endothelial growth factor gene expression were analyzed by densitometry. Insulinlike growth factor-I gene expression was found to be decreased in association with experimental diaphragmatic hernia (P = .005), but restored to normal with tracheal ligation. Insulinlike growth factor-I gene

  14. Gene expression profiling and non-small-cell lung cancer: where are we now?


    Santos, Edgardo S; Blaya, Marcelo; Raez, Luis E


    Despite new developments in molecular techniques and better knowledge on lung cancer tumor biology, many genetic alterations associated with the development and progression of lung carcinogenesis still remain unclear. Although the development of targeted agents has improved response rates and survival, lung cancer has a very high mortality rate, even for early stages. Thus, there is a greater need for other mechanisms or technologies that may help us diagnose, predict, and treat patients with lung cancer in a more effective way. One of these technologies has been the use of genomics. Some of the available genomic technologies include single-nucleotide polymorphism analysis, high-throughput capillary sequencing, serial analysis of gene expression, and gene expression arrays. DNA microarray analysis is capable of discovering changes in DNA expression within the neoplastic tumor. Thus, gene expression array could help us to decipher the complexity and interaction of different oncogenic pathways and, hence, could contribute to the selection of better targeted agents on an individual basis rather than a general and nonspecific approach as it has been done for many decades. Several studies initiated a few years ago have started to produce fruitful results. Herein, we review the role of gene expression profiling in lung cancer as a diagnostic tool, predictive and prognostic biomarker, and its potential use for a "personalized" medicine in the years to come.

  15. Regulated gene expression in cultured type II cells of adult human lung

    PubMed Central

    Lee, Jae W.; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R.; Fischer, Horst; Illek, Beate; Gonzales, Linda W.; Kolla, Venkatadri; Matthay, Michael A.


    Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at ∼95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days on collagen-coated dishes with or without DCI for the final 3 days. In freshly isolated cells, highly expressed genes included SFTPA/B/C, SCGB1A, IL8, CXCL2, and SFN in addition to ubiquitously expressed genes. Transcript abundance was correlated between fetal and adult cells (r = 0.88), with a subset of 187 genes primarily related to inflammation and immunity that were expressed >10-fold higher in adult cells. During control culture, expression increased for 8.1% of expressed genes and decreased for ∼4% including 118 immune response and 10 surfactant-related genes. DCI treatment promoted lamellar body production and increased expression of ∼3% of probed genes by ≥1.5-fold; 40% of these were also induced in fetal cells. Highly induced genes (≥10-fold) included PGC, ZBTB16, DUOX1, PLUNC, CIT, and CRTAC1. Twenty-five induced genes, including six genes related to surfactant (SFTPA/B/C, PGC, CEBPD, and ADFP), also had decreased expression during control culture and thus are candidates for hormonal regulation in vivo. Our results further define the adult human type II cell molecular phenotype and demonstrate that a subset of genes remains hormone responsive in cultured adult cells. PMID:20382749

  16. Phase I Metabolic Genes and Risk of Lung Cancer: Multiple Polymorphisms and mRNA Expression

    PubMed Central

    Rotunno, Melissa; Yu, Kai; Lubin, Jay H.; Consonni, Dario; Pesatori, Angela C.; Goldstein, Alisa M.; Goldin, Lynn R.; Wacholder, Sholom; Burdette, Laurie; Chanock, Stephen J.; Bertazzi, Pier Alberto; Tucker, Margaret A.; Caporaso, Neil E.; Chatterjee, Nilanjan; Bergen, Andrew W.; Landi, Maria Teresa


    Polymorphisms in genes coding for enzymes that activate tobacco lung carcinogens may generate inter-individual differences in lung cancer risk. Previous studies had limited sample sizes, poor exposure characterization, and a few single nucleotide polymorphisms (SNPs) tested in candidate genes. We analyzed 25 SNPs (some previously untested) in 2101 primary lung cancer cases and 2120 population controls from the Environment And Genetics in Lung cancer Etiology (EAGLE) study from six phase I metabolic genes, including cytochrome P450s, microsomal epoxide hydrolase, and myeloperoxidase. We evaluated the main genotype effects and genotype-smoking interactions in lung cancer risk overall and in the major histology subtypes. We tested the combined effect of multiple SNPs on lung cancer risk and on gene expression. Findings were prioritized based on significance thresholds and consistency across different analyses, and accounted for multiple testing and prior knowledge. Two haplotypes in EPHX1 were significantly associated with lung cancer risk in the overall population. In addition, CYP1B1 and CYP2A6 polymorphisms were inversely associated with adenocarcinoma and squamous cell carcinoma risk, respectively. Moreover, the association between CYP1A1 rs2606345 genotype and lung cancer was significantly modified by intensity of cigarette smoking, suggesting an underling dose-response mechanism. Finally, increasing number of variants at CYP1A1/A2 genes revealed significant protection in never smokers and risk in ever smokers. Results were supported by differential gene expression in non-tumor lung tissue samples with down-regulation of CYP1A1 in never smokers and up-regulation in smokers from CYP1A1/A2 SNPs. The significant haplotype associations emphasize that the effect of multiple SNPs may be important despite null single SNP-associations, and warrants consideration in genome-wide association studies (GWAS). Our findings emphasize the necessity of post-GWAS fine mapping and

  17. Lung tissues in systemic sclerosis have gene expression patterns unique to pulmonary fibrosis and pulmonary hypertension

    PubMed Central

    Hsu, Eileen; Shi, Haiwen; Jordan, Rick M.; Lyons-Weiler, James; Pilewski, Joseph M.; Feghali-Bostwick, Carol A.


    Objective Pulmonary complications in systemic sclerosis (SSc), including pulmonary fibrosis (PF) and pulmonary arterial hypertension (PAH), are the leading cause of mortality. We compared the molecular fingerprint of SSc lung tissues and matching primary lung fibroblasts to those of normal donors, and patients with idiopathic pulmonary fibrosis (IPF) and idiopathic pulmonary arterial hypertension (IPAH). Methods Lung tissues were obtained from 33 patients with SSc who underwent lung transplantation. Tissues and cells from a subgroup of SSc patients with predominantly PF or PAH were compared to those from normal donors, patients with IPF, or IPAH. Microarray data was analyzed using Efficiency Analysis for determination of optimal data processing methods. Real time PCR and immunohistochemistry were used to confirm differential levels of mRNA and protein, respectively. Results We identified a consensus of 242 and 335 genes that were differentially expressed in lungs and primary fibroblasts, respectively. Enriched function groups in SSc-PF and IPF lungs included fibrosis, insulin-like growth factor signaling and caveolin-mediated endocytosis. Functional groups shared by SSc-PAH and IPAH lungs included antigen presentation, chemokine activity, and IL-17 signaling. Conclusion Using microarray analysis on carefully phenotyped SSc and comparator lung tissues, we demonstrated distinct molecular profiles in tissues and fibroblasts of patients with SSc-associated lung disease compared to idiopathic forms of lung disease. Unique molecular signatures were generated that are disease- (SSc) and phenotype- (PF vs PAH) specific. These signatures provide new insights into pathogenesis and potential therapeutic targets for SSc lung disease. PMID:21360508

  18. Disease-specific gene expression profiling in multiple models of lung disease.


    Lewis, Christina C; Yang, Jean Yee Hwa; Huang, Xiaozhu; Banerjee, Suman K; Blackburn, Michael R; Baluk, Peter; McDonald, Donald M; Blackwell, Timothy S; Nagabhushanam, Vijaya; Peters, Wendy; Voehringer, David; Erle, David J


    Microarray technology is widely employed for studying the molecular mechanisms underlying complex diseases. However, analyses of individual diseases or models of diseases frequently yield extensive lists of differentially expressed genes with uncertain relationships to disease pathogenesis. To compare gene expression changes in a heterogeneous set of lung disease models in order to identify common gene expression changes seen in diverse forms of lung pathology, as well as relatively small subsets of genes likely to be involved in specific pathophysiological processes. We profiled lung gene expression in 12 mouse models of infection, allergy, and lung injury. A linear model was used to estimate transcript expression changes for each model, and hierarchical clustering was used to compare expression patterns between models. Selected expression changes were verified by quantitative polymerase chain reaction. A total of 24 transcripts, including many involved in inflammation and immune activation, were differentially expressed in a substantial majority (9 or more) of the models. Expression patterns distinguished three groups of models: (1) bacterial infection (n = 5), with changes in 89 transcripts, including many related to nuclear factor-kappaB signaling, cytokines, chemokines, and their receptors; (2) bleomycin-induced diseases (n = 2), with changes in 53 transcripts, including many related to matrix remodeling and Wnt signaling; and (3) T helper cell type 2 (allergic) inflammation (n = 5), with changes in 26 transcripts, including many encoding epithelial secreted molecules, ion channels, and transporters. This multimodel dataset highlights novel genes likely involved in various pathophysiological processes and will be a valuable resource for the investigation of molecular mechanisms underlying lung disease pathogenesis.

  19. Foxp transcription factors suppress a non-pulmonary gene expression program to permit proper lung development.


    Li, Shanru; Morley, Michael; Lu, MinMin; Zhou, Su; Stewart, Kathleen; French, Catherine A; Tucker, Haley O; Fisher, Simon E; Morrisey, Edward E


    The inhibitory mechanisms that prevent gene expression programs from one tissue to be expressed in another are poorly understood. Foxp1/2/4 are forkhead transcription factors that repress gene expression and are individually important for endoderm development. We show that combined loss of all three Foxp1/2/4 family members in the developing anterior foregut endoderm leads to a loss of lung endoderm lineage commitment and subsequent development. Foxp1/2/4 deficient lungs express high levels of transcriptional regulators not normally expressed in the developing lung, including Pax2, Pax8, Pax9 and the Hoxa9-13 cluster. Ectopic expression of these transcriptional regulators is accompanied by decreased expression of lung restricted transcription factors including Nkx2-1, Sox2, and Sox9. Foxp1 binds to conserved forkhead DNA binding sites within the Hoxa9-13 cluster, indicating a direct repression mechanism. Thus, Foxp1/2/4 are essential for promoting lung endoderm development by repressing expression of non-pulmonary transcription factors.

  20. Selection of Reference Genes for Gene Expression Studies related to lung injury in a preterm lamb model

    PubMed Central

    Pereira-Fantini, Prue M.; Rajapaksa, Anushi E.; Oakley, Regina; Tingay, David G.


    Preterm newborns often require invasive support, however even brief periods of supported ventilation applied inappropriately to the lung can cause injury. Real-time quantitative reverse transcriptase-PCR (qPCR) has been extensively employed in studies of ventilation-induced lung injury with the reference gene 18S ribosomal RNA (18S RNA) most commonly employed as the internal control reference gene. Whilst the results of these studies depend on the stability of the reference gene employed, the use of 18S RNA has not been validated. In this study the expression profile of five candidate reference genes (18S RNA, ACTB, GAPDH, TOP1 and RPS29) in two geographical locations, was evaluated by dedicated algorithms, including geNorm, Normfinder, Bestkeeper and ΔCt method and the overall stability of these candidate genes determined (RefFinder). Secondary studies examined the influence of reference gene choice on the relative expression of two well-validated lung injury markers; EGR1 and IL1B. In the setting of the preterm lamb model of lung injury, RPS29 reference gene expression was influenced by tissue location; however we determined that individual ventilation strategies influence reference gene stability. Whilst 18S RNA is the most commonly employed reference gene in preterm lamb lung studies, our results suggest that GAPDH is a more suitable candidate. PMID:27210246

  1. Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis

    NASA Astrophysics Data System (ADS)

    Kaminski, Naftali; Allard, John D.; Pittet, Jean F.; Zuo, Fengrong; Griffiths, Mark J. D.; Morris, David; Huang, Xiaozhu; Sheppard, Dean; Heller, Renu A.


    The molecular mechanisms of pulmonary fibrosis are poorly understood. We have used oligonucleotide arrays to analyze the gene expression programs that underlie pulmonary fibrosis in response to bleomycin, a drug that causes lung inflammation and fibrosis, in two strains of susceptible mice (129 and C57BL/6). We then compared the gene expression patterns in these mice with 129 mice carrying a null mutation in the epithelial-restricted integrin 6 subunit (6/-), which develop inflammation but are protected from pulmonary fibrosis. Cluster analysis identified two distinct groups of genes involved in the inflammatory and fibrotic responses. Analysis of gene expression at multiple time points after bleomycin administration revealed sequential induction of subsets of genes that characterize each response. The availability of this comprehensive data set should accelerate the development of more effective strategies for intervention at the various stages in the development of fibrotic diseases of the lungs and other organs.

  2. [Effect of cisplatin on the expression of Pokemon gene: experiment with different human lung cancer cells].


    Zhao, Zhi-Hong; Wang, Sheng-Fa; Yu, Liang; Wang, Ju; Cong, De-Gang; Chang, Hao; Wang, Xue-Feng; Zhang, Tie-Wa; Zhang, Jian; Fu, Kai; Jiang, Jiu-Yang


    To investigate the correlation between Pokemon gene and cisplatin mechanism. Human lung adenocarcinoma cells of the lines A549 and AGZY83-a, human lung squamous carcinoma cells of the line HE-99, and human giant cell lung cancer cells of the line 95D were cultured and cisplatin was added into the medium. Other lung cancer cells of the above mentioned lines were cultured in the medium without cisplatin and were used as control groups. RT-PCR and Western blotting were used to detect the mRNA and protein expression of Pokemon. Pokemon mRNA and protein were expressed highly in all the 4 cell lines. The Pokemon gene expression did not changed significantly after cisplatin treatment groups. There were not significant differences in the mRNA and protein expression of Pokemon among the 4 experiment groups and the control groups (all P > 0.05). Cisplatin has no effect on the Pokemon gene expression of the human lung cancer cells.

  3. The down-regulated ING5 expression in lung cancer: A potential target of gene therapy

    PubMed Central

    Zhao, Shuang; Yang, Xue-feng; Shen, Dao-fu; Gao, Yang; Shi, Shuai; Wu, Ji-cheng; Liu, Hong-xu; Sun, Hong-zhi; Su, Rong-jian; Zheng, Hua-chuan


    ING5 can interact with p53, thereby inhibiting cell growth and inducing apoptosis. We found that ING5 overexpression not only inhibited proliferation, migration, and invasion, but also induced G2 arrest, differentiation, autophagy, apoptosis, glycolysis and mitochondrial respiration in lung cancer cells. ING5 transfection up-regulated the expression of Cdc2, ATG13, ATG14, Beclin-1, LC-3B, AIF, cytochrome c, Akt1/2/3, ADFP, PFK-1 and PDPc, while down-regulated the expression of Bcl-2, XIAP, survivin,β-catenin and HXK1. ING5 transfection desensitized cells to the chemotherapy of MG132, paclitaxel, and SAHA, which paralleled with apoptotic alteration. ING5 overexpression suppressed the xenograft tumor growth by inhibiting proliferation and inducing apoptosis. ING5 expression level was significantly higher in normal tissue than that in lung cancer at both protein and mRNA levels. Nuclear ING5 expression was positively correlated with ki-67 expression and cytoplasmic ING5 expression. Cytoplasmic ING5 expression was positively associated with lymph node metastasis, and negatively with age, lymphatic invasion or CPP32 expression. ING5 expression was different in histological classification: squamous cell carcinoma > adenocarcinoma > large cell carcinoma > small cell carcinoma. Taken together, our data suggested that ING5 downregulation might involved in carcinogenesis, growth, and invasion of lung cancer and could be considered as a promising marker to gauge the aggressiveness of lung cancer. It might be employed as a potential target for gene therapy of lung cancer. PMID:27409347

  4. Impact of Cigarette Smoke on the Human and Mouse Lungs: A Gene-Expression Comparison Study

    PubMed Central

    Morissette, Mathieu C.; Lamontagne, Maxime; Bérubé, Jean-Christophe; Gaschler, Gordon; Williams, Andrew; Yauk, Carole; Couture, Christian; Laviolette, Michel; Hogg, James C.; Timens, Wim; Halappanavar, Sabina; Stampfli, Martin R.; Bossé, Yohan


    Cigarette smoke is well known for its adverse effects on human health, especially on the lungs. Basic research is essential to identify the mechanisms involved in the development of cigarette smoke-related diseases, but translation of new findings from pre-clinical models to the clinic remains difficult. In the present study, we aimed at comparing the gene expression signature between the lungs of human smokers and mice exposed to cigarette smoke to identify the similarities and differences. Using human and mouse whole-genome gene expression arrays, changes in gene expression, signaling pathways and biological functions were assessed. We found that genes significantly modulated by cigarette smoke in humans were enriched for genes modulated by cigarette smoke in mice, suggesting a similar response of both species. Sixteen smoking-induced genes were in common between humans and mice including six newly reported to be modulated by cigarette smoke. In addition, we identified a new conserved pulmonary response to cigarette smoke in the induction of phospholipid metabolism/degradation pathways. Finally, the majority of biological functions modulated by cigarette smoke in humans were also affected in mice. Altogether, the present study provides information on similarities and differences in lung gene expression response to cigarette smoke that exist between human and mouse. Our results foster the idea that animal models should be used to study the involvement of pathways rather than single genes in human diseases. PMID:24663285

  5. Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer.


    Spira, Avrum; Beane, Jennifer E; Shah, Vishal; Steiling, Katrina; Liu, Gang; Schembri, Frank; Gilman, Sean; Dumas, Yves-Martine; Calner, Paul; Sebastiani, Paola; Sridhar, Sriram; Beamis, John; Lamb, Carla; Anderson, Timothy; Gerry, Norman; Keane, Joseph; Lenburg, Marc E; Brody, Jerome S


    Lung cancer is the leading cause of death from cancer in the US and the world. The high mortality rate (80-85% within 5 years) results, in part, from a lack of effective tools to diagnose the disease at an early stage. Given that cigarette smoke creates a field of injury throughout the airway, we sought to determine if gene expression in histologically normal large-airway epithelial cells obtained at bronchoscopy from smokers with suspicion of lung cancer could be used as a lung cancer biomarker. Using a training set (n = 77) and gene-expression profiles from Affymetrix HG-U133A microarrays, we identified an 80-gene biomarker that distinguishes smokers with and without lung cancer. We tested the biomarker on an independent test set (n = 52), with an accuracy of 83% (80% sensitive, 84% specific), and on an additional validation set independently obtained from five medical centers (n = 35). Our biomarker had approximately 90% sensitivity for stage 1 cancer across all subjects. Combining cytopathology of lower airway cells obtained at bronchoscopy with the biomarker yielded 95% sensitivity and a 95% negative predictive value. These findings indicate that gene expression in cytologically normal large-airway epithelial cells can serve as a lung cancer biomarker, potentially owing to a cancer-specific airway-wide response to cigarette smoke.

  6. Proteases and oxidant stress control organic dust induction of inflammatory gene expression in lung epithelial cells.


    Natarajan, Kartiga; Gottipati, Koteswara R; Berhane, Kiflu; Samten, Buka; Pendurthi, Usha; Boggaram, Vijay


    Persistant inflammatory responses to infectious agents and other components in organic dust underlie lung injury and development of respiratory diseases. Organic dust components responsible for eliciting inflammation and the mechanisms by which they cause lung inflammation are not fully understood. We studied the mechanisms by which protease activities in poultry dust extracts and intracellular oxidant stress induce inflammatory gene expression in A549 and Beas2B lung epithelial cells. The effects of dust extracts on inflammatory gene expression were analyzed by quantitative polymerase chain reaction (qPCR), enzyme linked immunosorbent (ELISA) and western blot assays. Oxidant stress was probed by dihydroethidium (DHE) labeling, and immunostaining for 4-hydroxynonenal (4-HNE). Effects on interleukin-8 (IL-8) promoter regulation were determined by transient transfection assay. Dust extracts contained trypsin and elastase activities, and activated protease activated receptor (PAR)-1 and -2. Serine protease inhibitors and PAR-1 or PAR-2 knockdown suppressed inflammatory gene induction. Dust extract induction of IL-8 gene expression was associated with increased DHE-fluorescence and 4-HNE staining, and antioxidants suppressed inflammatory gene induction. Protease inhibitors and antioxidants suppressed protein kinase C and NF-κB activation and induction of IL-8 promoter activity in cells exposed to dust extract. Our studies demonstrate that proteases and intracellular oxidants control organic dust induction of inflammatory gene expression in lung epithelial cells. Targeting proteases and oxidant stress may serve as novel approaches for the treatment of organic dust induced lung diseases. This is the first report on the involvement of oxidant stress in the induction of inflammatory gene expression by organic dust.

  7. A gene expression signature that can predict green tea exposure and chemopreventive efficacy of lung cancer in mice.


    Lu, Yan; Yao, Ruisheng; Yan, Ying; Wang, Yian; Hara, Yukihiko; Lubet, Ronald A; You, Ming


    Green tea has been shown to be a potent chemopreventive agent against lung tumorigenesis in animal models. Previously, we found that treatment of A/J mice with either green tea (0.6% in water) or a defined green tea catechin extract (polyphenon E; 2.0 g/kg in diet) inhibited lung tumor tumorigenesis. Here, we described expression profiling of lung tissues derived from these studies to determine the gene expression signature that can predict the exposure and efficacy of green tea in mice. We first profiled global gene expressions in normal lungs versus lung tumors to determine genes which might be associated with the tumorigenic process (TUM genes). Gene expression in control tumors and green tea-treated tumors (either green tea or polyphenon E) were compared to determine those TUM genes whose expression levels in green tea-treated tumors returned to levels seen in normal lungs. We established a 17-gene expression profile specific for exposure to effective doses of either green tea or polyphenon E. This gene expression signature was altered both in normal lungs and lung adenomas when mice were exposed to green tea or polyphenon E. These experiments identified patterns of gene expressions that both offer clues for green tea's potential mechanisms of action and provide a molecular signature specific for green tea exposure.

  8. Integrating murine gene expression studies to understand obstructive lung disease due to chronic inhaled endotoxin.


    Lai, Peggy S; Hofmann, Oliver; Baron, Rebecca M; Cernadas, Manuela; Meng, Quanxin Ryan; Bresler, Herbert S; Brass, David M; Yang, Ivana V; Schwartz, David A; Christiani, David C; Hide, Winston


    Endotoxin is a near ubiquitous environmental exposure that that has been associated with both asthma and chronic obstructive pulmonary disease (COPD). These obstructive lung diseases have a complex pathophysiology, making them difficult to study comprehensively in the context of endotoxin. Genome-wide gene expression studies have been used to identify a molecular snapshot of the response to environmental exposures. Identification of differentially expressed genes shared across all published murine models of chronic inhaled endotoxin will provide insight into the biology underlying endotoxin-associated lung disease. We identified three published murine models with gene expression profiling after repeated low-dose inhaled endotoxin. All array data from these experiments were re-analyzed, annotated consistently, and tested for shared genes found to be differentially expressed. Additional functional comparison was conducted by testing for significant enrichment of differentially expressed genes in known pathways. The importance of this gene signature in smoking-related lung disease was assessed using hierarchical clustering in an independent experiment where mice were exposed to endotoxin, smoke, and endotoxin plus smoke. A 101-gene signature was detected in three murine models, more than expected by chance. The three model systems exhibit additional similarity beyond shared genes when compared at the pathway level, with increasing enrichment of inflammatory pathways associated with longer duration of endotoxin exposure. Genes and pathways important in both asthma and COPD were shared across all endotoxin models. Mice exposed to endotoxin, smoke, and smoke plus endotoxin were accurately classified with the endotoxin gene signature. Despite the differences in laboratory, duration of exposure, and strain of mouse used in three experimental models of chronic inhaled endotoxin, surprising similarities in gene expression were observed. The endotoxin component of tobacco

  9. Integrating Murine Gene Expression Studies to Understand Obstructive Lung Disease Due to Chronic Inhaled Endotoxin

    PubMed Central

    Lai, Peggy S.; Hofmann, Oliver; Baron, Rebecca M.; Cernadas, Manuela; Meng, Quanxin Ryan; Bresler, Herbert S.; Brass, David M.; Yang, Ivana V.; Schwartz, David A.; Christiani, David C.; Hide, Winston


    Rationale Endotoxin is a near ubiquitous environmental exposure that that has been associated with both asthma and chronic obstructive pulmonary disease (COPD). These obstructive lung diseases have a complex pathophysiology, making them difficult to study comprehensively in the context of endotoxin. Genome-wide gene expression studies have been used to identify a molecular snapshot of the response to environmental exposures. Identification of differentially expressed genes shared across all published murine models of chronic inhaled endotoxin will provide insight into the biology underlying endotoxin-associated lung disease. Methods We identified three published murine models with gene expression profiling after repeated low-dose inhaled endotoxin. All array data from these experiments were re-analyzed, annotated consistently, and tested for shared genes found to be differentially expressed. Additional functional comparison was conducted by testing for significant enrichment of differentially expressed genes in known pathways. The importance of this gene signature in smoking-related lung disease was assessed using hierarchical clustering in an independent experiment where mice were exposed to endotoxin, smoke, and endotoxin plus smoke. Results A 101-gene signature was detected in three murine models, more than expected by chance. The three model systems exhibit additional similarity beyond shared genes when compared at the pathway level, with increasing enrichment of inflammatory pathways associated with longer duration of endotoxin exposure. Genes and pathways important in both asthma and COPD were shared across all endotoxin models. Mice exposed to endotoxin, smoke, and smoke plus endotoxin were accurately classified with the endotoxin gene signature. Conclusions Despite the differences in laboratory, duration of exposure, and strain of mouse used in three experimental models of chronic inhaled endotoxin, surprising similarities in gene expression were observed

  10. Global Gene Expression Profiling in Lung Tissues of Rat Exposed to Lunar Dust Particles

    NASA Technical Reports Server (NTRS)

    Yeshitla, Samrawit A.; Lam, Chiu-Wing; Kidane, Yared H.; Feiveson, Alan H.; Ploutz-Snyder, Robert; Wu, Honglu; James, John T.; Meyers, Valerie E.; Zhang, Ye


    The Moon's surface is covered by a layer of fine, potential reactive dust. Lunar dust contain about 1-2% respirable very fine dust (less than 3 micrometers). The habitable area of any lunar landing vehicle and outpost would inevitably be contaminated with lunar dust that could pose a health risk. The purpose of the study is to analyze the dynamics of global gene expression changes in lung tissues of rats exposed to lunar dust particles. F344 rats were exposed for 4 weeks (6h/d; 5d/wk) in nose-only inhalation chambers to concentrations of 0 (control air), 2.1, 6.8, 21, and 61 mg/m3 of lunar dust. Animals were euthanized at 1 day and 13 weeks after the last inhalation exposure. After being lavaged, lung tissue from each animal was collected and total RNA was isolated. Four samples of each dose group were analyzed using Agilent Rat GE v3 microarray to profile global gene expression of 44K transcripts. After background subtraction, normalization, and log transformation, t tests were used to compare the mean expression levels of each exposed group to the control group. Correction for multiple testing was made using the method of Benjamini, Krieger, and Yekuteli (1) to control the false discovery rate. Genes with significant changes of at least 1.75 fold were identified as genes of interest. Both low and high doses of lunar dust caused dramatic, dose-dependent global gene expression changes in the lung tissues. However, the responses of lung tissue to low dose lunar dust are distinguished from those of high doses, especially those associated with 61mg/m3 dust exposure. The data were further integrated into the Ingenuity system to analyze the gene ontology (GO), pathway distribution and putative upstream regulators and gene targets. Multiple pathways, functions, and upstream regulators have been identified in response to lunar dust induced damage in the lung tissue.

  11. Anticancer drug clustering in lung cancer based on gene expression profiles and sensitivity database

    PubMed Central

    Gemma, Akihiko; Li, Cai; Sugiyama, Yuka; Matsuda, Kuniko; Seike, Yoko; Kosaihira, Seiji; Minegishi, Yuji; Noro, Rintaro; Nara, Michiya; Seike, Masahiro; Yoshimura, Akinobu; Shionoya, Aki; Kawakami, Akiko; Ogawa, Naoki; Uesaka, Haruka; Kudoh, Shoji


    background The effect of current therapies in improving the survival of lung cancer patients remains far from satisfactory. It is consequently desirable to find more appropriate therapeutic opportunities based on informed insights. A molecular pharmacological analysis was undertaken to design an improved chemotherapeutic strategy for advanced lung cancer. Methods We related the cytotoxic activity of each of commonly used anti-cancer agents (docetaxel, paclitaxel, gemcitabine, vinorelbine, 5-FU, SN38, cisplatin (CDDP), and carboplatin (CBDCA)) to corresponding expression pattern in each of the cell lines using a modified NCI program. Results We performed gene expression analysis in lung cancer cell lines using cDNA filter and high-density oligonucleotide arrays. We also examined the sensitivity of these cell lines to these drugs via MTT assay. To obtain our reproducible gene-drug sensitivity correlation data, we separately analyzed two sets of lung cancer cell lines, namely 10 and 19. In our gene-drug correlation analyses, gemcitabine consistently belonged to an isolated cluster in a reproducible fashion. On the other hand, docetaxel, paclitaxel, 5-FU, SN-38, CBDCA and CDDP were gathered together into one large cluster. Conclusion These results suggest that chemotherapy regimens including gemcitabine should be evaluated in second-line chemotherapy in cases where the first-line chemotherapy did not include this drug. Gene expression-drug sensitivity correlations, as provided by the NCI program, may yield improved therapeutic options for treatment of specific tumor types. PMID:16813650

  12. Bronchial airway gene expression in smokers with lung or head and neck cancer.


    Van Dyck, Eric; Nazarov, Petr V; Muller, Arnaud; Nicot, Nathalie; Bosseler, Manon; Pierson, Sandrine; Van Moer, Kris; Palissot, Valérie; Mascaux, Céline; Knolle, Ulrich; Ninane, Vincent; Nati, Romain; Bremnes, Roy M; Vallar, Laurent; Berchem, Guy; Schlesser, Marc


    Cigarette smoking is the major cause of cancers of the respiratory tract, including non-small cell lung cancer (NSCLC) and head and neck cancer (HNC). In order to better understand carcinogenesis of the lung and upper airways, we have compared the gene expression profiles of tumor-distant, histologically normal bronchial biopsy specimens obtained from current smokers with NSCLC or HNC (SC, considered as a single group), as well as nonsmokers (NS) and smokers without cancer (SNC). RNA from a total of 97 biopsies was used for gene expression profiling (Affymetrix HG-U133 Plus 2.0 array). Differentially expressed genes were used to compare NS, SNC, and SC, and functional analysis was carried out using Ingenuity Pathway Analysis (IPA). Smoking-related cancer of the respiratory tract was found to affect the expression of genes encoding xenobiotic biotransformation proteins, as well as proteins associated with crucial inflammation/immunity pathways and other processes that protect the airway from the chemicals in cigarette smoke or contribute to carcinogenesis. Finally, we used the prediction analysis for microarray (PAM) method to identify gene signatures of cigarette smoking and cancer, and uncovered a 15-gene signature that distinguished between SNC and SC with an accuracy of 83%. Thus, gene profiling of histologically normal bronchial biopsy specimens provided insight into cigarette-induced carcinogenesis of the respiratory tract and gene signatures of cancer in smokers. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  13. Bronchial airway gene expression in smokers with lung or head and neck cancer

    PubMed Central

    Van Dyck, Eric; Nazarov, Petr V; Muller, Arnaud; Nicot, Nathalie; Bosseler, Manon; Pierson, Sandrine; Van Moer, Kris; Palissot, Valérie; Mascaux, Céline; Knolle, Ulrich; Ninane, Vincent; Nati, Romain; Bremnes, Roy M; Vallar, Laurent; Berchem, Guy; Schlesser, Marc


    Cigarette smoking is the major cause of cancers of the respiratory tract, including non-small cell lung cancer (NSCLC) and head and neck cancer (HNC). In order to better understand carcinogenesis of the lung and upper airways, we have compared the gene expression profiles of tumor-distant, histologically normal bronchial biopsy specimens obtained from current smokers with NSCLC or HNC (SC, considered as a single group), as well as nonsmokers (NS) and smokers without cancer (SNC). RNA from a total of 97 biopsies was used for gene expression profiling (Affymetrix HG-U133 Plus 2.0 array). Differentially expressed genes were used to compare NS, SNC, and SC, and functional analysis was carried out using Ingenuity Pathway Analysis (IPA). Smoking-related cancer of the respiratory tract was found to affect the expression of genes encoding xenobiotic biotransformation proteins, as well as proteins associated with crucial inflammation/immunity pathways and other processes that protect the airway from the chemicals in cigarette smoke or contribute to carcinogenesis. Finally, we used the prediction analysis for microarray (PAM) method to identify gene signatures of cigarette smoking and cancer, and uncovered a 15-gene signature that distinguished between SNC and SC with an accuracy of 83%. Thus, gene profiling of histologically normal bronchial biopsy specimens provided insight into cigarette-induced carcinogenesis of the respiratory tract and gene signatures of cancer in smokers. PMID:24497500

  14. Low-dose oral cadmium increases airway reactivity and lung neuronal gene expression in mice.


    Chandler, Joshua D; Wongtrakool, Cherry; Banton, Sophia A; Li, Shuzhao; Orr, Michael L; Barr, Dana Boyd; Neujahr, David C; Sutliff, Roy L; Go, Young-Mi; Jones, Dean P


    Inhalation of cadmium (Cd) is associated with lung diseases, but less is known concerning pulmonary effects of Cd found in the diet. Cd has a decades-long half-life in humans and significant bioaccumulation occurs with chronic dietary intake. We exposed mice to low-dose CdCl2 (10 mg/L in drinking water) for 20 weeks, which increased lung Cd to a level similar to that of nonoccupationally exposed adult humans. Cd-treated mice had increased airway hyperresponsiveness to methacholine challenge, and gene expression array showed that Cd altered the abundance of 443 mRNA transcripts in mouse lung. In contrast to higher doses, low-dose Cd did not elicit increased metallothionein transcripts in lung. To identify pathways most affected by Cd, gene set enrichment of transcripts was analyzed. Results showed that major inducible targets of low-dose Cd were neuronal receptors represented by enriched olfactory, glutamatergic, cholinergic, and serotonergic gene sets. Olfactory receptors regulate chemosensory function and airway hypersensitivity, and these gene sets were the most enriched. Targeted metabolomics analysis showed that Cd treatment also increased metabolites in pathways of glutamatergic (glutamate), serotonergic (tryptophan), cholinergic (choline), and catecholaminergic (tyrosine) receptors in the lung tissue. Protein abundance measurements showed that the glutamate receptor GRIN2A was increased in mouse lung tissue. Together, these results show that in mice, oral low-dose Cd increased lung Cd to levels comparable to humans, increased airway hyperresponsiveness and disrupted neuronal pathways regulating bronchial tone. Therefore, dietary Cd may promote or worsen airway hyperresponsiveness in multiple lung diseases including asthma. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  15. Gene expression in the lung of p53 mutant mice exposed to cigarette smoke.


    Izzotti, Alberto; Cartiglia, Cristina; Longobardi, Mariagrazia; Bagnasco, Maria; Merello, Andrea; You, Ming; Lubet, Ronald A; De Flora, Silvio


    We showed previously that p53 mutations play a role in cigarette smoke-related carcinogenesis not only in humans but also in A/J mice. In fact, (UL53-3 x A/J)F(1) mice, carrying a dominant-negative germ-line p53 mutation, responded to exposure to environmental cigarette smoke more efficiently than their wild-type (wt) littermate controls in terms of molecular alterations, cytogenetic damage, and lung tumor yield. To clarify the mechanisms involved, we analyzed by cDNA array the expression of 1,185 cancer-related genes in the lung of the same mice. Neither environmental cigarette smoke nor the p53 status affected the expression of the p53 gene, but the p53 mutation strikingly increased the basal levels of p53 nuclear protein in the lung. Environmental cigarette smoke increased p53 protein levels in wt mice only. The p53 mutation enhanced the expression of positive cell cycle regulators in sham-exposed mice, which suggests a physiologic protective role of p53. In environmental cigarette smoke-exposed mice, the p53 mutation resulted in a lack of induction of proapoptotic genes and in overexpression of genes involved in cell proliferation, signal transduction, angiogenesis, inflammation, and immune response. Mutant mice and wt mice reacted to environmental cigarette smoke in a similar manner regarding genes involved in metabolism of xenobiotics, multidrug resistance, and protein repair. Irrespective of the p53 status, environmental cigarette smoke poorly affected the expression of oncogenes, tumor suppressor genes, and DNA repair genes. Taken together, these findings may explain the increased susceptibility of p53 mutant mice to smoke-related alterations of intermediate biomarkers and lung carcinogenesis.

  16. Expression profiling of angiogenesis-related genes in brain metastases of lung cancer and melanoma.


    Ilhan-Mutlu, Aysegül; Siehs, Christian; Berghoff, Anna Sophie; Ricken, Gerda; Widhalm, Georg; Wagner, Ludwig; Preusser, Matthias


    Brain metastases (BM) are the most common brain tumors of adults and are associated with fatal prognosis. Formation of new blood vessels, named angiogenesis, was proposed to be the main hallmark of the growth of BM. Previous preclinical evidence revealed that angiogenic blockage might be considered for treatment; however, there were varying responses. In this study, we aimed to characterize the expression pattern of angiogenesis-related genes in BM of lung cancer and melanoma, which might be of importance for the different responses against anti-angiogenic treatment. Fifteen snap-frozen tissues obtained from BM of non-small cell lung cancer (NSCLC), small-cell lung cancer (SCLC), and melanoma patients were analyzed for angiogenesis-related genes using a commercially available gene expression kit. Epilepsy tissue was used as control. Expression values were analyzed using hierarchical clustering investigating relative fold changes and mapping to Omicsnet protein interaction network. CXCL10, CEACAM1, PECAM1, KIT, COL4A2, COL1A1, and HSPG2 genes were more than 50-fold up-regulated in all diagnosis groups when compared to control, whereas genes such as ANGPT4, PDGFRB, and SERPINF1 were down-regulated only in SCLC and melanoma groups, respectively. Using hierarchical clustering, 12 out of 15 cases were allocated to the correct histological primary tumor type. We identified genes with consistent up-regulation in BM of lung cancer and melanoma and other genes with differential expression across BM of these tumor types. Our data may be of relevance for targeted therapy or prophylaxis of BM using anti-angiogenic agents.

  17. Gene expression profiling in Salmonella Choleraesuis-infected porcine lung using a long oligonucleotide microarray.


    Zhao, Shu-Hong; Kuhar, Daniel; Lunney, Joan K; Dawson, Harry; Guidry, Catherine; Uthe, Jolita J; Bearson, Shawn M D; Recknor, Justin; Nettleton, Dan; Tuggle, Christopher K


    Understanding the transcriptional response to pathogenic bacterial infection within food animals is of fundamental and applied interest. To determine the transcriptional response to Salmonella enterica serovar Choleraesuis (SC) infection, a 13,297-oligonucleotide swine array was used to analyze RNA from control, 24-h postinoculation (hpi), and 48-hpi porcine lung tissue from pigs infected with SC. In total, 57 genes showed differential expression (p < 0.001; false discovery rate = 12%). Quantitative real-time PCR (qRT-PCR) of 61 genes was used to confirm the microarray results and to identify pathways responding to infection. Of the 33 genes identified by microarray analysis as differentially expressed, 23 were confirmed by qRT-PCR results. A novel finding was that two transglutaminase family genes (TGM1 and TGM3) showed dramatic increases in expression postinoculation; combined with several other apoptotic genes, they indicated the induction of apoptotic pathways during SC infection. A predominant T helper 1-type immune response occurred during infection, with interferon gamma (IFNG) significantly increased at 48 hpi. Genes induced by IFNs (GBP1, GBP2, C1S, C1R, MHC2TA, PSMB8, TAP1, TAP2) showed increased expression during porcine lung infection. These data represent the first thorough investigation of gene regulation pathways that control an important porcine respiratory and foodborne bacterial infection.

  18. Gene expression subtraction of non-cancerous lung from smokers and non-smokers with adenocarcinoma, as a predictor for smokers developing lung cancer

    PubMed Central

    Stav, David; Bar, Ilan; Sandbank, Judith


    Background Lung cancer is the commonest cause of cancer death in developed countries. Adenocarcinoma is becoming the most common form of lung cancer. Cigarette smoking is the main risk factor for lung cancer. Long-term cigarettes smoking may be characterized by genetic alteration and diffuse injury of the airways surface, named field cancerization, while cancer in non-smokers is usually clonally derived. Detecting specific genes expression changes in non-cancerous lung in smokers with adenocarcinoma may give us instrument for predicting smokers who are going to develop this malignancy. Objectives We described the gene expression in non-cancerous lungs from 21 smoker patients with lung adenocarcinoma and compare it to gene expression in non-cancerous lung tissue from 10 non-smokers with primary lung adenocarcinoma. Methods Total RNA was isolated from peripheral non-cancerous lung tissue. The cDNA was hybridized to the U133A GeneChip array. Hierarchical clustering analysis on genes obtained from smokers and non-smokers, after subtracting were exported to the Ingenuity Pathway Analysis software for further analysis. Results The genes subtraction resulted in disclosure of 36 genes with high score. They were subsequently mapped and sorted based on location, cellular components, and biochemical activity. The gene functional analysis disclosed 20 genes, which are involved in cancer process (P = 7.05E-5 to 2.92E-2). Conclusion Detected genes may serve as a predictor for smokers who may be at high risk of developing lung cancer. In addition, since these genes originating from non-cancerous lung, which is the major area of the lungs, a sample from an induced sputum may represent it. PMID:18811983

  19. Gene Expression Changes during the Development of Acute Lung Injury Role of Transforming Growth Factor β

    PubMed Central

    Wesselkamper, Scott C.; Case, Lisa M.; Henning, Lisa N.; Borchers, Michael T.; Tichelaar, Jay W.; Mason, John M.; Dragin, Nadine; Medvedovic, Mario; Sartor, Maureen A.; Tomlinson, Craig R.; Leikauf, George D.


    Rationale: Acute lung injury can occur from multiple causes, resulting in high mortality. The pathophysiology of nickel-induced acute lung injury in mice is remarkably complex, and the molecular mechanisms are uncertain. Objectives: To integrate molecular pathways and investigate the role of transforming growth factor β (TGF-β) in acute lung injury in mice. Methods: cDNA microarray analyses were used to identify lung gene expression changes after nickel exposure. MAPPFinder analysis of the microarray data was used to determine significantly altered molecular pathways. TGF-β1 protein in bronchoalveolar lavage fluid, as well as the effect of inhibition of TGF-β, was assessed in nickel-exposed mice. The effect of TGF-β on surfactant-associated protein B (Sftpb) promoter activity was measured in mouse lung epithelial cells. Measurements and Main Results: Genes that decreased the most after nickel exposure play important roles in lung fluid absorption or surfactant and phospholipid synthesis, and genes that increased the most were involved in TGF-β signaling. MAPPFinder analysis further established TGF-β signaling to be significantly altered. TGF-β–inducible genes involved in the regulation of extracellular matrix function and fibrinolysis were significantly increased after nickel exposure, and TGF-β1 protein was also increased in the lavage fluid. Pharmacologic inhibition of TGF-β attenuated nickel-induced protein in bronchoalveolar lavage. In addition, treatment with TGF-β1 dose-dependently repressed Sftpb promoter activity in vitro, and a novel TGF-β–responsive region in the Sftpb promoter was identified. Conclusions: These data suggest that TGF-β acts as a central mediator of acute lung injury through the alteration of several different molecular pathways. PMID:16100012

  20. Tea polyphenols prevent lung from preneoplastic lesions and effect p53 and bcl-2 gene expression in rat lung tissues.


    Gu, Qihua; Hu, Chengping; Chen, Qiong; Xia, Ying


    Lung cancer is one of the cancers that have the highest incidence and the highest mortality rate, and it is of great interest to identify ways to prevent its occurrence. We had established an animal model by using 3,4-benzopyrene intra-pulmonary injection in our previous study, and had observed that the rats lung carcinoma incidence and multiplicity were significantly reduced by green tea administration. This study further investigated the effect of tea polyphenols on rat lung preneoplastic lesions using the lung carcinoma model established by 3,4-benzopyrene intra-pulmonary injection. Sprague-Dawley rats of the same age were randomly divided into 10 groups and treated with 3,4-benzopyrene by intra-pulmonary injection. Five groups were given 0.3% solution of tea polyphenols (equivalent to 1.2% of green tea) in drinking water, while the other 5 groups were given pure drinking water. The rats were sacrificed at 0, 1, 4, 8 and 16 weeks after carcinogen treatment. In the control groups of rats, local bronchial inflammation were observed at 1 week after 3,4-benzopyrene treatment. From 4 weeks to 16 weeks after carcinogen treatment, hyperplasia, cell hyperproliferation, heterogeneity were observed in the bronchial epithelium. Meanwhile, the expression of p53 mRNA and protein, as well as the level of bcl-2, increased in the bronchial epithelial lesion. Tea polyphenols treatment significantly alleviated the bronchial epithelial lesions. At the same time, tea polyphenols treatment enhanced p53 expression, but reduced bcl-2 expression. These results indicated that tea polyphenols may have preventive effect against lung preneoplasm lesions, possibly through regulating the expression of some critical genes such as p53 and bcl-2.

  1. Endothelial Cells Expressing Endothelial and Mesenchymal Cell Gene Products in Lung Tissue From Patients With Systemic Sclerosis-Associated Interstitial Lung Disease.


    Mendoza, Fabian A; Piera-Velazquez, Sonsoles; Farber, John L; Feghali-Bostwick, Carol; Jiménez, Sergio A


    To examine whether lung endothelial cells (ECs) from patients with systemic sclerosis (SSc)-associated interstitial lung disease (ILD) express mesenchymal cell-specific proteins and gene transcripts, indicative of the occurrence of endothelial-to-mesenchymal phenotypic transition (EndoMT). Lung tissue from 6 patients with SSc-associated pulmonary fibrosis was examined by histopathology and immunohistochemistry. Confocal laser microscopy was utilized to assess the simultaneous expression of EC and myofibroblast molecular markers. CD31+CD102+ ECs were isolated from the lung tissue of 2 patients with SSc-associated ILD and 2 normal control subjects, and the expression of EC and mesenchymal cell markers and other relevant genes was analyzed by quantitative polymerase chain reaction, immunofluorescence microscopy, and Western blotting. Immunohistochemical staining revealed cells expressing the EC-specific marker CD31 in the subendothelial, perivascular, and parenchymal regions of the lungs from all SSc patients. Confocal microscopy identified cells displaying simultaneous expression of von Willebrand factor and α-smooth muscle actin in small and medium-sized arterioles in the SSc lung tissue but not in normal control lungs. CD31+CD102+ ECs isolated from SSc lungs expressed high levels of mesenchymal cell-specific genes (type I collagen, type III collagen, and fibronectin), EC-specific genes (type IV collagen and VE-cadherin), profibrotic genes (transforming growth factor β1 and connective tissue growth factor), and genes encoding EndoMT-related transcription factors (TWIST1 and SNAI2). Cells coexpressing EC- and mesenchymal cell-specific molecules are present in the lungs of patients with SSc-associated ILD. CD31+CD102+ ECs isolated from SSc lungs simultaneously expressed mesenchymal cell- and EC-specific transcripts and proteins. Collectively, these observations demonstrate the occurrence of EndoMT in the lungs of patients with SSc-associated ILD. © 2016, American

  2. Glutathione S-transferase Copy Number Variation Alters Lung Gene Expression

    PubMed Central

    Butler, Marcus W.; Hackett, Neil R; Salit, Jacqueline; Strulovici-Barel, Yael; Omberg, Larsson; Mezey, Jason; Crystal, Ronald G.


    Summary Background The glutathione S-transferase (GST) enzymes catalyze the conjugation of xenobiotics to glutathione. Based on reports that inherited copy number variations (CNV) modulate some GST gene expression levels, and that the small airway epithelium (SAE) and alveolar macrophages (AM) are involved early in the pathogenesis of smoking-induced lung disease, we asked: do germline CNVs modulate GST expression levels in SAE and AM? Methods Microarrays were used to survey GST gene expression in SAE and AM obtained by bronchoscopy from current smokers and nonsmokers, and to determine CNV genotypes. Results Twenty six % of subjects were null for both GSTM1 alleles, with reduced GSTM1 mRNA levels seen in both SAE and AM. Thirty % of subjects had homozygous deletions of GSTT1 with reduced mRNA levels in both tissues. Interestingly, GSTT2B, exhibited homozygous deletion in blood in 27% of subjects and was not expressed in SAE in the remainder of subjects but was expressed in AM of heterozygotes and wild type subjects, proportionate to genotype. Conclusions These data show a germline CNV-mediated linear relationship of genotype to expression level suggesting minimal compensation of gene expression levels in heterozygotes consistent with GST polymorphisms playing a role in the risk of smoking-associated xenobiotic-induced lung disease. PMID:21349909

  3. MiR-374a suppresses lung adenocarcinoma cell proliferation and invasion by targeting TGFA gene expression

    PubMed Central

    Wu, Haijian; Liu, Yan; Shu, Xiao Ou; Cai, Qiuyin


    Aberrant expression of miR-374a has been reported in several types of human cancers, including lung cancer. However, the functional significance and molecular mechanisms underlying the role of miR-374a in lung cancer remain largely unknown. We found that the expression of miR-374a was significantly downregulated in lung adenocarcinoma tissues compared to adjacent normal lung tissues in samples included in The Cancer Genome Atlas. Functional studies revealed that overexpression of miR-374a led to inhibition of lung adenocarcinoma cell proliferation, migration and invasion and that miR-374a negatively regulated transforming growth factor-alpha (TGFA) gene expression by directly targeting the 3′-UTR of TGFA mRNA. Treating lung adenocarcinoma cells with TGF-α neutralizing antibody resulted in suppression of cell proliferation and invasion, which mimicked the action of miR-374a. Additionally, TGFA gene expression was significantly higher in tumor tissues compared to adjacent normal tissue and high TGFA gene expression strongly correlated with poor survival in patients with lung adenocarcinoma. Taken together, our studies suggest that miR-374a suppresses lung adenocarcinoma cell proliferation and invasion via targeting TGFA gene expression. Our findings may provide novel treatment strategies for lung adenocarcinoma patients. PMID:27207663

  4. MiR-374a suppresses lung adenocarcinoma cell proliferation and invasion by targeting TGFA gene expression.


    Wu, Haijian; Liu, Yan; Shu, Xiao Ou; Cai, Qiuyin


    Aberrant expression of miR-374a has been reported in several types of human cancers, including lung cancer. However, the functional significance and molecular mechanisms underlying the role of miR-374a in lung cancer remain largely unknown. We found that the expression of miR-374a was significantly downregulated in lung adenocarcinoma tissues compared to adjacent normal lung tissues in samples included in The Cancer Genome Atlas. Functional studies revealed that overexpression of miR-374a led to inhibition of lung adenocarcinoma cell proliferation, migration and invasion and that miR-374a negatively regulated transforming growth factor-alpha (TGFA) gene expression by directly targeting the 3'-UTR of TGFA mRNA. Treating lung adenocarcinoma cells with TGF-α neutralizing antibody resulted in suppression of cell proliferation and invasion, which mimicked the action of miR-374a. Additionally, TGFA gene expression was significantly higher in tumor tissues compared to adjacent normal tissue and high TGFA gene expression strongly correlated with poor survival in patients with lung adenocarcinoma. Taken together, our studies suggest that miR-374a suppresses lung adenocarcinoma cell proliferation and invasion via targeting TGFA gene expression. Our findings may provide novel treatment strategies for lung adenocarcinoma patients. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  5. Evaluation of reference genes for gene expression in red-tailed phascogale (Phascogale calura) liver, lung, small intestine and spleen

    PubMed Central

    Ong, Oselyne T.W.; Young, Lauren J.


    Background Reference genes serve an important role as an endogenous control/standard for data normalisation in gene expression studies. Although reference genes have recently been suggested for marsupials, independent analysis of reference genes on different immune tissues is yet to be tested. Therefore, an assessment of reference genes is needed for the selection of stable, expressed genes across different marsupial tissues. Methods The study was conducted on red-tailed phascogales (Phascogale calura) using five juvenile and five adult males. The stability of five reference genes (glyceraldehyde-3-phosphate dehydrogenase, GAPDH; β-actin, ACTB; 18S rRNA, 18S; 28S rRNA, 28S; and ribosomal protein L13A, RPL13A) was investigated using SYBR Green and analysed with the geNorm application available in qBasePLUS software. Results Gene stability for juvenile and adult tissue samples combined show that GAPDH was most stable in liver and lung tissue, and 18S in small intestine and spleen. While all reference genes were suitable for small intestine and spleen tissues, all reference genes except 28S were stable for lung and only 18S and 28S were stable for liver tissue. Separating the two age groups, we found that two different reference genes were considered stable in juveniles (ACTB and GAPDH) and adults (18S and 28S), and RPL13A was not stable for juvenile small intestine tissue. Except for 28S, all reference genes were stable in juvenile and adult lungs, and all five reference genes were stable in spleen tissue. Discussion Based on expression stability, ACTB and GAPDH are suitable for all tissues when studying the expression of marsupials in two age groups, except for adult liver tissues. The expression stability between juvenile and adult liver tissue was most unstable, as the stable reference genes for juveniles and adults were different. Juvenile and adult lung, small intestine and spleen share similar stable reference genes, except for small intestine tissues where

  6. Pathways enrichment analysis for differentially expressed genes in squamous lung cancer.


    Qian, Liqiang; Luo, Qingquan; Zhao, Xiaojing; Huang, Jia


    Squamous lung cancer (SQLC) is a common type of lung cancer, but its oncogenesis mechanism is not so clear. The aim of this study was to screen the potential pathways changed in SQLC and elucidate the mechanism of it. Published microarray data of GSE3268 series was downloaded from Gene Expression Omnibus (GEO). Significance analysis of microarrays was performed using software R, and differentially expressed genes (DEGs) were harvested. The functions and pathways of DEGs were mapped in Gene Otology and KEGG pathway database, respectively. A total of 2961 genes were filtered as DEGs between normal and SQLC cells. Cell cycle and metabolism were the mainly changed functions of SQLC cells. Meanwhile genes such as MCM, RFC, FEN1, and POLD may induce SQLC through DNA replication pathway, and genes such as PTTG1, CCNB1, CDC6, and PCNA may be involved in SQLC through cell cycle pathway. It is demonstrated that pathway analysis is useful in the identification of target genes in SQLC.

  7. RNA-seq analysis of lung adenocarcinomas reveals different gene expression profiles between smoking and nonsmoking patients

    PubMed Central

    Li, Yafang; Xiao, Xiangjun; Ji, Xuemei; Liu, Bin


    Lung adenocarcinoma is caused by the combination of genetic and environmental effects, and smoking plays an important role in the disease development. Exploring the gene expression profile and identifying genes that are shared or vary between smokers and nonsmokers with lung adenocarcinoma will provide insights into the etiology of this complex cancer. We obtained RNA-seq data from paired normal and tumor tissues from 34 nonsmoking and 34 smoking patients with lung adenocarcinoma (GEO: GSE40419). R Bioconductor, edgeR, was adopted to conduct differential gene expression analysis between paired normal and tumor tissues. A generalized linear model was applied to identify genes that were differentially expressed in nonsmoker and smoker patients as well as genes that varied between these two groups. We identified 2273 genes that showed differential expression with FDR<0.05 and |logFC| >1 in nonsmoker tumor versus normal tissues; 3030 genes in the smoking group; and 1967 genes were common to both groups. Sixty-eight and 70 % of the identified genes were downregulated in nonsmoking and smoking groups, respectively. The 20 genes such as SPP1, SPINK1, and FAM83A with largest fold changes in smokers also showed similar large and highly significant fold changes in nonsmokers and vice versa, showing commonalities in expression changes for adenocarcinomas in both smokers and nonsmokers for these genes. We also identified 175 genes that were significantly differently expressed between tumor samples from nonsmoker and smoker patients. Gene expression profile varied substantially between smoker and nonsmoker patients with lung adenocarcinoma. Smoking patients overall showed far more complicated disease mechanism and have more dysregulation in their gene expression profiles. Our study reveals pathogenetic differences in smoking and nonsmoking patients with lung adenocarcinoma from tran-scriptome analysis. We provided a list of candidate genes for further study for disease

  8. RNA-seq analysis of lung adenocarcinomas reveals different gene expression profiles between smoking and nonsmoking patients.


    Li, Yafang; Xiao, Xiangjun; Ji, Xuemei; Liu, Bin; Amos, Christopher I


    Lung adenocarcinoma is caused by the combination of genetic and environmental effects, and smoking plays an important role in the disease development. Exploring the gene expression profile and identifying genes that are shared or vary between smokers and nonsmokers with lung adenocarcinoma will provide insights into the etiology of this complex cancer. We obtained RNA-seq data from paired normal and tumor tissues from 34 nonsmoking and 34 smoking patients with lung adenocarcinoma (GEO: GSE40419). R Bioconductor, edgeR, was adopted to conduct differential gene expression analysis between paired normal and tumor tissues. A generalized linear model was applied to identify genes that were differentially expressed in nonsmoker and smoker patients as well as genes that varied between these two groups. We identified 2273 genes that showed differential expression with FDR < 0.05 and |logFC| >1 in nonsmoker tumor versus normal tissues; 3030 genes in the smoking group; and 1967 genes were common to both groups. Sixty-eight and 70% of the identified genes were downregulated in nonsmoking and smoking groups, respectively. The 20 genes such as SPP1, SPINK1, and FAM83A with largest fold changes in smokers also showed similar large and highly significant fold changes in nonsmokers and vice versa, showing commonalities in expression changes for adenocarcinomas in both smokers and nonsmokers for these genes. We also identified 175 genes that were significantly differently expressed between tumor samples from nonsmoker and smoker patients. Gene expression profile varied substantially between smoker and nonsmoker patients with lung adenocarcinoma. Smoking patients overall showed far more complicated disease mechanism and have more dysregulation in their gene expression profiles. Our study reveals pathogenetic differences in smoking and nonsmoking patients with lung adenocarcinoma from transcriptome analysis. We provided a list of candidate genes for further study for disease

  9. Gene expression profile of A549 cells from tissue of 4D model predicts poor prognosis in lung cancer patients.


    Mishra, Dhruva K; Creighton, Chad J; Zhang, Yiqun; Gibbons, Don L; Kurie, Jonathan M; Kim, Min P


    The tumor microenvironment plays an important role in regulating cell growth and metastasis. Recently, we developed an ex vivo lung cancer model (four dimensional, 4D) that forms perfusable tumor nodules on a lung matrix that mimics human lung cancer histopathology and protease secretion pattern. We compared the gene expression profile (Human OneArray v5 chip) of A549 cells, a human lung cancer cell line, grown in a petri dish (two-dimensional, 2D), and of the same cells grown in the matrix of our ex vivo model (4D). Furthermore, we obtained gene expression data of A549 cells grown in a petri dish (2D) and matrigel (three-dimensional, 3D) from a previous study and compared the 3D expression profile with that of 4D. Expression array analysis showed 2,954 genes differentially expressed between 2D and 4D. Gene ontology (GO) analysis showed upregulation of several genes associated with extracellular matrix, polarity and cell fate and development. Moreover, expression array analysis of 2D vs. 3D showed 1,006 genes that were most differentially expressed, with only 36 genes (4%) having similar expression patterns as observed between 2D and 4D. Finally, the differential gene expression signature of 4D cells (vs. 2D) correlated significantly with poor survival in patients with lung cancer (n = 1,492), while the expression signature of 3D vs. 2D correlated with better survival in lung cancer patients with lung cancer. As patients with larger tumors have a worse rate of survival, the ex vivo 4D model may be a good mimic of natural progression of tumor growth in lung cancer patients.

  10. Gene Expression Profiling in Lung Tissues from Rat Exposed to Lunar Dust Particles

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Lam, Chiu-Wing; Zalesak, Selina M.; Kidane, Yared H.; Feiveson, Alan H.; Ploutz-Snyder, Robert; Scully, Robert R.; Williams, Kyle; Wu, Honglu; James, John T.


    The Moon's surface is covered by a layer of fine, reactive dust. Lunar dust contain about 1-2% of very fine dust (< 3 micron), that is respirable. The habitable area of any lunar landing vehicle and outpost would inevitably be contaminated with lunar dust that could pose a health risk. The purpose of the study is to analyze the dynamics of global gene expression changes in lung tissues from rats exposed to lunar dust particles. F344 rats were exposed for 4 weeks (6h/d; 5d/wk) in nose-only inhalation chambers to concentrations of 0 (control air), 2.1, 6.8, 21, and 61 mg/m(exp 3) of lunar dust. Five rats per group were euthanized 1 day, and 3 months after the last inhalation exposure. The total RNAs were isolated from lung tissues after being lavaged. The Agilent Rat GE v3 microarray was used to profile global gene expression (44K). The genes with significant expression changes are identified and the gene expression data were further analyzed using various statistical tools.

  11. Establishment of a human lung cancer cell line with high metastatic potential to multiple organs: gene expression associated with metastatic potential in human lung cancer.


    Nakano, Tetsuhiro; Shimizu, Kimihiro; Kawashima, Osamu; Kamiyoshihara, Mitsuhiro; Kakegawa, Seiichi; Sugano, Masayuki; Ibe, Takashi; Nagashima, Toshiteru; Kaira, Kyoichi; Sunaga, Noriaki; Ohtaki, Youichi; Atsumi, Jun; Takeyoshi, Izumi


    Convenient and reliable multiple organ metastasis model systems might contribute to understanding the mechanism(s) of metastasis of lung cancer, which may lead to overcoming metastasis and improvement in the treatment outcome of lung cancer. We isolated a highly metastatic subline, PC14HM, from the human pulmonary adenocarcinoma cell line, PC14, using an in vivo selection method. The expression of 34,580 genes was compared between PC14HM and parental PC14 by cDNA microarray analysis. Among the differentially expressed genes, expression of four genes in human lung cancer tissues and adjacent normal lung tissues were compared using real-time reverse transcription polymerase chain reaction. Although BALB/c nude mice inoculated with parental PC14 cells had few metastases, almost all mice inoculated with PC14HM cells developed metastases in multiple organs, including the lung, bone and adrenal gland, the same progression seen in human lung cancer. cDNA microarray analysis revealed that 981 genes were differentially (more than 3-fold) expressed between the two cell lines. Functional classification revealed that many of those genes were associated with cell growth, cell communication, development and transcription. Expression of three upregulated genes (HRB-2, HS3ST3A1 and RAB7) was higher in human cancer tissue compared to normal lung tissue, while expression of EDG1, which was downregulated, was lower in the cancer tissue compared to the normal lung. These results suggest that the newly established PC14HM cell line may provide a mouse model of widespread metastasis of lung cancer. This model system may provide insights into the key genetic determinants of widespread metastasis of lung cancer.

  12. Effects of acupuncture on the gene expression profile of lung tissue from normal rats.


    Yin, Lei-Miao; Wang, Yu; Wang, Yan; Xu, Yu-Dong; Liu, Yan-Yan; Jin, Wei-Rong; Zhang, Qing-Hua; Yang, Yong-Qing


    Acupuncture has been demonstrated to be an effective treatment for various diseases. However, little attention has been paid to its physiological influences, especially on the changes in protein and mRNA levels following acupuncture treatment under normal conditions. In this study, we investigated the gene expression profile of lung tissue from acupuncture-treated normal rats and attempted to characterize the underlying mechanisms of the changes in expression. Three common acupoints, Dazhui (GV14), fengmen (BL12) and feishu (BL13) were selected for analysis, and 2 serial analyses of gene expression (SAGE) tag libraries of the lung tissues that were derived from the normal and acupuncture-treated rats were established. Bioinformatic analyses were carried out using the functional annotation tools of the database for annotation, visualization and integrated discovery (DAVID), the gene ontology (GO) Tree Machine and the Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis. In total, 144 tags were differentially expressed (P<0.05), and the DAVID functional classification of genes demonstrated that the genes were divided into 6 types. Furthermore, GO Tree Machine analysis of the gene categories indicated that 10 enriched GO categories had become enriched after acupuncture, and that 15 KEGG pathways matched the differentially expressed tags of the 2 SAGE libraries. Our results show that the essential effects of acupuncture on normal rats include the regulation of macromolecular biosynthesis, transportation and metabolism. Cellular biosynthesis and cellular lipid metabolism are the common biological processes that occur in response to acupuncture under normal and morbid conditions, which may be the general physiological effects of acupuncture.

  13. Abolition of fetal breathing movements by spinal cord transection leads to reductions in fetal lung liquid volume, lung growth, and IGF-II gene expression.


