Science.gov

Sample records for lupus erythematodes aseptic

  1. Association of autoimmune hepatitis and systemic lupus erythematodes: a case series and review of the literature.

    PubMed

    Beisel, Claudia; Weiler-Normann, Christina; Teufel, Andreas; Lohse, Ansgar W

    2014-09-21

    Liver test abnormalities have been described in up to 60% of patients with systemic lupus erythematodes (SLE) at some point during the course of their disease. Prior treatment with potentially hepatotoxic drugs or viral hepatitis is commonly considered to be the main cause of liver disease in SLE patients. However, in rare cases elevated liver enzymes may be due to concurrent autoimmune hepatitis (AIH). To distinguish whether the patient has primary liver disease with associated autoimmune clinical and laboratory features resembling SLE - such as AIH - or the elevation of liver enzymes is a manifestation of SLE remains a difficult challenge for the treating physician. Here, we present six female patients with complex autoimmune disorders and hepatitis. Patient charts were reviewed in order to investigate the complex relationship between SLE and AIH. All patients had coexisting autoimmune disease in their medical history. At the time of diagnosis of AIH, patients presented with arthralgia, abdominal complaints, cutaneous involvement and fatigue as common symptoms. All patients fulfilled the current diagnostic criteria of both, AIH and SLE. Remission of acute hepatitis was achieved in all cases after the initiation of immunosuppressive therapy. In addition to this case study a literature review was conducted.

  2. [Terbinafine : Drug-induced lupus erythematodes and triggering of psoriatic skin lesions].

    PubMed

    Mayser, P

    2016-09-01

    Based on the technical information that oral terbinafine must be used with caution in patients with pre-existing psoriasis or lupus erythematosus, the literature was summarized. Terbinafine belongs to the drugs able to induce subcutaneous lupus erythematosus (SCLE)-with a relatively high risk. The clinical picture of terbinafine-induced SCLE may be highly variable and can also include erythema exsudativum multiforme-like or bullous lesions. Thus, differentiation of terbinafine-induced Stevens-Johnson syndrome or toxic epidermal necrolysis may be difficult. Therefore, terbinafine should be prescribed with caution in patients who show light sensitivity, arthralgias, positive antinuclear antibodies or have a history of SLE or SCLE. Case reports include wide-spread, but mostly nonlife-threatening courses, which did not require systemic therapy with steroids or antimalarials in every case. Terbinafine is also able to induce or to aggravate psoriasis. The latency period seems to be rather short (<4 weeks). Terbinafine therefore is not first choice if a systemic therapy with antimycotics is indicated in a patient with psoriasis or psoriatic diathesis. Azole derivatives according to the guidelines may be used as an alternative.

  3. ASEPTIC

    NASA Image and Video Library

    2013-07-31

    ISS036-E-026661 (31 July 2013) --- In the International Space Station?s Rassvet Mini-Research Module (MRM1), Russian cosmonaut Fyodor Yurchikhin, Expedition 36 flight engineer, works with the Aseptic experiment, which involves collecting air and surface samples in the Russian segment of the station for analysis.

  4. Longitudinal myelitis, aseptic meningitis, and conus medullaris infarction as presenting manifestations of pediatric systemic lupus erythematosus.

    PubMed

    Katramados, A M; Rabah, R; Adams, M D; Huq, A H M M; Mitsias, P D

    2008-04-01

    A healthy boy developed subacutely progressive quadriparesis, complicated by sudden paraplegia, fever, and meningeal signs, diagnosed as longitudinal myelitis, aseptic meningitis, and conus medullaris infarction and identified as the presenting manifestations of neuropsychiatric systemic lupus erythematosus. Rapid expansion of the conus on serial neuroimaging led to emergent decompressive laminectomy and cord biopsy showing vasculitis and cord infarction. The patient had partial recovery after treatment with high-dose steroids. Increased vigilance is required when pediatric patients develop a similar subacute presentation on the ground of active systemic lupus erythematosus because it may herald the onset of a catastrophic neurological syndrome.

  5. Lupus

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Lupus KidsHealth > For Teens > Lupus Print A A A ... dad that she might have lupus. What Is Lupus? Lupus (pronounced: LOO-pus) is a disease that ...

  6. Lupus

    MedlinePlus

    What is lupus? Lupus is an autoimmune disease. This means that your immune system attacks healthy cells and tissues by mistake. This can ... vessels, and brain. There are several kinds of lupus Systemic lupus erythematosus (SLE) is the most common ...

  7. Aseptic technique.

    PubMed

    Bykowski, Tomasz; Stevenson, Brian

    2008-11-01

    This chapter describes common laboratory procedures that can reduce the risk of culture contaminations (sepsis), collectively referred as "aseptic technique." Two major strategies of aseptic work are described: using a Bunsen burner and a laminar flow hood. Both methods are presented in the form of general protocols applicable to a variety of laboratory tasks such as pipetting and dispensing aliquots, preparing growth media, and inoculating, passaging, and spreading microorganisms on petri dishes.

  8. Lupus

    MedlinePlus

    ... bite or scratch of a wolf ("lupus" is Latin for wolf and "erythematosus" is Latin for red). SLE is the most serious form ... occurs more often in African-American, Asian-American, Latin-American, and Native-American women than in non- ...

  9. Pathogenicity of Aseptic Bursaphelenchus xylophilus

    PubMed Central

    Zhu, Li-hua; Ye, Jianren; Negi, Sapna; Xu, Xu-ling; Wang, Zhang-li; Ji, Jin-yi

    2012-01-01

    Pine wilt is a disease of pine (Pinus spp.) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus. However, the pathogenic mechanism of pine wilt disease (PWD) remains unclear. Although the PWN was thought to be the only pathogenic agent associated with this disease, a potential role for bacterial symbionts in the disease process was recently proposed. Studies have indicated that aseptic PWNs do not cause PWD in aseptic pine trees, while PWNs associated with bacteria cause wilting symptoms. To investigate the pathogenicity of the PWN and its associated bacteria, 3-month-old microcuttings derived from certain clones of Pinus densiflora Siebold & Zucc. produced in vitro were inoculated under aseptic conditions with aseptic PWNs, non-aseptic PWNs and bacteria isolated from the nematodes. Six-month-old aseptic P. densiflora microcuttings and 7-month-old P. massoniana seedlings were also inoculated under aseptic conditions with aseptic PWNs and non-aseptic PWNs. The results showed that the aseptic microcuttings and seedlings inoculated with aseptic PWNs or non-aseptic PWNs wilted, while those inoculated with bacterial isolates did not wilt. Nematodes were recovered from wilted microcuttings and seedlings inoculated with aseptic PWNs and non-aseptic PWNs, and the asepsis of nematodes recovered from aseptic PWN-inoculated microcuttings and seedlings was reconfirmed by culturing them in NB liquid medium at 30°C for more than 7 days. Taken together, the results indicate that the asepsis of PWN did not cause the loss of pathogenicity. PMID:22662271

  10. Lamotrigine and aseptic meningitis.

    PubMed

    Simms, Kelley M; Kortepeter, Cindy; Avigan, Mark

    2012-03-20

    The purpose of this case series is to characterize a recently identified association of the antiepileptic drug (AED) lamotrigine with aseptic meningitis based on cases reported to the Food and Drug Administration (FDA)'s Adverse Event Reporting System (AERS) database. We performed a data mining analysis of 9 AEDs from the FDA's AERS database. We applied the multi-item gamma Poisson shrinker (MGPS) algorithm to the entire AERS database through November 2, 2009, to generate empirical Bayes geometric mean (EBGM) values with corresponding confidence intervals for 9 AEDs and the adverse event code "meningitis aseptic." The AERS database was also searched for postmarketing reports of aseptic meningitis associated with lamotrigine and a detailed review of each case was performed. Forty AERS cases were identified in this review. Findings from the AERS reports revealed CSF profiles with features of both bacterial as well as viral meningitis. Fifteen cases documented a positive rechallenge; the median time to onset of symptoms upon rechallenge was only 60 minutes. Data mining analysis of several anticonvulsants resulted in disproportionate reporting solely for lamotrigine. There appears to be an association between lamotrigine use and aseptic meningitis. It is notable that nearly 40% of cases in this case series reported a positive rechallenge. Lamotrigine-associated aseptic meningitis should be considered in the differential diagnosis of culture-negative meningitis. This case series highlights the need for continued pharmacovigilance and the importance of systematic monitoring of patients treated with antiepileptic medications.

  11. Ibuprofen-induced aseptic meningitis in rheumatoid arthritis.

    PubMed

    Horn, A C; Jarrett, S W

    1997-09-01

    To report a case of aseptic meningitis related to ibuprofen ingestion. We discuss the case of a 56-year-old white man with a history of rheumatoid arthritis and hypertension who became confused, nauseated, and began to vomit within 2 hours of the ingestion of ibuprofen. A diagnosis of ibuprofen-induced aseptic meningitis was made based on the patient's physical and laboratory findings, the quick onset and resolution of symptoms, and his medical history. Ibuprofen-induced aseptic meningitis has been most frequently reported in patients with systemic lupus erythematosus. However, there have been reports of this reaction in patients with other underlying disease states. Various nonsteroidal antiinflammatory drugs have been reported to cause this reaction, but ibuprofen is the most common offending agent. A drug-related cause should be considered in any patient who presents with typical meningitis symptoms, such as fever, headache, and stiff neck, that occur within hours of ingesting a drug. Although persons with systemic lupus erythematosus appear to have an increased risk for this type of reaction, the development of signs and symptoms in other patients warrants the consideration of nonsteroidal antiinflammatory drugs as the cause of aseptic meningitis.

  12. Aseptic meningitis associated with rofecoxib.

    PubMed

    Bonnel, Renan A; Villalba, Maria L; Karwoski, Claudia B; Beitz, Julie

    2002-03-25

    Rofecoxib is a nonsteroidal anti-inflammatory drug that is reported to act by selectively inhibiting cyclooxygenase-2. A review and analysis of reports sent to the Spontaneous Reporting System of the Food and Drug Administration, Rockville, Md, suggest that aseptic meningitis is associated with rofecoxib use. To our knowledge, there have been no published reports of aseptic meningitis occurring in association with rofecoxib use to date. We report 5 serious cases of aseptic meningitis associated with rofecoxib use.

  13. Handling difficult materials: Aseptic packaging

    SciTech Connect

    Lieb, K.

    1994-03-01

    Since aseptic packages, or drink boxes, were introduced in the US in the early 1980s, they have been praised for their convenience and berated for their lack of recyclability. As a result, aseptic packaging collection has been linked with that of milk cartons to increase the volume. The intervening years since the introduction of aseptic packaging have seen the drink box industry aggressively trying to create a recycling market for the boxes. Communities and schools have initiated programs, and recycling firms have allocated resources to see whether recycling aseptic packaging can work. Drink boxes are now recycled in 2.3 million homes in 15 states, and in 1,655 schools in 17 states. They are typically collected in school and curbside programs with other polyethylene coated (laminated) paperboard products such a milk cartons, and then baled and shipped to five major paper companies for recycling at eight facilities.

  14. Aseptic technique in microgravity.

    PubMed

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  15. Aseptic technique for cell culture.

    PubMed

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here.

  16. Lupus - resources

    MedlinePlus

    Resources - lupus ... The following organizations are good resources for information on systemic lupus erythematosus : The Lupus Foundation of America -- www.lupus.org The National Institute of Arthritis and Musculoskeletal ...

  17. Chronic meningitis in systemic lupus erythematosus: An unusual etiology.

    PubMed

    Gupta, Anu; Jogi, Vishal; Goyal, Manoj Kumar; Modi, Manish; Khurana, Dheeraj

    2014-10-01

    Chronic aseptic meningitis is a rare manifestation of systemic lupus erythematosus (SLE). Apart from immunological causes and drugs, the aseptic meningitis group can include some unidentified viral infections that cannot be detected by routine microbiological testing. It is imperative to do complete cerebrospinal fluid (CSF) workup before implicating the symptoms to disease activity or drugs, as untreated infections cause significant mortality in SLE. We present a case of young female with SLE who presented with chronic meningitis of an uncommon etiology.

  18. Chronic meningitis in systemic lupus erythematosus: An unusual etiology

    PubMed Central

    Gupta, Anu; Jogi, Vishal; Goyal, Manoj Kumar; Modi, Manish; Khurana, Dheeraj

    2014-01-01

    Chronic aseptic meningitis is a rare manifestation of systemic lupus erythematosus (SLE). Apart from immunological causes and drugs, the aseptic meningitis group can include some unidentified viral infections that cannot be detected by routine microbiological testing. It is imperative to do complete cerebrospinal fluid (CSF) workup before implicating the symptoms to disease activity or drugs, as untreated infections cause significant mortality in SLE. We present a case of young female with SLE who presented with chronic meningitis of an uncommon etiology. PMID:25506165

  19. Amoxicillin-induced acute aseptic meningitis.

    PubMed

    Prieto-González, Sergio; Escoda, Rosa; Coloma, Emmanuel; Grau, Josep M

    2011-03-01

    A 58-year-old man presented to the hospital with fever and headache after amoxicillin intake. Physical examination, laboratory, and a cranial CT scan were unremarkable. Cerebrospinal fluid (CSF) testing revealed lymphocytic pleocytosis. After discontinuation of amoxicillin and symptomatic care, the patient quickly improved. Interestingly, he had had two prior episodes of aseptic meningitis that were probably also related to the administration of amoxicillin. Aseptic meningitis can be caused by multiple non-infectious conditions including drugs, malignancy, and autoimmune diseases. We report a case associated with amoxicillin that meets the criteria of drug-induced aseptic meningitis. Considering the wide utilization of amoxicillin, healthcare providers should be aware of it as a possible cause of drug-induced aseptic meningitis.

  20. Different Types of Lupus

    MedlinePlus

    ... Twitter Facebook Pinterest Email Print Different types of lupus Lupus Foundation of America February 24, 2017 Resource ... lupus. Learn more about each type below. Systemic Lupus Erythematosus Systemic lupus is the most common form ...

  1. Different Types of Lupus

    MedlinePlus

    ... Twitter Facebook Pinterest Email Print Different types of lupus Lupus Foundation of America September 18, 2017 Resource ... lupus. Learn more about each type below. Systemic lupus erythematosus Systemic lupus is the most common form ...

  2. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  3. Aseptic laboratory techniques: plating methods.

    PubMed

    Sanders, Erin R

    2012-05-11

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: Perform plating procedures without contaminating media. Isolate single bacterial colonies by the streak

  4. Aseptic necrosis of the femoral head after pregnancy: a case report

    PubMed Central

    Nassar, Kawtar; Rachidi, Wafae; Janani, Saadia; Mkinsi, Ouafa

    2016-01-01

    A documented case of beginning aseptic necrosis of the femoral head associated with pregnancy together with a review of the literature about this rare complication of pregnancy is presented. The known risk factors of osteonecrosis are; steroid use, alcoholism, organ transplantation, especially after kidney transplant or bone marrow transplantation bone, systemic lupus erythematosus, dyslipidemia especially hypertriglyceridemia, dysbaric decompression sickness, drepanocytosis and Gaucher's disease. Among the less established factors, we mention procoagulations abnormalities, HIV infection, chemotherapy. We report a case of osteonecrosis of femoral head after pregnancy. PMID:27795792

  5. Lupus nephritis

    MedlinePlus

    ... American College of Rheumatology Guidelines for Screening, Case Definition, Treatment and Management of Lupus Nephritis. Arthritis Care Res (Hoboken) . ... kidney disease Immune response Incidence ...

  6. Different Types of Lupus

    MedlinePlus

    ... lupus. Learn more about each type below. Systemic lupus erythematosus Systemic lupus is the most common form of lupus—it’s ... it is likely that these people already had systemic lupus, with the skin rash as their ... lupus erythematosus Drug-induced lupus is a lupus-like disease ...

  7. Recurrent ibuprofen-induced aseptic meningitis.

    PubMed

    Nguyen, Huy T V; Juurlink, David N

    2004-03-01

    To report a case of recurrent aseptic meningitis temporally associated with the use of ibuprofen. A previously well 51-year-old white man presented with acute confusion and aphasia 7 days after taking a variety of nonprescription medications, including ibuprofen. Imaging of the brain was unremarkable, and lumbar puncture revealed lymphocytic pleocytosis with an elevated protein level. The symptoms improved shortly after admission, and no infectious cause was identified. Two weeks later, the patient was readmitted with similar symptoms beginning immediately after resumption of ibuprofen. His symptoms resolved promptly after ibuprofen was discontinued. Drug-induced aseptic meningitis is an unusual complication of drug therapy. Nonsteroidal antiinflammatory drugs (NSAIDs), particularly ibuprofen, are among the most commonly implicated agents, but rechallenge with the suspected agent is uncommon. Use of an objective causality tool indicated a probable relationship between ibuprofen and development of aseptic meningitis in our patient. Clinicians should consider NSAIDs as potential causes of aseptic meningitis, especially in patients with recurrent illness and no obvious infectious cause. A detailed drug history is invaluable in the assessment of such patients, with particular attention to nonprescription medications such as ibuprofen.

  8. Lupus mastitis.

    PubMed

    Cerveira, Isabel; Costa Matos, L; Garrido, António; Oliveira, Elda; Solheiro, Helena; Bastos, Marina; Cortez Vaz, F; Nogueira Martins, F

    2006-10-01

    We report a case of a 28-year-old female with the diagnosis of systemic lupus erythematosus (SLE) referred to our breast pathology consultancy in 2002 due to a left breast nodule. Further investigation revealed bilateral coarse calcifications. Biopsy was consistent with a diagnosis of lupus mastitis.

  9. Living with Lupus (For Parents)

    MedlinePlus

    ... Lupus The three main types of lupus are: Systemic lupus erythematosus, or SLE , which can affect multiple organs in ... which can cause scarring; and subacute cutaneous lupus erythematosus (SCLE) , ... systemic lupus. Drug-induced lupus , which accounts for about ...

  10. Early acute aseptic iritis after cataract extraction.

    PubMed

    Allen, H F; Grove, A S

    1976-01-01

    Severe iritis which occurs within the first five days after cataract extraction may be categorized as (1) bacterial endophthalmitis, (2) toxic iritis, or (3) aseptic iritis. These entities can sometimes be distinguished because of their clinical features. If bacterial endophthalmitis is suspected, anterior chamber paracentesis should be considered and appropriate antibiotic treatment should be initiated. Acute iritis may result from the introduction of toxic agents into the eye, and may follow the use of products sterilized with ethylene oxide. Early acute aseptic iritis probably occurs more often than has previously been recognized. Response to intensive anti-inflammatory treatment is usually prompt and dramatic. The judicious use of cryoextraction and the careful manipulation of intraocular tissues may minimize the incidence and the severity of postoperative inflammation.

  11. Diagnosing Lupus

    MedlinePlus

    ... on Twitter Facebook Pinterest Email Print Sort and Filter I want to sort by: Sort all topics ... tailored to your symptoms. article What does it mean when lupus is "active"? Disease activity is caused ...

  12. [Particle disease--aseptic loosening of the total hip endoprosthesis].

    PubMed

    Kolundzić, Robert; Orlić, Dubravko

    2008-01-01

    Total hip arthroplasty (THA) improves the ability and quality of life in patients with hip dysfunction due to different causes. Aseptic loosening is the major cause of the late hip endoprosthesis failure. It results from aseptic inflammatory reaction induced by the implant wear debris accumulating at the prosthesis interface, and is mediated by numerous cellular and humoral factors. Due to presence of wear debris we call aseptic loosening of the total hip endoprosthesis as "particle disease". In the most important of factors affecting the risk of aseptic instability include patient's age, sex, body mass index, underlying morbidity (reason for THA), endoprosthetic material and surgeon's skill. However, taken together, all these factors explain only a minor part of variability of this phenomenon. Factors that are decisive for the occurrence of aseptic instability are still largely unknown. The existence of "individual disposition" for development of aseptic instability that is not determined by demographic or biomechanical factors is well recognized.

  13. Sterile versus non-sterile glove use and aseptic technique.

    PubMed

    Flores, Ashley

    There is evidence indicating that improvements in infection control practice can reduce the incidence of healthcare-associated infection. This article explores the evidence base for glove use and aseptic technique. There is a lack of evidence regarding the influence of sterile versus clean gloves in clinical care. Therefore in practice, clean and aseptic techniques are often used interchangeably. Nurses must learn to select clean or aseptic technique, and therefore clean or sterile gloves, using a risk assessment protocol. Regular audits of aseptic technique and education are needed to improve care.

  14. Lupus Foundation of America

    MedlinePlus

    ... Spread Awareness Lupus Awareness Month Put On Purple World Lupus Day Lupus Voices Across America Become a Media Spokesperson KNOW LUPUS Special Thanks People and Stories Celebrity Supporters Raise Funds Walk to End Lupus Now Direct Giving Join Team Make Your ...

  15. Control of the aseptic processing environment.

    PubMed

    Frieben, W R

    1983-11-01

    Methods used by industry with applications to hospital pharmacy for maintaining an aseptic environment in production of sterile pharmaceutical products are discussed. A major source of product contamination is airborne microorganisms. The laminar-airflow workbench with a high-efficiency particulate air filter provides an ultraclean environment for preparation of sterile products. However, the workbench does not guarantee sterility of products and is not effective if not properly installed and maintained or if the operator uses poor aseptic technique. The laminar-airflow workbench should be tested for leaks, airflow velocity, and airflow patterns when installed, and the workbench should be checked periodically thereafter. The workbench should be placed in a cleanroom where traffic and air disturbances that might affect the laminar airflow are eliminated. A major source of airborne microbial contamination in cleanrooms is people. Personnel movement through an area and presence of personnel without lint-free, nonshedding protective garments increase the levels of microbial contaminants in an area. The transport of nonsterile products (bottles, boxes, paper products) into a cleanroom should be minimized. The cleanroom itself should be sanitized and should be immaculate. Microbial or particulate monitoring should be conducted in the cleanroom using a quantitative method, and corrective-action limits should be set. Hospital pharmacists should examine industrial sterile-processing techniques and apply them to the preparation of sterile products.

  16. Lupus Foundation of America

    MedlinePlus

    ... and Testing New Treatments Learn More About the Lupus Foundation of America We are devoted to solving ... Spam Control Text: Please leave this field empty Lupus FAQ What is lupus? What are the common ...

  17. [Study on drawing aseptic gas in diluting drugs].

    PubMed

    Fan, Z C; Yu, F Y; Zou, F S

    1996-07-01

    In this study, the gas was drawn from sealed aseptic bottles, the blue flame of an alcohol lamp, and the air of the same treatment room. And the gas was put into aseptic solutions of 10% glucose separately and dripped. Then the samples were taken for bacteriaculture at appointed time-points. Meanwhile, the gases were drawn and put into aseptic solutions of 10% glucose separately. Then deactived penicillines were diluted with the solutions separately. Finally, the penicillines were mixed with 10% glucose and dripped. The samples were taken for bacteria-culture in the same way. The results showed that there was no colony existed in the gas from the sealed aseptic bottles and the flame of the alcohol lamp. However, colonies existed in the samples from the air of the treatment room. It is suggested that sealed aseptic gas should be drawn and kept for use in diluting drugs.

  18. Living with Lupus

    MedlinePlus

    ... and Fatigue Family Life and Relationships Exercise and Nutrition Lupus and the Workplace Mental Health and Wellbeing Overlapping Diseases Personal Stories Lupus in Men Finding the Right Doctor ...

  19. Neonatal lupus.

    PubMed

    Robles, David T; Jaramillo, Lorena; Hornung, Robin L

    2006-12-10

    An otherwise healthy 5-week-old infant with erythematous plaques predominantly on the face and scalp presented to our dermatology clinic. The mother had been diagnosed with lupus erythematosus 2 years earlier but her disease was quiescent. Neonatal lupus is a rare condition associated with transplacental transfer of IgG anti-SSA/Ro and anti-SSB/La antibodies from the mother to the fetus. Active connective tissue disease in the mother does not have to be present and in fact is often absent. Although the cutaneous, hematologic and hepatic manifestations are transient, the potential for permanent heart block makes it necessary for this to be carefully ruled out. As in this case, the dermatologist may be the one to make the diagnosis and should be aware of the clinical presentation, work-up, and management of this important disease.

  20. Lupus erythematosus

    SciTech Connect

    Tuffanelli, D.L.

    1981-02-01

    Lupus erythematosus (LE) is a multisystem disease. Genetic predisposition, altered immunity, hormones, drugs, viruses, and ultraviolet light all may play a role in etiology. A wide range of cutaneous lesions occur, and variants such as subacute cutaneous LE, complement-deficient LE, and neonatal LE have recently been emphasized. Management of the LE patient, including appropriate diagnostic studies and therapy relevant to the dermatologist, is discussed in the review.

  1. Aseptic meningoencephalitis mimicking transient ischaemic attacks.

    PubMed

    Papavasileiou, V; Milionis, H; Cordier, M; Eskandari, A; Ntaios, G; Michel, P

    2013-04-01

    To highlight meningoencephalitis as a transient ischaemic attack (TIA) mimic and suggest clinical clues for differential diagnosis. This was an observational study of consecutively admitted patients over a 9.75-year period presenting as TIAs at a stroke unit. A total of 790 patients with TIAs and seven with TIA-like symptoms but a final diagnosis of viral meningoencephalitis were recognised. The most frequent presentations of meningoencephalitis patients were acute sensory hemisyndrome (6) and cognitive deficits (5). Signs of meningeal irritation were minor or absent on presentation. Predominantly lymphocytic pleocytosis, hyperproteinorachia and a normal cerebrospinal fluid (CSF)/serum glucose index (in 5 out of 6 documented patients) were present. Meningeal thickening on a brain magnetic resonance imaging (MRI) scan was the only abnormal imaging finding. Six patients received initial vascular treatment; one thrombolysed. Finally, six patients were treated with antivirals and/or antibiotics. Although neither bacterial nor viral agents were identified on extensive testing, viral meningoencephalitis was the best explanation for all clinical and laboratory findings. Aseptic meningoencephalitis should be part of the differential diagnosis in patients presenting as TIA. The threshold for a lumbar puncture in such patients should be set individually and take into account the presence of mild meningeal symptoms, age and other risk factors for vascular disease, the results of brain imaging and the basic diagnostic work-up for a stroke source.

  2. Diet and Nutrition With Lupus

    MedlinePlus

    ... on Twitter Facebook Pinterest Email Print Diet and nutrition with lupus Lupus Foundation of America September 26, ... Living with Lupus I Have Lupus Exercise and Nutrition Site Footer Need to talk to someone? Our ...

  3. Aseptic practice recommendations for circulating operating theatre nurses.

    PubMed

    Aholaakko, Teija-Kaisa; Metsälä, Eija

    Aseptic practices prevent exposure of a surgical wound to microbes, operating theatre environment and personnel. The circulating nurse assists the operating theatre personnel and supervises aseptic practices preventing surgical site infections. In the absence of analytical tools, few studies exist on intraoperative nursing-related aseptic practices. This study introduces recommendations to assess the role of the circulating nurse in aseptic practices. The authors used international recommendations and research findings to construct a 20-item self-report instrument with a demonstrated reliability across the scale. The authors structured the scale based on three phases: establishment; maintenance; and disestablishment of a sterile operating field. The tool was tested among operating theatre and day surgery nurses, and compared the differences in the mean acceptance rates of aseptic practice recommendations based on background characteristics. College-level nurses and nurses with 15 or more years' work experience accepted the recommendations at higher levels than bachelor-level nurses and nurses with less work experience. Continual assessment of the evidence base and comprehensive evaluation represent important components in further developing the tool. A reasonable number of items covering clinical practice are necessary for assessing the effectiveness and cost-effectiveness of aseptic practices, and a larger response rate is needed to validate the tool in future.

  4. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery.

    PubMed

    Chen, Jenny X; Alkire, Blake C; Lam, Allen C; Curry, William T; Holbrook, Eric H

    2016-10-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics.

  5. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery

    PubMed Central

    Chen, Jenny X.; Alkire, Blake C.; Lam, Allen C.; Curry, William T.; Holbrook, Eric H.

    2016-01-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics. PMID:27722072

  6. [Systemic lupus erythematosus in the pregnant patient. Implications for anesthesia].

    PubMed

    Pastor Tomás, E; Guillén Antón, J; Vaquerizo Gareta, A; Lirola Grajales, P; Martínez García, R; Cuartero Lobera, J

    2001-03-01

    A 28-year-old woman with systemic lupus erythematosus and a history of aseptic meningitis, digestive bleeding due to thrombopenia and deep venous thrombosis underwent elective cesarean for transverse presentation at 35 weeks. Preoperative blood work-up showed an antinuclear antibody titre that was slightly positive and steroid treatment was started. Surgery operation was performed with general anesthesia. The outcome was satisfactory even though serious complications can develop during the management of anesthesia in such patients. Systemic lupus erythematosus is a chronic, multisystemic disease that mainly affects women of childbearing age. Antibodies and immunocomplexes play a fundamental role. Given the multiorgan involvement in this disease, preoperative study of the lupus patient should assess all such involvement, including maternal-fetal risk, as well as consider the drug and anesthetic management to be applied. Among the clinical signs that can affect management of anesthesia are the following: aseptic meningitis, high blood pressure, pericarditis, pneumonitis and recurrent venous thrombosis. Anemia, thrombopenia and significantly altered coagulation events are common.

  7. Children & Teens (with Lupus)

    MedlinePlus

    ... How Lupus Affects the Body Lab Tests for Lupus Signs and Symptoms Treatment Options Financial Resources: Healthcare Family Life and Relationships Flares Exercise and Nutrition Mental Health and Wellbeing Personal Stories ...

  8. What Is Lupus?

    MedlinePlus

    ... better about themselves Remain more active. Pregnancy and Contraception for Women With Lupus Women with lupus can ... harmful to an unborn baby may want reliable birth control. Recent studies have shown that oral contraceptives (birth ...

  9. Can Lupus Cause Depression?

    MedlinePlus

    ... Adult Care 15 Questions – Pediatric Lupus 15 Questions - Reproduction and Contraception Health with Lupus 15 Questions - Men ... General slowing and clouding of mental functions Diminished sexual interest and/or performance Recurrent thoughts of death ...

  10. Living with Lupus

    MedlinePlus

    ... on your family article Stick to it: The benefits of exercise article Coping with hair loss article Lupus and ... leave your body, try turning inward. article Five benefits of exercise for managing lupus ​Whether or not a person ...

  11. Molecular identification of bacteria from aseptically loose implants.

    PubMed

    Kobayashi, Naomi; Procop, Gary W; Krebs, Viktor; Kobayashi, Hideo; Bauer, Thomas W

    2008-07-01

    Polymerase chain reaction (PCR) assays have been used to detect bacteria adherent to failed orthopaedic implants, but some PCR assays have had problems with probable false-positive results. We used a combination of a Staphylococcus species-specific PCR and a universal PCR followed by DNA sequencing to identify bacteria on implants retrieved from 52 patients (92 implants) at revision arthroplasty. We addressed two questions in this study: (1) Is this method able to show the existence of bacterial DNA on presumed aseptic loosed implants?; and (2) What proportion of presumed aseptic or culture-negative implants was positive for bacterial DNA by PCR? Fourteen implants (15%) were believed infected, whereas 74 implants (85%) were believed aseptic. Each implant was sonicated and the resulting solution was submitted for dual real-time PCR assay and culture. All implants believed aseptically loose were culture-negative, but nine of the 74 (12%) had bacterial DNA by PCR; two (2.7%) were PCR-positive and also showed histologic findings suggestive of infection. Uniquely developed PCR and bacterial sequencing assays showed bacterial DNA on 12% of implants removed for presumed aseptic loosening. Additional studies are needed to determine the clinical importance of bacterial DNA detected by PCR but not by conventional culture. Level III, diagnostic study.

  12. Systemic lupus erythematosus.

    PubMed

    Pearce, Lynne

    2016-06-22

    Essential facts Systemic lupus erythematosus (SLE) is a rare, chronic autoimmune disease that causes inflammation in various parts of the body. Its annual incidence is estimated at one in 20,000. Although there is no cure, early diagnosis and appropriate treatment can help to control the symptoms, preventing damage to vital organs. In addition, there are other types of lupus that affect the skin, including discoid lupus erythematosus and subacute cutaneous lupus erythematosus.

  13. Children & Teens (with Lupus)

    MedlinePlus

    ... teens on adjusting to life with lupus For teens, living with lupus can require some major lifestyle adjustments. blog Ensuring your child's success in school Advice from parents and education experts on 504 and Individualized Education Plans. article Your lupus care file PDF Download Use this ...

  14. [Metal ions: important co-players in aseptic loosening].

    PubMed

    Cadosch, D; Schlett, C L; Gautschi, O P; Frei, H C; Filgueira, L

    2010-08-01

    The aims of this review were to discuss the different mechanisms of biocorrosion of orthopaedic metal implants in the human body, as well as the effects of the released metal ions on bone metabolism and the immune system in regard to their involvement in the pathophysiological mechanisms of aseptic loosening and metal hypersensitivity. Implant failure due to aseptic loosening is thought to occur in about 10-15% of cases. A review of the literature (using PubMed with the search terms: biocorrosion, metal ions and bone metabolism) was performed. Additionally, we discuss our research results in the field of aseptic loosening. Despite a great effort in developing new implants, metal devices used in orthopaedic and trauma surgery remain prone to biocorrosion by several mechanisms including the direct corrosion by osteoclasts, leading to the production of significant amounts of wear particles and metal ions. In addition to the well documented increased osteolytic activity caused by large (in the nanometer range) wear particles, increasing evidence strongly suggests that the released metal ions contribute to the pathophysiological mechanism of aseptic loosening. Metal ions stimulate both the immune system and bone metabolism through a series of direct and indirect pathways leading to an increased osteolytic activity at the bone-implant interface. To date, revision surgery remains the only option for the treatment of a failed orthopaedic implant caused by aseptic loosening. A better understanding of the complex pathophysiological mechanisms (including the effects caused by the released metal ions) of aseptic loosening may have a significant potential in developing novel implants and therapies in order to reduce the incidence of this complication. Georg Thieme Verlag KG Stuttgart, New York.

  15. Risk factors for total knee arthroplasty aseptic revision.

    PubMed

    Namba, Robert S; Cafri, Guy; Khatod, Monti; Inacio, Maria C S; Brox, Timothy W; Paxton, Elizabeth W

    2013-09-01

    Using a Total Joint Replacement Registry, patient, operative, implant, surgeon, and hospital risk factors associated with aseptic revision after primary total knee arthroplasty (TKA) were evaluated. From 04/2001 to 12/31/2010 64,017 primary TKA cases, followed for a median time of 2.9 years, were registered and included in the analysis. Patients were predominantly female, white, with osteoarthritis, and obese. The crude aseptic revision rate is 1.3% (N=826). The cumulative survival for aseptic revision at 8 years is 97.6% (95% CI 97.3%-97.8%). Adjusted models revealed that age, race, body mass index, diabetic status, bilateral procedures, high-flex implants, and the LCS mobile bearing knee are associated with risk of revision. Gender, general health status, diagnosis, surgeon fellowship training, surgeon volume, hospital volume, fixation, and bearing surface material were not associated with risk of aseptic revision. Recognition of surgical factors associated with TKA failures can help the surgeons with their choices of surgical techniques and implants.

  16. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    SciTech Connect

    Doenmez, Halil Mavili, Ertugrul Ikizceli, Tuerkan; Durak, Ahmet Candan; Kurtsoy, Ali

    2009-07-15

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  17. Drug-induced lupus erythematosus

    MedlinePlus

    ... Causes Drug-induced lupus erythematosus is similar to systemic lupus erythematosus (SLE). It is an autoimmune disorder. This means ... 2015:chap 132. Wright B, Bharadwaj S, Abelson A. Systemic lupus erythematosus. In: Carey WD, ed. Cleveland Clinic: Current Clinical ...

  18. Aseptic meningitis due to Frater type virus in Ontario.

    PubMed

    KELEN, A; LESIAK, J; LABZOFFSKY, N A

    1963-07-06

    During the summer and fall of 1959 and 1960 a virus was isolated on 14 occasions from the stool or cerebrospinal fluid or both of 12 patients with a clinical picture of non-paralytic poliomyelitis or aseptic meningitis. The patients were from eight different localities in Ontario. The isolated virus was not neutralized by antisera to any of the known enteroviruses, reoviruses or adenoviruses, nor did antiserum to the isolate neutralize any of these viruses. Antiserum to Frater virus, however, did neutralize this isolate and in turn was itself neutralized by antiserum to this virus. Frater virus was isolated in Scotland from cases of aseptic meningitis during the same period in 1959 and 1960. In Ontario this virus was not encountered before 1959. Isolation of the virus from cerebrospinal fluid and demonstration of immunological response in the patients establish its etiological significance. Biological characteristics indicate that it belongs to the Echo group.

  19. Aseptic nonunion of the tibia treated by intramedullary osteosynthesis.

    PubMed

    Gualdrini, G; Rollo, G; Montanari, A; Zinghi, G F

    1996-01-01

    The authors report 52 cases of aseptic nonunion of the tibia treated by intramedullary osteosynthesis. The means of synthesis used were the Küntscher nail, the Eiffel Tower Rush nail, and the Grosse-Kempf nail. Which means of synthesis was used depended on the site and the features of the nonunion. Healing occurred in all of the cases after an average of 5 months. Mean follow-up was 4.5 years.

  20. [Recurrent aseptic meningitis secondary to taking ibuprofen and ketorolac].

    PubMed

    Cano Vargas-Machuca, E; Mondéjar-Marín, B; Navarro-Muñoz, S; Pérez-Molina, I; Garrido-Robres, J A; Alvarez-Tejerina, A

    Aseptic meningitis is a process that is characterised by an inflammatory reaction of the meninges that is not due to any infectious agent. Its aetiology is varied and is most frequently caused by rheumatologic and/or autoimmune processes, chemical or medication-induced meningitis, the most notable drugs involved being antibiotics and non-steroidal anti-inflammatory drugs (NSAI). We report the case of a 70-year-old male, with no relevant history, who was admitted to hospital five times over a period of 16 months because of acute meningitis with polymorphonuclear pleocytosis, high protein levels in cerebrospinal fluid and normal glucose in cerebrospinal fluid. No evidence of an infectious causation, chemical meningitis, carcinomatosis or autoimmune disease was found and the patient was diagnosed with recurrent aseptic meningitis. It was found that the patient had taken ibuprofen or ketorolac on several occasions, a few hours before the appearance of symptoms. These episodes were quickly resolved after withdrawal of this medication. A number of NSAI have been reported as inducers of aseptic meningitis, one of the most notable being ibuprofen. We report the case of a patient who, as a consequence of taking ibuprofen and ketorolac, presented episodes of recurrent aseptic meningitis. To our knowledge this side effect of ketorolac has not been reported before. Its clinical features are impossible to differentiate from those of infectious meningitis. Diagnosis is reached by exclusion and a careful pharmacological study, including over-the-counter drugs like some of the NSAI, must be performed in patients with this condition, since it is a problem that can easily be solved by withdrawing the drug that causes it.

  1. Causes of Aseptic Persistent Pain after Total Knee Arthroplasty

    PubMed Central

    Lim, Hong-An; Seon, Jong-Keun; Park, Kyung-Soon; Shin, Young-Joo; Yang, Hong-Yeol

    2017-01-01

    Background Persistent pain after total knee arthroplasty (TKA) is dissatisfying to the patient and frustrating to the surgeon. The purpose of this study is to evaluate the aseptic causes and clinical course of intractable pain following TKA. Methods Of the total 2,534 cases of primary TKA reviewed, 178 cases were classified as having aseptic persistent pain that was not resolved within 1 year after surgery. Except for the cases with periprosthetic fracture (56 knees), 122 cases of aseptic painful TKA were divided into two groups: intra-articular group (83 knees) and extra-articular group (39 knees). Results In the intra-articular group, the main reasons for pain were aseptic loosening (n = 40), polyethylene wear (n = 16), instability (n = 10), recurrent hemarthrosis (n = 5), patellar maltracking (n = 4), tendon ruptures (n = 4), and stiffness (n = 2). In the extraarticular group, 10 knees (25.6%) were found to have nerve entrapment in the spine, 6 knees (15.4%) were found to have hip osteoarthritis or femoral head avascular necrosis. The reasons for persistent knee pain in the remaining 23 knees (59.0%) still remain elusive. Conclusions Persistent pain after TKA originated from pathology of extra-articular origin in a considerable number of cases in this study. Therefore, it is important to perform thorough preoperative evaluations to reduce pain resulting from extra-articular causes. Furthermore, meticulous surgical procedures and optimal alignment are required to reduce pain of intra-articular origin related to implant wear, instability, and patellar maltracking. PMID:28261427

  2. Clinical decision rules to distinguish between bacterial and aseptic meningitis

    PubMed Central

    Dubos, F; Lamotte, B; Bibi‐Triki, F; Moulin, F; Raymond, J; Gendrel, D; Bréart, G; Chalumeau, M

    2006-01-01

    Background Clinical decision rules have been derived to distinguish between bacterial and aseptic meningitis in the emergency room to avoid unnecessary antibiotic treatments and hospitalisations. Aims To evaluate the reproducibility and to compare the diagnostic performance of five clinical decision rules. Methods All children hospitalised for bacterial meningitis between 1995 and 2004 or aseptic meningitis between 2000 and 2004 have been included in a retrospective cohort study. Sensitivity and specificity were calculated by applying each rule to the patients. The best rule was a priori defined as the one yielding 100% sensitivity for bacterial meningitis, the highest specificity, and the greatest simplicity for a bedside application. Results Among the 166 patients included, 20 had bacterial meningitis and 146 had aseptic meningitis. Although three rules achieved 100% sensitivity (95% CI 84–100), one had a significantly lower specificity (13%, 95% CI 8–19) than those of the other two rules (57%, 95% CI 48–65; and 66%, 95% CI 57–73), which were not statistically different. The ease of manual computation of the rule developed by Nigrovic et al (a simple list of five items: seizure, blood neutrophil count, cerebrospinal fluid (CSF) Gram stain, CSF protein, CSF neutrophil count) was higher than the one developed by Bonsu and Harper. Conclusion On our population, the rule derived by Nigrovic et al had the best balance between accuracy and simplicity of manual computation and could help to avoid two thirds of unnecessary antibiotic treatments and hospitalisations. PMID:16595647

  3. Functional outcome following aseptic single-stage revision knee arthroplasty.

    PubMed

    Malviya, Ajay; Brewster, Nigel T; Bettinson, Karen; Holland, James P; Weir, David J; Deehan, David J

    2012-10-01

    This study attempts to quantify the influence of constraint and various indications upon functional outcome following aseptic first-time revision knee arthroplasty. A single-centre prospective study was performed to examine the outcome for 175 consecutive total revision knee replacements performed between 2003 and 2008 with a minimum follow-up of 2 years. Patient-reported outcome data were used to determine the influence of final level of component constraint, its relationship with primary indication for surgery and the predictor variable for functional outcome at 1 year. All patients were found to have a significant improvement for WOMAC pain, function and stiffness score and physical functioning, role physical, bodily pain and social functioning components of SF-36 score. About 69% were satisfied with the overall procedure. WOMAC function, pain and stiffness score was significantly worse for patients revised for instability (27%) compared to that for aseptic loosening (46%). A significantly higher proportion of patients were satisfied with the procedure, had a better quality of life and would have the surgery again in the aseptic loosening group as compared to the instability group. Revision to a higher level of constraint did not improve knee function irrespective of the primary indication for surgery. This study has found that revision for instability, irrespective of choice of new device, was met with significantly poorer functional outcome. The level of constraint did not influence functional outcome. II.

  4. [Lupus nephritis treatment].

    PubMed

    Santos-Araújo, Carla; Pestana, Manuel

    2008-01-01

    Systemic lupus erithematosus (SLE) is a multiorganic inflammatory disease characterized by a significant morbidity and mortality related not just to disease evolution but also to therapeutic side effects. Sixty percent of SLE patients develop renal disease related to lupus. Moreover, several studies report that lupus nephritis is an important predictor of both renal impairment and global mortality in these patients. In lupus nephritis, the renal biopsy still represents a cornerstone for both histological grading and therapeutical management. Several classification schemes for lupus nephritis based mainly on morphological parameters have been proposed so far. In the WHO grading system the most severe form of lupus nephritis is the diffuse proliferative lupus nephritis or lupus nephritis class IV. In fact, several authors have documented an invariable course to end stage renal failure in these patients, in the absence of specific therapy. Despite the considerable improvement observed since the introduction of corticosteroid and cyclophosphamide treatment, a significant number of patients still present an incomplete response to therapy. Moreover, even in the cases of good response to therapy adverse events related to the treatment such as infertility, hemorrhagic cystitis or increased susceptibility to infection frequently supervenes.

  5. Performance of aseptic technique during neuraxial analgesia for labor before and after the publication of international guidelines on aseptic technique

    PubMed Central

    2014-01-01

    Background Aseptic technique and handwashing have been shown to be important factors in perioperative bacterial transmission, however compliance often remains low despite guidelines and educational programs. Infectious complications of neuraxial (epidural and spinal) anesthesia are severe but fortunately rare. We conducted a survey to assess aseptic technique practices for neuraxial anesthesia in Israel before and after publication of international guidelines (which focused on handwashing, jewelry/watch removal and the wearing of a mask and cap). Methods The sampling frame was the general anesthesiology workforce in hospitals selected from each of the four medical faculties in Israel. Data was collected anonymously over one week in each hospital in two periods: April 2006 and September 2009. Most anesthesiologists received the questionnaires at departmental staff meetings and filled them out during these meetings; additionally, a local investigator approached anesthesiologists not present at these staff meetings individually. Primary endpoint questions were: handwashing, removal of wristwatch/jewelry, wearing mask, wearing hat/cap, wearing sterile gown; answering options were: "always", "usually", "rarely" or "never". Primary endpoint for analysis: respondents who both always wash their hands and always wear a mask ("handwash-mask composite") - "always" versus "any other response". We used logistic regression to perform the analysis. Time (2006, 2009) and hospital were included in the analysis as fixed effects. Results 135/160 (in 2006) and 127/164 (in 2009) anesthesiologists responded to the surveys; response rate 84% and 77% respectively. Respondents constituted 23% of the national anesthesiologist workforce. The main outcome "handwash-mask composite" was significantly increased after guideline publication (33% vs 58%; p = 0.0003). In addition, significant increases were seen for handwashing (37% vs 63%; p = 0.0004), wearing of mask (61% vs 78%; p < 0

  6. How Does Lupus Affect the Blood?

    MedlinePlus

    ... on Twitter Facebook Pinterest Email Print How lupus affects the blood Lupus Foundation of America September 26, ... be safely treated with blood transfusions? How lupus affects white blood cells Blood test may indicate lupus ...