    Harding, R; Hooper, S B; Han, V K


    Fetal breathing movements (FBM) are considered necessary for normal growth and structural maturation of the fetal lung, but the underlying mechanisms are unclear. The small fluctuations in lung dimensions caused by FBM have been proposed as a stimulus to lung growth, but it is equally possible that FBM act by maintaining the basal level of lung luminal volume, which is an established determinant of fetal lung growth. Our aim, therefore, was to determine the effects of abolishing FBM, while retaining the integrity of the diaphragm, on the volume and rate of production of fetal lung liquid, gene expression for IGF-II, and fetal lung growth. FBM were abolished in seven fetal sheep by high spinal cord transection at 114 +/- 1.2 d of gestation; seven intact fetuses served as controls. At 119 to 124, 125 to 130, and 131 to 136 d, we measured the volume and secretion rate of lung liquid by dye dilution. At these three age ranges, the lungs of cord-transfected fetuses contained 27 to 53% less lung liquid than controls (p = 0.004), and their rates of secretion were 65 to 138% greater (p = 0.001). At postmortem (135 +/- 0.1 d), the lungs of the cord transected fetuses contained less DNA per kg body weight and tended to be lighter and to contain less protein than controls. IGF-II gene expression in the lungs of cord-transected fetuses was significantly less than that in controls.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Comparison of Chromosome 4 gene expression profile between lung telocytes and other local cell types.


    Song, Dongli; Cretoiu, Dragos; Zheng, Minghuan; Qian, Mengjia; Zhang, Miaomiao; Cretoiu, Sanda M; Chen, Luonan; Fang, Hao; Popescu, Laurentiu M; Wang, Xiangdong


    Telocytes (TCs) are new cellular entities of mesenchymal origin described almost ubiquitously in human and mammalian organs ( Different subtypes of TCs were described, all forming networks in the interstitial space by homo- and heterocellular junctions. Previous studies analysed the gene expression profiles of chromosomes 1, 2, 3, 17 and 18 of murine pulmonary TCs. In this study, we analysed by bioinformatics tools the gene expression profiles of chromosome 4 for murine pulmonary TCs and compared it with mesenchymal stem cells (MSCs), fibroblasts (Fbs), alveolar type II cells (ATII), airway basal cells, proximal airway cells, CD8(+) T cells from bronchial lymph nodes (T-BL) and CD8(+) T cells from lungs (T-L). Key functional genes were identified with the aid of the reference library of the National Center for Biotechnology Information Gene Expression Omnibus database. Seventeen genes were up-regulated and 56 genes were down-regulated in chromosome 4 of TCs compared with other cells. Four genes (Akap2, Gpr153, Sdc3 and Tbc1d2) were up-regulated between one and fourfold and one gene, Svep1, was overexpressed over fourfold. The main functional networks were identified and analysed, pointing out to a TCs involvement in cellular signalling, regulation of tissue inflammation and cell expansion and movement.

  15. Gene expression profile of oxidative stress and antioxidant defense in lung tissue of patients exposed to sulfur mustard.


    Tahmasbpour, Eisa; Ghanei, Mostafa; Qazvini, Ali; Vahedi, Ensieh; Panahi, Yunes


    Sulfur mustard (SM) is a potent alkylating agent that targets several organs, especially lung tissue. Although pathological effects of SM on mustard lung have been widely considered, molecular and cellular mechanisms for these pathologies are poorly understood. We investigated changes in expression of genes related to oxidative stress (OS) and antioxidant defense caused by SM in lung tissue of patients. We performed gene expression profiling of OS and antioxidant defense in lung tissue samples from healthy controls (n=5) and SM-exposed patients (n=6). Changes in gene expression were measured using a 96-well RT(2) Profiler ™PCR Array: Human Oxidative Stress and Antioxidant Defense, which arrayed 84 genes functionally involved in cellular OS response. 47 (55.95%) genes were found to be significantly upregulated in patients with mustard lung compared with controls (p<0.05), whereas 7 (8.33%) genes were significantly downregulated (p<0.05). Among the most upregulated genes were OS responsive-1 (OXSR1), forkhead box M1 (FOXM1), and glutathione peroxidase-2 (GPX2), while metallothionein-3 (MT3) and glutathione reductase (GSR) were the most downregulated genes. Expression of hypoxia-induced genes (CYGB and MB), antioxidants and reactive oxygen species (ROS)-producing genes were significantly altered, suggesting an increased oxidative damage in mustard lungs. Mustard lungs were characterized by hypoxia, massive production of ROS, OS, disruption of epithelial cells, surfactant dysfunction, as well as increased risk of lung cancer and pulmonary fibrosis. Oxidative stress induced by ROS is the major mechanism for direct effect of SM exposure on respiratory system. Antioxidant treatment may improve the main features of mustard lungs.

  16. Weighted gene co-expression network analysis in identification of metastasis-related genes of lung squamous cell carcinoma based on the Cancer Genome Atlas database.


    Tian, Feng; Zhao, Jinlong; Fan, Xinlei; Kang, Zhenxing


    Lung squamous cell carcinoma (lung SCC) is a common type of malignancy. Its pathogenesis mechanism of tumor development is unclear. The aim of this study was to identify key genes for diagnosis biomarkers in lung SCC metastasis. We searched and downloaded mRNA expression data and clinical data from The Cancer Genome Atlas (TCGA) database to identify differences in mRNA expression of primary tumor tissues from lung SCC with and without metastasis. Gene co-expression network analysis, protein-protein interaction (PPI) network, Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and quantitative real-time polymerase chain reactions (qRT-PCR) were used to explore the biological functions of the identified dysregulated genes. Four hundred and eighty-two differentially expressed genes (DEGs) were identified between lung SCC with and without metastasis. Nineteen modules were identified in lung SCC through weighted gene co-expression network analysis (WGCNA). Twenty-three DEGs and 26 DEGs were significantly enriched in the respective pink and black module. KEGG pathway analysis displayed that 26 DEGs in the black module were significantly enriched in bile secretion pathway. Forty-nine DEGs in the two gene co-expression module were used to construct PPI network. CFTR in the black module was the hub protein, had the connectivity with 182 genes. The results of qRT-PCR displayed that FIGF, SFTPD, DYNLRB2 were significantly down-regulated in the tumor samples of lung SCC with metastasis and CFTR, SCGB3A2, SSTR1, SCTR, ROPN1L had the down-regulation tendency in lung SCC with metastasis compared to lung SCC without metastasis. The dysregulated genes including CFTR, SCTR and FIGF might be involved in the pathology of lung SCC metastasis and could be used as potential diagnosis biomarkers or therapeutic targets for lung SCC.

  17. Weighted gene co-expression network analysis in identification of metastasis-related genes of lung squamous cell carcinoma based on the Cancer Genome Atlas database

    PubMed Central

    Tian, Feng; Zhao, Jinlong; Kang, Zhenxing


    Background Lung squamous cell carcinoma (lung SCC) is a common type of malignancy. Its pathogenesis mechanism of tumor development is unclear. The aim of this study was to identify key genes for diagnosis biomarkers in lung SCC metastasis. Methods We searched and downloaded mRNA expression data and clinical data from The Cancer Genome Atlas (TCGA) database to identify differences in mRNA expression of primary tumor tissues from lung SCC with and without metastasis. Gene co-expression network analysis, protein-protein interaction (PPI) network, Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and quantitative real-time polymerase chain reactions (qRT-PCR) were used to explore the biological functions of the identified dysregulated genes. Results Four hundred and eighty-two differentially expressed genes (DEGs) were identified between lung SCC with and without metastasis. Nineteen modules were identified in lung SCC through weighted gene co-expression network analysis (WGCNA). Twenty-three DEGs and 26 DEGs were significantly enriched in the respective pink and black module. KEGG pathway analysis displayed that 26 DEGs in the black module were significantly enriched in bile secretion pathway. Forty-nine DEGs in the two gene co-expression module were used to construct PPI network. CFTR in the black module was the hub protein, had the connectivity with 182 genes. The results of qRT-PCR displayed that FIGF, SFTPD, DYNLRB2 were significantly down-regulated in the tumor samples of lung SCC with metastasis and CFTR, SCGB3A2, SSTR1, SCTR, ROPN1L had the down-regulation tendency in lung SCC with metastasis compared to lung SCC without metastasis. Conclusions The dysregulated genes including CFTR, SCTR and FIGF might be involved in the pathology of lung SCC metastasis and could be used as potential diagnosis biomarkers or therapeutic targets for lung SCC. PMID:28203405

  18. Gene expression profile of human lung epithelial cells chronically exposed to single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Chen, Dongquan; Stueckle, Todd A.; Luanpitpong, Sudjit; Rojanasakul, Yon; Lu, Yongju; Wang, Liying


    A rapid increase in utility of engineered nanomaterials, including carbon nanotubes (CNTs), has raised a concern over their safety. Based on recent evidence from animal studies, pulmonary exposure of CNTs may lead to nanoparticle accumulation in the deep lung without effective clearance which could interact with local lung cells for a long period of time. Physicochemical similarities of CNTs to asbestos fibers may contribute to their asbestos-like carcinogenic potential after long-term exposure, which has not been well addressed. More studies are needed to identify and predict the carcinogenic potential and mechanisms for promoting their safe use. Our previous study reported a long-term in vitro exposure model for CNT carcinogenicity and showed that 6-month sub-chronic exposure of single-walled carbon nanotubes (SWCNT) causes malignant transformation of human lung epithelial cells. In addition, the transformed cells induced tumor formation in mice and exhibited an apoptosis resistant phenotype, a key characteristic of cancer cells. Although the potential role of p53 in the transformation process was identified, the underlying mechanisms of oncogenesis remain largely undefined. Here, we further examined the gene expression profile by using genome microarrays to profile molecular mechanisms of SWCNT oncogenesis. Based on differentially expressed genes, possible mechanisms of SWCNT-associated apoptosis resistance and oncogenesis were identified, which included activation of pAkt/p53/Bcl-2 signaling axis, increased gene expression of Ras family for cell cycle control, Dsh-mediated Notch 1, and downregulation of apoptotic genes BAX and Noxa. Activated immune responses were among the major changes of biological function. Our findings shed light on potential molecular mechanisms and signaling pathways involved in SWCNT oncogenic potential.

  19. Gene expression-based prognostic signatures in lung cancer: ready for clinical use?


    Subramanian, Jyothi; Simon, Richard


    A substantial number of studies have reported the development of gene expression-based prognostic signatures for lung cancer. The ultimate aim of such studies should be the development of well-validated clinically useful prognostic signatures that improve therapeutic decision making beyond current practice standards. We critically reviewed published studies reporting the development of gene expression-based prognostic signatures for non-small cell lung cancer to assess the progress made toward this objective. Studies published between January 1, 2002, and February 28, 2009, were identified through a PubMed search. Following hand-screening of abstracts of the identified articles, 16 were selected as relevant. Those publications were evaluated in detail for appropriateness of the study design, statistical validation of the prognostic signature on independent datasets, presentation of results in an unbiased manner, and demonstration of medical utility for the new signature beyond that obtained using existing treatment guidelines. Based on this review, we found little evidence that any of the reported gene expression signatures are ready for clinical application. We also found serious problems in the design and analysis of many of the studies. We suggest a set of guidelines to aid the design, analysis, and evaluation of prognostic signature studies. These guidelines emphasize the importance of focused study planning to address specific medically important questions and the use of unbiased analysis methods to evaluate whether the resulting signatures provide evidence of medical utility beyond standard of care-based prognostic factors.

  20. Genome Wide Host Gene Expression Analysis in Chicken Lungs Infected with Avian Influenza Viruses.


    Ranaware, Pradip B; Mishra, Anamika; Vijayakumar, Periyasamy; Gandhale, Pradeep N; Kumar, Himanshu; Kulkarni, Diwakar D; Raut, Ashwin Ashok


    The molecular pathogenesis of avian influenza infection varies greatly with individual bird species and virus strain. The molecular pathogenesis of the highly pathogenic avian influenza virus (HPAIV) or the low pathogenic avian influenza virus (LPAIV) infection in avian species remains poorly understood. Thus, global immune response of chickens infected with HPAI H5N1 (A/duck/India/02CA10/2011) and LPAI H9N2 (A/duck/India/249800/2010) viruses was studied using microarray to identify crucial host genetic components responsive to these infection. HPAI H5N1 virus induced excessive expression of type I IFNs (IFNA and IFNG), cytokines (IL1B, IL18, IL22, IL13, and IL12B), chemokines (CCL4, CCL19, CCL10, and CX3CL1) and IFN stimulated genes (OASL, MX1, RSAD2, IFITM5, IFIT5, GBP 1, and EIF2AK) in lung tissues. This dysregulation of host innate immune genes may be the critical determinant of the severity and the outcome of the influenza infection in chickens. In contrast, the expression levels of most of these genes was not induced in the lungs of LPAI H9N2 virus infected chickens. This study indicated the relationship between host immune genes and their roles in pathogenesis of HPAIV infection in chickens.

  1. Genome Wide Host Gene Expression Analysis in Chicken Lungs Infected with Avian Influenza Viruses

    PubMed Central

    Gandhale, Pradeep N.; Kumar, Himanshu; Kulkarni, Diwakar D.


    The molecular pathogenesis of avian influenza infection varies greatly with individual bird species and virus strain. The molecular pathogenesis of the highly pathogenic avian influenza virus (HPAIV) or the low pathogenic avian influenza virus (LPAIV) infection in avian species remains poorly understood. Thus, global immune response of chickens infected with HPAI H5N1 (A/duck/India/02CA10/2011) and LPAI H9N2 (A/duck/India/249800/2010) viruses was studied using microarray to identify crucial host genetic components responsive to these infection. HPAI H5N1 virus induced excessive expression of type I IFNs (IFNA and IFNG), cytokines (IL1B, IL18, IL22, IL13, and IL12B), chemokines (CCL4, CCL19, CCL10, and CX3CL1) and IFN stimulated genes (OASL, MX1, RSAD2, IFITM5, IFIT5, GBP 1, and EIF2AK) in lung tissues. This dysregulation of host innate immune genes may be the critical determinant of the severity and the outcome of the influenza infection in chickens. In contrast, the expression levels of most of these genes was not induced in the lungs of LPAI H9N2 virus infected chickens. This study indicated the relationship between host immune genes and their roles in pathogenesis of HPAIV infection in chickens. PMID:27071061

  2. Restoration of Mitochondrial Gene Expression Using a Cloned Human Gene in Chinese Hamster Lung Cell Mutant

    PubMed Central

    Sherif, Zaki A; Broome, Carolyn W


    Background Gal−32 is a Chinese hamster lung cell nuclear mutant that is unable to grow in galactose due to a defect in mitochondrial protein synthesis. Since the product of the Gal−32 gene was unknown, it was imperative to use phenotypic complementation to clone a human gene that corrected the Gal−32 mutation. Results Recessive Gal−32 cells were co-transformed with pSV2-neo plasmid DNA and recombinant DNA from a human genomic library containing the dominant human Gal+ gene and a chloramphenicol-resistance (camr) gene present in the pSV13 vector. Primary transformants were selected by growth in galactose and the neomycin analog G418. In order to rescue the human Gal+ gene, a genomic library was constructed with primary transformant DNA and the pCV108 cosmid vector. The camr gene was used to identify clones with the nearby human sequences. DNA from two camr, Alu-hybridizing clones was able to transform the recessive Gal−32 cells to the Gal+ phenotype and to restore mitochondrial protein synthesis. Conclusion These data demonstrate the isolation of two pCV108-transformant recombinant clones containing a human gene that complements the Chinese hamster Gal−32 mutation and restores galactose metabolism. PMID:26052559

  3. Expression of tumor necrosis factor-alpha-mediated genes predicts recurrence-free survival in lung cancer.


    Wang, Baohua; Song, Ning; Yu, Tong; Zhou, Lianya; Zhang, Helin; Duan, Lin; He, Wenshu; Zhu, Yihua; Bai, Yunfei; Zhu, Miao


    In this study, we conducted a meta-analysis on high-throughput gene expression data to identify TNF-α-mediated genes implicated in lung cancer. We first investigated the gene expression profiles of two independent TNF-α/TNFR KO murine models. The EGF receptor signaling pathway was the top pathway associated with genes mediated by TNF-α. After matching the TNF-α-mediated mouse genes to their human orthologs, we compared the expression patterns of the TNF-α-mediated genes in normal and tumor lung tissues obtained from humans. Based on the TNF-α-mediated genes that were dysregulated in lung tumors, we developed a prognostic gene signature that effectively predicted recurrence-free survival in lung cancer in two validation cohorts. Resampling tests suggested that the prognostic power of the gene signature was not by chance, and multivariate analysis suggested that this gene signature was independent of the traditional clinical factors and enhanced the identification of lung cancer patients at greater risk for recurrence.

  4. Global gene expression profiling in human lung cells exposed to cobalt

    PubMed Central

    Malard, Veronique; Berenguer, Frederic; Prat, Odette; Ruat, Sylvie; Steinmetz, Gerard; Quemeneur, Eric


    Background It has been estimated that more than 1 million workers in the United States are exposed to cobalt. Occupational exposure to 59 Co occurs mainly via inhalation and leads to various lung diseases. Cobalt is classified by the IARC as a possible human carcinogen (group 2B). Although there is evidence for in vivo and in vitro toxicity, the mechanisms of cobalt-induced lung toxicity are not fully known. The purpose of this work was to identify potential signatures of acute cobalt exposure using a toxicogenomic approach. Data analysis focused on some cellular processes and protein targets that are thought to be relevant for carcinogenesis, transport and biomarker research. Results A time course transcriptome analysis was performed on A549 human pulmonary cells, leading to the identification of 85 genes which are repressed or induced in response to soluble 59 Co. A group of 29 of these genes, representing the main biological functions, was assessed by quantitative RT-PCR. The expression profiles of six of them were then tested by quantitative RT-PCR in a time-dependent manner and three modulations were confirmed by Western blotting. The 85 modulated genes include potential cobalt carriers (FBXL2, ZNT1, SLC12A5), tumor suppressors or transcription factors (MAZ, DLG1, MYC, AXL) and genes linked to the stress response (UBC, HSPCB, BNIP3L). We also identified nine genes coding for secreted proteins as candidates for biomarker research. Of those, TIMP2 was found to be down-regulated and this modulation was confirmed, in a dose-dependent manner, at protein level in the supernatant of exposed cells. Conclusion Most of these genes have never been described as related to cobalt stress and provide original hypotheses for further study of the effects of this metal ion on human lung epithelial cells. A putative biomarker of cobalt toxicity was identified. PMID:17553155

  5. Temporal expression of hypoxia-regulated genes is associated with early changes in redox status in irradiated lung

    PubMed Central

    Jackson, Isabel L.; Zhang, Xiuwu; Hadley, Caroline; Rabbani, Zahid N.; Zhang, Yu; Marks, Sam; Vujaskovic, Zeljko


    The development of normal lung tissue toxicity after radiation exposure results from multiple changes in cell signaling and communication initiated at the time of the ionizing event. The onset of gross pulmonary injury is preceded by tissue hypoxia and chronic oxidative stress. We have previously shown development of debilitating lung injury can be mitigated or prevented by administration of AEOL10150, a potent catalytic antioxidant, 24 hours after radiation. This suggests that hypoxia-mediated signaling pathways may play a role in late radiation injury, but the exact mechanism remains unclear. The purpose of this study was to evaluate changes in the temporal expression of hypoxia-associated genes in irradiated mouse lung and determine whether AEOL10150 alters expression of these genes. A focused oligo array was used to establish a hypoxia-associated gene expression signature for lung tissue from sham-irradiated or irradiated mice treated with or without AEOL10150. Results were further verified by RT-PCR. 44 genes associated with metabolism, cell growth, apoptosis, inflammation, oxidative stress and extracellular matrix synthesis were upregulated after radiation. Elevated expression of 31 of these genes was attenuated in animals treated with AEOL10150, suggesting that expression of a number of hypoxia-associated genes are regulated by early development of oxidative stress after radiation. Genes identified herein could provide insight into the role of hypoxic signaling in radiation lung injury, suggesting novel therapeutic targets, as well as clues to the mechanism by which AEOL10150 confers pulmonary radioprotection. PMID:22588005

  6. Expression of the p16{sup INK4a} tumor suppressor gene in rodent lung tumors

    SciTech Connect

    Swafford, D.S.; Tesfaigzi, J.; Belinsky, S.A.


    Aberrations on the short arm of chromosome 9 are among the earliest genetic changes in human cancer. p16{sup INK4a} is a candidate tumor suppressor gene that lies within human 9p21, a chromosome region associated with frequent loss of heterozygosity in human lung tumors. The p16{sup INK4a} protein functions as an inhibitor of cyclin D{sub 1}-dependent kinases that phosphorylate the retinoblastoma (Rb) tumor suppressor gene product enabling cell-cycle progression. Thus, overexpression of cyclin D{sub 1}, mutation of cyclin-dependent kinase genes, or loss of p16{sup INK4a} function, can all result in functional inactivation of Rb. Inactivation of Rb by mutation or deletion can result in an increase in p16{sup INK4a} transcription, suggesting that an increased p16{sup INK4a} expression in a tumor cell signals dysfunction of the pathway. The p16{sup (INK4a)} gene, unlike some tumor suppressor genes, is rarely inactivated by mutation. Instead, the expression of this gene is suppressed in some human cancers by hypermethylation of the CpG island within the first exon or by homozygous deletion: 686. Chromosome losses have been observed at 9p21 syntenic loci in tumors of the mouse and rat, two species often used as animal models for pulmonary carcinogenesis. Expression of p16{sup INK4a} is lost in some mouse tumor cell lines, often due to homozygous deletion. These observations indicate that p16{sup INK4a} dysfunction may play a role in the development of neoplasia in rodents as well as humans. The purpose of the current investigation was to define the extent to which p16{sup INK4a} dysfunction contributes to the development of rodent lung tumors and to determine the mechanism of inactivation of the gene. There is no evidence to suggest a loss of function of the p16{sup INK4a} tumor suppressor gene in these primary murine lung tumors by mutation, deletion, or methylation.

  7. Gene Expression Profiling of Lung Tissue of Rats Exposed to Lunar Dust Particles

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Feiveson, Alan H.; Lam, Chiu-Wing; Kidane, Yared H.; Ploutz-Snyder Robert; Yeshitla, Samrawit; Zalesak, Selina M.; Scully, Robert R.; Wu, Honglu; James, John T.


    The purpose of the study is to analyze the dynamics of global gene expression changes in the lung tissue of rats exposed to lunar dust particles. Multiple pathways and transcription factors were identified using the Ingenuity Pathway Analysis tool, showing the potential networks of these signaling regulations involved in lunar dust-induced prolonged proflammatory response and toxicity. The data presented in this study, for the first time, explores the molecular mechanisms of lunar dust induced toxicity. This work contributes not only to the risk assessment for future space exploration, but also to the understanding of the dust-induced toxicity to humans on earth.

  8. Evaluation of Machine Learning Algorithm Utilization for Lung Cancer Classification Based on Gene Expression Levels.


    Podolsky, Maxim D; Barchuk, Anton A; Kuznetcov, Vladimir I; Gusarova, Natalia F; Gaidukov, Vadim S; Tarakanov, Segrey A


    Lung cancer remains one of the most common cancers in the world, both in terms of new cases (about 13% of total per year) and deaths (nearly one cancer death in five), because of the high case fatality. Errors in lung cancer type or malignant growth determination lead to degraded treatment efficacy, because anticancer strategy depends on tumor morphology. We have made an attempt to evaluate effectiveness of machine learning algorithms in the task of lung cancer classification based on gene expression levels. We processed four publicly available data sets. The Dana-Farber Cancer Institute data set contains 203 samples and the task was to classify four cancer types and sound tissue samples. With the University of Michigan data set of 96 samples, the task was to execute a binary classification of adenocarcinoma and non-neoplastic tissues. The University of Toronto data set contains 39 samples and the task was to detect recurrence, while with the Brigham and Women's Hospital data set of 181 samples it was to make a binary classification of malignant pleural mesothelioma and adenocarcinoma. We used the k-nearest neighbor algorithm (k=1, k=5, k=10), naive Bayes classifier with assumption of both a normal distribution of attributes and a distribution through histograms, support vector machine and C4.5 decision tree. Effectiveness of machine learning algorithms was evaluated with the Matthews correlation coefficient. The support vector machine method showed best results among data sets from the Dana-Farber Cancer Institute and Brigham and Women's Hospital. All algorithms with the exception of the C4.5 decision tree showed maximum potential effectiveness in the University of Michigan data set. However, the C4.5 decision tree showed best results for the University of Toronto data set. Machine learning algorithms can be used for lung cancer morphology classification and similar tasks based on gene expression level evaluation.

  9. Genetic regulation of gene expression in the lung identifies CST3 and CD22 as potential causal genes for airflow obstruction.


    Lamontagne, Maxime; Timens, Wim; Hao, Ke; Bossé, Yohan; Laviolette, Michel; Steiling, Katrina; Campbell, Joshua D; Couture, Christian; Conti, Massimo; Sherwood, Karen; Hogg, James C; Brandsma, Corry-Anke; van den Berge, Maarten; Sandford, Andrew; Lam, Stephen; Lenburg, Marc E; Spira, Avrum; Paré, Peter D; Nickle, David; Sin, Don D; Postma, Dirkje S


    COPD is a complex chronic disease with poorly understood pathogenesis. Integrative genomic approaches have the potential to elucidate the biological networks underlying COPD and lung function. We recently combined genome-wide genotyping and gene expression in 1111 human lung specimens to map expression quantitative trait loci (eQTL). To determine causal associations between COPD and lung function-associated single nucleotide polymorphisms (SNPs) and lung tissue gene expression changes in our lung eQTL dataset. We evaluated causality between SNPs and gene expression for three COPD phenotypes: FEV(1)% predicted, FEV(1)/FVC and COPD as a categorical variable. Different models were assessed in the three cohorts independently and in a meta-analysis. SNPs associated with a COPD phenotype and gene expression were subjected to causal pathway modelling and manual curation. In silico analyses evaluated functional enrichment of biological pathways among newly identified causal genes. Biologically relevant causal genes were validated in two separate gene expression datasets of lung tissues and bronchial airway brushings. High reliability causal relations were found in SNP-mRNA-phenotype triplets for FEV(1)% predicted (n=169) and FEV(1)/FVC (n=80). Several genes of potential biological relevance for COPD were revealed. eQTL-SNPs upregulating cystatin C (CST3) and CD22 were associated with worse lung function. Signalling pathways enriched with causal genes included xenobiotic metabolism, apoptosis, protease-antiprotease and oxidant-antioxidant balance. By using integrative genomics and analysing the relationships of COPD phenotypes with SNPs and gene expression in lung tissue, we identified CST3 and CD22 as potential causal genes for airflow obstruction. This study also augmented the understanding of previously described COPD pathways. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  10. Validation of the Lung Subtyping Panel in Multiple Fresh-Frozen and Formalin-Fixed, Paraffin-Embedded Lung Tumor Gene Expression Data Sets.


    Faruki, Hawazin; Mayhew, Gregory M; Fan, Cheng; Wilkerson, Matthew D; Parker, Scott; Kam-Morgan, Lauren; Eisenberg, Marcia; Horten, Bruce; Hayes, D Neil; Perou, Charles M; Lai-Goldman, Myla


    Context .- A histologic classification of lung cancer subtypes is essential in guiding therapeutic management. Objective .- To complement morphology-based classification of lung tumors, a previously developed lung subtyping panel (LSP) of 57 genes was tested using multiple public fresh-frozen gene-expression data sets and a prospectively collected set of formalin-fixed, paraffin-embedded lung tumor samples. Design .- The LSP gene-expression signature was evaluated in multiple lung cancer gene-expression data sets totaling 2177 patients collected from 4 platforms: Illumina RNAseq (San Diego, California), Agilent (Santa Clara, California) and Affymetrix (Santa Clara) microarrays, and quantitative reverse transcription-polymerase chain reaction. Gene centroids were calculated for each of 3 genomic-defined subtypes: adenocarcinoma, squamous cell carcinoma, and neuroendocrine, the latter of which encompassed both small cell carcinoma and carcinoid. Classification by LSP into 3 subtypes was evaluated in both fresh-frozen and formalin-fixed, paraffin-embedded tumor samples, and agreement with the original morphology-based diagnosis was determined. Results .- The LSP-based classifications demonstrated overall agreement with the original clinical diagnosis ranging from 78% (251 of 322) to 91% (492 of 538 and 869 of 951) in the fresh-frozen public data sets and 84% (65 of 77) in the formalin-fixed, paraffin-embedded data set. The LSP performance was independent of tissue-preservation method and gene-expression platform. Secondary, blinded pathology review of formalin-fixed, paraffin-embedded samples demonstrated concordance of 82% (63 of 77) with the original morphology diagnosis. Conclusions .- The LSP gene-expression signature is a reproducible and objective method for classifying lung tumors and demonstrates good concordance with morphology-based classification across multiple data sets. The LSP panel can supplement morphologic assessment of lung cancers, particularly

  11. Gene expression profiling in the lung and liver of PFOA-exposed mouse fetuses.


    Rosen, Mitchell B; Thibodeaux, Julie R; Wood, Carmen R; Zehr, Robert D; Schmid, Judith E; Lau, Christopher


    Perfluorooctanoic acid (PFOA) is a stable perfluoroalkyl acid used to synthesize fluoropolymers during the manufacture of a wide variety of products. Concerns have been raised over the potential health effects of PFOA because it is persistent in the environment and can be detected in blood and other tissues of many animal species, including humans. PFOA has also been shown to induce growth deficits and mortality in murine neonates. To better understand the mechanism of PFOA induced developmental toxicity, lung and liver gene expression profiling was conducted in PFOA-exposed full-term mouse fetuses. Thirty timed-pregnant CD-1 mice were orally dosed from gestation days 1-17 with either 0, 1, 3, 5, or 10mg/(kgday) PFOA in water. At term, fetal lung and liver were collected, total RNA prepared, and samples pooled from three fetuses per litter. Five biological replicates consisting of individual litter samples were then evaluated for each treatment group using Affymetrix mouse 430_2 microarrays. The expression of genes related to fatty acid catabolism was altered in both the fetal liver and lung. In the fetal liver, the effects of PFOA were robust and also included genes associated with lipid transport, ketogenesis, glucose metabolism, lipoprotein metabolism, cholesterol biosynthesis, steroid metabolism, bile acid biosynthesis, phospholipid metabolism, retinol metabolism, proteosome activation, and inflammation. These changes are consistent with transactivation of PPARalpha, although, with regard to bile acid biosynthesis and glucose metabolism, non-PPARalpha related effects were suggested as well. Additional studies will be needed to more thoroughly address the role of PPARalpha, and other nuclear receptors, in PFOA mediated developmental toxicity.

  12. Prediction of lung cancer based on serum biomarkers by gene expression programming methods.


    Yu, Zhuang; Chen, Xiao-Zheng; Cui, Lian-Hua; Si, Hong-Zong; Lu, Hai-Jiao; Liu, Shi-Hai


    In diagnosis of lung cancer, rapid distinction between small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) tumors is very important. Serum markers, including lactate dehydrogenase (LDH), C-reactive protein (CRP), carcino-embryonic antigen (CEA), neurone specific enolase (NSE) and Cyfra21-1, are reported to reflect lung cancer characteristics. In this study classification of lung tumors was made based on biomarkers (measured in 120 NSCLC and 60 SCLC patients) by setting up optimal biomarker joint models with a powerful computerized tool - gene expression programming (GEP). GEP is a learning algorithm that combines the advantages of genetic programming (GP) and genetic algorithms (GA). It specifically focuses on relationships between variables in sets of data and then builds models to explain these relationships, and has been successfully used in formula finding and function mining. As a basis for defining a GEP environment for SCLC and NSCLC prediction, three explicit predictive models were constructed. CEA and NSE are frequently- used lung cancer markers in clinical trials, CRP, LDH and Cyfra21-1 have significant meaning in lung cancer, basis on CEA and NSE we set up three GEP models-GEP 1(CEA, NSE, Cyfra21-1), GEP2 (CEA, NSE, LDH), GEP3 (CEA, NSE, CRP). The best classification result of GEP gained when CEA, NSE and Cyfra21-1 were combined: 128 of 135 subjects in the training set and 40 of 45 subjects in the test set were classified correctly, the accuracy rate is 94.8% in training set; on collection of samples for testing, the accuracy rate is 88.9%. With GEP2, the accuracy was significantly decreased by 1.5% and 6.6% in training set and test set, in GEP3 was 0.82% and 4.45% respectively. Serum Cyfra21-1 is a useful and sensitive serum biomarker in discriminating between NSCLC and SCLC. GEP modeling is a promising and excellent tool in diagnosis of lung cancer.

  13. Concurrent host-pathogen gene expression in the lungs of pigs challenged with Actinobacillus pleuropneumoniae.


    Brogaard, Louise; Klitgaard, Kirstine; Heegaard, Peter M H; Hansen, Mette Sif; Jensen, Tim Kåre; Skovgaard, Kerstin


    Actinobacillus pleuropneumoniae causes pleuropneumonia in pigs, a disease which is associated with high morbidity and mortality, as well as impaired animal welfare. To obtain in-depth understanding of this infection, the interplay between virulence factors of the pathogen and defense mechanisms of the porcine host needs to be elucidated. However, research has traditionally focused on either bacteriology or immunology; an unbiased picture of the transcriptional responses can be obtained by investigating both organisms in the same biological sample. Host and pathogen responses in pigs experimentally infected with A. pleuropneumoniae were analyzed by high-throughput RT-qPCR. This approach allowed concurrent analysis of selected genes encoding proteins known or hypothesized to be important in the acute phase of this infection. The expression of 17 bacterial and 31 porcine genes was quantified in lung samples obtained within the first 48 hours of infection. This provided novel insight into the early time course of bacterial genes involved in synthesis of pathogen-associated molecular patterns (lipopolysaccharide, peptidoglycan, lipoprotein) and genes involved in pattern recognition (TLR4, CD14, MD2, LBP, MYD88) in response to A. pleuropneumoniae. Significant up-regulation of proinflammatory cytokines such as IL1B, IL6, and IL8 was observed, correlating with protein levels, infection status and histopathological findings. Host genes encoding proteins involved in iron metabolism, as well as bacterial genes encoding exotoxins, proteins involved in adhesion, and iron acquisition were found to be differentially expressed according to disease progression. By applying laser capture microdissection, porcine expression of selected genes could be confirmed in the immediate surroundings of the invading pathogen. Microbial pathogenesis is the product of interactions between host and pathogen. Our results demonstrate the applicability of high-throughput RT-qPCR for the elucidation

  14. Efficiency Analysis of Competing Tests for Finding Differentially Expressed Genes in Lung Adenocarcinoma

    PubMed Central

    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James


    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA ( to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The ‘best’ test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  15. Efficiency analysis of competing tests for finding differentially expressed genes in lung adenocarcinoma.


    Jordan, Rick; Patel, Satish; Hu, Hai; Lyons-Weiler, James


    In this study, we introduce and use Efficiency Analysis to compare differences in the apparent internal and external consistency of competing normalization methods and tests for identifying differentially expressed genes. Using publicly available data, two lung adenocarcinoma datasets were analyzed using caGEDA ( to measure the degree of differential expression of genes existing between two populations. The datasets were randomly split into at least two subsets, each analyzed for differentially expressed genes between the two sample groups, and the gene lists compared for overlapping genes. Efficiency Analysis is an intuitive method that compares the differences in the percentage of overlap of genes from two or more data subsets, found by the same test over a range of testing methods. Tests that yield consistent gene lists across independently analyzed splits are preferred to those that yield less consistent inferences. For example, a method that exhibits 50% overlap in the 100 top genes from two studies should be preferred to a method that exhibits 5% overlap in the top 100 genes. The same procedure was performed using all available normalization and transformation methods that are available through caGEDA. The 'best' test was then further evaluated using internal cross-validation to estimate generalizable sample classification errors using a Naïve Bayes classification algorithm. A novel test, termed D1 (a derivative of the J5 test) was found to be the most consistent, and to exhibit the lowest overall classification error, and highest sensitivity and specificity. The D1 test relaxes the assumption that few genes are differentially expressed. Efficiency Analysis can be misleading if the tests exhibit a bias in any particular dimension (e.g. expression intensity); we therefore explored intensity-scaled and segmented J5 tests using data in which all genes are scaled to share the same intensity distribution range

  16. Microarray expression profiles of genes in lung tissues of rats subjected to focal cerebral ischemia-induced lung injury following bone marrow-derived mesenchymal stem cell transplantation.


    Hu, Yue; Xiong, Liu-Lin; Zhang, Piao; Wang, Ting-Hua


    Ischemia-induced stroke is the most common disease of the nervous system and is associated with a high mortality rate worldwide. Cerebral ischemia may lead to remote organ dysfunction, particular in the lungs, resulting in lung injury. Nowadays, bone marrow-derived mesenchymal stem cells (BMSCs) are widely studied in clinical trials as they may provide an effective solution to the treatment of neurological and cardiac diseases; however, the underlying molecular mechanisms remain unknown. In this study, a model of permanent focal cerebral ischemia-induced lung injury was successfully established and confirmed by neurological evaluation and lung injury scores. We demonstrated that the transplantation of BMSCs (passage 3) via the tail vein into the lung tissues attenuated lung injury. In order to elucidate the underlying molecular mechanisms, we analyzed the gene expression profiles in lung tissues from the rats with focal cerebral ischemia and transplanted with BMSCs using a Gene microarray. Moreover, the Gene Ontology database was employed to determine gene function. We found that the phosphoinositide 3-kinase (PI3K)-AKT signaling pathway, transforming growth factor-β (TGF-β) and platelet-derived growth factor (PDGF) were downregulated in the BMSC transplantation groups, compared with the control group. These results suggested that BMSC transplantation may attenuate lung injury following focal cerebral ischemia and that this effect is associated with the downregulation of TGF-β, PDGF and the PI3K-AKT pathway.

  17. Microarray expression profiles of genes in lung tissues of rats subjected to focal cerebral ischemia-induced lung injury following bone marrow-derived mesenchymal stem cell transplantation

    PubMed Central

    Hu, Yue; Xiong, Liu-Lin; Zhang, Piao; Wang, Ting-Hua


    Ischemia-induced stroke is the most common disease of the nervous system and is associated with a high mortality rate worldwide. Cerebral ischemia may lead to remote organ dysfunction, particular in the lungs, resulting in lung injury. Nowadays, bone marrow-derived mesenchymal stem cells (BMSCs) are widely studied in clinical trials as they may provide an effective solution to the treatment of neurological and cardiac diseases; however, the underlying molecular mechanisms remain unknown. In this study, a model of permanent focal cerebral ischemia-induced lung injury was successfully established and confirmed by neurological evaluation and lung injury scores. We demonstrated that the transplantation of BMSCs (passage 3) via the tail vein into the lung tissues attenuated lung injury. In order to elucidate the underlying molecular mechanisms, we analyzed the gene expression profiles in lung tissues from the rats with focal cerebral ischemia and transplanted with BMSCs using a Gene microarray. Moreover, the Gene Ontology database was employed to determine gene function. We found that the phosphoinositide 3-kinase (PI3K)-AKT signaling pathway, transforming growth factor-β (TGF-β) and platelet-derived growth factor (PDGF) were downregulated in the BMSC transplantation groups, compared with the control group. These results suggested that BMSC transplantation may attenuate lung injury following focal cerebral ischemia and that this effect is associated with the downregulation of TGF-β, PDGF and the PI3K-AKT pathway. PMID:27922691

  18. In Utero Environmental Tobacco Smoke Exposure Alters Gene Expression in Lungs of Adult BALB/c Mice

    PubMed Central

    Rouse, Rodney L.; Boudreaux, Marc J.; Penn, Arthur L.


    Background In utero environmental tobacco smoke (ETS) exposure exacerbates initial lung responses of adult mice to ovalbumin (OVA), a common allergen in rodent models of allergic asthma. Objective We tested the hypothesis that in utero ETS exposure alters expression of genes (including asthma-related and inflammatory genes) in the lungs of adult mice and that this differential expression is reflected in differential respiratory and immune responses to nontobacco allergens. Methods Using Affymetrix Mouse Genome 430 2.0 arrays, we examined gene expression changes in lungs of BALB/c mice exposed to ETS in utero, OVA, or saline aerosol at weeks 7–8, and OVA sensitization and challenge at weeks 11–15. Data sets were filtered by transcript p-value (≤ 0.05), false discovery rate (≤ 0.05), and fold change (≥ 1.5). Differential expression of selected genes was confirmed by polymerase chain reaction (PCR). Results Genes differentially expressed as a result of in utero ETS exposure are involved in regulation of biological processes (immune response, cell proliferation, apoptosis, cell metabolism) through altered cytoskeleton, adhesion, transcription, and enzyme molecules. A number of genes prominent in lung inflammation were differentially expressed on PCR but did not pass selection criteria for microarray, including arginase (Arg1), chitinases (Chia, Chi3l3, Chi3l4), eotaxins (Ccl11, Ccl24), small proline-rich protein 2a (Sprr2a), and cytokines (Il4, Il6, Il10, Il13, Tnfa) . Conclusion The differential lung gene expression reported here is consistent with previously reported functional changes in lungs of mice exposed in utero to ETS and as adults to the nontobacco allergen OVA. PMID:18087596

  19. In utero environmental tobacco smoke exposure alters gene expression in lungs of adult BALB/c mice.


    Rouse, Rodney L; Boudreaux, Marc J; Penn, Arthur L


    In utero environmental tobacco smoke (ETS) exposure exacerbates initial lung responses of adult mice to ovalbumin (OVA), a common allergen in rodent models of allergic asthma. We tested the hypothesis that in utero ETS exposure alters expression of genes (including asthma-related and inflammatory genes) in the lungs of adult mice and that this differential expression is reflected in differential respiratory and immune responses to nontobacco allergens. Using Affymetrix Mouse Genome 430 2.0 arrays, we examined gene expression changes in lungs of BALB/c mice exposed to ETS in utero, OVA, or saline aerosol at weeks 7-8, and OVA sensitization and challenge at weeks 11-15. Data sets were filtered by transcript p-value (< or = 0.05), false discovery rate (< or = 0.05), and fold change (> or = 1.5). Differential expression of selected genes was confirmed by polymerase chain reaction (PCR). Genes differentially expressed as a result of in utero ETS exposure are involved in regulation of biological processes (immune response, cell proliferation, apoptosis, cell metabolism) through altered cytoskeleton, adhesion, transcription, and enzyme molecules. A number of genes prominent in lung inflammation were differentially expressed on PCR but did not pass selection criteria for microarray, including arginase (Arg1), chitinases (Chia, Chi3l3, Chi3l4), eotaxins (Ccl11, Ccl24), small proline-rich protein 2a (Sprr2a), and cytokines (Il4, Il6, Il10, Il13, Tnfa) . The differential lung gene expression reported here is consistent with previously reported functional changes in lungs of mice exposed in utero to ETS and as adults to the nontobacco allergen OVA.

  20. Screening and identification of distant metastasis-related differentially expressed genes in human squamous cell lung carcinoma.


    Wang, Na; Zhou, Fachen; Xiong, Hai; Du, Sha; Ma, Jianwei; Okai, Issac; Wang, Jian; Suo, Jing; Hao, Lihong; Song, Yang; Hu, Jun; Shao, Shujuan


    Distant metastasis is one of the leading causes of lung cancer death. Detecting the early-stage molecular alternations in primary tumors, such as gene expression differences, provides a "prognostic" value to the precaution of tumor metastasis. The aim of this article is to screen and identify the metastasis-related genes in human squamous cell lung carcinoma. Primary tumor tissues of nine patients with subsequent metastasis and eight patients without metastasis were selected to perform the gene microarray experiment. GO and pathway analyses were used to determine the differentially expressed genes. Two identified genes were further validated by real-time quantitative reverse transcription polymerase chain reaction (PCR) (real-time qRT-PCR). Two hundred and thirty-eight differentially expressed genes were detected in gene chip experiment, including 51 up-regulated genes and 187 down-regulated genes. These genes were involved in several cellular processes, including cell adhesion, cell cycle regulation, and apoptosis. GO analysis showed that the differentially expressed genes participated in a wide ranging of metastasis-related processes, including extracellular region and regulation of liquid surface tension. In addition, pathway analysis demonstrated that the differentially expressed genes were enriched in pathways related to cell cycle and Wnt signaling. Real-time qRT-PCR validation experiment of LCN2 and PDZK1IP1 showed a consistent up-regulation in the metastasis group. The metastasis of human squamous cell lung carcinoma is a complex process that is regulated by multiple gene alternations on the expression levels. The 238 differentially expressed genes identified in this study presumably contain a core set of genes involved in tumor metastasis. The real-time qRT-PCR results of PDZK1IP1 and LCN2 validated the reliability of this gene microarray experiment.

  1. Expression of nicotinic acetylcholine receptor subunit genes in non-small-cell lung cancer reveals differences between smokers and nonsmokers.


    Lam, David Chi-Leung; Girard, Luc; Ramirez, Ruben; Chau, Wing-Shun; Suen, Wai-sing; Sheridan, Shelley; Tin, Vicky P C; Chung, Lap-ping; Wong, Maria P; Shay, Jerry W; Gazdar, Adi F; Lam, Wah-kit; Minna, John D


    Nicotine and its derivatives, by binding to nicotinic acetylcholine receptors (nAChR) on bronchial epithelial cells, can regulate cellular proliferation and apoptosis via activating the Akt pathway. Delineation of nAChR subtypes in non-small-cell lung cancers (NSCLC) may provide information for prevention or therapeutic targeting. Expression of nAChR subunit genes in 66 resected primary NSCLCs, 7 histologically non-involved lung tissues, 13 NSCLC cell lines, and 6 human bronchial epithelial cell lines (HBEC) was analyzed with quantitative PCR and microarray analysis. Five nonmalignant HBECs were exposed to nicotine in vitro to study the variation of nAChR subunit gene expression with nicotine exposure and removal. NSCLCs from nonsmokers showed higher expression of nAChR alpha6 (P < 0.001) and beta3 (P = 0.007) subunit genes than those from smokers, adjusted for gender. In addition, nAChR alpha4 (P < 0.001) and beta4 (P = 0.029) subunit gene expression showed significant difference between NSCLCs and normal lung. Using Affymetrix GeneChip U133 Sets, 65 differentially expressed genes associated with NSCLC nonsmoking nAChR alpha6beta3 phenotype were identified, which gave high sensitivity and specificity of prediction. nAChR alpha1, alpha5, and alpha7 showed significant reversible changes in expression levels in HBECs upon nicotine exposure. We conclude that between NSCLCs from smokers and nonsmokers, different nAChR subunit gene expression patterns were found, and a 65-gene expression signature was associated with nonsmoking nAChR alpha6beta3 expression. Finally, nicotine exposure in HBECs resulted in reversible differences in nAChR subunit gene expression. These results further implicate nicotine in bronchial carcinogenesis and suggest targeting nAChRs for prevention and therapy in lung cancer.

  2. Altered expression of the IQGAP1 gene in human lung cancer cell lines

    SciTech Connect

    Mitchell, C.E.; Palmisano, W.A.; Lechner, J.F.


    IQGAP1 is a GTPase activation protein that accelerates GTP hydrolysis by normal p21 ras proteins. Therefore, IQGAP1 could act as an upstream affector of p21 ras activity by convert in excess amounts of active GTP-21 ras to inactive GDP-21 ras. IQGAP1 displays extensive sequence similarity to the catalytic domain of all previously reported ras GAPs, including the tumor suppressor gene protein neurofibromatosis type 1 (NF1). It has been shown that abnormal NF1 protein cannot negatively regulate the activity of ras proteins in neuroblast cells. This observation supports the hypothesis that NF1 is a tumor suppressor gene whose product acts upstream of ras. IQGAP1 is primarily expressed in lung, where it may play a role similar to NF1 in regulating the activity of H-ras or K-ras proteins. IQGAP1 functions as other GAPs by controlling the activity of ras.

  3. Pulmonary FGF-18 gene expression is downregulated during the canalicular-saccular stages in nitrofen-induced hypoplastic lungs.


    Takahashi, Hiromizu; Friedmacher, Florian; Fujiwara, Naho; Hofmann, Alejandro; Kutasy, Balazs; Gosemann, Jan-Hendrik; Puri, Prem


    Pulmonary hypoplasia (PH) associated with congenital diaphragmatic hernia (CDH) represents one of the major challenges in neonatal intensive care. However, the molecular pathogenesis of PH is still poorly understood. In developing fetal lungs, fibroblast growth factor 18 (FGF-18) plays a crucial role in distal airway maturation. FGF-18 knockouts show smaller lung sizes with reduced alveolar spaces and thicker interstitial mesenchymal compartments, highlighting its important function for fetal lung growth and differentiation. We hypothesized that pulmonary FGF-18 gene expression is downregulated during late gestation in nitrofen-induced hypoplastic lungs. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetuses were harvested on D18 and D21, and lungs were divided into three groups: controls, hypoplastic lungs without CDH [CDH(-)], and hypoplastic lungs with CDH [CDH(+)] (n = 24 at each time-point). Pulmonary FGF-18 gene expression levels were analyzed by qRT-PCR. Immunohistochemistry was performed to investigate FGF-18 protein expression/distribution. Relative mRNA levels of pulmonary FGF-18 gene expression were significantly decreased in CDH(-) and CDH(+) on D18 and D21 compared to controls (p < 0.05 and p < 0.01, respectively). Immunoreactivity of FGF-18 was markedly diminished in mesenchymal cells surrounding the airway epithelium on D18 and D21 compared to controls. Downregulation of FGF-18 gene expression in nitrofen-induced hypoplastic lungs suggests that decreased FGF-18 expression during the canalicular-saccular stages may interfere with saccular-alveolar differentiation and distal airway maturation resulting in PH.

  4. Comparative transcriptomics and gene expression in larval tiger salamander (Ambystoma tigrinum) gill and lung tissues as revealed by pyrosequencing.


    Eo, Soo Hyung; Doyle, Jacqueline M; Hale, Matthew C; Marra, Nicholas J; Ruhl, Joseph D; DeWoody, J Andrew


    Biologists are beginning to unravel the complexities of gene expression in model organisms by studying the transcriptome, the complement of genes that are transcribed in a given tissue. It is unclear, however, if findings from model systems apply to non-model organisms because of environmental effects on gene expression. Furthermore, there have been few efforts to quantify how transcriptome or gene expression varies across individuals and across tissues in natural environments. Herein, we describe transcriptomic profiling of gene expression in lung and gill tissue of three larval tiger salamanders. We do so with a hierarchical experimental design that captures variation in expression among genes, among tissues, and among individuals. Using 454 pyrosequencing, we produced high-quality sequence data of 59 megabases and assembled ~200,000 reads into 19,501 contigs. These contigs BLASTed to 3,599 transcripts, of which 721 were expressed in both tissues, 1,668 were unique to gill, and 1,210 unique to lung. Our data showed tissue-specific patterns in gene expression level with variation among transcripts and individuals. We identified genes and gene ontology terms related to respiration and compared their relative expression levels between gill and lung tissues. We also found evidence of exogenous genes associated with larval salamanders, and we identified ~1400 potential molecular markers (microsatellites and single nucleotide polymorphisms) that are associated with expressed genes. Given the tissue-specific differences we observed in transcriptomes, these data reinforce the idea that changes in gene expression serve as a primary mechanism underlying phenotypic plasticity.

  5. Gene Expression Profiling of Bronchoalveolar Lavage Cells Preceding a Clinical Diagnosis of Chronic Lung Allograft Dysfunction

    PubMed Central

    Wang, Xiaoyan; Palchevskiy, Vyacheslav; Gregson, Aric L.; Patel, Naman; DerHovanessian, Ariss; Shino, Michael Y.; Sayah, David M.; Birjandi, Shirin; Lynch, Joseph P.; Saggar, Rajan; Ardehali, Abbas; Ross, David J.; Palmer, Scott M.; Elashoff, David; Belperio, John A.


    Background Chronic Lung Allograft Dysfunction (CLAD) is the main limitation to long-term survival after lung transplantation. Although CLAD is usually not responsive to treatment, earlier identification may improve treatment prospects. Methods In a nested case control study, 1-year post transplant surveillance bronchoalveolar lavage (BAL) fluid samples were obtained from incipient CLAD (n = 9) and CLAD free (n = 8) lung transplant recipients. Incipient CLAD cases were diagnosed with CLAD within 2 years, while controls were free from CLAD for at least 4 years following bronchoscopy. Transcription profiles in the BAL cell pellets were assayed with the HG-U133 Plus 2.0 microarray (Affymetrix). Differential gene expression analysis, based on an absolute fold change (incipient CLAD vs no CLAD) >2.0 and an unadjusted p-value ≤0.05, generated a candidate list containing 55 differentially expressed probe sets (51 up-regulated, 4 down-regulated). Results The cell pellets in incipient CLAD cases were skewed toward immune response pathways, dominated by genes related to recruitment, retention, activation and proliferation of cytotoxic lymphocytes (CD8+ T-cells and natural killer cells). Both hierarchical clustering and a supervised machine learning tool were able to correctly categorize most samples (82.3% and 94.1% respectively) into incipient CLAD and CLAD-free categories. Conclusions These findings suggest that a pathobiology, similar to AR, precedes a clinical diagnosis of CLAD. A larger prospective investigation of the BAL cell pellet transcriptome as a biomarker for CLAD risk stratification is warranted. PMID:28103284

  6. Exogenous Fibroblast Growth Factor-10 Induces Cystic Lung Development with Altered Target Gene Expression in the Presence of Heparin in Cultures of Embryonic Rat Lung

    PubMed Central

    Hashimoto, Shuichi; Nakano, Hiroshi; Suguta, Yuko; Irie, Seiko; Jianhua, Luo; Katyal, Sikardar L.


    Objectives Signaling by fibroblast growth factor (FGF) receptor (FGFR) 2IIIb regulates branching morphogenesis in the mammalian lung. FGFR2IIIb is primarily expressed in epithelial cells, whereas its ligands, FGF-10 and keratinocyte growth factor (KGF; FGF-7), are expressed in mesenchymal cells. FGF-10 null mice lack lungs, whereas KGF null animals have normal lung development, indicating that FGF-10 regulates lung branching morphogenesis. In this study, we determined the effects of FGF-10 on lung branching morphogenesis and accompanying gene expression in cultures of embryonic rat lungs. Methods Embryonic day 14 rat lungs were cultured with FGF-10 (0–250 ng/ml) in the absence or presence of heparin (30 ng/ml) for 4 days. Gene expression profiles were analyzed by Affymetrix microchip array including pathway analysis. Some of these genes, functionally important in FGF-10 signaling, were further analyzed by Northern blot, real-time PCR, in situ hybridization and immunohistochemistry. Results Exogenous FGF-10 inhibited branching and induced cystic lung growth only in cultures containing heparin. In total, 252 upregulated genes and 164 downregulated genes were identified, and these included Spry1 (Sprouty-1), Spry2 (Sprouty-2), Spred-1, Bmp4 (bone morphogenetic protein-4, BMP-4), Shh(sonic hedgehog, SHH), Pthlh (parathyroid hormone-related protein, PTHrP), Dusp6 (MAP kinase phosphatase-3, MKP-3) and Clic4 (chloride intracellular channel-4, CLIC-4) among the upregulated genes and Igf1 (insulin-like growth factor-1, IGF-1), Tcf21 (POD), Gyg1 (glycogenin 1), Sparc (secreted protein acidic and rich in cysteine, SPARC), Pcolce (procollagen C-endopeptidase enhancer protein, Pro CEP) and Lox (lysyl oxidase) among the downregulated genes. Gsk3β and Wnt2, which are involved in canonical Wnt signaling, were up- and downregulated, respectively. Conclusions Unlike FGF-7, FGF-10 effects on lung branching morphogenesis are heparin-dependent. Sprouty-2, BMP-4, SHH, IGF-1, SPARC

  7. Regulatory T cell-mediated resolution of lung injury: identification of potential target genes via expression profiling

    PubMed Central

    Aggarwal, Neil R.; D'Alessio, Franco R.; Tsushima, Kenji; Sidhaye, Venkataramana K.; Cheadle, Christopher; Grigoryev, Dmitry N.; Barnes, Kathleen C.


    In animal models of acute lung injury (ALI), gene expression studies have focused on the acute phase of illness, with little emphasis on resolution. In this study, the acute phase of intratracheal lipopolysaccharide (IT LPS)-induced lung injury was similar in wild-type (WT) and recombinase-activating gene-1-deficient (Rag-1−/−) lymphocyte-deficient mice, but resolution was impaired and resolution-phase lung gene expression remained different from baseline only in Rag-1−/− mice. By focusing on groups of genes involved in similar biological processes (gene ontologies) pertinent to inflammation and the immune response, we identified 102 genes at days 4 and 10 after IT LPS with significantly different expression between WT and Rag-1−/− mice. After adoptive transfer of isolated CD4+CD25+Foxp3+ regulatory T cells (Tregs) to Rag-1−/− mice at the time of IT LPS, resolution was similar to that in WT mice. Of the 102 genes distinctly changed in either WT or Rag-1−/− mice from our 7 gene ontologies, 19 genes reverted from the Rag-1−/− to the WT pattern of expression after adoptive transfer of Tregs, implicating those 19 genes in Treg-mediated resolution of ALI. PMID:20028937

  8. Differential gene expression profiles according to the Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society histopathological classification in lung adenocarcinoma subtypes.


    Molina-Romero, Camilo; Rangel-Escareño, Claudia; Ortega-Gómez, Alette; Alanis-Funes, Gerardo J; Avilés-Salas, Alejandro; Avila-Moreno, Federico; Mercado, Gabriela E; Cardona, Andrés F; Hidalgo-Miranda, Alfredo; Arrieta, Oscar


    The current lung cancer classification from the Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society has considerably changed the pathologic diagnosis of lung invasive adenocarcinoma, identifying disease subtypes with substantial implications for medical practice, such as clinical, radiological, molecular, and prognostic differences. We analyzed the differences in the genetic expression of adenocarcinoma subtypes according to the new classification. Microarray gene expression analysis was performed on a cohort of 29 adenocarcinoma patients treated at the Instituto Nacional de Cancerología of Mexico from 2008 to 2011. All patients had an available biopsy sample and were classified into 4 different subtypes of adenocarcinoma (2015 World Health Organization classification). Lepidic-predominant adenocarcinoma was the only pattern that exhibited a marked gene expression difference compared with other predominant histologic patterns, revealing genes with significant expression (P < .01). Moreover, we identified 13 genes with specific differential expression in the lepidic-predominant adenocarcinoma that could be used as a gene signature. The lepidic-predominant histologic pattern has a differential gene expression profile compared with all predominant histologic patterns. Additionally, we identified a gene expression signature of 13 genes that have a unique behavior in the lepidic histologic pattern; these 13 genes are candidates for follow-up studies for their potential use as biomarkers or therapeutic targets. Results from this study highlight the importance of the new Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society classification and exemplify the potential clinical implications of correlating histopathology with exclusive molecular beacons. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Hydrogen peroxide induces adaptive response and differential gene expression in human embryo lung fibroblast cells.


    Wei, Qinzhi; Huang, Haiyan; Yang, Linqing; Yuan, Jianhui; Yang, Xiaohua; Liu, Yungang; Zhuang, Zhixiong


    Hydrogen peroxide (H2 O2 ), a substance involved in cellular oxidative stress, has been observed to induce an adaptive response, which is characterized by a protection against the toxic effect of H2 O2 at higher concentrations. However, the molecular mechanism for the adaptive response remains unclear. In particular, the existing reports on H2 O2 -induced adaptive response are limited to animal cells and human tumor cells, and relatively normal human cells have never been observed for an adaptive response to H2 O2 . In this study, a human embryo lung fibroblast (MRC-5) cell line was used to model an adaptive response to H2 O2 , and the relevant differential gene expressions by using fluoro mRNA differential display RT-PCR. The results showed significant suppression of cytotoxicity of H2 O2 (1100 μM, 1 h) after pretreatment of the cells with H2 O2 at lower concentrations (0.088-8.8 μM, 24 h), as indicated by cell survival, lactate dehydrogenase release, and the rate of apoptotic cells. Totally 60 mRNA components were differentially expressed compared to untreated cells, and five of them (sizing 400-600 bp) which demonstrated the greatest increase in expression were cloned and sequenced. They showed identity with known genes, such as BCL-2, eIF3S5, NDUFS4, and RPS10. Real time RT-PCR analysis of the five genes displayed a pattern of differential expression consistent with that by the last method. These five genes may be involved in the induction of adaptive response by H2 O2 in human cells, at least in this particular cell type. Copyright © 2012 Wiley Periodicals, Inc.

  10. Resection of Non-Small Cell Lung Cancers Reverses Tumor-Induced Gene Expression Changes in the Peripheral Immune System

    PubMed Central

    Kossenkov, Andrew V.; Vachani, Anil; Chang, Celia; Nichols, Calen; Billouin, Shere; Horng, Wenhwai; Rom, William N.; Albelda, Steven M.; Showe, Michael K.; Showe, Louise C.


    PURPOSE To characterize the interactions of Non-small Cell Lung Cancer (NSCLC) tumors with the immune system at the level of mRNA and microRNA (miRNA) expression and to define expression signatures that characterize the presence of a malignant tumor vs. a non-malignant nodule. EXPERIMENTAL DESIGN We have examined the changes of both mRNA and miRNA expression levels in peripheral blood mononuclear cells (PBMC) between paired samples collected from NSCLC patients before and after tumor removal using Illumina gene expression arrays. RESULTS We found that malignant tumor removal significantly changes expression of more than 3,000 protein-coding genes, especially genes in pathways associated with suppression of the innate immune response, including NK cell signaling and apoptosis-associated ceramide signaling. Binding sites for the ETS-domain transcription factors ELK1, ELK4 and SPI1 were enriched in promoter regions of genes upregulated in the presence of a tumor. Additional important regulators included five miRNAs expressed at significantly higher levels before tumor removal. Repressed protein-coding targets of those miRNAs included many transcription factors, several involved in immunologically important pathways. While there was a significant overlap in the effects of malignant tumors and benign lung nodules on PBMC gene expression, we identified one gene panel which indicates a tumor or nodule presence and a second panel that can distinguish malignant from non-malignant nodules. CONCLUSIONS A tumor presence in the lung influences mRNA and miRNA expression in PBMC and this influence is reversed by tumor removal. These results suggest that PBMC gene expression signatures could be used for lung cancer diagnosis. PMID:21807633

  11. Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR

    PubMed Central


    Background Lung cancers are the most common type of human malignancy and are intractable. Lung cancers are generally classified into four histopathological subtypes: adenocarcinoma (AD), squamous cell carcinoma (SQ), large cell carcinoma (LC), and small cell carcinoma (SC). Molecular biological characterization of these subtypes has been performed mainly using DNA microarrays. In this study, we compared the gene expression profiles of these four subtypes using twelve human lung cancer cell lines and the more reliable quantitative real-time PCR (qPCR). Results We selected 100 genes from public DNA microarray data and examined them by DNA microarray analysis in eight test cell lines (A549, ABC-1, EBC-1, LK-2, LU65, LU99, STC 1, RERF-LC-MA) and a normal control lung cell line (MRC-9). From this, we extracted 19 candidate genes. We quantified the expression of the 19 genes and a housekeeping gene, GAPDH, with qPCR, using the same eight cell lines plus four additional validation lung cancer cell lines (RERF-LC-MS, LC-1/sq, 86-2, and MS-1-L). Finally, we characterized the four subtypes of lung cancer cell lines using principal component analysis (PCA) of gene expression profiling for 12 of the 19 genes (AMY2A, CDH1, FOXG1, IGSF3, ISL1, MALL, PLAU, RAB25, S100P, SLCO4A1, STMN1, and TGM2). The combined PCA and gene pathway analyses suggested that these genes were related to cell adhesion, growth, and invasion. S100P in AD cells and CDH1 in AD and SQ cells were identified as candidate markers of these lung cancer subtypes based on their upregulation and the results of PCA analysis. Immunohistochemistry for S100P and RAB25 was closely correlated to gene expression. Conclusions These results show that the four subtypes, represented by 12 lung cancer cell lines, were well characterized using qPCR and PCA for the 12 genes examined. Certain genes, in particular S100P and CDH1, may be especially important for distinguishing the different subtypes. Our results confirm that q

  12. Deuterium depleted water effects on survival of lung cancer patients and expression of Kras, Bcl2, and Myc genes in mouse lung.


    Gyöngyi, Zoltán; Budán, Ferenc; Szabó, István; Ember, István; Kiss, István; Krempels, Krisztina; Somlyai, Ildikó; Somlyai, Gábor


    Although advances in cancer therapies continue to develop, the shortness of the survival of lung cancer patients is still disappointing. Therefore, finding new adjuvant strategies is within the focus of cancer cure. Based on observations that deuterium depletion inhibits the growth of cancer cell lines and suppresses certain proto-oncogenes, we have conducted a clinical study in 129 patients with small cell and nonsmall cell lung cancers who consumed deuterium-depleted drinking water (DDW) as a nontoxic agent in addition to conventional chemotherapy and radiotherapy. Median survival time (MST) was 25.9 mo in males and 74.1 mo in female patients; the difference between genders was statistically significant (p < 0.05). Median survival of subjects with brain metastasis was 27.1 mo. Cumulative 5-yr survival probabilities were 19%, 52%, and 33% in males, females, and all patients with brain metastasis, respectively. Gene expression analysis in mouse lung indicated that DDW attenuates 7,12-dimethylbenz(a)anthracene (DMBA)-induced expression of Bcl2, Kras, and Myc in females. In conclusion, DDW counteracts the DMBA-induced overexpression of Bcl2, Kras and Myc genes in mouse lung, and it may extend survival of lung cancer patients as a nontoxic anticancer dietary supplement, especially for women with tumors overexpressing cancer-related genes, because MST of DDW-consuming group was 2-4 times longer than it is generally observed in lung cancer patients.

  13. Deuterium Depleted Water Effects on Survival of Lung Cancer Patients and Expression of Kras, Bcl2, and Myc Genes in Mouse Lung

    PubMed Central

    Gyöngyi, Zoltán; Budán, Ferenc; Szabó, István; Ember, István; Kiss, István; Krempels, Krisztina; Somlyai, Ildikó; Somlyai, Gábor


    Although advances in cancer therapies continue to develop, the shortness of the survival of lung cancer patients is still disappointing. Therefore, finding new adjuvant strategies is within the focus of cancer cure. Based on observations that deuterium depletion inhibits the growth of cancer cell lines and suppresses certain proto-oncogenes, we have conducted a clinical study in 129 patients with small cell and nonsmall cell lung cancers who consumed deuterium-depleted drinking water (DDW) as a nontoxic agent in addition to conventional chemotherapy and radiotherapy. Median survival time (MST) was 25.9 mo in males and 74.1 mo in female patients; the difference between genders was statistically significant (p < 0.05). Median survival of subjects with brain metastasis was 27.1 mo. Cumulative 5-yr survival probabilities were 19%, 52%, and 33% in males, females, and all patients with brain metastasis, respectively. Gene expression analysis in mouse lung indicated that DDW attenuates 7,12-dimethylbenz(a)anthracene (DMBA)-induced expression of Bcl2, Kras, and Myc in females. In conclusion, DDW counteracts the DMBA-induced overexpression of Bcl2, Kras and Myc genes in mouse lung, and it may extend survival of lung cancer patients as a nontoxic anticancer dietary supplement, especially for women with tumors overexpressing cancer-related genes, because MST of DDW-consuming group was 2–4 times longer than it is generally observed in lung cancer patients. PMID:23441611

  14. Comprehensive gene and microRNA expression profiling reveals miR-206 inhibits MET in lung cancer metastasis.


    Chen, Qing-yong; Jiao, De-min; Yan, Li; Wu, Yu-quan; Hu, Hui-zhen; Song, Jia; Yan, Jie; Wu, Li-jun; Xu, Li-qun; Shi, Jian-guo


    MiRNAs associated with the metastasis of lung cancer remain largely unexplored. In this study, gene and miRNA expression profiling were performed to analyze the global expression of mRNAs and miRNAs in human high- and low-metastatic lung cancer cell strains. By developing an integrated bioinformatics analysis, six miRNAs (miR-424-3p, miR-450b-5p, miR-335-5p, miR-34a-5p, miR-302b-3p and miR-206) showed higher target gene degrees in the miRNA-gene network and might be potential metastasis-related miRNAs. Using the qRT-PCR method, the six miRNAs were further confirmed to show a significant expression difference between human lung cancer and normal tissue samples. Since miR-206 showed lower expression both in lung cancer tissues and cell lines, it was used as an example for further functional verification. The wound healing assay and transwell invasion assay showed that miR-206 mimics significantly inhibited the cell migration and invasion of the high-metastatic lung cancer 95D cell strain. One of its predicted targets in our miRNA-gene network, MET, was also obviously decreased at the protein level when miR-206 was overexpressed. Instead, miR-206 inhibitors increased MET protein expression, cell migration and invasion of the low-metastatic lung cancer 95C cell strain. Meanwhile, the luciferase assay showed that MET was a direct target of miR-206. Furthermore, MET gene silence showed a similar anti-migration and anti-invasion effect with miR-206 mimics in 95D cells and could partially attenuate the migration- and invasion-promoting effect of miR-206 inhibitors in 95C cells, suggesting that miR-206 targets MET in lung cancer metastasis. Finally, we also demonstrated that miR-206 can significantly inhibit lung cancer proliferation and metastasis in mouse models. In conclusion, our study provided a miRNA-gene regulatory network in lung cancer metastasis and further demonstrated the roles of miR-206 and MET in this process, which enhances the understanding of the

  15. Differential expression of microRNAs and their target genes in non-small-cell lung cancer.


    Lee, Hui-Young; Han, Seon-Sook; Rhee, Hwanseok; Park, Jung Hoon; Lee, Jae Seung; Oh, Yeon-Mok; Choi, Sun Shim; Shin, Seung-Ho; Kim, Woo Jin


    MicroRNAs (miRNAs) are single‑stranded RNA species that constitute a class of non‑coding RNAs, and are emerging as key regulators of gene expression. Since each miRNA is capable of regulating multiple genes, miRNAs are attractive markers for studies of coordinated gene expression. In this study, we investigated miRNA expression profiling using a massively parallel sequencing technique to compare non‑small‑cell lung cancer (NSCLC) tissue and normal lung tissue. Lung cancer tissue and normal lung tissue were obtained from nine NSCLC patients. RNA isolated from these samples was processed using RNA sequencing (RNA Seq) and the HiSeq 2000 system. Differentially expressed miRNAs and mRNAs were analyzed using a t‑test. We selected target pairs that showed a negative correlation among significantly differentially expressed miRNAs and their putative target mRNAs using miRBase Targets. The differences in the expression levels of 222 miRNAs and 1,597 genes were statistically significant, as indicated by an absolute fold change ≥1.5 and P<0.05. miR‑577, miR‑301b, miR‑944, miR‑891a and miR‑615‑3p were generally upregulated, and miR‑338‑3p was generally downregulated. miRNA‑mRNA target pair analysis revealed that 49 miRNAs had 696 target mRNAs. There were significantly differentially expressed miRNAs and mRNAs between lung cancer and normal tissue. Further investigation of miRNAs and their target genes is warranted to better understand NSCLC.

  16. Gene identification for risk of relapse in stage I lung adenocarcinoma patients: a combined methodology of gene expression profiling and computational gene network analysis.


    Ludovini, Vienna; Bianconi, Fortunato; Siggillino, Annamaria; Piobbico, Danilo; Vannucci, Jacopo; Metro, Giulio; Chiari, Rita; Bellezza, Guido; Puma, Francesco; Della Fazia, Maria Agnese; Servillo, Giuseppe; Crinò, Lucio


    Risk assessment and treatment choice remains a challenge in early non-small-cell lung cancer (NSCLC). The aim of this study was to identify novel genes involved in the risk of early relapse (ER) compared to no relapse (NR) in resected lung adenocarcinoma (AD) patients using a combination of high throughput technology and computational analysis. We identified 18 patients (n.13 NR and n.5 ER) with stage I AD. Frozen samples of patients in ER, NR and corresponding normal lung (NL) were subjected to Microarray technology and quantitative-PCR (Q-PCR). A gene network computational analysis was performed to select predictive genes. An independent set of 79 ADs stage I samples was used to validate selected genes by Q-PCR.From microarray analysis we selected 50 genes, using the fold change ratio of ER versus NR. They were validated both in pool and individually in patient samples (ER and NR) by Q-PCR. Fourteen increased and 25 decreased genes showed a concordance between two methods. They were used to perform a computational gene network analysis that identified 4 increased (HOXA10, CLCA2, AKR1B10, FABP3) and 6 decreased (SCGB1A1, PGC, TFF1, PSCA, SPRR1B and PRSS1) genes. Moreover, in an independent dataset of ADs samples, we showed that both high FABP3 expression and low SCGB1A1 expression was associated with a worse disease-free survival (DFS).Our results indicate that it is possible to define, through gene expression and computational analysis, a characteristic gene profiling of patients with an increased risk of relapse that may become a tool for patient selection for adjuvant therapy.

  17. CREB- and NF-κB-Regulated CXC Chemokine Gene Expression in Lung Carcinogenesis

    PubMed Central

    Sun, Hongxia; Chung, Wen-Cheng; Ryu, Seung-Hee; Ju, Zhenlin; Tran, Hai T.; Kim, Edward; Kurie, Jonathan M.; Koo, Ja Seok


    The recognition of the importance of angiogenesis in tumor progression has led to the development of antiangiogenesis as a new strategy for cancer treatment and prevention. By modulating tumor microenvironment and inducing angiogenesis, the proinflammatory cytokine interleukine (IL)-1 β has been reported to promote tumor development. However, the factors mediating IL-1β-induced angiogenesis in non-small cell lung cancer (NSCLC) and the regulation of these angiogenic factors by IL-1β are less clear. Here, we report that IL-1β upregulated an array of proangiogenic CXC chemokine genes in NSCLC cell line A549 and in normal human tracheobronchial epithelium (NHTBE) cells, as determined by microarray analysis. Further analysis revealed that IL-1β induced much higher protein levels of CXC chemokines in NSCLC cells than in NHTBE cells. Conditioned medium from IL-1β treated A549 cells markedly increased endothelial cell migration, which was suppressed by neutralizing antibodies against CXCL5 and CXCR2. We also found that IL-1β-induced CXC chemokine gene overexpression in NSCLC cells was abrogated with the knockdown of CREB or NF-κB. Moreover, the expression of the CXC chemokine genes as well as CREB and NF-κB activities were greatly increased in tumorigenic NSCLC cell line compared with normal, premalignant immortalized or non-tumorigenic cell lines. A disruptor of the interaction between CREB-binding protein (CBP) and transcription factors such as CREB and NF-κB, 2-naphthol-AS-E-phosphate (KG-501), inhibited IL-1β-induced CXC chemokine gene expression and angiogenic activity in NSCLC. We propose that targeting CREB or NF-κB using small molecule inhibitors, such as KG-501, holds promise as a preventive and/or therapeutic approach for NSCLC. PMID:19138976

  18. Genome wide analysis of DNA methylation and gene expression changes in the mouse lung following subchronic arsenate exposure

    EPA Science Inventory

    Alterations in DNA methylation have been proposed as a mechanism for the complex toxicological effects of arsenic. In this study, whole genome DNA methylation and gene expression changes were evaluated in lungs from female mice exposed for 90 days to 50 ppm arsenate (As) in drink...

  19. Genome wide analysis of DNA methylation and gene expression changes in the mouse lung following subchronic arsenate exposure

    EPA Science Inventory

    Alterations in DNA methylation have been proposed as a mechanism for the complex toxicological effects of arsenic. In this study, whole genome DNA methylation and gene expression changes were evaluated in lungs from female mice exposed for 90 days to 50 ppm arsenate (As) in drink...

  20. Gene expression profiles reveal molecular mechanisms involved in the progression and resolution of bleomycin-induced lung fibrosis

    PubMed Central

    Cabrera, Sandra; Selman, Moises; Lonzano-Bolaños, Alfredo; Konishi, Kazuhisa; Richards, Thomas J.; Kaminski, Naftali


    Lung fibrosis is the final result of a large number of disorders and is usually considered an irreversible process. However, some evidence suggests that fibrosis could eventually be reversible. In this study we aimed to document the time-related reversibility of bleomycin-induced lung fibrosis and to examine the gene expression profile associated with its initial progression and subsequent resolution. C57BL/6 mice were instilled with a single dose of bleomycin and euthanized at 1, 4, 8, 12, and 16 wk. Control animals received an equal volume of saline. Lung fibrosis was examined by morphology and hydroxyproline content and the transcriptional signature by gene microarray analysis. Our results showed that bleomycin-injured mice developed prominent inflammation at 1 wk, followed by fibrosis that peaked at 2 mo. Then fibrosis resolved until lungs displayed almost normal architecture at 4 mo. Genomewide transcriptional profiling revealed 533 significantly changed genes. Self-organizing maps analysis of these genes identified four clusters based on the temporal pattern of gene expression. Clusters 1 and 2 contained genes upregulated during the inflammatory and fibrotic response and were enriched for extracellular matrix-related genes including several collagens, matrix metalloproteinases, and TIMP-1. Cluster 3 identified upregulated genes during the fibrotic response, and cluster 4 contained genes decreased during inflammation and fibrosis that increased during resolution. Most enriched pathways included genes involved in cell cycle and in regulation of transcription. Our findings corroborate the reversibility of bleomycin-induced lung fibrosis and reveal transcriptional signatures that characterize the progression and resolution. PMID:23457188

  1. Aberrant large tumor suppressor 2 (LATS2) gene expression correlates with EGFR mutation and survival in lung adenocarcinomas

    PubMed Central

    Luo, Susan Y.; Sit, Ko-Yung; Sihoe, Alan D.L.; Suen, Wai-Sing; Au, Wing-Kuk; Tang, Ximing; Ma, Edmond S.K.; Chan, Wai-Kong; Wistuba, Ignacio I.; Minna, John D.; Tsao, George S.W.; Lam, David C.L.


    Background Large tumor suppressor 2 (LATS2) gene is a putative tumor suppressor gene with potential roles in regulation of cell proliferation and apoptosis in lung cancer. The aim of this study is to explore the association of aberrant LATS2 expression with EGFR mutation and survival in lung adenocarcinoma (AD), and the effects of LATS2 silencing in both lung AD cell lines. Methods LATS2 mRNA and protein expression in resected lung AD were correlated with demographic characteristics, EGFR mutation and survival. LATS2-specific siRNA was transfected into four EGFR wild-type (WT) and three EGFR mutant AD cell lines and the changes in LATS2 expression and relevant signaling molecules before and after LATS2 knockdown were assayed. Results Fifty resected lung AD were included (M:F = 23:27, smokers:non-smokers = 19:31, EGFR mutant:wild-type = 21:29) with LATS2 mRNA levels showed no significant difference between gender, age, smoking and pathological stages while LATS2 immunohistochemical staining on an independent set of 79 lung AD showed similar trend. LATS2 mRNA level was found to be a significant independent predictor for survival status (disease-free survival RR = 0.217; p = 0.003; Overall survival RR = 0.238; p = 0.036). siRNA-mediated suppression of LATS2 expression resulted in augmentation of ERK phosphorylation in EGFR wild-type AD cell lines with high basal LATS2 expression, discriminatory modulation of Akt signaling between EGFR wild-type and mutant cells, and induction of p53 accumulation in AD cell lines with low baseline p53 levels. Conclusions LATS2 expression level is predictive of survival in patients with resected lung AD. LATS2 may modulate and contribute to tumor growth via different signaling pathways in EGFR mutant and wild-type tumors. PMID:24976335

  2. Growth regulation, imprinting, and epigenetic transcription-related gene expression differs in lung of deceased transgenic cloned and normal goats.


    Meng, Li; Jia, Ruo-Xin; Sun, Yan-Yan; Wang, Zi-Yu; Wan, Yong-Jie; Zhang, Yan-Li; Zhong, Bu-Shuai; Wang, Feng


    Somatic cell nuclear transfer (SCNT) is a promising technique to produce mammalian transgenic clones. Only a small proportion of manipulated embryos, however, can develop into viable offspring. The abnormal growth and development of cloned animals, furthermore, are accompanied by aberrant lung development. Our objective was to investigate molecular background of lung developmental problems in transgenic (random insertion of exogenous DNA) cloned goats. We examined expression of 15 genes involved in growth regulation, imprinting, and epigenetic transcription in lung tissue of deceased transgenic cloned and normal goats of various ages. Compared with normal goats of the same age from conventional reproduction, expression of 13 genes (BMP4, FGF10, GHR, HGFR, PDGFR, RABP, VEGF, H19, CDKNIC, PCAF, MeCP2, HDAC1, and Dnmt3b) decreased in transgenic cloned goats that died at or shortly after birth; Expression of eight genes (FGF10, PDGFR, RABP, VEGF, PCAF, HDAC1, MeCP2, and Dnmt3b) decreased in fetal death of transgenic cloned goats. Expression of two epigenetic transcription genes (PCAF and Dnmt3b) decreased in disease death of transgenic cloned goats (1-4 months old). Disruptions in gene expression might be associated with the high neonatal mortality in transgenic cloned animals. These findings have implications in understanding the low efficiency of transgenic cloning. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Identification of differentially expressed genes in lung tissues of nickel-exposed rats using suppression subtractive hybridization.


    Zhang, Jing; Zhang, Jun; Fan, Yingying; Liu, Lihong; Li, Mengjie; Zhou, Yang; Shao, Zhihua; Shi, Hongjun; Wang, Ying


    Occupational exposure to nickel compound, such as nickel refining, electroplating, and in conjunction with other metals, is harmful to the health, causing respiratory distress, and lung and nasal cancer. In this work, the different gene expression patterns of lung tissues from nickel-exposed rats and controls were investigated. The suppression subtractive hybridization (SSH) method was used to generate two subtracted cDNA libraries with gene transcripts differentially expressed after nickel inducing. Dot-blot hybridizations were used to confirm differential ratios of expression of obtained SSH clones. Out of 768 unique SSH clones, which were chosen randomly from the two subtraction libraries (384 of each), 319 could be verified as differentially expressed. According to blast screening and functional annotation, 28% genes in nickel-induced cDNA library were related to cell differentiation, whereas 21% in driver library were related to oxygen transport. Two novel expressed sequence tags (ESTs; NCBI Accession No. FC809414 and No. FC809411) in nickel-induced cDNA library were obtained. The genes detected in the present study are probably important genes associated with nickel-induced lung cancer.

  4. SOX2 expression is associated with FGFR fusion genes and predicts favorable outcome in lung squamous cell carcinomas.


    Zheng, Shanbo; Pan, Yunjian; Wang, Rui; Li, Yuan; Cheng, Chao; Shen, Xuxia; Li, Bin; Zheng, Difan; Sun, Yihua; Chen, Haiquan


    SOX2 is a gene that encodes for a transcription factor, which functions as an activator or suppressor of gene transcription. SOX2 amplification and overexpression have been found in various types of tumors and play important roles in cancer cells. The aim of the study was to evaluate SOX2 expression and amplification in lung squamous cell carcinomas (SCCs) and to determine the relationship with main clinicopathologic features, patient prognosis, and common driver mutations. SOX2 protein levels were measured by immunohistochemistry, while SOX2 copy numbers were measured by fluorescence in situ hybridization in resected samples from 162 Chinese lung SCC patients. All patients were also analyzed for mutations in EGFR, HER2, BRAF, PIK3CA, NFE2L2, and FGFR fusion genes. Clinical characteristics, including age, sex, smoking status, stage, relapse-free survival (RFS), and overall survival (OS), were collected. SOX2 overexpression and amplification were observed in 58.6% and 45.9% of lung SCCs. Lung SCC patients with SOX2 overexpression were significantly associated with absence of malignant tumor family history (P=0.021), FGFR fusion gene (P=0.046), longer RFS (P=0.041), and OS (P=0.025). No correlation was found between SOX2 gene amplification and main clinicopathologic features, patient prognosis, or common driver mutations. SOX2 overexpression and amplification are common in lung SCCs. SOX2 over-expression was associated with FGFR fusion genes and predicted favorable outcome in lung SCCs. The underlying relationship of SOX2 and FGFR still needs further investigation.

  5. Similarities in Gene Expression Profiles during In Vitro Aging of Primary Human Embryonic Lung and Foreskin Fibroblasts.


    Marthandan, Shiva; Priebe, Steffen; Baumgart, Mario; Groth, Marco; Cellerino, Alessandro; Guthke, Reinhard; Hemmerich, Peter; Diekmann, Stephan


    Replicative senescence is of fundamental importance for the process of cellular aging, since it is a property of most of our somatic cells. Here, we elucidated this process by comparing gene expression changes, measured by RNA-seq, in fibroblasts originating from two different tissues, embryonic lung (MRC-5) and foreskin (HFF), at five different time points during their transition into senescence. Although the expression patterns of both fibroblast cell lines can be clearly distinguished, the similar differential expression of an ensemble of genes was found to correlate well with their transition into senescence, with only a minority of genes being cell line specific. Clustering-based approaches further revealed common signatures between the cell lines. Investigation of the mRNA expression levels at various time points during the lifespan of either of the fibroblasts resulted in a number of monotonically up- and downregulated genes which clearly showed a novel strong link to aging and senescence related processes which might be functional. In terms of expression profiles of differentially expressed genes with age, common genes identified here have the potential to rule the transition into senescence of embryonic lung and foreskin fibroblasts irrespective of their different cellular origin.

  6. Expression of the WT1 gene -KTS domain isoforms suppresses the invasive ability of human lung squamous cell carcinoma cells.


    Moriya, Shogo; Takiguchi, Masaki; Seki, Naohiko


    Although the WT1 gene was originally isolated as a tumor suppressor gene from Wilms' tumor, oncogenic roles for WT1 have been reported in several tumors. Here, we present new findings of high levels of WT1 expression associated with the suppression of lymph node metastasis in patients with human lung squamous cell carcinoma (SCC). We investigated the effect of down-regulated WT1 gene expression on the invasive phenotype of the SCC cell line RERF-LC-AI. Invasive ability was enhanced in WT1-specific siRNA-transfected cells, and a WT1 target gene p21(Waf1/Cip1) was isolated by comprehensive gene expression analysis. As several isoforms are produced from the WT1 gene, we isolated eight major WT1 isoforms from a cDNA library and cloned each variant into an expression vector. Luciferase reporter assays revealed that p21(Waf1/Cip1) expression was enhanced only by the WT1 cDNA variants that included a three-amino acid deletion (-KTS). Our results suggested that the -KTS-containing variants of WT1 are directly involved in the regulation of p21(Waf1/Cip1) expression and the subsequent suppression of lymph node metastasis in human lung squamous cell carcinoma.

  7. Similarities in Gene Expression Profiles during In Vitro Aging of Primary Human Embryonic Lung and Foreskin Fibroblasts

    PubMed Central

    Marthandan, Shiva; Priebe, Steffen; Groth, Marco; Cellerino, Alessandro; Guthke, Reinhard; Hemmerich, Peter; Diekmann, Stephan


    Replicative senescence is of fundamental importance for the process of cellular aging, since it is a property of most of our somatic cells. Here, we elucidated this process by comparing gene expression changes, measured by RNA-seq, in fibroblasts originating from two different tissues, embryonic lung (MRC-5) and foreskin (HFF), at five different time points during their transition into senescence. Although the expression patterns of both fibroblast cell lines can be clearly distinguished, the similar differential expression of an ensemble of genes was found to correlate well with their transition into senescence, with only a minority of genes being cell line specific. Clustering-based approaches further revealed common signatures between the cell lines. Investigation of the mRNA expression levels at various time points during the lifespan of either of the fibroblasts resulted in a number of monotonically up- and downregulated genes which clearly showed a novel strong link to aging and senescence related processes which might be functional. In terms of expression profiles of differentially expressed genes with age, common genes identified here have the potential to rule the transition into senescence of embryonic lung and foreskin fibroblasts irrespective of their different cellular origin. PMID:26339636

  8. Lung epithelial cells have virus-specific and shared gene expression responses to infection by diverse respiratory viruses.


    VanLeuven, James T; Ridenhour, Benjamin J; Gonzalez, Andres J; Miller, Craig R; Miura, Tanya A


    The severity of respiratory viral infections is partially determined by the cellular response mounted by infected lung epithelial cells. Disease prevention and treatment is dependent on our understanding of the shared and unique responses elicited by diverse viruses, yet few studies compare host responses to viruses from different families while controlling other experimental parameters. Murine models are commonly used to study the pathogenesis of respiratory viral infections, and in vitro studies using murine cells provide mechanistic insight into the pathogenesis observed in vivo. We used microarray analysis to compare changes in gene expression of murine lung epithelial cells infected individually by three respiratory viruses causing mild (rhinovirus, RV1B), moderate (coronavirus, MHV-1), and severe (influenza A virus, PR8) disease in mice. RV1B infection caused numerous gene expression changes, but the differential effect peaked at 12 hours post-infection. PR8 altered an intermediate number of genes whose expression continued to change through 24 hours. MHV-1 had comparatively few effects on host gene expression. The viruses elicited highly overlapping responses in antiviral genes, though MHV-1 induced a lower type I interferon response than the other two viruses. Signature genes were identified for each virus and included host defense genes for PR8, tissue remodeling genes for RV1B, and transcription factors for MHV-1. Our comparative approach identified universal and specific transcriptional signatures of virus infection that can be used to distinguish shared and virus-specific mechanisms of pathogenesis in the respiratory tract.

  9. Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis.


    DePianto, Daryle J; Chandriani, Sanjay; Abbas, Alexander R; Jia, Guiquan; N'Diaye, Elsa N; Caplazi, Patrick; Kauder, Steven E; Biswas, Sabyasachi; Karnik, Satyajit K; Ha, Connie; Modrusan, Zora; Matthay, Michael A; Kukreja, Jasleen; Collard, Harold R; Egen, Jackson G; Wolters, Paul J; Arron, Joseph R


    There is microscopic spatial and temporal heterogeneity of pathological changes in idiopathic pulmonary fibrosis (IPF) lung tissue, which may relate to heterogeneity in pathophysiological mediators of disease and clinical progression. We assessed relationships between gene expression patterns, pathological features, and systemic biomarkers to identify biomarkers that reflect the aggregate disease burden in patients with IPF. Gene expression microarrays (N=40 IPF; 8 controls) and immunohistochemical analyses (N=22 IPF; 8 controls) of lung biopsies. Clinical characterisation and blood biomarker levels of MMP3 and CXCL13 in a separate cohort of patients with IPF (N=80). 2940 genes were significantly differentially expressed between IPF and control samples (|fold change| >1.5, p<0.05). Two clusters of co-regulated genes related to bronchiolar epithelium or lymphoid aggregates exhibited substantial heterogeneity within the IPF population. Gene expression in bronchiolar and lymphoid clusters corresponded to the extent of bronchiolisation and lymphoid aggregates determined by immunohistochemistry in adjacent tissue sections. Elevated serum levels of MMP3, encoded in the bronchiolar cluster, and CXCL13, encoded in the lymphoid cluster, corresponded to disease severity and shortened survival time (p<10(-7) for MMP3 and p<10(-5) for CXCL13; Cox proportional hazards model). Microscopic pathological heterogeneity in IPF lung tissue corresponds to specific gene expression patterns related to bronchiolisation and lymphoid aggregates. MMP3 and CXCL13 are systemic biomarkers that reflect the aggregate burden of these pathological features across total lung tissue. These biomarkers may have clinical utility as prognostic and/or surrogate biomarkers of disease activity in interventional studies in IPF. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  10. Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis

    PubMed Central

    DePianto, Daryle J.; Chandriani, Sanjay; Abbas, Alexander R.; Jia, Guiquan; N’Diaye, Elsa N.; Caplazi, Patrick; Kauder, Steven E.; Biswas, Sabyasachi; Karnik, Satyajit K.; Ha, Connie; Modrusan, Zora; Matthay, Michael A.; Kukreja, Jasleen; Collard, Harold R.; Egen, Jackson G.; Wolters, Paul J.; Arron, Joseph R.


    Background There is microscopic spatial and temporal heterogeneity of pathologic changes in idiopathic pulmonary fibrosis (IPF) lung tissue, which may relate to heterogeneity in pathophysiological mediators of disease and clinical progression. We assessed relationships between gene expression patterns, pathological features, and systemic biomarkers to identify biomarkers that reflect the aggregate disease burden in IPF patients. Methods Gene expression microarrays (N=40 IPF; 8 controls) and immunohistochemical analyses (N=22 IPF; 8 controls) of lung biopsies. Clinical characterization and blood biomarker levels of MMP3 and CXCL13 in a separate cohort of IPF patients (N=80). Results 2940 genes were significantly differentially expressed between IPF and control samples (|fold change| > 1.5, p < 0.05). Two clusters of co-regulated genes related to bronchiolar epithelium or lymphoid aggregates exhibited substantial heterogeneity within the IPF population. Gene expression in bronchiolar and lymphoid clusters corresponded to the extent of bronchiolization and lymphoid aggregates determined by immunohistochemistry in adjacent tissue sections. Elevated serum levels of MMP3, encoded in the bronchiolar cluster, and CXCL13, encoded in the lymphoid cluster, corresponded to disease severity and shortened survival time (p < 10−7 for MMP3 and p < 10−5 for CXCL13; Cox proportional hazards model). Conclusions Microscopic pathological heterogeneity in IPF lung tissue corresponds to specific gene expression patterns related to bronchiolization and lymphoid aggregates. MMP3 and CXCL13 are systemic biomarkers that reflect the aggregate burden of these pathological features across total lung tissue. These biomarkers may have clinical utility as prognostic and/or surrogate biomarkers of disease activity in interventional studies in IPF. PMID:25217476

  11. The 3p21 candidate tumor suppressor gene BAF180 is normally expressed in human lung cancer.


    Sekine, Ikuo; Sato, Mitsuo; Sunaga, Noriaki; Toyooka, Shinichi; Peyton, Michael; Parsons, Ramon; Wang, Weidong; Gazdar, Adi F; Minna, John D


    BAF180 encoding a subunit of the human SWI/SNF chromatin remodeling complex maps to 3p21, in a region where frequent allele loss has been detected in lung cancer. BAF180 can be mutated and has tumor suppressing properties in breast cancer. In addition, another member of this complex, hSNF5/INI1, is a known tumor suppressor gene (TSG) for malignant rhabdoid and childhood central nervous system tumors. Thus, BAF180 is a strong candidate TSG for lung cancer. The objective of this study was to determine whether BAF180 mRNA or protein expression was inactivated or abnormal in lung cancers to prompt detailed DNA promoter methylation or mutational analyses. In 30 non-small-cell and 26 small-cell lung cancer cell lines, most of which had 3p21 allele loss, BAF180 mRNA and protein expression were evaluated by RT-PCR using three sets of primers and Western blotting using two anti-BAF180 antibodies. In all cases, BAF180 was expressed and no abnormal size BAF180 protein was detected. Finally, we found no amino-acid sequence coding mutations in five non-small-cell and five small-cell lung cancer cell lines, while we did find a new splicing isoform of BAF180 (AY281068). We conclude that abnormalities of BAF180 are not frequently involved in the pathogenesis of lung cancer.

  12. Gene expression profile of oxidative stress in the lung of inbred mice after intestinal ischemia/reperfusion injury.


    Ikejiri, Adauto Tsutomu; Somaio Neto, Frederico; Chaves, José Carlos; Bertoletto, Paulo Roberto; Teruya, Roberto; Bertoletto, Eduardo Rodrigues; Taha, Murched Omar; Fagundes, Djalma José


    To determine the gene expression profile associated with oxidative stress and antioxidant defense in the lung tissue of mice subjected to intestinal ischemia and reperfusion. Twelve male, inbred mice (C57BL/6) were randomly assigned to one of two groups. The control group (CG) underwent anesthesia and laparotomy and was observed for 120 minutes; the ischemia/reperfusion group (IRG) was subjected to anesthesia, laparotomy, and ischemia of the small intestine for 60 minutes and to 60 minutes of reperfusion. A pool of six mice from each group was subjected to a reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to analyze the oxidative stress and antioxidant defense genes. All genes that were up-regulated or down-regulated greater than three-fold, based on the algorithm [2^(ΔΔCt)], were considered to be biologically meaningful. Out of a total of 84 genes in the lung that are related to oxidative stress, 67 (79.7%) were up-regulated and 17 (20.2%) were down-regulated. Only two genes (2.3%), Lpo (lactoperoxidase) (+3.51) and Gpx4 (glutathione peroxidase) (+4.10), were expressed above the three-fold threshold, while none of the down-regulated genes were expressed outside of this threshold. The intestinal ischemia/reperfusion injury promoted a gene expression profile consisting of the positive expression of oxidative genes in a remote organ. This suggests that activate signaling pathways are implicated in both cell survival and the maintenance of genome integrity in the lung.

  13. Expression of a TGF-beta1 inducible gene, TSC-36, causes growth inhibition in human lung cancer cell lines.


    Sumitomo, K; Kurisaki, A; Yamakawa, N; Tsuchida, K; Shimizu, E; Sone, S; Sugino, H


    TSC-36 (TGF-beta1-stimulated clone 36) is a TGF-beta1 inducible gene whose product is an extracellular glycoprotein that contains a single follistatin module. TSC-36 is highly expressed in the lung, but its physiological function is unknown. In an attempt to elucidate it, we investigated the effect of TSC-36 on proliferation of human lung cancer cell lines. We found a correlation between expression of TSC-36 and cell growth: TSC-36 mRNA was not detected in cells derived from small cell lung cancer (SCLC) cells, a highly aggressive neoplasm, but was detected in some non-small cell lung cancer (NSCLC) cells, a moderately aggressive neoplasm. This suggested an antiproliferative function for TSC-36. To address this question, NSCLC PC-14 cells, which express very low level of TSC-36 protein, were transfected with TSC-36 cDNA and the proliferative capacity of stable transfectants was determined by measuring the doubling time, colony forming activity in soft agar and the level of incorporation of (3)H-thymidine into DNA. Under normal culture conditions, the transfected cells showed a longer doubling time, lower plating efficiency and lower rate of DNA synthesis than the parental cells and the control neo transfectant cells. These findings suggested that expression of TSC-36 caused growth inhibition in human lung cancer cells.

  14. Gene expression of somatostatin receptor subtypes, SSTR1 and SSTR2, in human lung cancer cell lines.


    Fujita, T; Yamaji, Y; Sato, M; Murao, K; Takahara, J


    Somatostatin (SS) acts as a universal endocrine off-swich, and also inhibits the growth of neuroendocrine tumors through its specific receptors. Small cell lung cancer (SCLC) demonstrates some neuroendocrine characteristics and has been proposed as a candidate for treatment with SS and its analogues. In the present study, we investigated the expression of somatostatin receptor (SSTR) subtype (SSTR1 and SSTR2) mRNA in various human lung cancer cell lines by the sensitive reverse-transcription-PCR method and Southern blotting. The levels of expression of SSTR1 mRNA were higher in both SCLC and squamous cell carcinoma than in adenocarcinoma cell lines. Interestingly, SSTR1 gene expression was independent of that of SSTR2 in each SCLC cell line, although the expression of both genes showed a positive correlation in non-SCLC cells. Membranes from a cell line exhibiting highest expression of SSTR2 gene bound SS and its analogue, octreotide, with moderate affinity. These findings may provide useful information for the future clinical application of SS and its analogues for the treatment of lung cancer.

  15. Mechanical ventilation with 40% oxygen reduces pulmonary expression of genes that regulate lung development and impairs alveolar septation in newborn mice.


    Bland, Richard D; Mokres, Lucia M; Ertsey, Robert; Jacobson, Berit E; Jiang, Shu; Rabinovitch, Marlene; Xu, Liwen; Shinwell, Eric S; Zhang, Feijie; Beasley, Matthew A


    Mechanical ventilation with 40% oxygen reduces pulmonary expression of genes that regulate lung development and impairs alveolar septation in newborn mice. Am J Physiol Lung Cell Mol Physiol 293: , 2007. First published August 17, 2007; - Mechanical ventilation (MV) with O(2)-rich gas offers life-saving treatment for extremely premature infants with respiratory failure but often leads to neonatal chronic lung disease (CLD), characterized by defective formation of alveoli and blood vessels in the developing lung. We discovered that MV of 2- to 4-day-old mice with 40% O(2) for 8 h, compared with unventilated control pups, reduced lung expression of genes that regulate lung septation and angiogenesis (VEGF-A and its receptor, VEGF-R2; PDGF-A; and tenascin-C). MV with air for 8 h yielded similar results for PDGF-A and tenascin-C but did not alter lung mRNA expression of VEGF or VEGF-R2. MV of 4- to 6-day-old mice with 40% O(2) for 24 h reduced lung protein abundance of VEGF-A, VEGF-R2, PDGF-A, and tenascin-C and resulted in lung structural abnormalities consistent with evolving CLD. After MV with 40% O(2) for 24 h, lung volume was similar to unventilated controls, whereas distal air space size, assessed morphometrically, was greater in lungs of ventilated pups, indicative of impaired septation. Immunostaining for vimentin, which is expressed in myofibroblasts, was reduced in distal lung after 24 h of MV with 40% O(2). These molecular, cellular, and structural changes occurred without detectable lung inflammation as evaluated by histology and assays for proinflammatory cytokines, myeloperoxidase activity, and water content in lung. Thus lengthy MV of newborn mice with O(2)-rich gas reduces lung expression of genes and proteins that are critical for normal lung growth and development. These changes yielded lung structural defects similar to those observed in evolving CLD.

  16. Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

    SciTech Connect

    Li Hongwei; Li Jinzhong; Helm, Gregory A.; Pan Dongfeng . E-mail:


    PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of the luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.

  17. Gene expression analysis in rat lungs after intratracheal exposure to nanoparticles doped with cadmium

    NASA Astrophysics Data System (ADS)

    Coccini, Teresa; Fabbri, Marco; Roda, Elisa; Grazia Sacco, Maria; Manzo, Luigi; Gribaldo, Laura


    Silica nanoparticles (NPs) incorporating cadmium (Cd) have been developed for a range of potential application including drug delivery devices. Occupational Cd inhalation has been associated with emphysema, pulmonary fibrosis and lung tumours. Mechanistically, Cd can induce oxidative stress and mediate cell-signalling pathways that are involved in inflammation.This in vivo study aimed at investigating pulmonary molecular effects of NPs doped with Cd (NP-Cd, 1 mg/animal) compared to soluble CdCl2 (400 μg/animal), in Sprague Dawley rats treated intra-tracheally, 7 and 30 days after administration. NPs of silica containing Cd salt were prepared starting from commercial nano-size silica powder (HiSil™ T700 Degussa) with average pore size of 20 nm and surface area of 240 m2/g. Toxicogenomic analysis was performed by the DNA microarray technology (using Agilent Whole Rat Genome Microarray 4×44K) to evaluate changes in gene expression of the entire genome. These findings indicate that the whole genome analysis may represent a valuable approach to assess the whole spectrum of biological responses to cadmium containing nanomaterials.

  18. A study of myc-related gene expression in small cell lung cancer by in situ hybridization.

    PubMed Central

    Gu, J.; Linnoila, R. I.; Seibel, N. L.; Gazdar, A. F.; Minna, J. D.; Brooks, B. J.; Hollis, G. F.; Kirsch, I. R.


    The expression of myc-related genes (c-myc, N-myc, and L-myc) in small cell lung cancer (SCLC) was studied by RNA-RNA tissue in situ hybridization. The tissues investigated included cytospins of ten cell lines derived from patients with SCLC, four corresponding nude mouse xenografts from cell lines, and metastatic tumor tissue obtained by surgical biopsy and at autopsy. The probes were prepared as 35S labeled complementary RNA. The expression of each gene was demonstrated specifically by autoradiography in the cytoplasm of the neoplastic cell samples. The average levels of oncogene expression in each specimen corroborated previous data obtained by Northern blot assays. In addition, heterogeneity in gene expression from cell to cell in each sample was noted. This study represents the first attempt to demonstrate oncogene expression in lung cancer cell lines and tissues in situ, and confirms that the expression of these myc related genes can be seen in the primary tumor. The technique of RNA-RNA tissue in situ hybridization has great potential in answering fundamental questions of tumor cell heterogeneity and progression in SCLC. It should be useful in both prospective and retrospective studies. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2456019

  19. Gene expression profiling of the effects of organic dust in lung epithelial and THP-1 cells reveals inductive effects on inflammatory and immune response genes.


    Boggaram, Vijay; Loose, David S; Gottipati, Koteswara R; Natarajan, Kartiga; Mitchell, Courtney T


    The intensification and concentration of animal production operations expose workers to high levels of organic dusts in the work environment. Exposure to organic dusts is a risk factor for the development of acute and chronic respiratory symptoms and diseases. Lung epithelium plays important roles in the control of immune and inflammatory responses to environmental agents to maintain lung health. To better understand the effects of organic dust on lung inflammatory responses, we characterized the gene expression profiles of A549 alveolar and Beas2B bronchial epithelial and THP-1 monocytic cells influenced by exposure to poultry dust extract by DNA microarray analysis using Illumina Human HT-12 v4 Expression BeadChip. We found that A549 alveolar and Beas2B bronchial epithelial and THP-1 cells responded with unique changes in the gene expression profiles with regulation of genes encoding inflammatory cytokines, chemokines, and other inflammatory proteins being common to all the three cells. Significantly induced genes included IL-8, IL-6, IL-1β, ICAM-1, CCL2, CCL5, TLR4, and PTGS2. Validation by real-time qRT-PCR, ELISA, Western immunoblotting, and immunohistochemical staining of lung sections from mice exposed to dust extract validated DNA microarray results. Pathway analysis indicated that dust extract induced changes in gene expression influenced functions related to cellular growth and proliferation, cell death and survival, and cellular development. These data show that a broad range of inflammatory mediators produced in response to poultry dust exposure can modulate lung immune and inflammatory responses. This is the first report on organic dust induced changes in expression profiles in lung epithelial and THP-1 monocytic cells.

  20. Gene expression profiling of the effects of organic dust in lung epithelial and THP-1 cells reveals inductive effects on inflammatory and immune response genes

    PubMed Central

    Loose, David S.; Gottipati, Koteswara R.; Natarajan, Kartiga; Mitchell, Courtney T.


    The intensification and concentration of animal production operations expose workers to high levels of organic dusts in the work environment. Exposure to organic dusts is a risk factor for the development of acute and chronic respiratory symptoms and diseases. Lung epithelium plays important roles in the control of immune and inflammatory responses to environmental agents to maintain lung health. To better understand the effects of organic dust on lung inflammatory responses, we characterized the gene expression profiles of A549 alveolar and Beas2B bronchial epithelial and THP-1 monocytic cells influenced by exposure to poultry dust extract by DNA microarray analysis using Illumina Human HT-12 v4 Expression BeadChip. We found that A549 alveolar and Beas2B bronchial epithelial and THP-1 cells responded with unique changes in the gene expression profiles with regulation of genes encoding inflammatory cytokines, chemokines, and other inflammatory proteins being common to all the three cells. Significantly induced genes included IL-8, IL-6, IL-1β, ICAM-1, CCL2, CCL5, TLR4, and PTGS2. Validation by real-time qRT-PCR, ELISA, Western immunoblotting, and immunohistochemical staining of lung sections from mice exposed to dust extract validated DNA microarray results. Pathway analysis indicated that dust extract induced changes in gene expression influenced functions related to cellular growth and proliferation, cell death and survival, and cellular development. These data show that a broad range of inflammatory mediators produced in response to poultry dust exposure can modulate lung immune and inflammatory responses. This is the first report on organic dust induced changes in expression profiles in lung epithelial and THP-1 monocytic cells. PMID:26884459

  1. Single nucleotide polymorphisms, haplotype association and tumour expression of the vascular endothelial growth factor (VEGF) gene with lung carcinoma.


    Naykoo, Niyaz A; Dil-Afroze; Rasool, Roohi; Shah, Sonaullah; Ahangar, A G; Bhat, Imtiyaz A; Qasim, Iqbal; Siddiqi, Mushtaq A; Shah, Zafar A


    VEGF contains several polymorphic sites known to influence its expression. We examined the possible association between+405(-634)C>G,+936C>T,-2578C>A and lung cancer in 199 Kashmiri patients and 401 healthy controls. VEGF+405CG,+936CT+TT and-2578CA genotypes were significantly associated with lung cancer risk compared to VEGF+405CC,+936CC and-2578AA+CC genotypes [OR=0.07 (0.04-0.13), P<0.0001, OR=0.36 (0.25-0.52), P<0.0001 and 0.08 (0.05-0.13), P<0.0001]. Haplotype analysis revealed that CGA and TGA haplotypes of VEGF gene conveys the risk for lung cancer [OR=0.18 (0.10-0.33), P<0.0001 and 0.07 (0.03-0.13), P<0.0001]. VEGF expression revealed non-significant association with the genotypes of the three SNPs. In conclusion, the SNPs examined appear to influence lung cancer susceptibility while as genotypes of the SNPs don't appear to have significant association with VEGF mRNA expression in lung tumours.

  2. Gene Expression Profiles in Peripheral Blood Mononuclear Cells Can Distinguish Patients with Non-Small-Cell Lung Cancer from Patients with Non-Malignant Lung Disease

    PubMed Central

    Showe, Michael K.; Vachani, Anil; Kossenkov, Andrew V.; Yousef, Malik; Nichols, Calen; Nikonova, Elena V.; Chang, Celia; Kucharczuk, John; Tran, Bao; Wakeam, Elliot; Yie, Ting An; Speicher, David; Rom, William N.; Albelda, Steven


    Early diagnosis of lung cancer followed by surgery presently is the most effective treatment for non-small-cell lung cancer (NSCLC). An accurate, minimally invasive test that could detect early disease would permit timely intervention and potentially reduce mortality. Recent studies have shown that the peripheral blood can carry information related to the presence of disease, including prognostic information and information on therapeutic response. We have analyzed gene expression in peripheral blood mononuclear cell (PBMC) samples including 137 patients with NSCLC tumors and 91 patient controls with non-malignant lung conditions, including histologically diagnosed benign nodules. Subjects were primarily smokers and former smokers. We have identified a 29-gene signature that separates these two patient classes with 86% accuracy (91% sensitivity, 80% specificity). Accuracy in an independent validation set, including samples from a new location, was 78% (sensitivity of 76% and specificity of 82%). An analysis of this NSCLC-gene signature in 18 NSCLCs taken pre-surgery, with matched samples from 2-5 months post-surgery, showed that in 78% of cases, the signature was reduced post-surgery and disappeared entirely in 33%. Our results demonstrate the feasibility of using peripheral blood gene expression signatures to identify early-stage NSCLC in at-risk populations. PMID:19951989

  3. Nippostrongylus brasiliensis: identification of intelectin-1 and -2 as Stat6-dependent genes expressed in lung and intestine during infection.


    Voehringer, David; Stanley, Sarah A; Cox, Jeffery S; Completo, Gladys C; Lowary, Todd L; Locksley, Richard M


    Elimination of the helminth parasite Nippostrongylus brasiliensis from infected mice is mediated by IL-4 or IL-13 and dependent on the IL-4Ralpha chain and the transcription factor Stat6 in non-hematopoietic cells. However, it is not clear which Stat6-dependent effector molecules mediate worm expulsion. We identified intelectin-1 and -2 as Stat6-dependent genes that are induced during infection. Intelectins can bind galactofuranose, a sugar present only in microorganisms and might therefore serve as microbial pattern element. To analyze whether constitutive expression of intelectin-1 or -2 leads to accelerated pathogen clearance, transgenic mice were generated which express high levels of these genes selectively in the lung. Infection with N. brasiliensis or Mycobacterium tuberculosis did not result in accelerated pathogen clearance in transgenic as compared to wild-type mice. Further, no significant modulation of the immune response in lung or lymph nodes was observed. Thus, under these conditions, intelectins did not enhance pathogen clearance.

  4. Chlorogenic acid regulates apoptosis and stem cell marker-related gene expression in A549 human lung cancer cells.


    Yamagata, Kazuo; Izawa, Yuri; Onodera, Daiki; Tagami, Motoki


    Previous studies indicated that chlorogenic acid, a compound present in many fruits and vegetables, has anti-cancer activities. We report that chlorogenic acid regulates the expression of apoptosis-related genes and self-renewal-related stem cell markers in cancer cells. The lung cancer cell line A549 was cultured with or without chlorogenic acid. The presence of chlorogenic acid decreased cell proliferation as measured by MTT activity. Polymerase chain reaction (PCR) showed that treatment of cells with chlorogenic acid reduced the expression of BCL2 but increased that of both BAX and CASP3. Chlorogenic acid enhanced annexin V expression as measured using fluorescently labeled annexin V. Chlorogenic acid also induced p38 MAPK and JNK gene expression. Meanwhile, several agents, including SB203580 (p38 MAP kinase inhibitor), N-acetylcysteine (antioxidant inhibitor), dipyridamole (phosphodiesterase inhibitor), and apocynin (NADPH-oxidase inhibitor) blocked chlorogenic acid-induced BAX gene expression. Chlorogenic acid reduced gene expression levels of stem cell-associated markers NANOG, POU5F1, and SOX2. Together these results indicate that chlorogenic acid affects the expression of apoptosis-related genes that are part of oxidative stress and p38 MAP-dependent pathways, as well as genes encoding stem cell markers. In conclusion, chlorogenic acid may contribute to the polyphenolic anti-cancer effect associated with consumption of vegetables and fruits.

  5. Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

    PubMed Central

    Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny


    Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

  6. Integrated Analysis of DNA Methylation and mRNA Expression Profiles Data to Identify Key Genes in Lung Adenocarcinoma

    PubMed Central

    Jin, Xiang; Li, Xiaodan; Guan, Yinghui


    Introduction. Lung adenocarcinoma (LAC) is the most frequent type of lung cancer and has a high metastatic rate at an early stage. This study is aimed at identifying LAC-associated genes. Materials and Methods. GSE62950 downloaded from Gene Expression Omnibus included a DNA methylation dataset and an mRNA expression profiles dataset, both of which included 28 LAC tissue samples and 28 adjacent normal tissue samples. The differentially expressed genes (DEGs) were screened by Limma package in R, and their functions were predicted by enrichment analysis using TargetMine online tool. Then, protein-protein interaction (PPI) network was constructed using STRING and Cytoscape. Finally, LAC-associated methylation sites were identified by CpGassoc package in R and mapped to the DEGs to obtain LAC-associated DEGs. Results. Total 913 DEGs were identified in LAC tissues. In the PPI networks, MAD2L1, AURKB, CCNB2, CDC20, and WNT3A had higher degrees, and the first four genes might be involved in LAC through interaction. Total 8856 LAC-associated methylation sites were identified and mapped to the DEGs. And there were 29 LAC-associated methylation sites located in 27 DEGs (e.g., SH3GL2, BAI3, CDH13, JAM2, MT1A, LHX6, and IGFBP3). Conclusions. These key genes might play a role in pathogenesis of LAC. PMID:27610375


    EPA Science Inventory

    ABSTRACT BODY: Ozone causes oxidative stress and lung inflammation. We hypothesized that rat strains with or without genetic susceptibility to cardiovascular disease will have different antioxidant levels in alveolar lining, and that ozone induced inflammatory gene expression wil...


    EPA Science Inventory

    ABSTRACT BODY: Ozone causes oxidative stress and lung inflammation. We hypothesized that rat strains with or without genetic susceptibility to cardiovascular disease will have different antioxidant levels in alveolar lining, and that ozone induced inflammatory gene expression wil...

  9. Indications for distinct pathogenic mechanisms of asbestos and silica through gene expression profiling of the response of lung epithelial cells

    PubMed Central

    Perkins, Timothy N.; Peeters, Paul M.; Shukla, Arti; Arijs, Ingrid; Dragon, Julie; Wouters, Emiel F.M.; Reynaert, Niki L.; Mossman, Brooke T.


    Occupational and environmental exposures to airborne asbestos and silica are associated with the development of lung fibrosis in the forms of asbestosis and silicosis, respectively. However, both diseases display distinct pathologic presentations, likely associated with differences in gene expression induced by different mineral structures, composition and bio-persistent properties. We hypothesized that effects of mineral exposure in the airway epithelium may dictate deviating molecular events that may explain the different pathologies of asbestosis versus silicosis. Using robust gene expression-profiling in conjunction with in-depth pathway analysis, we assessed early (24 h) alterations in gene expression associated with crocidolite asbestos or cristobalite silica exposures in primary human bronchial epithelial cells (NHBEs). Observations were confirmed in an immortalized line (BEAS-2B) by QRT-PCR and protein assays. Utilization of overall gene expression, unsupervised hierarchical cluster analysis and integrated pathway analysis revealed gene alterations that were common to both minerals or unique to either mineral. Our findings reveal that both minerals had potent effects on genes governing cell adhesion/migration, inflammation, and cellular stress, key features of fibrosis. Asbestos exposure was most specifically associated with aberrant cell proliferation and carcinogenesis, whereas silica exposure was highly associated with additional inflammatory responses, as well as pattern recognition, and fibrogenesis. These findings illustrate the use of gene-profiling as a means to determine early molecular events that may dictate pathological processes induced by exogenous cellular insults. In addition, it is a useful approach for predicting the pathogenicity of potentially harmful materials. PMID:25351596

  10. Subchronic inhalation of soluble manganese induces expression of hypoxia-associated angiogenic genes in adult mouse lungs

    SciTech Connect

    Bredow, Sebastian . E-mail:; Falgout, Melanie M.; March, Thomas H.; Yingling, Christin M.; Malkoski, Stephen P.; Aden, James; Bedrick, Edward J.; Lewis, Johnnye L.; Divine, Kevin K.


    Although the lung constitutes the major exposure route for airborne manganese (Mn), little is known about the potential pulmonary effects and the underlying molecular mechanisms. Transition metals can mimic a hypoxia-like response, activating the hypoxia inducible factor-1 (HIF-1) transcription factor family. Through binding to the hypoxia-response element (HRE), these factors regulate expression of many genes, including vascular endothelial growth factor (VEGF). Increases in VEGF, an important biomarker of angiogenesis, have been linked to respiratory diseases, including pulmonary hypertension. The objective of this study was to evaluate pulmonary hypoxia-associated angiogenic gene expression in response to exposure of soluble Mn(II) and to assess the genes' role as intermediaries of potential pulmonary Mn toxicity. In vitro, 0.25 mM Mn(II) altered morphology and slowed the growth of human pulmonary epithelial cell lines. Acute doses between 0.05 and 1 mM stimulated VEGF promoter activity up to 3.7-fold in transient transfection assays. Deletion of the HRE within the promoter had no effect on Mn(II)-induced VEGF expression but decreased cobalt [Co(II)]-induced activity 2-fold, suggesting that HIF-1 may not be involved in Mn(II)-induced VEGF gene transcription. Nose-only inhalation to 2 mg Mn(II)/m{sup 3} for 5 days at 6 h/day produced no significant pulmonary inflammation but induced a 2-fold increase in pulmonary VEGF mRNA levels in adult mice and significantly altered expression of genes associated with murine angiogenesis. These findings suggest that even short-term exposures to soluble, occupationally relevant Mn(II) concentrations may alter pulmonary gene expression in pathways that ultimately could affect the lungs' susceptibility to respiratory disease.

  11. Transcriptome Profiling of the Lungs Reveals Molecular Clock Genes Expression Changes after Chronic Exposure to Ambient Air Particles

    PubMed Central

    Song, Pengcheng; Li, Zhigang; Li, Xiaoqian; Yang, Lixin; Zhang, Lulu; Li, Nannan; Guo, Chen; Lu, Shuyu; Wei, Yongjie


    The symptoms of asthma, breathlessness, insomnia, etc. all have relevance to pulmonary rhythmic disturbances. Epidemiology and toxicology studies have demonstrated that exposure to ambient air particles can result in pulmonary dysfunction. However, there are no data directly supporting a link between air pollution and circadian rhythm disorder. In the present study, we found that breathing highly polluted air resulted in changes of the molecular clock genes expression in lung by transcriptome profiling analyses in a rodent model. Compared to those exposed to filtered air, in both pregnant and offspring rats in the unfiltered group, key clock genes (Per1, Per2, Per3, Rev-erbα and Dbp) expression level decreased and Bmal1 expression level increased. In both rat dams and their offspring, after continuous exposure to unfiltered air, we observed significant histologic evidence for both perivascular and peribronchial inflammation, increased tissue and systemic oxidative stress in the lungs. Our results suggest that chronic exposure to particulate matter can induce alterations of clock genes expression, which could be another important pathway for explaining the feedbacks of ambient particle exposure in addition to oxidative stress and inflammation. PMID:28106813

  12. Gene expression modulation in A549 human lung cells in response to combustion-generated nano-sized particles.


    Arenz, Andrea; Hellweg, Christine E; Stojicic, Nevena; Baumstark-Khan, Christa; Grotheer, Horst-Henning


    High levels of ambient air pollution are associated in humans with aggravation of asthma and of respiratory and cardiopulmonary morbidity; long-term exposures to particulate matter (PM) have been linked to possible increases in lung cancer risk, chronic respiratory disease, and increased death rates. The Biodiagnostics Group of the DLR Institute of Aerospace Medicine develops cellular test systems capable of monitoring the biological consequences of environmental conditions on humans already on cellular and molecular level. Such bioassays rely on the receptor-reporter principle, where cell lines are transfected with plasmids carrying a reporter gene under control of environment-dependent promoters (receptor), which play a key role in regulating gene expressions in response to extracellular signals. We developed the recombinant human lung epithelial cell line A549-NF-kappaB-EGFP/Neo carrying a genetically encoded fluorescent indicator for monitoring activation of the NF-kappaB signaling pathway in living cells in response to genotoxic and cytotoxic environmental influences. With this cell line we screened several candidate human radiation-responsive genes (GADD45beta, CDKN1A) and NF-kappaB-dependent genes (IL-6, NFkappaBIA, and pNF-kappaB-EGFP) for gene expression changes by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) assay, using cDNA obtained from total RNA isolated at various time points after exposure to combustion generated nano-sized particle samples.

  13. Integrated Analysis of Genome-Wide Copy Number Alterations and Gene Expression Profiling of Lung Cancer in Xuanwei, China

    PubMed Central

    Zhang, Yanliang; Xue, Qiuyue; Pan, Guoqing; Meng, Qing H.; Tuo, Xiaoyu; Cai, Xuemei; Chen, Zhenghui; Li, Ya; Huang, Tao; Duan, Xincen; Duan, Yong


    Objectives Lung cancer in Xuanwei (LCXW), China, is known throughout the world for its distinctive characteristics, but little is known about its pathogenesis. The purpose of this study was to screen potential novel “driver genes” in LCXW. Methods Genome-wide DNA copy number alterations (CNAs) were detected by array-based comparative genomic hybridization and differentially expressed genes (DEGs) by gene expression microarrays in 8 paired LCXW and non-cancerous lung tissues. Candidate driver genes were screened by integrated analysis of CNAs and DEGs. The candidate genes were further validated by real-time quantitative polymerase chain reaction. Results Large numbers of CNAs and DEGs were detected, respectively. Some of the most frequently occurring CNAs included gains at 5p15.33-p15.32, 5p15.1-p14.3, and 5p14.3-p14.2 and losses at 11q24.3, 21q21.1, 21q22.12-q22.13, and 21q22.2. Integrated analysis of CNAs and DEGs identified 24 candidate genes with frequent copy number gains and concordant upregulation, which were considered potential oncogenes, including CREB3L4, TRIP13, and CCNE2. In addition, the analysis identified 19 candidate genes with a negative association between copy number change and expression change, considered potential tumor suppressor genes, including AHRR, NKD2, and KLF10. One of the most studied oncogenes, MYC, may not play a carcinogenic role in LCXW. Conclusions This integrated analysis of CNAs and DEGs identified several potential novel LCXW-related genes, laying an important foundation for further research on the pathogenesis of LCXW and identification of novel biomarkers or therapeutic targets. PMID:28056099

  14. Heterogeneity of excision repair cross-complementation group 1 gene expression in non-small-cell lung cancer patients

    PubMed Central



    Excision repair cross-complementation group 1 (ERCC1) gene expression analysis is currently used widely in the molecular diagnosis of cancer. According to numerous studies, ERCC1 gene expression correlates with overall survival and effectiveness of chemotherapy with platinum agents. However, the degree of this correlation differs among various studies, with certain authors reporting a complete lack of such a correlation. These contradictions may be attributed to a number of factors, including the heterogeneity of the tumor tissue. In this study, we attempted to assess the degree of genetic heterogeneity exhibited by tissue samples obtained from non-small-cell lung cancer (NSCLC) through the expression of the ERCC1 gene. This study included 25 samples of tumor tissue from patients with a morphologically confirmed NSCLC diagnosis. A total of three randomized sections of each specimen were used. The ERCC1 gene expression was assessed by quantitative polymerase chain reaction (qPCR) in the TaqMan format. When planning the experiment and analysis of qPCR data, the MIQE guidelines were taken into consideration. We established that the coefficient of variation of the relative level of ERCC1 gene expression in the majority of the samples exceeded 33% (P<0.05), indicating the significant heterogeneity of the sample. We also demonstrated that the degree of heterogeneity of the tumor tissue is largely dependent on disease stage. PMID:25469300

  15. Differences in gene expression profiles from asbestos-treated SPARC-null and wild type mouse lungs

    PubMed Central

    Pershouse, Mark A.; Smartt, Aubrey M.; Schwanke, Corbin; Putnam, Elizabeth A.


    The role of SPARC in the in vivo lung response to crocidolite asbestos was addressed by instillation of crocidolite asbestos in a series of wild type or SPARC -null mice. Animals were sacrificed at one week, one month, and three months post-instillation to assess the impact of SPARC on multiple stages in the development of fibrosis. RNA was harvested from 10 animals/time point, pooled, and used to probe a mouse array containing ∼10,000 probes. Gene expression data was analyzed for fold-change, and for broader functional group alterations. As expected, the one-week time point displayed alterations in genes involved in immune recognition, energy utilization, and growth factor production. Later time points showed expression alterations for genes involved in protein degradation, Wnt receptor signaling, membrane protein activity, and transport. Molecules in the Wnt pathway have been implicated in bone growth, mediation of fibroblast activity, and have been directly linked to SPARC regulation. PMID:19446018

  16. Gene Expression and Pathway Analysis of Effects of the CMAH Deactivation on Mouse Lung, Kidney and Heart

    PubMed Central

    Kwon, Deug-Nam; Chang, Byung-Soo; Kim, Jin-Hoi


    Background N-glycolylneuraminic acid (Neu5Gc) is generated by hydroxylation of CMP-Neu5Ac to CMP-Neu5Gc, catalyzed by CMP-Neu5Ac hydroxylase (CMAH). However, humans lack this common mammalian cell surface molecule, Neu5Gc, due to inactivation of the CMAH gene during evolution. CMAH is one of several human-specific genes whose function has been lost by disruption or deletion of the coding frame. It has been suggested that CMAH inactivation has resulted in biochemical or physiological characteristics that have resulted in human-specific diseases. Methodology/Principal Findings To identify differential gene expression profiles associated with the loss of Neu5Gc expression, we performed microarray analysis using Illumina MouseRef-8 v2 Expression BeadChip, using the main tissues (lung, kidney, and heart) from control mice and CMP-Neu5Ac hydroxylase (Cmah) gene knock-out mice, respectively. Out of a total of 25,697 genes, 204, 162, and 147 genes were found to be significantly modulated in the lung, kidney, and heart tissues of the Cmah null mouse, respectively. In this study, we examined the gene expression profiles, using three commercial pathway analysis software packages: Ingenuity Pathways Analysis, Kyoto Encyclopedia of Genes and Genomes analysis, and Pathway Studio. The gene ontology analysis revealed that the top 6 biological processes of these genes included protein metabolism and modification, signal transduction, lipid, fatty acid, and steroid metabolism, nucleoside, nucleotide and nucleic acid metabolism, immunity and defense, and carbohydrate metabolism. Gene interaction network analysis showed a common network that was common to the different tissues of the Cmah null mouse. However, the expression of most sialytransferase mRNAs of Hanganutziu-Deicher antigen, sialy-Tn antigen, Forssman antigen, and Tn antigen was significantly down-regulated in the liver tissue of Cmah null mice. Conclusions/Significance Mice bearing a human-like deletion of the Cmah gene

  17. The lung innate immune gene surfactant protein-D is expressed in adipose tissue and linked to obesity status.


    Ortega, F J; Pueyo, N; Moreno-Navarrete, J M; Sabater, M; Rodriguez-Hermosa, J I; Ricart, W; Tinahones, F J; Fernández-Real, J M


    Surfactant protein-D (SFTPD) is a component of the lung innate immunity that enhances clearance of pathogens and modulates inflammatory responses. An inverse association of putative, lung-derived circulating SFTPD with obesity has been reported but no information is available concerning possible SFTPD gene expression in human adipose tissue. SFTPD gene expression was analyzed in human omental (OM; n=156) and subcutaneous (SC; n=106) adipose tissue, and in isolated fat cells (n=12) in association with measures of obesity and glucose tolerance. SFTPD gene was expressed in human adipose tissue and adipocytes. This expression was decreased in OM and SC adipose tissue from obese subjects with (-47%, P<0.0001; and -37%, P=0.048) and without (-34%, P=0.001; and -22%, P=0.08; respectively) type 2 diabetes when compared with the control group. Indeed, OM SFTPD was inversely associated with body mass index (r=-0.33, P<0.0001), percent fat mass (r=-0.36, P<0.0001), waist perimeter (r=-0.26, P=0.002), diastolic blood pressure (r=-0.21, P=0.018) and fasting glucose (r=-0.21, P=0.012); and positively linked to the expression of insulin receptor substrate 1 (IRS1; r=0.25, P=0.004), perilipin A (PLIN; r=0.38, P=0.007) and fatty acid synthase (FASN; r=0.36, P<0.0001). Accordingly, increased SFTPD (4.5-fold, P=0.02) was detected in isolated adipocytes when compared with the stromal-vascular cell fraction, in parallel to IRS1, FASN and PLIN. Both OM and SC adipose tissue (mainly mature adipocytes) express SFTPD. This expression decreases with obesity and impaired glucose tolerance.