  7. Schizophrenia or Atypical Lupus Erythematosus with Predominant Psychiatric Manifestations over 25 Years: Case Analysis and Review

    PubMed Central

    Mack, Axel; Pfeiffer, Christiane; Schneider, E. Marion; Bechter, Karl

    2017-01-01

    We observed a case over 25 years of relapsing–remitting schizophrenic spectrum disorder, varying regarding the main symptomatology between more depressive or more schizoaffective or rather typical schizophrenic syndrome. Diseased phases were repeatedly accompanied by minor skin lesions, which were initially classified as mixed tissue disorder. Psychotic phases were waxing–waning over years. During one later relapse, skin involvement was severe, classified to likely represent an allergic reaction to psychopharmaca; this generalized exanthema remitted rapidly with cortisone treatment and azathioprine. Under continued azathioprine and low dose neuroleptics, the patient remitted completely, appearing psychiatrically healthy for 16 years. When azathioprine was set off due to pregnancy, an extraordinary severe relapse of schizophrenia like psychosis accompanied by most severe skin lesions developed within a few weeks, then requiring 2 years of psychiatric inpatient treatment. Finally, a diagnosis of systemic lupus erythematodes plus neuropsychiatric lupus was made. A single CSF sample in 2013 showed suspicious biomarkers, matching with CSF cytokine profiling in schizophrenic and affective spectrum disorder patients and indicated mild neuroinflammation. Complex immune suppressive treatment was reinitiated short after relapse, but was only partially successful. However, surprisingly the psychosis and skin lesions remitted (in parallel) when belimumab was given (add-on). The very details of this complicated, long-term disease course are discussed also with regard to general ideas, in particular with respect to the question if this case of seemingly comorbid schizophrenia with minor autoimmunity signs represented a case of one emerging autoimmune disorder with variant manifestations systemically and within the CNS, though atypically with predominant appearance as a schizophrenia spectrum disorder. PMID:28798699

  8. [Photosensitivity in lupus erythematosus].

    PubMed

    Bens, G

    2009-10-01

    Photosensitivity is one of the ARA diagnostic criteria of systemic lupus erythematosus. Sun exposure can also induce extracutaneous manifestations of the disease. Photosensitivity may be difficult to prove by history taking in lupus patients, as the delay between sun exposure and the onset of specific skin lesions is rather long. Photo-induction of lupus can occur by ultraviolet A (UVA) radiation in the shadow or behind window glass, so that the relationship between radiation exposure and exacerbation of the disease may not seem obvious to the patient. Phototesting procedures for lupus erythematosus have been described, but they are not used in routine practice. Both UVB and UVA play a role in the pathogenesis of lupus erythematosus: in the epidermis they induce DNA damage, they expose nuclear antigens and photo-induced neo-antigens at the cell surface, they lead to an accumulation of apoptotic material, and they induce several pro-inflammatory cytokines. In the dermis, UV radiation triggers skin infiltration by inflammatory cells by modulation of microvascular flow rates and by upregulation of white blood cell migration from dermal capillaries to the skin. Photodistribution of skin lesions and a delay of their onset of more than 48 hours after sun exposure are clinical hallmarks of cutaneous lupus erythematosus that are usually completed by histological confirmation. Photoprotection is essential in the treatment of lupus patients: it comprises sun avoidance suitable for both UVB and UVA radiation, protective clothing, and topical broad-spectrum filters.

  9. Oligophilic Bacteria as Tools To Monitor Aseptic Pharmaceutical Production Units

    PubMed Central

    Nagarkar, Parag P.; Ravetkar, Satish D.; Watve, Milind G.

    2001-01-01

    The bacterial loads of air, surfaces, and personnel in clean rooms are routinely monitored using a set of standard media. Bacteria that can grow on these media are a tiny fraction of the total numbers in any environment. A substantial proportion of bacteria long thought to be unculturable were recently shown to be oligophilic. Oligophile counts in clean rooms in our studies exceeded the standard plate counts by up to 2 orders of magnitude. They responded to disinfection routines in ways similar to the responses of conventional bacteria. We suggest that oligophiles are better tools than conventional bacteria for environmental monitoring in aseptic pharmaceutical production units. PMID:11229934

  10. Aseptic Meningitis Caused by Lassa Virus: Case Series Report.

    PubMed

    Okokhere, Peter O; Bankole, Idowu A; Iruolagbe, Christopher O; Muoebonam, Benard E; Okonofua, Martha O; Dawodu, Simeon O; Akpede, George O

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications.

  11. Idiopathic Facial Aseptic Granuloma: Review of an Evolving Clinical Entity.

    PubMed

    Zitelli, Kristine B; Sheil, Amy T; Fleck, Robert; Schwentker, Ann; Lucky, Anne W

    2015-01-01

    Idiopathic facial aseptic granuloma (IFAG), originally termed pyodermite froide du visage, describes a generally asymptomatic facial nodule presenting in childhood with clinical resemblance to pyoderma or cystic, granulomatous, or vascular lesions. Clinical understanding is constantly evolving, with recent observations indicating that IFAG may represent a subtype of childhood rosacea. We present a case of IFAG associated with eyelid chalazions in a 19-month-old boy. Although his clinical course paralleled previously reported IFAG cases, we observed a unique ultrasound variation during initial diagnostic examination. Further delineation of clinical, imaging, and histologic properties of IFAG may reveal insights into etiologic associations and ideal management.

  12. S.L.E. Lupus Foundation

    MedlinePlus

    ... Your Skin Lupus Myelitis Oral Contraceptives and Lupus Pregnancy and Family Planning Thinking, Memory and Behavior Exercise and Lupus Lupus and Massage Massage Therapy Resource Guide Single with Lupus What is Antiphospholipid Antibody Syndrome Living with Lupus Bone Up On Osteoporosis in ...

  13. Neurological Sequelae of Lupus

    MedlinePlus

    ... of medication, rest, exercise, proper nutrition, and stress management, most individuals with lupus can often ... ) is a disorder of the immune system. Normally, the immune system protects the body against ...

  14. Children & Teens (with Lupus)

    MedlinePlus

    ... continue to be the premier source for the lupus information you need. Donate Now Looking for support near you? Locate an office or support group to connect with. Find Support Near Me ... Spam Control Text: Please leave this field empty ...

  15. [Neonatal lupus erythematosus].

    PubMed

    Mayet, W J; Hermann, E; Bachmann, M; Poralla, T; Meyer zum Büschenfelde, K H

    1989-01-01

    The neonatal lupus erythematosus syndrome, first described by McCuistion and Schoch in 1954, is associated with characteristic skin lesions and congenital heart block in the new-born, and the presence of Ro-(SSA), La-(SSB), or RNP antibodies in mothers and infants. A transplacental transference of maternal autoantibodies is discussed as possible pathophysiologic mechanism in neonatal lupus. The symptoms, the onset, and recently published pathogenetic concepts are reviewed.

  16. Performance analysis of exam gloves used for aseptic rodent surgery.

    PubMed

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-05-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries.

  17. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-01-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  18. Extramedullary spinal teratoma presenting with recurrent aseptic meningitis.

    PubMed

    Mpayo, Lucy L; Liu, Xiao-Hong; Xu, Man; Wang, Kai; Wang, Jiao; Yang, Li

    2014-06-01

    Spinal teratomas are extremely rare; they constitute <0.5% of all spinal cord tumors. These rare tumors have nonspecific manifestations but in most cases are accompanied by neurological deficits. Rupture of a mature teratoma can cause chemical meningitis. A 7-year-old boy presented with paroxysmal abdominal pain and a history of recurrent aseptic meningitis. Kernig and Brudzinski signs were present. Lumber puncture revealed pleocytosis with no evidence of bacteria growth. Imaging of the spine revealed a cystic lesion in spinal cord at thoracic level 9-11. Endoscopic excision of the cyst was successfully performed. Surgical and histopathological findings confirmed extramedullary matured teratoma. As the symptomatic attacks of spontaneous rupture of spinal teratoma resemble presentations of Mollaret meningitis, spinal teratoma should be considered in the differential diagnosis of Mollaret meningitis. We describe a rare example of spinal teratoma causing recurrent meningitis. Spine imaging should be considered in individuals with recurrent aseptic meningitis as this promotes earlier diagnosis, more appropriate treatment, and improved neurological outcome. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. The pathobiology and pathology of aseptic implant failure

    PubMed Central

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  20. Role of cytokines in gonarthrosis and knee prosthesis aseptic loosening.

    PubMed

    Loria, Maria Paola; Dambra, Porzia; Moretti, Biagio; Patella, Vittorio; Capuzzimati, Laura; Cavallo, Elsa; Nettis, Eustachio; Pesce, Vito; Dell'Osso, Adriana; Simone, Carmelo; Tursi, Alfredo

    2004-01-01

    Cytokines, which have been demonstrated in synovial fluids during various joint diseases, play an important role in mediating synovial inflammation and in regulating the immune response of many inflammatory processes. We studied synovial fluid, serum, and synovial fragments obtained from 33 patients--10 affected by serious gonarthrosis re-quiring a prosthetic implant, 8 with knee prosthesis aseptic loosening, and (as controls) 15 affected by degenerative meniscopathies--to evaluate the degree of inflammation and level of interleukins (IL-2, IL-4, IL-6, IL-10) and interferon gamma secretion. Histological analysis revealed slightly more infiltration by inflammatory cells in the synovial tissue of patients with gonarthrosis and knee prosthesis aseptic loosening than in that of the control group, with a high prevalence of macrophages. Moreover, we observed enhanced production of the studied cytokines, especially in synovial fluid as compared to serum, indicating that in the pathological conditions examined the inflammatory events are mainly localized. Because the role of these cytokines is to modulate inflammation, better knowledge of the involvement of cells and their soluble mediators in articular damage could guide immunomodulating treatment.

  1. [Acute pancreatitis due to lupus].

    PubMed

    Hani, Mohamed Aziz; Guesmi, Fethi; Ben Achour, Jamel; Zribi, Riadh; Bouasker, Ibtissem; Zoghlami, Ayoub; Najah, Nabil

    2004-02-01

    Among digestive clinical presentations of systemic lupus erythematosus, acute pancreatitis remains a serious affection with very poor prognosis. To date, pathogenesis is still unclear. We report two cases of fatal acute pancreatitis related to systemic lupus erythematosus.

  2. [Early aseptic loosening of the CF 30 femoral stem].

    PubMed

    Kovanda, M; Havlícek, V; Hudec, J

    2007-02-01

    The CF 30 stem in combination with a cementless acetabulum was used at the First Department of Orthopedic Surgery in Brno in the years 1994 to 1995. From the second year following implantation, aseptic stem loosening was recorded. In order to find explanation of this early loosening, the authors, in cooperation with the Institute of Solid Mechanics, Mechatronics and Biomechanics, carried out the stress-strain analysis in a model system. Eighty patients (31 men and 49 women) received a cemented CF30 femoral component in 1994. Of them, 16 patients underwent revision arthroplasty, three died of causes unrelated to the surgery, and four were lost to follow-up. The final clinical and radiographic check-up was carried out in 2001. The results of a comprehensive examination were available in 57 patients with a CF30 stem. The patients were evaluated on the basis of the Harris hip score and anteroposterior radiographs of the hip. X-ray films obtained immediately after surgery and those taken at regular intervals during follow-up were compared. The following characteristics were noted: translucent lines in individual zones along the stem at the cement-bone interface; osteolysis, i. e., non-linear translucent areas, at least 5 mm long, at the cement-bone interface; and subsidence of the femoral component, i. e., migration of the stem distal to the tip of the greater trochanter. The CF 30 stem survival curve showed that aseptic stem loosening occurred from post-implantation year 2, and increased during the following years. At 6 years and 6 months, a total of 16 patients underwent revision surgery, involving reimplantation in 14 and implant removal in 2 patients. Potential causes of aseptic loosening: Polyethylene wear.However, no acetabular loosening was found in this group, although acetabular components are reported to become loose more often than femoral components. By comparison of the stem survival curves for Poldi and CF 30 stems it appeared that, at 6 years and 6 months

  3. Recurrent aseptic encephalitis in periodic fever, aphthous stomatitis, pharyngitis and adenopathy (PFAPA) syndrome.

    PubMed

    Frye, Richard E

    2006-05-01

    An 11-year-old boy with episodes of periodic fever, aphthous stomatitis, pharyngitis and adenitis (PFAPA) is reported. Two PFAPA episodes were associated with aseptic encephalitis and seizures. Recurrent acute aseptic encephalitis or seizures have never been reported during the febrile episodes of PFAPA. This possible association is discussed within the context of the etiology of PFAPA.

  4. Video-assisted structured teaching to improve aseptic technique during neuraxial block.

    PubMed

    Friedman, Z; Siddiqui, N; Mahmoud, S; Davies, S

    2013-09-01

    Teaching epidural catheter insertion tends to focus on developing manual dexterity rather than improving aseptic technique which usually remains poor despite increasing experience. The aim of this study was to compare epidural aseptic technique performance, by novice operators after a targeted teaching intervention, with operators taught aseptic technique before the intervention was initiated. Starting July 2008, two groups of second-year anaesthesia residents (pre- and post-teaching intervention) performing their 4-month obstetric anaesthesia rotation in a university affiliated centre were videotaped three to four times while performing epidural procedures. Trained blinded independent examiners reviewed the procedures. The primary outcome was a comparison of aseptic technique performance scores (0-30 points) graded on a scale task-specific checklist. A total of 86 sessions by 29 residents were included in the study analysis. The intraclass correlation coefficient for inter-rater reliability for the aseptic technique was 0.90. The median aseptic technique scores for the rotation period were significantly higher in the post-intervention group [27.58, inter-quartile range (IQR) 22.33-29.50 vs 16.56, IQR 13.33-22.00]. Similar results were demonstrated when scores were analysed for low, moderate, and high levels of experience throughout the rotation. Procedure-specific aseptic technique teaching, aided by video assessment and video demonstration, helped significantly improve aseptic practice by novice trainees. Future studies should consider looking at retention over longer periods of time in more senior residents.

  5. Associations between Meteorological Factors and Aseptic Meningitis in Six Metropolitan Provinces of the Republic of Korea

    PubMed Central

    Joshi, Yadav Prasad; Kim, Eun-Hye; Kim, Jong-Hun; Kim, Ho; Cheong, Hae-Kwan

    2016-01-01

    We assessed the association between climate factors and a number of aseptic meningitis cases in six metropolitan provinces of the Republic of Korea using a weekly number of cases from January 2002 to December 2012. Generalized linear quasi-Poisson models were applied to estimate the effects of climate factors on the weekly number of aseptic meningitis cases. We used generalized additive and generalized additive mixed models to assess dose–response relationships. A 1 °C increase in mean temperature was associated with an 11.4% (95% confidence interval (CI): 9.6%–13.3%) increase in aseptic meningitis with a 0-week lag; a 10 mm rise in rainfall was associated with an 8.0% (95% CI: 7.2%–8.8%) increase in aseptic meningitis with a 7-week lag; and a 1 mJ/m2 increase of solar radiation was associated with a 5.8% (95% CI: 3.0%–8.7%) increase in aseptic meningitis with a 10-week lag. Nino3 showed positive effects in all lags, and its one unit increase was associated with an 18.9% (95% CI: 15.3%–22.6%) increase of aseptic meningitis at lag 9. The variability in the relationship between climate factors and aseptic meningitis could be used to initiate preventive measures for climate determinants of aseptic meningitis. PMID:27916923

  6. RECURRENT ASEPTIC ENCEPHALITIS IN PERIODIC FEVER, APHTHOUS STOMATITIS, PHARYNGITISAND ADENOPATHY (PFAPA) SYNDROME

    PubMed Central

    Frye, Richard E.

    2008-01-01

    An 11-year-old boy with episodes of periodic fever, aphthous stomatitis, pharyngitis and adenopathy (PFAPA) is reported. Two PFAPA episodes were associated with aseptic encephalitis and seizures. Recurrent acute aseptic encephalitis or seizures have never been reported during the febrile episodes of PFAPA. This possible association is discussed within the context of the etiology of PFAPA. PMID:16645518

  7. Lupus vulgaris of external nose.

    PubMed

    Bhandary, Satheesh Kumar; Ranganna, B Usha

    2008-12-01

    Lupus vulgaris is the commonest form of cutaneous tuberculosis which commonly involve trunk and buttocks. Lupus vulgaris affecting nose and face, are rarely reported in India. This study reports an unusual case of lupus vulgaris involving the external nose that showed dramatic outcome after six months of anti- tubercular treatment.

  8. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  9. Aseptic lung and liver abscesses: a diagnostic challenge.

    PubMed

    Yildiz, Halil; Munting, Aline; Komuta, Mina; Danse, Etienne; Lefebvre, Chantal

    2017-08-01

    A 67-year-old man known with systemic sarcoidosis was admitted to the department of internal medicine because of cough and chest pain for several weeks. Thoracic tomodensitometry demonstrated multiple pulmonary nodules. Biopsies revealed features compatible with abscesses. Cultures and serologic tests were negative and the patient was successfully treated with prednisone. Three years later, a thoraco-abdominal tomodensitometry showed a relapse in the lung and also the apparition of similar lesions in the liver. Blood test revealed elevated CRP level at 40 mg/L and mild cholestasis. Biopsies of the liver excluded neoplastic or infectious diseases and showed inflammatory granulation tissue with abscess formation. A diagnosis of sarcoidosis-associated aseptic abscesses syndrome was then made, which was successfully treated with corticosteroids.

  10. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  11. Aseptic meningitis and hydrocephalus after posterior fossa surgery.

    PubMed

    Kaufman, H H; Carmel, P W

    1978-01-01

    In an attempt to define the tissue of origin of substances causing aseptic meningitis and secondary hydrocephalus after posterior fossa surgery, analysis of several marker substances from blood, brain, tumour and muscle in the CSF was performed early in seven postoperative patients. No clear pattern emerged which could relate the substances, CSF reaction, and meningeal scarring. The effects of various factors such as contrast studies, drainage, and steroids were also not clear. Review of the literature reveals that all four tissues can cause inflammation. Certain facts about the anatomy of the basilar cisterns and arachnoid villi probably make them logical sites for problems in CFS circulation. Children, for several reasons, are most susceptible to this complication. The complexity of factors in human cases suggests that the problem should be studied in an animal model.

  12. Aseptic multiplication of banana from excised floral apices.

    PubMed

    Cronauer, S S; Krikorian, A D

    1985-08-01

    Most economically important bananas and plantains are large triploid seedless herbs that must be propagated vegetatively by removing small side shoots or "suckers" from the parent plant or by planting seed pieces of larger corms. Consequently, multiplication of stock material is time consuming, Recently, the rapid production of young banana plantlets suitable for use as "seed" material has been described. Vegetative shoot apices were isolated and multiplied using aseptic tissue culture techniques. Although these multiplication systems, once established, can produce thousands of plants in a relatively short period of time, their establishment necessitates the initial sacrifice of an individual specimen, which may not always be desirable or prudent should a limited parent stock be available. We describe here the production and multiplication of rooted banana plantlets from the isolation and culture of terminal floral apices.

  13. Aseptic Meningitis Caused by Lassa Virus: Case Series Report

    PubMed Central

    Bankole, Idowu A.; Iruolagbe, Christopher O.; Muoebonam, Benard E.; Okonofua, Martha O.; Dawodu, Simeon O.; Akpede, George O.

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications. PMID:27957363

  14. Morbid Obesity: Increased Risk of Failure After Aseptic Revision TKA.

    PubMed

    Watts, Chad D; Wagner, Eric R; Houdek, Matthew T; Lewallen, David G; Mabry, Tad M

    2015-08-01

    Patients with obesity are known to have a higher risk of complications after primary TKA; however, there is a paucity of data regarding the effects of obesity with revision TKAs. We asked the following questions : (1) Are patients with morbid obesity (BMI≥40 kg/m2) at greater risk for repeat revision, reoperation, or periprosthetic joint infection (PJI) compared with patients without obesity (BMI<30 kg/m2) after an index revision TKA performed for aseptic reasons? (2) Do patients who are not obese achieve higher Knee Society pain and function scores after revision TKA for aseptic reasons? We used a retrospective cohort study with 1:1 matching for sex, age (±3 years) and date of surgery (±1 year) to compare patients with morbid obesity with patients without obesity with respect to repeat revision, reoperation, and PJI. Using our institution's total joint registry, we identified 1291 index both-component (femoral and tibial) aseptic revision TKAs performed during a 15-year period (1992-2007). Of these, 120 revisions were in patients with morbid obesity (BMI≥40 kg/m2) and 624 were in patients with a BMI less than 30 kg/m2. We then considered only patients with a minimum 5-year followup, which was available for 77% of patients with morbid obesity and 76% of patients with a BMI less than 30 kg/m2 (p=0.84). All patients with morbid obesity who met criteria were included (morbid obesity group: n=93; average followup, 7.9 years) and compared with a matched cohort of patients with a BMI less than 30 kg/m2 (nonmorbid obesity group: n=93; average followup, 7.3 years). Medical records were reviewed to gather details regarding complications and clinical outcomes. Overall, patients with morbid obesity had an increased risk of repeat revision (hazard ratio [HR], 3.8; 95% CI, 1.2-16.5; p<0.02), reoperation (HR, 2.9; 95% CI, 1.3-7.4; p<0.02), and PJI (HR, 6.4; 95% CI, 1.2-119.7; p<0.03). Implant survival rates were 96% (95% CI, 92%-100%) and 100% at 5 years, and 81% (95% CI

  15. Aseptic laboratory techniques: volume transfers with serological pipettes and micropipettors.

    PubMed

    Sanders, Erin R

    2012-05-31

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: ·Work within the sterile field created by the Bunsen burner flame. ·Use serological pipettes without compromising instrument sterility. ·Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. ·Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. ·Identify different applications for plastic versus glass serological pipettes. ·State accuracy limitations for micropipettors.

  16. Aseptic Laboratory Techniques: Volume Transfers with Serological Pipettes and Micropipettors

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: •Work within the sterile field created by the Bunsen burner flame. •Use serological pipettes without compromising instrument sterility.• Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. •Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. •Identify different applications for plastic versus glass serological pipettes. •State accuracy limitations for micropipettors.

  17. Neuropsychiatric Systemic Lupus Erythematosus

    PubMed Central

    Popescu, Alexandra; Kao, Amy H

    2011-01-01

    Neuropsychiatric systemic lupus erythematosus (NPSLE) is the least understood, yet perhaps the most prevalent manifestation of lupus. The pathogenesis of NPSLE is multifactorial and involves various inflammatory cytokines, autoantibodies, and immune complexes resulting in vasculopathic, cytotoxic and autoantibody-mediated neuronal injury. The management of NPSLE is multimodal and has not been subjected to rigorous study. Different treatment regimens include nonsteroidal anti-inflammatory drugs, anticoagulation, and immunosuppressives such as cyclophosphamide, azathioprine, mycophenolate mofetil, and methotrexate. For refractory NPSLE, intravenous immunoglobulin (IVIG), plasmapheresis, and rituximab have been used. Adjunctive symptomatic treatment complements these therapies by targeting mood disorders, psychosis, cognitive impairment, seizures or headaches. Several new biological agents are being tested including Belimumab, a human monoclonal antibody that targets B lymphocyte stimulator. This review focuses on the pathophysiology, treatment, and new potential therapies for neuropsychiatric manifestations of systemic lupus erythematosus. PMID:22379459

  18. Psoriasiform lupus vulgaris.

    PubMed

    Padmavathy, L; Rao, L Lakshmana; Ethirajan, N; Dhanlaklshmi, M

    2008-04-01

    Tuberculosis is a major public health problem in both developing and developed countries. Cutaneous Tuberculosis constitutes a minor proportion of extra-pulmonary manifestations of Tuberculosis. Lupus Vulgaris (LV) is one of the clinical variants of Cutaneous Tuberculosis. A case of a large plaque type psoriasiform lesion of lupus vulgaris on the thigh, of 15 years' duration, in an 18-year-old girl is reported. This case highlights the ignorance level among the patients and consequent failure to avail proper anti-tuberculous treatment despite campaign in print and audio visual media.

  19. I Am Newly Diagnosed with Lupus

    MedlinePlus

    ... About Lupus Photosensitivity Causes of Lupus Dealing with Hair Loss Dealing with Pain and Fatigue Family Life and ... she's ready to keep moving forward. Personal Story Hair loss and lupus Hair loss is a common side ...

  20. Drug-induced lupus.

    PubMed

    Rubin, Robert L

    2015-03-01

    Drug-induced lupus (DIL) refers to an idiosyncratic side effect of numerous, apparently unrelated, medications, in which symptoms overlap with those of systemic lupus erythematosus. DIL is reversible by discontinuation of the medication. The etiological mechanism underlying DIL is linked to the inherent susceptibility of the adaptive immune system to lapse into auto-reactivity. Clinical and laboratory features of DIL will be compared with those of idiopathic systemic lupus and with other types of drug reactions with overlapping features. Formerly commonly-used drugs conferred very high risk of developing DIL, although the probability of developing DIL has not been established with most lupus-inducing drugs. Pharmacological or physiochemical properties of the parent compounds are uninformative, but the importance of reactive drug metabolites in initiating autoimmunity will be discussed. As with most systemic autoimmune diseases, the pathogenesis of DIL is complex and obscure. The role of complement and human leukocyte allotypes as well as drug acetylator phenotype inform the underlying mechanism, and several of these non-mutually exclusive concepts will be described. The pros and cons of proposed mechanisms for DIL will be discussed in the context of current understanding of autoimmunity and immune tolerance to self.

  1. Drug-induced lupus.

    PubMed

    Rubin, Robert L

    2005-04-15

    Autoantibodies and, less commonly, systemic rheumatic symptoms are associated with treatment with numerous medications and other types of ingested compounds. Distinct syndromes can be distinguished, based on clinical and laboratory features, as well as exposure history. Drug-induced lupus has been reported as a side-effect of long-term therapy with over 40 medications. Its clinical and laboratory features are similar to systemic lupus erythematosus, except that patients fully recover after the offending medication is discontinued. This syndrome differs from typical drug hypersensitivity reactions in that drug-specific T-cells or antibodies are not involved in induction of autoimmunity, it usually requires many months to years of drug exposure, is drug dose-dependent and generally does not result in immune sensitization to the drug. Circumstantial evidence strongly suggests that oxidative metabolites of the parent compound trigger autoimmunity. Several mechanisms for induction of autoimmunity will be discussed, including bystander activation of autoreactive lymphocytes due to drug-specific immunity or to non-specific activation of lymphocytes, direct cytotoxicity with release of autoantigens and disruption of central T-cell tolerance. The latter hypothesis will be supported by a mouse model in which a reactive metabolite of procainamide introduced into the thymus results in lupus-like autoantibody induction. These findings, as well as evidence for thymic function in drug-induced lupus patients, support the concept that abnormalities during T-cell selection in the thymus initiate autoimmunity.

  2. Inoculation lupus vulgaris.

    PubMed

    Sehgal, V N; Jain, S; Gupta, R

    1992-01-01

    An 11-years-old girl with lupus vulgaris on the right buttock following inoculation is described. The diagnosis was formed by the history, morphological characteristics, Mantoux test, histopathology, and was supported by an affirmative response to short course intensive chemotherapy (6 months). This route of infection acquires special significance with the worldwide-spread of HIV infection.

  3. Living with Lupus

    MedlinePlus

    ... Scientific Advisory Council suggests to keep lupus under control. slideshow Support groups View a comprehensive list of local support groups ... support near you? Locate an office or support group to connect with. Find Support Near ... Control Text: Please leave this field empty Email Address ...

  4. [Neonatal lupus. Case report].

    PubMed

    Alcántara-Salinas, Adriana; Solano-Fiesco, Liborio; Romero-Ramírez, Jorge Armando; Olivera-Solórzano, Florisela; Alonso-Pérez, Nancy Carmencita; Marcos-Cabrera, Liliana; González-Martínez, Rosa Ana

    2012-01-01

    Neonatal lupus has a rare incidence, distinct from systemic lupus erythematosus. This is an acquired autoimmune disease associated with maternal antibodies to proteins Ro / La (SSA /SSB), transferred by the placenta; it represents the prototype of passive transfer of antibodies from mother to child. The disease can affect the skin, heart, and rarely, the hepatobiliary or hematologic systems. Congenital complete heart block is the most severe form of neonatal lupus. In clinical practice it is important to distinguish in utero a complete from an incomplete atrioventricular block (AV) in order to render prompt care. We present the case of a new born female, who was diagnosed with an atrio-ventricular block at 26 weeksí gestation. When the baby was delivered at 38 weeksí gestation, she presented bradycardia (54 xí). On the suspicion of neonatal lupus, we required antinuclear antibodies, anti-Sm, anti-RNP, anti-SS-A and anti-SS-B, which were positive. A bicameral pacemaker was placed uneventfully.

  5. Lupus Nephritis Susceptibility Loci in Women with Systemic Lupus Erythematosus

    PubMed Central

    Chung, Sharon A.; Brown, Elizabeth E.; Williams, Adrienne H.; Ramos, Paula S.; Berthier, Celine C.; Bhangale, Tushar; Alarcon-Riquelme, Marta E.; Behrens, Timothy W.; Criswell, Lindsey A.; Graham, Deborah Cunninghame; Demirci, F. Yesim; Edberg, Jeffrey C.; Gaffney, Patrick M.; Harley, John B.; Jacob, Chaim O.; Kamboh, M. Ilyas; Kelly, Jennifer A.; Manzi, Susan; Moser-Sivils, Kathy L.; Russell, Laurie P.; Petri, Michelle; Tsao, Betty P.; Vyse, Tim J.; Zidovetzki, Raphael; Kretzler, Matthias; Kimberly, Robert P.; Freedman, Barry I.; Graham, Robert R.

    2014-01-01

    Lupus nephritis is a manifestation of SLE resulting from glomerular immune complex deposition and inflammation. Lupus nephritis demonstrates familial aggregation and accounts for significant morbidity and mortality. We completed a meta-analysis of three genome-wide association studies of SLE to identify lupus nephritis–predisposing loci. Through genotyping and imputation, >1.6 million markers were assessed in 2000 unrelated women of European descent with SLE (588 patients with lupus nephritis and 1412 patients with lupus without nephritis). Tests of association were computed using logistic regression adjusting for population substructure. The strongest evidence for association was observed outside the MHC and included markers localized to 4q11-q13 (PDGFRA, GSX2; P=4.5×10−7), 16p12 (SLC5A11; P=5.1×10−7), 6p22 (ID4; P=7.4×10−7), and 8q24.12 (HAS2, SNTB1; P=1.1×10−6). Both HLA-DR2 and HLA-DR3, two well established lupus susceptibility loci, showed evidence of association with lupus nephritis (P=0.06 and P=3.7×10−5, respectively). Within the class I region, rs9263871 (C6orf15-HCG22) had the strongest evidence of association with lupus nephritis independent of HLA-DR2 and HLA-DR3 (P=8.5×10−6). Consistent with a functional role in lupus nephritis, intra-renal mRNA levels of PDGFRA and associated pathway members showed significant enrichment in patients with lupus nephritis (n=32) compared with controls (n=15). Results from this large-scale genome-wide investigation of lupus nephritis provide evidence of multiple biologically relevant lupus nephritis susceptibility loci. PMID:24925725

  6. Lupus nephritis susceptibility loci in women with systemic lupus erythematosus.

    PubMed

    Chung, Sharon A; Brown, Elizabeth E; Williams, Adrienne H; Ramos, Paula S; Berthier, Celine C; Bhangale, Tushar; Alarcon-Riquelme, Marta E; Behrens, Timothy W; Criswell, Lindsey A; Graham, Deborah Cunninghame; Demirci, F Yesim; Edberg, Jeffrey C; Gaffney, Patrick M; Harley, John B; Jacob, Chaim O; Kamboh, M Ilyas; Kelly, Jennifer A; Manzi, Susan; Moser-Sivils, Kathy L; Russell, Laurie P; Petri, Michelle; Tsao, Betty P; Vyse, Tim J; Zidovetzki, Raphael; Kretzler, Matthias; Kimberly, Robert P; Freedman, Barry I; Graham, Robert R; Langefeld, Carl D

    2014-12-01

    Lupus nephritis is a manifestation of SLE resulting from glomerular immune complex deposition and inflammation. Lupus nephritis demonstrates familial aggregation and accounts for significant morbidity and mortality. We completed a meta-analysis of three genome-wide association studies of SLE to identify lupus nephritis-predisposing loci. Through genotyping and imputation, >1.6 million markers were assessed in 2000 unrelated women of European descent with SLE (588 patients with lupus nephritis and 1412 patients with lupus without nephritis). Tests of association were computed using logistic regression adjusting for population substructure. The strongest evidence for association was observed outside the MHC and included markers localized to 4q11-q13 (PDGFRA, GSX2; P=4.5×10(-7)), 16p12 (SLC5A11; P=5.1×10(-7)), 6p22 (ID4; P=7.4×10(-7)), and 8q24.12 (HAS2, SNTB1; P=1.1×10(-6)). Both HLA-DR2 and HLA-DR3, two well established lupus susceptibility loci, showed evidence of association with lupus nephritis (P=0.06 and P=3.7×10(-5), respectively). Within the class I region, rs9263871 (C6orf15-HCG22) had the strongest evidence of association with lupus nephritis independent of HLA-DR2 and HLA-DR3 (P=8.5×10(-6)). Consistent with a functional role in lupus nephritis, intra-renal mRNA levels of PDGFRA and associated pathway members showed significant enrichment in patients with lupus nephritis (n=32) compared with controls (n=15). Results from this large-scale genome-wide investigation of lupus nephritis provide evidence of multiple biologically relevant lupus nephritis susceptibility loci. Copyright © 2014 by the American Society of Nephrology.

  7. Atypical leptospirosis: an overlooked cause of aseptic meningitis.

    PubMed

    Wang, Ning; Han, Yu-Hsuan; Sung, Jia-Ying; Lee, Wen-Sen; Ou, Tsong-Yih

    2016-03-10

    Leptospirosis, probably the most common zoonosis in the world, is caused by pathogenic Leptospira species. Clinical presentations range from nonspecific fevers to fulminant diseases such as Weil's syndrome. Neurological forms of leptospirosis (neuroleptospirosis) are usually underestimated, and many cases of leptospirosis are overlooked because of the lack of specificity of signs and symptoms. Diagnosis confirmation is difficult because of the challenges associated with isolating the organism and positive serologic testing. A comprehensive understanding of the clinical presentation of leptospirosis and risk factors for exposure to leptospirae are required for early diagnosis, in order to initiate appropriate treatment immediately. Here we present one male patient with anicteric leptospirosis that manifested as neuroleptospirosis with aseptic meningitis, although he did not have impaired kidney function or thrombocytopenia. He recovered well after an early investigation and treatment for leptospirosis based on suspected relevant risk factors and clinical manifestations. To facilitate optimal use of antibiotic treatments and prevent lethal complications of leptospirosis, we report this case of leptospirosis, which highlights the importance of knowing the occupational history and environmental exposures of patients living in leptospirosis-endemic areas and presenting meningeal signs.

  8. Postoperative Aseptic Intracranial Granuloma: The Possible Influence of Fluid Hemostatics

    PubMed Central

    Ganau, Mario; Nicassio, Nicola; Tacconi, Leonello

    2012-01-01

    Background. Numerous reports have demonstrated how postoperative intracranial granulomas can often mimic neoplasm clinically, radiologically, and even macroscopically. Herein we present an unusual case of postsurgical intracranial aseptic granuloma secondary to a chronic inflammatory reaction without any identifiable retained foreign body. Case Description. A 71-year-old patient started complaining of severe headache seven months after surgical excision of WHO Grade I right frontal falx meningioma. CT and MRI scans disclosed a contrast-enhanced lesion with diffuse mass effect in the previous surgical site. The lesion was resected; intraoperative finding and histological specimens led to the diagnosis of postoperative granuloma, likely expression of a glial reaction to the fluid absorbable hemostatics applied in the surgical site after meningioma excision. The possible granuloma-inducing materials and the timing of granuloma formation are discussed. Conclusion. A comprehensive analysis of clinical and neuroradiological data, as well as results of blood tests including positive and negative acute phase proteins, is mandatory to raise the suspicion of postoperative granuloma. The treatment options should be evaluated on a case-by-case basis, with a conservative attitude being the one of choice only for patients without progressive neurological deficit. Alternatively, aggressive surgical treatment and histopathological examination should be advocated. PMID:22924150

  9. Biomarkers for systemic lupus erythematosus.

    PubMed

    Ahearn, Joseph M; Liu, Chau-Ching; Kao, Amy H; Manzi, Susan

    2012-04-01

    The urgent need for lupus biomarkers was demonstrated in September 2011 during a Workshop sponsored by the Food and Drug Administration: Potential Biomarkers Predictive of Disease Flare. After 2 days of discussion and more than 2 dozen presentations from thought leaders in both industry and academia, it became apparent that highly sought biomarkers to predict lupus flare have not yet been identified. Even short of the elusive biomarker of flare, few biomarkers for systemic lupus erythematosus (SLE) diagnosis, monitoring, and stratification have been validated and employed for making clinical decisions. This lack of reliable, specific biomarkers for SLE hampers proper clinical management of patients with SLE and impedes development of new lupus therapeutics. As such, the intensity of investigation to identify lupus biomarkers is climbing a steep trajectory, lending cautious optimism that a validated panel of biomarkers for lupus diagnosis, monitoring, stratification, and prediction of flare may soon be in hand.

  10. Mortality following revision total knee arthroplasty: a matched cohort study of septic versus aseptic revisions.

    PubMed

    Choi, Ho-Rim; Bedair, Hany

    2014-06-01

    We report the medium-term mortality after septic versus aseptic revision total knee arthroplasty (TKA) and factors that can contribute to mortality in revision TKA. Mortality rates of 88 patients undergoing septic revision (septic group) were compared with age- and year of surgery-matched 88 patients of aseptic revision (aseptic group). The overall mortality after revision TKA was 10.7% at a median of 4 years of follow-up (range, 2-7 years). However, the mortality after septic revision (18%, 16/88) was six times higher than that of aseptic revision (3%, 3/88) (P = 0.003). Infections with Staphylococcus aureus and/or methicillin resistance was not associated with higher mortality rates. Multivariate analysis indicated that increased age (P < 0.001), higher ASA class (P = 0.002), and septic revision (P < 0.001) were identified as independent predictors of increased mortality after revision TKA.

  11. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068652 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, holds a sample from bioscience experiment ASEPTIC (BTKh-39) in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  12. Lupus vulgaris: difficulties in diagnosis.

    PubMed

    Rhodes, Julia; Caccetta, Tony Philip; Tait, Clare

    2013-05-01

    Lupus vulgaris is one of the most common forms of cutaneous tuberculosis. It presents a diagnostic challenge due to its paucibacillary nature. This is a report of a case of a delayed diagnosis of lupus vulgaris, presenting as perianal and peristomal plaques, followed by a review of the diagnostic tools for lupus vulgaris and their limitations. © 2012 The Authors. Australasian Journal of Dermatology © 2012 The Australasian College of Dermatologists.

  13. Recurrent case of ibuprofen-induced aseptic meningitis in mixed connective tissue disease.

    PubMed

    Karmacharya, Paras; Mainali, Naba Raj; Aryal, Madan Raj; Lloyd, Benjamin

    2013-04-30

    Although relatively uncommon, the incidence of non-steroidal anti-inflammatory drug-induced aseptic meningitis appears to be increasing among patients with connective tissue disease and also among the healthy population. Ibuprofen is the most common culprit identified. We report a case of a 28-year-old woman with mixed connective tissue disease and recent intake of ibuprofen, presenting with a recurrent episode of ibuprofen-induced aseptic meningitis.

  14. Cutaneous Lupus Erythematosus: Diagnosis and treatment

    PubMed Central

    Okon, Lauren G.; Werth, Victoria P.

    2013-01-01

    Cutaneous lupus erythematosus encompasses a wide range of dermatologic manifestations, which may or may not be associated with the development of systemic disease. Cutaneous lupus is divided into several subtypes, including acute cutaneous lupus erythematosus, subacute cutaneous lupus erythematosus, and chronic cutaneous lupus erythematosus. Chronic cutaneous lupus erythematosus includes discoid lupus erythematosus, lupus erythematosus profundus, chilblain cutaneous lupus, and lupus tumidus. Diagnosis of these diseases requires proper classification of the subtype, through a combination of physical exam, laboratory studies, histology, antibody serology, and occasionally direct immunofluorescence, while ensuring to exclude systemic disease. Treatment of cutaneous lupus consists of patient education on proper sun protection along with appropriate topical and systemic agents. Systemic agents are indicated in cases of widespread, scarring, or treatment-refractory disease. In this review, we discuss issues in classification and diagnosis of the various subtypes of CLE, as well as provide an update on therapeutic management. PMID:24238695

  15. Lung and lupus vulgaris.

    PubMed

    Mukta, V; Jayachandran, K

    2011-04-01

    Lupus vulgaris is chronic, postprimary, paucibacillary cutaneous tuberculosis found in individuals with moderate immunity and high degree of tuberculin sensitivity. Eighty percent of the lesions are on the head and neck. We present the case of a 38 year old lady who was admitted with complaints of worsening breathlessness and low grade fever of one month duration. Examination showed multiple, nontender skin ulcers on bilateral lumbar areas, two oozing serosanguinous discharge and others scarred in the centre. Respiratory system examination and chest X-ray revealed right sided pleural effusion. On investigation, pleural fluid was tuberculous in nature. Skin biopsy from the edge of ulcer was also suggestive of tuberculosis. Patient is doing well on antituberculous drugs. This case highlights the importance of cutaneous manifestations of systemic disease and is an example of the unusual presentation of lupus vulgaris in a case of pleural effusion.

  16. Lung and lupus vulgaris

    PubMed Central

    Mukta, V.; Jayachandran, K.

    2011-01-01

    Lupus vulgaris is chronic, postprimary, paucibacillary cutaneous tuberculosis found in individuals with moderate immunity and high degree of tuberculin sensitivity. Eighty percent of the lesions are on the head and neck. We present the case of a 38 year old lady who was admitted with complaints of worsening breathlessness and low grade fever of one month duration. Examination showed multiple, nontender skin ulcers on bilateral lumbar areas, two oozing serosanguinous discharge and others scarred in the centre. Respiratory system examination and chest X-ray revealed right sided pleural effusion. On investigation, pleural fluid was tuberculous in nature. Skin biopsy from the edge of ulcer was also suggestive of tuberculosis. Patient is doing well on antituberculous drugs. This case highlights the importance of cutaneous manifestations of systemic disease and is an example of the unusual presentation of lupus vulgaris in a case of pleural effusion. PMID:21712924

  17. What Causes Lupus Flares?

    PubMed

    Fernandez, David; Kirou, Kyriakos A

    2016-03-01

    Systemic lupus erythematosus (SLE), the prototypic systemic autoimmune disease, follows a chronic disease course, punctuated by flares. Disease flares often occur without apparent cause, perhaps from progressive inherent buildup of autoimmunity. However, there is evidence that certain environmental factors may trigger the disease. These include exposure to UV light, infections, certain hormones, and drugs which may activate the innate and adaptive immune system, resulting in inflammation, cytotoxic effects, and clinical symptoms. Uncontrolled disease flares, as well as their treatment, especially with glucocorticoids, can cause significant organ damage. Tight surveillance and timely control of lupus flares with judicial use of effective treatments to adequately suppress the excessive immune system activation are required to bring about long term remission of the disease. We hope that new clinical trials will soon offer additional effective and target-specific biologic treatments for SLE.

  18. Treatment of Cutaneous Lupus

    PubMed Central

    Chang, Aileen Y.; Werth, Victoria P.

    2011-01-01

    Cutaneous lupus erythematosus (CLE) is an autoimmune, inflammatory skin disease seen in patients with or without systemic lupus erythematosus (SLE). The management of CLE includes treatment and prevention of lesions, as well as routine assessment for systemic disease. Treatment options include both topical and systemic therapies. Topical therapies include corticosteroids and calcineurin inhibitors. Systemic therapies generally fall under one of three categories: antimalarials, immunomodulators, such as dapsone and thalidomide, and immunosuppressives, such as methotrexate and mycophenolate. Evidence for the treatment of CLE is limited by few prospective studies, as well as lack of a validated outcome measure up until recently. There is good evidence to support the use of topical steroids and calcineurin inhibitors, though most of these trials have not used placebo or vehicle controls. There have been no randomized placebo-controlled trials evaluating systemic therapies for the treatment of CLE. PMID:21503694

  19. Apoptosis in chronic cutaneous lupus erythematosus, discoid lupus, and lupus profundus

    PubMed Central

    Sáenz-Corral, Claudia Ileana; Vega-Memíje, María Elisa; Martínez-Luna, Eduwiges; Cuevas-González, Juan Carlos; Rodríguez-Carreón, Alma Angélica; de la Rosa, Juan José Bollain-y-Goytia; del Muro, Felipe de Jesús Torres; Avalos-Díaz, Esperanza

    2015-01-01

    Introduction: Lupus erythematosus is a multisystemic disease that is characterized by autoantibody production and immune complex deposition in such tissues as the mucosa, joints, the central nervous system, and skin. Cutaneous lupus erythematosus is categorized as acute, subacute, and chronic. Chronic cutaneous lupus erythematosus comprises discoid lupus erythematosus (DLE) and lupus profundus (LP). Aim: To analyze the expression of proapoptotic molecules in patients with lupus erythematosus discoid and lupus profundus. Material and methods: Descriptive study, the study groups comprised 10 cases of LP and 10 cases of DLE, and a control. Skin samples of cases and controls were processed for immunohistochemistry and by TUNEL technique. The database and statistical analysis was performed (statistical test X2) SPSS (Chicago, IL, USA). Results: Apoptotic features were broadly distributed along the skin biopsies in epidermal keratinocytes as well as at dermis. By immunohistochemistry the expression of Fas receptor and Fas-L was higher in the skin of lupus patients compared with controls. We also noted differences in Fas-L, -Fas, and -Bax proteins expression intensity in discoid lupus erythematosus patients in the epidermis, and hair follicles. Conclusions: Fas and Fas-L are expressed similarly in LP and DLE. PMID:26261624

  20. [Treatment of lupus nephritis].

    PubMed

    Novak, Srdan

    2014-01-01

    Approximately 50% of patients with systemic lupus erythematosus will develop lupus nephritis. Signs of renal involvement such as proteinuria > or = 0.5 g/24 h especially with glomerular hematuria and/or cellular casts should be an indication for biopsy. Goals of immunosuppressive treatment in lupus nephritis is remission with avoidance of treatment-re- lated harms. Initial treatment for patients with class III (+/- V) and class IV (+/- V) LN are intravenous cyclophosphamide (total dose 3 g over 3 months) or mycophenolate mofetil (or mycophenolic acid) in target dose of 3 g/day for 6 months, always in combination with glucocorticoids, wihile in class V, mycophenolate mofetil in combination with glucocorticoids is recommended. In patients improving after initial treatment, mycophenolate mofetil at lower doses (2 g/day) or azatioprine (2 mg/kg/day), both in combination with low dose prednisone for at least 3 years are recommended. In resistant and relapse cases switch from cyclophosphamide to mycophenolate mofetil, or vice versa, or rituximab is recommended.

  1. IL-10 regulates murine lupus.

    PubMed

    Yin, Zhinan; Bahtiyar, Gul; Zhang, Na; Liu, Lanzhen; Zhu, Ping; Robert, Marie E; McNiff, Jennifer; Madaio, Michael P; Craft, Joe

    2002-08-15

    MRL/MpJ-Tnfrsf6(lpr) (MRL/MpJ-Fas(lpr); MRL-Fas(lpr)) mice develop a spontaneous lupus syndrome closely resembling human systemic lupus erythematosus. To define the role of IL-10 in the regulation of murine lupus, IL-10 gene-deficient (IL-10(-/-)) MRL-Fas(lpr) (MRL-Fas(lpr) IL-10(-/-)) mice were generated and their disease phenotype was compared with littermates with one or two copies of an intact IL-10 locus (MRL-Fas(lpr) IL-10(+/-) and MRL-Fas(lpr) IL-10(+/+) mice, respectively). MRL-Fas(lpr) IL-10(-/-) mice developed severe lupus, with earlier appearance of skin lesions, increased lymphadenopathy, more severe glomerulonephritis, and higher mortality than their IL-10-intact littermate controls. The increased severity of lupus in MRL-Fas(lpr) IL-10(-/-) mice was closely associated with enhanced IFN-gamma production by both CD4(+) and CD8(+) cells and increased serum concentration of IgG2a anti-dsDNA autoantibodies. The protective effect of IL-10 in this lupus model was further supported by the observation that administration of rIL-10 reduced IgG2a anti-dsDNA autoantibody production in wild-type MRL-Fas(lpr) animals. In summary, our results provide evidence that IL-10 can down-modulate murine lupus through inhibition of pathogenic Th1 cytokine responses. Modulation of the level of IL-10 may be of potential therapeutic benefit for human lupus.

  2. [Systemic lupus erythematosus and weakness].

    PubMed

    Vinagre, Filipe; Santos, Maria José; da Silva, José Canas

    2006-01-01

    We report a case of a 13-year old young girl, with Juvenile Systemic Lupus Erythematosus and recent onset of muscle weakness. Investigations lead to the diagnosis of Myasthenia Gravis. The most important causes of muscle weakness in lupus patients are discussed.

  3. FDG-PET/CT for differentiating between aseptic and septic delayed union in the lower extremity.

    PubMed

    van Vliet, Kirsten E; de Jong, Vincent M; Termaat, M Frank; Schepers, Tim; van Eck-Smit, Berthe L F; Goslings, J Carel; Schep, Niels W L

    2017-09-27

    (18)F-fluorodeoxyglucose ((18)F-FDG) positron emission tomography (PET)/computed tomography (CT) has proven to have a high diagnostic accuracy for the detection of bone infections. In patients with delayed union it may be clinically important to differentiate between aseptic and septic delayed union. The aim of this study was to evaluate the efficacy and to assess the optimal diagnostic accuracy of FDG-PET/CT in differentiating between aseptic and septic delayed union in the lower extremity. This is a retrospective study of consecutive patients who underwent FDG-PET/CT scanning for suspicion of septic delayed union of the lower extremity. Diagnosis of aseptic delayed union or septic delayed union was made based on surgical deep cultures following PET/CT scanning and information on clinical follow-up. FDG-uptake values were measured at the fractured site by use of the maximum standardized uptake value (SUVmax). Sensitivity, specificity and diagnostic accuracy of FDG-PET/CT were calculated at various SUVmax cut-off points. A total of 30 patients were included; 13 patients with aseptic delayed unions and 17 patients with septic delayed unions. Mean SUVmax in aseptic delayed union patients was 3.23 (SD ± 1.21). Mean SUVmax in septic delayed union patients was 4.77 (SD ± 1.87). A cut-off SUVmax set at 4.0 showed sensitivity, specificity and diagnostic accuracy of FDG-PET/CT were 65, 77 and 70% to differentiate between aseptic and septic delayed union, respectively. Using a semi-quantitative measure (SUVmax) for interpretation of FDG-PET/CT imaging seems to be a promising tool for the discrimination between aseptic and septic delayed union.

  4. Factors affecting the incidence of aseptic nonunion after surgical fixation of humeral diaphyseal fracture.

    PubMed

    Ding, Liang; He, Zhimin; Xiao, Haijun; Chai, Leizi; Xue, Feng

    2014-11-01

    Although aseptic nonunion of humeral diaphyseal fracture is rare, it often is debilitating for the patient. Treatment is challenging for the surgeon when nonunion occurs. The purpose of this study was to analyze and identify independent risk factors for aseptic nonunion among patients with humeral diaphyseal fracture undergoing surgical fixation. The medical records of all humeral diaphyseal fracture patients who underwent surgical fixation from January 2005 to January 2011 were reviewed to identify those who developed aseptic nonunion. We performed univariate and multivariate logistic regression to identify independent associations of potential risk factors for aseptic nonunion among patients with surgical humeral diaphyseal fracture. A total of 686 patients were identified, with 659 meeting our inclusion criteria. Among these 659 cases there were 24 cases of septic nonunion, an incidence of 3.6%. The patients were followed for 9-24 months, with an average follow-up period of 14.8 months. In the final regression model, advanced age (odds ratio, 1.09; 95% CI: 1.03-1.14, P = 0.001), smoking (odds ratio, 5.34; 95% CI: 1.05-27.00, P = 0.043), use of NSAIDs (odds ratio, 2.51; 95% CI: 1.80-3.50, P < 0.001), and ASA score (odds ratio, 3.04; 95% CI: 1.06-8.74, P = 0.039) were risk factors for aseptic nonunion of humeral diaphyseal fracture after surgical fixation. This analysis confirms advanced age, smoking, use of NSAIDs, and ASA score were related to an increased risk of aseptic nonunion of humeral diaphyseal fracture after surgical fixation. Patients who have the risk factors identified in this study should be counseled about the possibility of aseptic nonunion occurring after surgical fixation.

  5. Pediatric lupus nephritis: Management update

    PubMed Central

    Sinha, Rajiv; Raut, Sumantra

    2014-01-01

    Childhood-onset systemic lupus erythematosus (cSLE) is a severe multisystem autoimmune disease. Renal involvement occurs in the majority of cSLE patients and is often fatal. Renal biopsy is an important investigation in the management of lupus nephritis. Treatment of renal lupus consists of an induction phase and maintenance phase. Treatment of childhood lupus nephritis using steroids is associated with poor outcome and excess side-effects. The addition of cyclophosphamide to the treatment schedule has improved disease control. In view of treatment failure using these drugs and a tendency for non-adherence, many newer agents such as immune-modulators and monoclonal antibodies are being tried in patients with cSLE. Trials of these novel agents in the pediatric population are still lacking making a consensus in the management protocol of pediatric lupus nephritis difficult. PMID:24868499

  6. Pediatric lupus nephritis: Management update.

    PubMed

    Sinha, Rajiv; Raut, Sumantra

    2014-05-06

    Childhood-onset systemic lupus erythematosus (cSLE) is a severe multisystem autoimmune disease. Renal involvement occurs in the majority of cSLE patients and is often fatal. Renal biopsy is an important investigation in the management of lupus nephritis. Treatment of renal lupus consists of an induction phase and maintenance phase. Treatment of childhood lupus nephritis using steroids is associated with poor outcome and excess side-effects. The addition of cyclophosphamide to the treatment schedule has improved disease control. In view of treatment failure using these drugs and a tendency for non-adherence, many newer agents such as immune-modulators and monoclonal antibodies are being tried in patients with cSLE. Trials of these novel agents in the pediatric population are still lacking making a consensus in the management protocol of pediatric lupus nephritis difficult.

  7. Photosensitivity in Cutaneous Lupus Erythematosus

    PubMed Central

    Kim, Andrew; Chong, Benjamin F.

    2012-01-01

    Cutaneous lupus erythematosus (CLE) encompasses several different forms including acute, subacute, and chronic manifestations that may or may not occur in the setting of systemic lupus erythematosus (SLE). Ultraviolet radiation (UVR) is a well-known exacerbating factor for CLE, with photosensitivity comprising one of the American College of Rheumatology (ACR) diagnostic criteria for SLE. However, discerning true photosensitivity in this population is difficult due to the broad language utilized by the ACR and the delayed-onset nature of photosensitive lupus lesions. Photoprovocation testing provides a more objective method to measure photosensitivity, but photoprovocation trials demonstrate significantly varying results due to protocol variations. Despite UVR’s deleterious effect on lupus patients, UVA-1 may have therapeutic benefits as shown by some observations on murine and human lupus subjects. Accurately discerning photosensitivity has diagnostic implications for SLE and provides motivation for greater patient adherence to photoprotective measures. PMID:23281691

  8. Comparative Analysis of Direct Hospital Care Costs between Aseptic and Two-Stage Septic Knee Revision

    PubMed Central

    Kasch, Richard; Merk, Sebastian; Assmann, Grit; Lahm, Andreas; Napp, Matthias; Merk, Harry; Flessa, Steffen

    2017-01-01

    Background The most common intermediate and long-term complications of total knee arthroplasty (TKA) include aseptic and septic failure of prosthetic joints. These complications cause suffering, and their management is expensive. In the future the number of revision TKA will increase, which involves a greater financial burden. Little concrete data about direct costs for aseptic and two-stage septic knee revisions with an in depth-analysis of septic explantation and implantation is available. Questions/Purposes A retrospective consecutive analysis of the major partial costs involved in revision TKA for aseptic and septic failure was undertaken to compare 1) demographic and clinical characteristics, and 2) variable direct costs (from a hospital department’s perspective) between patients who underwent single-stage aseptic and two-stage septic revision of TKA in a hospital providing maximum care. We separately analyze the explantation and implantation procedures in septic revision cases and identify the major cost drivers of knee revision operations. Methods A total of 106 consecutive patients (71 aseptic and 35 septic) was included. All direct costs of diagnosis, surgery, and treatment from the hospital department’s perspective were calculated as real purchase prices. Personnel involvement was calculated in units of minutes. Results Aseptic versus septic revisions differed significantly in terms of length of hospital stay (15.2 vs. 39.9 days), number of reported secondary diagnoses (6.3 vs. 9.8) and incision-suture time (108.3 min vs. 193.2 min). The management of septic revision TKA was significantly more expensive than that of aseptic failure ($12,223.79 vs. $6,749.43) (p <.001). On the level of the separate hospitalizations the mean direct costs of explantation stage ($4,540.46) were lower than aseptic revision TKA ($6,749.43) which were again lower than those of the septic implantation stage ($7,683.33). All mean costs of stays were not comparable as they

  9. Cerebrospinal fluid lactate dehydrogenase isoenzymes in children with bacterial and aseptic meningitis.

    PubMed

    Nussinovitch, Moshe; Finkelstein, Yaron; Elishkevitz, Keren Politi; Volovitz, Benjamin; Harel, Daniella; Klinger, Gil; Razon, Yaron; Nussinovitch, Udi; Nussinovitch, Naomi

    2009-10-01

    Differentiation of bacterial from aseptic meningitis may be difficult. Our aim was to determine the pattern of distribution of lactate dehydrogenase (LDH) isoenzymes in the cerebrospinal fluid (CSF) of patients with bacterial and aseptic meningitis. One hundred and fifty-seven patients with suspected meningitis were enrolled in the study. They were divided into 3 groups according to the culture- or bacterial antigen assay-proven diagnosis and CSF findings: bacterial meningitis (n = 31), aseptic meningitis (n = 65), and non-meningitis (n = 61). Total LDH level and percentages of LDH isoenzymes in the CSF were measured in each patient. Each group showed a distinct LDH isoenzyme distribution pattern, with a statistically significant difference among the groups in the percentages of the various isoenzymes. Compared with the non-meningitis group, total LDH activity in the CSF was high in the aseptic meningitis group (49.82+/-35.59 U/L, P < 0.001) and exaggerated in the bacterial meningitis group (944.53+/-112.3 U/L, P < 0.001). Low LDH-2 levels were unique to bacterial meningitis (P < 0.01), whereas high LDH-3 levels were characteristic of aseptic meningitis (P < 0.05). Both groups had low levels of LDH-1 and high levels of LDH-4 and LDH-5. In conclusion, the LDH isoenzyme pattern may be of clinical diagnostic value in meningitis, particularly when culture results are pending.

  10. Proposal for a new categorization of aseptic processing facilities based on risk assessment scores.

    PubMed

    Katayama, Hirohito; Toda, Atsushi; Tokunaga, Yuji; Katoh, Shigeo

    2008-01-01

    Risk assessment of aseptic processing facilities was performed using two published risk assessment tools. Calculated risk scores were compared with experimental test results, including environmental monitoring and media fill run results, in three different types of facilities. The two risk assessment tools used gave a generally similar outcome. However, depending on the tool used, variations were observed in the relative scores between the facilities. For the facility yielding the lowest risk scores, the corresponding experimental test results showed no contamination, indicating that these ordinal testing methods are insufficient to evaluate this kind of facility. A conventional facility having acceptable aseptic processing lines gave relatively high risk scores. The facility showing a rather high risk score demonstrated the usefulness of conventional microbiological test methods. Considering the significant gaps observed in calculated risk scores and in the ordinal microbiological test results between advanced and conventional facilities, we propose a facility categorization based on risk assessment. The most important risk factor in aseptic processing is human intervention. When human intervention is eliminated from the process by advanced hardware design, the aseptic processing facility can be classified into a new risk category that is better suited for assuring sterility based on a new set of criteria rather than on currently used microbiological analysis. To fully benefit from advanced technologies, we propose three risk categories for these aseptic facilities.

  11. Unusually severe varicella zoster (VZV) virus viral (aseptic) meningitis in an unimmunized, immunocompetent host with chickenpox.

    PubMed

    Cunha, Burke A; Warren-Favorito, Heather; Mickail, Nardeen

    2011-01-01

    Chickenpox is caused by the varicella zoster virus (VZV) and may be more severe in adults than in children. Central nervous system (CNS) manifestations of chickenpox and VZV are uncommon, for example, encephalitis and cerebellar ataxis. Viral (aseptic) meningitis is a rare CNS complication of VZV. The cerebrospinal fluid (CSF) profile in VZV viral (aseptic) meningitis is indistinguishable from other causes of viral meningitis. The clue to most of the diagnoses of VZV aseptic meningitis is based on the temporal relationship between antecedent or concomitant chickenpox. Chickenpox is a clinical diagnosis based on the appearance and distribution of the rash. The rash of chickenpox is vesicular/pruritic and typically appears in crops over 3 successive days. VZV vesicles are fragile, superficial, and surrounded by a erythematous halo. Common nonspecific laboratory findings in chickenpox include leukopenia, thrombocytopenia, and elevated serum transaminases (serum glutamate-oxaloacetate transaminase/serum glutamate-pyruvate transaminase). The erythrocyte sedimentation rate (ESR) is not highly elevated in chickenpox. In VZV aseptic meningitis, the CSF shows a lymphocytic pleocytosis with normal protein, glucose, and lactic acid levels. CSF red blood cells are not a feature of VZV meningitis. We present the case of a healthy unimmunized adult who was hospitalized with chickenpox complicated by VZV aseptic meningitis with an unusually severe headache and nuchal rigidity that occurred during hospitalization. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Aseptic peritonitis due to peptidoglycan contamination of pharmacopoeia standard dialysis solution.

    PubMed

    Martis, Leo; Patel, Mehul; Giertych, Joe; Mongoven, Jim; Taminne, Michel; Perrier, Michele A; Mendoza, Omar; Goud, Niranjan; Costigan, Aidan; Denjoy, Nicole; Verger, Christian; Owen, William F

    Manufacturers of parenteral solutions adhere to European and US Pharmacopoeia standards to define safety and sterility. In response to excess cases of aseptic peritonitis in peritoneal dialysis patients using icodextrin-containing dialysate that met all pharmacopoeia standards, a global recall was issued in May, 2002. We aimed to establish the cause of aseptic peritonitis. We analysed 186 reports of aseptic peritonitis between September, 2001, and January, 2003. Extensive physical, chemical, and microbiological investigations of recalled dialysate were done. We calculated dose-response curves for peptidoglycan-induced interleukin 6 elaboration in peripheral blood mononuclear cells (PBMCs) from healthy donors and for sterile peritonitis in rats. Although its chemical constituents and concentrations of endotoxin were within pharmacopoeia specifications, the dialysis solution elicited an interlukin 6 response in vivo and in vitro. We identified peptidoglycan from thermophilic acidophilic bacteria (Alicyclobacillus acidocaldarius) as the contaminating proinflammatory substance. In the PBMC assay, strong dose-response relations were noted between peptidoglycan concentrations and interleukin 6. In rats injected with peptidoglycan, dose-dependent increases of intraperitoneal neutrophils and pyrogenic cytokines were recorded. We measured a positive relation between peptidoglycan concentrations in recalled dialysate and reports of aseptic peritonitis. After implementation of corrective actions, the rate of peritonitis returned to baseline. Excess cases of aseptic peritonitis in peritoneal dialysis patients were due to peptidoglycan contamination of dialysate by Alicyclobacillus. This outbreak serves as an example of how contemporary parenteral products with microbial contaminants can be considered safe under current pharmacopoeia tests, but provoke adverse clinical effects.

  13. Flexible walled container having membrane fitment for use with aseptic filling apparatus

    SciTech Connect

    Davis, J.C.; Reiss, R.J.; Rica, A.F.

    1984-05-01

    There is disclosed an aseptic flexible walled container having a rigid fitment member cooperative with an aseptic filling apparatus and including a neck, outer flanges surrounding the neck, a frangible membrane and an outer end rim receptive of an hermetically sealed lid. The neck is formed with an internal chamferred seating shoulder for fluid-tight engagement with a fill tube. One outer flange cooperates with clamping jaws of the aseptic filling apparatus for detachably sealing the fitment to a sterilizing chamber and placing it in position for insertion of the filling tube which ruptures the membrane and permits the aseptic introduction of product to the container's interior. The other outer flange is secured to an opening in a wall of the flexible container. The joined fitment and container are presterilized prior to filling. Selected materials for the multi-ply container walls and the fitment permit the container to withstand gamma ray and other sterilization treatment, heat and pressure while maintaining required strength. After the container is aseptically filled, such as with flowable food product, the fill tube is withdrawn and a lid is hermetically sealed onto the rim of the fitment. A heat shield adjacent a container wall surrounds the fitment to protect the container from excessive heat generated by the associated filling apparatus during filling.

  14. Lupus Alma Disk Survey

    NASA Astrophysics Data System (ADS)

    Ansdell, Megan

    2016-07-01

    We present the first unbiased ALMA survey of both dust and gas in a large sample of protoplanetary disks. We surveyed 100 sources in the nearby (150-200 pc), young (1-2 Myr) Lupus region to constrain M_dust to 2 M_Mars and M_gas to 1 M_Jup. Most disks have masses < MMSN and gas-to-dust ratios < ISM. Such rapid gas depletion may explain the prevalence of super-Earths in the exoplanet population.

  15. Filaments in Lupus I

    NASA Astrophysics Data System (ADS)

    Takahashi, Satoko; Rodon, J.; De Gregorio-Monsalvo, I.; Plunkett, A.

    2017-06-01

    The mechanisms behind the formation of sub-stellar mass sources are key to determine the populations at the low-mass end of the stellar distribution. Here, we present mapping observations toward the Lupus I cloud in C18O(2-1) and 13CO(2-1) obtained with APEX. We have identified a few velocity-coherent filaments. Each contains several substellar mass sources that are also identified in the 1.1mm continuum data (see also SOLA catalogue presentation). We will discuss the velocity structure, fragmentation properties of the identified filaments, and the nature of the detected sources.

  16. [Cutaneous lupus erythematosus].

    PubMed

    Sandreva, Tatjana; Voss, Anne; Bygum, Anette

    2015-07-27

    Cutaneous lupus erythematosus (LE) is an autoimmune disease. The most common clinical forms are acute cutaneous LE (ACLE), subacute cutaneous LE (SCLE) and discoid LE (DLE). Cutaneous LE, mainly ACLE, can be the first sign of systemic LE (SLE). DLE and SCLE are less associated with development of SLE, however, up to 85% of patients with SLE have cutaneous manifestations. The aetiology is multifactorial. Drugs such as proton pump inhibitors can induce SCLE, while UV-light and smoking can worsen the lesions. Treatment includes preventive strategies in addition to topical steroids and systemic hydroxychloroquine.

  17. Pregnancy and Lupus Nephritis.

    PubMed

    Kattah, Andrea G; Garovic, Vesna D

    2015-09-01

    The management of lupus nephritis in pregnancy presents a diagnostic and therapeutic challenge for providers. Pregnancy creates a series of physiologic changes in the immune system and kidney that may result in an increased risk of disease flare and adverse maternal and fetal outcomes, such as preeclampsia, fetal loss, and preterm delivery. Conception should be delayed until disease is in remission to ensure the best pregnancy outcomes. Maternal disease activity and fetal well-being should be monitored closely by an interdisciplinary team, including obstetricians, rheumatologists, and nephrologists throughout pregnancy. Careful attention must be paid to the dosing and potential teratogenicity of medications.

  18. Epigenetics and lupus.

    PubMed

    Miceli-Richard, Corinne

    2015-03-01

    Systemic lupus erythematosus (SLE) is among the systemic autoimmune diseases whose complex pathogenesis involves both genetic and environmental factors. Epigenetic dysregulation resulting in overexpression of certain genes in some of the key immune cells, such as T cells, has been incriminated in the pathophysiology of SLE. Epigenetics is defined as transmissible and reversible modifications in gene expression without alterations in the nucleotide sequences. Epigenetic information is carried chiefly by DNA itself, histones, and noncoding RNAs. Several epigenetic mechanisms may play a role in SLE pathogenesis. This review discusses the various epigenetic mechanisms that regulate gene expression and provides examples relevant to SLE.

  19. The Pathogenesis of Lupus Nephritis

    PubMed Central

    Lech, Maciej

    2013-01-01

    Lupus nephritis is an immune complex GN that develops as a frequent complication of SLE. The pathogenesis of lupus nephritis involves a variety of pathogenic mechanisms. The extrarenal etiology of systemic lupus is based on multiple combinations of genetic variants that compromise those mechanisms normally assuring immune tolerance to nuclear autoantigens. This loss of tolerance becomes clinically detectable by the presence of antinuclear antibodies. In addition, nucleic acids released from netting or apoptotic neutrophils activate innate and adaptive immunity via viral nucleic acid-specific Toll-like receptors. Therefore, many clinical manifestations of systemic lupus resemble those of viral infection. In lupus, endogenous nuclear particles trigger IFN-α signaling just like viral particles during viral infection. As such, dendritic cells, T helper cells, B cells, and plasma cells all contribute to the aberrant polyclonal autoimmunity. The intrarenal etiology of lupus nephritis involves antibody binding to multiple intrarenal autoantigens rather than the deposition of circulating immune complexes. Tertiary lymphoid tissue formation and local antibody production add to intrarenal complement activation as renal immunopathology progresses. Here we provide an update on the pathogenic mechanisms that lead to lupus nephritis and provide the rationale for the latest and novel treatment strategies. PMID:23929771

  20. microRNAs in lupus

    PubMed Central

    ZAN, HONG; TAT, CONNIE; CASALI, PAOLO

    2014-01-01

    Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by the production of an array of pathogenic autoantibodies, including high-affinity anti-dsDNA IgG antibodies, which plays an important role in disease development and progression. Lupus preferentially affects women during their reproductive years. The pathogenesis of lupus is contributed by both genetic factors and epigenetic modifications that arise from exposure to the environment. Epigenetic marks, including DNA methylation, histone post-translational modifications and microRNAs (miRNAs), interact with genetic programs to regulate immune responses. Epigenetic modifications influence gene expression and modulate B cell functions, such as class switch DNA recombination (CSR), somatic hypermutation (SHM) and plasma cell differentiation, thereby informing the antibody response. Epigenetic dysregulation can result in aberrant antibody responses to exogenous antigens or self-antigens, such as chromatin, histones and dsDNA in lupus. miRNAs play key roles in the post-transcriptional regulation of most gene-regulatory pathways and regulate both the innate and the adaptive immune responses. In mice, dysregulation of miRNAs leads to aberrant immune responses and development of systemic autoimmunity. Altered miRNA expression has been reported in human autoimmune diseases, including lupus. The dysregulation of miRNAs in lupus could be the result of multiple environmental factors, such as sex hormones and viral or bacterial infection. Modulation of miRNA is a potential therapeutic strategy for lupus. PMID:24826805

  1. Femoral cement within cement technique in carefully selected aseptic revision arthroplasties.

    PubMed

    Marcos, Lucas; Buttaro, Martin; Comba, Fernando; Piccaluga, Francisco

    2009-06-01

    The aim of this study was to evaluate the clinical and radiological results in a group of patients who underwent aseptic revision hip arthroplasty using the cement within cement (CWC) technique. Between 1999 and 2005, 37 aseptic revision hip operations were performed. There were 30 women and five men, with an average age of 68 years. The reasons for revision were femoral stem fracture, cup failure, acetabular protrusion after hemi-arthroplasty and recurrent dislocation. At an average follow-up of 46 months, none of the patients required further femoral revision. The average post-operative Merle D'Aubigne score was 16.6 points (p<0.05). No evidence of radiological stem failure was observed and no femoral component was considered to be at risk for loosening. In this series of patients, the CWC technique provided consistent with high functional outcomes. This valid and effective alternative should be considered in carefully selected aseptic cases.

  2. [The indicators of immunity in patients with aseptic instability of knee joint].

    PubMed

    Chepeleva, M V; Chegurov, O K; Kuznetsova, E I; Shved, N S

    2014-08-01

    The examination was applied to sampling of 17 patients with stable implants after 18-36 months after endoprosthesis replacement of knee joint and to sampling of 17 patients with developed within this time-frame aseptic instability of endoprosthesis within the same time-frame. The typing of lymphocytes of peripheral blood was implemented using laser flow cytometry. The detection of immunoglobulins, cytokines, circulating immune complexes was made applying the technique of enzymoimmunoassay. In case of development of aseptic instability the signs testifying moderate activation of immune system and starting dysfunction of monocyte macrophage component of immune system. At that, IL-6, TNFα, CD14+HLA-DR provided the most complete information on the side of diagnostic of developing aseptic instability of joint.

  3. An investigation of the aseptic loosening of an AISI 316L stainless steel hip prosthesis.

    PubMed

    Godec, Matjaz; Kocijan, Aleksandra; Dolinar, Drago; Mandrino, Djordje; Jenko, Monika; Antolic, Vane

    2010-08-01

    The total replacement of joints by the implantation of permanently indwelling prosthetic components has been one of the major successes of modern surgery in terms of relieving pain and correcting deformity. However, the aseptic loosening of a prosthetic-joint component is the most common reason for joint-revision surgery. Furthermore, it is thought that wear particles are one of the major contributors to the development and perpetuation of aseptic loosening. The aim of the present study was to identify the factors related to the aseptic loosening of an AISI 316L stainless steel total hip prosthesis. The stem was evaluated by x-ray photoelectron spectroscopy, with polished and rough regions being analyzed in order to establish the differences in the chemical compositions of both regions. Specific areas were examined using scanning electron microscopy with energy dispersive x-ray spectroscopy and light microscopy.

  4. Aseptic meningitis outbreak associated with echovirus 9 among recreational vehicle campers--Connecticut, 2003.

    PubMed

    2004-08-13

    Aseptic meningitis is an inflammation of the tissues covering the brain and spinal cord and caused by a virus, most frequently an enterovirus. In August 2003, the Connecticut Department of Public Health (CDPH) received a report of three viral meningitis cases among recreational vehicle (RV) campers staying at a campground in northeastern Connecticut. CDPH, assisted by CDC, conducted an investigation, which 1) identified a total of 12 cases of aseptic meningitis and 24 cases of enterovirus-like illness among 201 campers interviewed, 2) demonstrated how transmission of enterovirus from persons with mild illness contributed to the aseptic meningitis outbreak, and 3) determined that crowded conditions inside RVs and in the campground swimming pool likely facilitated spread of enterovirus. Pool operators should check chlorine and pH levels frequently, particularly during peak pool occupancy; adults should take precautions against passing enterovirus to children, who are at greater risk for severe illness.

  5. Childhood systemic lupus erythematosus and neonatal lupus syndrome.

    PubMed

    Sandborg, C I

    1998-09-01

    Systemic lupus erythematosus in children can present with a wide spectrum of disease manifestations. Significant organ system involvement appears to be more severe in children than in adults. Central nervous system disease continues to be difficult to diagnose because of the lack of sensitive and specific diagnostic tests. Renal function is the major determinant of long-term prognosis and management in children with lupus. Identification of patients who are most at risk for progression of renal disease and aggressive treatment, including corticosteroids and immunosuppressive agents, are indicated. Genetic susceptibility studies in lupus reveal multiple contributions from HLA and non-HLA genes. Current concepts regarding apoptosis and DNA-protein complexes and autoreactive T-cell help for anti-DNA antibody production suggest novel directions for therapies. New understandings of the pathogenesis of neonatal lupus syndrome and congenital heart block reveals important information about prospective monitoring and management of mothers and fetuses at risk.

  6. Pre-Clinical Lupus

    PubMed Central

    Bourn, Rebecka; James, Judith A.

    2015-01-01

    Purpose of review Systemic lupus erythematosus (SLE) is often preceded by immune dysregulation and clinical manifestations below the threshold for SLE classification. This review discusses current and evolving concepts about the pre-classification period of SLE, including clinical and mechanistic observations, and potential avenues for early identification and intervention. Recent findings Although incomplete lupus erythematosus (ILE) involves fewer clinical manifestations than SLE, ILE can cause organ damage and mortality. Common clinical features in ILE include antinuclear antibody seropositivity, polyarthritis, immunologic manifestations, and hematological disorders. Despite having lower disease activity and damage scores than SLE patients, ILE patients may develop pulmonary arterial hypertension or renal, neurological, or peripheral vascular damage. The recently proposed SLICC SLE classification criteria could shift the period considered “preclinical SLE”. Murine studies suggest that the balance of T helper/T regulatory cells, peroxisome proliferator-activated receptor γ activity, and plasmacytoid dendritic cell pathways may be valuable targets for early intervention. Summary Advances in our understanding of early SLE, including stages before clinical features are fully developed, will improve our ability to identify individuals at high risk of classification for potential prevention trials, provide necessary information to improve diagnostic testing, and perhaps identify novel targets for directed therapeutics in clinical SLE. PMID:26125103

  7. Male only Systemic Lupus

    PubMed Central

    Aggarwal, Rachna; Namjou, Bahram; Li, Shibo; D'Souza, Anil; Tsao, Betty P; Bruner, Ben; James, Judith A.; Scofield, R. Hal

    2010-01-01

    Systemic lupus erythematosus (SLE) is more common among women than men with a ratio of about 10 to 1. We undertook this study to describe familial male SLE within a large cohort of familial SLE. SLE families (two or more patients) were obtained from the Lupus Multiplex Registry and Repository. Genomic DNA and blood samples were obtained using standard methods. Autoantibodies were determined by multiple methods. Medical records were abstracted for SLE clinical data. Fluorescent in situ hybridization (FISH) was performed with X and Y centromere specific probes, and a probe specific for the toll-like receptor 7 gene on the X chromosome. Among 523 SLE families, we found five families in which all the SLE patients were male. FISH found no yaa gene equivalent in these families. SLE-unaffected primary female relatives from the five families with only-male SLE patients had a statistically increased rate of positive ANA compared to SLE-unaffected female relatives in other families. White men with SLE were 5 times more likely to have an offspring with SLE than were White women with SLE but there was no difference in this likelihood among Black men. These data suggest genetic susceptibility factors that act only in men. PMID:20472921

  8. Histopathology of lupus nephritis.

    PubMed

    Giannakakis, Konstantinos; Faraggiana, Tullio

    2011-06-01

    The spectrum of morphologic changes in lupus nephritis, either microscopic, ultrastructural, or immunohistological, closely reflects the great variety of immune complexes that are produced in the course of the disease. Every tissue component of the kidney can be affected, but glomeruli are the target structure in most patients. Several attempts have been made to correlate the clinical severity and the outcome of the nephritis with the pathologic features; the current classification and the six classes that resulted from an international study group are entirely based on glomerular changes. Major criteria of classification include the focal or diffuse involvement of the glomerulus, the site of hypercellularity, the site of immune complex deposition and the presence of active and/or sclerotic lesions. Even if less thoroughly investigated than the glomerulus, the interstitial compartment has revealed many interesting features as are vascular lesions, a common and often underestimated feature. Typing of subpopulation of lymphoid infiltrates supports the emerging evidence indicating that B cells are promoting autoimmunity in mechanisms other than autoAb secretion. Many aspects are still debated and/or poorly understood, such as the interpretation of the so-called "full house nephropathy" that closely mimic lupus nephritis in seronegative patients.

  9. Quality comparison of continuous steam sterilization segmented-flow aseptic processing versus conventional canning of whole and sliced mushrooms.

    PubMed

    Anderson, N M; Walker, P N

    2011-08-01

    This study was carried out to investigate segmented-flow aseptic processing of particle foods. A pilot-scale continuous steam sterilization unit capable of producing shelf stable aseptically processed whole and sliced mushrooms was developed. The system utilized pressurized steam as the heating medium to achieve high temperature-short time processing conditions with high and uniform heat transfer that will enable static temperature penetration studies for process development. Segmented-flow technology produced a narrower residence time distribution than pipe-flow aseptic processing; thus, whole and sliced mushrooms were processed only as long as needed to achieve the target F₀  = 7.0 min and were not overcooked. Continuous steam sterilization segmented-flow aseptic processing produced shelf stable aseptically processed mushrooms of superior quality to conventionally canned mushrooms. When compared to conventionally canned mushrooms, aseptically processed yield (weight basis) increased 6.1% (SD = 2.9%) and 6.6% (SD = 2.2%), whiteness (L) improved 3.1% (SD = 1.9%) and 4.7% (SD = 0.7%), color difference (ΔE) improved 6.0% (SD = 1.3%) and 8.5% (SD = 1.5%), and texture improved 3.9% (SD = 1.7%) and 4.6% (SD = 4.2%), for whole and sliced mushrooms, respectively. Segmented-flow aseptic processing eliminated a separate blanching step, eliminated the unnecessary packaging of water and promoted the use of bag-in-box and other versatile aseptic packaging methods. Segmented-flow aseptic processing is capable of producing shelf stable aseptically processed particle foods of superior quality to a conventionally canned product. This unique continuous steam sterilization process eliminates the need for a separate blanching step, reduces or eliminates the need for a liquid carrier, and promotes the use of bag-in-box and other versatile aseptic packaging methods. © 2011 Institute of Food Technologists®

  10. Lupus nephritis in African Americans.

    PubMed

    Lea, Janice P

    2002-02-01

    Lupus nephritis is more common and severe in African American women. Despite aggressive immunosuppressive therapies employed in lupus nephritis, African Americans have a higher incidence of progression to end-stage renal disease. The reasons for the racial disparities are not clear, but seem to be due to genetic, environmental, and socioeconomic factors. Hypertension and proteinuria are well-defined prognostic factors that significantly impact the course of renal disease progression for most forms of renal disease. However, clinical trials in lupus nephritis to date have not evaluated the role of aggressive antihypertensive or antiproteinuric therapies in retarding renal disease progression. Thus, additional studies are needed to better elucidate the natural history of lupus nephritis in African Americans and to optimize therapeutic strategies for those who are identified as being at high risk.

  11. Diet and Nutrition With Lupus

    MedlinePlus

    ... Should a person with lupus be on a gluten-free diet? If you also have celiac disease, a gluten-free diet is critical. Otherwise, there is no evidence that gluten worsens or improves inflammation in any other autoimmune ...

  12. Living with Lupus (For Parents)

    MedlinePlus

    ... other conditions, like juvenile idiopathic arthritis, Crohn's disease, Lyme disease, and mononucleosis. Cutaneous (or skin) lupus , which usually ... Muscles, and Joints Immune System Juvenile Idiopathic Arthritis Lyme Disease Guillain-Barré Syndrome Your Immune System Life With ...

  13. Diet and Nutrition With Lupus

    MedlinePlus

    ... Should a person with lupus be on a gluten-free diet? If you also have celiac disease, a gluten-free diet is critical. Otherwise, there is no evidence that gluten worsens or improves inflammation in any other autoimmune ...

  14. Lupus Erythematosus Panniculitis in Pregnancy

    PubMed Central

    Gondane, Swati; Kothiwala, Rajkumar; Dangi, Sapna; Meherda, Ashok

    2015-01-01

    A case of lupus erythematosus (LE) panniculitis in pregnancy without any lesions of discoid LE or systemic LE is being reported. There were no systemic symptoms. Her ANA, anti-dsDNA, anti-Ro/SSA, and anti-La/SSB antibodies were within normal limits. Diagnosis of lupus panniculitis was considered on clinical and histopathological grounds. The condition responded favorably to systemic steroid therapy. PMID:26677307

  15. Photosensitivity in cutaneous lupus erythematosus.

    PubMed

    Kim, Andrew; Chong, Benjamin F

    2013-02-01

    Ultraviolet radiation (UVR) is a well-known exacerbating factor for cutaneous lupus erythematosus (CLE), with photosensitivity comprising one of the American College of Rheumatology (ACR) diagnostic criteria for systemic lupus erythematosus (SLE). However, discerning true photosensitivity in this population is difficult due to the broad language utilized by the ACR and the delayed-onset nature of photosensitive lupus lesions. The objective of this report is to provide a review of photosensitivity, photoprovocation, and phototherapy in the context of CLE patients. A literature review in PubMed was conducted using the terms 'ultraviolet light,' 'lupus erythematosus,' 'photoprovocation,' or 'photosensitivity.' Self-patient reporting of photosensitivity and the broad definition of photosensitivity have led to the wide range of photosensitivity rates in CLE patients. Photoprovocation testing provides a more objective method to measure photosensitivity, but even these trials demonstrate significant differences due to protocol variations. Despite UVR's deleterious effect on lupus patients, ultraviolet A (UVA)-1 may have therapeutic benefits as shown by observations on murine models and human lupus subjects. Accurately discerning photosensitivity has diagnostic implications for SLE and provides motivation for greater patient adherence to photoprotective methods. © 2013 John Wiley & Sons A/S.

  16. True vasculitis in lupus nephritis.

    PubMed

    Abdellatif, A A; Waris, S; Lakhani, A; Kadikoy, H; Haque, W; Truong, L D

    2010-08-01

    Vascular lesions are encountered frequently in renal biopsy specimens of patients with systemic lupus erythematosus (SLE) and can present in a variety of morphologic forms. True renal lupus vasculitis (TRLV) is one of the rare vascular lesions associated with lupus nephritis that has been infrequently reported in the medical literature. The primary focus on glomerular pathology and collective classification of the vascular lesions under lupus vasculopathy is one of the reasons why this form of inflammatory vasculitis has been under-recognized as a separate disease entity. Here we have comprehensively reviewed the literature on renal vascular involvement in SLE for a better understanding of the epidemiology, morphologic features, pathogenesis, clinical course and treatment of TRLV. It can be morphologically differentiated from other forms of renal vascular lesions in lupus nephritis, i.e. arteriosclerosis, uncomplicated vascular immune deposits, non-inflammatory necrotizing vasculopathy, and thrombotic microangiopathy. Despite close similarities with antineutrophil cytoplasmic autoantibody associated vasculitis (AASV), there are certain morphological differences that warrant a thorough investigation of the possible pauci-immune mechanism of pathogenesis. The vasculitis follows a severe clinical course in general with rapid progression to renal failure, although favorable outcomes have been reported in certain cases. The standard use of steroids and cytotoxic drugs has yielded variable results in the treatment of TRLV. Current treatment modalities being used in lupus nephritis and AASV have been compared in this article with focus on drugs acting on the inflammatory cells implicated in TRLV pathogenesis.

  17. 77 FR 38305 - Guidance for Industry on Lupus Nephritis Caused by Systemic Lupus Erythematosus-Developing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-27

    ... availability of a guidance entitled ``Lupus Nephritis Caused By Systemic Lupus Erythematosus--Developing... HUMAN SERVICES Food and Drug Administration Guidance for Industry on Lupus Nephritis Caused by Systemic Lupus Erythematosus--Developing Medical Products for Treatment; Withdrawal of Guidance AGENCY: Food...

  18. 75 FR 35492 - Guidance for Industry on Lupus Nephritis Caused By Systemic Lupus Erythematosus-Developing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-22

    ... availability of a guidance for industry entitled ``Lupus Nephritis Caused By Systemic Lupus Erythematosus... nephritis (LN) caused by systemic lupus erythematosus (SLE). This guidance finalizes the parts of the draft guidance entitled ``Systemic Lupus Erythematosus--Developing Drugs for Treatment'' (the draft...

  19. Systemic lupus erythematosus.

    PubMed

    Shaikh, Maliha F; Jordan, Natasha; D'Cruz, David P

    2017-02-01

    Systemic lupus erythematosus (SLE) is a chronic multisystem autoimmune disease that is highly heterogeneous in its presentation. This can pose significant challenges for physicians responsible for the diagnosis and treatment of such patients. SLE arises from a combination of genetic, epigenetic and environmental factors. Pathologically, the disease is primarily driven by loss of immune tolerance and abnormal B- and T-cell function. Major organ involvement may lead to significant morbidity and mortality. Classification criteria for SLE have been developed largely for research purposes; however, these are also widely used in clinical practice. Antinuclear antibodies are the hallmark serological feature, occurring in over 95% of patients with SLE at some point during their disease. The mainstay of treatment is antimalarial drugs such as hydroxychloroquine, combined with corticosteroids and conventional immunosuppressive drugs. An increasing understanding of pathogenesis has facilitated a move towards the development of targeted biologic therapies, with the introduction of rituximab and belimumab into clinical practice.

  20. [Neonatal lupus syndrome].

    PubMed

    Iwamoto, Masahiro

    2005-02-01

    Neonatal lupus syndrome is a passively acquired autoimmune syndrome in which pathogenic autoantibodies (anti-SSA/Ro, anti-SSB/La, and both, or rarely anti-U(1)RNP antibodies) are transmitted from a mother to her fetus through the placenta. The major clinical manifestations in the infants are cardiac (congenital heart block), dermatologic (skin lesion), hepatic (elevated hepatic enzymes), and hematologic (cytopenia). Congenital complete heart block (CCHB) is irreversible, while noncardiac manifestations are transient, resolving by one-year-old of age without specific treatments. Two prospective studies show that the prevalence of CCHB in children from a woman previously known to have anti-SSA/Ro antibodies is approximately 2%. However, when the previous pregnancy is complicated by CCHB and skin lesion, the recurrence rates of these symptoms go much higher to 10.5% and 26%, respectively, in the subsequent pregnancy.

  1. Early Cutaneous Lupus Erythematosus

    PubMed Central

    Sams, Wiley M.

    1966-01-01

    Cutaneous disorders which manifest themselves on the exposed parts are more likely than are hidden lesions to cause the patient to seek professional services promptly. Usually he consults his family physician or the community dermatologist. The physician who first sees the patient is dependent upon his own resources for management and diagnosis. A background of experience, a measure of energy and an inquisitive attitude are the necessary ingredients for successful management. The difficulties involved in differentiating early lupus erythematosus and polymorphic light eruptions cannot be invariably resolved even with the most complete review. The course of the disorder and the response to environmental factors supply important clues. Investigative work, especially in the field of immunology, offers hope for the solution of some of our problems. PMID:5909872

  2. Haematological manifestations of lupus

    PubMed Central

    Fayyaz, Anum; Igoe, Ann; Kurien, Biji T; Danda, Debashish; James, Judith A; Stafford, Haraldine A; Scofield, R Hal

    2015-01-01

    Our purpose was to compile information on the haematological manifestations of systemic lupus erythematosus (SLE), namely leucopenia, lymphopenia, thrombocytopenia, autoimmune haemolytic anaemia (AIHA), thrombotic thrombocytopenic purpura (TTP) and myelofibrosis. During our search of the English-language MEDLINE sources, we did not place a date-of-publication constraint. Hence, we have reviewed previous as well as most recent studies with the subject heading SLE in combination with each manifestation. Neutropenia can lead to morbidity and mortality from increased susceptibility to infection. Severe neutropenia can be successfully treated with granulocyte colony-stimulating factor. While related to disease activity, there is no specific therapy for lymphopenia. Severe lymphopenia may require the use of prophylactic therapy to prevent select opportunistic infections. Isolated idiopathic thrombocytopenic purpura maybe the first manifestation of SLE by months or even years. Some manifestations of lupus occur more frequently in association with low platelet count in these patients, for example, neuropsychiatric manifestation, haemolytic anaemia, the antiphospholipid syndrome and renal disease. Thrombocytopenia can be regarded as an important prognostic indicator of survival in patients with SLE. Medical, surgical and biological treatment modalities are reviewed for this manifestation. First-line therapy remains glucocorticoids. Through our review, we conclude glucocorticoids do produce a response in majority of patients initially, but sustained response to therapy is unlikely. Glucocorticoids are used as first-line therapy in patients with SLE with AIHA, but there is no conclusive evidence to guide second-line therapy. Rituximab is promising in refractory and non-responding AIHA. TTP is not recognised as a criteria for classification of SLE, but there is a considerable overlap between the presenting features of TTP and SLE, and a few patients with SLE have concurrent

  3. Hepatitis C virus transmission in hemodialysis units: importance of infection control practices and aseptic technique.