  18. Gene expression profiling in the lungs of pigs with different susceptibilities to Glässer's disease

    PubMed Central


    Background Haemophilus parasuis is the causative agent of Glässer's disease in pigs. Currently, little is known about the molecular mechanisms that contribute to disease susceptibility. This study used a porcine oligonucleotide microarray to identify genes that were differentially expressed (DE) in the lungs of colostrum-deprived animals previously characterized as being either 'Fully Resistant' (FR) or 'Susceptible' to infection by H. parasuis in a bacterial challenge experiment. Results Gene expression profiles of 'FR' and 'Susceptible' animals were obtained by the identification of genes that were differentially expressed between each of these groups and mock-inoculated 'Control' animals. At 24 hours post-inoculation, a total of 21 and 58 DE genes were identified in 'FR' and 'Susceptible' animals respectively. At 72 hours, the numbers of genes were 20 and 347 respectively. 'FR' animals at 24 hours exhibited an increased expression of genes encoding extracellular matrix and TGF-β signalling components, possibly indicative of tissue repair following the successful early resolution of infection. The gene expression profile of 'FR' animals at 72 hours supported the hypothesis that higher levels of antibacterial activity were responsible for the 'FR' phenotype, possibly due to an increase in natural immunoglobulin A and decrease in signalling by the immunoregulatory transcription factor peroxisome proliferator-activated receptor gamma (PPAR-γ). The expression profile of 'Susceptible' animals at both time-points was characterized by an imbalance in signalling between pro and anti-inflammatory cytokines and an increased expression of genes involved in biological processes associated with inflammation. These include the pro-inflammatory cytokine genes resistin (RETN) and interleukin 1-beta (IL1B). At 72 hours, a reduction in the expression of genes involved in antigen presentation by both MHC class I and II molecules was observed, which could have contributed to the

  19. Alterations in gene expression of proprotein convertases in human lung cancer have a limited number of scenarios.


    Demidyuk, Ilya V; Shubin, Andrey V; Gasanov, Eugene V; Kurinov, Alexander M; Demkin, Vladimir V; Vinogradova, Tatyana V; Zinovyeva, Marina V; Sass, Alexander V; Zborovskaya, Irina B; Kostrov, Sergey V


    Proprotein convertases (PCs) is a protein family which includes nine highly specific subtilisin-like serine endopeptidases in mammals. The system of PCs is involved in carcinogenesis and levels of PC mRNAs alter in cancer, which suggests expression status of PCs as a possible marker for cancer typing and prognosis. The goal of this work was to assess the information value of expression profiling of PC genes. Quantitative polymerase chain reaction was used for the first time to analyze mRNA levels of all PC genes as well as matrix metalloproteinase genes MMP2 and MMP14, which are substrates of PCs, in 30 matched pairs of samples of human lung cancer tumor and adjacent tissues without pathology. Significant changes in the expression of PCs have been revealed in tumor tissues: increased FURIN mRNA level (p<0.00005) and decreased mRNA levels of PCSK2 (p<0.007), PCSK5 (p<0.0002), PCSK7 (p<0.002), PCSK9 (p<0.00008), and MBTPS1 (p<0.00004) as well as a tendency to increase in the level of PCSK1 mRNA. Four distinct groups of samples have been identified by cluster analysis of the expression patterns of PC genes in tumor vs. normal tissue. Three of these groups covering 80% of samples feature a strong elevation in the expression of a single gene in cancer: FURIN, PCSK1, or PCSK6. Thus, the changes in the expression of PC genes have a limited number of scenarios, which may reflect different pathways of tumor development and cryptic features of tumors. This finding allows to consider the mRNAs of PC genes as potentially important tumor markers.

  20. Phosphodiesterase-4 Inhibition Alters Gene Expression and Improves Isoniazid – Mediated Clearance of Mycobacterium tuberculosis in Rabbit Lungs

    PubMed Central

    Subbian, Selvakumar; Tsenova, Liana; O'Brien, Paul; Yang, Guibin; Koo, Mi-Sun; Peixoto, Blas; Fallows, Dorothy; Dartois, Veronique; Muller, George; Kaplan, Gilla


    Tuberculosis (TB) treatment is hampered by the long duration of antibiotic therapy required to achieve cure. This indolent response has been partly attributed to the ability of subpopulations of less metabolically active Mycobacterium tuberculosis (Mtb) to withstand killing by current anti-TB drugs. We have used immune modulation with a phosphodiesterase-4 (PDE4) inhibitor, CC-3052, that reduces tumor necrosis factor alpha (TNF-α) production by increasing intracellular cAMP in macrophages, to examine the crosstalk between host and pathogen in rabbits with pulmonary TB during treatment with isoniazid (INH). Based on DNA microarray, changes in host gene expression during CC-3052 treatment of Mtb infected rabbits support a link between PDE4 inhibition and specific down-regulation of the innate immune response. The overall pattern of host gene expression in the lungs of infected rabbits treated with CC-3052, compared to untreated rabbits, was similar to that described in vitro in resting Mtb infected macrophages, suggesting suboptimal macrophage activation. These alterations in host immunity were associated with corresponding down-regulation of a number of Mtb genes that have been associated with a metabolic shift towards dormancy. Moreover, treatment with CC-3052 and INH resulted in reduced expression of those genes associated with the bacterial response to INH. Importantly, CC-3052 treatment of infected rabbits was associated with reduced ability of Mtb to withstand INH killing, shown by improved bacillary clearance, from the lungs of co-treated animals compared to rabbits treated with INH alone. The results of our study suggest that changes in Mtb gene expression, in response to changes in the host immune response, can alter the responsiveness of the bacteria to antimicrobial agents. These findings provide a basis for exploring the potential use of adjunctive immune modulation with PDE4 inhibitors to enhance the efficacy of existing anti-TB treatment. PMID:21949656

  1. Gene-Expression Signature Predicts Postoperative Recurrence in Stage I Non-Small Cell Lung Cancer Patients

    PubMed Central

    Lu, Yan; Wang, Liang; Liu, Pengyuan; Yang, Ping; You, Ming


    About 30% stage I non-small cell lung cancer (NSCLC) patients undergoing resection will recur. Robust prognostic markers are required to better manage therapy options. The purpose of this study is to develop and validate a novel gene-expression signature that can predict tumor recurrence of stage I NSCLC patients. Cox proportional hazards regression analysis was performed to identify recurrence-related genes and a partial Cox regression model was used to generate a gene signature of recurrence in the training dataset −142 stage I lung adenocarcinomas without adjunctive therapy from the Director's Challenge Consortium. Four independent validation datasets, including GSE5843, GSE8894, and two other datasets provided by Mayo Clinic and Washington University, were used to assess the prediction accuracy by calculating the correlation between risk score estimated from gene expression and real recurrence-free survival time and AUC of time-dependent ROC analysis. Pathway-based survival analyses were also performed. 104 probesets correlated with recurrence in the training dataset. They are enriched in cell adhesion, apoptosis and regulation of cell proliferation. A 51-gene expression signature was identified to distinguish patients likely to develop tumor recurrence (Dxy = −0.83, P<1e-16) and this signature was validated in four independent datasets with AUC >85%. Multiple pathways including leukocyte transendothelial migration and cell adhesion were highly correlated with recurrence-free survival. The gene signature is highly predictive of recurrence in stage I NSCLC patients, which has important prognostic and therapeutic implications for the future management of these patients. PMID:22292069

  2. Gene-expression signature predicts postoperative recurrence in stage I non-small cell lung cancer patients.


    Lu, Yan; Wang, Liang; Liu, Pengyuan; Yang, Ping; You, Ming


    About 30% stage I non-small cell lung cancer (NSCLC) patients undergoing resection will recur. Robust prognostic markers are required to better manage therapy options. The purpose of this study is to develop and validate a novel gene-expression signature that can predict tumor recurrence of stage I NSCLC patients. Cox proportional hazards regression analysis was performed to identify recurrence-related genes and a partial Cox regression model was used to generate a gene signature of recurrence in the training dataset -142 stage I lung adenocarcinomas without adjunctive therapy from the Director's Challenge Consortium. Four independent validation datasets, including GSE5843, GSE8894, and two other datasets provided by Mayo Clinic and Washington University, were used to assess the prediction accuracy by calculating the correlation between risk score estimated from gene expression and real recurrence-free survival time and AUC of time-dependent ROC analysis. Pathway-based survival analyses were also performed. 104 probesets correlated with recurrence in the training dataset. They are enriched in cell adhesion, apoptosis and regulation of cell proliferation. A 51-gene expression signature was identified to distinguish patients likely to develop tumor recurrence (Dxy = -0.83, P<1e-16) and this signature was validated in four independent datasets with AUC >85%. Multiple pathways including leukocyte transendothelial migration and cell adhesion were highly correlated with recurrence-free survival. The gene signature is highly predictive of recurrence in stage I NSCLC patients, which has important prognostic and therapeutic implications for the future management of these patients.

  3. Vegetables affect the expression of genes involved in carcinogenic and anticarcinogenic processes in the lungs of female C57BL/6 mice.


    van Breda, Simone G; van Agen, Ebienus; van Sanden, Suzy; Burzykowski, Tomasz; Kleinjans, Jos C; Delft, Joost H van


    Worldwide, lung cancer is the most prevalent and lethal malignant disease. In addition to avoidance of the most predominant risk factor, i.e., tobacco use, consumption of high amounts of vegetables and fruits could be an effective means of preventing lung cancer. However, the molecular mechanisms underlying lung cancer risk reduction by vegetables are not clear. In the present study, the effect of vegetables on gene expression changes in the lungs of female C57Bl/6 mice was investigated using cDNA microarray technology. The mice were fed 1 of 8 diets for 2 wk: a control diet containing no vegetables (diet 1); a diet containing a vegetable mixture at 100 (diet 2, 10% dose), 200 (diet 3, 20% dose), or 400 (diet 4, 40% dose) g/kg; or a diet containing cauliflower at 70 (diet 5, 7% dose); carrots at 73 (diet 6, 7.3% dose); peas at 226 (diet 7, 22.6% dose); or onions at 31 (diet 8, 3.1% dose) g/kg. The vegetable mixture consisted of these 4 individual vegetables. After the mice were killed, the lungs were removed and total RNA was isolated from the lungs for expression analysis of 602 genes involved in pathways of (anti)-carcinogenesis. The results of this study suggest that individual vegetables have a higher potential of modulating genes (5 from the 8 modulated genes) in favor of lung cancer risk prevention, in comparison with the vegetable mixture (2 from the 7 modulated genes); the other gene modulations are expected to enhance lung cancer risk. The pathways involved were miscellaneous and included cell growth, apoptosis, biotransformation, and immune response. Furthermore, carrots were able to modulate most gene expressions, and most of these effects occurred in processes that favored lung cancer risk prevention. The current study provides more insight into the genetic mechanisms by which vegetables, in particular carrots, can prevent lung cancer risk.

  4. Gene-expression Profiling in Non-small Cell Lung Cancer with Invasion of Mediastinal Lymph Nodes for Prognosis Evaluation.


    Grigoroiu, Madalina; Tagett, Rebecca; Draghici, Sorin; Dima, Simona; Nastase, Anca; Florea, Raluca; Sorop, Andrei; Ilie, Veronica; Bacalbasa, Nicolae; Tica, Valeria; Laszlo, Viktoria; Mansuet-Lupo, Audrey; Damotte, Dianne; Klepetko, Walter; Popescu, Irinel; Regnard, Jean Francois


    The aim of the study was to determine the pathways and expression profile of the genes that might predict response to neoadjuvant chemotherapy in patients with stage IIIA non-small cell lung cancer (NSCLC). We evaluated, by microarray, the gene-expression profile of tumoral mediastinal lymph node samples surgically removed from 27 patients with stage IIIA NSCLC before neoadjuvant chemotherapy treatment. Depending on the response to the induction treatment, the patients were divided in two groups: group A: patients whose disease evolved, stabilized or who had minor response to chemotherapy, and group B: patients whose disease stabilized or had major response to chemotherapy. The microarray experiments identified 1,127 genes with a modified expression in the tumoral tissue compared to normal tissue with p≤0.05 and 44 genes with p≤0.01. The identified up-regulated genes between tumoral versus normal tissue included collagen, type I, alpha 1 (COL1A1), inhibin beta A (INHBA) and thioredoxin interacting protein (TXNIP). Pathways identified with a false-discovery rate of <0.005 included: cytokine pathways, focal adhesion or extracellular matrix receptor interaction. Our approach identified important characteristics of NSCLC and pointed-out molecular differences between sub-groups of patients based on their response to therapy. Copyright© 2015, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.

  5. ALK gene expression status in pleural effusion predicts tumor responsiveness to crizotinib in Chinese patients with lung adenocarcinoma

    PubMed Central

    Wang, Zheng; Wu, Xiaonan; Han, Xiaohong; Cheng, Gang; Mu, Xinlin; Zhang, Yuhui; Cui, Di; Liu, Chang; Liu, Dongge; Shi, Yuankai


    Objective The relationship between anaplastic lymphoma kinase (ALK) expression in malignant pleural effusion (MPE) samples detected only by Ventana immunohistochemistry (IHC) ALK (D5F3) and the efficacy of ALK-tyrosine kinase inhibitor therapy is uncertain. Methods Ventana anti-ALK (D5F3) rabbit monoclonal primary antibody testing was performed on 313 cell blocks of MPE samples from Chinese patients with advanced lung adenocarcinoma, and fluorescence in situ hybridization (FISH) was used to verify the ALK gene status in Ventana IHC ALK (D5F3)-positive samples. The follow-up clinical data on patients who received crizotinib treatment were recorded. Results Of the 313 MPE samples, 27 (8.6%) were confirmed as ALK expression-positive, and the Ventana IHC ALK (D5F3)-positive rate was 17.3% (27/156) in wild-type epidermal growth factor receptor (EGFR) MPE samples. Twenty-three of the 27 IHC ALK (D5F3)-positive samples were positive by FISH. Of the 11 Ventana IHC ALK (D5F3)-positive patients who received crizotinib therapy, 2 patients had complete response (CR), 5 had partial response (PR) and 3 had stable disease (SD). Conclusions The ALK gene expression status detected by the Ventana IHC ALK (D5F3) platform in MPE samples may predict tumor responsiveness to crizotinib in Chinese patients with advanced lung adenocarcinoma. PMID:28174489

  6. Bioinforrnatics of Gene Expression Profiling Data Provide Mechanistic Understanding of Acute Ozone-Induced Lung injury

    EPA Science Inventory

    Acute ozone-induced pulmonary injury and inflammation are well characterized. A few studies have used gene expression profiling to determine the types of changes induced by ozone; however the mechanisms or the pathways involved are less well understood. We presumed that robust bi...

  7. Bioinforrnatics of Gene Expression Profiling Data Provide Mechanistic Understanding of Acute Ozone-Induced Lung injury

    EPA Science Inventory

    Acute ozone-induced pulmonary injury and inflammation are well characterized. A few studies have used gene expression profiling to determine the types of changes induced by ozone; however the mechanisms or the pathways involved are less well understood. We presumed that robust bi...

  8. Sex differences in risk of lung cancer: Expression of genes in the PAH bioactivation pathway in relation to smoking and bulky DNA adducts.


    Mollerup, Steen; Berge, Gisle; Baera, Rita; Skaug, Vidar; Hewer, Alan; Phillips, David H; Stangeland, Lodve; Haugen, Aage


    It is controversial whether women have a higher lung cancer susceptibility compared to men. We previously reported higher levels of smoking-related bulky DNA adducts in female lungs. In a pilot study (27 cases), we also found a higher level of female lung cytochrome P4501A1 (CYP1A1) gene expression. In the present extended study we report on the pulmonary expression of several genes involved in polycyclic aromatic hydrocarbon bioactivation in relation to sex, smoking and DNA adducts. CYP1A1, CYP1B1, aryl hydrocarbon receptor and microsomal epoxide hydrolase gene expression was measured by quantitative real-time reverse transcriptase-PCR in 121 normal lung tissue samples. The expression of CYP1A1 and CYP1B1 was significantly higher among current smokers compared to ex-smokers and never-smokers. Among current smokers, females had a 3.9-fold higher median level of CYP1A1 compared to males (p = 0.011). CYP1B1 expression was not related to sex. Lung DNA adducts (measured by 32P-postlabeling) were highly significantly related to CYP1A1 (p < 0.0001) irrespective of smoking-status. Our results are consistent with the hypothesis that CYP1A1 plays a significant role in lung DNA adduct formation and support a higher susceptibility to lung cancer among females. Copyright 2006 Wiley-Liss, Inc

  9. Differences in gene expression and cytokine production by crystalline vs. amorphous silica in human lung epithelial cells

    PubMed Central


    Background Exposure to respirable crystalline silica particles, as opposed to amorphous silica, is associated with lung inflammation, pulmonary fibrosis (silicosis), and potentially with lung cancer. We used Affymetrix/GeneSifter microarray analysis to determine whether gene expression profiles differed in a human bronchial epithelial cell line (BEAS 2B) exposed to cristobalite vs. amorphous silica particles at non-toxic and equal surface areas (75 and 150 × 106μm2/cm2). Bio-Plex analysis was also used to determine profiles of secreted cytokines and chemokines in response to both particles. Finally, primary human bronchial epithelial cells (NHBE) were used to comparatively assess silica particle-induced alterations in gene expression. Results Microarray analysis at 24 hours in BEAS 2B revealed 333 and 631 significant alterations in gene expression induced by cristobalite at low (75) and high (150 × 106μm2/cm2) amounts, respectively (p < 0.05/cut off ≥ 2.0-fold change). Exposure to amorphous silica micro-particles at high amounts (150 × 106μm2/cm2) induced 108 significant gene changes. Bio-Plex analysis of 27 human cytokines and chemokines revealed 9 secreted mediators (p < 0.05) induced by crystalline silica, but none were induced by amorphous silica. QRT-PCR revealed that cristobalite selectively up-regulated stress-related genes and cytokines (FOS, ATF3, IL6 and IL8) early and over time (2, 4, 8, and 24 h). Patterns of gene expression in NHBE cells were similar overall to BEAS 2B cells. At 75 × 106μm2/cm2, there were 339 significant alterations in gene expression induced by cristobalite and 42 by amorphous silica. Comparison of genes in response to cristobalite (75 × 106μm2/cm2) revealed 60 common, significant gene alterations in NHBE and BEAS 2B cells. Conclusions Cristobalite silica, as compared to synthetic amorphous silica particles at equal surface area concentrations, had comparable effects on the viability of human bronchial epithelial cells

  10. Using the one-lung method to link p38 to pro-inflammatory gene expression during overventilation in C57BL/6 and BALB/c mice.


    Siegl, Stephanie; Uhlig, Stefan


    The mechanisms of ventilator-induced lung injury (VILI), including the role of MAP kinases, are frequently studied in different mouse strains. A useful model for such studies is the isolated perfused mouse lung. As a further development we present the one-lung method that permits to continue perfusion and ventilation of the right lung after removal of the left lung. This method was used to compare the effect of high pressure ventilation (HPV) on pro-inflammatory signaling events in two widely used mouse strains (C57BL/6, BALB/c) and to further define the role of p38 in VILI. Lungs were perfused and ventilated for 30 min under control conditions before they were randomized to low (8 cm H(2)O) or high (25 cm H(2)O) pressure ventilation (HPV) for 210 min, with the left lung being removed after 180 min. In the left lung we measured the phosphorylation of p38, JNK, ERK and Akt kinase, and in the right lung gene expression and protein concentrations of Il1b, Il6, Tnf, Cxcl1, Cxcl2, and Areg. Lung mechanics and kinase activation were similar in both mouse strains. HPV increased all genes (except Tnf in BALB/c) and all mediators in both strains. The gene expression of mRNA for Il1b, Il6, Cxcl1 and Cxcl2 was higher in BALB/c mice. Backward regression of the kinase data at t = 180 min with the gene and protein expression data at t = 240 min suggested that p38 controls HPV-induced gene expression, but not protein production. This hypothesis was confirmed in experiments with the p38-kinase inhibitor SB203580. The one-lung method is useful for mechanistic studies in the lungs. While C57BL/6 show diminished pro-inflammatory responses during HPV, lung mechanics and mechanotransduction processes appear to be similar in both mouse strains. Finally, the one-lung method allowed us to link p38 to gene expression during VILI.

  11. Intratracheal instillation of single-wall carbon nanotubes in the rat lung induces time-dependent changes in gene expression

    PubMed Central

    Fujita, Katsuhide; Fukuda, Makiko; Fukui, Hiroko; Horie, Masanori; Endoh, Shigehisa; Uchida, Kunio; Shichiri, Mototada; Morimoto, Yasuo; Ogami, Akira; Iwahashi, Hitoshi


    Abstract The use of carbon nanotubes in the industry has grown; however, little is known about their toxicological mechanism of action. Single-wall carbon nanotube (SWCNT) suspensions were administered by single intratracheal instillation in rats. Persistence of alveolar macrophage-containing granuloma was observed around the sites of SWCNT aggregation at 90 days post-instillation in 0.2-mg- or 0.4-mg-injected doses per rat. Meanwhile, gene expression profiling revealed that a large number of genes involved in the inflammatory response were markedly upregulated until 90 days or 180 days post-instillation. Subsequently, gene expression patterns were dramatically altered at 365 days post-instillation, and the number of upregulated genes involved in the inflammatory response was reduced. These results suggested that alveolar macrophage-containing granuloma reflected a characteristic of the histopathological transition period from the acute-phase to the subchronic-phase of inflammation, as well as pulmonary acute phase response persistence up to 90 or 180 days after intratracheal instillation in this experimental setting. The expression levels of the genes Ctsk, Gcgr, Gpnmb, Lilrb4, Marco, Mreg, Mt3, Padi1, Slc26a4, Spp1, Tnfsf4 and Trem2 were persistently upregulated in a dose-dependent manner until 365 days post-instillation. In addition, the expression levels of Atp6v0d2, Lpo, Mmp7, Mmp12 and Rnase9 were significantly upregulated until 754 days post-instillation. We propose that these persistently upregulated genes in the chronic-phase response following the acute-phase response act as potential biomarkers in lung tissue after SWCNT instillation. This study provides further insight into the time-dependent changes in genomic expression associated with the pulmonary toxicity of SWCNTs. PMID:24911292

  12. Profiling Analysis of Histone Modifications and Gene Expression in Lewis Lung Carcinoma Murine Cells Resistant to Anti-VEGF Treatment

    PubMed Central

    Du, Yanhua; Chen, Kaiming; Liu, Zhenping; Li, Bing; Li, Jie; Tao, Fei; Gu, Hua; Jiang, Cizhong; Fang, Jianmin


    Tumor cells become resistant after long-term use of anti-VEGF (vascular endothelial growth factor) agents. Our previous study shows that treatment with a VEGF inhibitor (VEGF-Trap) facilitates to develop tumor resistance through regulating angiogenesis-related genes. However, the underlying molecular mechanisms remain elusive. Histone modifications as a key epigenetic factor play a critical role in regulation of gene expression. Here, we explore the potential epigenetic gene regulatory functions of key histone modifications during tumor resistance in a mouse Lewis lung carcinoma (LLC) cell line. We generated high resolution genome-wide maps of key histone modifications in sensitive tumor sample (LLC-NR) and resistant tumor sample (LLC-R) after VEGF-Trap treatment. Profiling analysis of histone modifications shows that histone modification levels are effectively predictive for gene expression. Composition of promoters classified by histone modification state is different between LLC-NR and LLC-R cell lines regardless of CpG content. Histone modification state change between LLC-NR and LLC-R cell lines shows different patterns in CpG-rich and CpG-poor promoters. As a consequence, genes with different level of CpG content whose gene expression level are altered are enriched in distinct functions. Notably, histone modification state change in promoters of angiogenesis-related genes consists with their expression alteration. Taken together, our findings suggest that treatment with anti-VEGF therapy results in extensive histone modification state change in promoters with multiple functions, particularly, biological processes related to angiogenesis, likely contributing to tumor resistance development. PMID:27362259

  13. Profiling Analysis of Histone Modifications and Gene Expression in Lewis Lung Carcinoma Murine Cells Resistant to Anti-VEGF Treatment.


    Li, Dong; Shi, Jiejun; Du, Yanhua; Chen, Kaiming; Liu, Zhenping; Li, Bing; Li, Jie; Tao, Fei; Gu, Hua; Jiang, Cizhong; Fang, Jianmin


    Tumor cells become resistant after long-term use of anti-VEGF (vascular endothelial growth factor) agents. Our previous study shows that treatment with a VEGF inhibitor (VEGF-Trap) facilitates to develop tumor resistance through regulating angiogenesis-related genes. However, the underlying molecular mechanisms remain elusive. Histone modifications as a key epigenetic factor play a critical role in regulation of gene expression. Here, we explore the potential epigenetic gene regulatory functions of key histone modifications during tumor resistance in a mouse Lewis lung carcinoma (LLC) cell line. We generated high resolution genome-wide maps of key histone modifications in sensitive tumor sample (LLC-NR) and resistant tumor sample (LLC-R) after VEGF-Trap treatment. Profiling analysis of histone modifications shows that histone modification levels are effectively predictive for gene expression. Composition of promoters classified by histone modification state is different between LLC-NR and LLC-R cell lines regardless of CpG content. Histone modification state change between LLC-NR and LLC-R cell lines shows different patterns in CpG-rich and CpG-poor promoters. As a consequence, genes with different level of CpG content whose gene expression level are altered are enriched in distinct functions. Notably, histone modification state change in promoters of angiogenesis-related genes consists with their expression alteration. Taken together, our findings suggest that treatment with anti-VEGF therapy results in extensive histone modification state change in promoters with multiple functions, particularly, biological processes related to angiogenesis, likely contributing to tumor resistance development.

  14. Cisplatin induces expression of drug resistance-related genes through c-jun N-terminal kinase pathway in human lung cancer cells.


    Xu, Li; Fu, Yingya; Li, Youlun; Han, Xiaoli


    Change of multidrug resistance-related genes (e.g., lung resistance protein, LRP) and overexpression of anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are responsible for cisplatin resistance. In our study, we investigated the mechanism by which cisplatin induces LRP, Bcl-2, Bcl-xL, XIAP, and Survivin expression in human lung adenocarcinoma A549 cells and human H446 small cell lung cancer cells at mRNA and protein levels. In our study, cell proliferation was assessed with CCK-8 assays, and cell apoptosis was assessed with flow cytometric analysis and Annexin-V/PI staining. qPCR was used to complete RNA experiments. Protein expression was assessed with Western blotting. Cisplatin increased Bcl-2, LRP, and Survivin expression, but decreased Bcl-xL and XIAP expression in a dose-dependent manner. Preincubation with JNK-specific inhibitor, SP600125, significantly inhibited these genes' expression at mRNA and protein levels, enhanced chemosensitivity of lung cancer cells to cisplatin, and promoted cisplatin-induced apoptosis. Our data suggest that the JNK signaling pathway plays an important role in cisplatin resistance. Lung resistance protein (LRP) and anti-apoptotic genes (Bcl-2, Bcl-Xl, XIAP, Survivin) are involved in the process. The results reminded us of a novel therapy target for lung cancer treatment.

  15. Persistent Expression Changes of Fibrosis-Related Genes in the Lung Tissues of Rats Exposed to Lunar Dust Particles

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Lam, Chiu-Wing; Scully, Robert R.; Yeshitla, Samrawit A.; Wu, Honglu; Meyers, Valerie; James, John T.


    The Moon's surface is covered by a layer of fine, potential reactive dust. Lunar dust contain about 1-2% of very fine respirable dust (less than 3 micrometers). The habitable area of any lunar landing vehicle and outpost would inevitably be contaminated with lunar dust that could pose a health risk. The purpose of the study is to evaluate the toxicity of Apollo moon dust in rodents to assess the health risk of dust exposures to humans. One of the particular interests in the study is to evaluate dust-induced changes of the expression of fibrosis-related genes, and to identify specific signaling pathways involved in lunar dustinduced toxicity. F344 rats were exposed for 4 weeks (6h/d; 5d/wk) in nose-only inhalation chambers to concentrations of 0 (control air), 2.1, 6.8, 21, and 61 milligrams per cubic meters of lunar dust. Five rats per group were euthanized at 1 day, 1 week, 1 month, and 3 months after the last inhalation exposure. The bronchoalveolar lavage fluid (BALF) was collected by lavaging with phosphate-buffered saline (PBS). A zymosan-induced luminolbased chemiluminescence assay was used to assess the activity of BAL cells. The lavaged lung tissue was snap frozen in LN2 and total RNA was isolated using the Qigen RNeasy kit. The expression of 84 fibrosisrelated genes were analyzed using the RT2 Profiler PCR Array technique. The expression of 18 genes of interest were further measured using real-time PCR technique in all the samples. 10 out of 18 genes of interest showed persistently significant expression changes in the local lung tissue exposed to lunar dust, indicating a prolonged proinflammatory response. The expressions of several of these genes were dose- and time-dependent and were significantly correlated with other pathological parameters. The potential signaling pathways and upstream regulators were further analyzed using IPA pathway analysis tool based on the gene expression data. The data presented in this study, for the first time, explore the

  16. Differential gene-expression and host-response profiles against avian influenza virus within the chicken lung due to anatomy and airflow.


    Reemers, Sylvia S; van Haarlem, Daphne A; Groot Koerkamp, Marian J; Vervelde, Lonneke


    Sampling the complete organ instead of defined parts might affect analysis at both the cellular and transcriptional levels. We defined host responses to H9N2 avian influenza virus (AIV) in trachea and different parts of the lung. Chickens were spray-inoculated with either saline or H9N2 AIV. Trachea and lung were sampled at 1 and 3 days post-inoculation (p.i.) for immunocytochemistry, real-time quantitative RT-PCR and gene-expression profiling. The trachea was divided into upper and lower parts and the lung into four segments, according to anatomy and airflow. Two segments contained the primary and secondary bronchi, cranial versus caudal (parts L1 and L3), and two segments contained the tertiary bronchi, cranial versus caudal (parts L2 and L4). Between the upper and lower trachea in both control and infected birds, minor differences in gene expression and host responses were found. In the lung of control birds, differences in anatomy were reflected in gene expression, and in the lung of infected birds, virus deposition enhanced the differences in gene expression. Differential gene expression in trachea and lung suggested common responses to a wide range of agents and site-specific responses. In trachea, site-specific responses were related to heat shock and lysozyme activity. In lung L1, which contained most virus, site-specific responses were related to genes involved in innate responses, interleukin activity and endocytosis. Our study indicates that the anatomy of the chicken lung must be taken into account when investigating in vivo responses to respiratory virus infections.

  17. [Construction of A eukaryotic expression vector carrying the iNOS gene and its effect on A549 lung cancer cells].


    Ye, Sujuan; Yang, Weihan; Wang, Yu; Ou, Wenjing; Ma, Qingping; Zhu, Wen


    The iNOS gene is associated with NO-mediated antitumor effects. The aims of this study are to construct a eukaryotic expression plasmid that carries the iNOS gene and to detect the expression levels and antitumor effects of the iNOS gene on A549 lung cancer cells. A DNA fragment of the human iNOS coding sequence was amplified using reverse transcription polymerase chain reaction (RT-PCR). The DNA fragment was subsequently cloned into the multiple cloning sites of the eukaryotic expression vector pVAX. The recombinant plasmid was confirmed using restriction enzyme treatment, PCR, and sequencing and was then transfected into A549 lung cancer cells. The expression of the iNOS gene in the A549 lung cancer cells after transfection was verified by RT-PCR and Western blot analysis. The effects of iNOS on cell apoptosis, proliferation, and migration were identified by staining with Hoechst 3235, an MTT assay, and a scratch assay, respectively. The results of the restriction enzyme digestion, PCR, and sequencing verified the successful construction of the eukaryotic expression plasmid pVAX-iNOS. The iNOS gene expression level was increased in the transfected A549 cells. Further experiments also showed increased cell apoptosis among the A549 lung cancer cells transfected with pVAX-iNOS. Meanwhile, the proliferation and migration of A549 cells were significantly inhibited by the enhanced iNOS gene expression. The recombinant eukaryotic expression vector pVAX-iNOS was successfully constructed and transfected into A549 cells. The enhanced iNOS gene expression significantly promoted cell apoptosis, whereas the proliferation and migration of A549 cells were inhibited. These findings contribute to the development of novel and effective gene therapies for lung cancer.

  18. Gene Expression of Human Lung Cancer Cell Line CL1–5 in Response to a Direct Current Electric Field

    PubMed Central

    Huang, Ching-Wen; Chen, Huai-Yi; Yen, Meng-Hua; Chen, Jeremy J. W.; Young, Tai-Horng; Cheng, Ji-Yen


    Background Electrotaxis is the movement of adherent living cells in response to a direct current (dc) electric field (EF) of physiological strength. Highly metastatic human lung cancer cells, CL1–5, exhibit directional migration and orientation under dcEFs. To understand the transcriptional response of CL1–5 cells to a dcEF, microarray analysis was performed in this study. Methodology/Principal Findings A large electric-field chip (LEFC) was designed, fabricated, and used in this study. CL1–5 cells were treated with the EF strength of 0mV/mm (the control group) and 300mV/mm (the EF-treated group) for two hours. Signaling pathways involving the genes that expressed differently between the two groups were revealed. It was shown that the EF-regulated genes highly correlated to adherens junction, telomerase RNA component gene regulation, and tight junction. Some up-regulated genes such as ACVR1B and CTTN, and some down-regulated genes such as PTEN, are known to be positively and negatively correlated to cell migration, respectively. The protein-protein interactions of adherens junction-associated EF-regulated genes suggested that platelet-derived growth factor (PDGF) receptors and ephrin receptors may participate in sensing extracellular electrical stimuli. We further observed a high percentage of significantly regulated genes which encode cell membrane proteins, suggesting that dcEF may directly influence the activity of cell membrane proteins in signal transduction. Conclusions/Significance In this study, some of the EF-regulated genes have been reported to be essential whereas others are novel for electrotaxis. Our result confirms that the regulation of gene expression is involved in the mechanism of electrotactic response. PMID:21998723

  19. Persistent Expression Changes of Fibrosis Related Genes in the Lung Tissues of Rats Exposed to Lunar Dust Particles

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Lam, Chiu-Wing; Scully, Robert R.; Theriot, Corey; Zalesak, Selina; Yeshitla, Samrawit; Williams, Kyle; Wu, Honglu; James, John T.


    The Moon's surface is covered by a layer of reactive dust, containing 1-2% of respirable fine dust (< 3 microns). The habitable area of any lunar landing vehicle would inevitably be contaminated with lunar dust that could pose a health risk. The purpose of the study is to evaluate the toxicity of Apollo moon dust in rodents through inhalation to assess the health risk of dust exposures to humans and to identify the mechanisms and potential pathways involved in lunar dust-induced toxicity. Ccl3, Ccl12, Cxcl2, Cxcl5, Itgb8, Tnf, Ldhc, Clec4e, Bmp7, and Smad6, showed persistently significant expression changes in the lung tissue. The expression of several of these genes were dose- and time- dependent, and were significantly correlated with other pathological. Our previous data showed that no pathological changes were detected in low dose groups. However, several genes, primarily produced by lung epithelial, were significantly altered persistently in response to low-dose dust exposure. The data presented in this study, for the first time, explores the molecular mechanisms of lunar dust induced toxicity, contributing not only the risk assessment for future space exploration, but also understandings of the dust-induced toxicity to humans on earth.

  20. Nippostrongylus brasiliensis: Identification of Intelectin-1 and -2 as Stat6-dependent genes expressed in lung and intestine during infection

    PubMed Central

    Voehringer, David; Stanley, Sarah A.; Cox, Jeffery S.; Completo, Gladys C.; Lowary, Todd L.; Locksley, Richard M.


    Elimination of the helminth parasite Nippostrongylus brasiliensis from infected mice is mediated by IL-4 or IL-13 and dependent on the IL-4Rα chain and the transcription factor Stat6 in non-hematopoietic cells. However, it is not clear which Stat6-dependent effector molecules mediate worm expulsion. We identified intelectin-1 and -2 as Stat6-dependent genes that are induced during infection. Intelectins can bind galactofuranose, a sugar present only in microorganisms and might therefore serve as microbial pattern element. To analyze whether constitutive expression of intelectin-1 or -2 leads to accelerated pathogen clearance, transgenic mice were generated which express high levels of these genes selectively in the lung. Infection with N. brasiliensis or Mycobacterium tuberculosis did not result in accelerated pathogen clearance in transgenic as compared to wild-type mice. Further, no significant modulation of the immune response in lung or lymph nodes was observed. Thus, under these conditions, intelectins did not enhance pathogen clearance. PMID:17420014

  1. Comparison between effects of free curcumin and curcumin loaded NIPAAm-MAA nanoparticles on telomerase and PinX1 gene expression in lung cancer cells.


    Badrzadeh, Fariba; Akbarzadeh, Abolfazl; Zarghami, Nosratollah; Yamchi, Mohammad Rahmati; Zeighamian, Vahide; Tabatabae, Fateme Sadate; Taheri, Morteza; Kafil, Hossein Samadi


    Herbal compounds such as curcumin which decrease telomerase and gene expression have been considered as beneficial tools for lung cancer treatment. In this article, we compared the effects of pure curcumin and curcumin-loaded NIPAAm-MAA nanoparticles on telomerase and PinX1 gene expression in a lung cancer cell line. A tetrazolium-based assay was used for determination of cytotoxic effects of curcumin on the Calu-6 lung cancer cell line and telomerase and pinX1 gene expression was measured with real-time PCR. MTT assay showed that Curcumin-loaded NIPAAm-MAA inhibited the growth of the Calu-6 lung cancer cell line in a time and dose-dependent manner. Our q-PCR results showed that the expression of telomerase gene was effectively reduced as the concentration of curcumin-loaded NIPAAm-MAA increased while expression of the PinX1 gene became elevated. The results showed that curcumin- loaded- NIPAAm-MAA exerted cytotoxic effects on the Calu-6 cell line through down-regulation of telomerase and stimulation of pinX1 gene expression. NIPPAm-MAA could be good carrier for such kinds of hydrophobic agent.

  2. Expression of human alpha1-antitrypsin in mice and dogs following AAV6 vector-mediated gene transfer to the lungs.


    Halbert, Christine L; Madtes, David K; Vaughan, Andrew E; Wang, Zejing; Storb, Rainer; Tapscott, Stephen J; Miller, A Dusty


    We evaluated the potential of lung-directed gene therapy for alpha1-antitrypsin (AAT) deficiency using an adeno-associated virus type 6 (AAV6) vector containing a human AAT (hAAT) complementary DNA (cDNA) delivered to the lungs of mice and dogs. The results in normal and immune-deficient mice showed that hAAT concentrations were much higher in lung fluid than in plasma, and therapeutic levels were obtained even in normal mice. However, in normal mice an immune response against the vector and/or transgene limited long-term gene expression. An AAV6 vector expressing a marker protein verified that AAV6 vectors efficiently transduced lung cells in dogs. Delivery of AAV6-hAAT resulted in low levels of hAAT in dog serum but therapeutic levels in the lung that persisted for at least 58 days to 4 months in three immunosuppressed dogs. Expression in the serum was not detectable after 45 days in one nonimmune suppressed dog. A lymphoproliferative response to AAV capsid but not to hAAT was detected even after immunosuppression. These results in mice and dogs show the feasibility of expression of therapeutic levels of AAT in the lungs after AAV vector delivery, and advocate for approaches to prevent cellular immune responses to AAV capsid proteins for persistence of gene expression in humans.

  3. Use of a Multiplex Transcript Method for Analysis of Pseudomonas aeruginosa Gene Expression Profiles in the Cystic Fibrosis Lung.


    Gifford, Alex H; Willger, Sven D; Dolben, Emily L; Moulton, Lisa A; Dorman, Dana B; Bean, Heather; Hill, Jane E; Hampton, Thomas H; Ashare, Alix; Hogan, Deborah A


    The discovery of therapies that modulate Pseudomonas aeruginosa virulence or that can eradicate chronic P. aeruginosa lung infections associated with cystic fibrosis (CF) will be advanced by an improved understanding of P. aeruginosa behavior in vivo We demonstrate the use of multiplexed Nanostring technology to monitor relative abundances of P. aeruginosa transcripts across clinical isolates, in serial samples, and for the purposes of comparing microbial physiology in vitro and in vivo The expression of 75 transcripts encoded by genes implicated in CF lung disease was measured in a variety of P. aeruginosa strains as well as RNA serial sputum samples from four P. aeruginosa-colonized subjects with CF collected over 6 months. We present data on reproducibility, the results from different methods of normalization, and demonstrate high concordance between transcript relative abundance data obtained by Nanostring or transcriptome sequencing (RNA-Seq) analysis. Furthermore, we address considerations regarding sequence variation between strains during probe design. Analysis of P. aeruginosa grown in vitro identified transcripts that correlated with the different phenotypes commonly observed in CF clinical isolates. P. aeruginosa transcript profiles in RNA from CF sputum indicated alginate production in vivo, and transcripts involved in quorum-sensing regulation were less abundant in sputum than strains grown in the laboratory. P. aeruginosa gene expression patterns from sputum clustered closely together relative to patterns for laboratory-grown cultures; in contrast, laboratory-grown P. aeruginosa showed much greater transcriptional variation with only loose clustering of strains with different phenotypes. The clustering within and between subjects was surprising in light of differences in inhaled antibiotic and respiratory symptoms, suggesting that the pathways represented by these 75 transcripts are stable in chronic CF P. aeruginosa lung infections.

  4. Use of a Multiplex Transcript Method for Analysis of Pseudomonas aeruginosa Gene Expression Profiles in the Cystic Fibrosis Lung

    PubMed Central

    Willger, Sven D.; Dolben, Emily L.; Moulton, Lisa A.; Dorman, Dana B.; Bean, Heather; Hill, Jane E.; Hampton, Thomas H.; Ashare, Alix


    The discovery of therapies that modulate Pseudomonas aeruginosa virulence or that can eradicate chronic P. aeruginosa lung infections associated with cystic fibrosis (CF) will be advanced by an improved understanding of P. aeruginosa behavior in vivo. We demonstrate the use of multiplexed Nanostring technology to monitor relative abundances of P. aeruginosa transcripts across clinical isolates, in serial samples, and for the purposes of comparing microbial physiology in vitro and in vivo. The expression of 75 transcripts encoded by genes implicated in CF lung disease was measured in a variety of P. aeruginosa strains as well as RNA serial sputum samples from four P. aeruginosa-colonized subjects with CF collected over 6 months. We present data on reproducibility, the results from different methods of normalization, and demonstrate high concordance between transcript relative abundance data obtained by Nanostring or transcriptome sequencing (RNA-Seq) analysis. Furthermore, we address considerations regarding sequence variation between strains during probe design. Analysis of P. aeruginosa grown in vitro identified transcripts that correlated with the different phenotypes commonly observed in CF clinical isolates. P. aeruginosa transcript profiles in RNA from CF sputum indicated alginate production in vivo, and transcripts involved in quorum-sensing regulation were less abundant in sputum than strains grown in the laboratory. P. aeruginosa gene expression patterns from sputum clustered closely together relative to patterns for laboratory-grown cultures; in contrast, laboratory-grown P. aeruginosa showed much greater transcriptional variation with only loose clustering of strains with different phenotypes. The clustering within and between subjects was surprising in light of differences in inhaled antibiotic and respiratory symptoms, suggesting that the pathways represented by these 75 transcripts are stable in chronic CF P. aeruginosa lung infections. PMID:27481238

  5. Functional interactors of three genome-wide association study genes are differentially expressed in severe chronic obstructive pulmonary disease lung tissue

    PubMed Central

    Morrow, Jarrett D.; Zhou, Xiaobo; Lao, Taotao; Jiang, Zhiqiang; DeMeo, Dawn L.; Cho, Michael H.; Qiu, Weiliang; Cloonan, Suzanne; Pinto-Plata, Victor; Celli, Bartholome; Marchetti, Nathaniel; Criner, Gerard J.; Bueno, Raphael; Washko, George R.; Glass, Kimberly; Quackenbush, John; Choi, Augustine M. K.; Silverman, Edwin K.; Hersh, Craig P.


    In comparison to genome-wide association studies (GWAS), there has been poor replication of gene expression studies in chronic obstructive pulmonary disease (COPD). We performed microarray gene expression profiling on a large sample of resected lung tissues from subjects with severe COPD. Comparing 111 COPD cases and 40 control smokers, 204 genes were differentially expressed; none were at significant GWAS loci. The top differentially expressed gene was HMGB1, which interacts with AGER, a known COPD GWAS gene. Differentially expressed genes showed enrichment for putative interactors of the first three identified COPD GWAS genes IREB2, HHIP, and FAM13A, based on gene sets derived from protein and RNA binding studies, RNA-interference, a murine smoking model, and expression quantitative trait locus analyses. The gene module most highly associated for COPD in Weighted Gene Co-Expression Network Analysis (WGCNA) was enriched for B cell pathways, and shared seventeen genes with a mouse smoking model and twenty genes with previous emphysema studies. As in other common diseases, genes at COPD GWAS loci were not differentially expressed; however, using a combination of network methods, experimental studies and careful phenotype definition, we found differential expression of putative interactors of these genes, and we replicated previous human and mouse microarray results. PMID:28287180

  6. DNA Repair Genes ERCC1 and BRCA1 Expression in Non-Small Cell Lung Cancer Chemotherapy Drug Resistance.


    Wang, Shuai; Liu, Feng; Zhu, Jingyan; Chen, Peng; Liu, Hongxing; Liu, Qi; Han, Junqing


    BACKGROUND Surgery combined with chemotherapy is an important therapy for non-small cell lung cancer (NSCLC). However, chemotherapy drug resistance seriously hinders the curative effect. Studies show that DNA repair genes ERCC1 and BRCA1 are associated with NSCLC chemotherapy, but their expression and mechanism in NSCLC chemotherapy drug-resistant cells has not been elucidated. MATERIAL AND METHODS NSCLC cell line A549 and drug resistance cell line A549/DDP were cultured. Real-time PCR and Western blot analyses were used to detect ERCC1 and BRCA1 mRNA expression. A549/DDP cells were randomly divided into 3 groups: the control group; the siRNA-negative control group (scramble group); and the siRNA ERCC1 and BRCA1siRNA transfection group. Real-time PCR and Western blot analyses were used to determine ERCC1 and BRCA1 mRNA and protein expression. MTT was used to detect cell proliferation activity. Caspase 3 activity was tested by use of a kit. Western blot analysis was performed to detect PI3K, AKT, phosphorylated PI3K, and phosphorylated AKT protein expression. RESULTS ERCC1 and BRCA1 were overexpressed in A549/DDP compared with A549 (P<0.05). ERCC1 and BRCA1siRNA transfection can significantly reduce ERCC1 and BRCA1 mRNA and protein expression (P<0.05). Downregulating ERCC1 and BRCA1 expression obviously inhibited cell proliferation and increased caspase 3 activity (P<0.05). Downregulating ERCC1 and BRCA1 significantly decreased PI3K and AKT phosphorylation levels (P<0.05). CONCLUSIONS ERCC1 and BRCA1 were overexpressed in NSCLC drug-resistant cells, and they regulated lung cancer occurrence and development through the phosphorylating PI3K/AKT signaling pathway.

  7. Expression of the lncRNA Maternally Expressed Gene 3 (MEG3) Contributes to the Control of Lung Cancer Cell Proliferation by the Rb Pathway

    PubMed Central

    Kruer, Traci L.; Dougherty, Susan M.; Reynolds, Lindsey; Long, Elizabeth; de Silva, Tanya; Lockwood, William W.; Clem, Brian F.


    Maternally expressed gene 3 (MEG3, mouse homolog Gtl2) encodes a long noncoding RNA (lncRNA) that is expressed in many normal tissues, but is suppressed in various cancer cell lines and tumors, suggesting it plays a functional role as a tumor suppressor. Hypermethylation has been shown to contribute to this loss of expression. We now demonstrate that MEG3 expression is regulated by the retinoblastoma protein (Rb) pathway and correlates with a change in cell proliferation. Microarray analysis of mouse embryonic fibroblasts (MEFs) isolated from mice with genetic deletion of all three Rb family members (TKO) revealed a significant silencing of Gtl2/MEG3 expression compared to WT MEFs, and re-expression of Gtl2/MEG3 caused decrease in cell proliferation and increased apoptosis. MEG3 levels also were suppressed in A549 lung cancer cells compared with normal human bronchial epithelial (NHBE) cells, and, similar to the TKO cells, re-constitution of MEG3 led to a decrease in cell proliferation and elevated apoptosis. Activation of pRb by treatment of A549 and SK-MES-1 cells with palbociclib, a CDK4/6 inhibitor, increased the expression of MEG3 in a dose-dependent manner, while knockdown of pRb/p107 attenuated this effect. In addition, expression of phosphorylation-deficient mutant of pRb increased MEG3 levels in both lung cancer cell types. Treatment of these cells with palbociclib also decreased the expression of pRb-regulated DNA methyltransferase 1 (DNMT1), while conversely, knockdown of DNMT1 resulted in increased expression of MEG3. As gene methylation has been suggested for MEG3 regulation, we found that palbociclib resulted in decreased methylation of the MEG3 locus similar to that observed with 5-aza-deoxycytidine. Anti-sense oligonucleotide silencing of drug-induced MEG3 expression in A549 and SK-MES-1 cells partially rescued the palbociclib-mediated decrease in cell proliferation, while analysis of the TCGA database revealed decreased MEG3 expression in human

  8. Expression of the lncRNA Maternally Expressed Gene 3 (MEG3) Contributes to the Control of Lung Cancer Cell Proliferation by the Rb Pathway.


    Kruer, Traci L; Dougherty, Susan M; Reynolds, Lindsey; Long, Elizabeth; de Silva, Tanya; Lockwood, William W; Clem, Brian F


    Maternally expressed gene 3 (MEG3, mouse homolog Gtl2) encodes a long noncoding RNA (lncRNA) that is expressed in many normal tissues, but is suppressed in various cancer cell lines and tumors, suggesting it plays a functional role as a tumor suppressor. Hypermethylation has been shown to contribute to this loss of expression. We now demonstrate that MEG3 expression is regulated by the retinoblastoma protein (Rb) pathway and correlates with a change in cell proliferation. Microarray analysis of mouse embryonic fibroblasts (MEFs) isolated from mice with genetic deletion of all three Rb family members (TKO) revealed a significant silencing of Gtl2/MEG3 expression compared to WT MEFs, and re-expression of Gtl2/MEG3 caused decrease in cell proliferation and increased apoptosis. MEG3 levels also were suppressed in A549 lung cancer cells compared with normal human bronchial epithelial (NHBE) cells, and, similar to the TKO cells, re-constitution of MEG3 led to a decrease in cell proliferation and elevated apoptosis. Activation of pRb by treatment of A549 and SK-MES-1 cells with palbociclib, a CDK4/6 inhibitor, increased the expression of MEG3 in a dose-dependent manner, while knockdown of pRb/p107 attenuated this effect. In addition, expression of phosphorylation-deficient mutant of pRb increased MEG3 levels in both lung cancer cell types. Treatment of these cells with palbociclib also decreased the expression of pRb-regulated DNA methyltransferase 1 (DNMT1), while conversely, knockdown of DNMT1 resulted in increased expression of MEG3. As gene methylation has been suggested for MEG3 regulation, we found that palbociclib resulted in decreased methylation of the MEG3 locus similar to that observed with 5-aza-deoxycytidine. Anti-sense oligonucleotide silencing of drug-induced MEG3 expression in A549 and SK-MES-1 cells partially rescued the palbociclib-mediated decrease in cell proliferation, while analysis of the TCGA database revealed decreased MEG3 expression in human

  9. TGF-β suppresses the expression of genes related to mitochondrial function in lung A549 cells.


    Sohn, E J; Kim, J; Hwang, Y; Im, S; Moon, Y; Kang, D M


    TGF-β is a mediator of lung fibrosis and regulates the alveolar epithelial type II cell phenotype. TGF-β can induce epithelial mesenchymal transition of idiopathic pulmonary disease and cancer metastasis. Peroxisome proliferator-activated receptor gamma co-activator 1-alpha (PGC-1 α) is a key metabolic regulator that stimulates mitochondrial biogenesis and promotes remodeling of muscle tissue to oxidative fiber-type composition. Here, we report that the induction of TGF-β decreased mRNA expression of PGC-1α, and PGC-1 target genes, such as the transcription factors NRF-2, ERR-α, and PPAR-γ in lung epithelial A549 cells. In addition, TGF-β led to the reduction of super oxide dismutase 2 (anti-oxidant enzyme), cytochrome C (electron transport chain in mitochondria), and MCAD (a mitochondrial β-oxidant enzyme) in A549 cells. Together, our results suggest that TGF-β may suppress the transcriptional activity of the genes related to mitochondrial biogenesis or function. This mechanism may provide a novel insight into the understanding of fibrosis disease.

  10. Modulation of MDR1 and MRP3 Gene Expression in Lung Cancer Cells after Paclitaxel and Carboplatin Exposure

    PubMed Central

    Melguizo, Consolación; Prados, Jose; Luque, Raquel; Ortiz, Raúl; Caba, Octavio; Álvarez, Pablo J.; Gonzalez, Beatriz; Aranega, Antonia


    Carboplatin-paclitaxel is a reference regimen in the treatment of locally advanced or disseminated non-small cell lung cancer (NSCLC). This paper discusses the multidrug resistance developed with this drug combination, which is one of the major obstacles to successful treatment. In order to understand and overcome the drug resistance pattern of NSCLC after carboplatin plus paclitaxel exposure, levels of mRNA expression of multidrug resistance 1 (MDR1) and multidrug resistance-associated protein 3 (MRP3) were investigated in primary NSCLC cell lines (A-549 and A-427) and a metastasis-derived NSCLC cell line (NODO). Our results showed that exposure of the three NSCLC lines to plasma concentrations of paclitaxel (5 μM) produced an increase in MDR1 expression, while MRP3 showed no alteration in expression. By contrast, the same cells exposed to carboplatin plasma concentrations (30 μM) showed overexpression of MRP3. In these cells, MDR1 showed no expression changes. Interestingly, the combination of both paclitaxel and carboplatin caused increased expression of the MDR1 drug resistance gene rather than the individual treatments. These results suggest that carboplatin and paclitaxel may induce drug resistance mediated by MDR1 and MRP3, which may be enhanced by the simultaneous use of both drugs. PMID:23443122

  11. Modulation of MDR1 and MRP3 gene expression in lung cancer cells after paclitaxel and carboplatin exposure.


    Melguizo, Consolación; Prados, Jose; Luque, Raquel; Ortiz, Raúl; Caba, Octavio; Alvarez, Pablo J; Gonzalez, Beatriz; Aranega, Antonia


    Carboplatin-paclitaxel is a reference regimen in the treatment of locally advanced or disseminated non-small cell lung cancer (NSCLC). This paper discusses the multidrug resistance developed with this drug combination, which is one of the major obstacles to successful treatment. In order to understand and overcome the drug resistance pattern of NSCLC after carboplatin plus paclitaxel exposure, levels of mRNA expression of multidrug resistance 1 (MDR1) and multidrug resistance-associated protein 3 (MRP3) were investigated in primary NSCLC cell lines (A-549 and A-427) and a metastasis-derived NSCLC cell line (NODO). Our results showed that exposure of the three NSCLC lines to plasma concentrations of paclitaxel (5 μM) produced an increase in MDR1 expression, while MRP3 showed no alteration in expression. By contrast, the same cells exposed to carboplatin plasma concentrations (30 μM) showed overexpression of MRP3. In these cells, MDR1 showed no expression changes. Interestingly, the combination of both paclitaxel and carboplatin caused increased expression of the MDR1 drug resistance gene rather than the individual treatments. These results suggest that carboplatin and paclitaxel may induce drug resistance mediated by MDR1 and MRP3, which may be enhanced by the simultaneous use of both drugs.

  12. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    SciTech Connect

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.


    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins.

  13. Oxidative stress and altered expression of peroxiredoxin genes family (PRDXS) and sulfiredoxin-1 (SRXN1) in human lung tissue following exposure to sulfur mustard.


    Tahmasbpour Marzony, Eisa; Ghanei, Mostafa; Panahi, Yunes


    Sulfur mustard (SM) is a potent and mutagenic agent that targets human lung tissue. The purpose of this investigation is to characterize the expression of sulfiredoxin-1 (SRXN1) and peroxiredoxin (PRDXs) genes and oxidative stress (OS) status in human lung after exposure to SM. Lung biopsy specimens bronchoalveolar lavage (BAL) fluids were provided from SM-exposed patients (n = 6) and controls (n = 5). Changes in gene expression were measured using RT(2) Profiler PCR Array. OS was considered by measuring BAL fluid levels of malondialdehyde (MDA) and protein carbonyls (PC). Mean of MDA and PC values in BAL fluid of patients (0.6467 ± 0.05922 nmol/l and 1.391 ± 0.421 nmol/mg, respectively) was higher than in controls (0.486 ± 0.04615 nmol/l and 0.949 ± 0.149 nmol/mg, respectively). Expression of all examined genes was in the order PRDX1> PRDX3> PRDX6> SRXN1> PRDX2> PRDX4> PRDX5. Among the most upregulated genes was the PRDX1, which was overexpressed by 10.1029-fold (p = 0.000634). SM-exposed individuals demonstrated expression of PRDX3 4.6231 (p = 0.000134), PRDX6 3.4964 (p = 0.001102), SRXN1 3.3719 (p < 0.0001) and PRDX2 2.7725-folds (p = 0.000383) higher than those of controls that reveal. Upregulation of PRDXs and SRXN1 genes may be because of reactive oxygen species (ROS) production and OS in lung tissue of patients after SM exposure. Expression of SRXN1 and PRDXNs genes, especially I, II, III, and VI is increased in SM-injured lungs, suggesting the induction of cellular responses to increased production of ROS and OS in lung of the patients. Therefore, sulfiredoxin and peroxiredoxins can be targeted as biomarkers of OS in these patients.

  14. Genome-wide analysis of the mouse lung transcriptome reveals novel molecular gene interaction networks and cell-specific expression signatures.


    Alberts, Rudi; Lu, Lu; Williams, Robert W; Schughart, Klaus


    The lung is critical in surveillance and initial defense against pathogens. In humans, as in mice, individual genetic differences strongly modulate pulmonary responses to infectious agents, severity of lung disease, and potential allergic reactions. In a first step towards understanding genetic predisposition and pulmonary molecular networks that underlie individual differences in disease vulnerability, we performed a global analysis of normative lung gene expression levels in inbred mouse strains and a large family of BXD strains that are widely used for systems genetics. Our goal is to provide a key community resource on the genetics of the normative lung transcriptome that can serve as a foundation for experimental analysis and allow predicting genetic predisposition and response to pathogens, allergens, and xenobiotics. Steady-state polyA+ mRNA levels were assayed across a diverse and fully genotyped panel of 57 isogenic strains using the Affymetrix M430 2.0 array. Correlations of expression levels between genes were determined. Global expression QTL (eQTL) analysis and network covariance analysis was performed using tools and resources in GeneNetwork Expression values were highly variable across strains and in many cases exhibited a high heritability factor. Several genes which showed a restricted expression to lung tissue were identified. Using correlations between gene expression values across all strains, we defined and extended memberships of several important molecular networks in the lung. Furthermore, we were able to extract signatures of immune cell subpopulations and characterize co-variation and shared genetic modulation. Known QTL regions for respiratory infection susceptibility were investigated and several cis-eQTL genes were identified. Numerous cis- and trans-regulated transcripts and chromosomal intervals with strong regulatory activity were mapped. The Cyp1a1 P450 transcript had a strong trans-acting eQTL (LOD 11

  15. Expression of the candidate tumor suppressor gene hSRBC is frequently lost in primary lung cancers with and without DNA methylation.


    Zöchbauer-Müller, Sabine; Fong, Kwun M; Geradts, Joseph; Xu, Xie; Seidl, Sonja; End-Pfützenreuter, Adelheid; Lang, György; Heller, Gerwin; Zielinski, Christoph C; Gazdar, Adi F; Minna, John D


    Recently, the human SRBC (hSRBC) gene, a candidate tumor suppressor gene (TSG), has been mapped to the chromosomal region 11p 15.5--p15.4 where frequent allele loss has been described in lung cancer. Aberrant methylation (referred to as methylation) of the promoter region of TSGs has been identified as an important mechanism for gene silencing. Loss of hSRBC protein expression occurs frequently in lung cancer cell lines and sodium bisulfite sequencing of the promoter region of hSRBC in several lung cancer cell lines suggested that methylation plays an important role in inactivating hSRBC. To determine the methylation status of hSRBC in a large collection of primary lung cancer samples, corresponding nonmalignant lung tissues and lung cancer cell lines (N=52), we designed primers for a methylation-specific PCR assay. Methylation was detected in 41% of primary non-small-cell lung cancers (NSCLC) (N=107) and in 80% of primary small-cell lung cancers (SCLC) (N=5), but was seen only in 4% of corresponding nonmalignant lung tissues (N=103). In all, 79% of lung cancer cell lines were methylated and the frequency of hSRBC methylation was significantly higher in SCLC (100%) than in NSCLC (58%) cell lines. Normal hSRBC protein expression was detected in only 18% of primary NSCLCs (N=93) by immunostaining and a significant association between loss of protein expression and methylation was found. hSRBC re-expression was observed after treatment of lung cancer cells with the demethylating agent 5-aza-2'-deoxycytidine. In addition, 45% of the 76 hSRBC immunostaining-negative NSCLCs did not have hSRBC promoter methylation, indicating that other mechanisms of hSRBC expression silencing also exist. Both hSRBC immunostaining and methylation results did not correlate with clinicopathological characteristics of these patients. Our findings suggest that hSRBC is a candidate TSG involved in lung cancer pathogenesis, where expression is frequently inactivated by methylation and other

  16. Altered expression of G1/S regulatory genes occurs early and frequently in lung carcinogenesis in transforming growth factor-beta1 heterozygous mice.


    Kang, Yang; Ozbun, Laurent L; Angdisen, Jerry; Moody, Terry W; Prentice, Margaret; Diwan, Bhalchandra A; Jakowlew, Sonia B


    We developed the AJBL6 transforming growth factor-beta 1 (TGF-beta1) heterozygous (HT) mouse by mating A/J mice with C57BL/6 TGF-beta1 HT mice that shows increased carcinogen-induced lung lesions with decreased latency to examine progressive events in lung tumorigenesis. Mouse cDNA macroarrays were used to identify cell cycle genes that are differentially regulated in ethyl carbamate-induced lung adenocarcinomas compared with normal lung tissue in AJBL6 TGF-beta1 HT mice using probes that were generated from tissues isolated using laser capture microdissection. While expression of the genes for cyclin D1, CDK4, and E2F1 increased in lung adenocarcinomas relative to normal lung, expression of p15(Ink4b), p16(Ink4a), p21(Cip1), p27(Kip1), p57(Kip2), and pRb genes decreased in comparison. Competitive RT-PCR showed that the levels of cyclin D1 and CDK4 mRNAs were 2- and 3-fold higher, respectively, in lung adenocarcinomas than in normal lung, while the mRNAs for p15(Ink4b), p16(Ink4a), p21(Cip1), p27(Kip1), and pRb were 3- to 4-fold lower in adenocarcinomas than in normal lung, thus validating the macroarray findings. Competitive RT-PCR of microdissected lesions also showed that the levels of cyclin D1 and CDK4 mRNAs increased significantly, while the mRNAs for p15(Ink4b) and p27(Kip1) decreased significantly as lung tumorigenesis progressed. Immunohistochemical staining for cyclin D1 and CDK4 showed staining in >80% of nuclei in adenocarcinomas compared with fewer than 20% of nuclei staining positively in normal lung. In contrast, while >60% of normal lung cells showed immunostaining for p15(Ink4b), p16(Ink4a), p21(Cip1), p27(Kip1), and pRb, staining for these proteins decreased in hyperplasias, adenomas, and adenocarcinomas. These data show that multiple components of the cyclin D1/CDK4/p16(Ink4a)/pRb signaling pathway are frequently altered early in lung lesions of AJBL6 TGF-beta1 HT mice that are induced by ethyl carbamate as a function of progressive lung

  17. Demethoxycurcumin alters gene expression associated with DNA damage, cell cycle and apoptosis in human lung cancer NCI-H460 cells in vitro.


    Ko, Yang-Ching; Hsu, Shu-Chun; Liu, Hsin-Chung; Hsiao, Yung-Ting; Hsia, Te-Chun; Yang, Su-Tso; Hsu, Wu-Huei; Chung, Jing-Gung


    Lung cancer is the leading cause of cancer-related deaths and new lung cancer cases are continuously emerging around the globe; however, treatment of lung cancer remains unsatisfactory. Demethoxycurcumin (DMC) has been shown to exert cytotoxic effects in human cancer cells via induction of apoptosis. However, the effects of DMC on genetic mechanisms associated with these actions have not been yet elucidated. Human lung cancer NCI-H460 cells were incubated with or without 35 μM of DMC for 24 h and total RNA was extracted for cDNA synthesis labeling and microarray hybridization, followed by fluor-labeled cDNA hybridization on chip. Expression Console software with default Robust Multichip Analysis (RMA) parameters were used for detecting and quantitating the localized concentrations of fluorescent molecules. The GeneGo software was used for investigating key genes involved and their possible interaction pathways. Genes associated with DNA damage and repair, cell-cycle check point and apoptosis could be altered by DMC; in particular, 144 genes were found up-regulated and 179 genes down-regulated in NCI-H460 cells after exposure to DMC. In general, DMC-altered genes may offer information to understand the cytotoxic mechanism of this agent at the genetic level since gene alterations can be useful biomarkers or targets for the diagnosis and treatment of human lung cancer in the future.

  18. Shared gene expression patterns in mesenchymal progenitors derived from lung and epidermis in pulmonary arterial hypertension: identifying key pathways in pulmonary vascular disease

    PubMed Central

    Gaskill, Christa; Marriott, Shennea; Pratap, Sidd; Menon, Swapna; Hedges, Lora K.; Fessel, Joshua P.; Kropski, Jonathan A.; Ames, DeWayne; Wheeler, Lisa; Loyd, James E.; Hemnes, Anna R.; Roop, Dennis R.; Klemm, Dwight J.; Austin, Eric D.


    Abstract Rapid access to lung-derived cells from stable subjects is a major challenge in the pulmonary hypertension field, given the relative contraindication of lung biopsy. In these studies, we sought to demonstrate the importance of evaluating a cell type that actively participates in disease processes, as well as the potential to translate these findings to vascular beds in other nonlung tissues, in this instance perivascular skin mesenchymal cells (MCs). We utilized posttransplant or autopsy lung explant–derived cells (ABCG2-expressing mesenchymal progenitor cells [MPCs], fibroblasts) and skin-derived MCs to test the hypothesis that perivascular ABCG2 MPCs derived from pulmonary arterial hypertension (PAH) patient lung and skin would express a gene profile reflective of ongoing vascular dysfunction. By analyzing the genetic signatures and pathways associated with abnormal ABCG2 lung MPC phenotypes during PAH and evaluating them in lung- and skin-derived MCs, we have identified potential predictor genes for detection of PAH as well as a targetable mechanism to restore MPCs and microvascular function. These studies are the first to explore the utility of expanding the study of ABCG2 MPC regulation of the pulmonary microvasculature to the epidermis, in order to identify potential markers for adult lung vascular disease, such as PAH. PMID:28090290

  19. Shared gene expression patterns in mesenchymal progenitors derived from lung and epidermis in pulmonary arterial hypertension: identifying key pathways in pulmonary vascular disease.


    Gaskill, Christa; Marriott, Shennea; Pratap, Sidd; Menon, Swapna; Hedges, Lora K; Fessel, Joshua P; Kropski, Jonathan A; Ames, DeWayne; Wheeler, Lisa; Loyd, James E; Hemnes, Anna R; Roop, Dennis R; Klemm, Dwight J; Austin, Eric D; Majka, Susan M


    Rapid access to lung-derived cells from stable subjects is a major challenge in the pulmonary hypertension field, given the relative contraindication of lung biopsy. In these studies, we sought to demonstrate the importance of evaluating a cell type that actively participates in disease processes, as well as the potential to translate these findings to vascular beds in other nonlung tissues, in this instance perivascular skin mesenchymal cells (MCs). We utilized posttransplant or autopsy lung explant-derived cells (ABCG2-expressing mesenchymal progenitor cells [MPCs], fibroblasts) and skin-derived MCs to test the hypothesis that perivascular ABCG2 MPCs derived from pulmonary arterial hypertension (PAH) patient lung and skin would express a gene profile reflective of ongoing vascular dysfunction. By analyzing the genetic signatures and pathways associated with abnormal ABCG2 lung MPC phenotypes during PAH and evaluating them in lung- and skin-derived MCs, we have identified potential predictor genes for detection of PAH as well as a targetable mechanism to restore MPCs and microvascular function. These studies are the first to explore the utility of expanding the study of ABCG2 MPC regulation of the pulmonary microvasculature to the epidermis, in order to identify potential markers for adult lung vascular disease, such as PAH.

  20. FGFR1 mRNA and protein expression, not gene copy number, predict FGFR TKI sensitivity across all lung cancer histologies.


    Wynes, Murry W; Hinz, Trista K; Gao, Dexiang; Martini, Michael; Marek, Lindsay A; Ware, Kathryn E; Edwards, Michael G; Böhm, Diana; Perner, Sven; Helfrich, Barbara A; Dziadziuszko, Rafal; Jassem, Jacek; Wojtylak, Szymon; Sejda, Aleksandra; Gozgit, Joseph M; Bunn, Paul A; Camidge, D Ross; Tan, Aik-Choon; Hirsch, Fred R; Heasley, Lynn E


    FGFR1 gene copy number (GCN) is being evaluated as a biomarker for FGFR tyrosine kinase inhibitor (TKI) response in squamous cell lung cancers (SCC). The exclusive use of FGFR1 GCN for predicting FGFR TKI sensitivity assumes increased GCN is the only mechanism for biologically relevant increases in FGFR1 signaling. Herein, we tested whether FGFR1 mRNA and protein expression may serve as better biomarkers of FGFR TKI sensitivity in lung cancer. Histologically diverse lung cancer cell lines were submitted to assays for ponatinib sensitivity, a potent FGFR TKI. A tissue microarray composed of resected lung tumors was submitted to FGFR1 GCN, and mRNA analyses and the results were validated with The Cancer Genome Atlas (TCGA) lung cancer data. Among 58 cell lines, 14 exhibited ponatinib sensitivity (IC50 values ≤ 50 nmol/L) that correlated with FGFR1 mRNA and protein expression, but not with FGFR1 GCN or histology. Moreover, ponatinib sensitivity associated with mRNA expression of the ligands, FGF2 and FGF9. In resected tumors, 22% of adenocarcinomas and 28% of SCCs expressed high FGFR1 mRNA. Importantly, only 46% of SCCs with increased FGFR1 GCN expressed high mRNA. Lung cancer TCGA data validated these findings and unveiled overlap of FGFR1 mRNA positivity with KRAS and PIK3CA mutations. FGFR1 dependency is frequent across various lung cancer histologies, and FGFR1 mRNA may serve as a better biomarker of FGFR TKI response in lung cancer than FGFR1 GCN. The study provides important and timely insight into clinical testing of FGFR TKIs in lung cancer and other solid tumor types. ©2014 American Association for Cancer Research.

  1. Effect of re-expansion after short-period lung collapse on pulmonary capillary permeability and pro-inflammatory cytokine gene expression in isolated rabbit lungs.


    Funakoshi, T; Ishibe, Y; Okazaki, N; Miura, K; Liu, R; Nagai, S; Minami, Y


    Re-expansion pulmonary oedema is a rare complication caused by rapid re-expansion of a chronically collapsed lung. Several cases of pulmonary oedema associated with one-lung ventilation (OLV) have been reported recently. Elevated levels of pro-inflammatory cytokines in pulmonary oedema fluid are suggested to play important roles in its development. Activation of cytokines after re-expansion of collapsed lung during OLV has not been thoroughly investigated. Here we investigated the effects of re-expansion of the collapsed lung on pulmonary oedema formation and pro-inflammatory cytokine expression. Lungs isolated from female white Japanese rabbits were perfused and divided into a basal (BAS) group (n=7, baseline measurement alone), a control (CONT) group (n=9, ventilated without lung collapse for 120 min) and an atelectasis (ATEL) group (n=9, lung collapsed for 55 min followed by re-expansion and ventilation for 65 min). Pulmonary vascular resistance (PVR) and the coefficient of filtration (Kfc) were measured at baseline and 60 and 120 min. At the end of perfusion, bronchoalveolar lavage fluid/plasma protein ratio (B/P), wet/dry lung weight ratio (W/D) and mRNA expressions of tumour necrosis factor (TNF)-alpha, interleukin (IL)-1beta and myeloperoxidase (MPO) were determined. TNF-alpha and IL-1beta mRNA were significantly up-regulated in lungs of the ATEL group compared with BAS and CONT, though no significant differences were noted in PVR, Kfc, B/P and W/D within and between groups. MPO increased at 120 min in CONT and ATEL groups. Pro-inflammatory cytokines were up-regulated upon re-expansion and ventilation after short-period lung collapse, though no changes were noted in pulmonary capillary permeability.

  2. Wnt signaling induces gene expression of factors associated with bone destruction in lung and breast cancer

    PubMed Central

    Johnson, Rachelle W.; Merkel, Alyssa R.; Page, Jonathan M.; Ruppender, Nazanin S.; Guelcher, Scott A.; Sterling, Julie A.


    Parathyroid hormone-related protein (PTHrP) is an important regulator of bone destruction in bone metastatic tumors. Transforming growth factor-beta (TGF-β) stimulates PTHrP production in part through the transcription factor Gli2, which is regulated independent of the Hedgehog signaling pathway in osteolytic cancer cells. However, inhibition of TGF-β in vivo does not fully inhibit tumor growth in bone or tumor-induced bone destruction, suggesting other pathways are involved. While Wnt signaling regulates Gli2 in development, the role of Wnt signaling in bone metastasis is unknown. Therefore, we investigated whether Wnt signaling regulates Gli2 expression in tumor cells that induce bone destruction. We report here that Wnt activation by β-catenin/T-cell factor 4 (TCF4) over-expression or lithium chloride (LiCl) treatment increased Gli2 and PTHrP expression in osteolytic cancer cells. This was mediated through the TCF and Smad binding sites within the Gli2 promoter as determined by promoter mutation studies, suggesting cross-talk between TGF-β and Wnt signaling. Culture of tumor cells on substrates with bone-like rigidity increased Gli2 and PTHrP production, enhanced autocrine Wnt activity and led to an increase in the TCF/Wnt signaling reporter (TOPFlash), enriched β-catenin nuclear accumulation, and elevated Wnt-related genes by PCR-array. Stromal cells serve as an additional paracrine source of Wnt ligands and enhanced Gli2 and PTHrP mRNA levels in MDA-MB-231 and RWGT2 cells in vitro and promoted tumor-induced bone destruction in vivo in a β-catenin/Wnt3a-dependent mechanism. These data indicate that a combination of matrix rigidity and stromal-secreted factors stimulate Gli2 and PTHrP through Wnt signaling in osteolytic breast cancer cells, and there is significant cross-talk between the Wnt and TGF-β signaling pathways. This suggests that the Wnt signaling pathway may be a potential therapeutic target for inhibiting tumor cell response to the bone

  3. Global gene expression changes in human embryonic lung fibroblasts induced by organic extracts from respirable air particles

    PubMed Central


    Background Recently, we used cell-free assays to demonstrate the toxic effects of complex mixtures of organic extracts from urban air particles (PM2.5) collected in four localities of the Czech Republic (Ostrava-Bartovice, Ostrava-Poruba, Karvina and Trebon) which differed in the extent and sources of air pollution. To obtain further insight into the biological mechanisms of action of the extractable organic matter (EOM) from ambient air particles, human embryonic lung fibroblasts (HEL12469) were treated with the same four EOMs to assess changes in the genome-wide expression profiles compared to DMSO treated controls. Method For this purpose, HEL cells were incubated with subtoxic EOM concentrations of 10, 30, and 60 μg EOM/ml for 24 hours and global gene expression changes were analyzed using human whole genome microarrays (Illumina). The expression of selected genes was verified by quantitative real-time PCR. Results Dose-dependent increases in the number of significantly deregulated transcripts as well as dose-response relationships in the levels of individual transcripts were observed. The transcriptomic data did not differ substantially between the localities, suggesting that the air pollution originating mainly from various sources may have similar biological effects. This was further confirmed by the analysis of deregulated pathways and by identification of the most contributing gene modulations. The number of significantly deregulated KEGG pathways, as identified by Goeman's global test, varied, depending on the locality, between 12 to 29. The Metabolism of xenobiotics by cytochrome P450 exhibited the strongest upregulation in all 4 localities and CYP1B1 had a major contribution to the upregulation of this pathway. Other important deregulated pathways in all 4 localities were ABC transporters (involved in the translocation of exogenous and endogenous metabolites across membranes and DNA repair), the Wnt and TGF-β signaling pathways (associated

  4. A Temporal Study of Gene Expression in Rat Lung Following Fixed-volume Hemorrhage

    DTIC Science & Technology


    2000. 2. Abraham E, Bursten S, Shenkar R, Allbee J, Tuder R, Woodson P, Guidot DM, Rice G, Singer JW, and Repine JE. Phosphatidic acid signaling...other immune cells. Other recent research has focused on free radicals, proteinases, and soluble agents in- cluding cytokines, arachidonic acid ...electrophoresis. A reference preparation consisting of equal amounts of RNA pooled from nine organs (liver, lung, kidney, spleen, heart, skeletal muscle

  5. [Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells].


    Yu, Yong; Shi, Min-Hua; Xu, Xun; Zhang, Zeng-Li; Hu, Hua-Cheng


    To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells. PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy. The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference. Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

  6. Expression of urokinase-type plasminogen activator, stromelysin 1, stromelysin 3, and matrilysin genes in lung carcinomas.

    PubMed Central

    Bolon, I.; Devouassoux, M.; Robert, C.; Moro, D.; Brambilla, C.; Brambilla, E.


    We have previously shown that the extracellular-matrix-degrading enzymes, urokinase-type plasminogen activator (u-PA), stromelysin 1, stromelysin 3, and matrilysin, may play an important role in the transition from lung preneoplasia to invasive carcinoma. Using in situ hybridization and immunohistochemistry, we analyzed serial frozen sections for the expression of these enzymes in 89 lung carcinomas including 25 neuroendocrine (NE) carcinomas (10 small-cell lung carcinomas, 7 large-cell NE carcinomas, 1 atypical, and 7 typical carcinoids) and 64 non-small-cell, non-NE carcinomas (29 squamous and 7 basaloid carcinomas, 23 adenocarcinomas, and 5 large-cell carcinomas). Proteases, except matrilysin, were more often expressed in stromal than cancer cells. In non-small-cell, non-NE carcinomas, stromal co-expression of u-PA and stromelysin 3 was seen in 80 to 90% of the tumors and was highly correlated (P < 0.0001). Stromal u-PA and stromelysin 3 expression was linked to tumor size (P = 0.01 and 0.03, respectively) and lymph node involvement (P = 0.001 and 0.02, respectively). Epithelial expression of u-PA was correlated to tumor size (P = 0.04). Epithelial expression of stromelysin 3 predominated in squamous and basaloid carcinomas (P = 0.0005) and was inversely correlated to squamous differentiation (P = 0.018). Epithelial expression of matrilysin predominated in adenocarcinomas and large-cell carcinomas (P = 0.07). In NE carcinomas including small-cell lung carcinomas, stromal expression of u-PA was correlated to lymph node metastasis (P = 0.017). Epithelial expression of all enzymes were significantly less frequent in NE than in non-NE tumors. We conclude that 1) epithelial expression of matrix proteases in lung cancer is linked to cell phenotype (NE versus non-NE, squamous versus glandular) and 2) their stromal, rather than epithelial, expression influences local metastasis. Images Figure 1 PMID:9137088

  7. Expression Levels of Some Antioxidant and Epidermal Growth Factor Receptor Genes in Patients with Early-Stage Non-Small Cell Lung Cancer

    PubMed Central

    De Palma, Giuseppe; Mozzoni, Paola; Acampa, Olga; Internullo, Eveline; Carbognani, Paolo; Rusca, Michele; Goldoni, Matteo; Corradi, Massimo; Tiseo, Marcello; Apostoli, Pietro; Mutti, Antonio


    This study was aimed at: (i) investigating the expression profiles of some antioxidant and epidermal growth factor receptor genes in cancerous and unaffected tissues of patients undergoing lung resection for non-small cell lung cancer (NSCLC) (cross-sectional phase), (ii) evaluating if gene expression levels at the time of surgery may be associated to patients' survival (prospective phase). Antioxidant genes included heme oxygenase 1 (HO-1), superoxide dismutase-1 (SOD-1), and -2 (SOD-2), whereas epidermal growth factor receptor genes consisted of epidermal growth factor receptor (EGFR) and v-erb-b2 erythroblastic leukaemia viral oncogene homolog 2 (HER-2). Twenty-eight couples of lung biopsies were obtained and gene transcripts were quantified by Real Time RT-PCR. The average follow-up of patients lasted about 60 months. In the cancerous tissues, antioxidant genes were significantly hypo-expressed than in unaffected tissues. The HER-2 transcript levels prevailed in adenocarcinomas, whereas EGFR in squamocellular carcinomas. Patients overexpressing HER-2 in the cancerous tissues showed significantly lower 5-year survival than the others. PMID:20700416

  8. Xeroderma pigmentosum group C gene expression is predominantly regulated by promoter hypermethylation and contributes to p53 mutation in lung cancers.


    Wu, Y-H; Tsai Chang, J-H; Cheng, Y-W; Wu, T-C; Chen, C-Y; Lee, H


    Reduced DNA repair capability is associated with developing lung cancer, especially in nonsmokers. XPC participates in the initial recognition of DNA damage during the DNA nucleotide excision repair process. We hypothesize that inactivation of XPC by promoter hypermethylation may play an important role in the reduction of DNA repair capability to cause p53 mutation during lung carcinogenesis. In this report we demonstrate that hypermethylation of 17 CpG islands between -175 and -1 of the XPC promoter correlates very well with XPC expression levels in eight lung cancer cell lines. When cells with hypermethylated XPC promoters were treated with the demethylating agent 5-aza-2'-deoxycytidine, XPC expression was de-repressed. Interestingly, XPC hypermethylation was found in 4 of 5 (80%) lung cancer cell lines harbored p53 mutation, but not observed in two lung cancer cells which had a wild-type p53 gene. Among the analysis of the hypermethylation status of 158 lung tumors, XPC hypermethylation is more common in nonsmokers (39 of 94, 41%) than in smokers (14 of 64, 22%; P=0.010). Additionally, XPC hypermethylation is more often with G --> T or G --> C mutations in the p53 gene. To verify whether XPC inactivation is involved in the occurrence of p53 mutation, XPC gene of A549 cells was knockdown by a small interference RNA and then XPC-inactivated cells were treated with benzo[a]pynrene for different passages. Surprisingly, G --> T mutation in p53 gene at codon 215 was indeed detected in XPC-inactivated A549 cells of passages 15 and confirmed by loss of transcription activity of mdm2. These results show that hypermethylation of the XPC promoter may play a crucial role in XPC inactivation, which may partly contribute to the occurrence of p53 mutations during lung tumorigenesis, especially nonsmokers.

  9. Network-based differential gene expression analysis suggests cell cycle related genes regulated by E2F1 underlie the molecular difference between smoker and non-smoker lung adenocarcinoma

    PubMed Central


    Background Differential gene expression (DGE) analysis is commonly used to reveal the deregulated molecular mechanisms of complex diseases. However, traditional DGE analysis (e.g., the t test or the rank sum test) tests each gene independently without considering interactions between them. Top-ranked differentially regulated genes prioritized by the analysis may not directly relate to the coherent molecular changes underlying complex diseases. Joint analyses of co-expression and DGE have been applied to reveal the deregulated molecular modules underlying complex diseases. Most of these methods consist of separate steps: first to identify gene-gene relationships under the studied phenotype then to integrate them with gene expression changes for prioritizing signature genes, or vice versa. It is warrant a method that can simultaneously consider gene-gene co-expression strength and corresponding expression level changes so that both types of information can be leveraged optimally. Results In this paper, we develop a gene module based method for differential gene expression analysis, named network-based differential gene expression (nDGE) analysis, a one-step integrative process for prioritizing deregulated genes and grouping them into gene modules. We demonstrate that nDGE outperforms existing methods in prioritizing deregulated genes and discovering deregulated gene modules using simulated data sets. When tested on a series of smoker and non-smoker lung adenocarcinoma data sets, we show that top differentially regulated genes identified by the rank sum test in different sets are not consistent while top ranked genes defined by nDGE in different data sets significantly overlap. nDGE results suggest that a differentially regulated gene module, which is enriched for cell cycle related genes and E2F1 targeted genes, plays a role in the molecular differences between smoker and non-smoker lung adenocarcinoma. Conclusions In this paper, we develop nDGE to prioritize

  10. Modulation of multidrug resistance gene expression in peripheral blood mononuclear cells of lung cancer patients and evaluation of their clinical significance.


    Melguizo, Consolación; Prados, Jose; Luque, Raquel; Ortiz, Raúl; Rama, Ana R; Caba, Octavio; Rodríguez-Serrano, Fernando; Álvarez, Pablo J; Aránega, Antonia


    Multidrug resistance is one of the major obstacles to the successful treatment of non-small cell lung cancer (NSCLC). An ability to identify molecular markers of drug resistance in peripheral blood cells in order to better target treatment would therefore be extremely useful in selecting therapy protocols for patients. The aim of the present study was to evaluate whether expression of resistance genes (MDR1, MRP3 and LRP) can predict clinical outcome in NSCLC patients treated with paclitaxel and carboplatin. Peripheral blood samples were obtained from lung cancer patients before and after chemotherapy and expression of the resistance gene in polymononuclear cells was detected by real-time reverse-transcription polymerase chain reaction. The results were correlated with treatment response and overall survival, which was calculated according to the Kaplan-Meier method. MDR1 expression levels in PMNs rose rapidly within 24 h post-administration of paclitaxel and carboplatin, whereas MRP and LRP expression levels remained unchanged. However, no significant correlation was observed between MDR1 expression and the patients' survival or treatment response. Modulation of MDR1 gene expression in PMNs after lung cancer treatment with paclitaxel and carboplatin cannot be used as a prognosis marker in these patients.

  11. Hidden Treasures in “Ancient” Microarrays: Gene-Expression Portrays Biology and Potential Resistance Pathways of Major Lung Cancer Subtypes and Normal Tissue

    PubMed Central

    Kerkentzes, Konstantinos; Lagani, Vincenzo; Tsamardinos, Ioannis; Vyberg, Mogens; Røe, Oluf Dimitri


    Objective: Novel statistical methods and increasingly more accurate gene annotations can transform “old” biological data into a renewed source of knowledge with potential clinical relevance. Here, we provide an in silico proof-of-concept by extracting novel information from a high-quality mRNA expression dataset, originally published in 2001, using state-of-the-art bioinformatics approaches. Methods: The dataset consists of histologically defined cases of lung adenocarcinoma (AD), squamous (SQ) cell carcinoma, small-cell lung cancer, carcinoid, metastasis (breast and colon AD), and normal lung specimens (203 samples in total). A battery of statistical tests was used for identifying differential gene expressions, diagnostic and prognostic genes, enriched gene ontologies, and signaling pathways. Results: Our results showed that gene expressions faithfully recapitulate immunohistochemical subtype markers, as chromogranin A in carcinoids, cytokeratin 5, p63 in SQ, and TTF1 in non-squamous types. Moreover, biological information with putative clinical relevance was revealed as potentially novel diagnostic genes for each subtype with specificity 93–100% (AUC = 0.93–1.00). Cancer subtypes were characterized by (a) differential expression of treatment target genes as TYMS, HER2, and HER3 and (b) overrepresentation of treatment-related pathways like cell cycle, DNA repair, and ERBB pathways. The vascular smooth muscle contraction, leukocyte trans-endothelial migration, and actin cytoskeleton pathways were overexpressed in normal tissue. Conclusion: Reanalysis of this public dataset displayed the known biological features of lung cancer subtypes and revealed novel pathways of potentially clinical importance. The findings also support our hypothesis that even old omics data of high quality can be a source of significant biological information when appropriate bioinformatics methods are used. PMID:25325012

  12. Single-cell RNA sequencing reveals an altered gene expression pattern as a result of CRISPR/cas9-mediated deletion of Gene 33/Mig6 and chronic exposure to hexavalent chromium in human lung epithelial cells.


    Park, Soyoung; Zhang, Xiaowen; Li, Cen; Yin, Changhong; Li, Jiangwei; Fallon, John T; Huang, Weihua; Xu, Dazhong


    Gene 33 (Mig6, ERRFI1) is an adaptor protein with multiple cellular functions. We recently reported that depletion of this protein promotes lung epithelial cell transformation induced by hexavalent chromium [Cr(VI)]. However, the early molecular events that mediate this process are not clear. In the present study, we used single-cell RNA sequencing to compare gene expression profiles between BEAS-2B lung epithelial cells chronically exposed to a sublethal dose of Cr(VI) with or without CRISPR/cas9-mediated deletion of Gene 33. Our data reveal 83 differentially expressed genes. The most notable changes are genes associated with cell adhesion, oxidative stresses, protein ubiquitination, epithelial-mesenchymal transition/metastasis, and WNT signaling. Up-regulation of some neuro-specific genes is also evident, particularly ubiquitin carboxyl-terminal hydrolase L1 (UCHL1), a deubiquitinase and potential biomarker for lung cancer. Gene 33 deletion and/or Cr(VI) exposure did not cause discernable changes in cell morphology. However, Gene 33 deletion led to a modest but significant reduction of cells in the G2/M phase of the cell cycle regardless of Cr(VI) exposure. Gene 33 deletion also significantly reduced cell proliferation. Interestingly, Cr(VI) exposure eliminated the difference in cell proliferation between the two genotypes. Gene 33 deletion also significantly elevated cell migration. Our data indicate that combined Gene 33 deletion and chronic Cr(VI) exposure produces a gene expression pattern and a phenotype resemble those of the transformed lung epithelial cells. Given the known association of UCHL1 with lung cancer, we propose that UCHL1 is an important player in the early stage of lung epithelial cell transformation and tumorigenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Methanolic extract of adlay seed suppresses COX-2 expression of human lung cancer cells via inhibition of gene transcription.


    Hung, Wen-Chun; Chang, Hui-Chiu


    Previous results demonstrated that the methanolic extract of adlay seed exerted an antiproliferative effect on human lung cancer cells in vitro and in vivo and might prevent tobacco carcinogen-induced lung tumorigenesis. In this study, the methanolic extract of adlay seed was tested for its regulation of COX-2 expression of human lung cancer cells. Western blot analysis showed that the methanolic extract of adlay seed inhibited basal and TPA-induced COX-2 expression in a dose-dependent fashion, whereas COX-1 expression was not affected. By using a promoter activity assay, it was found that the methanolic extract inhibited basal and TPA-stimulated COX-2 expression at the transcription level. The effect of the methanolic extract on COX-2 expression in vivo was then investigated. The data demonstrated that treatment of the methanolic extract reduced the PGE(2) level in serum and inhibited COX-2 expression of tumor tissues in nude mice. Taken together, these results suggest that inhibition of COX-2 is one of the mechanisms by which the methanolic extract of adlay seed inhibits cancer growth and prevents lung tumorigenesis.


    EPA Science Inventory

    Children residing in urbanized areas suffer disproportionately higher asthma-related morbidity and mortality. One explanation is that inner city children are exposured to higher levels of environmental asthma triggers such as airborne particulate matter. To elucidate gene-environ...


    EPA Science Inventory

    Children residing in urbanized areas suffer disproportionately higher asthma-related morbidity and mortality. One explanation is that inner city children are exposured to higher levels of environmental asthma triggers such as airborne particulate matter. To elucidate gene-environ...

  16. Retinoid Homeostatic Gene Expression in Liver, Lung and Kidney: Ontogeny and Response to Vitamin A-Retinoic Acid (VARA) Supplementation from Birth to Adult Age

    PubMed Central

    Owusu, Sarah A.; Ross, A. Catharine


    Vitamin A (VA, retinol) metabolism is homeostatically controlled, but little is known of its regulation in the postnatal period. Here, we determined the postnatal trajectory of VA storage and metabolism in major compartments of VA metabolism–plasma, liver, lung, and kidney from postnatal (P) day 1 to adulthood. We also investigated the response to supplementation with VARA, a combination of VA and 10% all-trans-retinoic acid that previously was shown to synergistically increase retinol uptake and storage in lung. Nursling pups of dams fed a VA-marginal diet received an oral dose of oil (placebo) or VARA on each of four neonatal days: P1, P4, P7, and P10; and again as adults. Tissues were collected 6 h after the final dosing on P1, P4, P10, and at adult age. Gene transcripts for Lrat and Rbp4 in liver and Raldh-1 and Raldh-3 in lung, did not differ in the neonatal period but were higher, P<0.05, in adults, while Cyp26B1, Stra6, megalin, and Raldh-2 in lung did not differ from perinatal to adult ages. VARA supplementation increased total retinol in plasma, liver and lung, with a dose-by-dose accumulation in neonatal liver and lung, while transcripts for Lrat in liver, megalin in kidney, Cyp26A1/B1 in liver and lung, respectively, and Stra6 in lung, were all increased, suggesting pathways of VA uptake, storage and RA oxidation were each augmented after VARA. VARA decreased hepatic expression of Rbp4, responsible for VA trafficking from liver to plasma, and, in lung, of Raldh-1 and Raldh-2, which function in RA production. Our results define retinoid homeostatic gene expression from neonatal and adult age and show that while supplementation with VARA acutely alters retinol content and retinoid homeostatic gene expression in neonatal and adult lung, liver and kidney, VARA supplementation of neonates increased adult-age VA content only in the liver. PMID:26731668

  17. Novel Roles for Notch3 and Notch4 Receptors in Gene Expression and Susceptibility to Ozone-Induced Lung Inflammation in Mice

    PubMed Central

    McCaw, Zachary; Gladwell, Wesley; Trivedi, Shweta; Bushel, Pierre R.; Kleeberger, Steven R.


    Background Ozone is a highly toxic air pollutant and global health concern. Mechanisms of genetic susceptibility to ozone-induced lung inflammation are not completely understood. We hypothesized that Notch3 and Notch4 are important determinants of susceptibility to ozone-induced lung inflammation. Methods Wild-type (WT), Notch3 (Notch3–/–), and Notch4 (Notch4–/–) knockout mice were exposed to ozone (0.3 ppm) or filtered air for 6–72 hr. Results Relative to air-exposed controls, ozone increased bronchoalveolar lavage fluid (BALF) protein, a marker of lung permeability, in all genotypes, but significantly greater concentrations were found in Notch4–/– compared with WT and Notch3–/– mice. Significantly greater mean numbers of BALF neutrophils were found in Notch3–/– and Notch4–/– mice compared with WT mice after ozone exposure. Expression of whole lung Tnf was significantly increased after ozone in Notch3–/– and Notch4–/– mice, and was significantly greater in Notch3–/– compared with WT mice. Statistical analyses of the transcriptome identified differentially expressed gene networks between WT and knockout mice basally and after ozone, and included Trim30, a member of the inflammasome pathway, and Traf6, an inflammatory signaling member. Conclusions These novel findings are consistent with Notch3 and Notch4 as susceptibility genes for ozone-induced lung injury, and suggest that Notch receptors protect against innate immune inflammation. Citation Verhein KC, McCaw Z, Gladwell W, Trivedi S, Bushel PR, Kleeberger SR. 2015. Novel roles for Notch3 and Notch4 receptors in gene expression and susceptibility to ozone-induced lung inflammation in mice. Environ Health Perspect 123:799–805; PMID:25658374

  18. Expression of genes involved in mouse lung cell differentiation/regulation after acute exposure to photons and protons with or without low-dose preirradiation.


    Tian, Jian; Zhao, WeiLing; Tian, Sisi; Slater, James M; Deng, Zhiyong; Gridley, Daila S


    The goal of this study was to compare the effects of acute 2 Gy irradiation with photons (0.8 Gy/min) or protons (0.9 Gy/min), both with and without pre-exposure to low-dose/low-dose-rate γ rays (0.01 Gy at 0.03 cGy/h), on 84 genes involved in stem cell differentiation or regulation in mouse lungs on days 21 and 56. Genes with a ≥1.5-fold difference in expression and P < 0.05 compared to 0 Gy controls are emphasized. Two proteins specific for lung stem cells/progenitors responsible for local tissue repair were also compared. Overall, striking differences were present between protons and photons in modulating the genes. More genes were affected by protons than by photons (22 compared to 2 and 6 compared to 2 on day 21 and day 56, respectively) compared to 0 Gy. Preirradiation with low-dose-rate γ rays enhanced the acute photon-induced gene modulation on day 21 (11 compared to 2), and all 11 genes were significantly downregulated on day 56. On day 21, seven genes (aldh2, bmp2, cdc2a, col1a1, dll1, foxa2 and notch1) were upregulated in response to most of the radiation regimens. Immunoreactivity of Clara cell secretory protein was enhanced by all radiation regimens. The number of alveolar type 2 cells positive for prosurfactant protein C in irradiated groups was higher on day 56 (12.4-14.6 cells/100) than on day 21 (8.5-11.2 cells/100) (P < 0.05). Taken together, these results showed that acute photons and protons induced different gene expression profiles in the lungs and that pre-exposure to low-dose-rate γ rays sometimes had modulatory effects. In addition, proteins associated with lung-specific stem cells/progenitors were highly sensitive to radiation.

  19. Peroxisome proliferator-activated receptor-gamma ligands suppress fibronectin gene expression in human lung carcinoma cells: involvement of both CRE and Sp1.


    Han, Shouwei; Ritzenthaler, Jeffrey D; Rivera, Hilda N; Roman, Jesse


    Lung carcinoma often occurs in patients with chronic lung disease such as tobacco-related emphysema and asbestos-related pulmonary fibrosis. These diseases are characterized by dramatic alterations in the content and composition of the lung extracellular matrix, and we believe this "altered" matrix has the ability to promote lung carcinoma cell growth. One extracellular matrix molecule shown to be altered in these lung diseases is fibronectin (Fn). We previously reported increased growth and survival of non-small cell lung carcinoma (NSCLC) cells exposed to Fn. Thus Fn may serve as a mitogen/survival factor for NSCLC and therefore represents a novel target for anti-cancer strategies. To this end, we studied the effects of the PPARgamma ligands 15d-PGJ(2), rosiglitazone (BRL49653), and troglitazone on Fn expression in NSCLC cells and found that they were able to inhibit Fn gene transcription. Inhibition of Fn expression by BRL49653 and troglitazone, but not by 15d-PGJ(2), was prevented by the specific PPARgamma antagonist GW-9662 and by PPARgamma small interfering RNA. Working with Fn deletion and mutated promoter constructs, we found that the region between -170 and -50 bp downstream from the transcriptional start site of the promoter was involved in PPARgamma ligand inhibition. PPARgamma ligands also diminished the phosphorylation of CREB, diminished Sp1 nuclear protein expression, and prevented the binding of these transcription factors to CRE and Sp1 sites, respectively, within the Fn promoter. In summary, our results demonstrate that PPARgamma ligands inhibit Fn gene expression in NSCLC cells through PPARgamma-dependent and -independent pathways that affect both CREB and Sp1.

  20. Bisphenol A suppresses glucocorticoid target gene (ENaCγ) expression via a novel ERβ/NF-κB/GR signalling pathway in lung epithelial cells.


    Hijazi, Ayten; Guan, Haiyan; Yang, Kaiping


    We previously demonstrated that prenatal exposure to Bisphenol A (BPA) disrupts fetal lung maturation likely through the glucocorticoid signalling pathway, but the precise molecular mechanisms remain obscure. Given that BPA diminished the expression of epithelial sodium channel-γ (ENaCγ), a well-known glucocorticoid receptor (GR) target gene, in fetal lungs, we used this GR target gene to delineate the molecular pathway through which BPA exerts its effects on lung cells. The A549 lung epithelial cell line was used as an in vitro model system. As a first step, we validated our in vitro cell model by demonstrating a robust concentration-dependent suppression of ENaCγ expression following BPA exposure. We also showed that both dexamethasone and siRNA-mediated knockdown of GR expression blocked/abrogated the inhibitory effects of BPA on ENaCγ expression, suggesting that BPA repressed ENaCγ expression via inhibition of GR activity. Given the well-known antagonistic interactions between the pro-inflammatory transcriptional factor NF-κB and GR, we then showed that BPA inhibited GR activity through the activation of NF-κB. Lastly, since BPA is known to function as a pro-inflammatory factor via the estrogen receptor β (ERβ), we provided evidence that BPA signals through ERβ to activate the NF-κB signalling pathway. Taken together, these findings demonstrate that BPA acts on ERβ to activate the NF-κB signalling pathway, which in turn leads to diminished GR activity and consequent repression of ENaCγ expression in lung epithelial cells. Thus, our present study reveals a novel BPA signalling pathway that involves ERβ, NF-κB and GR.

  1. Association and virulence gene expression vary among serotype III group B streptococcus isolates following exposure to decidual and lung epithelial cells.


    Korir, Michelle L; Knupp, David; LeMerise, Kathryn; Boldenow, Erica; Loch-Caruso, Rita; Aronoff, David M; Manning, Shannon D


    Group B Streptococcus (GBS) causes severe disease in neonates, the elderly, and immunocompromised individuals. GBS species are highly diverse and can be classified by serotype and multilocus sequence typing. Sequence type 17 (ST-17) strains cause invasive neonatal disease more frequently than strains of other STs. Attachment and invasion of host cells are key steps in GBS pathogenesis. We investigated whether four serotype III strains representing ST-17 (two strains), ST-19, and ST-23 differ in their abilities to attach to and invade both decidual cells and lung epithelial cells. Virulence gene expression following host cell association and exposure to amnion cells was also tested. The ST-17 strains differed in their abilities to attach to and invade decidual cells, whereas there were no differences with lung epithelial cells. The ST-19 and ST-23 strains, however, attached to and invaded decidual cells less than both ST-17 strains. Although the ST-23 strain attached to lung epithelial cells better than ST-17 and -19 strains, none of the strains effectively invaded the lung epithelial cells. Notably, the association with host cells resulted in the differential expression of several virulence genes relative to basal expression levels. Similar expression patterns of some genes were observed regardless of cell type used. Collectively, these results show that GBS strains differ in their abilities to attach to distinct host cell types and express key virulence genes that are relevant to the disease process. Enhancing our understanding of pathogenic mechanisms could aid in the identification of novel therapeutic targets or vaccine candidates that could potentially decrease morbidity and mortality associated with neonatal infections.

  2. Gene-expression profiling reveals distinct expression patterns for Classic versus Variant Merkel cell phenotypes and new classifier genes to distinguish Merkel cell from small-cell lung carcinoma.


    Van Gele, Mireille; Boyle, Glen M; Cook, Anthony L; Vandesompele, Jo; Boonefaes, Tom; Rottiers, Pieter; Van Roy, Nadine; De Paepe, Anne; Parsons, Peter G; Leonard, J Helen; Speleman, Frank


    Merkel cell carcinoma (MCC) is a rare aggressive skin tumor which shares histopathological and genetic features with small-cell lung carcinoma (SCLC), both are of neuroendocrine origin. Comparable to SCLC, MCC cell lines are classified into two different biochemical subgroups designated as 'Classic' and 'Variant'. With the aim to identify typical gene-expression signatures associated with these phenotypically different MCC cell lines subgroups and to search for differentially expressed genes between MCC and SCLC, we used cDNA arrays to profile 10 MCC cell lines and four SCLC cell lines. Using significance analysis of microarrays, we defined a set of 76 differentially expressed genes that allowed unequivocal identification of Classic and Variant MCC subgroups. We assume that the differential expression levels of some of these genes reflect, analogous to SCLC, the different biological and clinical properties of Classic and Variant MCC phenotypes. Therefore, they may serve as useful prognostic markers and potential targets for the development of new therapeutic interventions specific for each subgroup. Moreover, our analysis identified 17 powerful classifier genes capable of discriminating MCC from SCLC. Real-time quantitative RT-PCR analysis of these genes on 26 additional MCC and SCLC samples confirmed their diagnostic classification potential, opening opportunities for new investigations into these aggressive cancers.

  3. Promoter methylation status of tumor suppressor genes and inhibition of expression of DNA methyltransferase 1 in non-small cell lung cancer

    PubMed Central

    Liu, Bangqing; Song, Jianfei; Luan, Jiaqiang; Sun, Xiaolin; Bai, Jian; Wang, Haiyong; Li, Angui; Zhang, Lifei; Feng, Xiaoyan


    DNA methylation is an epigenetic DNA modification catalyzed by DNA methyltransferase 1 (DNMT1). The purpose of this study was to investigate DNMT1 gene and protein expression and the effects of methylation status on tumor suppressor genes in human non-small cell lung cancer (NSCLC) cell lines grown in vitro and in vivo. Human lung adenocarcinoma cell lines, A549 and H838, were grown in vitro and inoculated subcutaneously into nude mice to form tumors and were then treated with the DNA methylation inhibitor, 5-aza-2′-deoxycytidine, with and without treatment with the benzamide histone deacetylase inhibitor, entinostat (MS-275). DNMT1 protein expression was quantified by Western blot. Promoter methylation status of tumor suppressor genes (RASSF1A, ASC, APC, MGMT, CDH13, DAPK, ECAD, P16, and GATA4) was evaluated by methylation-specific polymerase chain reaction. Methylation status of the tumor suppressor genes was regulated by the DNMT1 gene, with the decrease of DNMT1 expression following DNA methylation treatment. Demethylation of tumor suppressor genes (APC, ASC, and RASSF1A) restored tumor growth in nude mice. The results of this study support a role for methylation of DNA as a potential epigenetic clinical biomarker of prognosis or response to therapy and for DNMT1 as a potential therapeutic target in NSCLC. PMID:27190263

  4. Lung tissue remodelling in MCT-induced pulmonary hypertension: a proposal for a novel scoring system and changes in extracellular matrix and fibrosis associated gene expression

    PubMed Central

    Franz, Marcus; Grün, Katja; Betge, Stefan; Rohm, Ilonka; Ndongson-Dongmo, Bernadin; Bauer, Reinhard; Schulze, P. Christian; Lichtenauer, Michael; Petersen, Iver; Neri, Dario; Berndt, Alexander; Jung, Christian


    Pulmonary hypertension (PH) is associated with vasoconstriction and remodelling. We studied lung tissue remodelling in a rat model of PH with special focus on histology and extracellular matrix (ECM) remodelling. After induction of PH by monocrotaline, lung tissue was analysed histologically, by gene expression analysis and immunofluorescence labelling of ED-A domain containing fibronectin (ED-A+ Fn), B domain containing tenascin-C (B+ Tn-C) as well as alpha-smooth muscle actin (α-SMA). Serum concentrations of ED-A+ Fn were determined by ELISA. Systolic right ventricular pressure (RVPsys) values were significantly elevated in PH (n = 18; 75 ± 26.4 mmHg) compared to controls (n = 10; 29 ± 19.3 mmHg; p = 0.015). The histological sum-score was significantly increased in PH (8.0 ± 2.2) compared to controls (2.5 ± 1.6; p < 0.001). Gene expression analysis revealed relevant induction of several key genes of extracellular matrix remodelling. Increased protein deposition of ED-A+ Fn but not of B+ Tn-C and α-SMA in lung tissue was found in PH (2.88 ± 3.19 area%) compared to controls (1.32 ± 0.16 area%; p = 0.030). Serum levels of ED-A+ Fn were significantly higher in PH (p = 0.007) positively correlating with RVPsys (r = 0.618, p = 0.019). We here present a novel histological scoring system to assess lung tissue remodelling in PH. Gene expression analysis revealed induction of candidate genes involved in collagen matrix turnover, fibrosis and vascular remodelling. The stable increased tissue deposition of ED-A+ Fn in PH as well as its dynamics in serum suggests a role as a promising novel biomarker and potential therapeutic target. PMID:27835899

  5. Response of the mouse lung transcriptome to welding fume: effects of stainless and mild steel fumes on lung gene expression in A/J and C57BL/6J mice

    PubMed Central


    Background Debate exists as to whether welding fume is carcinogenic, but epidemiological evidence suggests that welders are an at risk population for the development of lung cancer. Recently, we found that exposure to welding fume caused an acutely greater and prolonged lung inflammatory response in lung tumor susceptible A/J versus resistant C57BL/6J (B6) mice and a trend for increased tumor incidence after stainless steel (SS) fume exposure. Here, our objective was to examine potential strain-dependent differences in the regulation and resolution of the lung inflammatory response induced by carcinogenic (Cr and Ni abundant) or non-carcinogenic (iron abundant) metal-containing welding fumes at the transcriptome level. Methods Mice were exposed four times by pharyngeal aspiration to 5 mg/kg iron abundant gas metal arc-mild steel (GMA-MS), Cr and Ni abundant GMA-SS fume or vehicle and were euthanized 4 and 16 weeks after the last exposure. Whole lung microarray using Illumina Mouse Ref-8 expression beadchips was done. Results Overall, we found that tumor susceptibility was associated with a more marked transcriptional response to both GMA-MS and -SS welding fumes. Also, Ingenuity Pathway Analysis revealed that gene regulation and expression in the top molecular networks differed between the strains at both time points post-exposure. Interestingly, a common finding between the strains was that GMA-MS fume exposure altered behavioral gene networks. In contrast, GMA-SS fume exposure chronically upregulated chemotactic and immunomodulatory genes such as CCL3, CCL4, CXCL2, and MMP12 in the A/J strain. In the GMA-SS-exposed B6 mouse, genes that initially downregulated cellular movement, hematological system development/function and immune response were involved at both time points post-exposure. However, at 16 weeks, a transcriptional switch to an upregulation for neutrophil chemotactic genes was found and included genes such as S100A8, S100A9 and MMP9. Conclusions

  6. Health Risk Assessment for Air Pollutants: Alterations in Lung and Cardiac Gene Expression in Mice Exposed to Milano Winter Fine Particulate Matter (PM2.5)

    PubMed Central

    Battaglia, Cristina; Cifola, Ingrid; Mangano, Eleonora; Mantecca, Paride; Camatini, Marina; Palestini, Paola


    Oxidative stress, pulmonary and systemic inflammation, endothelial cell dysfunction, atherosclerosis and cardiac autonomic dysfunction have been linked to urban particulate matter exposure. The chemical composition of airborne pollutants in Milano is similar to those of other European cities though with a higher PM2.5 fraction. Milano winter fine particles (PM2.5win) are characterized by the presence of nitrate, organic carbon fraction, with high amount of polycyclic aromatic hydrocarbons and elements such as Pb, Al, Zn, V, Fe, Cr and others, with a negligible endotoxin presence. In BALB/c mice, we examined, at biochemical and transcriptomic levels, the adverse effects of repeated Milano PM2.5win exposure in lung and heart. We found that ET-1, Hsp70, Cyp1A1, Cyp1B1 and Hsp-70, HO-1, MPO respectively increased within lung and heart of PM2.5win-treated mice. The PM2.5win exposure had a strong impact on global gene expression of heart tissue (181 up-regulated and 178 down-regulated genes) but a lesser impact on lung tissue (14 up-regulated genes and 43 down-regulated genes). Focusing on modulated genes, in lung we found two- to three-fold changes of those genes related to polycyclic aromatic hydrocarbons exposure and calcium signalling. Within heart the most striking aspect is the twofold to threefold increase in collagen and laminin related genes as well as in genes involved in calcium signaling. The current study extends our previous findings, showing that repeated instillations of PM2.5win trigger systemic adverse effects. PM2.5win thus likely poses an acute threat primarily to susceptible people, such as the elderly and those with unrecognized coronary artery or structural heart disease. The study of genomic responses will improve understanding of disease mechanisms and enable future clinical testing of interventions against the toxic effects of air pollutant. PMID:25296036

  7. Health risk assessment for air pollutants: alterations in lung and cardiac gene expression in mice exposed to Milano winter fine particulate matter (PM2.5).


    Sancini, Giulio; Farina, Francesca; Battaglia, Cristina; Cifola, Ingrid; Mangano, Eleonora; Mantecca, Paride; Camatini, Marina; Palestini, Paola


    Oxidative stress, pulmonary and systemic inflammation, endothelial cell dysfunction, atherosclerosis and cardiac autonomic dysfunction have been linked to urban particulate matter exposure. The chemical composition of airborne pollutants in Milano is similar to those of other European cities though with a higher PM2.5 fraction. Milano winter fine particles (PM2.5win) are characterized by the presence of nitrate, organic carbon fraction, with high amount of polycyclic aromatic hydrocarbons and elements such as Pb, Al, Zn, V, Fe, Cr and others, with a negligible endotoxin presence. In BALB/c mice, we examined, at biochemical and transcriptomic levels, the adverse effects of repeated Milano PM2.5win exposure in lung and heart. We found that ET-1, Hsp70, Cyp1A1, Cyp1B1 and Hsp-70, HO-1, MPO respectively increased within lung and heart of PM2.5win-treated mice. The PM2.5win exposure had a strong impact on global gene expression of heart tissue (181 up-regulated and 178 down-regulated genes) but a lesser impact on lung tissue (14 up-regulated genes and 43 down-regulated genes). Focusing on modulated genes, in lung we found two- to three-fold changes of those genes related to polycyclic aromatic hydrocarbons exposure and calcium signalling. Within heart the most striking aspect is the twofold to threefold increase in collagen and laminin related genes as well as in genes involved in calcium signaling. The current study extends our previous findings, showing that repeated instillations of PM2.5win trigger systemic adverse effects. PM2.5win thus likely poses an acute threat primarily to susceptible people, such as the elderly and those with unrecognized coronary artery or structural heart disease. The study of genomic responses will improve understanding of disease mechanisms and enable future clinical testing of interventions against the toxic effects of air pollutant.

  8. Using gene expression profiling to evaluate cellular responses in mouse lungs exposed to V2O5 and a group of other mouse lung tumorigens and non-tumorigens.


    Black, Michael B; Dodd, Darol E; McMullen, Patrick D; Pendse, Salil; MacGregor, Judith A; Gollapudi, B Bhaskar; Andersen, Melvin E


    Many compounds test positive for lung tumors in two-year NTP carcinogenicity bioassays in B6C3F1 mice. V2O5 was identified as a lung carcinogen in this assay, leading to its IARC (International Agency for Research on Cancer) classification as group 2b or a "possible" human carcinogen. To assess potential tumorigenic mode of action of V2O5, we compared gene expression and gene ontology enrichment in lung tissue of female B6C3F1 mice exposed for 13 weeks to a V2O5 particulate aerosol at a tumorigenic level (2.0 mg/m(3)). Relative to 12 other compounds also tested for carcinogenicity in 2-year bioassays in mice, there were 1026 differentially expressed genes with V2O5, of which 483 were unique to V2O5. Ontology analysis of the 1026 V2O5 differentially expressed genes showed enrichment for hyaluronan and sphingolipid metabolism, adenylate cyclase functions, c-AMP signaling and PKA activation/signaling. Enrichment of lipids/lipoprotein metabolism and inflammatory pathways were consistent with previously reported clinical findings. Enrichment of c-AMP and PKA signaling pathways may arise due to inhibition of phosphatases, a known biological action of vanadate. We saw no enrichment for DNA-damage, oxidative stress, cell cycle, or apoptosis pathway signaling in mouse lungs exposed to V2O5 which is in contrast with past studies evaluating in vivo gene expression in target tissues of other carcinogens (arsenic, formaldehyde, naphthalene and chloroprene). Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Analysis of Microarray Data on Gene Expression and Methylation to Identify Long Non-coding RNAs in Non-small Cell Lung Cancer

    PubMed Central

    Feng, Nannan; Ching, Travers; Wang, Yu; Liu, Ben; Lin, Hongyan; Shi, Oumin; Zhang, Xiaohong; Zheng, Min; Zheng, Xin; Gao, Ming; Zheng, Zhi-jie; Yu, Herbert; Garmire, Lana; Qian, Biyun


    To identify what long non-coding RNAs (lncRNAs) are involved in non-small cell lung cancer (NSCLC), we analyzed microarray data on gene expression and methylation. Gene expression chip and HumanMethylation450BeadChip were used to interrogate genome-wide expression and methylation in tumor samples. Differential expression and methylation were analyzed through comparing tumors with adjacent non-tumor tissues. LncRNAs expressed differentially and correlated with coding genes and DNA methylation were validated in additional tumor samples using RT-qPCR and pyrosequencing. In vitro experiments were performed to evaluate lncRNA’s effects on tumor cells. We identified 8,500 lncRNAs expressed differentially between tumor and non-tumor tissues, of which 1,504 were correlated with mRNA expression. Two of the lncRNAs, LOC146880 and ENST00000439577, were positively correlated with expression of two cancer-related genes, KPNA2 and RCC2, respectively. High expression of LOC146880 and ENST00000439577 were also associated with poor survival. Analysis of lncRNA expression in relation to DNA methylation showed that LOC146880 expression was down-regulated by DNA methylation in its promoter. Lowering the expression of LOC146880 or ENST00000439577 in tumor cells could inhibit cell proliferation, invasion and migration. Analysis of microarray data on gene expression and methylation allows us to identify two lncRNAs, LOC146880 and ENST00000439577, which may promote the progression of NSCLC. PMID:27849024

  10. Expression of homeotic genes Hoxa3, Hoxb3, Hoxd3 and Hoxc4 is decreased in the lungs but not in the hearts of adriamycin-exposed mice.


    Calonge, W M; Martinez, L; Lacadena, J; Fernandez-Dumont, V; Matesanz, R; Tovar, J A


    Exposure of rat and mouse embryos to adriamycin (doxorubicin chlorhydrate) induces esophageal atresia (EA) and VACTERL association. Sonic hedgehog (Shh) and Gli2/Gli3 pathways are involved in these conditions and knockout mice for homeotic Hox genes Hoxa3, Hoxb3, Hoxc3, Hoxc4 and Hoxa5 show phenotypes with some of the associated VACTERL features. This study aims at evaluating the possible influence of Hoxa3, Hoxb3, Hoxd3 and Hoxc4 as upstream regulators of this complex signalling. Pregnant mice were exposed either to 4 mg/kg of adriamycin (EA group) or vehicle (controls) on embryonic days 7.5 and 8.5. Embryos were recovered at four endpoints (E12.5-E15.5) and randomly assigned for immunohistochemical or molecular biology studies. Lungs and hearts were separately harvested and processed for Hoxa3, Hoxb3, Hoxd3 and Hoxc4 quantitative RT-PCR measurements. Antibodies for Hoxa3, Hoxb3 and Hoxd3 proteins were used for immunohistochemical studies. RT-PCR studies showed a drastic and statistically significant decrease of the four genes in the lungs of EA mice when compared to controls, with a slight recovery from E15.5. Hearts of both groups showed a similar expression of all the genes throughout gestation. Control embryos expressed the hox3 paralogous genes in heart, skin, foregut derivatives and their surrounding mesoderm through E12.5-E15.5 whereas adriamycin-exposed embryos showed a severe decrease in expression of these three proteins in the same tissues but not in the heart. Adriamycin drastically reduced the expression of Hoxa3, Hoxb3, Hoxd3 and Hoxc4 in mice embryonic lungs. Their expression in the heart did not seem to be influenced by adriamycin in this experimental setting.

  11. Clinical value of miR-452-5p expression in lung adenocarcinoma: A retrospective quantitative real-time polymerase chain reaction study and verification based on The Cancer Genome Atlas and Gene Expression Omnibus databases.


    Gan, Xiao-Ning; Luo, Jie; Tang, Rui-Xue; Wang, Han-Lin; Zhou, Hong; Qin, Hui; Gan, Ting-Qing; Chen, Gang


    The role and mechanism of miR-452-5p in lung adenocarcinoma remain unclear. In this study, we performed a systematic study to investigate the clinical value of miR-452-5p expression in lung adenocarcinoma. The expression of miR-452-5p in 101 lung adenocarcinoma patients was detected by quantitative real-time polymerase chain reaction. The Cancer Genome Atlas and Gene Expression Omnibus databases were joined to verify the expression level of miR-452-5p in lung adenocarcinoma. Via several online prediction databases and bioinformatics software, pathway and network analyses of miR-452-5p target genes were performed to explore its prospective molecular mechanism. The expression of miR-452-5p in lung adenocarcinoma in house was significantly lower than that in adjacent tissues (p < 0.001). Additionally, the expression level of miR-452-5p was negatively correlated with several clinicopathological parameters including the tumor size (p = 0.014), lymph node metastasis (p = 0.032), and tumor-node-metastasis stage (p = 0.036). Data from The Cancer Genome Atlas also confirmed the low expression of miR-452 in lung adenocarcinoma (p < 0.001). Furthermore, reduced expression of miR-452-5p in lung adenocarcinoma (standard mean deviations = -0.393, 95% confidence interval: -0.774 to -0.011, p = 0.044) was validated by a meta-analysis. Five hub genes targeted by miR-452-5p, including SMAD family member 4, SMAD family member 2, cyclin-dependent kinase inhibitor 1B, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon, and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta, were significantly enriched in the cell-cycle pathway. In conclusion, low expression of miR-452-5p tends to play an essential role in lung adenocarcinoma. Bioinformatics analysis might be beneficial to reveal the potential mechanism of miR-452-5p in lung adenocarcinoma.

  12. Differential Cytokine Gene Expression in Granulomas from Lungs and Lymph Nodes of Cattle Experimentally Infected with Aerosolized Mycobacterium bovis

    PubMed Central


    The hallmark lesion of tuberculosis in humans and animals is the granuloma. The granuloma represents a distinct host cellular immune response composed of epithelioid macrophages, lymphocytes, and multinucleated giant cells, often surrounding a caseous necrotic core. Within the granuloma, host-pathogen interactions determine disease outcome. Factors within the granulomas such as cytokines and chemokines drive cell recruitment, activity, function and ultimately the success or failure of the host’s ability to control infection. Hence, an understanding of the granuloma-level cytokine response is necessary to understand tuberculosis pathogenesis. In-situ cytokine expression patterns were measured using a novel in situ hybridization assay, known as RNAScope® in granulomas of the lungs, tracheobronchial lymph nodes and caudal mediastinal lymph nodes of cattle experimentally infected with Mycobacterium bovis via aerosol exposure. In spite of microscopic morphological similarities, significant differences were seen between late stage granulomas of the lung compared to those of the tracheobronchial lymph nodes for IL-17A, IFN-γ, TGF-β, IL10 and IL-22 but not for TNF-α. Additionally, significant differences were noted between granulomas from two different thoracic lymph nodes that both receive afferent lymphatics from the lungs (i.e., tracheobronchial and caudal mediastinal lymph nodes) for TNF-α, IL-17A, IFN-γ, TGF-β and IL-10 but not for IL-22. These findings show that granuloma morphology alone is not a reliable indicator of granuloma function as granulomas of similar morphologies can have disparate cytokine expression patterns. Moreover, anatomically distinct lymph nodes (tracheobronchial vs caudal mediastinal) differ in cytokine expression patterns even when both receive afferent lymphatics from a lung containing tuberculoid granulomas. These findings show that selection of tissue and anatomic location are critical factors in assessing host immune response to M

  13. Multiple functional SNPs in differentially expressed genes modify risk and survival of non-small cell lung cancer in chinese female non-smokers.


    Fang, Xue; Yin, Zhihua; Li, Xuelian; Xia, Lingzi; Quan, Xiaowei; Zhao, Yuxia; Zhou, Baosen


    DNA genotype can affect gene expression, and gene expression can influence the onset and progression of diseases. Here we conducted a comprehensive study, we integrated analysis of gene expression profile and single nucleotide polymorphism (SNP) microarray data in order to scan out the critical genetic changes that participate in the onset and development of non-small cell lung cancer (NSCLC). Gene expression profile datasets were downloaded from the GEO database. Firstly, differentially expressed genes (DEGs) between NSCLC samples and adjacent normal samples were identified. Next, by STRING database, protein-protein interaction (PPI) network was constructed. At the same time, hub genes in PPI network were identified. Then, some functional SNPs in hub genes that may affect gene expression have been annotated. Finally, we carried a study to explore the relationship between functional SNPs and NSCLC risk and overall survival in Chinese female non-smokers. A total of 488 DEGs were identified in our study. There are 29 proteins with a higher degree of connectivity in the PPI network, including FOS, IL6 and MMP9. By using database annotation, we got 8 candidate functional SNPs that may affect the expression level of hub proteins. In the case-control study, we found that rs4754-T allele, rs959173-C allele and rs2239144-G allele were the protective allele of NSCLC risk. In dominant model, rs4754-CT+TT genotype were associated with a shorter survival time. In general, our study provides a novel research direction in the field of multi-omic data integration, and helps us find some critical genetic changes in disease.

  14. Bisdemethoxycurcumin (BDMC) Alters Gene Expression-associated Cell Cycle, Cell Migration and Invasion and Tumor Progression in Human Lung Cancer NCI-H460 Cells.


    Yu, Chien-Chih; Yang, Mei-Due; Lin, Hui-Yi; Huang, An-Cheng; Lin, Jing-Pin; Kuo, Chao-Lin; Liu, Kuo-Ching; Liu, Hsin-Chung; Yang, Su-Tso; Chung, Jing-Gung


    Lung cancer is one of the most common malignancies and a predominant cause of cancer-related death. It can metastasize in almost all organs, and currently, while new cases are increasing, treatment is still insufficient. Bisdemethoxycurcumin (BDMC), one of the components of turmeric, has been known to possess biological activities. However, the effects of BDMC on the genetic level remain unclear. Human lung cancer NCI-H460 cells were treated with 35 μM BDMC for 24 h and cells were harvested for total RNA extraction. The purified RNA was used for cDNA synthesis, labeling, microarray hybridization, and flour-labeled cDNA on-chip hybridization. The expression Console software (Affymetrix) with default RNA parameters was used to detect and quantitate concentrations of fluorescent molecules. The key genes involved and their possible interaction pathways were analyzed by the GeneGo software. Seven genes, such as CCNE2 (cyclin E), associated with cell cycle, were over 4-fold overexpressed, 22 genes, such as ERCC6L (excision repair cross-complementing rodent repair deficiency, complementation group 6-like) associated with DNA damage and repair, were from 3- to 4-fold overexpressed and 266, such as cell division cycle, S-phase associated kinase and associated with cell death, genes were from 2- to 3-fold overexpressed. BDMC induced changes in gene expression that may reveal cytotoxic information on the genetic level while presenting novel biomarkers or targets for treatment of human lung cancer in the future. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  15. Reduced Fhit protein expression and loss of heterozygosity at FHIT gene in tumours from smoking and asbestos-exposed lung cancer patients.


    Pylkkanen, Lea; Wolff, Henrik; Stjernvall, Tuula; Tuominen, Paivi; Sioris, Thanos; Karjalainen, Antti; Anttila, Sisko; Husgafvel-Pursiainen, Kirsti


    The FHIT gene, at 3p14.2, has been suggested to form a molecular target to damage induced by human lung carcinogens. We examined aberrant expression of the Fhit protein and allele loss at the FHIT gene in a series of lung cancer cases, mainly of non-small cell carcinoma (NSCLC) histology. We had detailed data on tobacco smoke exposure and occupational asbestos exposure available for the cases. The principal aim of the present study was to investigate whether absent or reduced Fhit expression or FHIT allele loss was associated with exposure to these pulmonary carcinogens. We detected reduced Fhit expression in 62% (33/53) of the cases analysed. Prevalence of allele loss at the FHIT locus was 22% (20/89). Reduced protein expression was common both in the asbestos-exposed (67%) and non-exposed cases (59%); [odds ratio (OR) 1.4, 95% confidence interval (CI) 0.4-4.9]. LOH frequencies differed somewhat between the two groups and were 25% vs. 16%, respectively (OR 1.8; 95% CI 0.5-5.9). Absent or reduced expression was common in smokers, with no significant difference found between current smokers and non-smokers (mainly former smokers) (OR 1.4, 95% CI 0.5-4.5). NSCLCs with squamous cell histology exhibited both aberrant expression (OR 3.1, 95% CI 0.9-10.3) and allele loss (OR 3.3, 95% CI 0.9-12.7) more frequently than adenocarcinoma. Finally, we found that FHIT allele loss was increased in stage II or more advanced disease (OR 2.5, 95% CI 0.9-7.4), and in poorly differentiated tumours (grade 3, OR 2.6, 95% CI 0.8-8.1). In conclusion, our present data support significance of FHIT inactivation in development of lung cancer.