    PubMed

    Thompson, Nicola D; Novak, Ryan T; Datta, Deblina; Cotter, Susanne; Arduino, Matthew J; Patel, Priti R; Williams, Ian T; Bialek, Stephanie R

    2009-09-01

    We investigated 4 hepatitis C virus (HCV) infection outbreaks at hemodialysis units to identify practices associated with transmission. Apparent failures to follow recommended infection control precautions resulted in patient-to-patient HCV transmission, through cross-contamination of the environment or intravenous medication vials. Fastidious attention to aseptic technique and infection control precautions are essential to prevent HCV transmission.

  4. Rapid and sensitive detection of enteroviruses in specimens from patients with aseptic meningitis.

    PubMed

    Yerly, S; Gervaix, A; Simonet, V; Caflisch, M; Perrin, L; Wunderli, W

    1996-01-01

    A 5-h PCR assay (Amplicor enterovirus test) was compared with viral culture for the detection of enteroviruses in cerebrospinal fluid. Of the cerebrospinal fluid specimens collected during a summer outbreak of aseptic meningitis, 34% were positive by viral culture whereas 66% were positive by the Amplicor PCR, suggesting that this technique improves the diagnosis of enteroviral meningitis.

  5. A low cost multi-level sampling device for synchronous aseptic collection of environmental water samples.

    PubMed

    McCormick, Michael L; Banishki, Nikola; Powell, Sarah; Rumack, Amy; Garrett, Jinnie M

    2014-10-01

    We describe a simple device for the aseptic collection of environmental water samples at high spatial resolution to depths of 50m. To demonstrate the utility of this technique we present geochemical and archaeal community data from samples collected throughout the water column of a stratified lake.

  6. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... for the Agency's current good manufacturing practice regulations for PET drugs. DATES: Although you... HUMAN SERVICES Food and Drug Administration Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography Drugs; Availability AGENCY: Food and Drug Administration,...

  7. Expression of tenascin-C in aseptic loosening of total hip replacement

    PubMed Central

    Konttinen, Y.; Li, T.; Michelsson, O.; Xu, J.; Sorsa, T.; Santavirta, S.; Imai, S.; Virtanen, I.

    1998-01-01

    OBJECTIVE—To assess if the bonding interlayer between the implant and bone in aseptic loosening of total hip replacement (THR) is qualitatively deteriorated by excessive accumulation of anti-adhesive glycoprotein, tenascin-C.
METHODS—Alkaline phosphatase-anti-alkaline phosphatase (APAAP) method was used for immunohistochemical staining of tenascin-C in interface tissue and control synovial tissue.
RESULTS—Tenascin-C was found to be a major component of the extracellular matrix at a hitherto unrecognised site, namely the synovial membrane-like interface tissue between implant and bone in aseptic loosening of THR. The overall tenascin-C staining (median score 4.0) was greatly increased in aseptic loosening compared with synovial membrane (median score 2.0; p<0.001) and fibrous capsule (median score 2.0; p<0.001) from primary THR operations. Topological analysis disclosed that tenascin-C was also found at the critical implant-interface and interface-bone surfaces.
CONCLUSION—Local tenascin-C expression is increased as a result of a chronic foreign body type reaction associated with excessive cytokine production and tissue injury mediated by microtrauma and neutral endoproteinases. This qualitative and topological deterioration of the bonding interlayer by an increase of anti-adhesive tenascin-C expression may inadvertantly contribute to loosening.

 Keywords: tenascin; aseptic loosening; total hip replacement PMID:9893574

  8. Continuous flow microwave-assisted processing and aseptic packaging of purple-fleshed sweetpotato purees

    USDA-ARS?s Scientific Manuscript database

    Pumpable purees from purple-flesh sweetpotatoes (PFSP) were subjected to microwave heating using a 915 MHz continuous flow system, followed by aseptic packaging in flexible containers to obtain a shelf-stable product. Initial test runs were conducted using a 5 kW microwave unit to measure dielectr...

  9. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068645 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  10. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068640 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  11. Kotov works with samples from the Bioscience Experiment ASEPTIC during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068638 (18 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, works with samples from the bioscience experiment ASEPTIC (BTKh-39) in the new Russian Glavboks-S (Glovebox) located in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  12. Magnetic thermometry in the aseptic processing of foods containing particulates (abstract)

    NASA Astrophysics Data System (ADS)

    Ghiron, Kenneth; Litchfield, Bruce

    1997-04-01

    Aseptic processing of foods has many advantages over canning, including higher efficiency, lighter packaging, better taste, and higher nutritional value. Aseptic processing is different from canning where the food and container are sterilized together. Instead, a thin stream of food is heated and the packaging is independently sterilized before the food is placed in the package. However, no aseptic processes have been successfully filed with the FDA for foods containing sizable solid particles because of uncertainties in the thermal sterilization of the particles (e.g., soup). We have demonstrated that by inserting small paramagnetic particles in the interior of the simulated and real food particles, the local temperature can be measured. With this information, any questions about the adequate sterilization of the particles can be resolved. The measurements were done by directing the food stream through a magnetic field and sensing the voltages induced in a pickup coil by the motion of the magnetized particles. Details of the equipment design and data analysis will be discussed along with an introduction to the aseptic processing of foods.

  13. Lupus, discoid on a child's face (image)

    MedlinePlus

    The round or disk shaped (discoid) rash of lupus produces red, raised patches with scales. The pores ( ... The majority (approximately 90%) of individuals with discoid lupus have only skin involvement as compared to more ...

  14. I Am Newly Diagnosed with Lupus

    MedlinePlus

    ... up. article I have lupus: Now what? Lisa Walters struggled to get her diagnosis. Now that she knows, she's ready to keep moving forward. Personal Story Hair loss and lupus Hair loss is a common side ...

  15. Systemic lupus erythematosus and Klinefelter's syndrome.

    PubMed Central

    French, M A; Hughes, P

    1983-01-01

    A case of Klinefelter's syndrome presenting with systemic lupus erythematosus while receiving androgen replacement therapy is described. The association of systemic lupus erythematosus with Klinefelter's syndrome is discussed, particularly in terms of the effect of sex hormones. PMID:6882046

  16. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    PubMed

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products.

  17. Relationship between GNAS1 T393C polymorphism and aseptic loosening after total hip arthroplasty.

    PubMed

    Stelmach, Patrick; Kauther, Max D; Fuest, Lena; Kurscheid, Gina; Gehrke, Thorsten; Klenke, Stefanie; Jäger, Marcus; Wedemeyer, Christian; Bachmann, Hagen S

    2017-08-23

    Aseptic loosening is a main cause for revision surgery after total hip arthroplasty (THA) and there is no reliable marker for the early detection of patients at high risk. This study has been performed to validate association of the T393C polymorphism (rs7121) in the GNAS1 gene, encoding for the alpha-subunit of heterotrimeric G-protein Gs, with risk for and time to aseptic loosening after THA, which has been demonstrated in our previous study. 231 patients with primary THA and 234 patients suffering from aseptic loosening were genotyped for dependency on GNAS1 genotypes and analyzed. Genotyping revealed almost similar minor allele frequencies of 0.49 and 0.46, respectively. Consistently, genotype distributions of both groups were not significantly different (p = 0.572). Neither gender nor GNAS1 genotype showed a statistically significant association with time to loosening (p = 0.501 and p = 0.840). Stratification by gender, as performed in our previous study, was not able to show a significant genotype-dependent difference in time (female p = 0.313; male p = 0.584) as well as median time to aseptic loosening (female p = 0.353; male p = 0.868). This study was not able to confirm the results of our preliminary study. An association of the GNAS1 T393C polymorphisms with risk for and time to aseptic loosening after THA is unlikely.

  18. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  19. Pathways of macrophage apoptosis within the interface membrane in aseptic loosening of prostheses.

    PubMed

    Yang, Fei; Wu, Wen; Cao, Lei; Huang, Yan; Zhu, Zhenan; Tang, Tingting; Dai, Kerong

    2011-12-01

    Aseptic loosening is a major cause of failure of total hip arthroplasty (THA). Macrophage apoptosis in interface membrane has been proved to play an important role in the pathogenesis of aseptic loosening. The purpose of current study was to identify the apoptotic mechanism of macrophages in the interface membrane of aseptic loosening. We collected periprosthetic interface membrane from 23 patients undergoing the revision operations for aseptic loosening of hip joint prostheses. To serve as the control group, samples of capsule were collected from 18 patients undergoing the primary hip arthroplasties for osteoarthritis (OA). The ultrastructure of interface membrane was examined by transmission electron microscopy (TEM), and in situ apoptotic macrophage identification was performed by TUNEL staining. Furthermore, using immunohistochemical methods we investigated the expression of some apoptosis-related markers such as inducible nitric oxide synthase (iNOS), peroxynitrite (ONOO(-)), cleaved caspase-3/4/8/9, cytochrome c, glucose regulated protein 78 (GRP78), and growth arrest and DNA damage-inducible gene 153 (GADD153) in macrophages. These markers were regarded as apoptotic inducers or specific indicators of different apoptotic pathways such as death receptor pathway, mitochondrial pathway and endoplasmic reticulum (ER) stress pathway. TEM showed that a great deal of wear debris was phagocytosed by macrophages, which displayed morphological changes characteristic of apoptosis. The results of TUNEL staining demonstrated that there were more apoptotic macrophages in interface membrane. The expression levels of iNOS, ONOO(-), cleaved caspase-3/4/8/9, cytochrome c, GRP78 and GADD153 in macrophages in interface membrane were significantly higher than those in the control samples (p < 0.05). Our results suggest that death receptor pathway, mitochondria/cytochrosome c caspase-dependent pathway and ER stress pathway are involved in the process of macrophage apoptosis. A

  20. Lupus vasculopathy: Diagnostic, pathogenetic and therapeutic considerations.

    PubMed

    Gonzalez-Suarez, M L; Waheed, A A; Andrews, D M; Ascherman, D P; Zeng, X; Nayer, A

    2014-04-01

    A rare form of vascular disease in systemic lupus erythematosus (SLE), lupus vasculopathy is characterized by necrosis and accumulation of immunoglobulins (IGs) and complements in the wall of arterioles and small arteries resulting in luminal narrowing. Lupus vasculopathy often accompanies lupus nephritis and portends a poor prognosis. Although there is general agreement on the treatment of lupus nephritis, effective treatment strategies for lupus vasculopathy remain to be defined. We report a 20-year-old woman with SLE who presented with generalized tonic-clonic seizure. Her immunosuppressive regimen consisted of mycophenolate mofetil, prednisone and hydroxychloroquine. On physical examination, she was Cushingoid in appearance and hypertensive. Laboratory tests indicated renal disease. Coagulation studies disclosed de novo lupus anticoagulant. Magnetic resonance imaging of the brain demonstrated acute focal cerebral hemorrhage. Echocardiography revealed reduced ejection fraction and severe mitral regurgitation. Despite high-dose glucocorticoids and mycophenolate mofetil, renal function remained poor. Kidney biopsy demonstrated lupus vasculopathy and glomerulonephritis. Plasma exchange therapy and intravenous cyclophosphamide were administered. Over the ensuing four weeks, renal function improved, complement levels increased, autoantibody titers decreased and lupus anticoagulant disappeared. In conclusion, lupus vasculopathy can occur in SLE despite a heavy immunosuppressive regimen. Antiphospholipid antibodies might be involved in the pathogenesis of lupus vasculopathy. Plasma exchange therapy in conjunction with intravenous cyclophosphamide may represent an effective treatment strategy for lupus vasculopathy.

  1. Lupus vasculopathy combined with acute renal failure in lupus nephritis.

    PubMed

    Wu, Chien-Te; Fu, Lin-Shien; Wen, Mei-Chin; Hung, Shein-Chung; Chi, Ching-Shiang

    2003-12-01

    Several risk factors have been associated with the prognosis of lupus nephritis. However, few studies have focused on renal vascular lesions (such as thrombi due to immune complexes) as a prognostic factor in this disease. Here we present a case of systemic lupus erythematosus (SLE) in a 12-year-old girl who exhibited acute renal failure and severe hypertension on admission. Renal pathology findings included diffuse proliferative glomerulonephritis (class IVb) and lupus vasculopathy (LV) with immune complex deposition within glomerular capillaries and the preglomerular arteriolar lumen. Her clinical condition deteriorated rapidly, even after cyclophosphamide and methylprednisolone pulse therapy. It improved after 5 days of plasmapheresis and remained stable for up to 6 months under regular treatment. We suggest that renal biopsy performed early in SLE patients with renal involvement should be studied carefully for the presence of vascular lesions. Additionally, plasmapheresis can be considered in patients with LV refractory to other modalities of therapy.

  2. The history of lupus erythematosus.

    PubMed

    Mallavarapu, Ravi K; Grimsley, Edwin W

    2007-09-01

    This article explores the history of lupus erythematosus from the origins of the name to the most modern therapeutic advances. The review includes information about the origin of the name "lupus," the first clear description of the skin lesions, the discovery of the systemic and discoid forms, and further advances which define our current view of this illness. The classical descriptions of Hippocrates, Paracelsus, Manardi, Rudolph Virchow, Cazenave, Robert Willan, and Moritz Kaposi are chronologically described. Later, the contributions of Sir William Osler, Jonathan Hutchinson, Sequira and Balean, Kraus and Bohac, Libman and Sacks, Malcolm Hargraves, and Edmund L. Dubois are highlighted. The major breakthroughs of the modern period, including the diagnostic tests, animal models, and genetics, are briefly described. The article ends with the history of drug-induced lupus, diagnostic criteria, and the history of the therapy of lupus erythematosus. With modern therapeutic advances, the mortality rate from lupus erythematosus has decreased substantially. It is hoped that current research will further improve the prognosis of this disease in the near future.

  3. Treatment of Cutaneous Lupus Erythematosus

    PubMed Central

    Kim, Grace K.; Del Rosso, James Q.

    2013-01-01

    The treatment of cutaneous lupus erythematosus is centered upon formulating a regimen of topical and systemic therapies designed to reduce disease activity and minimize cosmetic damage. Sun avoidance and sunscreen are important preventative measures proven to minimize cutaneous lupus erythematosus exacerbations. Limited disease is typically managed with topical corticosteroids or calcineurin inhibitors. Antimalarial therapy is the gold standard of systemic therapy. Many other treatments have been studied in patients with recalcitrant cutaneous lupus erythematosus, and their use must be evaluated based on individual risk-benefit concerns. R-salbutamol and pulsed dye laser therapy have proven to be effective topical alternatives. Additional systemic agents include retinoids, immunosuppressants, immunomodulators, biologics, and other experimental therapies with novel modes of action. According to the Oxford Centre for Evidence-based Medicine criteria for evaluating the strength of evidence supporting an individual treatment measure, no therapy for cutaneous lupus erythematosus has achieved Level 1 status. This demonstrates the need for randomized, controlled trials and systematic reviews of all cutaneous lupus erythematosus interventions in order to meet increasing standards and demand for evidence-based practice. PMID:23320123

  4. SIRT1 protects osteoblasts against particle-induced inflammatory responses and apoptosis in aseptic prosthesis loosening.

    PubMed

    Deng, Zhantao; Wang, Zhenheng; Jin, Jiewen; Wang, Yong; Bao, Nirong; Gao, Qian; Zhao, Jianning

    2017-02-01

    We hypothesized that SIRT1 downregulation in osteoblasts induced by wear particles was one of the reasons for particle-induced osteolysis (PIO) in total joint arthroplasty failure. In the present study, the expression of SIRT1 was examined in osteoblasts treated with TiAl6V4 particles (TiPs) and CoCrMo particles (CoPs) from materials used in prosthetics and specimens from PIO animal models. To address whether SIRT1 downregulation triggers inflammatory responses and apoptosis in osteoblasts, the effect of a SIRT1 activator, resveratrol on the expression of inflammatory cytokines and apoptosis in particle-treated osteoblasts was tested. The results demonstrated that SIRT1 expression was significantly downregulated in particle-treated osteoblasts and PIO animal models. Both pharmacological activation and overexpression of SIRT1 dramatically reduced the particle-induced expression of inflammatory cytokines and osteoblast apoptosis through NF-κB and p53 signaling, respectively. Furthermore, in PIO animal models, resveratrol significantly reduced the severity of osteolysis. Collectively, the results of the present study indicated that SIRT1 plays a vital role in the pathogenesis of aseptic loosening, and further treatment targeted at SIRT1 possibly lead to novel approaches for prevention of aseptic prosthesis loosening. Aseptic loosening is the most common cause of total hip arthroplasty (THA) and total knee arthroplasty (TKA) failure and revision surgery. However, there is still no effective therapeutic target in the clinical treatment. Besides, the underlying mechanism of aseptic loosening is largely unknown. The result of our study indicated that SIRT1 has the ability to effectively regulate the wear particle-induced inflammatory responses, apoptosis, osteolysis in particle-stimulated osteoblasts and particle-induced osteolysis animal models. Our study provides a potential target for the prevention and treatment of aseptic loosening and further investigated the

  5. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department.

    PubMed

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine.The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department.A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management.The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine.The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to viral agents or

  6. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  7. Lupus nephritis management guidelines compared.

    PubMed

    Wilhelmus, Suzanne; Bajema, Ingeborg M; Bertsias, George K; Boumpas, Dimitrios T; Gordon, Caroline; Lightstone, Liz; Tesar, Vladimir; Jayne, David R

    2016-06-01

    In the past years, many (randomized) trials have been performed comparing the treatment strategies for lupus nephritis. In 2012, these data were incorporated in six different guidelines for treating lupus nephritis. These guidelines are European, American and internationally based, with one separate guideline for children. They offer information on different aspects of the management of lupus nephritis including induction and maintenance treatment of the different histological classes, adjunctive treatment, monitoring of the patient, definitions of response and relapse, indications for (repeat) renal biopsy, and additional challenges such as the presence of vascular complications, the pregnant SLE patient, treatment in children and adolescents and considerations about end-stage renal disease and transplantation. In this review, we summarize the guidelines, determine the common ground between them, highlight the differences and discuss recent literature.

  8. Lupus pathobiology based on genomics.

    PubMed

    Saeed, Mohammad

    2017-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disorder with complex genetic underpinnings. This review attempts to assemble the myriad of genomic findings to build a clearer picture of the pathobiology of SLE to serve as a guide for therapeutics. Over 100 genes are now known for SLE, and several more penetrant ones have led to the emergence of more defined lupus phenotypes. Also discussed here are the targeted therapies that have come up on the horizon and the specific biologic mechanisms of more traditional therapies which have only recently been explored. The diagnostic toolbox has been enhanced by the addition of new antibodies, gene expression signatures, and mutation panels. This provides an opportunity to piece together the lupus puzzle and even revisit the clinical classification of SLE.

  9. Systemic lupus erythematosus.

    PubMed

    Kaul, Arvind; Gordon, Caroline; Crow, Mary K; Touma, Zahi; Urowitz, Murray B; van Vollenhoven, Ronald; Ruiz-Irastorza, Guillermo; Hughes, Graham

    2016-06-16

    Systemic lupus erythematosus (SLE) is an autoimmune disease that can affect many organs, including the skin, joints, the central nervous system and the kidneys. Women of childbearing age and certain racial groups are typically predisposed to developing the condition. Rare, inherited, single-gene complement deficiencies are strongly associated with SLE, but the disease is inherited in a polygenic manner in most patients. Genetic interactions with environmental factors, particularly UV light exposure, Epstein-Barr virus infection and hormonal factors, might initiate the disease, resulting in immune dysregulation at the level of cytokines, T cells, B cells and macrophages. Diagnosis is primarily clinical and remains challenging because of the heterogeneity of SLE. Classification criteria have aided clinical trials, but, despite this, only one drug (that is, belimumab) has been approved for use in SLE in the past 60 years. The 10-year mortality has improved and toxic adverse effects of older medications such as cyclophosphamide and glucocorticoids have been partially offset by newer drugs such as mycophenolate mofetil and glucocorticoid-sparing regimes. However, further improvements have been hampered by the adverse effects of renal and neuropsychiatric involvement and late diagnosis. Adding to this burden is the increased risk of premature cardiovascular disease in SLE together with the risk of infection made worse by immunosuppressive therapy. Challenges remain with treatment-resistant disease and symptoms such as fatigue. Newer therapies may bring hope of better outcomes, and the refinement to stem cell and genetic techniques might offer a cure in the future.

  10. Neonatal lupus erythematosus.

    PubMed

    Yokogawa, Naoto; Sumitomo, Naofumi; Miura, Masaru; Shibuya, Kazuhiko; Nagai, Hiroshi; Goto, Mikako; Murashima, Atsuko

    2017-01-01

      Neonatal lupus (NL), a passively-acquired autoimmune disease associated with maternal anti-SSA antibody, presents both cardiac manifestations such as cardiac NL and non-cardiac manifestations including rashes, cytopenia, and hepatic abnormalities. Cardiac NL, occurring in 1-2% of anti-SS-A antibody-positive mothers, is a life-threatening complication with a mortality rate of 20% and a pacemaker implantation rate of 70%. In contrast, cutaneous NL, which is more common than cardiac NL, usually resolves in six months. Since half of NL cases occur in asymptomatic mothers, if an infant presents characteristic cutaneous or cardiac manifestations of NL, the mother should be tested for anti-SS-A antibody. In mothers positive for anti-SS-A antibody, the risk of having a child with cardiac NL increases ten-fold and five-fold for a previous child with cardiac NL and cutaneous NL, respectively. A joint American, British, and French retrospective study of NL registries showed that hydroxychloroquine (HCQ) reduced the cardiac NL risk in subsequent pregnancies in mothers who previously had a child with cardiac NL. A prospective open-label study to confirm this effect is being undertaken in the USA. A similar prospective multi-center study will be undertaken in Japan. Establishing a Japanese registry of children with NL and subsequent pregnancies of their mothers will help promote clinical research in NL in Japan.

  11. Photosensitivity in lupus erythematosus.

    PubMed

    Kuhn, Annegret; Beissert, Stefan

    2005-11-01

    Lupus erythematosus (LE) is an autoimmune disease which can be triggered by environmental factors such as solar irradiation. It has long been observed that especially ultraviolet (UV) exposure can induce and exacerbate skin lesions in patients with this disease. However, despite the frequency of photosensitivity in LE, the mechanisms by which UV irradiation activates autoimmune responses is only now becoming increasingly unfolded by advanced molecular and cellular biological investigations. Phototesting, according to a standardized protocol with UVA and UVB irradiation has proven to be a valid model to study photosensitivity in various subtypes of LE and to evaluate the underlying pathomechanisms of this disease. Detailed analysis of the molecular events that govern lesion formation in experimentally photoprovoced LE showed increased accumulation of apoptotic keratinocytes and impaired expression of the inducible nitric oxide synthase (iNOS). In the near future, gene expression profiling and proteomics will further increase our knowledge on the complexity of the "UV response" in LE. This review summarizes the current understanding of the clinical and molecular mechanisms that initiate photosensitivity in this disease.

  12. Systemic Lupus Erythematosus and Pregnancy.

    PubMed

    Lateef, Aisha; Petri, Michelle

    2017-05-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease with a strong female predilection. Pregnancy remains a commonly encountered but high-risk situation in this setting. Both maternal and fetal mortality and morbidity are still significantly increased despite improvements in outcomes. Maternal morbidity includes higher risk of disease flares, preeclampsia and other pregnancy-related complications. Fetal issues include higher rates of preterm birth, intrauterine growth restriction, and neonatal lupus syndromes. Treatment options during pregnancy are also limited and maternal benefit has to be weighed against fetal risk. A coordinated approach, with close monitoring by a multidisciplinary team, is essential for optimal outcomes.

  13. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2014-10-29

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST. 2014 BMJ Publishing Group Ltd.

  14. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2015-12-01

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  15. Recurrence of ibuprofen-induced aseptic meningitis in an otherwise healthy patient.

    PubMed

    Pisani, E; Fattorello, C; Leotta, M R; Marcello, O; Zuliani, C

    1999-02-01

    We report the case of a 74-year-old woman who had three episodes of aseptic meningitis in a period of 20 years. These episodes always occurred a few hours after the assumption of a non-steroidal anti-inflammatory drug (NSAID) per os. Nevertheless, the pharmacological anamnesis did not receive proper attention, neither the first nor the second time, and the meningeal syndrome with aseptic liquor was attributed to a viral aggression. However, when the third episode occurred, due to the strict time correlation between the assumption of the drug and the occurrence of symptoms, both the results of the liquoral analysis and the anamnestic records allowed recognition of ibuprofen as the cause of acute meningitis.

  16. A survey of rotational use of biocides in hospital pharmacy aseptic units.

    PubMed

    Murtough, S M; Hiom, S J; Palmer, M; Russell, A D

    2002-03-01

    A postal survey of biocide rotation in UK hospital pharmacy aseptic units was carried out. Seventy per cent of respondents stated that biocides were rotated, most frequently in areas outside critical work zones. High-level disinfection was employed when 'aseptic' conditions were required. Decisions on frequency of rotation were most often based on in-house validation or consultation with colleagues. Toxicity and corrosiveness were the criteria rated most important in a rotation policy. Microbiological monitoring was carried out most frequently in critical work zones but less often for handwashing. Most QC hospital pharmacists supported rotation and would prefer a standard period for all applications (monthly). Guidelines need to be clarified to assist staff in decisions regarding biocide rotation. Copyright 2002 The Hospital Infection Society.

  17. Aseptic abscess syndrome associated with traveler's diarrhea after a trip to Malaysia.

    PubMed

    Panos, Zois; Giannopoulos, George; Papangeli, Eymorfia; Antalis, Emmanouil; Pavli, Androula; Spathis, Aris; Poulakou, Garyfalia; Dimitriadis, George; Panayiotides, Ioannis; Boumpas, Dimitrios; Tsiodras, Sotirios

    2016-01-01

    The first, to our knowledge, case of the aseptic abscesses syndrome as a complication of traveler's diarrhea after a trip to Malaysia is presented. The patient failed to respond to several antimicrobials. The diagnosis was histologically confirmed and the patient only responded to immunomodulatory therapy with corticosteroids and methotrexate. Travel physicians should be aware of this entity reviewed herein in the context of traveler's diarrhea.

  18. The thin blue line: a review and discussion of aseptic technique and postprocedural infections in rodents.

    PubMed

    Cooper, D M; McIver, R; Bianco, R

    2000-11-01

    A basic tenet of animal welfare philosophy is that pain and distress must be minimized whenever possible without interfering with the goals of the research. Aseptic technique during surgical procedures is essential to prevent pain and distress associated with post-procedural infections. However, many investigators have found that applying the aseptic techniques used for large animal and human surgery is not always practical when performing surgery on small rodents. Furthermore, the efficacy of some of these techniques for preventing post-procedural infections has been questioned. This review examines what is known about the development of postprocedural infections in animals and humans and the methods used to prevent them. Detection of postprocedural infections in rodents can be difficult unless objective measurements of physiologic indices are made. These measurements should be used experimentally to assess the relative benefits of various methods for preventing postprocedural infections. Measures of contamination, such as quantitative bacterial cultures, also can be used; however, they do not reliably predict infection rates. Much of the dogma about decontamination of skin and hair prior to surgery is not supported by valid experimental evidence. Hair removal may not be necessary. Alcohol may in fact be a better disinfectant than is often credited. Draping should be used when it contributes to the maintenance of the sterile field, but when it does not, modification of surgical technique may provide more protection from infection than the drape does. The contribution of surgical technique to the prevention of postprocedural infections is probably equal to that of aseptic technique. Further research needs to be done to assess various aseptic techniques for use in rodent surgery.

  19. Over-expression of p53/BAK in aseptic loosening after total hip replacement.

    PubMed

    Landgraeber, Stefan; Toetsch, Martin; Wedemeyer, Christian; Saxler, Guido; Tsokos, Michael; von Knoch, Fabian; Neuhäuser, Markus; Löer, Franz; von Knoch, Marius

    2006-05-01

    Particle-induced osteolysis is a major cause of aseptic loosening after total joint replacement. The possible induction of apoptosis has not been addressed in great detail. Thus far, it has been shown that ceramic and polyethylene particles can induce apoptosis of macrophages in vitro. The purpose of this study was to test the hypothesis that wears debris generated from total hip arthroplasty could induce cellular damage and apoptosis in vivo. We therefore determined by immunohistochemical methods if increased expression of p53, an important transcription factor, and BAK and Bcl-2, two important regulators of apoptosis, can be found in interface membranes and capsules of hips with aseptically loose implants. Strongly positive immunohistochemical staining for p53 and BAK was found in peri-implant tissues from patients with aseptic hip implant loosening. Differentiation of various cell types showed that macrophages stained positive for p53 in all capsule and interface specimens. p53 was frequently detected in giant cells. Positive staining of BAK in macrophages and giant cells was seen in all specimens. Some positive reactions were observed in fibroblasts, only two of 19 cases stained for p53 and three cases for BAK within synovial cells. Positive macrophages and giant cells were localized around polyethylene particles. While T-lymphocytes showed a regular BAK-staining, the other leukocytes were negative. Statistical analyses showed significant positive correlations (p < 0.001) between the presence of polyethylene and metal debris and the expression of BAK and p53. Polyethylene particles were surrounded by more positive macrophages and giant cells than were metal particles, indicating that polyethylene debris may be a stronger inductor of cell cycle arrest and apoptosis than metal debris. In this study apoptosis of macrophages, giant cells and T-lymphocytes in capsules and interface membranes of patients with aseptic hip implant loosening has been demonstrated in

  20. Detection of Leptospira DNA in Patients with Aseptic Meningitis by PCR

    PubMed Central

    Romero, Eliete C.; Billerbeck, Ana E. C.; Lando, Valéria S.; Camargo, Eide D.; Souza, Candida C.; Yasuda, Paulo H.

    1998-01-01

    Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively. PMID:9574730

  1. [Aseptic bone necroses as a late complication following successful treatment of leukemias and severe aplastic anemia].

    PubMed

    Slavc, I; Urban, C; Schwingshandl, J; Ritter, G; Trauner, R

    1987-01-01

    Aseptic bone necrosis is a well known complication after corticosteroid treatment in adults and several hundred cases have been reported. Alterations in fat metabolism with vascular occlusion due to fat embolization, as well as microtraumata and osteoporosis are discussed as etiologic factors. In contrast, aseptic bone necrosis in relation to corticosteroid treatment is rare in children and adolescents. We therefore report 3 patients, aged from 10 to 18 years, suffering from severe aplastic anemia, meningeal relapse after acute lymphocytic leukemia and acute myelocytic leukemia respectively, who developed aseptic bone necrosis 6, 11, and 20 months following the onset of corticoid therapy. The patients survive from 28+ to 50+ months after diagnosis of their initial hematologic disease, as it can be expected today for increasing numbers of patients. We therefore believe, that aseptic bone necrosis may represent a serious therapy related complication and suggest that, diagnostic examination in patients with suspicious complaints of the hip, shoulder or knee should also exclude the possibility of a bone necrosis after leucemic relapse has been ruled out. Since radiological changes only develop several weeks to months after the onset of the clinical symptoms and because of the disabling consequences for patients, misdiagnosed at the beginning, a 99 technetium bone scan should be done as early as possible. Corticosteroids, despite their serious side effects are still being considered as a important part of hematologic therapy and are not being omitted in the near future, so that the earliest possible diagnosis of bone necrosis will remain of great importance.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Behçet’s disease complicated by multiple aseptic abscesses of the liver and spleen

    PubMed Central

    Maeshima, Keisuke; Ishii, Koji; Inoue, Megumi; Himeno, Katsuro; Seike, Masataka

    2013-01-01

    Aseptic abscesses are an emergent entity and have been described in inflammatory bowel disease, especially in Crohn’s disease, and in other diseases. However, aseptic abscesses associated with Behçet’s disease are extremely rare. We report a Japanese male diagnosed with an incomplete type of Behçet’s disease who developed multiple aseptic abscesses of the spleen and liver. In 2002, the spleen abscesses were accompanied by paroxysmal oral aphthous ulcers and erythema nodosum. As the patient’s response to antibiotic treatment was inadequate, a splenectomy was performed. Severe inflammatory cell infiltration, largely of polymorphonuclear neutrophils, was observed without evidence of bacterial or fungal growth. Although the patient had no history of ocular symptoms or genital ulcers, a diagnosis of incomplete Behçet’s disease was made according to the Japanese diagnostic criteria because of the presence of paroxysmal arthritis and epididymitis since 2002. In 2005, multiple liver abscesses developed with right hypochondrial pain and seemed to be attributed to Behçet’s disease because the abscesses yielded negative results during a microbiologic investigation and failed to go into remission under antibiotic therapy. Oral prednisone (15 mg/d) was started in May 2006, and the abscesses dramatically disappeared 4 wk after treatment. Although the patient had a relapse of the liver abscesses in association with the tapering of prednisone, the augmentation of prednisone dosage yielded a response. The abscesses of the liver and spleen were strongly suggested to be attributed to Behçet’s disease. Clinician should be aware of the existence of aseptic abscesses as uncommon manifestations of Behçet’s disease. PMID:23717000

  3. Aseptic Handling of the MOMA Mass Spectrometer After Dry Heat Microbial Reduction

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2017-01-01

    Mars Organic Molecule Analyzer Mass Spectrometer (MOMA-MS) is an instrument in the larger MOMA instrument suite for the European Space Agency (ESA) ExoMars 2020 Rover. As a life-detection instrument on a Mars landing mission, MOMA-MS has very stringent Planetary Protection (PP) bioburden requirements. Within the MOMA instrument suite, the hardware surfaces of the sample path must be cleaned to a level of 0.03 spore/sq m. To meet this requirement, a process called Dry Heat Microbial Reduction (DHMR) is used to decrease the number of viable spores by 4 orders of magnitude. Before DHMR, the hardware is handled using standard cleanroom practices, while after DHMR, all sample path surfaces must be handled aseptically when exposed. Aseptic handling of the sample path involves a number of strategies and protocols including working only in an aseptic ISO class 5 work space, limiting the amount of time of exposure, using sterile garmenting with sterile gloves, and using sterile tools. Before work begins, the aseptic workspace will be tested for bioburden and particle fallout, and all tools that will contact sample path surfaces must be sterilized. During the exposure activity, sterile garments will be worn, sterile tools will be handled in a 2 person set up so that the operator touches only the sterile tool and not the exterior surfaces of the sterile pouch, and the environment will be monitored with active and passive fallout for bioburden and particle levels. Any breach in the planetary protection cleanliness can necessitate repeating DHMR, which not only has significant cost and schedule implications, it also become a risk to hardware that is not rated for repeated long exposures to high temperatures.

  4. Behçet's disease complicated by multiple aseptic abscesses of the liver and spleen.

    PubMed

    Maeshima, Keisuke; Ishii, Koji; Inoue, Megumi; Himeno, Katsuro; Seike, Masataka

    2013-05-28

    Aseptic abscesses are an emergent entity and have been described in inflammatory bowel disease, especially in Crohn's disease, and in other diseases. However, aseptic abscesses associated with Behçet's disease are extremely rare. We report a Japanese male diagnosed with an incomplete type of Behçet's disease who developed multiple aseptic abscesses of the spleen and liver. In 2002, the spleen abscesses were accompanied by paroxysmal oral aphthous ulcers and erythema nodosum. As the patient's response to antibiotic treatment was inadequate, a splenectomy was performed. Severe inflammatory cell infiltration, largely of polymorphonuclear neutrophils, was observed without evidence of bacterial or fungal growth. Although the patient had no history of ocular symptoms or genital ulcers, a diagnosis of incomplete Behçet's disease was made according to the Japanese diagnostic criteria because of the presence of paroxysmal arthritis and epididymitis since 2002. In 2005, multiple liver abscesses developed with right hypochondrial pain and seemed to be attributed to Behçet's disease because the abscesses yielded negative results during a microbiologic investigation and failed to go into remission under antibiotic therapy. Oral prednisone (15 mg/d) was started in May 2006, and the abscesses dramatically disappeared 4 wk after treatment. Although the patient had a relapse of the liver abscesses in association with the tapering of prednisone, the augmentation of prednisone dosage yielded a response. The abscesses of the liver and spleen were strongly suggested to be attributed to Behçet's disease. Clinician should be aware of the existence of aseptic abscesses as uncommon manifestations of Behçet's disease.

  5. Aseptic Bone Necrosis Among U.S. Navy Divers: Survey of 934 Nonrandomly Selected Personnel

    DTIC Science & Technology

    1977-06-01

    divers cannot be related to any specific index of diving activity, and may not be causally related to DCS. radiography dysbaric osteonecrosis ...other names, among them dysbaric osteonecrosis , caisson disease of bone, baro- traumatic arthropathy, and so forth.) For many years, the assumption was...underwater en- gineering group technical note 12. Davidson, J. K. 1976. Dysbaric osteonecrosis . Page 147, in J. K. Davidson, Ed. Aseptic necrosis of

  6. Chapter 6 Technology of Aseptic Cryoprotectant-Free Vitrification of Human ICSI Spermatozoa.

    PubMed

    Isachenko, Vladimir; Sanchez, Raul; Mallmann, Peter; Rahimi, Gohar; Isachenko, Evgenia

    2017-01-01

    The aim of this chapter was to describe the standardized aseptic technology of permeable cryoprotectant-free vitrification of human spermatozoa in capillaries (for ICSI or IVF in microvolume). Spermatozoa, vitrified by this technology, are free from seminal plasma owing to swim-up procedure preceding vitrification and are free from permeable cryoprotectants. They are ready for further use immediately after warming without any additional treatment.

  7. Risk of aseptic meningitis after measles, mumps, and rubella vaccine in UK children.

    PubMed

    Miller, E; Goldacre, M; Pugh, S; Colville, A; Farrington, P; Flower, A; Nash, J; MacFarlane, L; Tettmar, R

    1993-04-17

    Cases of aseptic meningitis associated with measles/mumps/rubella vaccine were sought in thirteen UK health districts following a reported cluster in Nottingham which suggested a risk of 1 in 4000 doses, substantially higher than previous estimates based on cases reported by paediatricians (4 per million). Cases were ascertained by obtaining vaccination records of children with aseptic meningitis diagnosed from cerebrospinal fluid samples submitted to Public Health Laboratories or discharged from hospital with a diagnosis of viral meningitis. Both methods identified vaccination 15-35 days before onset as a significant risk factor and therefore indicative of a causal association. With both, half the aseptic meningitis cases identified in children aged 12-24 months were vaccine-associated with onset 15-35 days after vaccine. The study confirmed that the true risk was substantially higher than suggested by case reports from paediatricians, probably about 1 in 11,000 doses. However, the possibility that the aseptic meningitis induced by vaccination was largely asymptomatic and a chance laboratory finding in children investigated for other clinical conditions, particularly febrile convulsions, could not be excluded. Comparison of national reports of virus-positive mumps meningitis cases before and after the introduction of this vaccine indicated that the risk from wild mumps was about 4-fold higher than from vaccine. Altogether, 28 vaccine-associated cases were identified, all in recipients of vaccines containing the Urabe mumps strain. The absence of cases in recipients of vaccine containing the Jeryl Lynn strain, despite its 14% market share, suggested a higher risk from Urabe vaccine. A prospective adverse event surveillance system using the study methods is currently being established to assess the risk, if any, from the Jeryl Lynn strain which is now the only mumps vaccine used in the UK.

  8. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis

    PubMed Central

    Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  9. Aseptic versus Sterile Acellular Dermal Matrices in Breast Reconstruction: An Updated Review

    PubMed Central

    Mendenhall, Shaun D.; Neumeister, Michael W.; Cederna, Paul S.; Momoh, Adeyiza O.

    2016-01-01

    Background: As the use of acellular dermal matrices in breast reconstruction has become more commonplace and efforts are made to improve on postoperative outcomes, the method of acellular dermal matrix (ADM) processing (aseptic versus sterile) has become a subject of interest. This article provides an updated overview of the critical aspects of ADM processing in addition to application of ADMs in single- and two-stage breast reconstruction, a review of the morbidity associated with ADM use, and alternatives. Methods: A literature review was performed in PubMed identifying recent systematic reviews, meta-analyses, and head-to-head comparisons on aseptically processed ADM and sterile-processed ADM in implant-based breast reconstruction. Results: Recent meta-analyses have shown a 2- to 3-fold increase in infections and tissue expander/implant explantation rates and a 3- to 4-fold increase in seroma formation compared with non-ADM reconstruction techniques. Comparisons of aseptic and sterile ADMs in multiple studies have shown no significant difference in infection rates and equivocal findings for other specific complications such as seroma formation. Conclusions: Current evidence on the impact of processing techniques that improve ADM sterility on postoperative morbidity in implant breast reconstruction is unclear. Deficiencies of the available data highlight the need for well-designed, multicenter, randomized controlled studies that will aid in optimizing outcomes in implant-based breast reconstruction. PMID:27536502

  10. Leptomeningeal contrast enhancement and blood-CSF barrier dysfunction in aseptic meningitis

    PubMed Central

    Eisele, Philipp; Ebert, Anne D.; Griebe, Martin; Engelhardt, Britta; Szabo, Kristina; Hennerici, Michael G.; Gass, Achim

    2015-01-01

    Objective: To investigate the blood-CSF barrier (BCSFB) dysfunction in aseptic meningitis. Methods: In our case series of 14 patients with acute aseptic meningitis, we compared MRI characteristics with CSF findings. Results: Contrast enhancement in the sulcal space in a leptomeningeal pattern was visualized in 7 patients with BCSFB dysfunction categorized as moderate to severe as evidenced by the CSF/serum albumin ratio (Qalb) but was not present in those with mild or no barrier disturbance (p = 0.001). The Qalb as a marker for the leakiness of the BCSFB and, more indirectly, of the blood-brain barrier (BBB) was positively correlated with the incidence of leptomeningeal contrast enhancement seen on postcontrast fluid-attenuated inversion recovery (FLAIR) MRI (p = 0.003). Patients with a more pronounced brain barrier dysfunction recovered more slowly and stayed longer in the hospital. Conclusions: The severity of meningeal BBB disturbance can be estimated on postcontrast FLAIR MRI, which may be of diagnostic value in patients with aseptic meningitis. PMID:26516629

  11. The neurochemical markers in cerebrospinal fluid to differentiate between aseptic and tuberculous meningitis.

    PubMed

    Qureshi, G A; Baig, S M; Bednar, I; Halawa, A; Parvez, S H

    1998-02-01

    In this study, the use of neurochemical markers in patients with aseptic and tuberculous meningitis has been investigated. The cerebrospinal fluid levels of amino acids, nitrite (a metabolite of nitric oxide), vitamin B12 and homocysteine were quantitated in both groups of patients. Among the amino acids, aspartic acid and glutamic acid both excitatory amino acid, GABA, glycine and tryptophan were all significantly increased in both patient groups whereas decreased level of taurine and increased level of phenylalanine were only found in patients with tuberculous meningitis. The levels of nitrite and its precursor arginine were significantly higher in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. A significantly increased homocysteine level and a decreased level of vitamin B12 were found only in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. This indicates that patients with tuberculous meningitis are particularly prone to vitamin B12 deficiency resulting into increased level of HC, and involvement of free radical showing the importance of these biological markers for promoting the possibility for the design of therapeutic approach.

  12. Varicella Zoster Aseptic Meningitis: Report of an Atypical Case and Literature Review

    PubMed Central

    Ibrahim, Walid; Elzouki, Abdel-Naser; Husain, Ahmed; Osman, Lubna

    2015-01-01

    Patient: Female, 15 Final Diagnosis: Varicella Zoster aseptic meningitis Symptoms: — Medication: — Clinical Procedure: Lumber punctur Specialty: Infectious Diseases Objective: Unusual clinical course Background: Neurologic complications can occur with varicella zoster virus (VZV) infection, usually after vesicular exanthem. A review of the literature revealed 3 cases of viral meningitis associated with 6th nerve palsy but without significantly increased intracranial pressure. Case Report: We report a case of a previously healthy 15-year-old girl with aseptic meningitis as a result of reactivated-VZV infection with symptoms of increased intracranial pressure and reversible 6th cranial nerve palsy but without exanthema. Diagnosis was made by detection of VZV-DNA in cerebrospinal fluid using polymerase chain reaction and documented high intracranial pressure. Full recovery was achieved after a course of acyclovir and acetazolamide. Conclusions: This case demonstrates that VZV may be considered in cases of aseptic meningitis in immunocompetent individuals, even without exanthema, and it may increase the intracranial pressure, leading to symptoms, and causing reversible neurological deficit. PMID:26342350

  13. Kotov collects samples from the Bioscience Experiment ASEPTIC (BTKh-39) in the MRM2 during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068654 (19 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, collects samples from the new bioscience experiment ASEPTIC (BTKh-39) in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  14. Kotov collects samples from the Bioscience Experiment ASEPTIC (BTKh-39) in the MRM2 during Joint Operations

    NASA Image and Video Library

    2010-02-19

    ISS022-E-068655 (19 Feb. 2010) --- Russian cosmonaut Oleg Kotov, Expedition 22 flight engineer, collects samples from the new bioscience experiment ASEPTIC (BTKh-39) in the Poisk Mini-Research Module 2 (MRM2) of the International Space Station.

  15. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-01-01

    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  16. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory.

    PubMed

    Neville, Michael W; Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-08-25

    To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students' aseptic technique at the conclusion of the semester. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos.

  17. Neonatal lupus syndromes.

    PubMed

    Buyon, J P; Rupel, A; Clancy, R M

    2004-01-01

    The neonatal lupus syndromes (NLS), while quite rare, carry significant mortality and morbidity in cases of cardiac manifestations. Although anti-SSA/Ro-SSB/La antibodies are detected in > 85% of mothers whose fetuses are identified with congenital heart block (CHB) in a structurally normal heart, when clinicians applied this testing to their pregnant patients, the risk for a woman with the candidate antibodies to have a child with CHB was at or below 1 in 50. While the precise pathogenic mechanism of antibody-mediated injury remains unknown, it is clear that the antibodies alone are insufficient to cause disease and fetal factors are likely contributory. In vivo and in vitro evidence supports a pathologic cascade involving apoptosis of cardiocytes, surface translocation of Ro and La antigens, binding of maternal autoantibodies, secretion of profibrosing factors (e.g., TGFbeta) from the scavenging macrophages and modulation of cardiac fibroblasts to a myofibroflast scarring phenotype. The spectrum of cardiac abnormalities continues to expand, with varying degrees of block identified in utero and reports of late onset cardiomyopathy (some of which display endocardial fibroelastosis). Moreover, there is now clear documentation that incomplete blocks (including those improving in utero with dexamethasone) can progress postnatally, despite the clearance of the maternal antibodies from the neonatal circulation. Better echocardiographic measurements which identify first degree block in utero may be the optimal means of approaching pregnant women at risk. Prophylactic therapies, including treatment with intravenous immunoglobulin, await larger trials. In order to achieve advances at both the bench and bedside, national research registries established in the US and Canada are critical.

  18. Neonatal lupus syndromes.

    PubMed

    Buyon, J P

    1994-09-01

    Neonatal lupus continues to generate considerable interest despite its rarity; more than 15 original contributions were made to the literature in the past year. Diverse aspects of this "syndrome" of passively acquired autoimmunity have been covered. Experiments using a rabbit model provided insights into the pathogenicity of maternal anti-Ro/SS-A and anti-La/SS-B antibodies. Perfusion of rabbit hearts with anti-Ro/SS-A and anti-La/SS-B sera resulted in conduction abnormalities in whole adult rabbit hearts and induced a reduction in the peak slow inward current in patch-clamp experiments of isolated rabbit ventricular myocytes, suggesting involvement of calcium channels. Clinical investigations are moving away from case reports, and recent studies now include substantial entries. Assuming that patients reported from the United States, Finland, and England are all separate, sera from at least 100 different mothers of infants with congenital heart block have been studied. Although there is apparently no serologic profile that is unique to mothers of affected children, compared with mothers of healthy children, anti-Ro/SS-A antibodies (anti-52-kD antibodies are more prevalent by immunoblot in congenital heart block, although all these sera are likely to have anti-60-kD antibodies by immunoprecipitation) are usually of high titer and associated with anti-La/SS-B antibodies. To date, the only maternal autoantibodies that have been associated with congenital heart block recognize Ro/SS-A or La/SS-B antigens. Mothers of affected infants are often asymptomatic, and when symptomatic, the clinical features are frequently characteristic of Sjögren's syndrome. Although treatment of affected fetuses with dexamethasone has successfully diminished associated effusions, there has been no report of reversal of established third-degree heart block.

  19. Dyslipidemia in systemic lupus erythematosus.

    PubMed

    Szabó, Melinda Zsuzsanna; Szodoray, Peter; Kiss, Emese

    2017-02-07

    Cardiovascular disease is one of the major causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE). Accelerated atherosclerosis is related to traditional (age, hypertension, diabetes mellitus, dyslipidemia, obesity, smoking, and positive family history) and non-traditional, disease-related factors. Traditional risk factors are still more prominent in patients with lupus, as both hypertension and hypercholesterinemia were independently associated with premature atherosclerosis in several SLE cohorts. In this work, the authors summarize the epidemiology of dyslipidemia in lupus patients and review the latest results in the pathogenesis of lipid abnormalities. The prevalence of dyslipidemia, with elevations in total cholesterol (TC), low-density lipoprotein (LDL), triglyceride (TG), and apolipoprotein B (ApoB), and a reduction in low-density lipoprotein (LDL) levels are about 30% at the diagnosis of SLE rising to 60% after 3 years. Multiple pathogenetic mechanism is included, C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) can suppress HDL and increase TG, auto-antibodies can cause the injury of the endothelium, lipoprotein lipase (LPL) activity can be reduced by circulating inflammatory mediators and antibodies, and increased oxidative stress may trigger a wide range of pro-atherogenic lipid modifications. As a major risk factor, dyslipidemia should be treated aggressively to minimize the risk of atherosclerosis and cardiovascular events. Randomized controlled trials with statins are controversial in the detention of atherosclerosis progression, but can be favorable by inhibiting immune activation that is the arterial wall and by decreasing lupus activity.

  20. [Systemic lupus erythematosus and pregnancy].

    PubMed

    Diniz-da-Costa, Teresa; Centeno, Mónica; Pinto, Luísa; Marques, Aurora; Mendes-Graça, Luís

    2012-01-01

    Systemic lupus erythematosus is a chronic inflammatory disease, resulting from an auto-immune dysfunction. The etiology of this disease is unknown. It frequently occurs in women of childbearing age. Pregnancy in patients with systemic lupus erythematosus may be associated with several complications (maternal, obstetrical and fetal). The prognosis for both mother and child is better when systemic lupus erythematosus has been quiescent for at least six months before pregnancy. Thus, preconceptional assessment and management is crucial for helping women to achieve a period of disease remission before pregnancy as well as for allowing an adjustment of therapy. Maternal health and fetal development should be closely monitored during pregnancy. These patients should be surveilled by a multidisciplinary team (obstetrician, rheumatologist or internist, nephrologist if necessary and a pediatrician), in a tertiary care hospital. Antiphospholipid syndrome, positivity for anti-SSA/Ro or anti-SSB/LA antibodies, hypertension or renal involvement are associated with an increase of adverse pregnancy outcomes. In this article the authors review the main aspects of Systemic lupus erythematosus (SLE) and pregnancy.

  1. Immunogenetics of cutaneous lupus erythematosus.

    PubMed

    Hersh, Aimee O; Arkin, Lisa M; Prahalad, Sampath

    2016-08-01

    Systemic lupus erythematosus (SLE) is the prototypic autoimmune condition, often affecting multiple organ systems, including the skin. Cutaneous lupus erythematosus (CLE) is distinct from SLE and may be skin limited or associated with systemic disease. Histopathologically, the hallmark of lupus-specific manifestations of SLE and CLE is an interface dermatitis. The cause of SLE and CLE is likely multifactorial and may include shared genetic factors. In this review, we will discuss the genetic findings related to the cutaneous manifestations of SLE and isolated CLE, with a particular focus on the lupus-specific CLE subtypes. Several major histocompatibility complex and nonmajor histocompatibility complex genetic polymorphisms have been identified which may contribute to the cutaneous manifestations of SLE and to CLE. Most of these genetic variants are associated with mechanisms attributed to the pathogenesis of SLE, including pathways involved in interferon and vitamin D regulation and ultraviolet light exposure. Although there is overlap between the genetic factors associated with SLE and CLE, there appear to be unique genetic factors specific for CLE. Improved understanding of the genetics of CLE may lead to the creation of targeted therapies, improving outcomes for patients with this challenging dermatologic condition.

  2. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.

    PubMed

    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2015-01-02

    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  3. Renal biopsy in patients with systemic lupus erythematosus: Not just lupus glomerulonephritis!

    PubMed

    Howell, David N

    2017-01-01

    Kidney biopsy is a mainstay in the diagnosis and management of renal disease in patients with systemic lupus erythematosus. Though biopsies from patients with lupus typically show various forms of immune complex glomerulonephritis, other pathologies are occasionally encountered, including unusual lupus-related nephropathies, other forms of autoimmune disease, and occasional renal disorders without any direct connection with lupus or autoimmunity. Electron microscopy is a powerful tool for detecting and classifying these unusual conditions, which frequently have important therapeutic and prognostic implications.

  4. Successful treatment of severe refractory lupus hepatitis with mycophenolate mofetil.

    PubMed

    Tagawa, Y; Saito, T; Takada, K; Kawahata, K; Kohsaka, H

    2016-04-01

    Systemic lupus erythematosus-related hepatitis, known as lupus hepatitis, is a rare manifestation of systemic lupus erythematosus, and is usually subclinical with mild abnormalities of serum liver enzymes. While cases with clinically significant and refractory lupus hepatitis are uncommon, treatment options for lupus hepatitis are to be established. Here, we report the case of a 45-year-old man with progressive lupus hepatitis accompanied by autoimmune haemolytic anaemia. Lupus hepatitis of this patient was refractory to tacrolimus, azathioprine and cyclophosphamide, but was successfully treated by mycophenolate mofetil. Mycophenolate mofetil might be an effective therapeutic option for refractory lupus hepatitis.

  5. Living Well with Lupus: Can I Still Plan a Pregnancy?

    MedlinePlus

    ... History of low platelets History of blood clots History or presence of antiphospholipid antibodies Planning Your Pregnancy Although many lupus pregnancies will have no complications, all lupus pregnancies ...

  6. Disseminated lupus vulgaris.

    PubMed

    Garg, Taru; Ramchander; Shrihar, Rashmi; Gupta, Tanvi Pal; Aggarwal, Shilpi

    2011-01-01

    follicular plugging and multiple epithelioid cell granulomas, rimmed by lymphocytes in the deeper portion of the dermis, mainly peri-appendageal. Stain for acid-fast bacteria was negative. Cultures from the skin lesions were negative. The patient was diagnosed as having lupus vulgaris with multiple lesions of varying morphology at different sites with pulmonary tuberculosis and healed lymph node involvement.

  7. Cutaneous lupus erythematosus: diagnosis and treatment.

    PubMed

    Okon, L G; Werth, V P

    2013-06-01

    Cutaneous lupus erythematosus (CLE) encompasses a wide range of dermatologic manifestations, which may or may not be associated with the development of systemic disease. Cutaneous lupus is divided into several sub-types, including acute CLE (ACLE), sub-acute CLE (SCLE) and chronic CLE (CCLE). CCLE includes discoid lupus erythematosus (DLE), LE profundus (LEP), chilblain cutaneous lupus and lupus tumidus. The diagnosis of these diseases requires proper classification of the sub-type, through a combination of physical examination, laboratory studies, histology, antibody serology and occasionally direct immunofluorescence, while ensuring to exclude systemic disease. The treatment of cutaneous lupus consists of patient education on proper sun protection along with appropriate topical and systemic agents. Systemic agents are indicated in cases of widespread, scarring or treatment-refractory disease. In this chapter, we discuss issues in classification and diagnosis of the various sub-types of CLE, as well as provide an update on therapeutic management.

  8. Breastfeeding in mothers with systemic lupus erythematosus.

    PubMed

    Noviani, M; Wasserman, S; Clowse, M E B

    2016-08-01

    Breastfeeding is known to improve the well-being of a mother and her infant, and about half of all new mothers breastfeed, but it is unknown how breastfeeding is pursued in systemic lupus erythematosus (SLE; lupus) patients. We sought to determine the rate of breastfeeding and the factors influencing this among women with lupus. In addition, we reassessed the current safety data in lactation of lupus medications. Data were collected from lupus patients enrolled in a prospective registry who fulfilled the 2012 SLICC criteria, had a live birth, and for whom postpartum breastfeeding status was known. Data included physician assessments of lupus activity and medications, breastfeeding intentions during pregnancy and practice following pregnancy. The safety of medications in breastfed infants was assessed through a comprehensive review of LactMed, a national database about medications in lactation. A total of 51 pregnancies in 84 women with lupus were included in the study. Half of the lupus patients (n = 25, 49%) chose to breastfeed. The rate of breastfeeding was not significantly affected by socioeconomic factors. In contrast, low postpartum lupus activity, term delivery, and a plan to breastfeed early in pregnancy were significantly associated with breastfeeding in lupus patients. In reviewing the most up-to-date data, the majority of lupus medications appear to have very minimal transfer into breast milk and are likely compatible with breastfeeding. Half of women with lupus breastfed and most desire to breastfeed. Hydroxychloroquine, azathioprine, methotrexate, and prednisone have very limited transfer into breast milk and may be continued while breastfeeding. © The Author(s) 2016.

  9. Lupus tumidus: a report of two cases*

    PubMed Central

    Bousquet Muylaert, Bianca Pinheiro; Braga, Bruna Backsmann; Esteves, Eduarda Braga; Garbelini, Luciana Elisa Barandas; Michalany, Alexandre Ozores; de Oliveira Filho, Jayme

    2016-01-01

    Lupus tumidus is considered a rare subtype of chronic cutaneous lupus erythematosus, characterized by erythema and bright urticarial erythematous-violaceous lesions that leave no scars after regression. Histopathology reveals perivascular and periannexal lymphohistiocytic infiltrates in the papillary and reticular dermis and interstitial mucin deposition. Treatment is based on photoprotection, topical corticosteroids and antimalarials. We report two cases of lupus tumidus, which deserve attention for their low frequency in the literature, in addition to their relevance as a differential diagnosis among dermatologic disorders.

  10. Renal infarction due to lupus vasculopathy.

    PubMed

    Varalaxmi, B; Sandeep, P; Sridhar, A V S S N; Raveendra, P; Kishore, C Krishna; Ram, R; Kumar, V Siva

    2015-08-01

    In the ISN/RPS 2003 classification of lupus nephritis (LN) renal vascular lesions are not mentioned. We present a patient with postpartum lupus vasculopathy. The renal biopsy in our patient showed concentric intimal thickening with narrowed lumen. No inflammatory changes were found. It also revealed immunoglobulin and complement deposition on the wall of the arteriole. These changes indicate lupus vasculopathy. The glomeruli revealed diffuse proliferative glomerulonephritis, with wire loops and cellular crescent in one glomerulus. The patient showed improvement with immunosuppression.

  11. Pulmonary neuroendocrine tumor in a female wolf (Canis lupus lupus)

    PubMed Central

    SHIRAKI, Ayako; YOSHIDA, Toshinori; KAWASHIMA, Masahi; MURAYAMA, Hirotada; NAGAHARA, Rei; ITO, Nanao; SHIBUTANI, Makoto

    2017-01-01

    A 17-year-old female wolf (Canis lupus lupus) had a right lung mass that was adhered to the thoracic cavity. Histopathological examination revealed that the mass consisted of sheets, cord or ribbon-like structures of monotonous, small, cuboidal cells with round, oval or short-spindle nuclei and scant clear cytoplasm, demarcated by a fine fibrovascular stroma. Focal necrosis, congestion and thrombi were observed. Immunohistochemically, the tumor cells diffusely expressed cytokeratin AE1/AE3, and some expressed chromogranin A, neural cell adhesion molecule (CD56) and thyroid transcription factor-1. The number of proliferating cell nuclear antigen-positive tumor cells was low. A diagnosis of pulmonary neuroendocrine tumor was based on the resemblance to carcinoids. PMID:28190820

  12. [Cutaneous lupus erythematosus induced by terbinafine].

    PubMed

    Møller, Maiken; Bygum, Anette

    2006-12-11

    Cutaneous lupus erythematosus can be induced or precipitated by a variety of drugs. Among the cutaneous variants of lupus, subacute cutaneous lupus erythematosus is the one most often associated with drug intake. The time lag between drug intake and skin eruption makes the clinical association less obvious, and the condition is often overlooked. We report on a 50-year-old woman with previously diagnosed systemic lupus erythematosus who had a severe cutaneous flare-up seven weeks after starting treatment with terbinafine for suspected onychomycosis.

  13. Sex differences in childhood lupus nephritis.

    PubMed

    Celermajer, D S; Thorner, P S; Baumal, R; Arbus, G S

    1984-06-01

    The renal status of 60 children (15 male and 45 female) with systemic lupus erythematosus seen over a 21-year period was evaluated clinically and by renal biopsy. The occurrence of serious clinical renal disease at initial observation, more severe renal impairment at outcome, and diffuse proliferative lupus nephritis were more common in male than in female patients. Although lupus is relatively uncommon in male subjects, our epidemiologic study shows that there is a sex difference in the severity of lupus nephritis, with male subjects being more severely affected than female subjects.

  14. Neurological Manifestations in Systemic Lupus Erythematosus: A Single Centre Study from North East India

    PubMed Central

    Kakati, Sanjeeb; Ahmed, Sobur U; Hussain, Masaraf

    2017-01-01

    Introduction Neurological manifestations although common in Systemic Lupus Erythematosus (SLE), are often not recognized due to their diversed and varied presentation. Therefore, the study was planned to highlight the pattern of neurological involvement in SLE to help in early recognition. Aim To study the pattern of neurological involvement in SLE and its correlation with disease activity and different investigation. Materials and Methods This hospital based prospective observational study was carried out from August 2009 to July 2010. Diagnosed cases of SLE [based upon American Rheumatism Association (ARA) criteria] who presented with neurological manifestations at the time of diagnosis or develop during the course of the disease were included in the study. They were assessed clinically and investigated with neuroimaging and neurophysiological tests as applicable. Results In total, 52 consecutive patients with SLE were evaluated, 92% were female. The most common age group was 21 to 25 years. Nervous system involvement was found in 19 (36.54%) patients. Cognitive impairment was the most frequent manifestation, present in 11 (57.89%) patients followed by seizure disorder in eight patients (42.1%). Peripheral neuropathy was diagnosed in eight (42.1%), acute confusional state in six (31.57%) and headache and depression was diagnosed in five (26.31%) patients each. Less common manifestations were psychosis, movement disorder and aseptic meningitis. Percentage of neurological manifestations directly correlated with disease activity. A significant difference was found in Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) score between the patients with Neuro Psychiatric Systemic Lupus Erythematosus (NPSLE) and those without NPSLE (32.42±16.34 Vs 17.3±10.6). Conclusion Neurological involvement in SLE is seen relatively early in the course of the disease with cognitive impairment being the most common manifestation and correlate with disease activity. PMID

  15. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    USGS Publications Warehouse

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  16. Growth and toxin production by Clostridium botulinum in steamed rice aseptically packed under modified atmosphere.

    PubMed

    Kasai, Yoshiaki; Kimura, Bon; Kawasaki, Susumu; Fukaya, Tetsuya; Sakuma, Kinya; Fujii, Tateo

    2005-05-01

    Sales and consumption of ready-to-eat aseptic steamed rice products have increased manyfold in Japan over the past 10 years. To determine the safety of steamed rice (water content 60%, pH 6.5) aseptically packaged under modified atmosphere, challenge studies were performed using a mixture of Clostridium botulinum proteolytic strains (five strains of type A and five strains of type B). Atmospheric conditions of 0 and 15% oxygen (with 5% CO2 and 5% N2 as the balance) were used. No neurotoxins were detected, and organoleptically acceptable conditions persisted for 24 weeks at 15% oxygen conditions. However, botulinum neurotoxin was found in one of three samples at 12 weeks and in one of two samples at 24 weeks at 0% oxygen and 30 degrees C. When samples were inoculated with C. botulinum with amylase (0% oxygen), neurotoxin and sample spoilage was detected after only 1 week of storage. Challenge studies using proteolytic strains of C. botulinum mixed with Bacillus subtilis (amylase formers) also were performed with atmosphere conditions of oxygen at 0, 5, 10, and 15% (with 5% CO2 and 5% N2 as the balance). Under 10 and 15% oxygen conditions, neurotoxin was not detected after 1 week of storage, but sample spoilage was detected after the same period. Under 0% oxygen conditions, neurotoxin was detected at 1 week, but the sample remained organoleptically acceptable even after 2 weeks of storage. Both neurotoxin and sample spoilage were detected at 1 week of storage under 5% oxygen conditions. Based on these results, cocontamination of amylase-producing Bacillus with C. botulinum would increase the risk of foodborne botulism when aseptic rice samples are packed under low-oxygen conditions (<5%). Therefore, to ensure the safety of these products, packing under atmospheric containing more than 10% oxygen is recommended.

  17. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    PubMed

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones.

  18. Persistent subcutaneous oedema and aseptic fatty tissue necrosis after using octenisept.

    PubMed

    Schupp, C J; Holland-Cunz, S

    2009-06-01

    Wound management and the prevention and treatment of tissue infections are part of daily routine. Octenisept (Schülke & Mayr), an antiseptic with a broad antimicrobiological effect, is widely used for various indications. This paper reports prolonged oedema and tissue swelling after treatment of deep wounds with Octenisept in three children. Three paediatric patients, aged between 2 months and 4 years, were treated with Octenisept in different hospitals. One initially presented with an abscess of the gluteal area, two with deep wounds of the cheek following injury with a wooden stick. The wounds were cleaned and washed out with Octenisept. Adequate drainage was in place at all times. COMMON FINDINGS: We observed aseptic, non painful subcutaneous tissue swelling and oedema in all three cases after wound lavage with Octenisept. This occurred shortly after the wound was initially treated and lasted for weeks until the symptoms slowly declined. It was not accompanied by persistent general infection parameters. A biopsy taken from one patient demonstrated an aseptic inflammatory reaction and oedema of the subcutaneous tissue, with partial tissue necrosis. Neither surgical revision nor antibiotic therapy brought any improvement. Retrospectively, one can consider these occurrences as a consequence of the use of Octenisept, since the changes are consistent with those described by Schülke & Mayr when Octenisept was accidentally administered by subcutaneous injection or under pressure to flush deep hand stab wounds that were not drained. The underlying pathobiological mechanism remains unclear. Hence, we recommend not to apply Octenisept in any wound cavity until further investigation has taken place. If aseptic fatty tissue necrosis and oedema develop after using Octenisept, further surgical intervention or antibiotic treatment will not give any benefit. Changes subside slowly. So far, adequate treatment is not available.

  19. Manifestations of Systemic Lupus Erythematosus

    PubMed Central

    COJOCARU, Manole; COJOCARU, Inimioara Mihaela; SILOSI, Isabela; VRABIE, Camelia Doina

    2011-01-01

    ABSTRACT Systemic lupus erythematosus (SLE) is a chronic, multifaceted autoimmune inflammatory disease that can affect any part of the body. SLE is a disease of unknown aetiology with a variety of presenting features and manifestations. Interest in the disease has been stimulated in recent years, and improved methods of diagnosis have resulted in a significant increase in the number of cases recognized. It is apparent that it can no longer be regarded as a rare disease. The majority of the pathology in SLE is related to deposits of immune complexes in various organs, which triggers complement and other mediators of inflammation. Symptoms vary from person to person, and may come and go, depend on what part of the body is affected, can be mild, moderate, or severe. Diagnosis can be difficult because lupus mimics many other diseases; it requires clinical and serologic criteria. PMID:22879850

  20. Somatic embryogenesis ofCyclamen persicum Mill. 'Anneke' from aseptic seedlings.

    PubMed

    Takamura, T; Miyajima, I; Matsuo, E

    1995-01-01

    InCyclamen persicum 'Anneke', explants from the various vegetative organs of aseptic seedling formed embryoids. The optimal responses were recorded in Murashige and Skoog (MS) medium enriched with 5.0µM 2,4-dichlorophenoxyacetic acid (2,4-D), 0.5µM kinetin and 3-6% sucrose. Embryogenesis was enhanced at higher temperature of 25-30°C. On the other hand, light inhibited embryogenesis. Histological and morphological studies confirmed that the embryoids were indeed somatic embryos.

  1. Aseptic addition method for Lactobacillus casei assay of folate activity in human serum

    PubMed Central

    Herbert, Victor

    1966-01-01

    An `aseptic addition' method is described for microbiological assay with Lactobacillis casei of folate activity in human serum. It has the following advantages over the previously reported `standard' method. 1 The manipulations involved in the assay are halved, by deleting autoclaving of serum in buffers. 2 The use of 1 g.% ascorbate better preserves serum folates than the lower amounts of ascorbate which are the maximum quantities usable in the standard methods. 3 Only 0·3 ml. of serum is required (0·1 ml. for one sample; 0·2 ml. for its duplicate). PMID:5904975

  2. Solvent effect in the polyethylene recovery from multilayer postconsumer aseptic packaging.

    PubMed

    Cervantes-Reyes, Alejandro; Núñez-Pineda, Alejandra; Barrera-Díaz, Carlos; Varela-Guerrero, Víctor; Martínez-Barrera, Gonzalo; Cuevas-Yañez, Erick

    2015-04-01

    Polyethylene films were separated and recovered from polyethylene-aluminum composites derived from recycling multilayer postconsumer aseptic packaging. A brief study about the separation process by dissolving PE-aluminum (PE-Al) composites into a series of organic solvents with a combination of time and temperature is presented. Through this procedure, 56% polyethylene is recovered from this kind of composites in optimized conditions. DSC and TGA studies were performed to determine the thermal stability of recovered polyethylene films and to establish a comparison with a PE reference commercial product, demonstrating that recovered polyethylene films kept their thermal properties. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. [Systemic lupus erythematosus during pregnancy].

    PubMed

    Christensen, H

    1996-01-22

    Systemic lupus erythematosus (SLE) is a connective tissue disease most commonly affecting women of a fertile age. It is recommended that pregnancy is planned during periods with remission or low activity of he disease because it seems that SLE is more likely to be exacerbated by pregnancy when the disease is active at the time of conception. Presence of circulating anti-phospholipid antibodies is associated with a poor prognostic outcome for the foetus and increases the risk of complications related to pregnancy.

  4. THE PROBLEM OF LUPUS ERYTHEMATOSUS

    PubMed Central

    Michelson, Henry E.

    1949-01-01

    Lupus erythematosus is a challenging disease. Progress in our knowledge of it will come only from intensive research, but in the meantime the practicing dermatologist must be on the alert to make his own observations, to follow current literature carefully and welcome new discoveries from any reliable source. The disease is not the sole property of dermatology; we should rejoice at the interest of pathologists and internists in this condition and work closely with them. PMID:18104714

  5. [Management of systemic lupus erythematosus].

    PubMed

    Aringer, M; Schneider, M

    2016-11-01

    In the last few decades a number of small, often largely unrecognized steps have fundamentally changed the management of systemic lupus erythematosus (SLE). The current goal is to stop all disease activity without long-term use of more than 5 mg prednisolone per day. Remission, i.e. absence of activity in the SLE activity score of choice, is the defined target in the treat to target approach. The essential basic measures include life-long hydroxychloroquine as well as protection from sunlight (UV) and vitamin D substitution. Patients suffering from SLE need more vaccinations than the healthy population and control of risk factors for atherosclerosis is critical for long-term survival. Methotrexate is on par with azathioprine. If disease activity cannot be controlled in this way, belimumab is an approved therapeutic option. Cyclophosphamide is still used but only in life-threatening situations, such as lupus nephritis or central nervous system (CNS) vasculitis and in drastically reduced doses. Alternatively, off-label mycophenolate mofetil (MMF) can be used particularly for lupus nephritis and off-label rituximab in refractory disease courses. Numerous novel approaches are being tested in controlled trials and it is hoped that new drugs will be available for SLE patients within a few years.

  6. Pathophysiology of cutaneous lupus erythematosus.

    PubMed

    Lin, Julie H; Dutz, Jan P; Sontheimer, Richard D; Werth, Victoria P

    2007-10-01

    Cutaneous lupus erythematosus (LE; syn LE-specific skin disease) is an autoimmune disease with well-defined skin manifestations often accentuated in a photodistribution and frequently associated with specific autoantibodies. These clinical observations have led to numerous laboratory studies related to the role of ultraviolet light, as well as studies of the cascade of immunologic events involved in the pathogenesis of cutaneous LE. We discuss the epidemiologic, clinical, and laboratory findings of cutaneous LE, including the classification of disease subsets. We review the evidence for abnormal photoreactivity in LE with an overview of the cellular, molecular, and genetic factors that may underlie this abnormality. As there is yet no convincing animal model of cutaneous LE, many studies remain descriptive in nature. To arrive at an understanding of the potential mechanisms underlying the development of cutaneous lupus, we discuss the role of ultraviolet light-mediated induction of apoptosis, antigen presentation, genetic factors, and mediators of inflammation. In addition, we consider the role and importance of humoral and cellular factors, synthesizing the current understanding of the pathophysiology of cutaneous lupus.

  7. Infections and systemic lupus erythematosus

    PubMed Central

    Skare, Thelma Larocca; Dagostini, Jéssica Scherer; Zanardi, Patricia Imai; Nisihara, Renato Mitsunori

    2016-01-01

    ABSTRACT Objective To determine the incidence of infections in a population of systemic lupus erythematosus individuals and the characteristics of infections regarding original site, as well as to study the possible associations between infections and treatment. Methods An analytical retrospective study using data from medical charts of systemic lupus erythematosus patients from a single university hospital. A total of 144 patients followed up for five years were included. Data collected comprised age of patients and age at onset of lupus, sex and ethnicity, disease duration before the study period, medications, cumulative dose of prednisone, occurrence of infections and their original site. Results The most frequent infections were urinary tract infections (correlated to use of prednisone − p<0.0001 and cyclophosphamide − p=0.045), upper airways infections (correlated to use of prednisone − p=0.0004, mycophenolate mofetil − p=0.0005, and cyclosporine − p=0.025), and pneumonia (associated to prednisone − p=0.017). Conclusion Prednisone was the drug more often associated with presence of infections, pointing to the need for a more judicious management of this drug. PMID:27074234

  8. Sporotrichoid lupus vulgaris: A rare presentation.

    PubMed

    Maheshwari, Anshul; Tiwari, Siddhi; Mathur, Deepak K; Bhargava, Puneet

    2015-01-01

    Lupus vulgaris is the most common presentation of cutaneous tuberculosis in India and can present as papular, nodular, plaque, ulcerative, vegetating, and tumid forms. Unusual variants include the frambesiform, gangrenous, ulcerovegetating, lichen simplex chronicus, myxomatous, and sporotrichoid types. We describe a rare sporotrichoid presentation of lupus vulgaris on the leg of a 28-year-old female of 12 years duration.

  9. Sporotrichoid lupus vulgaris: A rare presentation

    PubMed Central

    Maheshwari, Anshul; Tiwari, Siddhi; Mathur, Deepak K.; Bhargava, Puneet

    2015-01-01

    Lupus vulgaris is the most common presentation of cutaneous tuberculosis in India and can present as papular, nodular, plaque, ulcerative, vegetating, and tumid forms. Unusual variants include the frambesiform, gangrenous, ulcerovegetating, lichen simplex chronicus, myxomatous, and sporotrichoid types. We describe a rare sporotrichoid presentation of lupus vulgaris on the leg of a 28-year-old female of 12 years duration. PMID:25821736

  10. Drug-induced subacute cutaneous lupus erythematosus.

    PubMed

    Callen, J P

    2010-08-01

    Subacute cutaneous lupus erythematosus (SCLE) is a subset of cutaneous lupus erythematosus with unique immunologic and clinical features. The first description dates back to 1985 when a series of five patients were found to have hydrochlorothiazide-induced SCLE. Since that time, at least 40 other drugs have been implicated in the induction of SCLE.

  11. Low Level of Haptoglobin in Lupus

    PubMed Central

    Timlin, Homa; Machireddy, Kirthi; Petri, Michelle

    2017-01-01

    Haptoglobin levels are measured in systematic lupus erythematosus patients as part of the workup for anemia, with low levels indicating hemolysis. Haptoglobin is an acute phase protein. We present 2 lupus patients who were found to have low haptoglobin levels in the absence of other evidence of hemolysis. PMID:28203576

  12. Acute transverse myelopathy complicating systemic lupus erythematosus.

    PubMed Central

    Propper, D J; Bucknall, R C

    1989-01-01

    A sixteen year old girl with systemic lupus erythematosus developed acute transverse myelopathy. She was treated with high dose steroids, cyclophosphamide, and plasma exchange and regained partial neurological function. Previous descriptions of transverse myelopathy complicating systemic lupus erythematosus are reviewed, with particular reference to the efficacy of high dose steroid treatment. PMID:2662918

  13. Discoid lupus erythematosus presenting as unilateral blepharitis.

    PubMed

    Au, Leon

    2006-01-01

    A 39-year-old man presented with a 4-month history of unilateral blepharitis that did not respond to conventional treatment. Punch biopsy confirmed the diagnosis of discoid lupus erythematosus. Unilateral blepharitis as the only presenting sign of discoid lupus erythematosus is uncommon but should be considered in the differential diagnosis in patients with asymmetric blepharitis.

  14. Lupus update: perspective and clinical pearls.

    PubMed

    Manzi, Susan

    2009-02-01

    Patients with systemic lupus erythematosus (SLE, lupus) have a markedly better survival rate today than they did 50 years ago, but they face a greater risk of cancer, cardiovascular disease, and osteoporosis at early ages. With better understanding of the immunological mechanisms of the disease, new avenues of therapy are emerging.

  15. Subacute Cutaneous Lupus Erythematosus Presenting as Erythroderma

    PubMed Central

    Pai, Varadraj V; Naveen, KN; Athanikar, SB; Dinesh, US; Reshme, Priyanka; Divyashree, RA

    2014-01-01

    Subacute cutaneous lupus erythematosus (SCLE) is a type of lupus erythematosus having distinct characteristic clinical, serologic, and genetic features. Other than the commonly occurring papulosquamous and annular polycyclic lesion, rarely it may present as erythema multiformae, toxic epidermo necrolysis like lesion (Rowell syndrome), erythroderma, and generalized poikiloderma. Herein, we report a case of SCLE presenting as erythroderma. PMID:25484433

  16. Outbreak of aseptic meningitis by echo 4: prevalence of clinical cases among adults.

    PubMed

    Portolani, M; Pecorari, M; Pietrosemoli, P; Bartoletti, A; Sabbatini, A M; Meacci, M; Gennari, W; Bazzani, E; Beretti, F; Guaraldi, G

    2001-01-01

    Twenty five cases of meningitis occurred in urban areas surrounding a city (Modena) in Northern Italy, in the period May-July 1999. When the patients were admitted to the Infectious Diseases Division of the University of Modena and Reggio Emilia Hospital and studied by virological and serological methods, the meningitis proved to have an enteroviral origin and enterovirus ECHO 4 type was responsible for all cases of illness. An epidemiological characteristic of the enteroviral meninigitis outbreak was the adult age in 23 out of the 25 patients (mean age 24.50 +/- 7.84 years). The monthly distribution of the aseptic meningitis cases was the following: five cases occurred in May, 13 in June and seven in July. The origin of the spread of the virus infection and the reason for its sudden end remained unknown. The unusual drop in temperature which occurred in the geographic area involved in the aseptic meningitis outbreak at the beginning of August could have interfered with the slowdown in virus circulation.

  17. Factors affecting aseptic loosening of 4750 total hip arthroplasties: multivariate survival analysis

    PubMed Central

    Bordini, Barbara; Stea, Susanna; De Clerico, Manuela; Strazzari, Sergio; Sasdelli, Antonio; Toni, Aldo

    2007-01-01

    Background Total hip arthroplasty is a successful surgery, that fails at a rate of approximately 10% at ten years from surgery. Causes for failure are mainly aseptic loosening of one or both components partially due to wear of articular surfaces and partially to design. The present analysis aimed to identify risk factors and quantify their effects on aseptic failure. Methods Multivariate survival analysis was applied to 4,750 primary total hip arthroplasties performed between 1995 and 2000. Results The survival of the prosthesis is affected by gender, age, pathology, type of the prosthesis and skill of the. The worst conditions are male patients, younger than 40 years, affected by sequelae of congenital diseases, operated by a who performed less than 400 total hip artroplasty in the period. Furthermore, cemented cups and stems (less expensive) have a higher risk of failure compared with uncemented ones (more expensive). Conclusion The only variable that affects survival and that can be modified by is the type of prosthesis: a lower cost is associated to a higher risk. Results concerning the risk associated with cemented components are partially in disagreement with studies performed in countries where cemented prostheses are used more often than uncemented ones. PMID:17650301

  18. Aseptic Culture Systems of Radopholus similis for In Vitro Assays on Musa spp. and Arabidopsis thaliana.

    PubMed

    Elsen, A; Lens, K; Nguyet, D T; Broos, S; Stoffelen, R; De Waele, D

    2001-06-01

    Radopholus similis is one of the most damaging nematodes in bananas. Chemical control is currently the most-used method, but nematode control through genetic improvement is widely encouraged. The objective of this study was to establish an aseptic culture system for R. similis and determine whether R. similis can infect and reproduce on in vitro banana plantlets and in vitro Arabidopsis thaliana. In the study's first part, a suitable aseptic culture system was developed using alfalfa callus. Radopholus similis could penetrate and reproduce in the callus. Six weeks after inoculation with 25 females, the reproduction ratio was 26.3 and all vermiform stages were present. The reproduction ratio increased to 223.2 after 12 weeks. Results of a greenhouse test showed that R. similis did not lose its pathogenicity after culturing on alfalfa callus. In the study's second part, the infection and reproduction of the nematodes cultured on the callus were studied on both in vitro banana plantlets and A. thaliana. Radopholus similis infected and reproduced on both banana and A. thaliana. Furthermore, nematode damage was observed in the root systems of both hosts. These successful infections open new perspectives for rapid in vitro screening for resistance in banana cultivars and anti-nematode proteins expressed in A. thaliana.

  19. Intravenous Immunoglobulin with Enhanced Polyspecificity Improves Survival in Experimental Sepsis and Aseptic Systemic Inflammatory Response Syndromes

    PubMed Central

    Djoumerska-Alexieva, Iglika; Roumenina, Lubka; Pashov, Anastas; Dimitrov, Jordan; Hadzhieva, Maya; Lindig, Sandro; Voynova, Elisaveta; Dimitrova, Petya; Ivanovska, Nina; Bockmeyer, Clemens; Stefanova, Zvetanka; Fitting, Catherine; Bläss, Markus; Claus, Ralf; von Gunten, Stephan; Kaveri, Srini; Cavaillon, Jean-Marc; Bauer, Michael; Vassilev, Tchavdar

    2015-01-01

    Sepsis is a major cause for death worldwide. Numerous interventional trials with agents neutralizing single proinflammatory mediators have failed to improve survival in sepsis and aseptic systemic inflammatory response syndromes. This failure could be explained by the widespread gene expression dysregulation known as “genomic storm” in these patients. A multifunctional polyspecific therapeutic agent might be needed to thwart the effects of this storm. Licensed pooled intravenous immunoglobulin preparations seemed to be a promising candidate, but they have also failed in their present form to prevent sepsis-related death. We report here the protective effect of a single dose of intravenous immunoglobulin preparations with additionally enhanced polyspecificity in three models of sepsis and aseptic systemic inflammation. The modification of the pooled immunoglobulin G molecules by exposure to ferrous ions resulted in their newly acquired ability to bind some proinflammatory molecules, complement components and endogenous “danger” signals. The improved survival in endotoxemia was associated with serum levels of proinflammatory cytokines, diminished complement consumption and normalization of the coagulation time. We suggest that intravenous immunoglobulin preparations with additionally enhanced polyspecificity have a clinical potential in sepsis and related systemic inflammatory syndromes. PMID:26701312

  20. Large artery inflammation in systemic lupus erythematosus.

    PubMed

    Sokalski, D G; Copsey Spring, T R; Roberts, W N

    2013-08-01

    A 23-year-old African-American woman with a history of recurrent pneumonias presented to the hospital with 2 weeks of shortness of breath, chest pain, fevers, and lightheadedness. The histologic diagnosis proved to be lupus aortitis. Optimal Framingham risk factor management by itself may not be a completely successful approach in diminishing the extra risk of atherosclerosis conferred by systemic lupus erythematosus (SLE). Therefore it remains possible that important modifiable cardiovascular risk factors may include low-grade SLE disease activity in medium-sized vessels. The implication of the idea that subclinical vessel inflammation is widespread in patients with lupus-and that this inflammation confers a significant part of the patients' risk of accelerated atherosclerosis-might be a lowering of the threshold for aggressive disease-modifying treatment of lupus, essentially a "treat-to-target" approach to systemic lupus.

  1. Lupus vulgaris with squamous cell carcinoma.

    PubMed

    Motswaledi, Mojakgomo Hendrick; Doman, Chantal

    2007-12-01

    Tuberculosis is still a significant problem in developing countries. Cutaneous forms of tuberculosis account for approximately 10% of all cases of extrapulmonary tuberculosis. Cutaneous tuberculosis may be because of true infection with Mycobacterium tuberculosis or because of tuberculids. Tuberculids are immunological reactions to haematogenously spread antigenic components of M. tuberculosis. True cutaneous tuberculosis may be because of inoculation or haematogenous spread of M. tuberculosis to the skin. Lupus vulgaris is the commonest form of true cutaneous tuberculosis. Other forms of true cutaneous tuberculosis are tuberculous chancre, tuberculosis verrucosa cutis, scrofuloderma, periorificial tuberculosis and miliary tuberculosis of the skin. Lupus vulgaris is usually chronic and progressive. It occurs in patients with moderate to high immunity against M. tuberculosis as evidenced by strongly positive tuberculin test. Long-standing cases of lupus vulgaris may be complicated by squamous cell carcinoma (SCC). We describe a patient who had undiagnosed lupus vulgaris for 35 years until she developed SCC on the lesion of lupus vulgaris.

  2. Lupus mastitis - peculiar radiological and pathological features

    PubMed Central

    Wani, Abdul Majid; Hussain, Waleed Mohd; Fatani, Mohamed I; Shakour, Bothaina Abdul

    2009-01-01

    Lupus mastitis is a form of lupus profundus that is seen in patients with systemic lupus erythematosus. It usually presents as a swelling (or swellings) in the breasts, with or without pain. The condition is recurrent and progresses along with the underlying disease, with fat necrosis, calcification, fibrosis, scarring, and breast atrophy. Lupus mastitis is often confused with malignancy and lymphoma and, in our part of the world, with tuberculosis. Confusion is especially likely when it occurs in an unusual clinical setting. In this article, we present a case that presented with unique radiological, pathological, and clinical features. Awareness of the various manifestations of lupus mastitis is essential if unnecessary interventions such as biopsies and surgeries, and their consequences, are to be avoided. PMID:19881078

  3. Patient satisfaction and functional status after aseptic versus septic revision total knee arthroplasty using the PROSTALAC articulating spacer.

    PubMed

    Meek, R M Dominic; Dunlop, David; Garbuz, Donald S; McGraw, Robert; Greidanus, Nelson V; Masri, Bassam A

    2004-10-01

    This study compared the functional results of an articulating antibiotic spacer for 2-stage revision knee arthroplasty for infection, to the functional results of aseptic revision. One hundred twenty-five patients who underwent revision of total knee arthroplasty for infection and aseptic loosening were identified. All of the patients with infection were treated with the PROSTALAC system (DePuy). At a minimum 2-year follow-up, WOMAC, Oxford-12, SF-12, patient satisfaction data, Harris Hip Score knee scores, and range of motion were assessed. The 2 cohorts (4 deaths in total, leaving 54 septic, 57 aseptic) were equivalent for age, gender, and comorbidity scores. At a mean of 41 months, none of the outcomes were significantly worse for the septic group, which had 2 recurrences of infection (4%). The satisfactory functional results of the PROSTALAC system may be related to the design features.

  4. Subacute cutaneous lupus erythematosus starting as linear lupus erythematosus.

    PubMed

    Frances, Laura; Betlloch, Isabel; Leiva-Salinas, Maria; Marin, Irene; Pascual, Jose Carlos

    2016-02-01

    Cutaneous lupus in childhood is usually associated with systemic lupus erythematosus (LE). Linear cutaneous LE (LCLE) is an unusual presentation mostly seen in children and young adults. We report a rare case of cutaneous subacute LE with a segmentary pattern following the lines of Blaschko in an 18-month-old girl with a 2-month history of persistent, linear, asymptomatic, erythematous lesions along the right arm. The clinical diagnosis at presentation was lichen striatus. A biopsy showed an intense, band-like, inflammatory cell infiltrate with perivascular and periadnexal involvement associated with basal cell liquefactive degeneration. The lesions were treated with topical corticosteroids and healed without scarring. Two months later, new lesions manifested as multiple erythematous, edematous, polycyclic plaques. A new biopsy showed a periadnexal infiltrate, a large amount of mucin, and a thickened basement membrane. Direct immunofluorescence was negative. Our definitive diagnosis was subacute cutaneous LE starting as linear LE. The lesions responded slowly to oral corticosteroids. Six months later, only a mild livedoid skin pattern remained on the patient's legs. Linear cutaneous LE usually presents with erythematous, atrophic, hyperkeratotic, dyschromic circular lesions arranged in a linear pattern; the main differential diagnosis is lichen striatum. In general, LCLE can be considered as discoid lupus following Blaschko's lines, which correspond to the direction of growth in clones of cutaneous cells that arise during embryogenesis. The present patient represents the first pediatric case of subacute cutaneous LE following Blaschko's lines, with posterior progression to a generalized form of subacute LE. © 2015 The International Society of Dermatology.