  16. Analysis of p16 gene mutations and their expression using exhaled breath condensate in non-small-cell lung cancer.


    Chen, Jin-Liang; Chen, Jian-Rong; Huang, Fen-Fen; Tao, Guo-Hua; Zhou, Feng; Tao, Yi-Jiang


    The aim of the present study was to investigate the mutational status of exons 1 and 2 of the p16 gene in the exhaled breath condensate (EBC) of patients with non-small-cell lung cancer (NSCLC) and determine the feasibility and clinical significance of applying EBC in the diagnosis of NSCLC. Polymerase chain reaction and DNA sequencing were applied to detect exon 1 and 2 alterations of the p16 gene in EBC by comparing 58 samples from NSCLC patients and 30 from healthy controls. Of the 58 EBC samples from NSCLC patients, 54 were successfully tested and 8 cases of mutations were identified, of which 3 were in exon 1 and 5 in exon 2. The mutation rate was 14.81% (8/54). There were no p16 gene mutations in the 30 samples obtained from healthy controls. EBC p16 gene mutations exhibited no statistically significant differences according to gender, smoking history, pathological type, degree of differentiation and presence or absence of lymph node metastasis. The p16 gene mutation rate was proportional to the tumor stage (P<0.05). Therefore, the detection of the p16 gene mutation in EBC may be used as a novel molecular marker to assist in the diagnosis of NSCLC.

  17. A mass spectrometry assay to simultaneously analyze ROS1 and RET fusion gene expression in non-small-cell lung cancer.


    Wijesinghe, Priyanga; Bepler, Gerold; Bollig-Fischer, Aliccia


    ROS1 and RET gene fusions were recently discovered in non-small-cell lung cancer (NSCLC) as potential therapeutic targets with small-molecule kinase inhibitors. The conventional screening methods of these fusions are time-consuming and require samples of high quality and quantity. Here, we describe a novel and efficient method by coupling the power of multiplexing polymerase chain reaction and the sensitivity of mass spectrometry. The multiplex mass spectrometry platform simultaneously tests samples for the expression of nine ROS1 and six RET fusion genes. The assay incorporates detection of wild-type exon junctions immediately upstream and downstream of the fusion junction to exclude false-negative results. To flag false-positives, the system also comprises two independent assays for each fusion gene junction. The characteristic mass spectrometric peaks of the gene fusions were obtained using engineered plasmid constructs. Specific assays targeting the wild-type gene exon junctions were validated using complimentary DNA from lung tissue of healthy individuals. The system was further validated using complimentary DNA derived from NSCLC cell lines that express endogenous fusion genes. The expressed ROS1-SLC34A2 and CCDC6-RET gene fusions from the NSCLC cell lines HCC78 and LC-2/ad, respectively, were accurately detected by the novel assay. The assay is extremely sensitive, capable of detecting an event in test specimens containing 0.5% positive tumors. The novel multiplexed assay is robustly capable of detecting 15 different clinically relevant RET and ROS1 fusion variants. The benefits of this detection method include exceptionally low sample input, high cost efficiency, flexibility, and rapid turnover.

  18. Bufalin alters gene expressions associated DNA damage, cell cycle, and apoptosis in human lung cancer NCI-H460 cells in vitro.


    Wu, Shin-Hwar; Hsiao, Yung-Ting; Chen, Jaw-Chyum; Lin, Ju-Hwa; Hsu, Shu-Chun; Hsia, Te-Chun; Yang, Su-Tso; Hsu, Wu-Huei; Chung, Jing-Gung


    Lung cancer is the leading cause of cancer related death and there is no effective treatment to date. Bufalin has been shown effective in inducing apoptosis and DNA damage in lung cancer cells. However, the genetic mechanisms underlying these actions have not been elucidated yet. Cultured NCI-H460 cells were treated with or without 2 μM of bufalin for 24 h. The total RNA was extracted from each treatment for cDNA synthesis and labeling, microarray hybridization, and then followed by flour-labeled cDNA hybridized on chip. The localized concentrations of fluorescent molecules were detected and quantitated and analyzed by Expression Console software (Affymetrix) with default RMA parameters. The key genes involved and their possible interaction pathways were mapped by GeneGo software. About 165 apoptosis-related genes were affected. CASP9 was up-regulated by 5.51 fold and THAP1 by 2.75-fold while CCAR1 was down-regulated by 2.24 fold. 107 genes related to DNA damage/repair were affected. MDC1 was down-regulated by 2.22-fold, DDIT4 by 2.52 fold while GADD45B up-regulated by 3.72 fold. 201 genes related to cell cycles were affected. CCPG1 was down-regulated by 2.11 fold and CDCA7L by 2.71 fold. Many genes about apoptosis, cell cycle regulation and DNA repair are changed significantly following bufalin treatment in NCI-H460 cells. These changes provide an in depth understanding of cytotoxic mechanism of bufalin in genetic level and also offer many potentially useful biomarkers for diagnosis and treatment of lung cancer in future.

  19. Acute high-level exposure to WTC particles alters expression of genes associated with oxidative stress and immune function in the lung.


    Cohen, Mitchell D; Vaughan, Joshua M; Garrett, Brittany; Prophete, Colette; Horton, Lori; Sisco, Maureen; Kodavanti, Urmila P; Ward, William O; Peltier, Richard E; Zelikoff, Judith; Chen, Lung-chi


    First responders (FR) present at Ground Zero in the first 72 h after the World Trade Center (WTC) collapsed have progressively exhibited significant respiratory injuries. The few toxicology studies performed to date evaluated effects from just fine (< 2.5 µm) WTC dusts; none examined health effects/toxicities from atmospheres bearing larger particle sizes, despite the fact the majority (> 96%) of dusts were > 10 µm and most FR likely entrained dusts by mouth breathing. Using a system that generated/delivered supercoarse (10-53 µm) WTC dusts to F344 rats (in a manner that mimicked FR exposures), this study sought to examine potential toxicities in the lungs. In this exploratory study, rats were exposed for 2 h to 100 mg WTC dust/m(3) (while under isoflurane [ISO] anesthesia) or an air/ISO mixture; this dose conservatively modeled likely exposures by mouth-breathing FR facing ≈750-1000 mg WTC dust/m(3). Lungs were harvested 2 h post-exposure and total RNA extracted for subsequent global gene expression analysis. Among the >  1000 genes affected by WTC dust (under ISO) or ISO alone, 166 were unique to the dust exposure. In many instances, genes maximally-induced by the WTC dust exposure (relative to in naïve rats) were unchanged/inhibited by ISO only; similarly, several genes maximally inhibited in WTC dust rats were largely induced/unchanged in rats that received ISO only. These outcomes reflect likely contrasting effects of ISO and the WTC dust on lung gene expression. Overall, the data show that lungs of rats exposed to WTC dust (under ISO) - after accounting for any impact from ISO alone - displayed increased expression of genes related to lung inflammation, oxidative stress, and cell cycle control, while several involved in anti-oxidant function were inhibited. These changes suggested acute inflammogenic effects and oxidative stress in the lungs of WTC dust-exposed rats. This study, thus, concludes that a single very high exposure

  20. Acute high-level exposure to WTC particles alters expression of genes associated with oxidative stress and immune function in the lung

    PubMed Central

    Cohen, Mitchell D.; Vaughan, Joshua M.; Garrett, Brittany; Prophete, Colette; Horton, Lori; Sisco, Maureen; Kodavanti, Urmila P.; Ward, William O.; Peltier, Richard E.; Zelikoff, Judith; Chen, Lung-chi


    First responders (FR) present at Ground Zero in the first 72 h after the World Trade Center (WTC) collapsed have progressively exhibited significant respiratory injuries. The few toxicology studies performed to date evaluated effects from just fine (<2.5 µm) WTC dusts; none examined health effects/toxicities from atmospheres bearing larger particle sizes, despite the fact the majority (496%) of dusts were >10µm and most FR likely entrained dusts by mouth breathing. Using a system that generated/delivered supercoarse (10–53 µm) WTC dusts to F344 rats (in a manner that mimicked FR exposures), this study sought to examine potential toxicities in the lungs. In this exploratory study, rats were exposed for 2 h to 100 mg WTC dust/m3 (while under isoflurane [ISO] anesthesia) or an air/ISO mixture; this dose conservatively modeled likely exposures by mouth-breathing FR facing ≈750–1000 mg WTC dust/m3. Lungs were harvested 2 h post-exposure and total RNA extracted for subsequent global gene expression analysis. Among the > 1000 genes affected by WTC dust (under ISO) or ISO alone, 166 were unique to the dust exposure. In many instances, genes maximally-induced by the WTC dust exposure (relative to in naïve rats) were unchanged/inhibited by ISO only; similarly, several genes maximally inhibited in WTC dust rats were largely induced/unchanged in rats that received ISO only. These outcomes reflect likely contrasting effects of ISO and the WTC dust on lung gene expression. Overall, the data show that lungs of rats exposed to WTC dust (under ISO) – after accounting for any impact from ISO alone – displayed increased expression of genes related to lung inflammation, oxidative stress, and cell cycle control, while several involved in anti-oxidant function were inhibited. These changes suggested acute inflammogenic effects and oxidative stress in the lungs of WTC dust-exposed rats. This study, thus, concludes that a single very high exposure to WTC dusts could

  1. Mutation and expression of multiple treatment response-related genes in a population with locally advanced non-small cell lung cancer

    PubMed Central



    Individual therapy based on various pathohistological types and biological characteristics may be the practical trend of advanced non-small cell lung cancer (NSCLC) treatment. To provide a molecular criterion for drug selection, we investigated the incidence of somatic mutation and mRNA expression levels of common genes relevant to treatment response in a population with locally advanced NSCLC. Mutant-enriched and branched DNA-liquidchip technology (bDNA-LCT) were used to detect the somatic mutations in the epidermal growth factor receptor (EGFR), KRAS, BRAF and phosphatidylinositol-3-kinase catalytic α (PIK3CA) genes, and mRNA levels of EGFR, ERCC1, class III β-tubulin (TUBB3) and TYMS, separately, in paraffin tissue blocks from 30 patients with stage IIIA NSCLC. Our current findings revealed that 6, 4 and 2 out of 30 samples were found with mutations in exons 19, 21 and 20 of the EGFR gene, respectively. The mutation incidence of exons 19 and 21 had a positive correlation with EGFR mRNA expression. Mutations in exons 12 and 13 of the K-ras gene were found in 2 out of 30, and 1 out of 30 samples, separately. Three out of 30 samples were found with mutations in codon 542 of the PIK3CA gene. No mutations were found in the BRAF gene. The expression levels of ERCC1 and TUBB3 mRNAs were higher in patients with adenocarcinoma than those in patients with squamous cell carcinoma. The expression of TYMS mRNA in patients with adenocarcinoma was lower than that in patients with squamous cell carcinoma. In conclusion, mutations and mRNA expression of these commonly studied genes provides a basis for the selection of suitable molecular markers for individual treatment in a population with locally advanced NSCLC. PMID:22740923

  2. High MET receptor expression but not gene amplification in ALK 2p23 rearrangement positive non-small-cell lung cancer.


    Feng, Yan; Minca, Eugen C; Lanigan, Christopher; Liu, Angen; Zhang, Wei; Yin, Lihong; Pennell, Nathan A; Farver, Carol; Tubbs, Raymond; Ma, Patrick C


    Overexpression of MET receptor tyrosine kinase and its ligand hepatocyte growth factor (HGF) and MET gene amplification have been well-documented in non-small-cell lung cancer (NSCLC). Activated MET signaling plays an important role in human cancer tumorigenesis, metastasis, and drug resistance. However, the deregulation of MET/HGF pathway in NSCLC harboring ALK gene rearrangement (ALK[+]), which is sensitive to dual ALK and MET inhibitor Crizotinib, has not been reported. We performed systematic analysis of MET/HGF expression by immunohistochemistry (IHC) and MET gene amplification by dual color, dual hapten bright field in situ hybridization in 19 ALK(+) and 73 ALK(-) NSCLC tumor tissues from those who had clinical ALK rearrangement test done at the Cleveland Clinic from August 2010 to January 2013. IHC scoring was interpreted on a standard four-tier system. The percentage of MET IHC score 0, 1+, 2+, and 3+ were 5.5%, 27.8%, 50.0%, and 16.7% in ALK(+) group, compared with 28.8%, 33.9%, 23.7%, and 13.6% in ALK(-) group, respectively. The MET high expression (IHC score 2 or 3) was significantly higher in ALK(+) group statistically (66.7% versus 37.3%, p = 0.03). HGF-high expression (IHC score 2 or 3) was 33.3% in ALK(+) and 15.8% in ALK(-) (p = 0.17). We identified eight cases in ALK(-) and one case in ALK(+) tumor who had MET gene amplification (18.4% versus 7.1%, p = 0.43) by dual color, dual hapten bright field in situ hybridization. No significant correlation between MET protein receptor expression and gene amplification was identified. Our study demonstrated for the first time that MET receptor expression, but not MET gene amplification, is significantly increased in ALK(+) NSCLC. MET gene amplification is a relatively rare event in this unique population compared with ALK(-) NSCLC.

  3. Investigation by microarray analysis of effects of cigarette design characteristics on gene expression in human lung mucoepidermoid cancer cells NCI-H292 exposed to cigarette smoke.


    Sekine, Takashi; Sakaguchi, Chikako; Fukano, Yasuo


    The effects of tobacco leaf types and the presence or absence of charcoal in the cigarette filters on gene expression were investigated using cigarette prototypes made of either flue-cured (FC) leaf or burley (BLY) leaf and Kentucky Reference 2R4F as a representative blend cigarette with cellulose acetate filters or charcoal filters. NCI-H292, human lung mucoepidermoid carcinoma cell line, was exposed to the total particulate matter (TPM) and gas/vapor phase (GVP) from each prototype for 8h and then the changes in gene expression from microarray data were analyzed. A number of genes associated with oxidative stress, inflammation, DNA damage and xenobiotic response were modified by the two fractions, TPM and GVP, from the three prototypes with cellulose acetate filters. Both TPM and GVP fractions strongly enhanced the gene expression of HMOX1, which is encoding the limiting enzyme in heme degradation and a key regulator of oxidative stress and inflammatory process. Comparing the effects of TPM and GVP fraction, TPM strongly activated Nrf2 pathway-mediated anti-oxidative stress reaction, whereas GVP caused notable DNA damage response. In comparison of FC and BLY, TPM from FC more strongly induced the expression of histone family proteins than that from BLY. GVP from FC markedly induced gene expression associated with HSP70-mediated inflammation relative to that from BLY. Charcoal included in the filter strongly reduced the effects of GVP from each cigarette on gene expression. However, charcoal did not modified the effects of TPM. As a whole, charcoal is a useful material for reducing the biological effects of GVP.

  4. Association of PD-1, PD-L1, and CTLA-4 Gene Expression and Clinicopathologic Characteristics in Patients With Non-Small-Cell Lung Cancer.


    Lafuente-Sanchis, Aránzazu; Zúñiga, Ángel; Estors, Miriam; Martínez-Hernández, Néstor J; Cremades, Antonio; Cuenca, María; Galbis, José M


    Recent studies show a potential benefit of therapies that target programmed death receptor 1 (PD-1)/programmed death-ligand 1 (PD-L1) and cytotoxic T-lymphocyte antigen 4 (CTLA-4) inhibitory checkpoints in a subgroup of patients with non-small-cell lung cancer (NSCLC), without the clinicopathologic characteristics related to positive responses to these treatments being well determined. The aim of this study was to determine PD-1, PD-L1, and CTLA-4 gene expression at the mRNA level in tumoral tissue from patients with NSCLC and analyze their possible relationship with the clinicopathological characteristics and their potential prognostic role. PD-1, PD-L1, and CTLA-4 expression levels were analyzed using real-time quantitative reverse transcriptase polymerase chain reaction in fresh-frozen tumor and normal adjacent lung tissue samples from 78 patients with NSCLC. Later, a significant association between mRNA levels, clinicopathologic characteristics, and patient's survival was assessed. No significant correlation between gene expression levels and sex, age, histological type, smoking status, pathologic stage, or tumor differentiation was found. However, higher levels of PD-1 were significantly associated with worse prognosis in patients with NSCLC, and PD-L1 overexpression was associated with a worse prognosis in stage I patients and in Grade 1 to 2 tumors. Alterations in PD-1/PD-L1 and CTLA-4 expression in lung tumoral tissue seem not to be related to age, sex, smoking status, histological type, pathological stage, or tumor differentiation degree. However, PD-1 and PD-L1 overexpression might predict worse survival in patients with stage I NSCLC and in well differentiated tumors. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Gene Expression Changes in Human Lung Cells Exposed to Arsenic, Chromium, Nickel or Vanadium Indicate the First Steps in Cancer

    PubMed Central

    Clancy, Hailey A.; Sun, Hong; Passantino, Lisa; Kluz, Thomas; Muñoz, Alexandra; Zavadil, Jiri; Costa, Max


    The complex process of carcinogenesis begins with transformation of a single cell to favor aberrant traits such as loss of contact inhibition and unregulated proliferation – features found in every cancer. Despite cancer’s widespread prevalence, the early events that initiate cancer remain elusive, and without knowledge of these events cancer prevention is difficult. Here we show that exposure to As, Cr, Ni, or Vanadium (V) promotes changes in gene expression that occur in conjunction with aberrant growth. We exposed immortalized human bronchial epithelial cells to one of four metals/metalloid for four to eight weeks and selected transformed clonal populations based upon anchorage independent growth of single cells in soft agar. We detected a metal-specific footprint of cancer-related gene expression that was consistent across multiple transformed clones. These gene expression changes persisted in the absence of the progenitor metal for numerous cell divisions. Our results show that even a brief exposure to a carcinogenic metal may cause many changes in gene expression in the exposed cells, and that from these many changes, the specific change(s) that each metal causes that initiate cancer likely arise. PMID:22714537

  6. Early alterations in extracellular matrix and transforming growth factor [beta] gene expression in mouse lung indicative of late radiation fibrosis

    SciTech Connect

    Finkelstein, J.N.; Johnston, C.J.; Baggs, R.; Rubin, P. )


    Fibrosis, characterized by the accumulation of collagen, is a late result of thoracic irradiation. The expression of late radiation injury can be found immediately after irradiation by measuring messenger RNA (mRNA) abundance. To determine if extracellular matrix mRNA and transforming growth factor beta abundance was affected acutely after irradiation, the authors measured mRNA levels of collagen I (CI), collagen III (CIII), collagen IV (CIV), fibronectin (FN), and transforming growth factor [beta] (TGF[beta][sub 1,2 3]) in mouse lungs on day 1 and day 14 after graded doses of radiation. C57BL/6 female mice were irradiated with a single dose to the thorax of 5 or 12.5 Gy. Total lung RNA was prepared and immobilized by Northern and slot blotting and hybridized with radiolabelled cDNA probes for CI, CIII, CIV, FN, TGF[beta][sub 1,2 3] and a control probe encoding for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Autoradiographic data were quantified by video densitometry and results normalized to GAPDH. Changes in the expression of CI, CIII, CIV, FN and TGF[beta][sub 1,2 3] were observed as early as 1 day after exposure. Through 14 days, changes in mRNA up to 5-fold were seen for any one dose. Dose related changes as high as 10-fold were also evident. The CI:CIII ratio increased gradually for the 5 Gy dose at 14 days postirradiation while the CI:CII ratio for the 12.5 Gy dose decreased by approximately 4-fold as compared to the control. These studies suggest that alterations in expression of extracellular matrix and TGF[beta] mRNA occur very early after radiation injury even at low doses and may play a role in the development of chronic fibrosis. 37 refs., 6 figs.


    PubMed Central

    Kim, Namjin; Yamamoto, Hiroaki; Pauling, Michelle Haynes; Lorizio, Walter; Vu, Thiennu H.


    Epithelial-mesenchymal interactions are essential for tissue patterning during organogenesis. Distal lung epithelium and its adjacent mesenchyme comprise the epithelial-mesenchymal signaling unit that regulates lung branching morphogenesis. Tissue recombination experiments have demonstrated the importance of mesenchymal signals in inducing lung epithelial differentiation and branching, but the role of the epithelium in regulating mesenchymal signals has not been well characterized. Using transgenic mice, we ablated distal lung epithelial cells during lung development by inducing the expression of a constitutively active proapoptotic Bax protein under the surfactant protein C (SP-C) promoter. We found that epithelial cell ablation results in impaired lung branching morphogenesis, which progresses to emphysematous airspaces in the adults. Mesenchymal expression of fibroblast growth factor 10 (Fgf-10), whose strict spatial and temporal expression is critical for proper lung branching morphogenesis, is disrupted and loses its localized pattern. Interestingly, the expression of sonic hedgehog (Shh), an epithelial gene known to modulate Fgf-10 expression, is unchanged, indicating the existence of other distal epithelial signals that regulate mesenchymal Fgf-10 expression. We propose that distal SP-C expressing lung epithelial cells provide essential signals for the downregulation of Fgf-10 expression in the distal mesenchyme during lung development. PMID:19115389

  8. Ablation of lung epithelial cells deregulates FGF-10 expression and impairs lung branching morphogenesis.


    Kim, Namjin; Yamamoto, Hiroaki; Pauling, Michelle Haynes; Lorizio, Walter; Vu, Thiennu H


    Epithelial-mesenchymal interactions are essential for tissue patterning during organogenesis. Distal lung epithelium and its adjacent mesenchyme comprise the epithelial-mesenchymal signaling unit that regulates lung branching morphogenesis. Tissue recombination experiments have demonstrated the importance of mesenchymal signals in inducing lung epithelial differentiation and branching, but the role of the epithelium in regulating mesenchymal signals has not been well characterized. Using transgenic mice, we ablated distal lung epithelial cells during lung development by inducing the expression of a constitutively active proapoptotic Bax protein under the surfactant protein C (SP-C) promoter. We found that epithelial cell ablation results in impaired lung branching morphogenesis, which progresses to emphysematous airspaces in the adults. Mesenchymal expression of fibroblast growth factor 10 (Fgf-10), whose strict spatial and temporal expression is critical for proper lung branching morphogenesis, is disrupted and loses its localized pattern. Interestingly, the expression of sonic hedgehog (Shh), an epithelial gene known to modulate Fgf-10 expression, is unchanged, indicating the existence of other distal epithelial signals that regulate mesenchymal Fgf-10expression. We propose that distal SP-C expressing lung epithelial cells provide essential signals for the downregulation of Fgf-10 expression in the distal mesenchyme during lung development. 292:123-130, 2009. (c) 2008 Wiley-Liss, Inc.

  9. Gene and miRNA expression signature of Lewis lung carcinoma LLC1 cells in extracellular matrix enriched microenvironment.


    Stankevicius, Vaidotas; Vasauskas, Gintautas; Bulotiene, Danute; Butkyte, Stase; Jarmalaite, Sonata; Rotomskis, Ricardas; Suziedelis, Kestutis


    The extracellular matrix (ECM), one of the key components of tumor microenvironment, has a tremendous impact on cancer development and highly influences tumor cell features. ECM affects vital cellular functions such as cell differentiation, migration, survival and proliferation. Gene and protein expression levels are regulated in cell-ECM interaction dependent manner as well. The rate of unsuccessful clinical trials, based on cell culture research models lacking the ECM microenvironment, indicates the need for alternative models and determines the shift to three-dimensional (3D) laminin rich ECM models, better simulating tissue organization. Recognized advantages of 3D models suggest the development of new anticancer treatment strategies. This is among the most promising directions of 3D cell cultures application. However, detailed analysis at the molecular level of 2D/3D cell cultures and tumors in vivo is still needed to elucidate cellular pathways most promising for the development of targeted therapies. In order to elucidate which biological pathways are altered during microenvironmental shift we have analyzed whole genome mRNA and miRNA expression differences in LLC1 cells cultured in 2D or 3D culture conditions. In our study we used DNA microarrays for whole genome analysis of mRNA and miRNA expression differences in LLC1 cells cultivated in 2D or 3D culture conditions. Next, we indicated the most common enriched functional categories using KEGG pathway enrichment analysis. Finally, we validated the microarray data by quantitative PCR in LLC1 cells cultured under 2D or 3D conditions or LLC1 tumors implanted in experimental animals. Microarray gene expression analysis revealed that 1884 genes and 77 miRNAs were significantly altered in LLC1 cells after 48 h cell growth under 2D and ECM based 3D cell growth conditions. Pathway enrichment results indicated metabolic pathway, MAP kinase, cell adhesion and immune response as the most significantly altered

  10. Inactivation of LLC1 gene in nonsmall cell lung cancer

    PubMed Central

    Hong, Kyeong-Man; Yang, Sei-Hoon; Chowdhuri, Sinchita R.; Player, Audrey; Hames, Megan; Fukuoka, Junya; Meerzaman, Daoud; Dracheva, Tatiana; Sun, Zhifu; Yang, Ping; Jen, Jin


    Serial analysis of gene expression studies led us to identify a previously unknown gene, c20orf85, that is present in the normal lung epithelium, but absent or downregulated in most primary non-small cell lung cancers and lung cancer cell lines. We named this gene LLC1 for Low in Lung Cancer 1. LLC1 is located on chromosome 20q13.3 and has a 70% GC content in the promoter region. It has 4 exons and encodes a protein containing 137 amino acids. By in situ hybridization, we observed that LLC1 message is localized in normal lung bronchial epithelial cells, but absent in 13 of 14 lung adenocarcinoma and 9 out of 10 lung squamous carcinoma samples. Methylation at CpG sites of the LLC1 promoter was frequently observed in lung cancer cell lines and in a fraction of primary lung cancer tissues. Treatment with 5-aza deoxycytidine resulted in a reduced methylation of the LLC1 promoter concomitant with the increase of LLC1 expression. These results suggest that inactivation of LLC1 by means of promoter methylation is a frequent event in nonsmall cell lung cancer and may play a role in lung tumorigenesis. PMID:17304513

  11. p53 gene product expression in resected non-small cell carcinoma of the lung, with studies of concurrent cytological preparations and microwave antigen retrieval.

    PubMed Central

    Binks, S; Clelland, C A; Ronan, J; Bell, J


    AIM: To document the frequency and extent of p53 gene product expression in paraffin sections of resected non-small cell carcinoma of the lung and in cytological preparations of the same tumours; to determine the effect of microwave antigen retrieval on antigen detection. METHODS: Representative paraffin sections of 50 non-small cell carcinomas were stained with an antibody to p53 gene product (DO-7) both with and without prior microwave antigen retrieval. Cytoblocks and cell smears obtained from 19 cases were similarly stained. RESULTS: Using a histochemical scoring system (0-300) which takes into account staining intensity and extent, 78% (n = 39) of microwave pretreated paraffin sections and 52% (n = 26) of non-pretreated sections scored between 5 and 300; p = 0.001; 56% (n = 28) of microwave pretreated sections and only 2% (n = 1) of non-pretreated sections scored between 100 and 300 (p = 0.0001); 75% of direct smears of tumours and 80% of cytoblocks stained similarly to the paraffin sections of the resected specimens. No smears or cytoblocks stained positively when the sections of the resected specimen were negative. CONCLUSIONS: As up to 78% of non-small cell lung carcinomas overexpress p53 gene product, this may prove to be a valuable diagnostic method in biopsy or cytological material when the morphological diagnosis is uncertain. Microwave antigen retrieval is effective on formalin fixed tissue. Images PMID:9215149

  12. cDNA microarray analysis of the effect of cantharidin on DNA damage, cell cycle and apoptosis-associated gene expression in NCI-H460 human lung cancer cells in vitro.


    Hsia, Te-Chun; Yu, Chien-Chih; Hsu, Shu-Chun; Tang, Nou-Ying; Lu, Hsu-Feng; Yu, Chun-Shu; Wu, Shin-Hwar; Lin, Jaung-Geng; Chung, Jing-Gung


    Cantharidin (CTD) induces cytotoxic effects in different types of human cancer cell; however, to date, there have been no studies on the effects of CTD on gene expression in human lung cancer cells and the potential associated signaling pathways. Therefore, the present study aimed to investigate how CTD affects the expression of key genes and functional pathways of human H460 lung cancer cells using complementary DNA microarray analysis. Human H460 lung cancer cells were cultured for 24 h in the presence or absence of 10 µM CTD; gene expression was then examined using microarray analysis. The results indicated that 8 genes were upregulated > 4-fold, 29 genes were upregulated >3-4-fold and 156 genes were upregulated >2-3-fold. In addition, 1 gene was downregulated >4 fold, 14 genes were downregulated >3-4-fold and 150 genes were downregulated >2-3 fold in H460 cells following exposure to CTD. It was found that CTD affected DNA damage genes, including DNIT3 and GADD45A, which were upregulated 2.26- and 2.60-fold, respectively, as well as DdiT4, which was downregulated 3.14-fold. In addition, the expression of genes associated with the cell cycle progression were altered, including CCND2, CDKL3 and RASA4, which were upregulated 2.72-, 2.19- and 2.72-fold, respectively; however, CDC42EP3 was downregulated 2.16-fold. Furthermore, apoptosis-associated genes were differentially expressed, including CARD6, which was upregulated 3.54-fold. In conclusion, the present study demonstrated that CTD affected the expression of genes associated with DNA damage, cell cycle progression and apoptotic cell death in human lung cancer H460 cells.

  13. Evaluation of gene expression changes in human primary lung epithelial cells following 24-hr exposures to inorganic arsenic and its methylated metabolites and to arsenic trioxide.


    Efremenko, Alina Y; Seagrave, JeanClare; Clewell, Harvey J; Van Landingham, Cynthia; Gentry, P Robinan; Yager, Janice W


    The concentration response for altered gene expression in primary lung epithelial cells was determined following two treatments with arsenicals: (1) a mixture of trivalent arsenic compounds representative of urinary arsenic concentrations in exposed human populations, and (2) arsenite (As2 O3 ) a common form of inhaled arsenic dust that is frequently used in both in vivo and in vitro experimental exposures. Biochemical assays did not detect any evidence of cytotoxicity at the concentrations used, apart from a concentration-related increase in cellular heme oxygenase that was also indicated by the genomic analysis. Cell signal pathway enrichment analysis indicated similar responses to both treatments, with concentration-related responses in pathways related to cell adhesion, cytoskeleton remodeling, development (morphogenesis), cell cycle control, and to a lesser extent inflammatory responses. These cellular responses to arsenic were consistent with those observed in a previous study with primary uroepithelial cells. Benchmark dose analysis also demonstrated similar potency of the two treatments as well as comparable sensitivity of the two cell types. A number of genes showing similar concentration-dependent expression across individuals in both bladder and lung cells were identified, including heme oxygenase 1, thioredoxin reductase, DNA damage binding protein 2, and thrombomodulin. The data on human primary lung cells from this study, together with the data from human primary uroepithelial cells, support a conclusion that biological responses to arsenic by human cells under study conditions are unlikely to occur at concentrations below 0.1 µM. Environ. Mol. Mutagen. 56:477-490, 2015. © 2015 Wiley Periodicals, Inc.

  14. Quantitative analysis of mRNA expression levels and DNA methylation profiles of three neighboring genes: FUS1, NPRL2/G21 and RASSF1A in non-small cell lung cancer patients.


    Pastuszak-Lewandoska, Dorota; Kordiak, Jacek; Migdalska-Sęk, Monika; Czarnecka, Karolina H; Antczak, Adam; Górski, Paweł; Nawrot, Ewa; Kiszałkiewicz, Justyna M; Domańska, Daria; Brzeziańska-Lasota, Ewa


    Tumor suppressor gene (TSG) inactivation plays a crucial role in carcinogenesis. FUS1, NPRL2/G21 and RASSF1A are TSGs from LUCA region at 3p21.3, a critical chromosomal region in lung cancer development. The aim of the study was to analyze and compare the expression levels of these 3 TSGs in NSCLC, as well as in macroscopically unchanged lung tissue surrounding the primary lesion, and to look for the possible epigenetic mechanism of TSG inactivation via gene promoter methylation. Expression levels of 3 TSGs and 2 DNA methyltransferases, DNMT1 and DNMT3B, were assessed using real-time PCR method (qPCR) in 59 primary non-small cell lung tumors and the matched macroscopically unchanged lung tissue samples. Promoter methylation status of TSGs was analyzed using methylation-specific PCRs (MSP method) and Methylation Index (MI) value was calculated for each gene. The expression of all three TSGs were significantly different between NSCLC subtypes: RASSF1A and FUS1 expression levels were significantly lower in squamous cell carcinoma (SCC), and NPRL2/G21 in adenocarcinoma (AC). RASSF1A showed significantly lower expression in tumors vs macroscopically unchanged lung tissues. Methylation frequency was 38-76%, depending on the gene. The highest MI value was found for RASSF1A (52%) and the lowest for NPRL2/G21 (5%). The simultaneous decreased expression and methylation of at least one RASSF1A allele was observed in 71% tumor samples. Inverse correlation between gene expression and promoter methylation was found for FUS1 (rs = -0.41) in SCC subtype. Expression levels of DNMTs were significantly increased in 75-92% NSCLCs and were significantly higher in tumors than in normal lung tissue. However, no correlation between mRNA expression levels of DNMTs and DNA methylation status of the studied TSGs was found. The results indicate the potential role of the studied TSGs in the differentiation of NSCLC histopathological subtypes. The significant differences in RASSF1A expression

  15. Ectopic expression of C/EBPalpha in the lung epithelium disrupts late lung development.


    Berg, Tove; Didon, Lukas; Nord, Magnus


    The lung develops from the endoderm through a process of branching morphogenesis. This process is highly active during the pseudoglandular stage of lung development and continues into the canalicular stage, resulting in the formation of terminal sacs. CCAAT/enhancer binding proteins (C/EBPs) are transcription factors regulating central aspects of differentiation and proliferation. We report here the developmental expression of C/EBPalpha, -beta, and -delta in the lung. C/EBPalpha exhibits a dynamic expression pattern and is first detected during the late pseudoglandular stage. At this stage, expression is observed in a subset of epithelial cells in the distal parts of the branching tubules. The expression of C/EBPalpha is confined to nonproliferating cells. To examine the role of C/EBPalpha in lung development, we generated transgenic mice ectopically expressing C/EBPalpha in the lung epithelium using the human surfactant protein C promoter. Lungs from these mice were of normal size but exhibited a phenotype characterized by fewer and larger developing epithelial tubules, indicating that the branching process was affected. No effects on overall proliferation or cellular differentiation were observed. When this phenotype was compared with that of mice carrying a targeted mutation of the Cebpa gene, the Cebpa-/- mice exhibited a similar developmental phenotype. In conclusion, our results show a role for C/EBPalpha in lung development and suggest a function in the later stages of lung branching morphogenesis.

  16. Gene and miRNA expression profiles of mouse Lewis lung carcinoma LLC1 cells following single or fractionated dose irradiation.


    Stankevicius, Vaidotas; Kuodyte, Karolina; Schveigert, Diana; Bulotiene, Danute; Paulauskas, Tomas; Daniunaite, Kristina; Suziedelis, Kestutis


    In clinical practice ionizing radiation (IR) is primarily applied to cancer treatment in the form of fractionated dose (FD) irradiation. Despite this fact, a substantially higher amount of current knowledge in the field of radiobiology comes from in vitro studies based on the cellular response to single dose (SD) irradiation. In addition, intrinsic and acquired resistance to IR remains an issue in clinical practice, leading to radiotherapy treatment failure. Numerous previous studies suggest that an improved understanding of the molecular processes involved in the radiation-induced DNA damage response to FD irradiation could improve the effectiveness of radiotherapy. Therefore, the present study examined the differential expression of genes and microRNA (miRNA) in murine Lewis lung cancer (LLC)1 cells exposed to SD or FD irradiation. The results of the present study indicated that the gene and miRNA expression profiles of LLC1 cells exposed to irradiation were dose delivery type-dependent. Data analysis also revealed that mRNAs may be regulated by miRNAs in a radiation-dependent manner, suggesting that these mRNAs and miRNAs are the potential targets in the cellular response to SD or FD irradiation. However, LLC1 tumors after FD irradiation exhibited no significant changes in the expression of selected genes and miRNAs observed in the irradiated cells in vitro, suggesting that experimental in vitro conditions, particularly the tumor microenvironment, should be considered in detail to promote the development of efficient radiotherapy approaches. Nevertheless, the present study highlights the primary signaling pathways involved in the response of murine cancer cells to irradiation. Data presented in the present study can be applied to improve the outcome and development of radiotherapy in preclinical animal model settings.

  17. Methylation of RAD51B, XRCC3 and other homologous recombination genes is associated with expression of immune checkpoints and an inflammatory signature in squamous cell carcinoma of the head and neck, lung and cervix

    PubMed Central

    Rieke, Damian T.; Ochsenreither, Sebastian; Klinghammer, Konrad; Seiwert, Tanguy Y.; Klauschen, Frederick; Tinhofer, Inge; Keilholz, Ulrich


    Immune checkpoints are emerging treatment targets, but mechanisms underlying checkpoint expression are poorly understood. Since alterations in DNA repair genes have been connected to the efficacy of checkpoint inhibitors, we investigated associations between methylation of DNA repair genes and CTLA4 and CD274 (PD-L1) expression. A list of DNA repair genes (179 genes) was selected from the literature, methylation status and expression of inflammation-associated genes (The Cancer Genome Atlas data) was correlated in head and neck squamous cell carcinoma (HNSCC), cervical and lung squamous cell carcinoma. A significant positive correlation of the methylation status of 15, 3 and 2 genes with checkpoint expression was identified, respectively. RAD51B methylation was identified in all cancer subtypes. In HNSCC and cervical cancer, there was significant enrichment for homologous recombination genes. Methylation of the candidate genes was also associated with expression of other checkpoints, ligands, MHC- and T-cell associated genes as well as an interferon-inflammatory immune gene signature, predictive for the efficacy of PD-1 inhibition in HNSCC. Homologous recombination deficiency might therefore be mediated by DNA repair gene hypermethylation and linked to an immune-evasive phenotype in SCC. The methylation status of these genes could represent a new predictive biomarker for immune checkpoint inhibition. PMID:27683114

  18. Gene expression studies demonstrate that the K-ras/Erk MAP kinase signal transduction pathway and other novel pathways contribute to the pathogenesis of cumene-induced lung tumors.


    Wakamatsu, Nobuko; Collins, Jennifer B; Parker, Joel S; Tessema, Mathewos; Clayton, Natasha P; Ton, Thai-Vu T; Hong, Hue-Hua L; Belinsky, Steven; Devereux, Theodora R; Sills, Robert C; Lahousse, Stephanie A


    National Toxicology Program (NTP) inhalation studies demonstrated that cumene significantly increased the incidence of alveolar/bronchiolar adenomas and carcinomas in B6C3F1 mice. Cumene or isopropylbenzene is a component of crude oil used primarily in the production of phenol and acetone. The authors performed global gene expression analysis to distinguish patterns of gene regulation between cumene-induced tumors and normal lung tissue and to look for patterns based on the presence or absence of K-ras and p53 mutations in the tumors. Principal component analysis segregated the carcinomas into groups with and without K-ras mutations, but failed to separate the tumors based on p53 mutation status. Expression of genes associated with the Erk MAP kinase signaling pathway was significantly altered in carcinomas with K-ras mutations compared to tumors without K-ras mutations or normal lung. Gene expression analysis also suggested that cumene-induced carcinomas with K-ras mutations have greater malignant potential than those without mutations. In addition, significance analysis of function and expression (SAFE) demonstrated expression changes of genes regulated by histone modification in carcinomas with K-ras mutations. The gene expression analysis suggested the formation of alveolar/bronchiolar carcinomas in cumene-exposed mice typically involves mutation of K-ras, which results in increased Erk MAP kinase signaling and modification of histones.

  19. Drug exposure in a metastatic human lung adenocarcinoma cell line gives rise to cells with differing adhesion, proliferation, and gene expression: Implications for cancer chemotherapy.


    Li, Huiling; He, Jianxing; Zhong, Nanshan; Hoffman, Robert M


    The Am1010 cell line was previously established from a metastatic deposit in an arm muscle from a patient with lung adenocarcinoma who had undergone four cycles of chemotherapy with cisplatin and taxol. Am1010 cells were labeled with red fluorescent protein or green fluorescent protein. A total of eight sublines were isolated following in vitro exposure to cisplatin or taxol. The sublines differed with regard to their adhesion and proliferation properties, with certain sublines exhibiting an increased proliferation rate and/or decreased surface adhesion. Gene expression assays demonstrated that tenascin C; cyclin D1; collagen, type 1, α2; integrin α1; related RAS viral (r‑ras) oncogene homolog 2; platelet‑derived growth factor C; and Src homolog 2 domain containing in the focal adhesion pathway, and intercellular adhesion molecule 1, F11 receptor, claudin 7 and cadherin 1 in the cell adhesion pathway, varied in expression among the sublines. The results of the present study suggested that drug exposure may alter the aggressiveness and metastatic potential of cancer cells, which has important implications for cancer chemotherapy.

  20. Slit and robo expression in the developing mouse lung.


    Greenberg, James M; Thompson, Felisa Y; Brooks, Sherry K; Shannon, John M; Akeson, Ann L


    Mammalian lung development is mediated through complex interactions between foregut endoderm and surrounding mesenchyme. As airway branching progresses, the mesenchyme undergoes dramatic remodeling and differentiation. Little is understood about the mechanisms that direct mesenchymal organization during lung development. A screen for candidate genes mediating this process identified Slit, a ligand for the Roundabout (Robo) receptor previously associated with guidance of axonal projections during central nervous system development. Here, we demonstrate by in situ hybridization that two Slit genes (Slit-2 and Slit-3) and two Robo genes (Robo-1 and Robo-2) are expressed in fetal lung mesenchyme. Slit-2 and Robo-1 expression is present throughout mesenchyme at midgestation and is not detectable by newborn day 1. Slit-3 and Robo-2 expression is restricted to specific, complementary subsets of mesenchyme. Robo-2 is expressed in mesenchymal cells immediately adjacent to large airways, whereas Slit-3 expression predominates in mesenchyme remote from airway epithelium. The temporal and spatial distribution of Slit and Robo mRNAs indicate that these genes may direct the functional organization and differentiation of fetal lung mesenchyme.

  1. Alterations of LKB1 and KRAS and Risk of Brain Metastasis: Comprehensive Characterization by Mutation Analysis, Copy Number, and Gene Expression in Non-Small-Cell Lung Carcinoma

    PubMed Central

    Zhao, Ni; Wilkerson, Matthew D.; Shah, Usman; Yin, Xiaoying; Wang, Anyou; Hayward, Michele C.; Roberts, Patrick; Lee, Carrie B.; Parsons, Alden M.; Thorne, Leigh B.; Haithcock, Benjamin E.; Grilley-Olson, Juneko E.; Stinchcombe, Thomas E.; Funkhouser, William K.; Wong, Kwok K.; Sharpless, Norman E.; Hayes, D. Neil


    Background Brain metastases are one of the most malignant complications of lung cancer and constitute a significant cause of cancer related morbidity and mortality worldwide. Recent years of investigation suggested a role of LKB1 in NSCLC development and progression, in synergy with KRAS alteration. In this study, we systematically analyzed how LKB1 and KRAS alteration, measured by mutation, gene expression (GE) and copy number (CN), are associated with brain metastasis in NSCLC. Materials and Methods Patients treated at University of North Carolina Hospital from 1990 to 2009 with NSCLC provided frozen, surgically extracted tumors for analysis. GE was measured using Agilent 44,000 custom-designed arrays, CN was assessed by Affymetrix GeneChip Human Mapping 250K Sty Array or the Genome-Wide Human SNP Array 6.0 and gene mutation was detected using ABI sequencing. Integrated analysis was conducted to assess the relationship between these genetic markers and brain metastasis. A model was proposed for brain metastasis prediction using these genetic measurements. Results 17 of the 174 patients developed brain metastasis. LKB1 wild type tumors had significantly higher LKB1 CN (p < 0.001) and GE (p = 0.002) than the LKB1 mutant group. KRAS wild type tumors had significantly lower KRAS GE (p < 0.001) and lower CN, although the latter failed to be significant (p = 0.295). Lower LKB1 CN (p = 0.039) and KRAS mutation (p = 0.007) were significantly associated with more brain metastasis. The predictive model based on nodal (N) stage, patient age, LKB1 CN and KRAS mutation had a good prediction accuracy, with area under the ROC curve of 0.832 (p < 0.001). Conclusion LKB1 CN in combination with KRAS mutation predicted brain metastasis in NSCLC. PMID:25224251

  2. Suppressive effects of a proton beam on tumor growth and lung metastasis through the inhibition of metastatic gene expression in 4T1 orthotopic breast cancer model.


    Kwon, Yun-Suk; Lee, Kyu-Shik; Chun, So-Young; Jang, Tae Jung; Nam, Kyung-Soo


    A proton beam is a next generation tool to treat intractable cancer. Although the therapeutic effects of a proton beam are well known, the effect on tumor metastasis is not fully described. Here, we investigated the effects of a proton beam on metastasis in highly invasive 4T1 murine breast cancer cells and their orthotopic breast cancer model. Cells were irradiated with 2, 4, 8 or 16 Gy proton beam, and changes in cell proliferation, survival, and migration were observed by MTT, colony forming and wound healing assays. 4T1 breast cancer cell-implanted BALB/c mice were established and the animals were randomly divided into 4 groups when tumor size reached 200 mm3. Breast tumors were selectively irradiated with 10, 20 or 30 Gy proton beam. Breast tumor sizes were measured twice a week, and breast tumor and lung tissues were pathologically observed. Metastasis-regulating gene expression was assessed with quantitative RT-PCR. A proton beam dose-dependently decreased cell proliferation, survival and migration in 4T1 murine breast cancer cells. Also, growth of breast tumors in the 4T1 orthotopic breast cancer model was significantly suppressed by proton beam irradiation without significant change of body weight. Furthermore, fewer tumor nodules metastasized from breast tumor into lung in mice irradiated with 30 Gy proton beam, but not with 10 and 20 Gy, than in control. We observed correspondingly lower expression levels of urokinase plasminogen activator (uPA), uPA receptor, cyclooxygenase (COX)-2, and vascular endothelial growth factor (VEGF), which are important factors in cancer metastasis, in breast tumor irradiated with 30 Gy proton beam. Proton beam irradiation did not affect expressions of matrix metalloproteinase (MMP)-9 and MMP-2. Taken together, the data suggest that, although proton beam therapy is an effective tool for breast cancer treatment, a suitable dose is necessary to prevent metastasis-linked relapse and poor prognosis.

  3. Acute and subchronic exposure to air particulate matter induces expression of angiotensin and bradykinin-related genes in the lungs and heart: Angiotensin-II type-I receptor as a molecular target of particulate matter exposure.


    Aztatzi-Aguilar, Octavio Gamaliel; Uribe-Ramírez, Marisela; Arias-Montaño, José Antonio; Barbier, Olivier; De Vizcaya-Ruiz, Andrea


    Particulate matter (PM) adverse effects on health include lung and heart damage. The renin-angiotensin-aldosterone (RAAS) and kallikrein-kinin (KKS) endocrine systems are involved in the pathophysiology of cardiovascular diseases and have been found to impact lung diseases. The aim of the present study was to evaluate whether PM exposure regulates elements of RAAS and KKS. Sprague-Dawley rats were acutely (3 days) and subchronically (8 weeks) exposed to coarse (CP), fine (FP) or ultrafine (UFP) particulates using a particulate concentrator, and a control group exposed to filtered air (FA). We evaluated the mRNA of the RAAS components At1, At2r and Ace, and of the KKS components B1r, B2r and Klk-1 by RT-PCR in the lungs and heart. The ACE and AT1R protein were evaluated by Western blot, as were HO-1 and γGCSc as indicators of the antioxidant response and IL-6 levels as an inflammation marker. We performed a binding assay to determinate AT1R density in the lung, also the subcellular AT1R distribution in the lungs was evaluated. Finally, we performed a histological analysis of intramyocardial coronary arteries and the expression of markers of heart gene reprogramming (Acta1 and Col3a1). The PM fractions induced the expression of RAAS and KKS elements in the lungs and heart in a time-dependent manner. CP exposure induced Ace mRNA expression and regulated its protein in the lungs. Acute and subchronic exposure to FP and UFP induced the expression of At1r in the lungs and heart. All PM fractions increased the AT1R protein in a size-dependent manner in the lungs and heart after subchronic exposure. The AT1R lung protein showed a time-dependent change in subcellular distribution. In addition, the presence of AT1R in the heart was accompanied by a decrease in HO-1, which was concomitant with the induction of Acta1 and Col3a1 and the increment of IL-6. Moreover, exposure to all PM fractions increased coronary artery wall thickness. We demonstrate that exposure to PM induces

  4. Electroporation-mediated Delivery of Genes in Rodent Models of Lung Contusion

    PubMed Central

    Machado-Aranda, David; Raghavendran, Krishnan


    Several of the biological processes involved in the pathogenesis of acute lung injury and acute respiratory distress syndrome after lung contusion are regulated at a genetic and epigenetic level. Thus, strategies to manipulate gene expression in this context are highly desirable not only to elucidate the mechanisms involved but also to look for potential therapies. In the present chapter, we describe mouse and rat models of inducing blunt thoracic injury followed by electroporation-mediated gene delivery to the lung. Electroporation is a highly efficient and easily reproducible technique that allows circumvention of several of lung gene delivery challenges and safety issues present with other forms of lung gene therapy. PMID:24510825

  5. Electroporation-mediated delivery of genes in rodent models of lung contusion.


    Machado-Aranda, David; Raghavendran, Krishnan


    Several of the biological processes involved in the pathogenesis of acute lung injury and acute respiratory distress syndrome after lung contusion are regulated at a genetic and epigenetic level. Thus, strategies to manipulate gene expression in this context are highly desirable not only to elucidate the mechanisms involved but also to look for potential therapies. In the present chapter, we describe mouse and rat models of inducing blunt thoracic injury followed by electroporation-mediated gene delivery to the lung. Electroporation is a highly efficient and easily reproducible technique that allows circumvention of several of lung gene delivery challenges and safety issues present with other forms of lung gene therapy.

  6. Differential gene expression of proinflammatory chemokines and cytokines in lungs of ascites-resistant and -susceptible broiler chickens following intravenous cellulose microparticle injection.


    Hamal, Krishna R; Wideman, Robert F; Anthony, Nicholas B; Erf, Gisela F


    Intravenous injection of microparticles (MPs) is a tool to reveal susceptibility to pulmonary hypertension (PH) syndrome (PHS, ascites) in broilers. After injection MPs get lodged in pulmonary arterioles and cause localized inflammation. To examine the expression of chemokines/cytokines during the MP-induced pulmonary inflammatory response, lungs were collected from 4-week-old broilers (6/line/time point) from the PHS-resistant (RES) and -susceptible (SUS) broilers before (0h) and after (2, 6, 12, 24, and 48h) MP injection and analyzed using quantitative RT-PCR. In both lines, expression of interleukin-1beta (IL-1beta), IL-6, IL-8, and K60 increased from 0 to 6h, reached peak levels at 6 and 12h, and decreased thereafter, whereas IL-4 and interferon gamma (IFN-gamma) expression remained elevated past 12h. Lungs from the RES line broilers had higher expression (P<0.05) of IL-1beta and IL-6 at 2, 6, and 12h; higher IL-8 at 6 and 12h; higher K60 at 6, 12, and 24h; higher IL-4 at 12, 24, and 48h and higher IFN-gamma expression at 6 and 48h post-MP injection than SUS line broilers. Higher expression of chemokines/cytokines in RES compared to SUS line lungs may explain the ability of RES line broilers to effectively counteract the MP-induced PH and resolve the vascular occlusion.

  7. Diet-derived 25-hydroxyvitamin D3 activates vitamin D receptor target gene expression and suppresses EGFR mutant non-small cell lung cancer growth in vitro and in vivo

    PubMed Central

    Verone-Boyle, Alissa R.; Shoemaker, Suzanne; Attwood, Kristopher; Morrison, Carl D.; Makowski, Andrew J.; Battaglia, Sebastiano; Hershberger, Pamela A.


    Epidemiologic studies implicate vitamin D status as a factor that influences growth of EGFR mutant lung cancers. However, laboratory based evidence of the biological effect of vitamin D in this disease is lacking. To fill this knowledge gap, we determined vitamin D receptor (VDR) expression in human lung tumors using a tissue microarray constructed of lung cancer cases from never-smokers (where EGFR gene mutations are prevalent). Nuclear VDR was detected in 19/19 EGFR mutant tumors. Expression tended to be higher in tumors with EGFR exon 19 deletions than those with EGFR L858R mutations. To study anti-proliferative activity and signaling, EGFR mutant lung cancer cells were treated with the circulating metabolite of vitamin D, 25-hydroxyvitamin D3 (25D3). 25D3 inhibited clonogenic growth in a dose-dependent manner. CYP27B1 encodes the 1α-hydroxylase (1αOHase) that converts 25D3 to the active metabolite, 1,25-dihydroxyvitamin D3 (1,25D3). Studies employing VDR siRNA, CYP27B1 zinc finger nucleases, and pharmacologic inhibitors of the vitamin D pathway indicate that 25D3 regulates gene expression in a VDR-dependent manner but does not strictly require 1αOHase-mediated conversion of 25D3 to 1,25D3. To determine the effects of modulating serum 25D3 levels on growth of EGFR mutant lung tumor xenografts, mice were fed diets containing 100 or 10,000 IU vitamin D3/kg. High dietary vitamin D3 intake resulted in elevated serum 25D3 and significant inhibition of tumor growth. No toxic effects of supplementation were observed. These results identify EGFR mutant lung cancer as a vitamin D-responsive disease and diet-derived 25D3 as a direct VDR agonist and therapeutic agent. PMID:26654942

  8. Study on expression of CDH4 in lung cancer.


    Li, Zhupeng; Su, Dan; Ying, Lisha; Yu, Guangmao; Mao, Weimin


    The human CDH4 gene, which encodes the R-cadherin protein, has an important role in cell migration and cell adhesion, sorting, tissue morphogenesis, and tumor genesis. This study analyzed the relationship of CDH4 mRNA expression with lung cancer. Real time PCR was applied to detect CDH4 mRNA transcription in 142 paired cases of lung cancer and noncancerous regions. No correlation was identified between CDH4 mRNA expression and gender, age, lymphnode metastasis, TNM stage, family history, smoking state, drinking state (P > 0.05), but grade and histotype (P < 0.05). The relative CDH4 mRNA value was remarkably decreased in lung cancer tissues compared with noncancerous tissues (P = 0.001). We found that CDH4 mRNA expression was associated with grade and histotype. What is more, the relative CDH4 mRNA value was decreased in the lung cancer tissues. Our results suggested that CDH4 might be a putative tumor suppressor gene (TSG) in lung cancer.

  9. Basal Gene Expression by Lung CD4+ T Cells in Chronic Obstructive Pulmonary Disease Identifies Independent Molecular Correlates of Airflow Obstruction and Emphysema Extent

    PubMed Central

    Freeman, Christine M.; McCubbrey, Alexandra L.; Crudgington, Sean; Nelson, Joshua; Martinez, Fernando J.; Han, MeiLan K.; Washko, George R.; Chensue, Stephen W.; Arenberg, Douglas A.; Meldrum, Catherine A.; McCloskey, Lisa; Curtis, Jeffrey L.


    Lung CD4+ T cells accumulate as chronic obstructive pulmonary disease (COPD) progresses, but their role in pathogenesis remains controversial. To address this controversy, we studied lung tissue from 53 subjects undergoing clinically-indicated resections, lung volume reduction, or transplant. Viable single-cell suspensions were analyzed by flow cytometry or underwent CD4+ T cell isolation, followed either by stimulation with anti-CD3 and cytokine/chemokine measurement, or by real-time PCR analysis. In lung CD4+ T cells of most COPD subjects, relative to lung CD4+ T cells in smokers with normal spirometry: (a) stimulation induced minimal IFN-γ or other inflammatory mediators, but many subjects produced more CCL2; (b) the T effector memory subset was less uniformly predominant, without correlation with decreased IFN-γ production. Analysis of unstimulated lung CD4+ T cells of all subjects identified a molecular phenotype, mainly in COPD, characterized by markedly reduced mRNA transcripts for the transcription factors controlling TH1, TH2, TH17 and FOXP3+ T regulatory subsets and their signature cytokines. This mRNA-defined CD4+ T cell phenotype did not result from global inability to elaborate mRNA; increased transcripts for inhibitory CD28 family members or markers of anergy; or reduced telomerase length. As a group, these subjects had significantly worse spirometry, but not DLCO, relative to subjects whose lung CD4+ T cells expressed a variety of transcripts. Analysis of mRNA transcripts of unstimulated lung CD4+ T cell among all subjects identified two distinct molecular correlates of classical COPD clinical phenotypes: basal IL-10 transcripts correlated independently and inversely with emphysema extent (but not spirometry); by contrast, unstimulated IFN-γ transcripts correlated independently and inversely with reduced spirometry (but not reduced DLCO or emphysema extent). Aberrant lung CD4+ T cells polarization appears to be common in advanced COPD, but also

  10. IL-2–Controlled Expression of Multiple T Cell Trafficking Genes and Th2 Cytokines in the Regulatory T Cell-Deficient Scurfy Mice: Implication to Multiorgan Inflammation and Control of Skin and Lung Inflammation

    PubMed Central

    Sharma, Rahul; Sharma, Poonam R.; Kim, Youngchul; Leitinger, Norbert; Lee, Jae K.; Fu, Shu Man; Ju, Shyr-Te


    Scurfy (Sf) mice bear a mutation in the Foxp3 transcription factor, lack regulatory T cells (Treg), develop multiorgan inflammation, and die prematurely. The major target organs affected are skin, lungs, and liver. Sf mice lacking the Il2 gene (Sf.Il2−/−), despite being devoid of Treg, did not develop skin and lung inflammation, but the inflammation in liver, pancreas, submandibular gland, and colon remained. Genome-wide microarray analysis revealed hundreds of genes that were differentially regulated among Sf, Sf.Il2−/−, and B6 CD4+ T cells, but the most significant changes were those encoding receptors for trafficking/chemotaxis/retention and cytokines. Our study suggests that IL-2 controls the skin and lung inflammation in Sf mice in an apparent “organ-specific” manner through two novel mechanisms: by regulating the expression of genes encoding a variety of receptors for T cell trafficking/chemotaxis/retention and by regulating Th2 cell expansion and cytokine production. Thus, IL-2 is potentially a master regulator for multiorgan inflammation and an underlying etiological factor for various diseases associated with skin and lung inflammation. PMID:21169543

  11. Synergistic effects of co-administration of suicide gene expressing mesenchymal stem cells and prodrug-encapsulated liposome on aggressive lung melanoma metastases in mice.


    Zhang, Tian-Yuan; Huang, Bing; Wu, Hai-Bin; Wu, Jia-He; Li, Li-Ming; Li, Yan-Xin; Hu, Yu-Lan; Han, Min; Shen, You-Qing; Tabata, Yasuhiko; Gao, Jian-Qing


    The success of conventional suicide gene therapy for cancer treatment is still limited because of lack of efficient delivery methods, as well as poor penetration into tumor tissues. Mesenchymal stem cells (MSCs) have recently emerged as potential vehicles in improving delivery issues. However, these stem cells are usually genetically modified using viral gene vectors for suicide gene overexpression to induce sufficient therapeutic efficacy. This approach may result in safety risks for clinical translation. Therefore, we designed a novel strategy that uses non-viral gene vector in modifying MSCs with suicide genes to reduce risks. In addition, these cells were co-administrated with prodrug-encapsulated liposomes for synergistic anti-tumor effects. Results demonstrate that this strategy is effective for gene and prodrug delivery, which co-target tumor tissues, to achieve a significant decrease in tumor colonization and a subsequent increase in survival in a murine melanoma lung metastasis model. Moreover, for the first time, we demonstrated the permeability of MSCs within tumor nests by using an in vitro 3D tumor spheroid model. Thus, the present study provides a new strategy to improve the delivery problem in conventional suicide gene therapy and enhance the therapeutic efficacy. Furthermore, this study also presents new findings to improve our understanding of MSCs in tumor-targeted gene delivery. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Combined Use of Gene Expression Modeling and siRNA Screening Identifies Genes and Pathways Which Enhance the Activity of Cisplatin When Added at No Effect Levels to Non-Small Cell Lung Cancer Cells In Vitro

    PubMed Central

    Leung, Ada W. Y.; Hung, Stacy S.; Backstrom, Ian; Ricaurte, Daniel; Kwok, Brian; Poon, Steven; McKinney, Steven; Segovia, Romulo; Rawji, Jenna; Qadir, Mohammed A.; Aparicio, Samuel; Stirling, Peter C.; Steidl, Christian; Bally, Marcel B.


    Platinum-based combination chemotherapy is the standard treatment for advanced non-small cell lung cancer (NSCLC). While cisplatin is effective, its use is not curative and resistance often emerges. As a consequence of microenvironmental heterogeneity, many tumour cells are exposed to sub-lethal doses of cisplatin. Further, genomic heterogeneity and unique tumor cell sub-populations with reduced sensitivities to cisplatin play a role in its effectiveness within a site of tumor growth. Being exposed to sub-lethal doses will induce changes in gene expression that contribute to the tumour cell’s ability to survive and eventually contribute to the selective pressures leading to cisplatin resistance. Such changes in gene expression, therefore, may contribute to cytoprotective mechanisms. Here, we report on studies designed to uncover how tumour cells respond to sub-lethal doses of cisplatin. A microarray study revealed changes in gene expressions that occurred when A549 cells were exposed to a no-observed-effect level (NOEL) of cisplatin (e.g. the IC10). These data were integrated with results from a genome-wide siRNA screen looking for novel therapeutic targets that when inhibited transformed a NOEL of cisplatin into one that induced significant increases in lethality. Pathway analyses were performed to identify pathways that could be targeted to enhance cisplatin activity. We found that over 100 genes were differentially expressed when A549 cells were exposed to a NOEL of cisplatin. Pathways associated with apoptosis and DNA repair were activated. The siRNA screen revealed the importance of the hedgehog, cell cycle regulation, and insulin action pathways in A549 cell survival and response to cisplatin treatment. Results from both datasets suggest that RRM2B, CABYR, ALDH3A1, and FHL2 could be further explored as cisplatin-enhancing gene targets. Finally, pathways involved in repairing double-strand DNA breaks and INO80 chromatin remodeling were enriched in both

  13. Combined Use of Gene Expression Modeling and siRNA Screening Identifies Genes and Pathways Which Enhance the Activity of Cisplatin When Added at No Effect Levels to Non-Small Cell Lung Cancer Cells In Vitro.


    Leung, Ada W Y; Hung, Stacy S; Backstrom, Ian; Ricaurte, Daniel; Kwok, Brian; Poon, Steven; McKinney, Steven; Segovia, Romulo; Rawji, Jenna; Qadir, Mohammed A; Aparicio, Samuel; Stirling, Peter C; Steidl, Christian; Bally, Marcel B


    Platinum-based combination chemotherapy is the standard treatment for advanced non-small cell lung cancer (NSCLC). While cisplatin is effective, its use is not curative and resistance often emerges. As a consequence of microenvironmental heterogeneity, many tumour cells are exposed to sub-lethal doses of cisplatin. Further, genomic heterogeneity and unique tumor cell sub-populations with reduced sensitivities to cisplatin play a role in its effectiveness within a site of tumor growth. Being exposed to sub-lethal doses will induce changes in gene expression that contribute to the tumour cell's ability to survive and eventually contribute to the selective pressures leading to cisplatin resistance. Such changes in gene expression, therefore, may contribute to cytoprotective mechanisms. Here, we report on studies designed to uncover how tumour cells respond to sub-lethal doses of cisplatin. A microarray study revealed changes in gene expressions that occurred when A549 cells were exposed to a no-observed-effect level (NOEL) of cisplatin (e.g. the IC10). These data were integrated with results from a genome-wide siRNA screen looking for novel therapeutic targets that when inhibited transformed a NOEL of cisplatin into one that induced significant increases in lethality. Pathway analyses were performed to identify pathways that could be targeted to enhance cisplatin activity. We found that over 100 genes were differentially expressed when A549 cells were exposed to a NOEL of cisplatin. Pathways associated with apoptosis and DNA repair were activated. The siRNA screen revealed the importance of the hedgehog, cell cycle regulation, and insulin action pathways in A549 cell survival and response to cisplatin treatment. Results from both datasets suggest that RRM2B, CABYR, ALDH3A1, and FHL2 could be further explored as cisplatin-enhancing gene targets. Finally, pathways involved in repairing double-strand DNA breaks and INO80 chromatin remodeling were enriched in both

  14. Gene expression technology

    SciTech Connect

    Goeddel, D.V. )


    The articles in this volume were assemble to enable the reader to design effective strategies for the expression of cloned genes and cDNAs. More than a compilation of papers describing the multitude of techniques now available for expressing cloned genes, this volume provides a manual that should prove useful for solving the majority of expression problems one likely to encounter. The four major expression systems commonly available to most investigators are stressed: Escherichia coli, Bacillus subtilis, yeast, and mammalian cells. Each of these system has its advantages and disadvantages, details of which are found in Chapter 1 and the strategic overviews for the four major sections of the volume. The papers in each of these sections provide many suggestions on how to proceed if initial expression levels are not sufficient.