  5. Validation of the LupusPRO in Chinese patients from Hong Kong with systemic lupus erythematosus.

    PubMed

    Mok, Chi Chiu; Kosinski, Mark; Ho, Ling Yin; Chan, Kar Li; Jolly, Meenakshi

    2015-02-01

    LupusPRO is a disease-targeted, patient-reported outcome (PRO) measure that was developed and validated for assessment of quality of life in US patients with systemic lupus erythematosus (SLE). We present results of adapting the LupusPRO into Chinese and testing its psychometric properties in Chinese patients with SLE. LupusPRO was translated into "traditional" Chinese, followed by pretesting among native Cantonese Chinese speakers. The translation version was revised based on the feedback obtained. The Chinese language LupusPRO tool was administered along with a generic PRO tool (the Short Form 36 health survey [SF-36]) to ethnic Chinese SLE patients. At the same time, demographic information, clinical data, disease activity (Safety of Estrogens in Lupus Erythematosus National Assessment [SELENA] version of the Systemic Lupus Erythematosus Disease Activity Index [SLEDAI]), and damage (Systemic Lupus International Collaborating Clinics/American College of Rheumatology Damage Index [SDI]) were obtained. We performed confirmatory factor analysis of the Chinese LupusPRO and evaluated internal consistency reliability, as well as convergent and criterion validity. Among the 463 SLE patients (95% women) with a mean ± SD age of 42.3 ± 13.5 years, the mean ± SD physician global assessment score was 0.48 ± 0.45, the mean ± SD SELENA-SLEDAI score was 2.9 ± 3.0, and the mean ± SD SDI score was 0.7 ± 1.2. Results of factor analysis conformed to the original LupusPRO model with only minor modifications. The reliability of the LupusPRO domains ranged from 0.60-0.94. LupusPRO domains had correlations as expected with the corresponding SF-36 domains. A significant but weak correlation with disease activity was noted for criterion validity as expected. The Chinese language LupusPRO has fair psychometric properties and may be used in SLE clinical trials. Copyright © 2015 by the American College of Rheumatology.

  6. Circulating biomarkers for discrimination between aseptic joint failure, low-grade infection, and high-grade septic failure.

    PubMed

    Ettinger, Max; Calliess, Tilman; Kielstein, Jan T; Sibai, Jasmin; Brückner, Thomas; Lichtinghagen, Ralf; Windhagen, Henning; Lukasz, Alexander

    2015-08-01

    Late-onset chronic (low-grade) periprosthetic joint infections are often accompanied by unspecific symptoms, false-negative cultures or nonspecific low values of serum biomarkers. This may lead to the unintended implantation of a revision prosthesis into an infected surgical site with the risk of short-term failure developing again. Conversely, false diagnosis of joint infection may result in multistage revision procedures, which expose the patient to unnecessary surgical procedures and inappropriate antibiotic treatment. Here, we investigated whether circulating biomarkers can preoperatively distinguish between aseptic prosthesis loosening and low-grade joint infection, and which biomarker combinations are most accurate. Inclusion criteria for the study were indication for revision arthroplasty due to aseptic implant failure, acute high-grade infection, or (suspected) low-grade infection. C-reactive protein (CRP), procalcitonin, tumor necrosis factor α, interleukin 6 (IL-6), interleukin 10, and lipopolysaccharide binding protein were assessed preoperatively in the serum of 98 adult patients. The classification tree method revealed IL-6 and CRP as the most suitable biomarker combination for the discrimination of aseptic loosening vs low-grade joint infection. The combination of IL-6 >5.12 pg/mL and CRP >0.3 mg/dL correctly identified 15 of 16 patients as having low-grade infection (94%) whereas just one patient was aseptic (6%). This is the first comprehensive prospective clinical study to our knowledge investigating the significance of a combined biomarker approach in differentiating between aseptic prosthesis loosening and low-grade joint infection. CRP plus IL-6 seems to be the most helpful combination for preoperative discrimination of aseptic loosening vs low-grade joint infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    PubMed

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  8. Vascular lesions in lupus nephritis.

    PubMed

    Grishman, E; Venkataseshan, V S

    1988-05-01

    Three groups of kidney specimens from patients with systemic lupus erythematosus (SLE) were examined for histologic evidence of vascular lesions in small arteries and arterioles. Group 1 consisted of 24 autopsy kidneys from patients who died before the advent of steroid therapy, and Group 2, of 26 more recent autopsy specimens from patients treated with steroids and/or immunosuppressive drugs. Group 3 comprised 276 renal biopsies. Group 1 showed characteristic subendothelial eosinophilic deposits in small arteries and arterioles of 8 cases; Group 2 showed similar lesions in 5 specimens, while 3 others revealed evidence of resorption of deposits. Deposits were characterized by clumping and were delimited toward the media by a thick basement membrane. Only one case showed necrotizing arteritis resembling polyarteritis nodosa. Group 3 presented vascular deposits in 19 cases and thrombotic microangiopathy in 2. Electron microscopic appearance of some of the deposits is described. Immunofluorescence microscopy showed a mixture of IgG, IgA, and IgM in 7 cases, a finding that was not seen in a group of non-lupus patients with various vascular lesions. Vascular deposits are generally rare in systemic lupus erythematosus, although in autopsies widely scattered involvement of arteries and arterioles was seen in nearly 1/3 of the cases. The deposits were more common in male patients. The evolution of the lesions could be followed through various stages to eventual sclerosis, particularly in patients treated with steroids or immunosuppressants. Some deposits appeared to resolve after treatment. Patients with vascular deposits had more severe glomerular disease and a more serious clinical course. Thrombotic microangiopathy appears to be a secondary phenomenon whose pathogenesis is unknown.

  9. Belimumab in Systemic Lupus Erythematosus

    PubMed Central

    Srivastava, Ankita

    2016-01-01

    Belimumab is the only approved biological agent for the treatment of systemic lupus erythematosus (SLE). It is a fully humanized IgG1γ monoclonal antibody directed against soluble B lymphocyte stimulator (BLyS). It is indicated as an add-on therapy for the treatment of adult patients with active, autoantibody-positive SLE, who are receiving standard therapy. Belimumab is generally well-tolerated, common adverse effects include infections, infusion reactions, hypersensitivity, headache, nausea, and fatigue. Psychiatric events including suicidal tendency, progressive multifocal leukoencephalopathy and malignancies too have been reported. Apart from SLE, the drug is also being tried for other autoimmune disorders. PMID:27688447

  10. [Systemic lupus erythematosus and pregnancy].

    PubMed

    Schreiber, Karen; Lykke, Jacob Alexander; Nielsen, Henriette Svarre; Jacobsen, Søren

    2016-08-01

    Systemic lupus erythematosus (SLE) is a complex autoimmune disease which most often affects women of childbearing age. Pregnancy is therefore an important issue for the patient and the responsible physician. Pregnancy outcomes in women with SLE has improved significantly over the latest decades, and current research initiatives aim towards further improvement. Pregnant women with SLE are still considered being at various levels of risk. In order to achieve the best possible outcomes for mother and child, joint care in specialised multidisciplinary teams including rheumatologists and obstetricians is recommended.

  11. [Ballism in systemic lupus erythematosus].

    PubMed

    Havsager, A M; Carstensen, N C

    1991-08-12

    A case of systemic lupus erythematosus (SLE) with ballism is presented. The movement disorders, as a group, account for approximately 2% of the neurological and psychiatric symptoms of central nervous system (CNS) involvement in SLE, and more than any of the other neuro-psychiatric manifestations they tend to precede the diagnosis of SLE. Ballism and other rare movement disorders are not included in the 1982 revised American Rheumatism Association criteria for SLE. Being aware of the correlation between CNS disease and more severe SLE, one should assess therapeutic intervention critically.

  12. Transition circumnstellar disks in Lupus

    NASA Astrophysics Data System (ADS)

    Romero, G. A.; Schreiber, M. R.; Cieza, L. A.; Rebassa-Manssergas, A.; Williams, J. P.; Merin, B.; Smith-Castelli, A.; Orellana, M.

    2011-10-01

    Based on Spitzer selected YSOs, we present a study of transition disks located in Lupus. Several mechanisms have been proposed to explain their defining characteristic: an inner opacity hole and an optically thick outer disk. These processes are: planet formation, grain growth, photoevaporation, tidal truncation in close binaries. We have carried out Adaptive Optics (AO) imaging, submillimeter photometry, and echelle spectroscopy in order to observationally characterize our transition disk sample. With the analyzed data we can distinguish the four scenarios and identify candidate transition disk systems that are currently forming planets. Such objects are excellent targets to be followed-up with Herschel and ALMA.

  13. Systemic lupus erythematosus and exercise.

    PubMed

    Ayán, C; Martín, V

    2007-01-01

    Systemic lupus erythematosus (SLE) is a rheumatic disease characterized by a variety of symptoms, especially fatigue, pain and reduced quality of life. Physical exercise is a useful tool for improving cardiovascular fitness, reducing metabolic abnormalities and fatigue and improving quality of life. However, very few studies have focused on the relationship between SLE and physical exercise. This paper reviews the main SLE symptoms that can be alleviated by exercising, as well as the results of studies seeking to analyse the exercise capacity and physical training possibilities of SLE patients. Considerations for future research are also discussed.

  14. The lupus band test in systemic lupus erythematosus patients

    PubMed Central

    Reich, Adam; Marcinow, Katarzyna; Bialynicki-Birula, Rafal

    2011-01-01

    The lupus band test (LBT) is a diagnostic procedure that is used to detect deposits of immunoglobulins and complement components along the dermoepidermal junction in patients with lupus erythematosus (LE). The LBT is positive in about 70%–80% of sun-exposed non-lesional skin specimens obtained from patients with systemic LE (SLE), and in about 55% of SLE cases if sun-protected nonlesional skin is analyzed. In patients with cutaneous LE only, the lesional skin usually shows a positive LBT. The LBT helps in differentiating LE from other similar skin conditions and may also be helpful in making the diagnosis of SLE in subjects with no specific cutaneous lesions. Furthermore, a positive LBT may be applied as a prognostic parameter for LE patients. However, the correct interpretation of this test requires detailed knowledge of the site of the biopsy, deposit components, morphology and brightness of the immunofluorescent band, and other associated serologic findings, as well as the response to treatment. It must be emphasized that LBT is a laboratory procedure that should always be interpreted in conjunction with clinical findings and other serological and immunopathological parameters. PMID:21339940

  15. Cross-fostering in gray wolves (Canis lupus lupus).

    PubMed

    Scharis, Inger; Amundin, Mats

    2015-01-01

    Cross-fostering in canids, with captive-bred pups introduced into endangered wild populations, might aid conservation efforts by increasing genetic diversity and lowering the risk of inbreeding depression. The gray wolf (Canis lupus lupus) population in Scandinavia suffers from severe inbreeding due to a narrow genetic base and geographical isolation. This study aimed at evaluating the method to cross-foster wolf pups from zoo-born to zoo-born litters. The following was assessed: female initial acceptance of foster pups, growth rate in relation to age difference between foster pups and pups in recipient litters and survival over the first 33 weeks. The study included four litters added by two foster pups in each. The age differences between the foster pups and the recipient litters were 2-8 days. After augmentation, all four females accepted the foster pups, demonstrated by her moving the entire litter to a new den site. Growth rate was dependent on the age difference of the pups in the foster litters, with a considerably slower growth rate in the 8 days younger pups. However, these pups later appeared to be at no disadvantage. Foster pups had a higher survival rate than females' pups, however, the causes of death were probably not kin or non-kin related. The results indicate that cross-fostering works in gray wolves and that this might be a plausible way to increase genetic variation in the wild population. © 2015 Wiley Periodicals, Inc.

  16. Mechanical properties of human bone-implant interface tissue in aseptically loose hip implants.

    PubMed

    Kraaij, Gert; Zadpoor, Amir A; Tuijthof, Gabrielle J M; Dankelman, Jenny; Nelissen, Rob G H H; Valstar, Edward R

    2014-10-01

    The main cause of failure in total hip replacement is aseptic loosening which is associated with the formation of a periprosthetic fibrous (interface) tissue. Despite important applications for finite element modeling of loose implants, the mechanical properties of the bone-implant interface tissue have never been measured in humans. In this study, we performed unconfined compression tests to characterize the mechanical properties of the interface tissue and to determine the parameters of various hyperelastic material models which were fitted to the measurements. Human interface tissues were retrieved during 21 elective revision surgeries from aseptically loosened cemented (N=10) and uncemented hip implants (N=11). Specimens were tested at a fixed deformation rate of 0.1mm/min up to a maximum force of 10N. Elastic moduli for low and high strain regions of the stress-strain curves were determined. Interface tissue from aseptically loose cemented prostheses shows higher elastic moduli (mean=1.85MPa, 95% C.I.=1.76-1.95MPa) in the high strain region as compared to that of the interface tissue from the cementless group (mean=1.65MPa, 95% C.I.=1.43-1.88MPa). The 5-terms Mooney-Rivlin model ( [Formula: see text] ) described the stress-strain behavior the best. Large variations in the mechanical behavior were observed both between specimens from the same patient as between those of different patients. The material model parameters were therefore estimated for the mean data as well as for the curves with the highest and lowest strain at the maximum load. The model parameters found for the mean data were C1=-0.0074MPa, C2=0.0019MPa, C3=0MPa, C4=-0.0032MPa and C5=0MPa in the cemented group and C1=-0.0137MPa, C2=0.0069MPa, C3=0.0026MPa, C4=-0.0094MPa and C5=0MPa in the cementless group. The results of this study can be used in finite element computer. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. The stellar population of the Lupus clouds

    NASA Technical Reports Server (NTRS)

    Hughes, Joanne; Hartigan, Patrick; Krautter, Joachim; Kelemen, Janos

    1994-01-01

    We present photometric and spectroscopic observations of the H alpha emission stars in the Lupus dark cloud complex. We estimate the effective temperatures of the stars from their spectral types and calculate the reddening towards each object from the (R-I) colors. From these data, we derive mass and age distributions for the Lupus stars using a new set of pre-main sequence evolutionar tracks. We compare the results for the Lupus stars with those for a similar population of young stellar objects in Taurus-Auriga and Chamaeleon and with the initial mass function for field stars in the solar neighborhood. From the H-R diagrams, Lupus appears to contain older stars than Taurus. The Lupus dark clouds form a greater proportion of low mass stars than the Taurus complex. Also, the proportion of low mass stars in Lupus is higher than that predicted by the Miller-Scalo initial mass function, and the lowest mass stars in Lupus are less active than similar T Tauri stars in other regions.

  18. The stellar population of the Lupus clouds

    NASA Technical Reports Server (NTRS)

    Hughes, Joanne; Hartigan, Patrick; Krautter, Joachim; Kelemen, Janos

    1994-01-01

    We present photometric and spectroscopic observations of the H alpha emission stars in the Lupus dark cloud complex. We estimate the effective temperatures of the stars from their spectral types and calculate the reddening towards each object from the (R-I) colors. From these data, we derive mass and age distributions for the Lupus stars using a new set of pre-main sequence evolutionar tracks. We compare the results for the Lupus stars with those for a similar population of young stellar objects in Taurus-Auriga and Chamaeleon and with the initial mass function for field stars in the solar neighborhood. From the H-R diagrams, Lupus appears to contain older stars than Taurus. The Lupus dark clouds form a greater proportion of low mass stars than the Taurus complex. Also, the proportion of low mass stars in Lupus is higher than that predicted by the Miller-Scalo initial mass function, and the lowest mass stars in Lupus are less active than similar T Tauri stars in other regions.

  19. Quality of Life in Cutaneous Lupus Erythematosus

    PubMed Central

    Klein, Rachel; Moghadam-Kia, Siamak; Taylor, Lynne; Coley, Christopher; Okawa, Joyce; LoMonico, Jonathan; Chren, Mary-Margaret; Werth, Victoria P.

    2010-01-01

    Background Little is known about quality of life in patients with cutaneous lupus erythematosus. Objective We sought to determine how cutaneous lupus affects quality of life and which independent variables are associated with poor quality of life. Methods 157 patients with cutaneous lupus completed surveys related to quality of life, including the Skindex-29 and the SF-36. Results Quality of life in cutaneous lupus is severely impaired, particularly with respect to emotional well-being. Patients with cutaneous lupus have worse quality of life than those with other common dermatologic conditions, such as acne, non-melanoma skin cancer, and alopecia. With respect to mental health status, patients with cutaneous lupus have similar or worse scores than patients with hypertension, type 2 diabetes mellitus, recent myocardial infarction, and congestive heart failure. Factors related to poor quality of life include female gender, generalized disease, severe disease, distribution of lesions, and younger age. Limitations The study was done at a single referral-only center. Conclusion Patients with cutaneous lupus have very impaired quality of life, particularly from an emotional perspective. PMID:21397983

  20. Do Asian patients have worse lupus?

    PubMed

    Mok, M Y; Li, W L

    2010-10-01

    The predisposition to and clinical phenotype of systemic lupus erythematosus, an autoimmune disease that is associated with significant morbidity and mortality, are affected by genetic and environmental factors. This article aims to examine whether Asians have worse lupus by reviewing the literature on genetic predisposition and clinical outcomes, including major organ involvement, damage score and mortality in Asian populations compared with other ethnicities. A number of lupus nephritis susceptibility genes have been identified in Asians and White patients, with further variations among different Asian populations. Meta-analysis studies on various Fcγ receptor subtypes revealed that FcγRIIIA-F158 allele, which is associated with low binding affinity to IgG1 and IgG3, predisposed to lupus nephritis in Asian patients. Asian patients were reported to have higher rates of lupus nephritis-associated autoantibodies, lupus nephritis and more active glomerulonephritis compared with White patients. Renal outcome and the level of immunosuppressant use in Asians were comparable to Afro-American Blacks in some studies. Asians were also found to have higher overall damage scores compared with Whites. The difference in mortality between Asian patients and other ethnicities in different geographical regions was found to vary depending on socioeconomic factors such as access to health care. Poverty, education level, cultural and behavioural factors are confounders to ethnicity in determining clinical outcome of systemic lupus erythematosus.

  1. [Serious bleeding in systemic lupus erythematosus complicated by lupus anticoagulant-hypoprothrombinaemia syndrome].

    PubMed

    Engelsen, Jytte; Nielsen, Susan M; Thorsen, Sixtus

    2006-01-30

    Severe hemorrhagic diathesis due to lupus anticoagulant complicated by hypoprothrombinaemia resulting from prothrombin autoantibodies is a rare disorder and is often associated with systemic lupus erythematosus (SLE). We report a case in which a 15-year-old girl with SLE developed marked haemorrhagic manifestations due to menorrhagia and nosebleeds. The acute bleeding episode was treated with SAGM, tranexamic acid and recombinant factor VIIa. Lupus anticoagulant, cardiolipin antibodies and antiprothrombin antibodies were successfully depressed within weeks after corticosteroid therapy was begun.

  2. Lupus vulgaris in a patient with systemic lupus erythematosus and persistent IgG deficiency.

    PubMed

    Düzgün, N; Duman, M; Sonel, B; Peksari, Y; Erdem, C; Tokgöz, G

    1997-01-01

    We present the case of a patient with juvenile onset systemic lupus erythematosus (SLE) who developed a persistent, acquired hypogammaglobulinaemia with IgG deficiency. The hypogammaglobulinaemia was probably a complication of high dose corticosteroid treatment. The serum IgG level remained subnormal despite intravenous immunoglobulin therapy. Lupus vulgaris, which developed on the nasal cartilage in this patient with SLE, is not an expected finding. This patient is probably the first reported case of SLE associated with lupus vulgaris.

  3. Childhood-onset bullous systemic lupus erythematosus.

    PubMed

    Lourenço, D M R; Gomes, R Cunha; Aikawa, N E; Campos, L M A; Romiti, R; Silva, C A

    2014-11-01

    Bullous systemic lupus erythematosus has rarely been described in pediatric lupus population and the real prevalence of childhood-onset bullous systemic lupus erythematosus has not been reported. From January 1983 to November 2013, 303 childhood-onset SLE (c-SLE) patients were followed at the Pediatric Rheumatology Unit of the Childreńs Institute of Hospital das Clínicas da Faculdade de Medicina Universidade da Universidade de São Paulo, three of them (1%) diagnosed as childhood-onset bullous systemic lupus erythematosus. All three cases presented tense vesiculobullous lesions unassociated with lupus erythematosus lesions, with the median duration of 60 days (30-60). All patients fulfilled bullous systemic lupus erythematosus criteria. Two had nephritis and serositis and presented specific autoantibodies. The histological pattern demonstrated subepidermal blisters with neutrophils-predominant infiltrates within the upper dermis. Direct immunofluorescence (DIF) showed deposits of IgG and complement along the epidermal basement membrane, in the presence or absence of IgA and/or IgM. A positive indirect immunofluorescence on salt-split skin demonstrating dermal binding was observed in two cases. All of them had moderate/severe disease activity at diagnosis with median Systemic Lupus Erythematosus Disease Activity Index 2000 (SLEDAI-2K) of 18 (14-24). Two patients received dapsone and one with severe nephritis received immunosuppressive drugs. In conclusion, in the last 30 years the prevalence of bullous lupus in childhood-onset lupus population was low (1%) in our tertiary University Hospital. A diagnosis of SLE should always be considered in children with recurrent tense vesiculobullous lesions with or without systemic manifestations.

  4. Magnetic resonance imaging of the brain in neuropsychiatric systemic lupus erythematosus.

    PubMed

    Stimmler, M M; Coletti, P M; Quismorio, F P

    1993-04-01

    To determine the utility of magnetic resonance imaging (MRI) of the brain in diagnosing active neuropsychiatric disease in systemic lupus erythematosus (NP-SLE), a prospective study of 51 hospitalized systemic lupus erythematosus (SLE) patients during 64 separate episodes of suspected NP-SLE was initiated. In addition to standard hematology, chemistry, and serological tests, the workup included MRI in all patients. A computed tomographic scan of the brain was obtained in patients enrolled in the first year of the study. Of the 64 neuropsychiatric episodes, 42 were attributable to NP-SLE and 22 were attributed to causes other than SLE. Neuropsychiatric complaints unrelated to lupus included depression (n = 6), seizures (n = 5), headache (n = 3), altered mental status (n = 2), aseptic meningitis (n = 2), cardiovascular accident (n = 2), transient ischemic attack (n = 1), and vertigo (n = 1). The MRI was abnormal in 34 of 64 (53%) episodes. MRI abnormalities were more common in patients with focal neurological deficits (19/26) than in those without focal findings (15/38; P = .008) and in patients with nephritis (19/24) than in those without renal disease (15/40; P = .002). MRI abnormalities were as frequent in NP-SLE (25/42) as in cases with non-NP-SLE-related causes (9/22). Periventricular increased signal (PIS) was a frequent MRI finding (10/64). Enlargement of the prepontine cistern, an MRI finding not previously described in NP-SLE, was seen (14/64). Both findings were associated with the presence of hypertension and lupus nephritis. PIS similar to that seen in our patients has been described in otherwise healthy elderly individuals with risk factors for stroke, suggesting that vascular abnormalities may be important in the etiology of these lesions. In conclusion, abnormalities in brain MRI occur frequently in NP-SLE, especially in patients with focal neurological deficits. However, the presence of similar MRI abnormalities in SLE patients with neuropsychiatric

  5. Hypertrophic lupus vulgaris: an unusual presentation.

    PubMed

    Jain, Vijay K; Aggarwal, Kamal; Jain, Sarika; Singh, Sunita

    2009-07-01

    Lupus vulgaris is the most common form of cutaneous tuberculosis occurring in previously sensitized individuals with a high degree of tuberculin sensitivity. Various forms including plaque, ulcerative, hypertrophic, vegetative, papular, and nodular forms have been described. A 30-year-old male patient presented with a very large hypertrophic lupus vulgaris lesion over left side of chest since 22 years. Histopathological examination showed granulomatous infiltration without caseation necrosis. The Mantoux reaction was strongly positive. Hypertrophic lupus vulgaris of such a giant size and that too at an unusual site is extremely rare and hence is being reported.

  6. HYPERTROPHIC LUPUS VULGARIS: AN UNUSUAL PRESENTATION

    PubMed Central

    Jain, Vijay K; Aggarwal, Kamal; Jain, Sarika; Singh, Sunita

    2009-01-01

    Lupus vulgaris is the most common form of cutaneous tuberculosis occurring in previously sensitized individuals with a high degree of tuberculin sensitivity. Various forms including plaque, ulcerative, hypertrophic, vegetative, papular, and nodular forms have been described. A 30-year-old male patient presented with a very large hypertrophic lupus vulgaris lesion over left side of chest since 22 years. Histopathological examination showed granulomatous infiltration without caseation necrosis. The Mantoux reaction was strongly positive. Hypertrophic lupus vulgaris of such a giant size and that too at an unusual site is extremely rare and hence is being reported. PMID:20161866

  7. [Cutaneous lupus erythematosus, a multidimensional entity].

    PubMed

    Méndez-Flores, Silvia; Tinoco-Fragoso, Fátima; Hernández-Molina, Gabriela

    2015-01-01

    Skin lesions caused by systemic lupus erythematosus are among the most frequent manifestations of this disease. These lesions show great variability in both their clinical and histological expression, making their understanding and study difficult. Patients presenting with cutaneous lupus do not necessarily have serious systemic complications, but they do have significant morbidity from impact on quality of life given the extent of the lesions, chronic tendency, and the risk of scarring; hence the importance of establishing a fast and effective treatment. This paper addresses the different varieties of specific injuries attributed to lupus erythematosus, correlation with systemic activity, quality of life, and the treatments available.

  8. Concurrent Kimura disease and lupus nephritis

    PubMed Central

    Wang, Haitao; Fang, Fang; Sun, Ying; Wang, Songlan; Mao, Yonghui

    2016-01-01

    Abstract Background: Kimura disease is a rare chronic inflammatory disorder with peripheral eosinophilia and elevated serum IgE and is also frequently complicated by nephropathy. Methods: We report a rare case of Kimura disease concomitant with lupus nephritis in a 72-year old male patient with recurrent unexplained lymphadenopathy, renal lesions, and immunologic abnormalities. Results: The patient was successfully managed with gamma immunoglobulin, intravenous pulse methylprednisolone therapy, hydroxychloroquine, and prednisone. Conclusion: This is the first report of a case of Kimura disease concomitant with lupus nephritis and highlights the importance of considering lupus nephritis as a possible concurrent disease in patients with Kimura disease that have immunologic abnormalities. PMID:27741124

  9. Metabolic Factors that Contribute to Lupus Pathogenesis

    PubMed Central

    Li, Wei; Sivakumar, Ramya; Titov, Anton A.; Choi, Seung-Chul; Morel, Laurence

    2017-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease in which organ damage is mediated by pathogenic autoantibodies directed against nucleic acids and protein complexes. Studies in SLE patients and in mouse models of lupus have implicated virtually every cell type in the immune system in the induction or amplification of the autoimmune response as well as the promotion of an inflammatory environment that aggravates tissue injury. Here, we review the contribution of CD4+ T cells, B cells, and myeloid cells to lupus pathogenesis and then discuss alterations in the metabolism of these cells that may contribute to disease, given the recent advances in the field of immunometabolism. PMID:27480903

  10. First epidemic of aseptic meningitis due to echovirus type 13 among Spanish children.

    PubMed Central

    Trallero, G.; Casas, I.; Avellón, A.; Pérez, C.; Tenorio, A.; De La Loma, A.

    2003-01-01

    Echoviruses are the commonest cause of aseptic meningitis (AM). Echovirus type 13 (EV-13) was the second enterovirus serotype associated with different local outbreaks of AM in Spain between February and October 2000. It was the first time that an epidemic AM caused by this virus was recognized in Spain. The index case appeared in the Canary Islands (Canarias). The EV-13 virus was isolated from 135 patients, predominantly from cerebrospinal fluid (CSF). All isolates were from children under 13 years. The age specific peak incidence was in infants under 1 year. Most patients had fever, headache and other meningeal signs. This enterovirus serotype, not previously detected in Spain, caused severe illness with a high attack rate. PMID:12729193

  11. [Acute disseminated encephalomyelitis in children as the result of aseptic meningitis - a report of two cases].

    PubMed

    Gołąbek, Violetta; Woźniakowska-Gęsicka, Teresa; Sokołowska, Dorota

    2011-01-01

    Acute disseminated encephalomyelitis (ADEM) is an inflammation of the spinal cord and brain. Diagnosis of ADEM, due to its rare occurrence and lack of definite laboratory indices, is difficult and is never totally certain. The clinical criterion required for the diagnosis is presence of acute symptoms from the brain and/or spine with fever, occurring after viral or bacterial infection, vaccination or serum administration. Differentiation between ADEM and acute multiple sclerosis in children is difficult, and diagnosis of ADEM may only be confirmed after years of observation, especially as multiple sclerosis is more common than ADEM. The most useful tool in differentiation between the two diseases is MRI. The aim of the study was to present two cases of ADEM with unknown aetiology after aseptic meningitis in children.

  12. Laser welding of thin polymer films to container substrates for aseptic packaging

    NASA Astrophysics Data System (ADS)

    Brown, N.; Kerr, D.; Jackson, M. R.; Parkin, R. M.

    2000-03-01

    Keyhole laser welding of polymers is a subject well covered and researched, but relatively little information exists regarding the welding of thin polymer films, particularly to a heavier substrate. This paper presents the design of a suitable test apparatus for laser welding thin film to a heavier substrate, and shows the results of an investigation into the feasibility of laser welding multi-layer polymer film lids to tubs for the manufacture of aseptic food containers. A consistent weld, free from defects, is the key to process success. Typical welding defects have been synthesised in order to investigate, and consequently remove, their cause. The result is a reliable welding method based on even film clamping. With careful attention to machine design, a seal of high mechanical strength and chemical integrity is possible.

  13. Aseptic meningitis in a patient taking etanercept for rheumatoid arthritis: a case report

    PubMed Central

    Booker, Matthew J; Flint, Julia; Saravana, Shanmugam

    2008-01-01

    Background We report a case of a 53 year old lady recently commenced on etanercept, an anti-TNF (tumour necrosis factor) therapy for rheumatoid arthritis presenting with confusion, pyrexia and an erythematous rash. Case presentation A lumbar puncture was highly suggestive of bacterial meningitis, but CSF cultures produced no growth, and polymerase chain reactions (PCR) for all previously reported bacterial, fungal and viral causes of meningitis were negative. Conclusion This case report describes aseptic meningitis as a previously unreported complication of etanercept therapy, and serves as a reminder of the rare but potentially life-threatening risk of serious infections in patients taking anti-TNF therapy for a variety of conditions. PMID:19046446

  14. Innovative food processing technology using ohmic heating and aseptic packaging for meat.

    PubMed

    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko

    2014-02-01

    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage.

  15. [Validation of a clinical prediction rule to distinguish bacterial from aseptic meningitis].

    PubMed

    Agüero, Gonzalo; Davenport, María C; Del Valle, María de la P; Gallegos, Paulina; Kannemann, Ana L; Bokser, Vivian; Ferrero, Fernando

    2010-02-01

    Despite most meningitis are not bacterial, antibiotics are usually administered on admission because bacterial meningitis is difficult to be rule-out. Distinguishing bacterial from aseptic meningitis on admission could avoid inappropriate antibiotic use and hospitalization. We aimed to validate a clinical prediction rule to distinguish bacterial from aseptic meningitis in children, on arriving to the emergency room. This prospective study included patients aged < 19 years with meningitis. Cerebrospinal fluid (CSF) and peripheral blood neutrophil count were obtained from all patients. The BMS (Bacterial Meningitis Score) described by Nigrovic (Pediatrics 2002; 110: 712), was calculated: positive CSF Gram stain= 2 points, CSF absolute neutrophil count > or = 1000 cells/mm(3), CSF protein > or = 80 mg/dl, peripheral blood absolute neutrophil count > or = 10.000/mm(3), seizure = 1 point each. Sensitivity (S), specificity (E), positive and negative predictive values (PPV and NPV), positive and negative likelihood ratios (PLR and NLR) of the BMS to predict bacterial meningitis were calculated. Seventy patients with meningitis were included (14 bacterial meningitis). When BMS was calculated, 25 patients showed a BMS= 0 points, 11 BMS= 1 point, and 34 BMS > or = 2 points. A BMS = 0 showed S: 100%, E: 44%, VPP: 31%, VPN: 100%, RVP: 1,81 RVN: 0. A BMS > or = 2 predicted bacterial meningitis with S: 100%, E: 64%, VPP: 41%, VPN: 100%, PLR: 2.8, NLR:0. Using BMS was simple, and allowed identifying children with very low risk of bacterial meningitis. It could be a useful tool to assist clinical decision making.

  16. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin N.; Berlin, David

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  17. Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

    PubMed

    Glimåker, M; Johansson, B; Olcén, P; Ehrnst, A; Forsgren, M

    1993-01-01

    An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

  18. Techniques and clinical effect of aseptic procedures on patients with acute leukemia in laminar airflow rooms.

    PubMed

    Takeo, H; Sakurai, T; Amaki, I

    1983-01-01

    The techniques of aseptic procedures in the laminar airflow room (LAF) were evaluated in 110 adult patients undergoing antileukemic chemotherapy for remission induction. The patients were divided into three groups according to the regimens: Group A, consisting of 20 patients who stayed in the LAF and received the gown technique + sterile food + prophylactic oral and topical antibiotics; Group B, consisting of 12 patients who stayed in the LAF and received sterile food + prophylactic oral antibiotics; and Group C, consisting of 78 patients in open wards, who received prophylactic oral antibiotics alone. Species and numbers of microorganisms on the skin surface were far less in the patients in Group A than in those in Group B. Airborne microorganisms were counted by the air sampling method. No microorganisms could be detected at the time of the patient's rest and of blood collection in either Group A or B. Electrocardiography and X-ray examination caused an increase in the number of colonies to more than one colony in Group B, but Group A had a count of less than 0.5 colony. The colony counts became negative within 5 min after the cessation of each operation. The percentage of febrile days for patients with a peripheral granulocyte count of less than 100/microliter was 29% in Group A, 21% in Group B and 44% in Group C. The incidence of documented infections during the total hospital stay was 25% (5/20), 42% (5/12) and 86% (67/78), respectively. The aseptic procedures in Group B were not as strict as in Group A, but the incidence of infections in Group B was significantly lower than in Group C.

  19. Establishing and monitoring an aseptic workspace for building the MOMA mass spectrometer

    NASA Astrophysics Data System (ADS)

    Lalime, Erin N.; Berlin, David

    2016-09-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  20. A pharmacodynamic investigation into the efficacy of osteoprotegerin during aseptic inflammation.

    PubMed

    Curl, Linda; Barker, Christopher; Dreyer, Craig; Sampson, Wayne

    2012-11-01

    Osteoprotegerin (OPG), as an osteoclast antagonist, limits mineralised tissue resorption under physiological conditions. Previous work investigating OPG in a rat periodontal ligament (PDL) ankylosis model found no inhibitory effect on osteoclasts when OPG was administered at a dosage of 2.5mg/kg. The object of this study was to determine whether dosages higher than 2.5 mg/kg of OPG were required to limit osteoclastic activity in an aseptic inflammatory model in rats. Dry ice was applied for 15 minutes to the upper right first molar crown of eighteen, 8-week-old, male Sprague-Dawley rats. Three groups of 3 were injected with OPG at dosages of 2.5, 5.0 and 7.5 mg/kg of body weight immediately following the thermal insult. After 7 days, the rats were sacrificed and each maxilla processed for histological examination and stained for osteoclastic activity using tartrate-resistant acid phosphatase (TRAP). Osteoclast population numbers were estimated via light microscopy and results were analysed using a comparative mixed model statistical analysis. Results showed OPG inhibited osteoclastic activity in a dose-dependent manner. From 2.5 mg/kg to 7.5 mg/kg, osteoclast populations were linearly reduced by 39.78% (p < 0.05). OPG did not appear to affect the inflammatory process and had varied efficacy in different regions of individual teeth. Although osteoclastic activity reduced, it was not completely eliminated, perhaps because dosages were still inadequate, or additional factors might influence OPG and osteoclast activation in the aseptic inflammatory model.

  1. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    PubMed

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for Advancement of

  2. Aseptically Processed Placental Membrane Improves Healing of Diabetic Foot Ulcerations: Prospective, Randomized Clinical Trial

    PubMed Central

    DiDomenico, Lawrence A.; Orgill, Dennis P.; Galiano, Robert D.; Serena, Thomas E.; Carter, Marissa J.; Kaufman, Jarrod P.; Young, Nathan J.

    2016-01-01

    Background: Allogeneic grafts derived from amnion/chorion are known to be efficacious in healing chronic diabetic foot ulcerations (DFUs). The goal of this study was to compare aseptically processed dehydrated human amnion and chorion allograft (dHACA) versus standard of care (SOC) in facilitating wound closure in nonhealing DFUs. Methods: Patients with DFUs treated with SOC (off-loading, appropriate debridement, and moist wound care) after a 2-week screening period were randomized to either SOC or wound-size-specific dHACA (AmnioBand, Musculoskeletal Transplant Foundation, Edison, N.J.) applied weekly for up to 12 weeks plus SOC. Primary endpoint was the percentage of wounds healed at 6 weeks between groups. Results: At 6 weeks, 70% (14/20) of the dHACA-treated DFUs healed compared with 15% (3/20) treated with SOC alone. Furthermore, at 12 weeks, 85% (17/20) of the DFUs in the dHACA group healed compared with 25% (5/20) in the SOC group, with a corresponding mean time to heal of 36 and 70 days, respectively. At 12 weeks, the mean number of grafts used per healed wound for the dHACA group was 3.8 (median 3.0), and mean cost of the tissue to heal a DFU was $1400. The mean wastage at 12 weeks was 40%. One adverse event and 1 serious adverse event occurred in the dHACA group; neither was graft related. Three adverse events and 1 serious adverse event occurred in the SOC group. Conclusion: Aseptically processed dHACA heals diabetic foot wounds significantly faster than SOC at 6 and 12 weeks with minimal graft wastage. PMID:27826487

  3. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions

    PubMed Central

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B.; Goodacre, Royston; Smith, Alistair

    2015-01-01

    Abstract There is growing interest in the development of methods capable of non‐invasive characterization of stem cells prior to their use in cell‐based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm−1 after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up‐regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non‐invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process. © 2015 The Authors. Published by Wiley Periodicals, Inc. on behalf of the International Society for

  4. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  5. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.

    1992-01-01

    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  6. Report of Two Cases of Aseptic Meningitis with Persistence of Pneumococcal Cell Wall Components in Cerebrospinal Fluid after Pneumococcal Meningitis▿

    PubMed Central

    Angoulvant, François; Lachenaud, Julie; Mariani-Kurkdjian, Patricia; Aubertin, Guillaume; Houdouin, Véronique; Lorrot, Mathie; de Los Angeles, Laure; Bingen, Edouard; Bourrillon, Antoine; Faye, Albert

    2006-01-01

    We describe two cases of aseptic meningitis occurring some time after pneumococcal meningitis. Both cases may have resulted from an inflammatory response to persistent pneumococcal cell membrane components, as the cerebrospinal fluid samples were positive by the Binax NOW Streptococcus pneumoniae antigen test. Potential mechanisms and diagnostic impact are discussed. PMID:17005744

  7. Complete Genome Sequence Analysis of Echovirus 18 Associated with Aseptic Meningitis in Hebei Province, China, in 2015

    PubMed Central

    Sun, Su-zhen; Guo, Jia-yun; Li, Jing-jie

    2016-01-01

    Echovirus 18 is a member of the genus Enterovirus, family Picornaviridae, which can cause meningitis in children. Here, we report the echovirus 18 complete genome sequence, which was isolated from the cerebrospinal fluid of a child with aseptic meningitis in Hebei Province, China. PMID:27789638

  8. Central nervous system manifestations of neonatal lupus: a systematic review.

    PubMed

    Chen, C C; Lin, K-L; Chen, C-L; Wong, A May-Kuen; Huang, J-L

    2013-12-01

    Neonatal lupus is a rare and acquired autoimmune disease. Central nervous system abnormalities are potential manifestations in neonatal lupus. Through a systematic literature review, we analyzed the clinical features of previously reported neonatal lupus cases where central nervous system abnormalities had been identified. Most reported neonatal lupus patients with central nervous system involvement were neuroimaging-determined and asymptomatic. Only seven neonatal lupus cases were identified as having a symptomatic central nervous system abnormality which caused physical disability or required neurosurgery. A high percentage of these neurosymptomatic neonatal lupus patients had experienced a transient cutaneous skin rash and had no maternal history of autoimmune disease before pregnancy.

  9. Recurrent podocytopathy in a patient with systemic lupus erythematosus

    PubMed Central

    Paramalingam, Shereen; Wong, Daniel D; Dogra, Gursharan K; Nossent, Johannes C

    2017-01-01

    Podocytopathy in systemic lupus erythematosus is characterised by diffuse foot process effacement without significant peripheral capillary wall immune deposits as seen on electron microscopy. Lupus podocytopathy falls outside the scope of the current International Society of Nephrology and the Renal Pathology Society classification of lupus nephritis. We present a case of relapsing podocytopathy with nephrotic syndrome occurring simultaneously with two extra-renal and serological disease flares, which makes it likely that podocytopathy was related to systemic lupus erythematosus activity. This case adds to the growing body of evidence that lupus podocytopathy must be considered in the differential diagnosis of systemic lupus erythematosus patients presenting with nephrotic syndrome. PMID:28321309

  10. Recurrent podocytopathy in a patient with systemic lupus erythematosus.

    PubMed

    Paramalingam, Shereen; Wong, Daniel D; Dogra, Gursharan K; Nossent, Johannes C

    2017-01-01

    Podocytopathy in systemic lupus erythematosus is characterised by diffuse foot process effacement without significant peripheral capillary wall immune deposits as seen on electron microscopy. Lupus podocytopathy falls outside the scope of the current International Society of Nephrology and the Renal Pathology Society classification of lupus nephritis. We present a case of relapsing podocytopathy with nephrotic syndrome occurring simultaneously with two extra-renal and serological disease flares, which makes it likely that podocytopathy was related to systemic lupus erythematosus activity. This case adds to the growing body of evidence that lupus podocytopathy must be considered in the differential diagnosis of systemic lupus erythematosus patients presenting with nephrotic syndrome.

  11. Lupus cystitis in Korean patients with systemic lupus erythematosus: risk factors and clinical outcomes.

    PubMed

    Koh, J H; Lee, J; Jung, S M; Ju, J H; Park, S-H; Kim, H-Y; Kwok, S-K

    2015-10-01

    This study was performed to investigate the clinical characteristics of lupus cystitis and determine the risk factors and clinical outcomes of lupus cystitis in patients with systemic lupus erythematosus (SLE). We retrospectively reviewed 1064 patients at Seoul St. Mary's Hospital in Seoul, Korea, from 1998 to 2013. Twenty-four patients had lupus cystitis. Lupus cystitis was defined as unexplained ureteritis and/or cystitis as detected by imaging studies, cystoscopy, or bladder histopathology without urinary microorganisms or stones. Three-fourths of patients with lupus cystitis had concurrent lupus mesenteric vasculitis (LMV). The initial symptoms were gastrointestinal in nature for most patients (79.2%). High-dose methylprednisolone was initially administered to most patients (91.7%) with lupus cystitis. Two patients (8.3%) died of urinary tract infections. Sixty-five age- and sex-matched patients with SLE who were admitted with other manifestations were included as the control group. Patients with lupus cystitis showed a lower C3 level (p = 0.031), higher SLE Disease Activity Index score (p = 0.006), and higher ESR (p = 0.05) upon admission; more frequently had a history of LMV prior to admission (p < 0.001); and less frequently had a history of neuropsychiatric lupus (p = 0.031) than did patients with SLE but without lupus cystitis. The occurrence of lupus cystitis was associated with a history of LMV (OR, 21.794; 95% CI, 4.061-116.963). The median follow-up period was 3.4 years, and the cumulative one-year mortality rate was 20%. Complications developed in 33.3% of patients with lupus cystitis and were related to survival (log-rank p = 0.021). Our results suggest that the possibility of lupus cystitis should be considered when a patient with SLE and history of LMV presents with gastrointestinal symptoms or lower urinary tract symptoms. Development of complications in patients with lupus cystitis can be fatal. Thus, intensive treatment

  12. Cystinosis and lupus erythematosus: coincidence or causation.

    PubMed

    Ahmad, Zahida P; Johnstone, Lilian M; Walker, Amanda M

    2010-08-01

    A 14-year-old boy with known stable cystinosis, treated with cysteamine since infancy, presented with a deterioration of renal function with haematuria in conjunction with a nodular rash, arthralgia, leucopenia, hypocomplementaemia and raised antinuclear antibodies. He was diagnosed with spontaneous onset of systemic lupus erythematosus (SLE), and his renal biopsy was consistent with lupus nephritis. It is unusual for patients with one severe disease to develop another disease process completely unrelated to their original condition, but it can occur. However, other distinct variants of lupus have been described, including drug-induced lupus (DIL), which have features that over-lap with SLE. The potential differential diagnosis of the SLE as a form of DIL in association with cysteamine is discussed.

  13. [Cerebral infarction in systemic lupus erythematosus].

    PubMed

    Overbeck, S; Wermuth, L

    1989-02-13

    The case-history of a man aged 31 years with systemic lupus erythematosus and cerebral infarction is presented. Although patients with active disease are young, cerebral infarcts are strikingly frequent among them.

  14. Poverty Could Make Lupus Even Worse

    MedlinePlus

    ... page: https://medlineplus.gov/news/fullstory_165745.html Poverty Could Make Lupus Even Worse Second study saw ... 19, 2017 FRIDAY, May 19, 2017 (HealthDay News) -- Poverty and race are tied to the health of ...

  15. Lupus mastitis: a mimicker of breast carcinoma

    PubMed Central

    Warne, Richard Roger; Taylor, Donna; Segal, Amanda; Irish, Ashley

    2011-01-01

    The authors present a case of lupus mastitis which was initially diagnosed following an incisional biopsy of a breast lump, with similar pathology found 2 years later after an ultrasound guided biopsy of the same lump. The woman had been diagnosed 7 years before with systemic lupus erythematosus. The radiological and pathological features are presented in this report with discussion of similar cases in the literature. PMID:22669997

  16. CO observations of dark clouds in Lupus

    NASA Technical Reports Server (NTRS)

    Murphy, D. C.; Cohen, R.; May, J.

    1986-01-01

    C-12O observations covering 170 square degrees toward the southern T Association Lupus have revealed the presence of an extended physically related complex of dark clouds which have recently formed low mass stars. The estimated mass of the clouds (about 30,000 solar masses) is comparable to that of the nearby Ophiuchus dust clouds. The Lupus clouds are projected onto a gap between two subgroups of the Scorpio-Centaurus OB association suggesting that this long accepted subgrouping may require reinterpretation.