    EPA Science Inventory

    Quantitative RT-PCR is frequently used to analyze gene expression in different experimental systems. In this assay, housekeeping genes are frequently used to normalize for the variability between samples (relative quantification). We have examined the utility of using qRT-PCR and...


    EPA Science Inventory

    Quantitative RT-PCR is frequently used to analyze gene expression in different experimental systems. In this assay, housekeeping genes are frequently used to normalize for the variability between samples (relative quantification). We have examined the utility of using qRT-PCR and...

  17. “Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

    PubMed Central

    Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.


    Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

  18. The lung enriched transcription factor TTF-1 and the ubiquitously expressed proteins Sp1 and Sp3 interact with elements located in the minimal promoter of the rat Clara cell secretory protein gene.

    PubMed Central

    Toonen, R F; Gowan, S; Bingle, C D


    The mechanisms that direct expression of the Clara cell secretory protein (CCSP) gene to the bronchiolar epithelial cells of the lung remain to be elucidated. Previous studies have identified a number of proteins which bind to a functionally important region (Region 1) located -132 to -76 bp from the transcription start site in the rat CCSP gene. Subsequently we have shown that while Region 1 is an important positive regulator of CCSP gene expression, sequences 3' of this region (-75 to +38) are sufficient to confer tissue-specific expression of a reporter gene. In the present study we have used transient transfections with a deletion series of CCSP-CAT reporter plasmids (where CAT is chloramphenicol acetyltransferase) and gel mobility shift assays with a series of overlapping oligonucleotides covering the whole minimal promoter region to study protein-DNA interactions within this region. These studies have identified a conserved functional binding site for the lung and thyroid enriched homeodomain transcription factor TTF-1, located between positions -51 and -42 from the transcription start site. CCSP-CAT chimaeric reporters containing this region are specifically activated by TTF-1 in co-transfection assays, and nuclear extracts from cells which express TTF-1 bind to this region, as does in vitro translated rat TTF-1. Three additional conserved regions were identified, and in further gel mobility shift studies with an oligonucleotide spanning the conserved region immediately 5' to the TTF-1 site we identified a binding site for the ubiquitously expressed zinc-finger-containing proteins Sp1 and Sp3. These studies suggest that cell-type-restricted and ubiquitous nuclear proteins may play a combined role in the regulation of the CCSP gene within the bronchiolar epithelium by interacting with the minimal promoter region. PMID:8687389

  19. [Screening differential expression of docetaxel-resistance related genes of human lung adenocarcinoma cell line SPC-A1 by cDNA microarray].


    Sun, Hai; Geng, Jian; Chen, Longbang


    Docetaxel is one of effective chemotherapeutics in the last few years, however, it is interfered by drug resistance in its further application. The aim of this study is to screen differentially expressed genes of docetaxel resistant cell line SPC-A1/Docetaxel and its parent cell line SPC-A1 with gene chip technique. The cDNA retro-transcribed from equal quantity mRNA derived from SPC-A1/Docetaxel and SPC-A1 cell lines. The mixed probes were hybridized with Affymetrix GeneChip HG-U133A2.0. The acquired image was analyzed by Affymetrix GeneChip Operating Software Version 1.0. Then, part of these results were verified by RT-PCR. A total of 934 differentially expressed genes were screened out, in which up-and down-regulated genes were 428 and 506 respectively. These genes involved in ABC transporter, apoptosis regulator, tubulin, signal transducer, enzyme and so on. These differentially expressed genes may be related to the mechanisms of docetaxel resistance in SPC-A1/Docetaxel cell line.

  20. Gene variant linked to lung cancer risk

    A variation of the gene NFKB1, called rs4648127, is associated with an estimated 44 percent reduction in lung cancer risk. When this information, derived from samples obtained as part of a large NCI-sponsored prevention clinical trial, was compared with d

  1. Lung Cancer Gene Signatures and Clinical Perspectives

    PubMed Central

    Kuner, Ruprecht


    Microarrays have been used for more than two decades in preclinical research. The tumor transcriptional profiles were analyzed to select cancer-associated genes for in-deep functional characterization, to stratify tumor subgroups according to the histopathology or diverse clinical courses, and to assess biological and cellular functions behind these gene sets. In lung cancer—the main type of cancer causing mortality worldwide—biomarker research focuses on different objectives: the early diagnosis of curable tumor diseases, the stratification of patients with prognostic unfavorable operable tumors to assess the need for further therapy regimens, or the selection of patients for the most efficient therapies at early and late stages. In non-small cell lung cancer, gene and miRNA signatures are valuable to differentiate between the two main subtypes’ squamous and non-squamous tumors, a discrimination which has further implications for therapeutic schemes. Further subclassification within adenocarcinoma and squamous cell carcinoma has been done to correlate histopathological phenotype with disease outcome. Those tumor subgroups were assigned by diverse transcriptional patterns including potential biomarkers and therapy targets for future diagnostic and clinical applications. In lung cancer, none of these signatures have entered clinical routine for testing so far. In this review, the status quo of lung cancer gene signatures in preclinical and clinical research will be presented in the context of future clinical perspectives. PMID:27605195

  2. Assessing molecular initiating events (MIEs), key events (KEs) and modulating factors (MFs) for styrene responses in mouse lungs using whole genome gene expression profiling following 1-day and multi-week exposures.


    Andersen, Melvin E; Cruzan, George; Black, Michael B; Pendse, Salil N; Dodd, Darol; Bus, James S; Sarang, Satinder S; Banton, Marcy I; Waites, Robbie; McMullen, Patrick D


    Styrene increased lung tumors in mice at chronic inhalation exposures of 20ppm and greater. MIEs, KEs and MFs were examined using gene expression in three strains of male mice (the parental C57BL/6 strain, a CYP2F2(-/-) knock out and a CYP2F2(-/-) transgenic containing human CYP2F1, 2A13 and 2B6). Exposures were for 1-day and 1, 4 and 26weeks. After 1-day exposures at 1, 5, 10, 20, 40 and 120ppm significant increases in differentially expressed genes (DEGs) occurred only in parental strain lungs where there was already an increase in DEGs at 5ppm and then many thousands of DEGs by 120ppm. Enrichment for 1-day and 1-week exposures included cell cycle, mitotic M-M/G1 phases, DNA-synthesis and metabolism of lipids and lipoproteins pathways. The numbers of DEGs decreased steadily over time with no DEGs meeting both statistical significance and fold-change criteria at 26weeks. At 4 and 26weeks, some key transcription factors (TFs) - Nr1d1, Nr1d2, Dbp, Tef, Hlf, Per3, Per2 and Bhlhe40 - were upregulated (|FC|>1.5), while others - Npas, Arntl, Nfil3, Nr4a1, Nr4a2, and Nr4a3 - were down-regulated. At all times, consistent changes in gene expression only occurred in the parental strain. Our results support a MIE for styrene of direct mitogenicity from mouse-specific CYP2F2-mediated metabolites activating Nr4a signaling. Longer-term MFs include down-regulation of Nr4a genes and shifts in both circadian clock TFs and other TFs, linking circadian clock to cellular metabolism. We found no gene expression changes indicative of cytotoxicity or activation of p53-mediated DNA-damage pathways. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Rat Models of Cardiovascular Disease Demonstrate Distinctive Pulmonary Gene Expressions for Vascular Response Genes: Impact of Ozone Exposure

    EPA Science Inventory

    Comparative gene expression profiling of multiple tissues from rat strains with genetic predisposition to diverse cardiovascular diseases (CVD) can help decode the transcriptional program that governs organ-specific functions. We examined expressions of CVD genes in the lungs of ...

  4. Rat Models of Cardiovascular Disease Demonstrate Distinctive Pulmonary Gene Expressions for Vascular Response Genes: Impact of Ozone Exposure

    EPA Science Inventory

    Comparative gene expression profiling of multiple tissues from rat strains with genetic predisposition to diverse cardiovascular diseases (CVD) can help decode the transcriptional program that governs organ-specific functions. We examined expressions of CVD genes in the lungs of ...

  5. Triptolide reverses the Taxol resistance of lung adenocarcinoma by inhibiting the NF-κB signaling pathway and the expression of NF-κB-regulated drug-resistant genes.


    Jiang, Ning; Dong, Xiao-Peng; Zhang, Suo-Lin; You, Qing-Yong; Jiang, Xing-Tao; Zhao, Xiao-Gang


    Paclitaxel (or Taxol®) is a first-line chemotherapeutic drug for the treatment of non-small cell lung cancer; however, resistance to the drug is an important factor, which influences the outcome of chemotherapy. The present study aimed to investigate the role of triptolide (TPL) in reversing Taxol‑resistant human lung adenocarcinoma and to elucidate the underlying molecular mechanism of resistance reversal mediated by TPL. It was hypothesized that this experimental approach would assist in solving the problem of chemotherapeutic resistance in non‑small cell lung cancer, thereby improving the clinical outcomes. The human Taxol‑resistant lung adenocarcinoma cell line, A549/Taxol, was established. The resistance index of the cell line was calculated, according to the half maximal inhibitory concentration (IC50) of A549/Taxol IC50 of A549, to be 51.87. The levels of apoptosis and the cell cycle in the A549/Taxol cell line were assessed to confirm the effects of TPL at three different concentrations (0.03, 0.3 and 3 µmol/l) and treatment durations (2, 4, 6 and 12 h) by flow cytometric analysis, and the inhibition of the NF‑κB signaling pathway and the expression of NF‑κB‑regulated drug‑resistant proteins were determined by immunofluorescence and western blotting, respectively. The administration of TPL promoted cell apoptosis in the A549/Taxol lung adenocarcinoma Taxol‑resistant cell line and also promoted cell cycle regulation. The drug was also able to elicit a reversal of the drug resistance. TPL inhibited the nuclear factor‑κB (NF‑κB) signaling pathway and the expression of NF‑κB‑regulated drug‑resistant genes, including those for FLICE‑like inhibitory protein, X‑linked inhibitor of apoptosis protein, Bcl‑2, Bcl‑xL and cyclo‑oxygenase‑2. TPL exerted a marked drug‑resistance‑reversal effect on human lung adenocarcinoma Taxol resistance, and the effect was revealed to be dose‑ and time‑dependent. In conclusion, TPL

  6. Triptolide reverses the Taxol resistance of lung adenocarcinoma by inhibiting the NF-κB signaling pathway and the expression of NF-κB-regulated drug-resistant genes

    PubMed Central



    Paclitaxel (or Taxol®) is a first-line chemotherapeutic drug for the treatment of non-small cell lung cancer; however, resistance to the drug is an important factor, which influences the outcome of chemotherapy. The present study aimed to investigate the role of triptolide (TPL) in reversing Taxol-resistant human lung adenocarcinoma and to elucidate the underlying molecular mechanism of resistance reversal mediated by TPL. It was hypothesized that this experimental approach would assist in solving the problem of chemotherapeutic resistance in non-small cell lung cancer, thereby improving the clinical outcomes. The human Taxol-resistant lung adenocarcinoma cell line, A549/Taxol, was established. The resistance index of the cell line was calculated, according to the half maximal inhibitory concentration (IC50) of A549/Taxol IC50 of A549, to be 51.87. The levels of apoptosis and the cell cycle in the A549/Taxol cell line were assessed to confirm the effects of TPL at three different concentrations (0.03, 0.3 and 3 µmol/l) and treatment durations (2, 4, 6 and 12 h) by flow cytometric analysis, and the inhibition of the NF-κB signaling pathway and the expression of NF-κB-regulated drug-resistant proteins were determined by immunofluorescence and western blotting, respectively. The administration of TPL promoted cell apoptosis in the A549/Taxol lung adenocarcinoma Taxol-resistant cell line and also promoted cell cycle regulation. The drug was also able to elicit a reversal of the drug resistance. TPL inhibited the nuclear factor-κB (NF-κB) signaling pathway and the expression of NF-κB-regulated drug-resistant genes, including those for FLICE-like inhibitory protein, X-linked inhibitor of apoptosis protein, Bcl-2, Bcl-xL and cyclo-oxygenase-2. TPL exerted a marked drug-resistance-reversal effect on human lung adenocarcinoma Taxol resistance, and the effect was revealed to be dose- and time-dependent. In conclusion, TPL exerted its role in the process of resistance

  7. Differential Gene Expression Profiles of Radioresistant Non-Small-Cell Lung Cancer Cell Lines Established by Fractionated Irradiation: Tumor Protein p53-Inducible Protein 3 Confers Sensitivity to Ionizing Radiation

    SciTech Connect

    Lee, Young Sook; Oh, Jung-Hwa; Yoon, Seokjoo; Kwon, Myung-Sang


    Purpose: Despite the widespread use of radiotherapy as a local and regional modality for the treatment of cancer, some non-small-cell lung cancers commonly develop resistance to radiation. We thus sought to clarify the molecular mechanisms underlying resistance to radiation. Methods and Materials: We established the radioresistant cell line H460R from radiosensitive parental H460 cells. To identify the radioresistance-related genes, we performed microarray analysis and selected several candidate genes. Results: Clonogenic and MTT assays showed that H460R was 10-fold more resistant to radiation than H460. Microarray analysis indicated that the expression levels of 1,463 genes were altered more than 1.5-fold in H460R compared with parental H460. To evaluate the putative functional role, we selected one interesting gene tumor protein p53-inducible protein 3 (TP53I3), because that this gene was significantly downregulated in radioresistant H460R cells and that it was predicted to link p53-dependent cell death signaling. Interestingly, messenger ribonucleic acid expression of TP53I3 differed in X-ray-irradiated H460 and H460R cells, and overexpression of TP53I3 significantly affected the cellular radiosensitivity of H460R cells. Conclusions: These results show that H460R may be useful in searching for candidate genes that are responsible for radioresistance and elucidating the molecular mechanism of radioresistance.

  8. Gene expression profiling of common signal transduction pathways affected by rBMSCs/F92A-Cav1 in the lungs of rat with pulmonary arterial hypertension.


    Chen, Haiying; Yang, Hongli; Xu, Chong; Yue, Hongmei; Xia, Peng; Strappe, Pádraig Michael; Wang, Lei; Pan, Li; Tang, Wenqiang; Chen, Shuangfeng; Wang, Lexin


    Pulmonary arterial hypertension (PAH) is associated with sustained vasoconstriction, inflammation and suppressed apoptosis of smooth muscle cells. Our previous studies have found that rat bone marrow-derived mesenchymal stem cells (rBMSCs) transduced with a mutant caveolin-1(F92A-Cav1) could enhance endothelial nitric oxide synthase (eNOS) activity and improve pulmonary vascular remodeling, but the potential mechanism is not yet fully explored. The present study was to investigate the gene expression profile upon rBMSCs/F92A-Cav1delivered to PAH rat to evaluate the role of F92A-Cav1 in its regulation. PAH was induced with monocrotaline (MCT, 60mg/kg) prior to delivery of lentiviral vector transduced rBMSCs expressing Cav1 or F92A-Cav1. Gene expression profiling was performed using Rat Signal Transduction PathwayFinder array. The expression changes of 84 key genes representing 10 signal transduction pathways in rat following rBMSCs/F92A-Cav1 treatment was examined. Screening with the Rat Signal Transduction PathwayFinder R(2) PCR Array system and subsequent western blot, immunohistochemistry or real time PCR analysis revealed that F92A-Cav1 modified rBMSCs can inhibit the inflammation factors (TNF-alpha, Icam1 and C/EBPdelta), pro-proliferation genes (c-Myc, Bcl2a1d, Notch1and Hey2), oxidative stress gene (Hmox1) and activate cell cycle arrested gene Cdkn1a, ameliorating inflammation and inhibiting cell proliferation in PAH rat. rBMSCs/F92A-Cav1 inhibits inflammation and cell proliferation by regulating signaling pathways that related to inflammation, proliferation, cell cycle and oxidative stress. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  9. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells.


    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang


    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future.

  10. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells

    PubMed Central

    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang


    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future. PMID:27362942

  11. Gene Environment Interactions in Women With Breast and Secondary Lung Cancer

    DTIC Science & Technology


    or due to alterations in genes whose products interact or communicate with p53. Most mutations result in the inability of the protein to activate...p53 and smoking in breast cancer can be made. The p53 gene is mutated in about 50% of lung cancers. Among the 2,372 mutations recorded for lung...carcinogenesis by affecting expression of mutated genes [44]. Methylation profiles associated with certain types of cancer could be used to identify cancer

  12. Identification of candidate lung cancer susceptibility genes in mouse using oligonucleotide arrays

    PubMed Central

    Lemon, W; Bernert, H; Sun, H; Wang, Y; You, M


    We applied microarray gene expression profiling to lungs from mouse strains having variable susceptibility to lung tumour development as a means to identify, within known quantitative trait loci (QTLs), candidate genes responsible for susceptibility or resistance to lung cancer. At least eight chromosomal regions of mice have been mapped and verified to be linked with lung tumour susceptibility or resistance. In this study, high density oligonucleotide arrays were used to measure the relative expression levels of >36 000 genes and ESTs in lung tissues of A/J, BALB/cJ, SM/J, C3H/HeJ, and C57BL/6J mice. A number of differentially expressed genes were found in each of the lung cancer susceptibility QTLs. Bioinformatic analysis of the differentially expressed genes located within QTLs produced 28 susceptibility candidates and 22 resistance candidates. These candidates may be extremely helpful in the ultimate identification of the precise genes responsible for lung tumour susceptibility or resistance in mice and, through follow up, humans. Complete data sets are available at PMID:12205107

  13. Science review: searching for gene candidates in acute lung injury.


    Grigoryev, Dmitry N; Finigan, James H; Hassoun, Paul; Garcia, Joe G N


    Acute lung injury (ALI) is a complex and devastating illness, often occurring within the setting of sepsis, and carries an annual mortality rate of 30-50%. Although the genetic basis of ALI has not been fully established, an increasing body of evidence suggests that genetic predisposition contributes to disease susceptibility and severity. Significant difficulty exists, however, in defining the exact nature of these genetic factors, including large phenotypic variance, incomplete penetrance, complex gene-environment interactions, and strong potential for locus heterogeneity. We utilized the candidate gene approach and an ortholog gene database to provide relevant gene ontologies and insights into the genetic basis of ALI. We employed a Medline search of selected basic and clinical studies in the English literature and studies sponsored by the HopGene National Institutes of Health sponsored Program in Genomic Applications. Extensive gene expression profiling studies in animal models of ALI (rat, murine, canine), as well as in humans, were performed to identify potential candidate genes We identified a number of candidate genes for ALI, with blood coagulation and inflammation gene ontologies being the most highly represented. The candidate gene approach coupled with extensive gene profiling and novel bioinformatics approaches is a valuable way to identify genes that are involved in ALI.

  14. Reduced transcription of the RB2/p130 gene in human lung cancer.


    Xue Jun, Hu; Gemma, Akihiko; Hosoya, Yoko; Matsuda, Kuniko; Nara, Michiya; Hosomi, Yukio; Okano, Tetsuya; Kurimoto, Futoshi; Seike, Masahiro; Takenaka, Kiyoshi; Yoshimura, Akinobu; Toyota, Minoru; Kudoh, Shoji


    Reduced expression of the retinoblastoma gene (RB)2/p130 protein, as well as mutation of exons 19, 20, 21, and 22 of the same gene, has been reported in primary lung cancer. However, it has been suggested by other investigators that mutational inactivation and loss of the RB2/p130 gene and protein, respectively, are rare events in lung cancer. In order to determine the contribution and mechanisms of RB2/p130 gene inactivation to lung cancer development and progression, we quantified RB2/p130 mRNA expression levels in a range of human lung cancer cell lines (n = 13) by real-time reverse transcription (RT)-polymerase chain reaction (PCR) analysis. In comparison to normal lung tissue, reduced transcription of the RB2/p130 gene was found in all small cell lung cancer cell lines examined, along with six out of the eight nonsmall cell lung cancers tested, most of which had inactivation of RB/p16 pathway. On the basis of Western blot analysis, the expression of RB2/p130 protein was consistent with RNA expression levels in all lung cancer cell lines examined. In addition, the mutational status of the RB2/p130 gene (specifically, exons 19, 20, 21, and 22) was determined in 30 primary lung cancers (from patients with distant metastasis) and 30 lung cancer cell lines by PCR-single strand conformation polymorphism (SSCP) analysis and direct DNA sequencing. There was no evidence of somatic mutations within the RB2/p130 gene in the 60 lung cancer samples (both cell lines and tumors) assessed, including the 11 lung cancer cell lines that displayed reduced expression of the gene. Furthermore, hypermethylation of the RB2/p130 promoter was not found in any of the above-mentioned 11 cell lines, as determined by a DNA methylation assay, combined bisulfite restriction analysis (COBRA). The results of the present study suggest that the reduced RB2/p130 expression seen in lung cancer may be in part transcriptionally mediated, albeit not likely via a mechanism involving hypermethylation

  15. Expression of hPNAS-4 Radiosensitizes Lewis Lung Cancer

    SciTech Connect

    Zeng Hui; Yuan Zhu; Zhu Hong; Li Lei; Shi Huashan; Wang Zi; Fan Yu; Deng Qian; Zeng Jianshuang; He Yinbo; Xiao Jianghong; Li Zhiping


    Purpose: This study aimed to transfer the hPNAS-4 gene, a novel apoptosis-related human gene, into Lewis lung cancer (LL2) and observe its radiosensitive effect on radiation therapy in vitro and in vivo. Methods and Materials: The hPNAS-4 gene was transfected into LL2 cells, and its expression was detected via western blot. Colony formation assay and flow cytometry were used to detect the growth and apoptosis of cells treated with irradiation/PNAS-4 in vitro. The hPNAS-4 gene was transferred into LL2-bearing mice through tail vein injection of the liposome/gene complex. The tumor volumes were recorded after radiation therapy. Proliferating cell nuclear antigen (PCNA) immunohistochemistry staining and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay were performed to detect the tumor cell growth and apoptosis in vivo. Results: The hPNAS-4 gene was successfully transferred into LL2 cells and tumor tissue, and its overexpressions were confirmed via western blot analysis. Compared with the control, empty plasmid, hPNAS-4, radiation, and empty plasmid plus radiation groups, the hPNAS-4 plus radiation group more significantly inhibited growth and enhanced apoptosis of LL2 cells in vitro and in vivo (P<.05). Conclusions: The hPNAS-4 gene was successfully transferred into LL2 cells and tumor tissue and was expressed in both LL2 cell and tumor tissue. The hPNAS-4 gene therapy significantly enhanced growth inhibition and apoptosis of LL2 tumor cells by radiation therapy in vitro and in vivo. Therefore, it may be a potential radiosensitive treatment of radiation therapy for lung cancer.

  16. New genes linked to lung cancer susceptibility in Asian women

    An international group of scientists has identified three genes that predispose Asian women who have never smoked to lung cancer. The discovery of specific genetic variations, which have not previously been associated with lung cancer risk in other popul

  17. Expression of pleiotrophin in small cell lung cancer.


    Wang, H Q; Wang, J


    Pleiotrophin (PTN) is a kind of heparin binding growth factor closely related to tumor progression. This study aimed to discuss the significance of the expression of PTN in benign and malignant lung cancer tissues, especially small cell lung cancer. Lung cancer samples were collected for study and lung tissue samples with benign lesions were taken as controls. The expression of PTN was detected using tissue chip combined with the immunohistochemical method, and the differences of small cell lung cancer with non-small cell lung cancer and benign lesion tissue were compared. It was found that PTN expression was mainly located in the cytoplasm and membrane of cells; PTN expression in the lung cancer group was higher than that in the control group (p < 0.01), and PTN expression in the small cell cancer group was higher than that in the squamous carcinoma group and glandular cancer group (p < 0.05). In addition, PTN expression quantity in patients with lung cancer were in close correlation with TNM staging, pathological type and tumor differentiation degree (p < 0.05). PTN was found to express abnormally high in lung cancer, especially small cell lung cancer tissue. PTN is most likely to be a new tumor marker for diagnosis and prognosis of lung cancer.

  18. Decreased Laminin Expression by Human Lung Epithelial Cells and Fibroblasts Cultured in Acellular Lung Scaffolds from Aged Mice.


    Godin, Lindsay M; Sandri, Brian J; Wagner, Darcy E; Meyer, Carolyn M; Price, Andrew P; Akinnola, Ifeolu; Weiss, Daniel J; Panoskaltsis-Mortari, Angela


    The lung changes functionally and structurally with aging. However, age-related effects on the extracellular matrix (ECM) and corresponding effects on lung cell behavior are not well understood. We hypothesized that ECM from aged animals would induce aging-related phenotypic changes in healthy inoculated cells. Decellularized whole organ scaffolds provide a powerful model for examining how ECM cues affect cell phenotype. The effects of age on ECM composition in both native and decellularized mouse lungs were assessed as was the effect of young vs old acellular ECM on human bronchial epithelial cells (hBECs) and lung fibroblasts (hLFs). Native aged (1 year) lungs demonstrated decreased expression of laminins α3 and α4, elastin and fibronectin, and elevated collagen, compared to young (3 week) lungs. Proteomic analyses of decellularized ECM demonstrated similar findings, and decellularized aged lung ECM contained less diversity in structural proteins compared to young ECM. When seeded in old ECM, hBECs and hLFs demonstrated lower gene expression of laminins α3 and α4, respectively, as compared to young ECM, paralleling the laminin deficiency of aged ECM. ECM changes appear to be important factors in potentiating aging-related phenotypes and may provide clues to mechanisms that allow for aging-related lung diseases.

  19. Decreased Laminin Expression by Human Lung Epithelial Cells and Fibroblasts Cultured in Acellular Lung Scaffolds from Aged Mice

    PubMed Central

    Godin, Lindsay M.; Sandri, Brian J.; Wagner, Darcy E.; Meyer, Carolyn M.; Price, Andrew P.; Akinnola, Ifeolu; Weiss, Daniel J.; Panoskaltsis-Mortari, Angela


    The lung changes functionally and structurally with aging. However, age-related effects on the extracellular matrix (ECM) and corresponding effects on lung cell behavior are not well understood. We hypothesized that ECM from aged animals would induce aging-related phenotypic changes in healthy inoculated cells. Decellularized whole organ scaffolds provide a powerful model for examining how ECM cues affect cell phenotype. The effects of age on ECM composition in both native and decellularized mouse lungs were assessed as was the effect of young vs old acellular ECM on human bronchial epithelial cells (hBECs) and lung fibroblasts (hLFs). Native aged (1 year) lungs demonstrated decreased expression of laminins α3 and α4, elastin and fibronectin, and elevated collagen, compared to young (3 week) lungs. Proteomic analyses of decellularized ECM demonstrated similar findings, and decellularized aged lung ECM contained less diversity in structural proteins compared to young ECM. When seeded in old ECM, hBECs and hLFs demonstrated lower gene expression of laminins α3 and α4, respectively, as compared to young ECM, paralleling the laminin deficiency of aged ECM. ECM changes appear to be important factors in potentiating aging-related phenotypes and may provide clues to mechanisms that allow for aging-related lung diseases. PMID:26954258

  20. Global gene profiling of aging lungs in Atp8b1 mutant mice

    PubMed Central

    Soundararajan, Ramani; Stearns, Timothy M.; Czachor, Alexander; Fukumoto, Jutaro; Turn, Christina; Westermann-Clark, Emma; Breitzig, Mason; Tan, Lee; Lockey, Richard F.; King, Benjamin L.; Kolliputi, Narasaiah


    Objective Recent studies implicate cardiolipin oxidation in several age-related diseases. Atp8b1 encoding Type 4 P-type ATPases is a cardiolipin transporter. Mutation in Atp8b1 gene or inflammation of the lungs impairs the capacity of Atp8b1 to clear cardiolipin from lung fluid. However, the link between Atp8b1 mutation and age-related gene alteration is unknown. Therefore, we investigated how Atp8b1 mutation alters age-related genes. Methods We performed Affymetrix gene profiling of lungs isolated from young (7-9 wks, n=6) and aged (14 months, 14 M, n=6) C57BL/6 and Atp8b1 mutant mice. In addition, Ingenuity Pathway Analysis (IPA) was performed. Differentially expressed genes were validated by quantitative real-time PCR (qRT-PCR). Results Global transcriptome analysis revealed 532 differentially expressed genes in Atp8b1 lungs, 157 differentially expressed genes in C57BL/6 lungs, and 37 overlapping genes. IPA of age-related genes in Atp8b1 lungs showed enrichment of Xenobiotic metabolism and Nrf2-mediated signaling pathways. The increase in Adamts2 and Mmp13 transcripts in aged Atp8b1 lungs was validated by qRT-PCR. Similarly, the decrease in Col1a1 and increase in Cxcr6 transcripts was confirmed in both Atp8b1 mutant and C57BL/6 lungs. Conclusion Based on transcriptome profiling, our study indicates that Atp8b1 mutant mice may be susceptible to age-related lung diseases. PMID:27689529

  1. Gene Express Inc.


    Saccomanno, Colette F


    Gene Express, Inc. is a technology-licensing company and provider of Standardized Reverse Transcription Polymerase Chain Reaction (StaRT-PCR) services. Designed by and for clinical researchers involved in pharmaceutical, biomarker and molecular diagnostic product development, StaRT-PCR is a unique quantitative and standardized multigene expression measurement platform. StaRT-PCR meets all of the performance characteristics defined by the US FDA as required to support regulatory submissions [101,102] , and by the Clinical Laboratory Improvement Act of 1988 (CLIA) as necessary to support diagnostic testing [1] . A standardized mixture of internal standards (SMIS), manufactured in bulk, provides integrated quality control wherein each native template target gene is measured relative to a competitive template internal standard. Bulk production enables the compilation of a comprehensive standardized database from across multiple experiments, across collaborating laboratories and across the entire clinical development lifecycle of a given compound or diagnostic product. For the first time, all these data are able to be directly compared. Access to such a database can dramatically shorten the time from investigational new drug (IND) to new drug application (NDA), or save time and money by hastening a substantiated 'no-go' decision. High-throughput StaRT-PCR is conducted at the company's automated Standardized Expression Measurement (SEM) Center. Currently optimized for detection on a microcapillary electrophoretic platform, StaRT-PCR products also may be analyzed on microarray, high-performance liquid chromatography (HPLC), or matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) platforms. SEM Center services deliver standardized genomic data--data that will accelerate the application of pharmacogenomic technology to new drug and diagnostic test development and facilitate personalized medicine.

  2. Identification of Methylation-Driven, Differentially Expressed STXBP6 as a Novel Biomarker in Lung Adenocarcinoma

    PubMed Central

    Lenka, Govinda; Tsai, Mong-Hsun; Lin, Hsin-Chieh; Hsiao, Jen-Hao; Lee, Yi-Ching; Lu, Tzu-Pin; Lee, Jang-Ming; Hsu, Chung-Ping; Lai, Liang-Chuan; Chuang, Eric Y.


    DNA methylation is an essential epigenetic marker associated with the silencing of gene expression. Although various genome-wide studies revealed aberrantly methylated gene targets as molecular biomarkers for early detection, the survival rate of lung cancer patients is still poor. In order to identify methylation-driven biomarkers, genome-wide changes in DNA methylation and differential expression in 32 pairs of lung adenocarcinoma and adjacent normal lung tissue in non-smoking women were examined. This concurrent analysis identified 21 negatively correlated probes (r ≤ −0.5), corresponding to 17 genes. Examining the endogenous expression in lung cancer cell lines, five of the genes were found to be significantly down-regulated. Furthermore, in tumor cells alone, 5-aza-2′-deoxycytidine treatment increased the expression levels of STXBP6 in a dose dependent manner and pyrosequencing showed higher percentage of methylation in STXBP6 promoter. Functional analysis revealed that overexpressed STXBP6 in A549 and H1299 cells significantly decreased cell proliferation, colony formation, and migration, and increased apoptosis. Finally, significantly lower survival rates (P < 0.05) were observed when expression levels of STXBP6 were low. Our results provide a basis for the genetic etiology of lung adenocarcinoma by demonstrating the possible role of hypermethylation of STXBP6 in poor clinical outcomes in lung cancer patients. PMID:28198450

  3. Progressive lung cancer determined by expression profiling and transcriptional regulation.


    Han, Namshik; Dol, Zulkifli; Vasieva, Olga; Hyde, Russell; Liloglou, Triantafillos; Raji, Olaide; Brambilla, Elisabeth; Brambilla, Christian; Martinet, Yves; Sozzi, Gabriella; Risch, Angela; Montuenga, Luis M; Brass, Andy; Field, John K


    Clinically, our ability to predict disease outcome for patients with early stage lung cancer is currently poor. To address this issue, tumour specimens were collected at surgery from non-small cell lung cancer (NSCLC) patients as part of the European Early Lung Cancer (EUELC) consortium. The patients were followed-up for three years post-surgery and patients who suffered progressive disease (PD, tumour recurrence, metastasis or a second primary) or remained disease-free (DF) during follow-up were identified. RNA from both tumour and adjacent-normal lung tissue was extracted from patients and subjected to microarray expression profiling. These samples included 36 adenocarcinomas and 23 squamous cell carcinomas from both PD and DF patients. The microarray data was subject to a series of systematic bioinformatics analyses at gene, network and transcription factor levels. The focus of these analyses was 2-fold: firstly to determine whether there were specific biomarkers capable of differentiating between PD and DF patients, and secondly, to identify molecular networks which may contribute to the progressive tumour phenotype. The experimental design and analyses performed permitted the clear differentiation between PD and DF patients using a set of biomarkers implicated in neuroendocrine signalling and allowed the inference of a set of transcription factors whose activity may differ according to disease outcome. Potential links between the biomarkers, the transcription factors and the genes p21/CDKN1A and Myc, which have previously been implicated in NSCLC development, were revealed by a combination of pathway analysis and microarray meta-analysis. These findings suggest that neuroendocrine-related genes, potentially driven through p21/CDKN1A and Myc, are closely linked to whether or not a NSCLC patient will have poor clinical outcome.

  4. GSTCD and INTS12 Regulation and Expression in the Human Lung

    PubMed Central

    Probert, Kelly; Billington, Charlotte K.; Henry, Amanda P.; Hodge, Emily; Nelson, Carl P.; Stewart, Ceri E.; Swan, Caroline; Wain, Louise V.; Artigas, María Soler; Melén, Erik; Ushey, Kevin; Hao, Ke; Lamontagne, Maxime; Bossé, Yohan; Postma, Dirkje S.; Tobin, Martin D.; Sayers, Ian; Hall, Ian P.


    Genome-Wide Association Study (GWAS) meta-analyses have identified a strong association signal for lung function, which maps to a region on 4q24 containing two oppositely transcribed genes: glutathione S-transferase, C-terminal domain containing (GSTCD) and integrator complex subunit 12 (INTS12). Both genes were found to be expressed in a range of human airway cell types. The promoter regions and transcription start sites were determined in mRNA from human lung and a novel splice variant was identified for each gene. We obtained the following evidence for GSTCD and INTS12 co-regulation and expression: (i) correlated mRNA expression was observed both via Q-PCR and in a lung expression quantitative trait loci (eQTL) study, (ii) induction of both GSTCD and INTS12 mRNA expression in human airway smooth muscle cells was seen in response to TGFβ1, (iii) a lung eQTL study revealed that both GSTCD and INTS12 mRNA levels positively correlate with percent predicted FEV1, and (iv) FEV1 GWAS associated SNPs in 4q24 were found to act as an eQTL for INTS12 in a number of tissues. In fixed sections of human lung tissue, GSTCD protein expression was ubiquitous, whereas INTS12 expression was predominantly in epithelial cells and pneumocytes. During human fetal lung development, GSTCD protein expression was observed to be highest at the earlier pseudoglandular stage (10-12 weeks) compared with the later canalicular stage (17-19 weeks), whereas INTS12 expression levels did not alter throughout these stages. Knowledge of the transcriptional and translational regulation and expression of GSTCD and INTS12 provides important insights into the potential role of these genes in determining lung function. Future work is warranted to fully define the functions of INTS12 and GSTCD. PMID:24058608

  5. GSTCD and INTS12 regulation and expression in the human lung.


    Obeidat, Ma'en; Miller, Suzanne; Probert, Kelly; Billington, Charlotte K; Henry, Amanda P; Hodge, Emily; Nelson, Carl P; Stewart, Ceri E; Swan, Caroline; Wain, Louise V; Soler Artigas, María; Melén, Erik; Ushey, Kevin; Hao, Ke; Lamontagne, Maxime; Bossé, Yohan; Postma, Dirkje S; Tobin, Martin D; Sayers, Ian; Hall, Ian P


    Genome-Wide Association Study (GWAS) meta-analyses have identified a strong association signal for lung function, which maps to a region on 4q24 containing two oppositely transcribed genes: glutathione S-transferase, C-terminal domain containing (GSTCD) and integrator complex subunit 12 (INTS12). Both genes were found to be expressed in a range of human airway cell types. The promoter regions and transcription start sites were determined in mRNA from human lung and a novel splice variant was identified for each gene. We obtained the following evidence for GSTCD and INTS12 co-regulation and expression: (i) correlated mRNA expression was observed both via Q-PCR and in a lung expression quantitative trait loci (eQTL) study, (ii) induction of both GSTCD and INTS12 mRNA expression in human airway smooth muscle cells was seen in response to TGFβ1, (iii) a lung eQTL study revealed that both GSTCD and INTS12 mRNA levels positively correlate with percent predicted FEV1, and (iv) FEV1 GWAS associated SNPs in 4q24 were found to act as an eQTL for INTS12 in a number of tissues. In fixed sections of human lung tissue, GSTCD protein expression was ubiquitous, whereas INTS12 expression was predominantly in epithelial cells and pneumocytes. During human fetal lung development, GSTCD protein expression was observed to be highest at the earlier pseudoglandular stage (10-12 weeks) compared with the later canalicular stage (17-19 weeks), whereas INTS12 expression levels did not alter throughout these stages. Knowledge of the transcriptional and translational regulation and expression of GSTCD and INTS12 provides important insights into the potential role of these genes in determining lung function. Future work is warranted to fully define the functions of INTS12 and GSTCD.

  6. Deletion and differential expression of p16{sup INK4a} in mouse lung tumors

    SciTech Connect

    Belinsky, S.A.; Swafford, D.S.; Middleton, S.K.; Kennedy, C.H.; Tesfaigzi, J.


    Recent allelotyping of chemical-induced lung tumors in hybrid mice has detected loss of heterozygosity on chromosome 4 in a region involving the interferon-{alpha} (IFN-{alpha}) gene cluster that is syntenic to human chromosome 9p21-22, the location of the p16{sup INK4a}(p16) and (p15) tumor suppressor genes. The purpose of the current investigation was to characterize the expression of p16 and p15 in lung tumors and tumor-derived cell lines induced in Ad mice by exposure to the tobacco-specific nitrosamine, 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK). Expression of p16 and p15 was detected in all primary lung tumors; however, levels of expression of p16 differed by up to 15-fold between tumors. This is the first study to note a marked difference in the expression of the p16 gene in primary lung tumors. The apparent low levels of expression seen in approximately half of the tumors was not attributed to deletion, mutation or methylation of the p16 gene. Conversely, the high levels of p16 expression were not the result of effects on the retinoblastoma gene (Rb) or cyclin D1 proteins but most likely in response to a dysfunction elsewhere within this pathway. In contrast to the detection of p16 expression in primary tumors, this gene was deleted in all four cell lines. Three of four cell lines also showed loss of the p15 gene. Mapping of these homozygous deletions on chromosome 4 revealed that the p16 gene resides near the D4MIT77 marker, which is located approximately 12 cM proximal to the IFN-{alpha} gene cluster, thereby implicating the p16 gene as one of the targets within the allelic deletions detected previously in primary lung tumors from hybrid mice.

  7. Air pollution particulate matter (PM2.5)-induced gene expression of volatile organic compound and/or polycyclic aromatic hydrocarbon-metabolizing enzymes in an in vitro coculture lung model.


    Abbas, Imane; Saint-Georges, Françoise; Billet, Sylvain; Verdin, Anthony; Mulliez, Philippe; Shirali, Pirouz; Garçon, Guillaume


    The overarching goals were: (i) to develop an in vitro coculture model, including two relevant lung target cells: human alveolar macrophage (AM) isolated from bronchoalveolar lavage fluid, and immortalized cells originated from the normal lung tissue of a human embryo (L132 cell line), as a future strategy for near-realistic exposures to air pollution particulate matter (PM), and (ii) to study the gene expression of volatile organic compound (VOC) and/or polycyclic aromatic hydrocarbons (PAH)-metabolizing enzymes in this in vitro coculture model. Human AM and/or L132 cells in mono- and coculture were exposed for 24, 48 and 72h to Dunkerque City's PM2.5 at its lethal concentrations at 10% and 50% (i.e. AM: LC10=14.93 microgPM/mL and LC50=74.63 microgPM/mL; L132: LC10=18.84 microgPM/mL and LC50=75.36 microgPM/mL), and the gene expression (i.e. Cytochrome P450 1A1, CYP1A1; CYP2E1; CYP2F1; microsomal Epoxide Hydrolase; NADPH Quinone Oxydo-Reductase-1, NQO1; and Glutathione S-Transferase pi-1 and mu-3, GST-pi1 and GST-mu3) was studied. In human AM in mono- and coculture, and in L132 cells in monoculture, VOC and/or PAH-coated onto PM induced the gene expression of CYP1A1, CYP2E1, NQO1, GST-pi1, and/or GST-mu3. However, there were quiet different outcomes based on the use of L132 cells in mono- vs. coculture: the pattern of VOC and/or PAH-metabolizing enzymes induced by PM in L132 cells in monoculture remained almost unaffected when in coculture with AM. Taken together, these results reinforced the key role of PM-exposed target human AM in the defenses of the human lung from external injuries, notably through their higher capacity to retain PM, and indicated that carbonaceous cores of PM, as physical vector of the penetration and retention of coated-VOC and/or PAH into cells, enabled them to exert a longer toxicity. The use of such a near realistic exposure system could also be a very useful and powerful tool to identify the mechanisms by which air pollution PM induced

  8. Immunoglobulin G Expression in Lung Cancer and Its Effects on Metastasis

    PubMed Central

    Jiang, Chunfan; Huang, Tao; Wang, Yun; Huang, Guowei; Wan, Xia; Gu, Jiang


    Lung cancer is one of the leading malignancies worldwide, but the regulatory mechanism of its growth and metastasis is still poorly understood. We investigated the possible expression of immunoglobulin G (IgG) genes in squamous cell carcinomas and adenocarcinomas of the lung and related cancer cell lines. Abundant mRNA of IgG and essential enzymes for IgG synthesis, recombination activation genes 1, 2 (RAG1, 2) and activation-induced cytidine deaminase (AID) were detected in the cancer cells but not in adjacent normal lung tissue or normal lung epithelial cell line. The extents of IgG expression in 86 lung cancers were found to associate with clinical stage, pathological grade and lymph node metastasis. We found that knockdown of IgG with siRNA resulted in decreases of cellular proliferation, migration and attachment for cultured lung cancer cells. Metastasis-associated gene 1 (MTA1) appeared to be co-expressed with IgG in lung cancer cells. Statistical analysis showed that the rate of IgG expression was significantly correlated to that of MTA1 and to lymph node metastases. Inhibition of MTA1 gene expression with siRNA also led to decreases of cellular migration and attachment for cultured lung cancer cells. These evidences suggested that inhibition of cancer migration and attachment induced by IgG down-regulation might be achieved through MTA1 regulatory pathway. Our findings suggest that lung cancer-produced IgG is likely to play an important role in cancer growth and metastasis with significant clinical implications. PMID:24853685

  9. Nonadditive gene expression in polyploids.


    Yoo, Mi-Jeong; Liu, Xiaoxian; Pires, J Chris; Soltis, Pamela S; Soltis, Douglas E


    Allopolyploidy involves hybridization and duplication of divergent parental genomes and provides new avenues for gene expression. The expression levels of duplicated genes in polyploids can show deviation from parental additivity (the arithmetic average of the parental expression levels). Nonadditive expression has been widely observed in diverse polyploids and comprises at least three possible scenarios: (a) The total gene expression level in a polyploid is similar to that of one of its parents (expression-level dominance); (b) total gene expression is lower or higher than in both parents (transgressive expression); and (c) the relative contribution of the parental copies (homeologs) to the total gene expression is unequal (homeolog expression bias). Several factors may result in expression nonadditivity in polyploids, including maternal-paternal influence, gene dosage balance, cis- and/or trans-regulatory networks, and epigenetic regulation. As our understanding of nonadditive gene expression in polyploids remains limited, a new generation of investigators should explore additional phenomena (i.e., alternative splicing) and use other high-throughput "omics" technologies to measure the impact of nonadditive expression on phenotype, proteome, and metabolome.

  10. Aspergillus fumigatus germ tube growth and not conidia ingestion induces expression of inflammatory mediator genes in the human lung epithelial cell line A549.


    Bellanger, Anne-Pauline; Millon, Laurence; Khoufache, Khaled; Rivollet, Danièle; Bièche, Ivan; Laurendeau, Ingrid; Vidaud, Michel; Botterel, Françoise; Bretagne, Stéphane


    Inhalation of conidia is the main cause of invasive pulmonary aspergillosis (IPA) and the respiratory epithelium is the first line of defence. To explore the triggering factor for the inflammatory response to Aspergillus fumigatus, the species mainly responsible for IPA, this study analysed the differential expression of three inflammatory genes in A549 cells after challenge with live and killed conidia. The influence of steroids, one of the main risk factors for developing IPA, was also investigated. Quantification of mRNAs of the inflammatory mediator genes encoding interleukin (IL)-8, tumour necrosis factor (TNF)-alpha and granulocyte-monocyte colony-stimulating factor (GM-CSF) was carried out using real-time PCR. Ingestion rates were studied for the conidia of A. fumigatus and Penicillium chrysogenum using a fluorescence brightener. Similar results were obtained for both species, with ingestion rates ranging from 35 to 40 %. Exposure of A549 cells to live A. fumigatus conidia only induced a four- to fivefold increase in the mRNA levels of the three genes, starting 8 h after the initial contact. Both inactivation of live A. fumigatus conidia and treatment by dexamethasone (10(-7) M) prevented the overexpression of TNF-alpha, IL-8 and GM-CSF. Fungal growth, rather than conidia ingestion, appears to be the main stimulus for the production of inflammatory mediators by epithelial cells, and this production is inhibited by steroid therapy. These results underline the role that the epithelium plays in the innate response against IPA.

  11. Nuclear Receptor Expression Defines a Set of Prognostic Biomarkers for Lung Cancer

    PubMed Central

    Xiao, Guanghua; Behrens, Carmen; Girard, Luc; Wistuba, Ignacio I.; Minna, John D.; Mangelsdorf, David J.


    Background The identification of prognostic tumor biomarkers that also would have potential as therapeutic targets, particularly in patients with early stage disease, has been a long sought-after goal in the management and treatment of lung cancer. The nuclear receptor (NR) superfamily, which is composed of 48 transcription factors that govern complex physiologic and pathophysiologic processes, could represent a unique subset of these biomarkers. In fact, many members of this family are the targets of already identified selective receptor modulators, providing a direct link between individual tumor NR quantitation and selection of therapy. The goal of this study, which begins this overall strategy, was to investigate the association between mRNA expression of the NR superfamily and the clinical outcome for patients with lung cancer, and to test whether a tumor NR gene signature provided useful information (over available clinical data) for patients with lung cancer. Methods and Findings Using quantitative real-time PCR to study NR expression in 30 microdissected non-small-cell lung cancers (NSCLCs) and their pair-matched normal lung epithelium, we found great variability in NR expression among patients' tumor and non-involved lung epithelium, found a strong association between NR expression and clinical outcome, and identified an NR gene signature from both normal and tumor tissues that predicted patient survival time and disease recurrence. The NR signature derived from the initial 30 NSCLC samples was validated in two independent microarray datasets derived from 442 and 117 resected lung adenocarcinomas. The NR gene signature was also validated in 130 squamous cell carcinomas. The prognostic signature in tumors could be distilled to expression of two NRs, short heterodimer partner and progesterone receptor, as single gene predictors of NSCLC patient survival time, including for patients with stage I disease. Of equal interest, the studies of microdissected

  12. Collagen gene expression in radiation interstitial pneumonitis

    SciTech Connect

    Bai Yun-hong; Wang, De-wen; Cui Cai-bin


    By using type I and type III collagen cDNA probe and cDNA-mRNA in situ hybridization, we observed the changes of rat lung {alpha} 1(I) and {alpha} 1(III) collagen gene expression in radiation interstitial pneumonitis. The results showed that the expressed cell of type I and type III collagen were scattered within the fibroblasts in the thickened interalveolar walls. The type I and type III collagen mRNA content in irradiated animals were higher than those in the controls at 0.5, 1, 2, 3, 6, and 12 months. 10 refs., 4 figs., 1 tab.

  13. Expression of IRAK1 in lung cancer tissues and its clinicopathological significance: a microarray study.


    Zhang, Xiuling; Dang, Yiwu; Li, Ping; Rong, Minhua; Chen, Gang


    The interleukin-1 receptor associated kinases 1 (IRAK1) is a down stream effector molecule of the toll like receptor (TLR) signaling pathway, which is involved in inflammation, autoimmunity and cancer. However, the role of IRAK1 in lung cancer remains unclarified. Herein, we investigated the protein expression and the clinicopathological significance of IRAK1 in 3 formalin-fixed paraffin-embedded lung cancer tissue microarrays by using immunohistochemistry, which included 365 tumor and 30 normal lung tissues. We found that the expression of IRAK1 in lung cancer was significantly higher compared with that in normal lung tissues (P=0.002). Receiver operating characteristic (ROC) curves were generated to evaluate the power of IRAK1 to distinguish lung cancer from non-cancerous lung tissue. The area under curve (AUC) of ROC of IRAK1 was 0.643 (95% CI 0.550~0.735, P=0.009). Additionally, IRAK1 expression was related to clinical TNM stage (r=0.241, P < 0.001), lymph node metastasis (r=0.279, P < 0.001) and tumor size (r=0.299, P < 0.001) in lung cancer. In the subgroup of non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), the positive rates of IRAK1 were both higher than that in the normal lung tissues (P=0.003, P=0.002, respectively). Further spearman analysis showed that IRAK1 protein in NSCLC was positive correlated with clinical TNM stage (r=0.222, P < 0.001), lymph node metastasis (r=0.277, P < 0.001), tumor size (r=0.292, P < 0.001) and distal metastasis (r=0.110, P=0.043). In conclusion, the expression of IRAK1 protein might be valuable in identifying patients with increased risks of lung cancer and might act as a target for diagnosis and gene therapy for lung cancer.

  14. Gene Therapy for Human Lung Adenocarcinoma Using a Suicide Gene Driven by a Lung-Specific Promoter Delivered by JC Virus-Like Particles.


    Chao, Chun-Nun; Lin, Mien-Chun; Fang, Chiung-Yao; Chen, Pei-Lain; Chang, Deching; Shen, Cheng-Huang; Wang, Meilin


    Lung adenocarcinoma, the most commonly diagnosed type of lung cancer, has a poor prognosis even with combined surgery, chemotherapy, or molecular targeted therapies. Most patients are diagnosed with an in-operable advanced or metastatic disease, both pointing to the necessity of developing effective therapies for lung adenocarcinoma. Surfactant protein B (SP-B) has been found to be overexpressed in lung adenocarcinoma. In addition, it has also been demonstrated that human lung adenocarcinoma cells are susceptible to the JC polyomavirus (JCPyV) infection. Therefore, we designed that the JCPyV virus-like particle (VLP) packaged with an SP-B promoter-driven thymidine kinase suicide gene (pSPB-tk) for possible gene therapy of human lung adenocarcinoma. Plasmids expressing the GFP (pSPB-gfp) or thymidine kinase gene (pSPB-tk) under the control of the human SP-B promoter were constructed. The promoter's tissue specificity was tested by transfection of pSPB-gfp into A549, CH27, and H460 human lung carcinoma cells and non-lung cells. The JCPyV VLP's gene transfer efficiency and the selective cytotoxicity of pSPB-tk combined with ganciclovir (GCV) were tested in vitro and in a xenograft mouse model. In the current study, we found that SP-B promoter-driven GFP was specifically expressed in human lung adenocarcinoma (A549) and large cell carcinoma (H460) cells. JCPyV VLPs were able to deliver a GFP reporter gene into A549 cells for expression. Selective cytotoxicity was observed in A549 but not non-lung cells that were transfected with pSPB-tk or infected with pSPB-tk-carrying JCPyV VLPs. In mice injected with pSPB-tk-carrying JCPyV VLPs through the tail vein and treated with ganciclovir (GCV), a potent 80% inhibition of growth of human lung adenocarcinoma nodules resulted. The JCPyV VLPs combined with the use of SP-B promoter demonstrates effectiveness as a potential gene therapy against human lung adenocarcinoma.

  15. Evolution of Gene Expression after Gene Amplification

    PubMed Central

    Garcia, Nelson; Zhang, Wei; Wu, Yongrui; Messing, Joachim


    We took a rather unique approach to investigate the conservation of gene expression of prolamin storage protein genes across two different subfamilies of the Poaceae. We took advantage of oat plants carrying single maize chromosomes in different cultivars, called oat–maize addition (OMA) lines, which permitted us to determine whether regulation of gene expression was conserved between the two species. We found that γ-zeins are expressed in OMA7.06, which carries maize chromosome 7 even in the absence of the trans-acting maize prolamin-box-binding factor (PBF), which regulates their expression. This is likely because oat PBF can substitute for the function of maize PBF as shown in our transient expression data, using a γ-zein promoter fused to green fluorescent protein (GFP). Despite this conservation, the younger, recently amplified prolamin genes in maize, absent in oat, are not expressed in the corresponding OMAs. However, maize can express the oldest prolamin gene, the wheat high-molecular weight glutenin Dx5 gene, even when maize Pbf is knocked down (through PbfRNAi), and/or another maize transcription factor, Opaque-2 (O2) is knocked out (in maize o2 mutant). Therefore, older genes are conserved in their regulation, whereas younger ones diverged during evolution and eventually acquired a new repertoire of suitable transcriptional activators. PMID:25912045

  16. Regulation of Airway Mucin Gene Expression

    PubMed Central

    Thai, Philip; Loukoianov, Artem; Wachi, Shinichiro; Wu, Reen


    Mucins are important components that exert a variety of functions in cell-cell interaction, epidermal growth factor receptor signaling, and airways protection. In the conducting airways of the lungs, mucins are the major contributor to the viscoelastic property of mucous secretion, which is the major barrier to trapping inhaled microbial organism, particulates, and oxidative pollutants. The homeostasis of mucin production is an important feature in conducting airways for the maintenance of mucociliary function. Aberrant mucin secretion and accumulation in airway lumen are clinical hallmarks associated with various lung diseases, such as asthma, chronic obstructive pulmonary disease, cystic fibrosis, emphysema, and lung cancer. Among 20 known mucin genes identified, 11 of them have been verified at either the mRNA and/or protein level in airways. The regulation of mucin genes is complicated, as are the mediators and signaling pathways. This review summarizes the current view on the mediators, the signaling pathways, and the transcriptional units that are involved in the regulation of airway mucin gene expression. In addition, we also point out essential features of epigenetic mechanisms for the regulation of these genes. PMID:17961085

  17. A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

    PubMed Central

    Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun


    A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

  18. A catalog of genes homozygously deleted in human lung cancer and the candidacy of PTPRD as a tumor suppressor gene.


    Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D; Yokota, Jun


    A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis.

  19. Regulation of proto-oncogene expression in adult and developing lungs.

    PubMed Central

    Molinar-Rode, R; Smeyne, R J; Curran, T; Morgan, J I


    Activation of immediate-early gene expression has been associated with mitogenesis, differentiation, nerve cell depolarization, and recently, terminal differentiation processes and programmed cell death. Previous evidence also suggested that immediate-early genes play a role in the physiology of the lungs (J. I. Morgan, D. R. Cohen, J. L. Hempstead, and T. Curran, Science 237:192-197, 1987). Therefore, we analyzed c-fos expression in adult and developing lung tissues. Seizures elicited by chemoconvulsants induced expression of mRNA for c-fos, c-jun, and junB and Fos-like immunoreactivity in lung tissue. The use of pharmacological antagonists and adrenalectomy indicated that this increased expression was neurogenic. Interestingly, by using a fos-lacZ transgenic mouse, it was shown that Fos-LacZ expression in response to seizure occurred preferentially in clusters of epithelial cells at the poles of the bronchioles. This was the same location of Fos-LacZ expression detected during early lung development. These data imply that pharmacological induction of immediate-early gene expression in adult mice recapitulates an embryological program of gene expression. Images PMID:8497249

  20. Cytokine expression profile in human lungs undergoing normothermic ex-vivo lung perfusion.


    Sadaria, Miral R; Smith, Phillip D; Fullerton, David A; Justison, George A; Lee, Joon H; Puskas, Ferenc; Grover, Frederick L; Cleveland, Joseph C; Reece, T Brett; Weyant, Michael J


    A donor lung shortage prevents patients from receiving life-saving transplants. Ex-vivo lung perfusion (EVLP) is a viable means of expanding the donor pool by evaluating and potentially improving donor lung function. The metabolic and inflammatory effects of EVLP on human lung tissue are currently unknown. We sought to establish representative cytokine expression in human donor lungs meeting acceptable lung transplant criteria after prolonged normothermic EVLP. Seven single human lungs not meeting traditional transplantation criteria for various reasons underwent normothermic EVLP. Lungs were perfused with deoxygenated colloid, rewarmed, and ventilated per standard protocol. Lung function was evaluated every hour. Biopsies were taken at 1, 6, and 12 hours. Inflammatory cytokines were quantitatively measured using a human cytokine magnetic bead-based multiplex assay. All lungs met traditional transplant criteria after EVLP. The partial pressure of arterial oxygen and physiologic lung function significantly improved (p<0.05). No pulmonary edema was formed, and histology demonstrated no evidence of acute lung injury. Interleukin (IL)-6, IL-8, granulocyte colony-stimulating factor, and monocyte chemotactic protein-1 were upregulated, while granulocyte macrophage colony-stimulating factor was downregulated during EVLP (p<0.05). IL-1β, IL-4, IL-7, IL-12, interferon-γ, macrophage inflammatory protein-1β, and tumor necrosis factor-α were detectable and unchanged. Ex-vivo lung perfusion demonstrates the ability to improve oxygenation and physiologic lung function in donor lungs unacceptable for transplantation without injury to the lung. We establish here a cytokine expression profile in human lungs undergoing normothermic EVLP. These data can be used in the future to explore novel targeted therapies for ischemia-reperfusion injury. Copyright © 2011 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

  1. Elevated expression of WWP2 in human lung adenocarcinoma and its effect on migration and invasion.


    Yang, Rui; He, Yao; Chen, Shanshan; Lu, Xinhua; Huang, Chun; Zhang, Guojun


    Lung cancer has been a hot area of research because of its high incidence and mortality. In this study, WWP2, an E3 ubiquitin ligase, is proposed to be an oncoprotein contributing to lung tumorigenesis. We attempted to determine if WWP2 gene expression is correlated with the development of human lung adenocarcinoma. Real-time PCR and western blotting were used to detect the expression of WWP2 in 65 paired lung adenocarcinoma and adjacent normal lung tissues. We found that WWP2 expression was elevated in lung adenocarcinoma tissues and was correlated with the tumor differentiation stage, TNM stage and presence of lymph node metastasis. We performed CCK-8 and colony formation assays and found that down-regulation of WWP2 inhibited proliferation in A549 and SPC-A-1 cells. A wound healing assay and trans-well invasion assays showed that down-regulation of WWP2 inhibited the migration and invasion of lung adenocarcinoma cells. It could be predicted from these data that elevated expression of WWP2 may play a role in facilitating the development of lung adenocarcinoma. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Association of lung function genes with chronic obstructive pulmonary disease.


    Kim, Woo Jin; Lim, Myoung Nam; Hong, Yoonki; Silverman, Edwin K; Lee, Ji-Hyun; Jung, Bock Hyun; Ra, Seung Won; Choi, Hye Sook; Jung, Young Ju; Park, Yong Bum; Park, Myung Jae; Lee, Sei Won; Lee, Jae Seung; Oh, Yeon-Mok; Lee, Sang Do


    Spirometric measurements of pulmonary function are important in diagnosing and determining the severity of chronic obstructive pulmonary disease (COPD). We performed this study to determine whether candidate genes identified in genome-wide association studies of spirometric measurements were associated with COPD and if they interacted with smoking intensity. The current analysis included 1,000 COPD subjects and 1,000 controls recruited from 24 hospital-based pulmonary clinics. Thirteen SNPs, chosen based on genome-wide association studies of spirometric measurements in the Korean population cohorts, were genotyped. Genetic association tests were performed, adjusting for age, sex, and smoking intensity, using models including a SNP-by-smoking interaction term. PID1 and FAM13A were significantly associated with COPD susceptibility. There were also significant interactions between SNPs in ACN9 and FAM13A and smoking pack-years, and an association of ACN9 with COPD in the lowest smoking tertile. The risk allele of FAM13A was associated with increased expression of FAM13A in the lung. We have validated associations of FAM13A and PID1 with COPD. ACN9 showed significant interaction with smoking and is a potential candidate gene for COPD. Significant associations of genetic variants of FAM13A with gene expression levels suggest that the associated loci may act as genetic regulatory elements for FAM13A gene expression.

  3. Method of controlling gene expression


    Peters, Norman K.; Frost, John W.; Long, Sharon R.


    A method of controlling expression of a DNA segment under the control of a nod gene promoter which comprises administering to a host containing a nod gene promoter an amount sufficient to control expression of the DNA segment of a compound of the formula: ##STR1## in which each R is independently H or OH, is described.

  4. The flow of gene expression.


    Misteli, Tom


    Gene expression is a highly interconnected multistep process. A recent meeting in Iguazu Falls, Argentina, highlighted the need to uncover both the molecular details of each single step as well as the mechanisms of coordination among processes in order to fully understand the expression of genes.

  5. Frequent expression of MAGE1 tumor antigens in bronchial epithelium of smokers without lung cancer

    PubMed Central



    Melanoma antigens (MAGE) are frequently expressed in lung cancer and are promising targets of anticancer immunotherapy. Our preliminary data suggested that MAGE may be expressed during early lung carcinogenesis, raising the possibility of targeting MAGE as a lung cancer prevention strategy. The purpose of this study was to investigate MAGE activation patterns in the airways of chronic smokers without lung cancer. MAGE-A1, -A3 and -B2 gene expression was determined in bronchial brush cells from chronic former smokers without lung cancer by reverse transcription-PCR (RT-PCR). The results were correlated with clinical parameters. The 123 subjects had a median age of 57 years, a median of 40 pack-years smoking history, and had quit smoking for at least one year prior to enrollment. Among the subjects, 31 (25%), 38 (31%), and 46 (37%) had detectable MAGE-A1, -A3 and -B2 expression, respectively, in their bronchial brush samples. Expression of MAGE-A1 and -B2 positively correlated with pack-years smoking history (P=0.03 and 0.03, respectively). The frequency of expression did not decrease despite a prolonged smoking cessation period. In conclusion, MAGE-A1, -A3 and -B2 genes are frequently expressed in the bronchial epithelial cells of chronic smokers without lung cancer, suggesting that chronic exposure to cigarette smoke activates these genes even before the malignant transformation of bronchial cells in susceptible individuals. Once activated, the expression persists despite long-term smoking cessation. These data support the targeting of MAGE as a novel lung cancer prevention strategy. PMID:22977481

  6. Discovering modulators of gene expression

    PubMed Central

    Babur, Özgün; Demir, Emek; Gönen, Mithat; Sander, Chris; Dogrusoz, Ugur


    Proteins that modulate the activity of transcription factors, often called modulators, play a critical role in creating tissue- and context-specific gene expression responses to the signals cells receive. GEM (Gene Expression Modulation) is a probabilistic framework that predicts modulators, their affected targets and mode of action by combining gene expression profiles, protein–protein interactions and transcription factor–target relationships. Using GEM, we correctly predicted a significant number of androgen receptor modulators and observed that most modulators can both act as co-activators and co-repressors for different target genes. PMID:20466809

  7. [The biological significance of FHIT protein expression in lung cancer and precancerous tissues detected by tissue microarray].


    Yuan, Ling; Wang, Xinyun; Zheng, Haiyan


    Fragile histidine triad (FHIT) is a candidate tumor suppressor gene. Aberrant expression of FHIT has been observed in multiple carcinomas induced by environmental carcinogens, especially in lung cancer. In this study, the expression of FHIT protein in lung cancer progression tissue microarray was detected and their roles in oncogenesis and progression of lung cancer were discussed. The expression of FHIT protein in tissue microarray with 270 cores was detected by SP immunohistochemistry method, in which there were 89 cases of primary lung cancer, 12 cases of lymph node metastasis of lung cancer, 12 cases of precancerous lesion and 10 cases of normal lung tissue, and the clinicopathological features of lung cancer were analyzed. The expression of FHIT was localized in the cytoplasm. Loss of FHIT expression in primary cancers, precancerous lesion and lymph node metastasis of lung cancer was 46.1%, 41.7% and 50.0% respectively, while 0 in 10 cases of normal tissues. A significant difference of FHIT expression was observed among four groups (P < 0.05). Loss of FHIT expression in precancerous lesion, primary lung cancer and lymph node metastasis of lung cancer was significantly higher than that in normal lung tissue (P < 0.05). The difference among precancerous lesion, primary lung cancer and lymph node metastasis of lung cancer groups was not statistically significant (P > 0.05). Loss of FHIT expression was related to tumor histologicol types, degree of cell differentiation and the smoking history of patients (P < 0.05), but not to sex, age, gross appearance types, TNM stages, or lymph node metastasis (P > 0.05). The protein expression level of FHIT is reduced in primary cancers and precancerous tissues, especially in most squamous cell carcinomas, poorly differentiated group and the patients with a smoking history. These results indicate that loss of FHIT expression might correlate with carcinogenesis, development of lung cancer and the carcinogenesis induced by

  8. [Novel reference gene RPN1 for normalization of quantitative data in lung and kidney cancer].


    Krasnov, G S; Oparina, N Iu; Dmitriev, A A; Kudriavtsev, A V; Anedchenko, E A; Kondrat'eva, T T; Zabarovskiĭ, E R; Senchenko, V N


    Quantitative methods of gene expression analysis in tumors require accurate data normalization, which allows comparison of different mRNA/cDNA samples with unknown concentration. For this purpose reference genes with stable expression level (such as GAPDH, ACTB, HPRT1, TBP) are used. The choice of appropriate reference genes is still actual because well-known reference genes are not suitable for certain cancer types frequently and their unreasonable use without additional tests lead to wrong conclusions. We have developed the bioinformatic approach and selected a new potential reference gene RPN1 for lung and kidney tumors. This gene is located at the long arm of chromosome 3. Our method includes mining of the dbEST and Oncomine databases and functional analysis of genes. The RPN1 was selected from 1500 candidate housekeeping genes. Using comparative genomic hybridization with NotI-microarrays we found no methylation, deletions and/or amplifications at the RPN1-containing locus in 56 non-small cell lung and 42 clear cell renal cancer samples. Using RT-qPCR we showed low variability of RPN1 mRNA level comparable to those of reference genes GAPDH and GUSB in lung and kidney cancer. The mRNA levels of two target genes coding hyalouronidases--HYAL1 and HYAL2--were estimated and normalized relative to pair RPN1--GAPDH genes for lung cancer and RPN1--GUSB for kidney cancer. These combinations were shown to be optimal for obtaining accurate and reproducible data. All obtained results allow us to suggest RPN1 as novel reference gene for quantitative data normalization in gene expression studies for lung and kidney cancers.

  9. RNA-Sequencing studies identify genes differentially regulated during inflammation-driven lung tumorigenesis and targeted by chemopreventive agents

    PubMed Central

    Qian, Xuemin; Khammanivong, Ali; Song, Jung Min; Teferi, Fitsum; Upadhyaya, Pramod; Dickerson, Erin; Kassie, Fekadu


    Chronic pulmonary inflammation has been consistently shown to increase the risk of lung cancer. Therefore, assessing the molecular links between the two diseases and identification of chemopreventive agents that inhibit inflammation-driven lung tumorigenesis is indispensable. Recently, we found that 4-(methylnitro-samino)-1-(3-pyridyl)-1-butanone (NNK)-induced mouse lung tumorigenesis was significantly enhanced by chronic treatment with the inflammatory agents lipopolysaccharide (LPS) and combinatory treatment with the chemoprevenitve agents silibinin (Sil) and indole-3-carbinol (I3C) significantly inhibited the burden of inflammation-driven lung tumors. In this report, we described gene expression profiling of lung tissues derived from these studies to determine the gene expression signature in inflammation-driven lung tumors and modulation of this signature by the chemopreventive agents Sil and I3C. We found that 330, 2,957, and 1,143 genes were differentially regulated in mice treated with NNK, LPS, and NNK + LPS, respectively. The inflammatory response of lung tumors to LPS, as determined by the number of proinflammatory genes with altered gene expression or the level of alteration, was markedly less than that of normal lungs. Among 1,143 genes differentially regulated in the NNK + LPS group, the expression of 162 genes and associated signaling pathways were significantly modulated by I3C and/or Sil + I3C. These genes include cytokines, chemokines, putative oncogenes and tumor suppressor genes and Ros1, AREG, EREG, Cyp1a1, Arntl, and Npas2. To our knowledge, this is the first report that provides insight into genes that are differentially expressed during inflammation-driven lung tumorigenesis and the modulation of these genes by chemopreventive agents. PMID:25795230

  10. High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis

    PubMed Central

    Doldo, Elena; Costanza, Gaetana; Ferlosio, Amedeo; Pompeo, Eugenio; Agostinelli, Sara; Bellezza, Guido; Mazzaglia, Donatella; Giunta, Alessandro; Sidoni, Angelo; Orlandi, Augusto


    Purpose Adenocarcinoma, the most common non-small cell lung cancer is a leading cause of death worldwide, with a low overall survival (OS) despite increasing attempts to achieve an early diagnosis and accomplish surgical and multimodality treatment strategies. Cellular retinol binding protein-1 (CRBP-1) regulates retinol bioavailability and cell differentiation, but its role in lung cancerogenesis remains uncertain. Experimental design CRBP-1 expression, clinical outcome and other prognostic factors were investigated in 167 lung adenocarcinoma patients. CRBP-1 expression was evaluated by immunohistochemistry of tissue microarray sections, gene copy number analysis and tumor methylation specific PCR. Effects of CRBP-1 expression on proliferation/apoptosis gene array, protein and transcripts were investigated in transfected A549 lung adenocarcinoma cells. Results CRBP-1High expression was observed in 62.3% of adenocarcinomas and correlated with increased tumor grade and reduced OS as an independent prognostic factor. CRBP-1 gene copy gain also associated with tumor CRBP-1High status and dedifferentiation. CRBP-1-transfected (CRBP-1+) A549 grew more than CRBP-1− A549 cells. At >1μM concentrations, all trans-retinoic acid and retinol reduced viability more in CRBP-1+ than in CRBP-1− A549 cells. CRBP-1+ A549 cells showed up-regulated RARα/ RXRα and proliferative and transcriptional genes including pAkt, pEGFR, pErk1/2, creb1 and c-jun, whereas RARβ and p53 were strongly down-regulated; pAkt/pErk/ pEGFR inhibitors counteracted proliferative advantage and increased RARα/RXRα, c-jun and CD44 expression in CRBP-1+ A549 cells. Conclusion CRBP-1High expression in lung adenocarcinoma correlated with increased tumor grade and reduced OS, likely through increased Akt/Erk/EGFR-mediated cell proliferation and differentiation. CRBP-1High expression can be considered an additional marker of poor prognosis in lung adenocarcinoma patients. PMID:26807202

  11. Radioisotopic imaging allows optimization of adenovirus lung deposition for cystic fibrosis gene therapy.


    Lerondel, S; Le Pape, A; Sené, C; Faure, L; Bernard, S; Diot, P; Nicolis, E; Mehtali, M; Lusky, M; Cabrini, G; Pavirani, A


    Cystic fibrosis is a common, heriditary disease resulting from mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Airway transfer of the CFTR gene is a potential strategy to treat or prevent the lung pathology that is the main cause of morbidity and mortality. Among the vectors used for gene therapy, adenoviruses have shown their ability to transfer the CFTR gene to respiratory epithelial cells, using either instillation or nebulization. Our objective was to characterize the lung deposition of aerosolized adenovirus by quantitative radioisotopic imaging, the only noninvasive technique allowing in vivo quantitation of inhaled drugs. We first labeled an adenovirus expressing human CFTR with the gamma-emitting radioisotope, technetium 99m (99mTc), and determined the best labeling conditions to allow preservation of virus bioactivity. We then administered the radioaerosol to baboons, determined lung regional deposition of 99mTc-labeled adenovirus, and compared the expression of CFTR transcripts 3 and 21 days after inhalation. The expression of vector-encoded mRNA ranged from 4 to 22% with respect to the endogenous CFTR mRNA depending on the lung segments. Moreover, we have developed a model using 99mTc-DTPA (diethylenetriamine pentaacetic acid), which can be used, as an alternative to adenovirus, to determine the profile of lung deposition of the vector. This study demonstrates that scintigraphy is a useful technique to achieve optimization of gene administration to the airways.

  12. Human Lacrimal Gland Gene Expression

    PubMed Central

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian


    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151

  13. The significance of PIWI family expression in human lung embryogenesis and non-small cell lung cancer

    PubMed Central

    Navarro, Alfons; Tejero, Rut; Viñolas, Nuria; Cordeiro, Anna; Marrades, Ramon M.; Fuster, Dolors; Caritg, Oriol; Moises, Jorge; Muñoz, Carmen; Molins, Laureano; Ramirez, Josep; Monzo, Mariano


    The expression of Piwi-interacting RNAs, small RNAs that bind to PIWI proteins, was until recently believed to be limited to germinal stem cells. We have studied the expression of PIWI genes during human lung embryogenesis and in paired tumor and normal tissue prospectively collected from 71 resected non-small-cell lung cancer patients. The mRNA expression analysis showed that PIWIL1 was highly expressed in 7-week embryos and downregulated during the subsequent weeks of development. PIWIL1 was expressed in 11 of the tumor samples but in none of the normal tissue samples. These results were validated by immunohistochemistry, showing faint cytoplasmic reactivity in the PIWIL1-positive samples. Interestingly, the patients expressing PIWIL1 had a shorter time to relapse (TTR) (p = 0.006) and overall survival (OS) (p = 0.0076) than those without PIWIL1 expression. PIWIL2 and 4 were downregulated in tumor tissue in comparison to the normal tissue (p < 0.001) and the patients with lower levels of PIWIL4 had shorter TTR (p = 0.048) and OS (p = 0.033). In the multivariate analysis, PIWIL1 expression emerged as an independent prognostic marker. Using 5-Aza-dC treatment and bisulfite sequencing, we observed that PIWIL1 expression could be regulated in part by methylation. Finally, an in silico study identified a stem-cell expression signature associated with PIWIL1 expression. PMID:25742785

  14. Beryllium-induced lung disease exhibits expression profiles similar to sarcoidosis

    PubMed Central

    Li, Li; Silveira, Lori J.; Hamzeh, Nabeel; Gillespie, May; Mroz, Peggy M.; Mayer, Annyce S.; Fingerlin, Tasha E.; Maier, Lisa A.


    A subset of beryllium-exposed workers develop beryllium sensitisation (BeS) which precedes chronic beryllium disease (CBD). We conducted an in-depth analysis of differentially expressed candidate genes in CBD. We performed Affymetrix GeneChip 1.0 ST array analysis on peripheral blood mononuclear cells (PBMCs) from 10 CBD, 10 BeS and 10 beryllium-exposed, nondiseased controls stimulated with BeSO4 or medium. The differentially expressed genes were validated by high-throughput real-time PCR in this group and in an additional group of cases and nonexposed controls. The functional roles of the top candidate genes in CBD were assessed using a pharmacological inhibitor. CBD gene expression data were compared with whole blood and lung tissue in sarcoidosis from the Gene Expression Omnibus. We confirmed almost 450 genes that were significantly differentially expressed between CBD and controls. The top enrichment of genes was for JAK (Janus kinase)–STAT (signal transducer and activator of transcription) signalling. A JAK2 inhibitor significantly decreased tumour necrosis factor-α and interferon-γ production. Furthermore, we found 287 differentially expressed genes overlapped in CBD/sarcoidosis. The top shared pathways included cytokine–cytokine receptor interactions, and Toll-like receptor, chemokine and JAK–STAT signalling pathways. We show that PBMCs demonstrate differentially expressed gene profiles relevant to the immunnopathogenesis of CBD. CBD and sarcoidosis share similar differential expression of pathogenic genes and pathways. PMID:27103383

  15. WWOX gene restoration prevents lung cancer growth in vitro and in vivo.


    Fabbri, Muller; Iliopoulos, Dimitrios; Trapasso, Francesco; Aqeilan, Rami I; Cimmino, Amelia; Zanesi, Nicola; Yendamuri, Sai; Han, Shuang-Yin; Amadori, Dino; Huebner, Kay; Croce, Carlo M


    The WWOX (WW domain containing oxidoreductase) gene at the common fragile site, FRA16D, is altered in many types of cancer, including lung cancer. We have examined the tumor suppressor function of WWOX in preclinical lung cancer models. The WWOX gene was expressed in lung cancer cell lines through recombinant adenovirus (Ad) infection (Ad-WWOX), and through a drug [ponasterone A, (ponA)]-inducible system. After WWOX restoration in vitro, endogenous Wwox protein-negative cell lines (A549, H460, and H1299) underwent apoptosis through activation of the intrinsic apoptotic caspase cascade in A549 and H460 cells. Ectopic expression of Wwox caused dramatic suppression of tumorigenicity of A549, H460, and H1299 cells in nude mice after Ad-WWOX infection and after ponA induction of Wwox expression in H1299 lung cancer cells. Tumorigenicity and in vitro growth of U2020 (Wwox-positive) lung cancer cells was unaffected by Wwox overexpression. This study confirms that WWOX is a tumor suppressor gene and is highly effective in preventing growth of lung cancer xenografts, whether introduced through viral infection or by induction of a silent WWOX transgene.

  16. The innate immune response in fetal lung mesenchymal cells targets VEGFR2 expression and activity.


    Medal, Rachel M; Im, Amanda M; Yamamoto, Yasutoshi; Lakhdari, Omar; Blackwell, Timothy S; Hoffman, Hal M; Sahoo, Debashis; Prince, Lawrence S


    In preterm infants, soluble inflammatory mediators target lung mesenchymal cells, disrupting airway and alveolar morphogenesis. However, how mesenchymal cells respond directly to microbial stimuli remains poorly characterized. Our objective was to measure the genome-wide innate immune response in fetal lung mesenchymal cells exposed to the bacterial endotoxin lipopolysaccharide (LPS). With the use of Affymetrix MoGene 1.0st arrays, we showed that LPS induced expression of unique innate immune transcripts heavily weighted toward CC and CXC family chemokines. The transcriptional response was different between cells from E11, E15, and E18 mouse lungs. In all cells tested, LPS inhibited expression of a small core group of genes including the VEGF receptor Vegfr2 Although best characterized in vascular endothelial populations, we demonstrated here that fetal mouse lung mesenchymal cells express Vegfr2 and respond to VEGF-A stimulation. In mesenchymal cells, VEGF-A increased cell migration, activated the ERK/AKT pathway, and promoted FOXO3A nuclear exclusion. With the use of an experimental coculture model of epithelial-mesenchymal interactions, we also showed that VEGFR2 inhibition prevented formation of three-dimensional structures. Both LPS and tyrosine kinase inhibition reduced three-dimensional structure formation. Our data suggest a novel mechanism for inflammation-mediated defects in lung development involving reduced VEGF signaling in lung mesenchyme. Copyright © 2017 the American Physiological Society.

  17. Tuning noise in gene expression.


    Tyagi, Sanjay


    The relative contribution of promoter architecture and the associated chromatin environment in regulating gene expression noise has remained elusive. In their recent work, Arkin, Schaffer and colleagues (Dey et al, 2015) show that mean expression and noise for a given promoter at different genomic loci are uncorrelated and influenced by the local chromatin environment.

  18. Monoallelic Gene Expression in Mammals.


    Chess, Andrew


    Monoallelic expression not due to cis-regulatory sequence polymorphism poses an intriguing problem in epigenetics because it requires the unequal treatment of two segments of DNA that are present in the same nucleus and that can indeed have absolutely identical sequences. Here, I focus on a few recent developments in the field of monoallelic expression that are of particular interest and raise interesting questions for future work. One development is regarding analyses of imprinted genes, in which recent work suggests the possibility that intriguing networks of imprinted genes exist and are important for genetic and physiological studies. Another issue that has been raised in recent years by a number of publications is the question of how skewed allelic expression should be for it to be designated as monoallelic expression and, further, what methods are appropriate or inappropriate for analyzing genomic data to examine allele-specific expression. Perhaps the most exciting recent development in mammalian monoallelic expression is a clever and carefully executed analysis of genetic diversity of autosomal genes subject to random monoallelic expression (RMAE), which provides compelling evidence for distinct evolutionary forces acting on random monoallelically expressed genes.

  19. Transgenic control of perforin gene expression

    SciTech Connect

    Lichtenheld, M.G.; Podack, E.R.; Levy, R.B.


    Perforin is a pore-forming effector molecule of CTL and NK cells. To characterize perforin gene expression and its transcriptional control mechanisms in vivo, expression of a cell surface tag, i.e., human CD4, was driven by 5.1 kb of the murin perforin 5{prime} flanking and promoter region in transgenic mice. Six out of seven transgenic lines expressed the perforin-tag hybrid gene at low to intermediate levels, depending on the integration site. Transgene expression occurred in all cells that physiologically are able to express perforin. At the whole organ level, significant amounts of transgenic mRNA and endogenous perforin mRNA were co-expressed in the lymphoid organs, as well as in the lung, the ileum, the oviduct/uterus, and the bone marrow. At the single cell level, the perforin tag was present on NK cells and on CD8{sup +}, as well as on CD4{sup +} cells. Also targeted were Thy-1.2{sup +} {gamma}{delta} T cells, but not Thy-1.2{sup -} {gamma}{delta} T cells, B cells, nor monocytes. During thymic T cell development, transgene expression occurred in double negative (CD4{sup -}CD8{sup -}) thymocytes and was detected at all subsequent stages, but exceeded the expression levels of the endogenous gene in the thymus. In conclusion, the analyzed perforin 5{prime} flanking and promoter region contains important cis-acting sequences that restrict perforin expression to T cells and NK cells, and therefore provides a unique tool for manipulating T cell and/or Nk cell-mediated immune responses in transgenic mice. On the other hand, the normal control of perforin gene expression involves at least one additional negative control mechanism that was not mediated by the transgenic promoter and upstream region. This control restricts perforin gene expression in thymically developing T cells and in most resting peripheral T cells, but can be released upon T cell activation. 43 refs., 7 figs., 1 tab.

  20. Aberrant gene expression in deceased transgenic cloned calves.


    Zhang, L; Wang, S H; Dai, Y P; Li, N


    Several transgenic cloned species have been obtained; however, the efficiency of transgenic cloning remains very low, even lower than cloning. Many experiments have demonstrated abnormal growth and development, and inappropriate gene expression in cloned animals. In this study, we examined the expression of 19 development-related genes in lungs of three normal controls and three aberrant transgenic cloned calves. Results showed in transgenic cloned calves, 84.2% genes had decreased expression levels, however, 5.3% genes had increased levels. This study suggests transgenic cloning and the aberrant expression would cause abnormal growth and development in transgenic cloned calves. To our knowledge, this is the first time that gene expression was examined in transgenic cloned cattle. These findings may have some implications in understanding the low efficiency of the transgenic cloning.

  1. Identification of Novel Deregulated RNA Metabolism-Related Genes in Non-Small Cell Lung Cancer

    PubMed Central

    Valles, Iñaki; Pajares, Maria J.; Segura, Victor; Guruceaga, Elisabet; Gomez-Roman, Javier; Blanco, David; Tamura, Akiko; Montuenga, Luis M.; Pio, Ruben


    Lung cancer is a leading cause of cancer death worldwide. Several alterations in RNA metabolism have been found in lung cancer cells; this suggests that RNA metabolism-related molecules are involved in the development of this pathology. In this study, we searched for RNA metabolism-related genes that exhibit different expression levels between normal and tumor lung tissues. We identified eight genes differentially expressed in lung adenocarcinoma microarray datasets. Of these, seven were up-regulated whereas one was down-regulated. Interestingly, most of these genes had not previously been associated with lung cancer. These genes play diverse roles in mRNA metabolism: three are associated with the spliceosome (ASCL3L1, SNRPB and SNRPE), whereas others participate in RNA-related processes such as translation (MARS and MRPL3), mRNA stability (PCBPC1), mRNA transport (RAE), or mRNA editing (ADAR2, also known as ADARB1). Moreover, we found a high incidence of loss of heterozygosity at chromosome 21q22.3, where the ADAR2 locus is located, in NSCLC cell lines and primary tissues, suggesting that the downregulation of ADAR2 in lung cancer is associated with specific genetic losses. Finally, in a series of adenocarcinoma patients, the expression of five of the deregulated genes (ADAR2, MARS, RAE, SNRPB and SNRPE) correlated with prognosis. Taken together, these results support the hypothesis that changes in RNA metabolism are involved in the pathogenesis of lung cancer, and identify new potential targets for the treatment of this disease. PMID:22876301

  2. Sex differences in the expression of lung inflammatory mediators in response to ozone.


    Cabello, Noe; Mishra, Vikas; Sinha, Utkarshna; DiAngelo, Susan L; Chroneos, Zissis C; Ekpa, Ndifreke A; Cooper, Timothy K; Caruso, Carla R; Silveyra, Patricia


    Sex differences in the incidence of respiratory diseases have been reported. Women are more susceptible to inflammatory lung disease induced by air pollution and show worse adverse pulmonary health outcomes than men. However, the mechanisms underlying these differences remain unknown. In the present study, we hypothesized that sex differences in the expression of lung inflammatory mediators affect sex-specific immune responses to environmental toxicants. We focused on the effects of ground-level ozone, a major air pollutant, in the expression and regulation of lung immunity genes. We exposed adult male and female mice to 2 ppm of ozone or filtered air (control) for 3 h. We compared mRNA levels of 84 inflammatory genes in lungs harvested 4 h postexposure using a PCR array. We also evaluated changes in lung histology and bronchoalveolar lavage fluid cell counts and protein content at 24 and 72 h postexposure. Our results revealed sex differences in lung inflammation triggered by ozone exposure and in the expression of genes involved in acute phase and inflammatory responses. Major sex differences were found in the expression of neutrophil-attracting chemokines (Ccl20, Cxcl5, and Cxcl2), the proinflammatory cytokine interleukin-6, and oxidative stress-related enzymes (Ptgs2, Nos2). In addition, the phosphorylation of STAT3, known to mediate IL-6-related immune responses, was significantly higher in ozone-exposed mice. Together, our observations suggest that a differential regulation of the lung immune response could be implicated in the observed increased susceptibility to adverse health effects from ozone observed in women vs. men. Copyright © 2015 the American Physiological Society.

  3. Sex differences in the expression of lung inflammatory mediators in response to ozone

    PubMed Central

    Cabello, Noe; Mishra, Vikas; Sinha, Utkarshna; DiAngelo, Susan L.; Chroneos, Zissis C.; Ekpa, Ndifreke A.; Cooper, Timothy K.; Caruso, Carla R.


    Sex differences in the incidence of respiratory diseases have been reported. Women are more susceptible to inflammatory lung disease induced by air pollution and show worse adverse pulmonary health outcomes than men. However, the mechanisms underlying these differences remain unknown. In the present study, we hypothesized that sex differences in the expression of lung inflammatory mediators affect sex-specific immune responses to environmental toxicants. We focused on the effects of ground-level ozone, a major air pollutant, in the expression and regulation of lung immunity genes. We exposed adult male and female mice to 2 ppm of ozone or filtered air (control) for 3 h. We compared mRNA levels of 84 inflammatory genes in lungs harvested 4 h postexposure using a PCR array. We also evaluated changes in lung histology and bronchoalveolar lavage fluid cell counts and protein content at 24 and 72 h postexposure. Our results revealed sex differences in lung inflammation triggered by ozone exposure and in the expression of genes involved in acute phase and inflammatory responses. Major sex differences were found in the expression of neutrophil-attracting chemokines (Ccl20, Cxcl5, and Cxcl2), the proinflammatory cytokine interleukin-6, and oxidative stress-related enzymes (Ptgs2, Nos2). In addition, the phosphorylation of STAT3, known to mediate IL-6-related immune responses, was significantly higher in ozone-exposed mice. Together, our observations suggest that a differential regulation of the lung immune response could be implicated in the observed increased susceptibility to adverse health effects from ozone observed in women vs. men. PMID:26342085

  4. Identification of Importin 8 (IPO8) as the most accurate reference gene for the clinicopathological analysis of lung specimens

    PubMed Central

    Nguewa, Paul A; Agorreta, Jackeline; Blanco, David; Lozano, Maria Dolores; Gomez-Roman, Javier; Sanchez, Blas A; Valles, Iñaki; Pajares, Maria J; Pio, Ruben; Rodriguez, Maria Jose; Montuenga, Luis M; Calvo, Alfonso


    Background The accurate normalization of differentially expressed genes in lung cancer is essential for the identification of novel therapeutic targets and biomarkers by real time RT-PCR and microarrays. Although classical "housekeeping" genes, such as GAPDH, HPRT1, and beta-actin have been widely used in the past, their accuracy as reference genes for lung tissues has not been proven. Results We have conducted a thorough analysis of a panel of 16 candidate reference genes for lung specimens and lung cell lines. Gene expression was measured by quantitative real time RT-PCR and expression stability was analyzed with the softwares GeNorm and NormFinder, mean of |ΔCt| (= |Ct Normal-Ct tumor|) ± SEM, and correlation coefficients among genes. Systematic comparison between candidates led us to the identification of a subset of suitable reference genes for clinical samples: IPO8, ACTB, POLR2A, 18S, and PPIA. Further analysis showed that IPO8 had a very low mean of |ΔCt| (0.70 ± 0.09), with no statistically significant differences between normal and malignant samples and with excellent expression stability. Conclusion Our data show that IPO8 is the most accurate reference gene for clinical lung specimens. In addition, we demonstrate that the commonly used genes GAPDH and HPRT1 are inappropriate to normalize data derived from lung biopsies, although they are suitable as reference genes for lung cell lines. We thus propose IPO8 as a novel reference gene for lung cancer samples. PMID:19014639

  5. Epidermal growth factor receptor mutation enhances expression of vascular endothelial growth factor in lung cancer.


    Hung, Ming-Szu; Chen, I-Chuan; Lin, Paul-Yann; Lung, Jr-Hau; Li, Ya-Chin; Lin, Yu-Ching; Yang, Cheng-Ta; Tsai, Ying-Huang


    Epidermal growth factor receptor (EGFR) activation has been demonstrated to have a critical role in tumor angiogenesis. In the present study, the correlation between EGFR mutations and vascular endothelial growth factor (VEGF) was investigated in lung cancer cell lines and non-small-cell lung cancer (NSCLC) tumor tissues. VEGF levels were significantly increased in culture medium of lung cancer cells and NSCLC tissues with EGFR mutations (H1650 vs. A549, P=0.0399; H1975 vs. A549, P<0.0001). Stable lung cancer cell lines expressing mutant (exon 19 deletion, E746-A750; exon 21 missense mutation, L858R) and wild-type EGFR genes were established. Significantly increased expression of VEGF and stronger inhibitory effects of gefitinib to VEGF expression were observed in exon 19 deletion stable lung cancer cells (exon 19 deletion vs. wild-type EGFR, P=0.0005). The results of the present study may provide an insight into the association of mutant EGFR and VEGF expression in lung cancer, and may assist with further development of targeted therapy for NSCLC in the future.

  6. Decreased expression of interleukin 13 in human lung emphysema

    PubMed Central

    Boutten, A; Bonay, M; Laribe, S; Leseche, G; Castier, Y; Lecon-Malas, V; Fournier, M; Durand, G; Aubier, M; Dehoux, M; Crestani, B


    Background: The overexpression of interferon (IFN)γ or interleukin (IL)-13 in the adult murine lung induces the development of changes that mirror human lung emphysema. Methods: IL-13 and IFNγ expression was determined in lung samples from five groups of patients: severe emphysema without α1-antitrypsin deficiency (SE+, n = 10); severe emphysema with α1-antitrypsin deficiency (SE–, n = 5); mild localised emphysema (ME, n = 8); non-emphysema smokers (NE-S, n = 9), and non-emphysema non-smokers (NE-NS, n = 11). Lung IL-13 and IFNγ mRNA were analysed by RT-PCR. Lung concentrations of IL-13 protein were assessed by ELISA. Results: The expression of IFNγ mRNA was similar in patients with or without emphysema. IL-13 mRNA was markedly decreased in the SE+ group compared with the SE– (p = 0.04), ME (p = 0.02), and non-emphysema groups (p = 0.01). IL-13 mRNA correlated with forced expiratory volume in 1 second (r = 0.5, p = 0.04) and arterial oxygen tension (r = 0.45, p = 0.03) in emphysema patients. In contrast to the non-emphysematous lung, IL-13 protein was below the detection limit of the assay in most emphysematous lung homogenates. Conclusion: The lung IL-13 content is reduced in patients with severe emphysema without α1-antitrypsin deficiency. PMID:15454650

  7. 2058 Expressed sequence tags (ESTs) from a human fetal lung cDNA library

    SciTech Connect

    Kazunori, Sudo |; Katsuya Chinen; Yusuke Nakamura


    ESTs (expressed sequence tags) provide complementary resources for structural and functional analyses of the human genome. The authors have performed single-pass sequencing of 2058 randomly selected, directionally cloned cDNAs isolated from a fetal-lung cDNA library constructed with oligo (dT) primers. Computer analyses of the 5{prime}-end sequences revealed that 60.4% of the clones were considered to be identical to previously reported human genes or ESTs; 9.0% of them showed significant homology to known genes in human, other mammals, or lower organisms; 30.6% showed no homology to any genes or DNA sequences in the public database. These data and reagents will be useful for future investigations of gene expression during prenatal development of human lung. 11 refs., 1 fig., 2 tabs.

  8. Gene expression profiling of candidate genes in peripheral blood mononuclear cells for predicting toxicity of diesel exhaust particles.


    Srivastava, Ankita; Sharma, Amit; Yadav, Sanjay; Flora, Swaran J S; Dwivedi, Uppendra N; Parmar, Devendra


    To validate gene expression profiling of peripheral blood mononuclear cells (PBMCs) as a surrogate for monitoring tissue expression, this study using RT-PCR-based TaqMan low-density array (TLDA) was initiated to investigate similarities in the mRNA expression of target genes altered by exposure to diesel exhaust particles (DEPs) in freshly prepared PBMCs and in lungs. Adult Wistar rats were treated transtracheally with a single dose of 7.5 or 15 or 30mg/kg DEPs and sacrificed 24h later. Blood and lungs were immediately taken out and processed for RT-PCR. DEP treatment induced similar patterns of increase in the expression of polycyclic aromatic hydrocarbon-responsive cytochrome P450s, the phase II enzymes, and their associated transcription factors in both lungs and PBMCs, at all doses. Similar to that seen in lungs, a dose-dependent increase was observed in the expression of genes involved in inflammation, such as cytokines, chemokines, and adhesion molecules, in PBMCs. The expression of various genes involved in DNA repair and apoptosis was also increased in a dose-dependent manner in PBMCs and lungs. The present TLDA data indicating similarities in the responsiveness of candidate genes involved in the toxicity of DEPs between PBMCs and lungs after exposure to DEPs demonstrate that expression profiles of genes in PBMCs could be used as a surrogate for monitoring the acute toxicity of fine and ultrafine particulate matter present in vehicular emissions.

  9. Role of AXL expression in non-small cell lung cancer.


    Qu, Xiaohan; Liu, Jinlu; Zhong, Xinwen; Li, Xi; Zhang, Qigang


    The present study aimed to investigate the expression profile of AXL in non-small cell lung cancer (NSCLC) and its clinical significance. The current study included 257 NSCLC patients, tyrosine-protein kinase receptor UFO (AXL) expression in paired lung cancer and adjacent normal lung tissues of NSCLC patients were compared by immunohistochemistry, western blot analysis and quantitative polymerase chain reaction (qPCR). These methods were used to detect the expression of the AXL gene and protein in fresh tissues from 35 patients. Small interfering RNA (siRNA) was transfected into the H1299 lung cancer cell line to knock down AXL expression; the effects of AXL-siRNA on cell proliferation and migration were examined by MTT and Transwell migration assay, respectively. It was found that AXL staining density in lung cancer tissues was significantly increased compared with adjacent normal lung tissues (55.25 vs. 26.85%; P<0.01); and the expression level of AXL in NSCLC patients was significantly associated with the degree of tumor differentiation (P<0.01) and the clinical stage of disease (P<0.01). Western blotting and qPCR showed that AXL expression was significantly higher in cancer tissues compared with that in adjacent lung tissue (P<0.05). Additionally, the current study also showed that AXL-siRNA inhibited H1299 cell proliferation and migration in vitro. The present study demonstrates the association between increased expression of AXL in NSCLC and the low differentiation phenotype, and its effects on cell proliferation and migration, suggesting its potential clinical values for the prognosis of NSCLC.

  10. Role of AXL expression in non-small cell lung cancer

    PubMed Central

    Qu, Xiaohan; Liu, Jinlu; Zhong, Xinwen; Li, Xi; Zhang, Qigang


    The present study aimed to investigate the expression profile of AXL in non-small cell lung cancer (NSCLC) and its clinical significance. The current study included 257 NSCLC patients, tyrosine-protein kinase receptor UFO (AXL) expression in paired lung cancer and adjacent normal lung tissues of NSCLC patients were compared by immunohistochemistry, western blot analysis and quantitative polymerase chain reaction (qPCR). These methods were used to detect the expression of the AXL gene and protein in fresh tissues from 35 patients. Small interfering RNA (siRNA) was transfected into the H1299 lung cancer cell line to knock down AXL expression; the effects of AXL-siRNA on cell proliferation and migration were examined by MTT and Transwell migration assay, respectively. It was found that AXL staining density in lung cancer tissues was significantly increased compared with adjacent normal lung tissues (55.25 vs. 26.85%; P<0.01); and the expression level of AXL in NSCLC patients was significantly associated with the degree of tumor differentiation (P<0.01) and the clinical stage of disease (P<0.01). Western blotting and qPCR showed that AXL expression was significantly higher in cancer tissues compared with that in adjacent lung tissue (P<0.05). Additionally, the current study also showed that AXL-siRNA inhibited H1299 cell proliferation and migration in vitro. The present study demonstrates the association between increased expression of AXL in NSCLC and the low differentiation phenotype, and its effects on cell proliferation and migration, suggesting its potential clinical values for the prognosis of NSCLC. PMID:28105215

  11. Repression of Igf1 expression by Ezh2 prevents basal cell differentiation in the developing lung

    PubMed Central

    Galvis, Laura A.; Holik, Aliaksei Z.; Short, Kieran M.; Pasquet, Julie; Lun, Aaron T. L.; Blewitt, Marnie E.; Smyth, Ian M.; Ritchie, Matthew E.; Asselin-Labat, Marie-Liesse


    Epigenetic mechanisms involved in the establishment of lung epithelial cell lineage identities during development are largely unknown. Here, we explored the role of the histone methyltransferase Ezh2 during lung lineage determination. Loss of Ezh2 in the lung epithelium leads to defective lung formation and perinatal mortality. We show that Ezh2 is crucial for airway lineage specification and alveolarization. Using optical projection tomography imaging, we found that branching morphogenesis is affected in Ezh2 conditional knockout mice and the remaining bronchioles are abnormal, lacking terminally differentiated secretory club cells. Remarkably, RNA-seq analysis revealed the upregulation of basal genes in Ezh2-deficient epithelium. Three-dimensional imaging for keratin 5 further showed the unexpected presence of a layer of basal cells from the proximal airways to the distal bronchioles in E16.5 embryos. ChIP-seq analysis indicated the presence of Ezh2-mediated repressive marks on the genomic loci of some but not all basal genes, suggesting an indirect mechanism of action of Ezh2. We found that loss of Ezh2 de-represses insulin-like growth factor 1 (Igf1) expression and that modulation of IGF1 signaling ex vivo in wild-type lungs could induce basal cell differentiation. Altogether, our work reveals an unexpected role for Ezh2 in controlling basal cell fate determination in the embryonic lung endoderm, mediated in part by repression of Igf1 expression. PMID:25790853

  12. Multi-walled carbon nanotube-induced gene signatures in the mouse lung: potential predictive value for human lung cancer risk and prognosis

    PubMed Central

    Guo, Nancy L; Wan, Ying-Wooi; Denvir, James; Porter, Dale W; Pacurari, Maricica; Wolfarth, Michael G; Castranova, Vincent; Qian, Yong


    Concerns over the potential for multi-walled carbon nanotubes (MWCNT) to induce lung carcinogenesis have emerged. This study sought to (1) identify gene expression signatures in the mouse lungs following pharyngeal aspiration of well-dispersed MWCNT and (2) determine if these genes were associated with human lung cancer risk and progression. Genome-wide mRNA expression profiles were analyzed in mouse lungs (n=160) exposed to 0, 10, 20, 40, or 80 µg of MWCNT by pharyngeal aspiration at 1, 7, 28, and 56 days post-exposure. By using pairwise-Statistical Analysis of Microarray (SAM) and linear modeling, 24 genes were selected, which have significant changes in at least two time points, have a more than 1.5 fold change at all doses, and are significant in the linear model for the dose or the interaction of time and dose. Additionally, a 38-gene set was identified as related to cancer from 330 genes differentially expressed at day 56 post-exposure in functional pathway analysis. Using the expression profiles of the cancer-related gene set in 8 mice at day 56 post-exposure to 10 µg of MWCNT, a nearest centroid classification accurately predicts human lung cancer survival with a significant hazard ratio in training set (n=256) and test set (n=186). Furthermore, both gene signatures were associated with human lung cancer risk (n=164) with significant odds ratios. These results may lead to development of a surveillance approach for early detection of lung cancer and prognosis associated with MWCNT in the workplace. PMID:22891886

  13. Differential gene expression in glaucoma.


    Jakobs, Tatjana C


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell-matrix interactions and adhesion, the cell cycle, and the endothelin system.

  14. Differential Gene Expression in Glaucoma

    PubMed Central

    Jakobs, Tatjana C.


    In glaucoma, regardless of its etiology, retinal ganglion cells degenerate and eventually die. Although age and elevated intraocular pressure (IOP) are the main risk factors, there are still many mysteries in the pathogenesis of glaucoma. The advent of genome-wide microarray expression screening together with the availability of animal models of the disease has allowed analysis of differential gene expression in all parts of the eye in glaucoma. This review will outline the findings of recent genome-wide expression studies and discuss their commonalities and differences. A common finding was the differential regulation of genes involved in inflammation and immunity, including the complement system and the cytokines transforming growth factor β (TGFβ) and tumor necrosis factor α (TNFα). Other genes of interest have roles in the extracellular matrix, cell–matrix interactions and adhesion, the cell cycle, and the endothelin system. PMID:24985133

  15. Fas expression in lung metastasis from osteosarcoma patients.


    Gordon, Nancy; Arndt, Carola A S; Hawkins, Douglas S; Doherty, Debra K; Inwards, Carrie Y; Munsell, Mark F; Stewart, John; Koshkina, Nadezhda V; Kleinerman, Eugenie S


    The authors' animal studies have shown that the metastatic potential of osteosarcoma (OS) cells correlates inversely with Fas expression-that is, Fas-negative cells metastasize but Fas-positive cells do not. One reason for this in the context of OS lung metastases may be that Fas-positive cells are eliminated by engagement with the Fas ligand (FasL) constitutively expressed on the surface of pneumocytes, whereas Fas-negative tumor cells are not. The purpose of this study was to determine the status of Fas expression in OS lung metastases from patients. Specifically, archived paraffin-embedded specimens of lung metastases from 38 patients with OS were analyzed by immunohistochemistry. Lung nodules from 23 of the 38 patients (60%) were Fas negative, those from 12 patients (32%) were weakly positive, and that from only 1 patient (3%) was strongly positive. Findings in the samples from the remaining two patients (5%) could not be interpreted because of extensive necrosis. Most patients with the weakly positive tumors and the single patient with the strongly positive tumor received chemotherapy prior to lung resection. There was a significant correlation between Fas expression and the administration of preoperative salvage chemotherapy (P = 0.0013). These data indicate that loss of Fas may be one mechanism by which OS cells evade host resistance in the lung. Chemotherapy may induce regression by upregulating Fas.

  16. Use of Nascent RNA Microarrays to Study Inducible Gene Expression in Breast Cancer Cells

    DTIC Science & Technology


    detect inducible gene expression following activation of a transcription factor we used the p53 mutant lung cancer cell line H1299 /tsp53 expressing a...temperature-sensitive p53 gene and a control cell line H1299 /neo expressing a neo control vector. To activate the transcription factor p53 we lowered...expression in H1299 +tsp53 cells nascent RNA gene expression in H1299 +neo cells. Nascent RNA was collected 3 hours after switching to the permissive

  17. Pathway-based identification of a smoking associated 6-gene signature predictive of lung cancer risk and survival

    PubMed Central

    Guo, Nancy Lan; Wan, Ying-Wooi


    Objective Smoking is a prominent risk factor for lung cancer. However, it is not an established prognostic factor for lung cancer in clinics. To date, no gene test is available for diagnostic screening of lung cancer risk or prognostication of clinical outcome in smokers. This study sought to identify a smoking associated gene signature in order to provide a more precise diagnosis and prognosis of lung cancer in smokers. Methods and materials An implication network based methodology was used to identify biomarkers by modeling crosstalk with major lung cancer signaling pathways. Specifically, the methodology contains the following steps: 1) identifying genes significantly associated with lung cancer survival; 2) selecting candidate genes which are differentially expressed in smokers versus non-smokers from the survival genes identified in Step 1; 3) from these candidate genes, constructing gene coexpression networks based on prediction logic for the smoker group and the non-smoker group, respectively; 4) identifying smoking-mediated differential components, i.e., the unique gene coexpression patterns specific to each group; and 5) from the differential components, identifying genes directly co-expressed with major lung cancer signaling hallmarks. Results A smoking-associated 6-gene signature was identified for prognosis of lung cancer from a training cohort (n=256). The 6-gene signature could separate lung cancer patients into two risk groups with distinct post-operative survival (log-rank P < 0.04, Kaplan-Meier analyses) in three independent cohorts (n=427). The expression-defined prognostic prediction is strongly related to smoking association and smoking cessation (P < 0.02; Pearson’s Chi-squared tests). The 6-gene signature is an accurate prognostic factor (hazard ratio = 1.89, 95% CI: [1.04, 3.43]) compared to common clinical covariates in multivariate Cox analysis. The 6-gene signature also provides an accurate diagnosis of lung cancer with an overall

  18. Folate Receptor α Expression Level Correlates With Histologic Grade in Lung Adenocarcinoma.


    Driver, Brandon R; Barrios, Roberto; Ge, Yimin; Haque, Abida; Tacha, David; Cagle, Philip T


    -Folate receptor α (FRA) is a glycosylphosphatidylinositol-anchored high-affinity folate receptor that localizes to the apical surface of epithelia when it is expressed in normal tissue. Unlike normal tissues, FRA may localize to the basolateral side in tumors. These features make FRA an attractive drug target, and several FRA-targeted drugs have been developed and are in phases of clinical testing. Folate receptor α protein expression shows intertumoral variability that may correlate with response to therapy and to clinicopathologic parameters. Using immunohistochemistry, a recent study of breast carcinomas found FRA protein expression was associated with triple-negative status and high histologic grade in breast cancer. Although a prior study of lung adenocarcinomas found the expression level of the gene encoding FRA, FOLR1, was significantly increased in low-histologic-grade tumors compared to high-histologic-grade tumors, the relationship between FRA protein expression and histologic grade has not been reported for lung adenocarcinomas. -To investigate the relationship between FRA protein expression level and clinicopathologic parameters in lung adenocarcinomas, including histologic grade, by performing immunohistochemistry for FRA on a cohort of non-small cell lung carcinomas. -High-density tissue microarrays constructed from 188 non-small cell lung carcinomas and used in prior studies were immunostained with FRA-specific antibody clone 26B3. Folate receptor α membranous staining intensity was given a semiquantitative score from 0 to 3+ for triplicate cores of tumor and averaged for each tumor. An average semiquantitative score from 0 to 1.4 was considered low expression, and an average semiquantitative score greater than 1.4 was considered high expression. -The majority (60 of 78; 77%) of lung adenocarcinomas and a minority (4 of 41; 10%) of lung squamous cell carcinomas were positive for FRA. Folate receptor α expression in lung adenocarcinomas compared

  19. Hypoxia induces different genes in the lungs of rats compared with mice.


    Hoshikawa, Yasushi; Nana-Sinkam, Patrick; Moore, Mark D; Sotto-Santiago, Sylk; Phang, Tzulip; Keith, Robert L; Morris, Kenneth G; Kondo, Takashi; Tuder, Rubin M; Voelkel, Norbert F; Geraci, Mark W


    Different animal species have a varying response to hypoxia. Mice develop less pulmonary artery thickening after chronic hypoxia exposure than rats. We hypothesized that the lung tissue gene expression pattern displayed in hypoxic rats would differ from that of hypoxic mice. We exposed Sprague-Dawley rats and C57BL/6 mice to both 1 and 3 wk of hypobaric hypoxia. Although both species developed pulmonary hypertension, mice showed less pulmonary vascular remodeling than rats. Microarray gene analysis demonstrated a distinct pattern of gene expression between mice and rats when exposed to hypoxic conditions. In addition, some genes appeared to be more responsive at an earlier time point of 1 wk of hypoxia. Hypoxic conditions in the rat induce genes involved in endothelial cell proliferation, repression of apoptosis, and vasodilation. Mice exposed to hypoxic conditions decrease the expression of genes involved in vasodilation and in endothelial cell proliferation. Although we cannot determine whether the differential expression of genes during chronic hypoxia is cause or consequence of the differential pulmonary vascular remodeling, we propose that a balance between over- and under-expression of a selective group of genes may be responsible for lung vascular remodeling and vascular tone control.

  20. Transgenic Arabidopsis Gene Expression System

    NASA Technical Reports Server (NTRS)

    Ferl, Robert; Paul, Anna-Lisa


    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  1. Integrative Analyses Identify Osteopontin, LAMB3 and ITGB1 as Critical Pro-Metastatic Genes for Lung Cancer

    PubMed Central

    Yan, Ming-Xia; Liu, Lei; Jia, De-Shui; Geng, Qin; Lin, He-Chun; He, Xiang-Huo; Li, Jin-Jun; Yao, Ming


    Objective To explore the key regulatory genes associated with lung cancer in order to reduce its occurrence and progress through silencing these key genes. Methods To identify the key regulatory genes involved in lung cancer, we performed a combination of gene array and bioinformatics analyses to compare gene transcription profiles in 3 monoclonal cell strains with high, medium or low metastatic abilities, which were separated from the SPC-A-1sci and SPC-A-1 cell lines by limiting dilution monoclone assay. We then analyzed those genes’ biological activities by knocking down their expression in SPC-A-1sci cells using siRNA and lenti-viral shRNA vectors, followed by determinations of the invasion and migration capabilities of the resulting cell lines in vitro as well as their potential for inducing occurrence and metastasis of lung cancer in vivo. To examine the clinical relevance of these findings, we analyzed the expression levels of the identified genes in human lung cancer tissues (n = 135) and matched adjacent normal tissues by immunohistochemical (IHC) staining. Results Three monoclonal cell strains characterized with high, medium or low metastatic abilities were successfully selected. Gene array and bioinformatics analyses implied that osteopontin, LAMB3 and ITGB1 were key genes involved in lung cancer. Knockdown of these genes suppressed human lung cancer cell invasion and metastasis in vitro and in vivo. Clinical sample analyses indicated that osteopontin, LAMB3 and ITGB1 protein expression levels were higher in lung cancer patients, compared to non-cancerous adjacent tissues, and correlated with lymphatic metastasis. Conclusions We confirmed that osteopontin, LAMB3 and ITGB1 played important roles in the occurrence and metastasis of lung cancer, thus provided important clues to understanding the molecular mechanism of metastasis and contributing to the therapeutic treatment of lung cancer. PMID:23441154

  2. Stochastic Mechanisms in Gene Expression

    NASA Astrophysics Data System (ADS)

    McAdams, Harley H.; Arkin, Adam


    In cellular regulatory networks, genetic activity is controlled by molecular signals that determine when and how often a given gene is transcribed. In genetically controlled pathways, the protein product encoded by one gene often regulates expression of other genes. The time delay, after activation of the first promoter, to reach an effective level to control the next promoter depends on the rate of protein accumulation. We have analyzed the chemical reactions controlling transcript initiation and translation termination in a single such ``genetically coupled'' link as a precursor to modeling networks constructed from many such links. Simulation of the processes of gene expression shows that proteins are produced from an activated promoter in short bursts of variable numbers of proteins that occur at random time intervals. As a result, there can be large differences in the time between successive events in regulatory cascades across a cell population. In addition, the random pattern of expression of competitive effectors can produce probabilistic outcomes in switching mechanisms that select between alternative regulatory paths. The result can be a partitioning of the cell population into different phenotypes as the cells follow different paths. There are numerous unexplained examples of phenotypic variations in isogenic populations of both prokaryotic and eukaryotic cells that may be the result of these stochastic gene expression mechanisms.

  3. Integrative analysis of lung development-cancer expression associations reveals the roles of signatures with inverse expression patterns.


    Zhang, Chunlong; Li, Chunquan; Xu, Yanjun; Feng, Li; Shang, Desi; Yang, Xinmiao; Han, Junwei; Sun, Zeguo; Li, Yixue; Li, Xia


    Recent studies have focused on exploring the associations between organ development and malignant tumors; however, the clinical relevance of the development signatures was inadequately addressed in lung cancer. In this study, we explored the associations between lung development and lung cancer progression by analyzing a total of two development and seven cancer datasets. We identified representative expression patterns (continuously up- and down-regulated) from development and cancer profiles, and inverse pattern associations were observed at both the gene and functional levels. Furthermore, we dissected the biological processes dominating the associations, and found that proliferation and immunity were respectively involved in the two inverse development-cancer expression patterns. Through sub-pathway analysis of the signatures with inverse expression patterns, we finally identified a 13-gene risk signature from the cell cycle sub-pathway, and evaluated its predictive performance for lung cancer patient clinical outcome using independent cohorts. Our findings indicated that the integrative analysis of development and cancer expression patterns provided a framework for identifying effective molecular signatures for clinical utility.

  4. Zipf's Law in Gene Expression

    NASA Astrophysics Data System (ADS)

    Furusawa, Chikara; Kaneko, Kunihiko


    Using data from gene expression databases on various organisms and tissues, including yeast, nematodes, human normal and cancer tissues, and embryonic stem cells, we found that the abundances of expressed genes exhibit a power-law distribution with an exponent close to -1; i.e., they obey Zipf’s law. Furthermore, by simulations of a simple model with an intracellular reaction network, we found that Zipf’s law of chemical abundance is a universal feature of cells where such a network optimizes the efficiency and faithfulness of self-reproduction. These findings provide novel insights into the nature of the organization of reaction dynamics in living cells.

  5. Down-Regulation of FXYD3 Expression in Human Lung Cancers

    PubMed Central

    Okudela, Koji; Yazawa, Takuya; Ishii, Jun; Woo, Tetsukan; Mitsui, Hideaki; Bunai, Tomoyasu; Sakaeda, Masashi; Shimoyamada, Hiroaki; Sato, Hanako; Tajiri, Michihiko; Ogawa, Nobuo; Masuda, Munetaka; Sugimura, Haruhiko; Kitamura, Hitoshi


    FXYD3 is a FXYD-containing Na,K-ATPase ion channel regulator first identified as a protein overexpressed in murine breast tumors initiated by oncogenic ras or neu. However, our preliminary study revealed that FXYD3 expression was down-regulated in oncogenic KRAS-transduced airway epithelial cells. This contradiction led us to investigate the role of FXYD3 in carcinogenesis of the lung. FXYD3 mRNA and protein levels were lower in most of the lung cancer cell lines than in either the noncancerous lung tissue or airway epithelial cells. Protein levels were also lower in a considerable proportion of primary lung cancers than in nontumoral airway epithelia; FXYD3 expression levels decreased in parallel with the dedifferentiation process. Also, a somatic point mutation, g55c (D19H), was found in one cell line. Forced expression of the wild-type FXYD3, but not the mutant, restored the well-demarcated distribution of cortical actin in cancer cells that had lost FXYD3 expression, suggesting FXYD3 plays a role in the maintenance of cytoskeletal integrity. However, no association between FXYD3 expression and its promoter’s methylation status was observed. Therefore, inactivation of FXYD3 through a gene mutation or unknown mechanism could be one cause of the atypical shapes of cancer cells and play a potential role in the progression of lung cancer. PMID:19893046

  6. Genetic susceptibility variants for lung cancer: replication study and assessment as expression quantitative trait loci

    PubMed Central

    Pintarelli, Giulia; Cotroneo, Chiara Elisabetta; Noci, Sara; Dugo, Matteo; Galvan, Antonella; Delli Carpini, Simona; Citterio, Lorena; Manunta, Paolo; Incarbone, Matteo; Tosi, Davide; Santambrogio, Luigi; Dragani, Tommaso A.; Colombo, Francesca


    Many single nucleotide polymorphisms (SNPs) have been associated with lung cancer but lack confirmation and functional characterization. We retested the association of 56 candidate SNPs with lung adenocarcinoma risk and overall survival in a cohort of 823 Italian patients and 779 healthy controls, and assessed their function as expression quantitative trait loci (eQTLs). In the replication study, eight SNPs (rs401681, rs3019885, rs732765, rs2568494, rs16969968, rs6495309, rs11634351, and rs4105144) associated with lung adenocarcinoma risk and three (rs9557635, rs4105144, and rs735482) associated with survival. Five of these SNPs acted as cis-eQTLs, being associated with the transcription of IREB2 (rs2568494, rs16969968, rs11634351, rs6495309), PSMA4 (rs6495309) and ERCC1 (rs735482), out of 10,821 genes analyzed in lung. For these three genes, we obtained experimental evidence of differential allelic expression in lung tissue, pointing to the existence of in-cis genomic variants that regulate their transcription. These results suggest that these SNPs exert their effects on cancer risk/outcome through the modulation of mRNA levels of their target genes. PMID:28181565

  7. Viral infection of human lung macrophages increases PDL1 expression via IFNβ.


    Staples, Karl J; Nicholas, Ben; McKendry, Richard T; Spalluto, C Mirella; Wallington, Joshua C; Bragg, Craig W; Robinson, Emily C; Martin, Kirstin; Djukanović, Ratko; Wilkinson, Tom M A


    Lung macrophages are an important defence against respiratory viral infection and recent work has demonstrated that influenza-induced macrophage PDL1 expression in the murine lung leads to rapid modulation of CD8+ T cell responses via the PD1 receptor. This PD1/PDL1 pathway may downregulate acute inflammatory responses to prevent tissue damage. The aim of this study was to investigate the mechanisms of PDL1 regulation by human macrophages in response to viral infection. Ex-vivo viral infection models using influenza and RSV were established in human lung explants, isolated lung macrophages and monocyte-derived macrophages (MDM) and analysed by flow cytometry and RT-PCR. Incubation of lung explants, lung macrophages and MDM with X31 resulted in mean cellular infection rates of 18%, 18% and 29% respectively. Viral infection significantly increased cell surface expression of PDL1 on explant macrophages, lung macrophages and MDM but not explant epithelial cells. Infected MDM induced IFNγ release from autologous CD8+ T cells, an effect enhanced by PDL1 blockade. We observed increases in PDL1 mRNA and IFNβ mRNA and protein release by MDM in response to influenza infection. Knockdown of IFNβ by siRNA, resulted in a 37.5% reduction in IFNβ gene expression in response to infection, and a significant decrease in PDL1 mRNA. Furthermore, when MDM were incubated with IFNβ, this cytokine caused increased expression of PDL1 mRNA. These data indicate that human macrophage PDL1 expression modulates CD8+ cell IFNγ release in response to virus and that this expression is regulated by autologous IFNβ production.

  8. Developmental expression of heme oxygenase in the rat lung.


    Dennery, Phyllis A; Lee, Christen S; Ford, Berendera S; Weng, Yi-Hao; Yang, Guang; Rodgers, Pamela A


    Heme oxygenase (HO), the rate-limiting enzyme in the formation of bilirubin, is expressed in the lung and may serve as an antioxidant. This enzyme results in the formation of antioxidant bile pigments and the degradation of pro-oxidant heme. We wanted to evaluate the differences in expression of HO-1, the inducible form, and HO-2, the constitutive isoenzyme, during lung maturation and document whether lung HO expression was similar to that of other antioxidant enzymes. Lung total HO activity and HO-1 and HO-2 proteins as well as HO-1 and HO-2 mRNA were evaluated in animals from 16 d of gestation (e(16.5)) to 2 mo of age. Heme content was also evaluated because heme is the substrate of the reaction. HO-1 mRNA was maximal at e(19.5) and e(20.5), whereas HO-2 mRNA was not changed throughout maturation. Lung HO-1 protein was highest on the first days of life and lowest in adults, whereas HO-2 protein was maximally expressed at postnatal d 5 and then declined to reach adult values. As to HO activity, there was a prenatal peak at e(20.5), a second lesser peak at d 5, and thereafter a decline to adult values. Lung heme content was inversely correlated with HO activity or protein as the highest heme values were seen in adults with the lowest HO activity. In response to hyperoxia, HO-1 mRNA was induced only in the adult lungs. A better understanding of the maturational regulation of lung HO will define a role for HO in newborns at risk for oxygen toxicity.

  9. Neighboring Genes Show Correlated Evolution in Gene Expression.


    Ghanbarian, Avazeh T; Hurst, Laurence D


    When considering the evolution of a gene's expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (<100 kb) but extends much further. Sex-specific expression change is also genomically clustered. As genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking.

  10. CXCR2 expression in tumor cells is a poor prognostic factor and promotes invasion and metastasis in lung adenocarcinoma

    PubMed Central

    Saintigny, Pierre; Massarelli, Erminia; Lin, Steven; Chen, Yulong; Goswami, Sangeeta; Erez, Baruch; O’Reilly, Michael S.; Liu, Diane; Lee, J. Jack; Zhang, Li; Ping, Yuan; Behrens, Carmen; Soto, Luisa M. Solis; Heymach, John V.; Kim, Edward S.; Herbst, Roy S.; Lippman, Scott M.; Wistuba, Ignacio I.; Hong, Waun Ki; Kurie, Jonathan M.; Koo, Ja Seok


    CXCR2 in non-small cell lung cancer (NSCLC) has been studied mainly in stromal cells and is known to increase tumor inflammation and angiogenesis. Here, we examined the prognostic importance of CXCR2 in NSCLC and the role of CXCR2 and its ligands in lung cancer cells. The effect of CXCR2 expression on tumor cells was studied using stable knockdown clones derived from a murine KRAS/p53-mutant lung adenocarcinoma cell line with high metastatic potential and an orthotopic syngeneic mouse model and in vitro using a CXCR2 small molecule antagonist (SB225002). CXCR2 protein expression was analyzed in tumor cells from 262 NSCLC. Gene expression profiles for CXCR2 and its ligands (CXCR2 axis) were analyzed in 52 human NSCLC cell lines and 442 human lung adenocarcinomas. Methylation of CXCR2 axis promoters was determined in 70 human NSCLC cell lines. Invasion and metastasis were decreased in CXCR2 knockdown clones in vitro and in vivo. SB225002 decreased invasion in vitro. In lung adenocarcinomas, CXCR2 expression in tumor cells was associated with smoking and poor prognosis. CXCR2 axis gene expression profiles in human NSCLC cell lines and lung adenocarcinomas defined a cluster driven by CXCL5 and associated with smoking, poor prognosis and RAS pathway activation. Expression of CXCL5 was regulated by promoter methylation. The CXCR2 axis may be an important target in smoking-related lung adenocarcinoma. PMID:23204236

  11. Cancer-targeted BikDD gene therapy elicits protective antitumor immunity against lung cancer.


    Sher, Yuh-Pyng; Liu, Shih-Jen; Chang, Chun-Mien; Lien, Shu-Pei; Chen, Chien-Hua; Han, Zhenbo; Li, Long-Yuan; Chen, Jin-Shing; Wu, Cheng-Wen; Hung, Mien-Chie


    Targeted cancer-specific gene therapy is a promising strategy for treating metastatic lung cancer, which is a leading cause of lung cancer-related deaths. Previously, we developed a cancer-targeted gene therapy expression system with high tumor specificity and strong activity that selectively induced lung cancer cell killing without affecting normal cells in immunocompromised mice. Here, we found this cancer-targeted gene therapy, SV-BikDD, composed of the survivin promoter in the VP16-GAL4-WPRE integrated systemic amplifier system to drive the apoptotic gene BikDD, not only caused cytotoxic effects in cancer cells but also elicited a cancer-specific cytotoxic T lymphocyte response to synergistically increase the therapeutic effect and further develop an effective systemic antitumoral immunity against rechallenges of tumorigenic dose of parental tumor cells inoculated at distant sites in immunocompetent mice. In addition, this cancer-targeted gene therapy does not elicit an immune response against normal tissues, but CMV-BikDD treatment does. The therapeutic vector could also induce proinflammatory cytokines to activate innate immunity and provide some benefits in antitumor gene therapy. Thus, this study provides a promising strategy with benefit of antitumoral immune response worthy of further development in clinical trials for treating lung cancer via cancer-targeted gene therapy.

  12. Gene amplification of the transcription factor DP1 and CTNND1 in human lung cancer.


    Castillo, Sandra D; Angulo, Barbara; Suarez-Gauthier, Ana; Melchor, Lorenzo; Medina, Pedro P; Sanchez-Verde, Lydia; Torres-Lanzas, Juan; Pita, Guillermo; Benitez, Javier; Sanchez-Cespedes, Montse


    The search for novel oncogenes is important because they could be the target of future specific anticancer therapies. In the present paper we report the identification of novel amplified genes in lung cancer by means of global gene expression analysis. To screen for amplicons, we aligned the gene expression data according to the position of transcripts in the human genome and searched for clusters of over-expressed genes. We found several clusters with gene over-expression, suggesting an underlying genomic amplification. FISH and microarray analysis for DNA copy number in two clusters, at chromosomes 11q12 and 13q34, confirmed the presence of amplifications spanning about 0.4 and 1 Mb for 11q12 and 13q34, respectively. Amplification at these regions each occurred at a frequency of 3%. Moreover, quantitative RT-PCR of each individual transcript within the amplicons allowed us to verify the increased in gene expression of several genes. The p120ctn and DP1 proteins, encoded by two candidate oncogenes, CTNND1 and TFDP1, at 11q12 and 13q amplicons, respectively, showed very strong immunostaining in lung tumours with gene amplification. We then focused on the 13q34 amplicon and in the TFDP1 candidate oncogene. To further determine the oncogenic properties of DP1, we searched for lung cancer cell lines carrying TFDP1 amplification. Depletion of TFDP1 expression by small interference RNA in a lung cancer cell line (HCC33) with TFDP1 amplification and protein over-expression reduced cell viability by 50%. In conclusion, we report the identification of two novel amplicons, at 13q34 and 11q12, each occurring at a frequency of 3% of non-small cell lung cancers. TFDP1, which encodes the E2F-associated transcription factor DP1 is a candidate oncogene at 13q34. The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus (GEO; and are accessible through GEO Series Accession No. GSE21168.

  13. Neighboring Genes Show Correlated Evolution in Gene Expression

    PubMed Central