  17. Urinary tract infections and lupus erythematosus

    PubMed Central

    Hidalgo-Tenorio, C; Jimenez-Alonso, J; de Dios, Luna J; Tallada, M; Martinez-Brocal, A; Mario, S

    2004-01-01

    Background: Infections are one of the main causes of morbidity and mortality in patients with systemic lupus erythematosus. Objective: To analyse urinary tract infection (UTI) risk factors in lupus patients; the influence of these factors on disease activity, organ damage, and disease development; the type and prevalence of UTI; and the micro-organisms involved. Method: 86 control subjects and 81 lupus patients were studied prospectively over a 12 month period and examined on five occasions. Epidemiological data and information on urinary symptoms, disease activity (SLEDAI), and organ damage (SLICC/ACR) data were collected. Autoantibodies, complement levels, urine culture, and antibiogram were determined; urological studies were also carried out. SPPS 10.0 and STATA 6.0. were used for statistical analysis. Results: The prevalence of UTI in lupus patients was 36%. Lupus influences the onset of UTI (p = 0.001), regardless of other variables. UTI risk factors in lupus patients were age (p = 0.002), previous cases of UTI (p = 0.0001), antinuclear antibodies (ANA) >1/80 IU/ml (p = 0.022), thrombocytopenia (p = 0.02), and admission to hospital due to UTI (p = 0.002). Leucopenia (p = 0.09) and the weekly administration of methotrexate (p = 0.06) had a bearing on the onset of UTI; disease development (p = 0.99), lupus activity (p = 0.32), and organ damage (p = 0.36) do not. The uropathogen most frequently isolated was E coli (60%). Conclusions: Lupus patients are likely to have UTI, usually manifesting in the lower tract. They are community acquired, basically caused by E coli, and favoured by age, previous UTI, admissions to hospital due to UTI, thrombopenia, ANA, leucopenia, and methotrexate treatments. PMID:15020339

  18. CO observations of dark clouds in Lupus

    NASA Technical Reports Server (NTRS)

    Murphy, D. C.; Cohen, R.; May, J.

    1986-01-01

    C-12O observations covering 170 square degrees toward the southern T Association Lupus have revealed the presence of an extended physically related complex of dark clouds which have recently formed low mass stars. The estimated mass of the clouds (about 30,000 solar masses) is comparable to that of the nearby Ophiuchus dust clouds. The Lupus clouds are projected onto a gap between two subgroups of the Scorpio-Centaurus OB association suggesting that this long accepted subgrouping may require reinterpretation.

  19. Mucormycosis complications in systemic lupus erythematosus.

    PubMed

    Arce-Salinas, C A; Pérez-Silva, E

    2010-07-01

    This case involved a 75-year-old woman with systemic lupus erythematosus. Two months previously, she had a flare that was treated successfully by increasing the dosages of prednisone and azathioprine. A sudden onset of ocular pain, diplopia, and loss of vision suggestive of optical neuritis or vascular involvement confused the issue, and rhinocerebral zygomycosis was demonstrated later. We review the presentations of this fungal infection in patients with systemic lupus erythematosus with emphasis on its initial features.

  20. Genetics of Lupus Nephritis: Clinical Implications

    PubMed Central

    Munroe, Melissa E.; James, Judith A.

    2015-01-01

    Systemic lupus erythematosus (SLE) is a heterogeneous autoimmune disease marked by the presence of pathogenic autoantibodies, immune dysregulation, and chronic inflammation that may lead to increased morbidity and early mortality from end-organ damage. Over half of all SLE patients will develop lupus nephritis. Genetic association studies have identified more than fifty polymorphisms that contribute to lupus nephritis pathogenesis, including genetic variants associated with altered programmed cell death (PCD) and defective immune clearance of PCD debris. These variants may support the generation of autoantibody-containing immune complexes that contribute to lupus nephritis. Genetic variants associated with lupus nephritis also affect the initial phase of innate immunity and the amplifying, adaptive phase of the immune response. Finally, genetic variants associated with the kidney-specific effector response may influence end-organ damage and the progression to end-stage renal disease and death. This review discusses genetic insights of key pathogenic processes and pathways that may lead to lupus nephritis, as well as the clinical implications of these findings as they apply to recent advances in biologic therapies. PMID:26573543

  1. Targeting cancer with a lupus autoantibody#

    PubMed Central

    Hansen, James E.; Chan, Grace; Liu, Yanfeng; Hegan, Denise C.; Dalal, Shibani; Dray, Eloise; Kwon, Youngho; Xu, Yuanyuan; Xu, Xiaohua; Peterson-Roth, Elizabeth; Geiger, Erik; Liu, Yilun; Gera, Joseph; Sweasy, Joann B.; Sung, Patrick; Rockwell, Sara; Nishimura, Robert N.; Weisbart, Richard H.; Glazer, Peter M.

    2013-01-01

    Systemic lupus erythematosus (SLE) is distinct among autoimmune diseases due to its association with circulating autoantibodies reactive against host DNA. The precise role that anti-DNA antibodies play in SLE pathophysiology remains to be elucidated, and potential applications of lupus autoantibodies in cancer therapy have not previously been explored. Here we report the unexpected finding that a cell-penetrating lupus autoantibody, 3E10, has potential as a targeted therapy for DNA-repair deficient malignancies. We find that 3E10 preferentially binds DNA single-strand tails, inhibits key steps in DNA single-strand and double-strand break repair, and sensitizes cultured tumor cells and human tumor xenografts to DNA-damaging therapy, including doxorubicin and radiation. Moreover, we demonstrate that 3E10 alone is synthetically lethal to BRCA2-deficient human cancer cells and selectively sensitizes such cells to low dose doxorubicin. Our results establish an approach to cancer therapy that we expect will be particularly applicable to BRCA2-related malignancies such as breast, ovarian, and prostate cancers. In addition, our findings raise the possibility that lupus autoantibodies may be partly responsible for the intrinsic deficiencies in DNA repair and the unexpectedly low rates of breast, ovarian, and prostate cancers observed in SLE patients. In summary, this study provides the basis for the potential use of a lupus anti-DNA antibody in cancer therapy and identifies lupus autoantibodies as a potentially rich source of therapeutic agents. PMID:23100628

  2. Renoprotective strategies in lupus nephritis: beyond immunosuppression.

    PubMed

    Griffin, B; Lightstone, L

    2013-10-01

    Lupus nephritis needs to be diagnosed promptly and treated specifically with appropriate immunosuppression. However, all patients with lupus nephritis have by definition chronic kidney disease (CKD) as they will have proteinuria with varying degrees of renal impairment. CKD requires careful additional management, not only to reduce the risk of progression to end-stage renal disease but also because it is probably the strongest risk for cardiovascular morbidity and mortality. This review focuses on the evidence underscoring strategies to prevent progression of CKD beyond the "simple" treatment of the lupus nephritis. The strategies include immaculate control of blood pressure, inhibition of the renin-angiotensin system to reduce blood pressure and proteinuria, and the benefits of lifestyle modifications such as tackling smoking, obesity and exercise. We also review the literature on control of dyslipidaemias which, although clearly of cardiovascular benefit, provide less compelling data for offering renoprotection. We touch on the emerging area of the importance of controlling urate levels in protecting against progressive renal impairment. Finally, there is a reminder about the importance of considering the nephrotoxicity of all medications prescribed for patients with lupus nephritis - above all the need to avoid the use of non-steroidal anti-inflammatory drugs. Overall, the theme is that there is much more to the management of patients with lupus nephritis than "just" the nephritis - a multidisciplinary approach involving nephrologists as well as rheumatologists is more likely to provide the appropriate wider care required for all patients with lupus nephritis.

  3. Targeting cancer with a lupus autoantibody.

    PubMed

    Hansen, James E; Chan, Grace; Liu, Yanfeng; Hegan, Denise C; Dalal, Shibani; Dray, Eloise; Kwon, Youngho; Xu, Yuanyuan; Xu, Xiaohua; Peterson-Roth, Elizabeth; Geiger, Erik; Liu, Yilun; Gera, Joseph; Sweasy, Joann B; Sung, Patrick; Rockwell, Sara; Nishimura, Robert N; Weisbart, Richard H; Glazer, Peter M

    2012-10-24

    Systemic lupus erythematosus (SLE) is distinct among autoimmune diseases because of its association with circulating autoantibodies reactive against host DNA. The precise role that anti-DNA antibodies play in SLE pathophysiology remains to be elucidated, and potential applications of lupus autoantibodies in cancer therapy have not previously been explored. We report the unexpected finding that a cell-penetrating lupus autoantibody, 3E10, has potential as a targeted therapy for DNA repair-deficient malignancies. We find that 3E10 preferentially binds DNA single-strand tails, inhibits key steps in DNA single-strand and double-strand break repair, and sensitizes cultured tumor cells and human tumor xenografts to DNA-damaging therapy, including doxorubicin and radiation. Moreover, we demonstrate that 3E10 alone is synthetically lethal to BRCA2-deficient human cancer cells and selectively sensitizes such cells to low-dose doxorubicin. Our results establish an approach to cancer therapy that we expect will be particularly applicable to BRCA2-related malignancies such as breast, ovarian, and prostate cancers. In addition, our findings raise the possibility that lupus autoantibodies may be partly responsible for the intrinsic deficiencies in DNA repair and the unexpectedly low rates of breast, ovarian, and prostate cancers observed in SLE patients. In summary, this study provides the basis for the potential use of a lupus anti-DNA antibody in cancer therapy and identifies lupus autoantibodies as a potentially rich source of therapeutic agents.

  4. [Pregnancy complications in a patient with systemic lupus erythematosus and lupus nephritis].

    PubMed

    Bisgaard, Helene; Jacobsen, Søren; Tvede, Niels; Langhoff-Roos, Jens

    2014-07-14

    A woman with systemic lupus erythematosus (SLE) and lupus nephritis had two pregnancies which both resulted in complications known to be associated with SLE, i.e. late abortion, preterm delivery and pre-eclampsia. We conclude that disease quiescence is important for a successful outcome and that pregnant women with SLE should be followed in a multidisciplinary setting.

  5. Hydroxychloroquine and pregnancy on lupus flares in Korean patients with systemic lupus erythematosus.

    PubMed

    Koh, J H; Ko, H S; Kwok, S-K; Ju, J H; Park, S-H

    2015-02-01

    We investigated the clinical and laboratory characteristics of pregnancies with systemic lupus erythematosus (SLE) and identified lupus flare predictors during pregnancy. Additionally, we examined lupus activity and pregnancy outcomes in SLE patients who continued, discontinued or underwent no hydroxychloroquine (HCQ) treatment during pregnancy. We retrospectively analyzed 179 pregnancies in 128 SLE patients at Seoul St. Mary's Hospital, Korea, between 1998 and 2012 and then assessed the clinical profiles and maternal and fetal outcomes. Overall, 90.5% of pregnancies resulted in a successful delivery and were divided into two groups: those who experienced lupus flares (80 pregnancies, 44.7%) and those who did not (99 pregnancies, 55.3%). Increased preeclampsia, preterm births, low birth weight, intrauterine growth restriction (IUGR), and low 1-minute Apgar scores occurred in pregnancies with lupus flares compared to pregnancies in quiescent disease. Lupus flares were predicted by HCQ discontinuation, a history of lupus nephritis, high pre-pregnancy serum uric acid and low C4 levels. Our study indicates that achieving pre-pregnancy remission and continuing HCQ treatment during pregnancy are important for preventing lupus flares. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  6. Systemic lupus erythematosus: an update.

    PubMed

    Golder, Vera; Hoi, Alberta

    2017-03-20

    Systemic lupus erythematosus (SLE) is a chronic multisystem autoimmune disease predominantly affecting women of childbearing age. New classification criteria for SLE have greater sensitivity and therefore improve the diagnostic certainty for some patients, especially those who may previously have been labelled as having undifferentiated symptoms. Uncontrolled disease activity leads to irreversible end-organ damage, which in turn increases the risk of premature death; early and sustained control of disease activity can usually be achieved by conventional immunosuppressant therapy. The development of biological therapy lags behind that for other rheumatic diseases, with belimumab being the only targeted therapy approved by the Therapeutic Goods Administration. "Treat-to-target" concepts are changing trial design and clinical practice, with evidence-based definition of response criteria in the form of remission and low disease activity now on the horizon. While new therapies are awaited, research should also focus on optimising the use of current therapy and improving the quality of care of patients with SLE.

  7. Humor in systemic lupus erythematosus.

    PubMed

    Moura, Cristiano S; Li, Rui; Lawrie, Sarah; Bar-Or, Amit; Clarke, Ann E; Da Costa, Deborah; Banerjee, Devi; Bernatsky, Sasha; Lee, Jennifer L; Pineau, Christian A

    2015-03-01

    Humor has neurophysiological effects influencing the release of cortisol, which may have a direct impact on the immune system. Laughter is associated with a decreased production of inflammatory cytokines both in the general population and in rheumatoid arthritis (RA). Our objective was to explore the effects of humor on serum cytokines [particularly interleukin-6 (IL-6)] and cortisol levels in systemic lupus erythematosus (SLE), after a standard intervention (120 min of visual comedy). We enrolled 58 females with SLE from consecutive patients assessed in the Montreal General Hospital lupus clinic. The subjects who consented to participate were randomized in a 1:1 ratio to the intervention (watching 120 min of comedy) or control group (watching a 120 min documentary). Measurements of cytokine and serum cortisol levels as well as 24-h urine cortisol were taken before, during, and after the interventions. We compared serum cytokine levels and serum and 24-h urine cortisol levels in the humor and control groups and performed regression analyses of these outcomes, adjusting for demographics and the current use of prednisone. There were no significant differences between the control and humor groups in demographics or clinical variables. Baseline serum levels of IL-6, IL-10, tumor necrosis factor-alpha, and B-cell activating factor were also similar in both groups. There was no evidence of a humor effect in terms of decreasing cytokine levels, although there was some suggestion of lowered cortisol secretion in the humor group based the 24-h urinary cortisol levels in a subgroup. In contrast to what has been published for RA, we saw no clear effects of humor in altering cytokine levels in SLE, although interesting trends were seen for lower cortisol levels after humor intervention compared with the control group.

  8. Lupus pneumonitis as the initial presentation of systemic lupus erythematosus: case series from a single institution.

    PubMed

    Wan, S A; Teh, C L; Jobli, A T

    2016-11-01

    Objective The aim of this study was to examine the clinical features, treatment and outcome of systemic lupus erythematosus (SLE) patients in our centre who presented with lupus pneumonitis as the initial manifestation. Methods We performed a retrospective review of all patients who presented with lupus pneumonitis during the initial SLE manifestation from March 2006 to March 2015. Results There were a total of five patients in our study who presented with fever and cough as the main clinical features. All patients had pulmonary infiltrates on chest radiographs. High-resolution computed tomography, which was performed in two patients, showed ground glass opacities with patchy consolidations bilaterally. All patients received high-dose steroids, 80% received intravenous cyclophosphamide and 60% received intravenous immunoglobulin. Two patients died from severe lupus pneumonitis within 2 weeks of admission despite treatment with ventilation, steroids, cyclophosphamide and intravenous immunoglobulin. Conclusions Acute lupus pneumonitis is an uncommon presentation of SLE. Mortality in this case series is 40%.

  9. Lupus anticoagulant: clinical significance in anticardiolipin positive patients with systemic lupus erythematosus.

    PubMed

    McHugh, N J; Moye, D A; James, I E; Sampson, M; Maddison, P J

    1991-08-01

    The significance of anticardiolipin antibodies and the lupus anticoagulant was studied in 58 consecutive patients with systemic lupus erythematosus. On 85 occasions serum IgG and IgM anticardiolipin antibodies were measured by an enzyme linked immunosorbent assay (ELISA), and simultaneous plasma samples tested for lupus anticoagulant activity. The most significant association with clinical events (previous thrombosis or thrombocytopenia occurring in 11/58 patients) was with prolonged tissue thromboplastin inhibition time (TTIT) followed by prolonged kaolin cephalin clotting time (KCCT) then raised IgG anticardiolipin antibody concentrations and dilute Russell's viper venom time. Although IgG anticardiolipin antibodies or KCCT were the most sensitive tests in identifying this group, the TTIT was the most specific (98%). Nine patients were IgG anticardiolipin antibody positive and lupus anticoagulant negative, of whom one had thrombocytopenia but none had thrombosis. The presence of a lupus anticoagulant in anticardiolipin antibody positive patients increases specificity for certain adverse clinical events.

  10. A 12-year retrospective review of bullous systemic lupus erythematosus in cutaneous and systemic lupus erythematosus patients.

    PubMed

    Chanprapaph, K; Sawatwarakul, S; Vachiramon, V

    2017-01-01

    Objective The aim of this study was to investigate the clinical features, laboratory findings, systemic manifestations, treatment and outcome of patients with bullous systemic lupus erythematosus in a tertiary care center in Thailand. Methods We performed a retrospective review from 2002 to 2014 of all patients who fulfilled the diagnostic criteria for bullous systemic lupus erythematosus to evaluate for the clinical characteristics, extracutaneous involvement, histopathologic features, immunofluorescence pattern, serological abnormalities, internal organ involvement, treatments and outcome. Results Among 5149 patients with cutaneous lupus erythematosus and/or systemic lupus erythematosus, 15 developed vesiculobullous lesions. Ten patients had validation of the diagnosis of bullous systemic lupus erythematosus, accounting for 0.19%. Bullous systemic lupus erythematosus occurred after the diagnosis of systemic lupus erythematosus in six patients with a median onset of 2.5 months (0-89). Four out of 10 patients developed bullous systemic lupus erythematosus simultaneously with systemic lupus erythematosus. Hematologic abnormalities and renal involvement were found in 100% and 90%, respectively. Polyarthritis (40%) and serositis (40%) were less frequently seen. Systemic corticosteroids, immunosuppressants, antimalarials and dapsone offered resolution of cutaneous lesions. Conclusion Bullous systemic lupus erythematosus is an uncommon presentation of systemic lupus erythematosus. Blistering can occur following or simultaneously with established systemic lupus erythematosus. We propose that clinicians should carefully search for systemic involvement, especially hematologic and renal impairment, in patients presenting with bullous systemic lupus erythematosus.

  11. Spontaneous ureteral rupture in a patient with systemic lupus erythematosus

    SciTech Connect

    Benson, C.H.; Pennebaker, J.B.; Harisdangkul, V.; Songcharoen, S.

    1983-08-01

    A patient with known systemic lupus erythematosus had fever and symptoms of a lower urinary tract infection. Bone scintigraphy showed left ureteral perforation and necrosis with no demonstrable nephrolithiasis. It is speculated that this episode was due to lupus vasculitis.

  12. Pauci-immune lupus nephritis: possibility or co-incidence?

    PubMed Central

    Cansu, Döndü Üsküdar; Temiz, Gökhan; Açıkalın, Mustafa F.; Korkmaz, Cengiz

    2017-01-01

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized with immune complex formation and renal involvement of lupus and may include several kinds of pathological conditions, but mostly, it is associated with immune complex-induced glomerular disease. Pauci-immune lupus nephritis is a very rare condition. We describe a 45-year-old female patient with pauci-immune crescentic necrotizing lupus nephritis and briefly discuss the possible mechanism and pathogenesis. PMID:28293460

  13. Lupus

    MedlinePlus

    ... Be careful with supplements Never take vitamins or herbal supplements without talking to your doctor first. They might ... you to take a vitamin for this reason. Herbal supplements have no proven benefit and can cause harm. ...

  14. Lupus vulgaris: report of two cases.

    PubMed

    Wozniacka, Anna; Schwartz, Robert A; Sysa-Jedrzejowska, Anna; Borun, Marta; Arkuszewska, Cecylia

    2005-04-01

    Although there has been a steady decline in the incidence of tuberculosis in recent years, it persists in some regions, and where AIDS is especially prevalent, the number of new cases has been increasing. Thus, cutaneous tuberculosis has re-emerged in areas with a high incidence of HIV infection and multidrug-resistant pulmonary tuberculosis. Lupus vulgaris has been and remains the most common form of cutaneous tuberculosis. Cutaneous manifestations of disseminated tuberculosis are unusual, being seen in less than 0.5% of cases. Scrofuloderma, tuberculosis verrucosa cutis and lupus vulgaris comprise most cutaneous tuberculosis cases. Bacillus Calmette-Guerin (BCG) is derived from an attenuated strain of Mycobacterium bovis and is employed beneficially as a relatively safe vaccination in Poland and other countries in which the prevalence of tuberculosis is high. However, BCG vaccination may produce complications, including disseminated BCG and lupus vulgaris, the latter seen in one of our two patients in whom lupus vulgaris at the inoculation site followed a second vaccination with BCG 12 years after the initial one. A similar phenomenon has been described after immunotherapy with BCG vaccination. Re-infection (secondary) inoculation cutaneous tuberculosis may also occur as a result of BCG vaccination, producing either lupus vulgaris or tuberculosis verrucosa cutis, probably depending upon the patient's degree of cell-mediated immunity. However, most lupus vulgaris cases are not associated with vaccination with BCG, as occurred in our first patient. For those who do develop lupus vulgaris, it can be persistent for a long period, in some cases for many decades. In the second patient we describe a lengthy duration and cutaneous reactivation at distant sites after more than 40 years.

  15. Novel Therapeutic Target for the Treatment of Lupus

    DTIC Science & Technology

    2013-12-01

    RhoB. 15. SUBJECT TERMS RhoB, animal model, antibody secretion, antibody therapy, Systemic lupus erythematosus , autoantibodies. 16. SECURITY...9. Other Achievements 10. References 11. Appendices 1. INTRODUCTION: Systemic lupus erythematosus (SLE) affects approximately 300,000 to over...therapy, Systemic lupus erythematosus , autoantibodies. 3. OVERALL PROJECT SUMMARY: Objective to complete in the award period of 18 months

  16. Oxidized Hemoglobin Is Antigenic and Immunogenic in Lupus

    PubMed Central

    Jain, Sonia; Bose, Anjali; Bastia, Banajit; Sharma, Hritika; Sachdeva, Ruchi; Jain, Arun K.; Pal, Rahul

    2017-01-01

    Hemolysis-associated anemia is characteristic of diseases such as atherosclerosis, lupus, malaria, and leishmaniasis; the toxic effects of free hemoglobin (Hb) have been extensively described. This study was based on the premise that release of this sequestered, inflammatory molecule can result in deleterious immunological consequences, particularly in the context of pre-existing lupus. IgG anti-Hb responses were detected in the sera of lupus patients. Lupus-prone mice exhibited heightened plasma Hb levels, and ferric (Fe3+) Hb triggered preferential release of lupus-associated cytokines from splenocytes derived from aging lupus-prone mice. Anti-Hb B cell precursor frequencies were heightened in such mice, which also expressed increased titers of anti-Hb antibodies in serum and in kidney eluates. Fe3+ Hb preferentially increased the functional maturation of bone marrow-derived dendritic cells (BMDCs) from lupus-prone mice, effects abrogated upon the inhibition of Stat3. Hb interacted with lupus-associated autoantigens extruded during apoptosis and coincubation of Hb and apoptotic blebs had additional maturation-inducing effects on lupus BMDCs. Immunization with Hb in lupus-prone mice induced antigen spreading to lupus-associated moieties; Hb-interacting autoantigens were preferentially targeted and increased complement deposition and glomerulosclerosis were observed. Hb therefore demonstrates both antigenicity and immunogenicity and triggers specific immuno-pathological effects in a lupus milieu. PMID:28694810

  17. Aseptic colon resection by an invagination technique. Experimental study on dogs.

    PubMed

    Jørgensen, L S; Raundahl, U; Knudsen, L L; Aksglaede, K; Søgaard, P

    1991-07-01

    A new aseptic colon resection by an invagination technique is presented. The bowel to be resected is invaginated down into the healthy intestine, and the anastomosis is sutured in one layer of continuous suture before transection by a diathermy wire, placed in the intestinal lumen via the anus. Sections of bowel that cannot be invaginated, e.g., because of a tumor, are first removed by transection between pairs of cable ties, which close the lumen. Twenty dogs were operated on without receiving prophylactic antibiotics. In 10, the intestine was transected between cable ties. An imprint, taken from the anastomosis and subcutis, was cultured. The bacterial count at the anastomosis exceeded 100 in only three cases; in the subcutis, this was the case in one dog. One wound infection developed. Serial barium enemas at 1, 2, 3, and 4 weeks revealed no anastomotic leakage. One early death because of a total anastomotic dehiscence was encountered, and two dogs were killed because of wound dehiscence and anastomotic stricture, respectively. It is concluded that, in dogs, the method is easily and safely performed, but further experimental studies are needed.

  18. Is recurrent aseptic meningitis a manifestation of familial Mediterranean fever? A systematic review.

    PubMed

    Capron, Jean; Grateau, Gilles; Steichen, Olivier

    2013-01-01

    Familial Mediterranean fever (FMF) causes recurrent episodes of fever and painful serositis. It has been suggested that FMF can cause recurrent aseptic meningitis (RAM). Due to the rarity of both diseases, this claim cannot be assessed with epidemiological methods. We therefore decided to perform a systematic review of the literature to assess the number and validity of published case reports. Medline, Embase, Pascal, Web of Science and the proceedings of relevant conferences were searched. Two independent investigators selected reports asserting RAM in FMF patients, abstracted data and rated the strength of evidence with a custom tool designed to assess: (a) the diagnosis of FMF; (b) the diagnosis of RAM; and (c) the link between FMF and RAM. A causal link was supported by (i) evidence of inflammation and/or clinical FMF features during episodes of RAM; (ii) effectiveness of colchicine to prevent further bouts of meningitis; and (iii) the exclusion of other causes of RAM. Among 944 retrieved references, 917 were rejected by title and abstract screening and 15 after full text review. The strength of evidence of 12 alleged cases of RAM due to FMF was assessed. FMF was unsupported in 4 cases and RAM in 3 further cases. Four of the 5 remaining cases did not provide adequate evidence to support a causal relationship between FMF and RAM. The possibility of RAM due to FMF is poorly supported by a single fairly documented case report that does not, however, meet current diagnostic standards.

  19. Growth and colour development of some surface ripening bacteria with Debaryomyces hansenii on aseptic cheese curd.

    PubMed

    Mounier, Jérôme; Irlinger, Françoise; Leclercq-Perlat, Marie-Noëlle; Sarthou, Anne-Sophie; Spinnler, Henry-Eric; Fitzgerald, Gerald F; Cogan, Timothy M

    2006-11-01

    The growth of five bacteria isolated from red-smear cheeses, Brevibacterium aurantiacum, Corynebacterium casei, Corynebacterium variabile, Microbacterium gubbeenense and Staphylococcus saprophyticus in mixed cultures with Debaryomyces hansenii on aseptic model cheese curd at 10 and 14 degrees C was investigated. At both temperatures, C. casei and Micro. gubbeenense had a longer lag phase than C. variabile, Brevi. aurantiacum and Staph. saprophyticus. In all cultures, lactose was utilised first and was consumed more rapidly at 14 degrees C than at 10 degrees C, i.e., 6 d at 14 degrees C and 10 d at 10 degrees C. This utilisation coincided with the exponential growth of Deb. hansenii on the cheese surface. Lactate was also used as a carbon source and was totally consumed after 21 d at 14 degrees C and approximately 90% was consumed after 21 d at 10 degrees C regardless of the ripening culture. Small differences (<0.5 pH unit) in the surface-pH during ripening were noticeable between ripening cultures. Differences in the colour development of the mixed cultures with the yeast control were only noticeable after 15 d for Brevi. aurantiacum and after 21 d for the other bacteria. Regardless of the organisms tested, colour development and colour intensity were also greater at 14 degrees C than at 10 degrees C. This study has provided useful information on the growth and contribution to colour development of these bacteria on cheese.

  20. Adhesion molecules in gonarthrosis and knee prosthesis aseptic loosening follow-up: possible therapeutic implications.

    PubMed

    Dambra, P; Loria, M P; Moretti, B; D'Oronzio, L; Patella, V; Pannofino, A; Cavallo, E; Pesce, V; Dell'Osso, A; Simone, C

    2003-05-01

    The involvement of the synovium is common in phlogistic processes of various joint diseases. Apart from synoviocytes and the other cells in the synovial tissue, circulating cells recruited from peripheral blood also participate in the phlogistic process. The increased expression of adhesion molecules on both circulating and endothelial cell surface may further this recruitment. We studied 15 patients affected by serious gonarthrosis requiring a prosthetic implant (GPI) and 7 with knee prosthesis aseptic loosening (KPL) to evaluate adhesion molecule expression and phlogistic infiltration in the synovium using immunohistochemistry and microscopic analysis. As control we studied 10 subjects affected by degenerative meniscopathies undergoing a selective arthroscopic surgical meniscectomy. Analysis with Kruskal-Wallis test showed no statistical significant differences in the expression of CD54, CD11a, CD11b and CD18 in three groups examined. The model of variance analysis (Friedman test), showed that CD54 expression is greater in patients with GPI and KPL in comparison with the other molecules. Adhesion molecules and their functions are important in arthropathies not only because their evaluation can allow us to identify the degree of inflammation and to predict its evolution, but also because pharmacological control of their expression could have important therapeutic implications.

  1. Teriparatide (rh [1-34] PTH) improved osteointegration of a hemiarthroplasty with signs of aseptic loosening.

    PubMed

    Oteo-Álvaro, Ángel; Matas, José A; Alonso-Farto, Juan C

    2011-09-09

    Incidences of osteoporosis and fragility fractures are constantly increasing, which are associated with increased morbidity and mortality. When these patients undergo surgery, a higher number of postoperative complications may be expected because of poor bone quality and delayed healing. As a result, poorer primary stability of the implant, initial loosening, and impaired fixation strength in different regions may be seen. In these patients, we can choose the most advanced implants, but it is necessary to stimulate bone biology to increase the stability of the implant. This article reports the result obtained in a patient diagnosed with osteoporosis with aseptic loosening of a hip hemiarthroplasty after treatment with teriparatide (rh [1-34] PTH). This drug is indicated for the treatment of osteoporosis in men and postmenopausal women with high fracture risk and glucocorticoid-induced osteoporosis, and is administered subcutaneously for 2 years. It has an anabolic effect through stimulation of the osteoblast population that increases trabecular connectivity, cortical thickness, and bone mineral content. In animal models, teriparatide improved implant fixation 2 to 4 weeks after administration, resulting in the thickening of bone trabeculae and increased bone mass in the peri-implant area. In this retrospective analysis of clinical data and radiographic and scintigraphic images, after 24 months of treatment, the patient experienced clinical improvement associated with the disappearance of radiographic signs of loosening and a decrease in pathological radiotracer uptake in the bone scan, which are signs of osteointegration after treatment with teriparatide. Copyright 2011, SLACK Incorporated.

  2. Iron Supplementation Effects on Redox Status following Aseptic Skeletal Muscle Trauma in Adults and Children

    PubMed Central

    Tsiokanos, Athanasios; Georgakouli, Kalliopi; Zalavras, Athanasios; Avloniti, Alexandra; Koutedakis, Yiannis

    2017-01-01

    Exercise-induced skeletal muscle microtrauma is characterized by loss of muscle cell integrity, marked aseptic inflammatory response, and oxidative stress. We examined if iron supplementation would alter redox status after eccentric exercise. In a randomized, double blind crossover study, that was conducted in two cycles, healthy adults (n = 14) and children (n = 11) received daily either 37 mg of elemental iron or placebo for 3 weeks prior to and up to 72 h after an acute eccentric exercise bout. Blood was drawn at baseline, before exercise, and 72 h after exercise for the assessment of iron status, creatine kinase activity (CK), and redox status. Iron supplementation at rest increased iron concentration and transferrin saturation (p < 0.01). In adults, CK activity increased at 72 h after exercise, while no changes occurred in children. Iron supplementation increased TBARS at 72 h after exercise in both adults and children; no changes occurred under placebo condition. Eccentric exercise decreased bilirubin concentration at 72 h in all groups. Iron supplementation can alter redox responses after muscle-damaging exercise in both adults and children. This could be of great importance not only for healthy exercising individuals, but also in clinical conditions which are characterized by skeletal muscle injury and inflammation, yet iron supplementation is crucial for maintaining iron homeostasis. This study was registered at Clinicaltrials.gov Identifier: NCT02374619. PMID:28203319

  3. Acute respiratory distress syndrome complicating generalized pustular psoriasis (psoriasis-associated aseptic pneumonitis).

    PubMed

    Kluger, Nicolas; Bessis, Didier; Guillot, Bernard; Girard, Céline

    2011-06-01

    Generalized pustular and/or erythrodermic psoriasis may have severe or even lethal complications. A peculiar noninfectious acute respiratory distress syndrome (so-called "sterile pneumonitis") has been described in generalized pustular psoriasis and/or erythrodermic psoriasis. We report a new case in a 14-year-old girl with a long history of pustular psoriasis and review the published work on this complication. The girl developed sterile pneumonitis during a disease flare-up, and high-dose corticosteroid therapy was quickly initiated. Within a few days, her clinical and radiological status was dramatically improved. The pathogenesis of aseptic pneumonitis is unknown, but various proinflammatory cytokines have been implicated, especially tumor necrosis factor-alpha, which could play a role in the recruitment of leukocytes to the lung. This complication has rarely been reported but should be more widely known as the differential diagnoses include congestive heart failure, acute lung infection related or unrelated to immunosuppressive therapy, and drug hypersensitivity reaction. Early recognition would avoid delays in the correct management of this potentially lethal complication, which requires high-dose systemic corticosteroid therapy. Copyright © 2009 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  4. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature

    PubMed Central

    Scaffidi, Michael A.; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon. PMID:28265555

  5. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature.

    PubMed

    Bollegala, Natasha; Khan, Rishad; Scaffidi, Michael A; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol; Grover, Samir C

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon.

  6. [Simultaneous determination of various aseptics and sweeteners in milk and dairy products].

    PubMed

    Song, Ge; Jiang, Jindou; Zhang, Qiumei

    2010-03-01

    A method for simultaneous determination of acesulfame, benzoic acid, sodium saccharin, sorbic acid, and aspartame in milk and dairy products using high performance liquid chromatography (HPLC) was developed. The proteins in milk and dairy products were mostly eliminated by the precipitators. Three aseptics and two sweeteners were separated on a C18 column with the mobile phase of methanol-0.05 mol/L potassium dihydrogen phosphate under gradient elution. With a diode array detector, acesulfame, benzoic acid, and sorbic acid were detected at 230 nm and sodium saccharin and aspartame were detected at 210 nm. The recoveries were 96.0% - 103.5% with the relative standard deviations (RSDs) in the range of 1.93% - 2.76%. The detection limits of acesulfame, benzoic acid, sodium saccharin, sorbic acid and aspartame were 1.0, 1.0, 0.5, 1.0, and 1.5 microg/g, respectively. This method can be used for the routine analysis of these additives in milk and dairy products.

  7. Cementless revisions of failed aseptic cemented and cementless total hip arthroplasties. 284 cases.

    PubMed

    Lord, G; Marotte, J H; Guillamon, J L; Blanchard, J P

    1988-10-01

    Over the past 13 years, 284 revisions of aseptic total hip arthroplasty failures have been performed with cementless implants. There were 213 cases involving cemented implant failures and 71 involving cementless ones. Considered as salvage procedures, these revisions provided a satisfactory result in about 70% of the reviewed patients after five years. A biologic fixation by bony ingrowth can be expected under certain conditions from decorticated living bone, a tight mechanical fitting, and a retentive corrugated surface of the implant. A prosthetic reimplantation, safely done without cement, appears more economical for the bone stock and prevents the long-term complications related with cement. Bone grafts are often required but cannot ensure the incoming osteogenic fixation of the implant. Long-term results and complications mandate harmless extractability of the revisional implant, a forged stem, an easy exchange of the plastic liner (in a two-part acetabular component), and an updated low-friction system (high-density polyethylene wear being a potential long-term problem).

  8. Bilateral non-traumatic aseptic osteonecrosis in the femoral head. An experimental study of incidence

    SciTech Connect

    Hauzeur, J.P.; Pasteels, J.L.; Orloff, S.

    1987-10-01

    Thirty-five patients who were seen with non-traumatic aseptic osteonecrosis of the femoral head were included in a study of the contralateral hip to evaluate the incidence of bilateral disease. We used not only conventional radiography and scintigraphy but also measurement of intramedullary pressure and core biopsy. Pain was caused by 14.3 per cent of the contralateral hips, a lesion was demonstrated on plain radiographs in 51.4 per cent, and increased isotopic uptake was seen in 31.4 per cent. Histological study of specimens obtained by osteomedullary biopsy (after special procedure) showed bilateral necrosis in 88.5 per cent of the patients. After a mean follow-up of thirty-four months, only one of nine hips that were painless and had negative radiographic and isotopic findings, but had positive findings on biopsy, became painful and radiographically positive. The intramedullary pressure in the intertrochanteric area was recorded in each hip, and no correlation was found with the radiographic stage or with pain.

  9. Molecular phylogeny and surface morphology of marine aseptate gregarines (Apicomplexa): Selenidium spp. and Lecudina spp.

    PubMed

    Leander, B S; Harper, J T; Keeling, P J

    2003-12-01

    Many aseptate gregarines from marine invertebrate hosts are thought to have retained several plesiomorphic characteristics and are instrumental in understanding the early evolution of intracellular parasitism in apicomplexans and the phylogenetic position of cryptosporidians. We sequenced the small-subunit (SSU) ribosomal RNA genes from 2 archigregarines, Selenidium terebellae and Selenidium vivax, and 2 morphotypes of the marine eugregarine Lecudina polymorpha. We also used scanning electron microscopy to investigate the surface morphology of trophozoites from Lecudina tuzetae, Monocystis agilis, the 2 species of Selenidium, and the 2 morphotypes of L. polymorpha. The SSU ribosomal DNA sequences from S. vivax and L. polymorpha had long branch lengths characteristic of other gregarine sequences. However, the sequence from S. terebellae was not exceptionally divergent and consistently emerged as 1 of the earliest 'true' gregarines in phylogenetic analyses. Statistical support for the sister relationship between Cryptosporidium spp. and gregarines was significantly bolstered in analyses including the sequence from S. terebellae but excluding the longest branches in the alignment. Eugregarines formed a monophyletic group with the neogregarine Ophryocystis, suggesting that trophozoites with elaborate cortex folds and gliding motility evolved only once. The trophozoites from the 2 species of Selenidium shared novel transverse striations but differed from one another in overall cell morphologies and writhing behavior.

  10. [Clinical, epidemiological and etiological studies of adult aseptic meningitis: Report of 13 cases with mumps meningitis].

    PubMed

    Takeshima, Shinichi; Yoshimoto, Takeshi; Shiga, Yuji; Kanaya, Yuhei; Neshige, Shuichiro; Himeno, Takahiro; Kono, Ryuhei; Takamatsu, Kazuhiro; Shimoe, Yutaka; Kuriyama, Masaru

    2015-01-01

    We experienced 13 cases (29.8 ± 7.0 years) of mumps meningitis and 365 cases of adult aseptic meningitis during 11 years from 2004 to 2014. A small epidemic of mumps occurred for 3-4 years, and the incidence rate of adult mumps meningitis coincided with the epidemic without seasonal fluctuation. Parotitis was observed in 8 of the 13 mumps meningitis patients (61.5%) and orchitis in 2 of 7 male patients (28.6%). There were no differences in clinical manifestations, laboratory findings, and outcome between patients with adult mumps meningitis and those with echovirus 9 meningitis (9 patients), except for the low frequency of nausea/vomiting and a high percentage of mononuclear cells of the cerebrospinal fluid in those with mumps. Eight patients had contact with persons with mumps before the symptomatic stage of meningitis. Only one patient had received mumps vaccination in childhood. On the basis of the values of the anti-mumps IgM and IgG antibodies, we speculated primary infection and the re-infection of mumps in 6 and 2 patients, respectively. Moreover, second vaccine failure was suggested in the vaccinated patient.

  11. A case of cerebral salt-wasting syndrome associated with aseptic meningitis in an 8-year-old boy.

    PubMed

    Inatomi, Jun; Yokoyama, Yoshiki; Sekine, Takashi; Igarashi, Takashi

    2008-04-01

    Cerebral salt-wasting syndrome is a disorder in which excessive natriuresis and subsequent hyponatremic dehydration occur in patients with intracranial diseases. Cerebral salt-wasting syndrome often develops in patients with severe neurosurgical disorders, such as hydrocephalus, cerebral infarction, and tuberculous meningitis. Here, we report on the case of an 8-year-old boy with cerebral salt-wasting syndrome associated with aseptic meningitis. He showed mild developmental retardation and had a history of convulsion. Four days after his admission, cerebral salt-wasting syndrome abruptly started: natriuresis and hyponatremia gradually improved over 10 days. To the best of our knowledge, this is the first report on cerebral salt-wasting syndrome associated with clinically benign aseptic meningitis.

  12. Vitrification of human laser treated blastocysts within cut standard straws (CSS): novel aseptic packaging and reduced concentrations of cryoprotectants.

    PubMed

    Isachenko, Vladimir; Katkov, Igor I; Yakovenko, Sergey; Lulat, Ayub G-M I; Ulug, Murat; Arvas, Ayse; Isachenko, Evgenia

    2007-06-01

    Vitrification of laser treated human blastocysts using reduced concentrations of permeable cryoprotectants was carried out by submerging cut standard straws (CSS) into liquid nitrogen. The CSS were made by cutting a standard 0.25 ml straw at an angle of approximately 45 degrees . After laser assisted hatching, 6 day blastocysts (n=250) were loaded into droplets of approximately 0.75 microl in the CSS and were either plunged directly into liquid nitrogen or first encased in a standard 0.5 ml straw (aseptic technique) before being vitrified. Permeable cryoprotectants (ethylene glycol+Me(2)SO) at concentrations of 15% and 20% v:v were tested for their effect on post warming re-expansion and post transfer pregnancy rates. Our results indicate that the use of reduced concentrations of cryoprotectants and aseptic packaging of blastocysts did not have any statistically significant impact on the study outcomes.

  13. Burden of lupus on work: Issues in the employment of individuals with lupus.

    PubMed

    Agarwal, Neelam; Kumar, Vinod

    2016-10-17

    Systemic lupus erythematosus (SLE) or Lupus is one of the leading causes of work disability in the United States, accounting for about 20% of the more than estimated 1.5 million Americans with a work disability. The symptoms of lupus can have a profound impact on the person's employment. Impacts of lupus are more pronounced among young and middle-adulthood. Studies have shown that loss in work hours cost the nation nearly $13 billion annually. The loss also impacts the individual's work, quality of life, self-management, and self-efficacy. In this article, the author describes the financial burden of lupus. The article also describes the substantial impact of lupus on employment outcomes for individuals living with the condition. The author also reviews major signs and symptoms of disease and their impact on employment. Findings from this research can be used to identify various accommodations and strategies for individuals to prevent flare-ups. The paper presents innovative strategies that include early interventions and how employers andco-workers can provide helpful support that includes job accommodations to individuals with lupus.

  14. Obstetric nephrology: lupus and lupus nephritis in pregnancy.

    PubMed

    Stanhope, Todd J; White, Wendy M; Moder, Kevin G; Smyth, Andrew; Garovic, Vesna D

    2012-12-01

    SLE is a multi-organ autoimmune disease that affects women of childbearing age. Renal involvement in the form of either active lupus nephritis (LN) at the time of conception, or a LN new onset or flare during pregnancy increases the risks of preterm delivery, pre-eclampsia, maternal mortality, fetal/neonatal demise, and intrauterine growth restriction. Consequently, current recommendations advise that the affected woman achieve a stable remission of her renal disease for at least 6 months before conception. Hormonal and immune system changes in pregnancy may affect disease activity and progression, and published evidence suggests that there is an increased risk for a LN flare during pregnancy. The major goal of immunosuppressive therapy in pregnancy is control of disease activity with medications that are relatively safe for a growing fetus. Therefore, the use of mycophenolate mofetil, due to increasing evidence supporting its teratogenicity, is contraindicated during pregnancy. Worsening proteinuria, which commonly occurs in proteinuric renal diseases toward the end of pregnancy, should be differentiated from a LN flare and/or pre-eclampsia, a pregnancy-specific condition clinically characterized by hypertension and proteinuria. These considerations present challenges that underscore the importance of a multidisciplinary team approach when caring for these patients, including a nephrologist, rheumatologist, and obstetrician who have experience with these pregnancy-related complications. This review discusses the pathogenesis, maternal and fetal risks, and management pertinent to SLE patients with new onset or a history of LN predating pregnancy.

  15. High early post-operative complication rate after elective aseptic orthopedic implant removal of upper and lower limb.

    PubMed

    Suda, Arnold J; Heilgeist, Eva; Tinelli, Marco; Bischel, Oliver E

    2017-09-01

    The necessity of orthopedic implant removal is under intense discussion and even if it is performed as an elective procedure, the risk of complications is present. Aim of the study was to identify parameters responsible for an increased risk of early post-operative complications after elective aseptic orthopedic implant removal. We reviewed 1545 cases of aseptic and elective orthopedic implant removal between 2009 and 2011. The patient's demographic data, time and duration of operation, patient's comorbidities and presence of complications in the first four weeks after implant removal were evaluated. Patients with signs of infection at the time of the surgical procedure were excluded from this study. 579 women and 966 men who underwent elective aseptic orthopedic implant removal were identified. Mean age at implant removal was 42 years and mean duration of the surgical procedure was 37 minutes. In this cohort, 70 patients (4.5%) underwent elective aseptic implant removal after 6pm. 52 patients (3.37%) operated on during daytime suffered from complications postoperatively and 5 patients (0.3%) who were operated on during the night experienced complications. The parameters age, sex, BMI and surgeon showed no statistically significant differences for the risk of postoperative complications. Patients' comorbidities such as diabetes seem to have influence but were not statistically significant either. Patients with revision surgery since their first operation, nocturnal surgery and longer duration of the procedure showed a statistically significant higher risk for complications, especially in the lower leg. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  16. Pyomyositis in childhood-systemic lupus erythematosus.

    PubMed

    Blay, Gabriela; Ferriani, Mariana P L; Buscatti, Izabel M; França, Camila M P; Campos, Lucia M A; Silva, Clovis A

    2016-01-01

    Pyomyositis is a pyogenic infection of skeletal muscle that arises from hematogenous spread and usually presents with localized abscess. This muscle infection has been rarely reported in adult-onset systemic lupus erythematous and, to the best of our knowledge, has not been diagnosed in pediatric lupus population. Among our childhood-onset systemic lupus erythematous population, including 289 patients, one presented pyomyositis. This patient was diagnosed with childhood-onset systemic lupus erythematous at the age of 10 years-old. After six years, while being treated with prednisone, azathioprine and hydroxychloroquine, she was hospitalized due to a 30-day history of insidious pain in the left thigh and no apparent trauma or fever were reported. Her physical examination showed muscle tenderness and woody induration. Laboratory tests revealed anemia, increased acute phase reactants and normal muscle enzymes. Computer tomography of the left thigh showed collection on the middle third of the vastus intermedius, suggesting purulent stage of pyomyositis. Treatment with broad-spectrum antibiotic was initiated, leading to a complete clinical resolution. In conclusion, we described the first case of pyomyositis during childhood in pediatric lupus population. This report reinforces that the presence of localized muscle pain in immunocompromised patients, even without elevation of muscle enzymes, should raise the suspicion of pyomyositis. A prompt antibiotic therapy is strongly recommended.

  17. Intravenous immunoglobulin therapy and systemic lupus erythematosus.

    PubMed

    Zandman-Goddard, Gisele; Levy, Yair; Shoenfeld, Yehuda

    2005-12-01

    Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease with diverse manifestations. We suggest that intravenous immunoglobulin (IVIg) therapy may be beneficial and safe for various manifestations in SLE. A structured literature search of articles published on the efficacy of IVIg in the treatment of SLE between 1983 and 2005 was conducted. We searched the terms "IVIg," "intravenous immunoglobulin," "lupus," "SLE," and "systemic lupus erythematosus." The various clinical manifestations of SLE that were reported to be successfully treated by IVIg in case reports include autoimmune hemolytic anemia, acquired factor VIII inhibitors, acquired von Willebrand disease, pure red cell aplasia, thrombocytopenia, pancytopenia, myelofibrosis, pneumonitis, pleural effusion, pericarditis, myocarditis, cardiogenic shock, nephritis, end-stage renal disease, encephalitis, neuropsychiatric lupus, psychosis, peripheral neuropathy, polyradiculoneuropathy, and vasculitis. The most extensive experience is with lupus nephritis. There are only a few case series of IVIg use in patients with SLE with various manifestations, in which the response rate to IVIg therapy ranged from 33 to 100%. We suggest that IVIg devoid of sucrose, at a dose of 2 g/kg over a 5-d period given uniformly and at a slow infusion rate in patients without an increased risk for thromboembolic events or renal failure, is a safe and beneficial adjunct therapy for cases of SLE that are resistant to or refuse conventional treatment. The duration of therapy is yet to be established. Controlled trials are warranted.

  18. PKK deficiency in B cells prevents lupus development in Sle lupus mice.

    PubMed

    Oleksyn, D; Zhao, J; Vosoughi, A; Zhao, J C; Misra, R; Pentland, A P; Ryan, D; Anolik, J; Ritchlin, C; Looney, J; Anandarajah, A P; Schwartz, G; Calvi, L M; Georger, M; Mohan, C; Sanz, I; Chen, L

    2017-03-06

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by the production of autoantibodies that can result in damage to multiple organs. It is well documented that B cells play a critical role in the development of the disease. We previously showed that protein kinase C associated kinase (PKK) is required for B1 cell development as well as for the survival of recirculating mature B cells and B-lymphoma cells. Here, we investigated the role of PKK in lupus development in a lupus mouse model. We demonstrate that the conditional deletion of PKK in B cells prevents lupus development in Sle1Sle3 mice. The loss of PKK in Sle mice resulted in the amelioration of multiple classical lupus-associated phenotypes and histologic features of lupus nephritis, including marked reduction in the levels of serum autoantibodies, proteinuria, spleen size, peritoneal B-1 cell population and the number of activated CD4 T cells. In addition, the abundance of autoreactive plasma cells normally seen in Sle lupus mice was also significantly decreased in the PKK-deficient Sle mice. Sle B cells deficient in PKK display defective proliferation responses to BCR and LPS stimulation. Consistently, B cell receptor-mediated NF-κB activation, which is required for the survival of activated B cells, was impaired in the PKK-deficient B cells. Taken together, our work uncovers a critical role of PKK in lupus development and suggests that targeting the PKK-mediated pathway may represent a promising therapeutic strategy for lupus treatment.

  19. Osteonecrosis in systemic lupus erythematosus.

    PubMed

    Gontero, Romina Patricia; Bedoya, María Eugenia; Benavente, Emilio; Roverano, Susana Graciela; Paira, Sergio Oscar

    2015-01-01

    To define the proportion of osteonecrosis (ON) in our patient population with lupus and to identify factors associated with the development of ON in systemic lupus erythematosus, as well as to carry out a descriptive analysis of ON cases. Observational retrospective study of 158 patients with SLE (ACR 1982 criteria). Demographic and laboratory data, clinical manifestations, SLICC, SLEDAI, cytotoxic and steroid treatments were compared. In patients with ON, we analyzed time of disease progression and age at ON diagnosis, form of presentation, joints involved, diagnostic methods, Ficat-Arlet classification, and treatment. To compare the means, t-test or Mann-Whitney's test were employed and the cHi-2 test or Fisher's exact test, as appropriate, were used to measure the equality of proportions. ON was present in 15 out 158 patients (9.5%), 13 women and 2 men, with a mean age of 30 (r: 16-66) at diagnosis and 35 months of evolution until diagnosis (r: 1-195). Among the 15 patients, 34 joints presented ON, 23 were symptomatic and 22 were diagnosed by magnetic resonance images. Twenty-six occurred in hips (24 bilateral), 4 in knees and 4 in shoulders. In 13 patients, ON involved 2 or more joints. At onset, 28 joints were in stage i-ii, one in stage iii and 5 had no data and; in the end, 14 were in stage iii-iv, 5 in stage i-ii and 15 had no data. Twenty-nine underwent conservative treatment with rest and 8 hips required joint replacement. ON progression was associated with Cushing's syndrome (P=0.014) OR 4.16 (95% CI 1.4-12.6) and 2nd year SLICC (P=0.042). No relation with clinical manifestations, lab results, cytotoxic treatment, steroid treatment (total accumulated dose, mean daily dose and duration) metilprednisolone pulses, nor activity was found. All patients with ON received antimalarials, in contrast to 77% of those without ON. The proportion of ON was 9.5%, mainly in women, 76% in hips (26) and 92% bilaterally. They were associated significantly with Cushing

  20. Establishment of an operating room committee and a training program to improve aseptic techniques for rodent and large animal surgery.

    PubMed

    Héon, Hélène; Rousseau, Nathalie; Montgomery, Jane; Beauregard, Gilles; Choiniére, Manon

    2006-11-01

    Investigators of our research facility generally accept the concept of asepsis as an important component of adequate surgical care for animals. However, they experience difficulties putting it into practice, especially in the case of rodents. The reasons for this are inconvenience, cost, and lack of training. To better assist investigators in the implementation of aseptic surgical techniques in their laboratories, we have created an Operating Room (OR) Committee modeled after OR committees found in human hospitals. A reconstructive surgeon, a veterinarian, a research scientist, a nurse involved in the training of OR personnel, interns, graduate students, and an animal health technician were chosen as committee members in light of their OR and animal care expertise. The first task of the OR Committee was to establish institutional guidelines for aseptic surgery, taking into account the costs imposed on research budgets by these procedures. The OR Committee also supports a complete training program in aseptic surgery techniques, which consists of lectures, a training manual, videos, and a practical course. Furthermore, when experimental procedures require specialized equipment, the OR Committee collaborates with researchers to develop strategies to achieve asepsis. This OR Committee and the training program proved to be important tools to promote and improve the quality of animal care during surgery.

  1. Periorbital discoid lupus: a rare localization in a patient with systemic lupus erythematosus.

    PubMed

    Cakici, Ozgur; Karadag, Remzi; Bayramlar, Huseyin; Ozkanli, Seyma; Uzuncakmak, Tugba Kevser; Karadag, Ayse Serap

    2016-01-01

    A 40-year-old female patient with a 5-year history of systemic lupus erythematosus was referred to our policlinic with complaints of erythema, atrophy, and telangiectasia on the upper eyelids for 8 months. No associated mucocutaneous lesion was present. Biopsy taken by our ophthalmology department revealed discoid lupus erythematosus. Topical tacrolimus was augmented to the systemic therapeutic regimen of the patient, which consisted of continuous antimalarial treatment and intermittent corticosteroid drugs. We observed no remission in spite of the 6-month supervised therapy. Periorbital discoid lupus erythematosus is very unusual and should be considered in the differential diagnosis of erythematous lesions of the periorbital area..

  2. Systemic lupus erythematosus presenting as fulminant lupus pneumonitis: a rare case report.

    PubMed

    Aggarwal, H K; Jain, D; Mittal, A; Rao, A; Yadav, R K; Jain, P

    2016-06-23

    We report a case of 19 year-old female patient diagnosed as systemic lupus erythematosus (SLE) presented with fever and diffuse cutaneous lesions. During the hospital stay she had acute pneumonia, pleural effusion and respiratory failure, which required intensive care unit (ICU) care and mechanical ventilator support. A fulminant course of the disease, decreased values of complement levels and positive antinuclear antibodies (ANA) in pleural fluid and repeated negative sputum for acid-fast bacillus, blood cultures enabled diagnosis of fulminant lupus pneumonitis. Fulminant lupus pneumonitis is a rare but potentially life threatening complication of SLE. Management requires involvement of multiple specialties and rigorous efforts in reviving the patient.

  3. Periorbital discoid lupus: a rare localization in a patient with systemic lupus erythematosus*

    PubMed Central

    Cakici, Ozgur; Karadag, Remzi; Bayramlar, Huseyin; Ozkanli, Seyma; Uzuncakmak, Tugba Kevser; Karadag, Ayse Serap

    2016-01-01

    A 40-year-old female patient with a 5-year history of systemic lupus erythematosus was referred to our policlinic with complaints of erythema, atrophy, and telangiectasia on the upper eyelids for 8 months. No associated mucocutaneous lesion was present. Biopsy taken by our ophthalmology department revealed discoid lupus erythematosus. Topical tacrolimus was augmented to the systemic therapeutic regimen of the patient, which consisted of continuous antimalarial treatment and intermittent corticosteroid drugs. We observed no remission in spite of the 6-month supervised therapy. Periorbital discoid lupus erythematosus is very unusual and should be considered in the differential diagnosis of erythematous lesions of the periorbital area.. PMID:28300917

  4. Cutaneous lupus erythematosus in skin of color.

    PubMed

    Nozile, Wallace; Adgerson, Cheri N; Cohen, George F

    2015-04-01

    Cutaneous Lupus Erythematosus (CLE) is a common manifestation in patients with Systemic Lupus Erythematosus. In a significant population of patients, CLE is the predominant feature and, in some cases, patients suffer from cutaneous disease alone. Chronic Cutaneous Lupus Erythematosus (CCLE) is a scarring subtype, more prevalent in blacks. Patients with skin of color may pose a challenge to physicians due to exaggerated cutaneous findings and increased risk of post-inflammatory hyperpigmentation and hypertrophic scarring. With the demographics of the United States rapidly shifting towards a greater population of non-Caucasian racial and ethnic groups, it is imperative that we expand on the limited research into molecular variation, clinical presentation, and therapeutic efficacy in CLE. The purpose of this review is to bring attention to the unique and severe aspects of CLE in persons of color, which calls for early and aggressive treatment.

  5. Double Valve Replacement for Lupus Valvulitis

    PubMed Central

    Ferraris, Victor A.; Hawksley, Vaughn C.; Rabinowitz, Max; Coyne, Carolyn M.; Sullivan, Thomas J.; Sprague, Merle S.

    1990-01-01

    Hemodynamically significant lupus valvulitis, requiring valve replacement, is rare: 21 cases have been reported so far in the literature, and only 2 of these have involved double valve replacement. We describe an additional case of double valve replacement in a patient with systemic lupus erythematosus. The histopathologic and clinical features of this case suggest that valvular involvement resulted from both acute and chronic disease processes. Medical success in the treatment of systemic lupus erythematosus, especially that achieved through prolonged or high-dose steroid therapy, may cause chronic valvular disease to become a more common surgical problem. A review of the literature supports this contention. (Texas Heart Institute Journal 1990;17:56-60) Images PMID:15227191

  6. Biomarkers for CNS involvement in pediatric lupus

    PubMed Central

    Rubinstein, Tamar B; Putterman, Chaim; Goilav, Beatrice

    2015-01-01

    CNS disease, or central neuropsychiatric lupus erythematosus (cNPSLE), occurs frequently in pediatric lupus, leading to significant morbidity and poor long-term outcomes. Diagnosing cNPSLE is especially difficult in pediatrics; many current diagnostic tools are invasive and/or costly, and there are no current accepted screening mechanisms. The most complicated aspect of diagnosis is differentiating primary disease from other etiologies; research to discover new biomarkers is attempting to address this dilemma. With many mechanisms involved in the pathogenesis of cNPSLE, biomarker profiles across several modalities (molecular, psychometric and neuroimaging) will need to be used. For the care of children with lupus, the challenge will be to develop biomarkers that are accessible by noninvasive measures and reliable in a pediatric population. PMID:26079959

  7. Breast cancer in systemic lupus.

    PubMed

    Bernatsky, S; Ramsey-Goldman, R; Petri, M; Urowitz, M B; Gladman, D D; Fortin, P F; Ginzler, E; Romero-Diaz, J; Peschken, C; Jacobsen, S; Hanly, J G; Gordon, C; Nived, O; Yelin, E H; Isenberg, D; Rahman, A; Bae, S-C; Joseph, L; Witte, T; Ruiz-Irastorza, G; Aranow, C; Kamen, D; Sturfeldt, G; Foulkes, W D; Hansen, J E; St Pierre, Y; Raymer, P Chrétien; Tessier-Cloutier, B; Clarke, A E

    2017-03-01

    Objective There is a decreased breast cancer risk in systemic lupus erythematosus (SLE) versus the general population. We assessed a large sample of SLE patients, evaluating demographic and clinical characteristics and breast cancer risk. Methods We performed case-cohort analyses within a multi-center international SLE sample. We calculated the breast cancer hazard ratio (HR) in female SLE patients, relative to demographics, reproductive history, family history of breast cancer, and time-dependent measures of anti-dsDNA positivity, cumulative disease activity, and drugs, adjusted for SLE duration. Results There were 86 SLE breast cancers and 4498 female SLE cancer-free controls. Patients were followed on average for 7.6 years. Versus controls, SLE breast cancer cases tended to be white and older. Breast cancer cases were similar to controls regarding anti-dsDNA positivity, disease activity, and most drug exposures over time. In univariate and multivariate models, the principal factor associated with breast cancers was older age at cohort entry. Conclusions There was little evidence that breast cancer risk in this SLE sample was strongly driven by any of the clinical factors that we studied. Further search for factors that determine the lower risk of breast cancer in SLE may be warranted.

  8. [Systemic lupus erythematosus and pregnancy].

    PubMed

    Schwarz, P; Halberg, P

    1989-04-24

    The literature about pregnancies in patients with systemic lupus erythematosus (SLE) was reviewed. Information about 1,164 pregnancies was compiled. Fifty-four per cent of the pregnancies were normal, 15 per cent of the babies were premature, and 29 per cent of the pregnancies resulted in fetal wastage. In a background population of 50,000 women the corresponding figures were 80, 4 and 16 per cent, respectively. The neonatal mortality of babies borne by women with SLE was 2 per cent. About one third of the patients had an exacerbation of their disease, mostly post-partum or during the last trimester of the pregnancy. The risk of a exacerbation for patients with active disease at the time of conception was double that of patients with inactive disease. Therapeutic abortions were followed by improvement as well as deterioration of the disease. Two per cent of the patients died during pregnancy or post-partum. Cardiolipin-antibody may be a marker of fetal wastage and Ro-antibody may be a marker of fetal heart block in babies borne by women with SLE. Pregnancy was previously considered inadvisable in all patients with SLE. During recent years, the attitude to this problem has been less rigid. However the patients should be fully informed about the risk of exacerbation, fetal wastage, and premature delivery and patients with active disease should be advised to postpone pregnancy until a remission has been achieved.

  9. [Systemic lupus erythematosus and pregnancy].

    PubMed

    Basheva, S; Nikolov, A; Stoilov, R; Stoilov, N

    2012-01-01

    Connective-tissue disorders, also referred to as collagen-vascular disorders, are characterized by autoantibody-mediated connective-tissue abnormalities. These are also called immune-complex diseases because many involve deposition of immune complexes in specific organ or tissue sites. Some of these disorders are characterized by sterile inflammation, especially of the skin, joints, blood vessels, and kidneys, and are referred to as rheumatic diseases. For inexplicable reasons, many rheumatic diseases primarily affect women. Another major category of connective-tissue diseases includes inherited disorders of bone, skin, cartilage, blood vessels. Examples include Marfan syndrome, osteogenesis imperfecta, and Ehlers-Danlos syndrome. Lupus erythematosus (LE) is the main and most important disease in the group of systemic connective tissue diseases. It is heterogeneous, multiple organs autoimmune inflammatory disease with complex pathogenesis, which is the result of interaction between the susceptible genes and environmental factors that lead to abnormal immune response. In this review will consider: its incidence, pathogenesis, clinical forms and clinical features and diagnosis set based on generally accepted clinical criteria developed by the American College of Rheumatology (ACR), the course of pregnancy in patients suffering from LE, the most common complications of LE during pregnancy and antiphospholipid syndrome as part of LE.

  10. [Neonatal lupus syndrome: Literature review].

    PubMed

    Morel, N; Georgin-Lavialle, S; Levesque, K; Guettrot-Imbert, G; Le Guern, V; Le Bidois, J; Bessières, B; Brouzes, C; Le Mercier, D; Villain, E; Maltret, A; Costedoat-Chalumeau, N

    2015-03-01

    Neonatal lupus syndrome is associated with transplacental passage of maternal anti-SSA/Ro and anti-SSB/La antibodies. Children display cutaneous, hematological, liver or cardiac features. Cardiac manifestations include congenital heart block (CHB); endocardial fibroelastosis and dilated cardiomyopathy. The prevalence of CHB in newborns of anti-Ro/SSA positive women with known connective tissue disease is between 1 and 2% and the risk of recurrence is around 19%. Skin and systemic lesions are transient, whereas CHB is definitive and associated with significant morbidity and a mortality of 18%. A pacemaker must be implanted in 2/3 of cases. Myocarditis may be associated or appear secondly. Mothers of children with CHB are usually asymptomatic or display Sjogren's syndrome or undifferentiated connective tissue disease. In anti-Ro/SSA positive pregnant women, fetal echocardiography should be performed at least every 2 weeks from the 16th to 24th week gestation. An electrocardiogram should be performed for all newborn babies. The benefit of fluorinated corticosteroid therapy for CHB detected in utero remains unclear. Maternal use of hydroxychloroquine may be associated with a decreased recurrent CHB risk in a subsequent offspring. A prospective study is actually ongoing to confirm these findings.

  11. Periodontitis and systemic lupus erythematosus.

    PubMed

    Sete, Manuela Rubim Camara; Figueredo, Carlos Marcelo da Silva; Sztajnbok, Flavio

    2016-01-01

    A large number of studies have shown a potential association between periodontal and autoimmune diseases, such as rheumatoid arthritis and systemic lupus erythematosus (SLE). Similar mechanisms of tissue destruction concerning periodontitis and other autoimmune diseases have stimulated the study of a possible relationship between these conditions. This study aims to review the literature about this potential association and their different pathogenic mechanisms. Considering that periodontal disease is a disease characterized by inflammation influenced by infectious factors, such as SLE, it is plausible to suggest that SLE would influence periodontal disease and vice versa. However, this issue is not yet fully elucidated and several mechanisms have been proposed to explain this association, as deregulation mainly in innate immune system, with action of phagocytic cells and proinflammatory cytokines such as IL-1β and IL-18 in both conditions' pathogenesis, leading to tissue destruction. However, studies assessing the relationship between these diseases are scarce, and more studies focused on common immunological mechanisms should be conducted to further understanding.

  12. Cutaneous lupus erythematosus: An update

    PubMed Central

    Grönhagen, Carina M; Nyberg, Filippa

    2014-01-01

    Lupus erythematosus (LE) is a chronic, autoimmune, multisystem disease that displays many diverse symptoms in which localized cutaneous LE (CLE) is on one end of the spectrum and severe systemic LE (SLE) on the other end. The underlying cause of LE is unknown but the etiology is thought to be multifactorial and polygenic. CLE is a disfiguring, chronic skin disease, with a significant impact on the patients’ everyday life. CLE are further divided into three main subsets: Acute CLE (ACLE), subacute CLE (SCLE) and chronic CLE (CCLE), where classic discoid LE (DLE) is the most common form. These subsets are defined by clinical symptoms, average duration of symptoms and histological and serological findings, although, the three subtypes can have overlapping clinical features. CLE patients display well-defined skin lesions, often in sun-exposed areas. The disease often has a chronic and relapsing course that can be induced or aggravated by UV light. It is important to confirm a CLE diagnosis histopathologically by a biopsy and in that there are several differential diagnoses and because CLE is a chronic disease in which regular follow-up is important and systemic treatment is sometimes indicated. PMID:24616847

  13. Genome-Wide Association Study in African-Americans with Systemic Lupus Erythematosus

    DTIC Science & Technology

    2013-09-01

    Americans with Systemic Lupus Erythematosus PRINCIPAL INVESTIGATOR: John Harley, M.D., Ph.D...SUPPLEMENTARY NOTES 14. ABSTRACT Systemic lupus erythematosus ( lupus ) is a potentially deadly systemic autoimmune disease that disproportionately... Systemic lupus erythematosus ( lupus ) is a potentially deadly systemic autoimmune disease that disproportionately afflicts women and African

  14. Antiphospholipid syndrome nephropathy in systemic lupus erythematosus.

    PubMed

    Daugas, Eric; Nochy, Dominique; Huong, Du Le Thi; Duhaut, Pierre; Beaufils, Hélène; Caudwell, Valérie; Bariety, Jean; Piette, Jean-Charles; Hill, Gary

    2002-01-01

    In the course of the antiphospholipid syndrome (APS), the existence of vaso-occlusive lesions capable of affecting numerous organs is now well established. The renal involvement attributable to primary APS, APS nephropathy (APSN), corresponds to vaso-occlusive lesions of the intrarenal vessels, associating side-by-side, acute thromboses with chronic arterial and arteriolar lesions, leading to zones of cortical ischemic atrophy. A retrospective study of 114 lupus patients undergoing renal biopsy was undertaken to determine the following: (1) if APSN can be found in the course of systemic lupus erythematosus (SLE); (2) if certain clinical and biologic factors can permit the prediction of the presence of APSN; and (3) if APSN is a superadded renal morbidity factor in lupus patients. This study shows the following: (1) APSN occurs in SLE (32% of patients with renal biopsies) in addition to, and independently of, lupus nephritis; (2) APSN is statistically associated with lupus anticoagulant but not with anticardiolipin antibodies; (3) APSN is associated with extrarenal APS, mainly arterial thromboses and obstetrical fetal loss, but not with the venous thromboses of APS; (4) APSN is an independent risk factor, over and above lupus nephritis, that contributes to an elevated prevalence of hypertension, elevated serum creatinine, and increased interstitial fibrosis. Thus, it seems likely that, because of its associations with hypertension, elevated serum creatinine, and increased interstitial fibrosis, APSN may worsen the prognosis in these patients. APSN may also have therapeutic significance in that its recognition should permit a better balance between immunosuppressor and antithrombotic and/or vasoprotective therapy. Finally, this study suggests that APSN should be considered as an element to be included in the classification criteria of APS.

  15. Lupus vulgaris: unusual presentations over the face.

    PubMed

    Khandpur, S; Reddy, B S N

    2003-11-01

    Lupus vulgaris (LV) is the most common morphological variant of cutaneous tuberculosis. However, the occurrence of bizarre clinical presentations over atypical sites often leads to misdiagnosis and inappropriate treatment causing significant morbidity. This report seeks to highlight two unusual cases of lupus vulgaris occurring on the face of immunocompetent women and remarkably mimicking periorbital cellulitis and basal cell carcinoma, respectively. The diagnosis was confirmed by histopathology, an enzyme-linked immunosorbent assay (ELISA) test for Mycobacterium tuberculosis and polymerase chain reaction (PCR). With four-drug antitubercular therapy, both patients had a dramatic response.

  16. Shining light on lupus and UV.

    PubMed

    Kuechle, Melanie K; Elkon, Keith B

    2007-01-01

    People exposed to sunlight can develop erythema, DNA damage, and photoimmunosupression. Extended exposure of normal epidermis to sunlight will induce dysmorphic keratinocytes with pyknotic nuclei scattered throughout the spinous layer. These 'sunburn cells' are apoptotic keratinocytes and are usually cleared within 48 hours after sunburn. Patients with lupus erythematosus, however, whether it be the discoid, subacute cutaneous, systemic, or tumid form, develop new cutaneous lesions and can experience systemic worsening of their disease. Are sunlight-induced keratinocyte apoptosis and the immune response to these cells abnormal in lupus patients?

  17. [Pregnancy and systemic lupus erythematosus: compatible?].

    PubMed

    Jason, M; von Frenckell, C; Emonts, P

    2012-11-01

    Systemic lupus erythematosus (SLE) is a chronic, multisystem autoimmune disease that predominantly occurs in women of childbearing age. The risk of obstetric complications in lupus parturients is significant. In addition, pregnancy may be associated with flares of the disease requiring immunosuppressive therapy. For these reasons, SLE pregnancies are considered high risk and involve careful collaboration of the obstetrician and rheumatologist. Through the latter and medical advances including a better and better understanding of the binomial mother-child, most pregnancies end in a success.

  18. Shining light on lupus and UV

    PubMed Central

    Kuechle, Melanie K; Elkon, Keith B

    2007-01-01

    People exposed to sunlight can develop erythema, DNA damage, and photoimmunosupression. Extended exposure of normal epidermis to sunlight will induce dysmorphic keratinocytes with pyknotic nuclei scattered throughout the spinous layer. These 'sunburn cells' are apoptotic keratinocytes and are usually cleared within 48 hours after sunburn. Patients with lupus erythematosus, however, whether it be the discoid, subacute cutaneous, systemic, or tumid form, develop new cutaneous lesions and can experience systemic worsening of their disease. Are sunlight-induced keratinocyte apoptosis and the immune response to these cells abnormal in lupus patients? PMID:17284304

  19. [B lymphocyte stimulator in systemic lupus erythematosus].

    PubMed

    Mercado, Ulises

    2012-01-01

    The B lymphocyte stimulator (BLyS) is an essential protein for the growth and survival of B cells. BLyS is expressed on monocytes, macrophages, and dendritic cells. BLyS binds to three receptors on B cells: BAFF-R, BCMA, and TACI. BLyS overexpression in mice leads to lupus-like syndrome, but not in all, whereas BLyS deficient mice results in a block of B cell development. High serum levels of BLyS can be detected in patients with lupus and rheumatoid arthritis. BLyS antagonists are an attractive target for treating autoimmune diseases.

  20. Media-fill simulation tests in manual and robotic aseptic preparation of injection solutions in syringes.

    PubMed

    Krämer, Irene; Federici, Matteo; Kaiser, Vanessa; Thiesen, Judith

    2016-04-01

    The purpose of this study was to evaluate the contamination rate of media-fill products either prepared automated with a robotic system (APOTECAchemo™) or prepared manually at cytotoxic workbenches in the same cleanroom environment and by experienced operators. Media fills were completed by microbiological environmental control in the critical zones and used to validate the cleaning and disinfection procedures of the robotic system. The aseptic preparation of patient individual ready-to-use injection solutions was simulated by using double concentrated tryptic soy broth as growth medium, water for injection and plastic syringes as primary packaging materials. Media fills were either prepared automated (500 units) in the robot or manually (500 units) in cytotoxic workbenches in the same cleanroom over a period of 18 working days. The test solutions were incubated at room temperature (22℃) over 4 weeks. Products were visually inspected for turbidity after a 2-week and 4-week period. Following incubation, growth promotion tests were performed with Staphylococcus epidermidis. During the media-fill procedures, passive air monitoring was performed with settle plates and surface monitoring with contact plates on predefined locations as well as fingerprints. The plates got incubated for 5-7 days at room temperature, followed by 2-3 days at 30-35℃ and the colony forming units (cfu) counted after both periods. The robot was cleaned and disinfected according to the established standard operating procedure on two working days prior to the media-fill session, while on six other working days only six critical components were sanitized at the end of the media-fill sessions. Every day UV irradiation was operated for 4 h after finishing work. None of the 1000 media-fill products prepared in the two different settings showed turbidity after the incubation period thereby indicating no contamination with microorganisms. All products remained uniform, clear, and light

  1. Transmission of Seasonal Outbreak of Childhood Enteroviral Aseptic Meningitis and Hand-foot-mouth Disease

    PubMed Central

    Park, Sue K.; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu

    2010-01-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD. PMID:20436701

  2. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive.

  3. Evaluation of disinfecting procedures for aseptic transfer in hospital pharmacy departments.

    PubMed

    Mehmi, Manita; Marshall, Lindsay J; Lambert, Peter A; Smith, Julian C

    2009-01-01

    Current practice in National Health Service (NHS) hospitals employs 70% Industrial Methylated Spirit spray for surface disinfection of components required in Grade A pharmaceutical environments. This study seeks to investigate other agents and procedures that may provide more effective sanitisation. Several methods are available to test the efficacy of disinfectants against vegetative organisms. However, no methods currently available test the efficacy of disinfectants against spores on the hard surfaces encountered in the pharmacy aseptic processing environment. Therefore, a method has been developed to test the efficacy of disinfectants against spores, modified from British Standard 13697 and Association of Analytical Chemists standards. The testing procedure was used to evaluate alternative biocides and disinfection methods for transferring components into hospital pharmacy cleanrooms, and to determine which combinations of biocide and application method have the greatest efficacy against spores of Bacillus subtilis subspecies subtilis 168, Bacillus subtilis American Type Culture Collection (ATCC) 6633, and Bacillus pumilis ATCC 27142. Stainless steel carrier test plates were used to represent the hard surfaces in hospital pharmacy cleanrooms. Plates were inoculated with 10(7)-10(8) colony-forming units per milliliter (CFU/mL) and treated with the various biocide formulations, using different disinfection methods. Sporicidal activity was calculated as log reduction in CFU. Of the biocides tested, 6% hydrogen peroxide and a quaternary ammonium compound/chlorine dioxide combination were most effective compared to a Quat/biguanide, amphoteric surfactant, 70% v/v ethanol in deionised water and isopropyl alcohol in water for injection. Of the different application methods tested, spraying followed by wiping was the most effective, followed closely by wiping alone. Spraying alone was least effective.

  4. Management and outcome of diaphyseal aseptic non-unions of the lower limb: a systematic review.

    PubMed

    Pneumaticos, Spiros G; Panteli, Michalis; Triantafyllopoulos, Georgios K; Papakostidis, Costas; Giannoudis, Peter V

    2014-06-01

    To review current treatments utilising biological enhancement modalities and their efficacy for the management of lower limb long bone aseptic non-unions. A systematic review of English articles using PubMed Medline; Ovid Medline; Embase; and the Cochrane Library was performed, supplemented by a manual search of bibliographies. Thirteen manuscripts met the inclusion criteria reporting on 428 patients. The overall healing had a pooled estimate of effect size at 94.3%. The calculated summarised estimate of effect size for deep infection rate (413 patients) was 2.3%. Three subgroups were then created on the basis of the exact type of graft used at the non-union site (ABG, BMP-7, BMP-7 + ABG). Comparison between the above subgroups revealed that ABG resulted in approximately 3-fold increase of the odds of healing compared with the use of BMP-7. Combined use of ABGs and BMP-7 improved the odds of healing by 3.5 times compared with BMP-7 alone. However, the previous median operations prior to the implantation of ABG or BMP-7 treatment was 1.09 versus 2.3 respectively (p = 0.02). Although the implantation of ABG was associated with a greater incidence of infection the documented differences did not reach significance. Although ABG was found to have a higher success rate compared to BMP-7 (95% Vs 87%), patients treated with BMP-7 had a higher number of previous failed interventions, statistically significantly so (BMP-7 is used for the treatment of more recalcitrant non-unions). It is the surgeon's judgement that should determine the most suitable treatment modality, depending on the nature and characteristics (personality) of the non-union and the patient. Copyright © 2013 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  5. Economic assessment of aseptic compounding rooms in hospital pharmacies in five European countries.

    PubMed

    Dekyndt, Bérengère; Décaudin, Bertrand; Lannoy, Damien; Odou, Pascal

    2015-04-01

    The aims of the study are to make an inventory of fixtures of aseptic compounding structures, to compare, using real examples, the design and operating costs of controlled atmosphere area (CAA) with isolators and CAA with laminar flow biological safety cabinets (BSCs) in order to determine the most economical scheme in hospitals and to give a final facilities cost calculated for one workstation. Forty-three hospitals were interviewed (21 French and 22 from four European countries) over seven months. Hospital pharmacists completed a form with 390 items. Hospitals are compared according to their workstation type: BSCII or BSCIII (group B) and isolator (group I), using Mann and Whitney's statistical test and Monte-Carlo modeling. Twenty-one hospitals responded (11 French and 10 from other European countries). All European compounding unit organizations are not significantly different. The study compared items such as infrastructure cost, equipment cost, staff cost, consumable cost, cleaning cost and control cost. A synthesis of all costs has been drafted to calculate an estimated preparation cost which seemed to be higher for group B than for group I when staff costs were included ($46 and $31, respectively, in study conditions). The different costs studied have revealed little significant difference between group B and I. The preparation cost in group B appears higher than in group I. This pilot study has resulted in the calculation of an estimated manufactured preparation cost but this work should be completed to help optimize resources and save money. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  6. Transmission of seasonal outbreak of childhood enteroviral aseptic meningitis and hand-foot-mouth disease.

    PubMed

    Park, Sue K; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu; Cheong, Hae-Kwan

    2010-05-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD.

  7. Characteristics of pleural effusions in systemic lupus erythematosus: differential diagnosis of lupus pleuritis.

    PubMed

    Choi, B Y; Yoon, M J; Shin, K; Lee, Y J; Song, Y W

    2015-03-01

    We investigated the clinical characteristics of pleural effusion in systemic lupus erythematosus (SLE). A prospective analysis of 17 SLE patients with pleural effusion (seven lupus pleuritis, eight transudative effusions and two parapneumonic effusions) was performed. Thirty non-SLE patients with pleural effusion were recruited as controls. A pleural fluid ANA titer ≥1:160 was found in 8/17 (47.1%) SLE patients and none of the 30 non-SLE patients (p = 0.0001). Pleural fluid to serum C3 ratios were significantly lower in SLE than in non-SLE (median (minimum-maximum) 0.29 (0.03-0.43) versus 0.52 (0.26-0.73), p = 0.0002). Among SLE patients, pleural fluid ANA titers ≥1:160 were more frequently found in patients with lupus pleuritis than in those with pleural effusion from causes other than lupus itself (85.7% versus 20.0%, p = 0.0152). Serum CRP levels were significantly increased in patients with lupus pleuritis compared with SLE patients with transudative pleural effusion (2.30 (0.30-5.66) versus 0.7 (0.12-1.47) mg/dl, p = 0.0062). In conclusion, pleural fluid ANA titer and serum CRP levels are significantly increased in lupus pleuritis.

  8. Illness perceptions in patients with systemic lupus erythematosus and proliferative lupus nephritis.

    PubMed

    Daleboudt, G M N; Broadbent, E; Berger, S P; Kaptein, A A

    2011-03-01

    This study investigated the illness perceptions of patients with systemic lupus erythematosus (SLE) and whether perceptions are influenced by type of treatment for proliferative lupus nephritis. In addition, the illness perceptions of SLE patients were compared with those of patients with other chronic illnesses. Thirty-two patients who had experienced at least one episode of proliferative lupus nephritis were included. Patients were treated with either a high or low-dose cyclophosphamide (CYC) regimen (National Institutes of Health [NIH] vs. Euro-Lupus protocol). Illness perceptions were measured with the Brief Illness Perception Questionnaire (B-IPQ) and a drawing assignment. The low-dose CYC group perceived their treatment as more helpful than the high-dose CYC group. In comparison with patients with asthma, SLE patients showed more negative illness perceptions on five of the eight illness perception domains. Drawings of the kidney provided additional information about perceptions of treatment effectiveness, kidney function and patients' understanding of their illness. Drawing characteristics showed associations with perceptions of consequences, identity, concern and personal control. These findings suggest that the type of treatment SLE patients with proliferative lupus nephritis receive may influence perceptions of treatment effectiveness. In addition, patients' drawings reveal perceptions of damage caused by lupus nephritis to the kidneys and the extent of relief provided by treatment. The finding that SLE is experienced as a more severe illness than other chronic illnesses supports the need to more frequently assess and aim to improve psychological functioning in SLE patients.

  9. [Case of lupus vasculopathy associated with lupus nephritis class IV-G (A)].

    PubMed

    Eguchi, Eriko; Shimazu, Keiji; Takaori, Kouji; Nishiguchi, Kensuke; Mori, Keita; Yorifuji, Soushi; Murakami, Toru; Koshikawa, Masao; Tanaka, Atsuo; Kuwahara, Takashi

    2010-01-01

    Various renal vascular lesions are complicated with systemic lupus erythematosus (SLE), and are often overlooked in the actual renal biopsy specimen. We report a case of biopsy-proven lupus vasculopathy, with lupus nephritis class IV-G (A). She developed SLE at 15 years of age, and was treated with prednisolone(PSL) and cyclophosphamide (CTX). Sometimes she experienced a flare-up clinically or serologically, requiring a dose increase of oral PSL. At 40 years of age, she visited our hospital after discontinuation of hospital visits for about 4 months. Oral PSL at 30 mg per day was not effective for urinary abnormalities, increase of anti double-stranded DNA (ds-DNA) antibody titer and decrease in complement components. On admission she had hypertension (180/92 mmHg) and signs of microangiopathic hemolytic anemia. Renal biopsy findings showed the glomerular changes of lupus nephritis, WHO class IV-G (A), and lupus vasculopathy, which is marked luminal narrowing or total occlusion by abundant subendothelial accumulation of immunoglobulins and complement components. In addition to PSL, intravenous pulse CTX promptly achieved clinical remission. When lupus vasculopathy is complicated, CTX may be useful.

  10. Hypocomplementemic Urticarial Vasculitis in Systemic Lupus Erythematosus

    PubMed Central

    Her, Min Young; Song, Joo Yeon

    2009-01-01

    Urticarial vasculitis is characterized clinically by urticarial skin lesions and histologically by leukocytoclastic vasculitis. Hypocomplementemic urticarial vasculitis is associated with connective tissue diseases such as systemic lupus erythematosus (SLE). We report a case of urticarial vasculitis that preceded manifestations of SLE. PMID:19270838

  11. Hypocomplementemic urticarial vasculitis in systemic lupus erythematosus.

    PubMed

    Her, Min Young; Song, Joo Yeon; Kim, Dong Yook

    2009-02-01

    Urticarial vasculitis is characterized clinically by urticarial skin lesions and histologically by leukocytoclastic vasculitis. Hypocomplementemic urticarial vasculitis is associated with connective tissue diseases such as systemic lupus erythematosus (SLE). We report a case of urticarial vasculitis that preceded manifestations of SLE.

  12. Kawasaki disease and juvenile systemic lupus erythematosus.

    PubMed

    Diniz, J C; Almeida, R T; Aikawa, N E; Sallum, A M E; Sakane, P T; Silva, C A

    2012-01-01

    Kawasaki disease (KD) is a common vasculitis in childhood. To the authors' knowledge, only one case of juvenile systemic lupus erythematosus (JSLE)-like onset mimicking KD and another case of KD and JSLE association have previously been described. However, the prevalence of this association of the two diseases was not reported. Therefore, over 27 consecutive years, 5419 patients were followed at the Pediatric Rheumatology Unit and 271 (5%) of them met the ACR classification criteria for JSLE. Two (0.7%) of them were female. These also had KD according to European League against Rheumatism / Paediatric Rheumatology European Society (EULAR/PReS) consensus criteria and are described in this report. One case was a 13-year-old who presented all six KD criteria. Echocardiogram showed pericardial effusion, dilatation and tortuosity of right and left coronary, and her symptoms promptly improved after treatment with intravenous immunoglobulin (IVIG). Lupus diagnosis was established a few days later. Another case was a 4-year-old who had also met all six KD criteria, with improvement after IVIG, and lupus diagnosis was made 1 year later. In conclusion, the frequency of the association between these two autoimmune diseases was rare. The occurrence of a second autoimmune systemic disease in a patient with a history of KD should also be considered. Furthermore, the initial presentation of lupus may mimic KD.

  13. Autoinoculation lupus vulgaris of the perineum.

    PubMed

    Sehgal, V N; Chaudhry, A K; Gupta, R

    1991-08-01

    The case of a young heterosexual male, with a 7 year history of an asymptomatic progressive plaque over the right side of the perineum is described, which 4 years later involved the left perineum and scrotal skin, indicating autoinoculation. The diagnosis of lupus vulgaris was made by strongly positive tuberculin test, histopathology, and a favourable response to a short course of intensive antitubercular therapy.

  14. Mycophenolate mofetil inducing remission of lupus enteritis.

    PubMed

    Al Balushi, F; Humby, F; Mahto, A; Kelly, C; Jawad, A

    2012-04-01

    We report the case of a young woman with a background history of discoid lupus who presented with abdominal pain, vomiting and intermittent diarrhoea. Physical examination revealed tenderness in the right upper quadrant with a palpable right inguinal lymph node without any other clinical signs of active lupus. Laboratory investigations showed normal inflammatory markers, positive ANA and Anti-Ro antibodies, persistent hypocomplementemia and lymphopenia, CT showed marked bowel oedema involving the small and large bowel (halo sign) with massive ascites and moderate right-sided pleural effusion. Mantoux test, AFB and TB cultures were negative. A diagnosis of lupus enteritis was made and treatment with high-dose steroids was commenced with little improvement. Treatment with cyclophosphamide was discussed but declined by the patient. Mycophenolate mofetil was commenced and resulted in significant clinical and radiological resolution. To the best of the authors' knowledge this is the first report of the successful use of mycophenolate mofetil in inducing and maintaining remission in lupus enteritis.

  15. Lupus - Multiple Languages: MedlinePlus

    MedlinePlus

    ... XYZ List of All Topics All Lupus - Multiple Languages To use the sharing features on this page, please enable JavaScript. Chinese - Traditional (繁體中文) Korean (한국어) Spanish (español) Vietnamese (Tiếng Việt) Chinese - Traditional ( ...

  16. Squamous cell carcinoma associated with lupus vulgaris.

    PubMed

    Gooptu, C; Marks, N; Thomas, J; James, M P

    1998-05-01

    Squamous cell carcinomas are known to arise in certain chronic, scarring dermatoses and also to be associated with exposure to ultraviolet radiation. We now report a case arising in a plaque of lupus vulgaris, the patient having received radiation from a Finsen lamp as a child for a tuberculous abscess in that region.

  17. Epigenetics and Systemic Lupus Erythematosus: Unmet Needs.

    PubMed

    Meroni, Pier Luigi; Penatti, Alessandra Emiliana

    2016-06-01

    Systemic lupus erythematosus (SLE) is a chronic relapsing-remitting autoimmune disease affecting several organs. Although the management of lupus patients has improved in the last years, several aspects still remain challenging. More sensitive and specific biomarkers for an early diagnosis as well as for monitoring disease activity and tissue damage are needed. Genome-wide association and gene mapping studies have supported the genetic background for SLE susceptibility. However, the relatively modest risk association and the studies in twins have suggested a role for environmental and epigenetic factors, as well as genetic-epigenetic interaction. Accordingly, there is evidence that differences in DNA methylation, histone modifications, and miRNA profiling can be found in lupus patients versus normal subjects. Moreover, impaired DNA methylation on the inactive X-chromosome was suggested to explain, at least in part, the female prevalence of the disease. Epigenetic markers may be help in fulfilling the unmet needs for SLE by offering new diagnostic tools, new biomarkers for monitoring disease activity, or to better characterize patients with a silent clinical disease but with an active serology. Anti-DNA, anti-phospholipid, and anti-Ro/SSA autoantibodies are thought to be pathogenic for glomerulonephritis, recurrent thrombosis and miscarriages, and neonatal lupus, respectively. However, tissue damage occurs occasionally or, in some patients, only in spite of the persistent presence of the antibodies. Preliminary studies suggest that epigenetic mechanisms may explain why the damage takes place in some patients only or at a given time.

  18. Induction of lupus autoantibodies by adjuvants

    USGS Publications Warehouse

    Satoh, M.; Kuroda, Y.; Yoshida, H.; Behney, K.M.; Mizutani, A.; Akaogi, J.; Nacionales, D.C.; Lorenson, T.D.; Rosenbauer, R.J.; Reeves, W.H.

    2003-01-01

    Exposure to the hydrocarbon oil pristane induces lupus specific autoantibodies in non-autoimmune mice. We investigated whether the capacity to induce lupus-like autoimmunity is a unique property of pristane or is shared by other adjuvant oils. Seven groups of 3-month-old female BALB/cJ mice received a single intraperitoneal injection of pristane, squalene (used in the adjuvant MF59), incomplete Freund's adjuvant (IFA), three different medicinal mineral oils, or saline, respectively. Serum autoantibodies and peritoneal cytokine production were measured. In addition to pristane, the mineral oil Bayol F (IFA) and the endogenous hydrocarbon squalene both induced anti-nRNP/Sm and -Su autoantibodies (20% and 25% of mice, respectively). All of these hydrocarbons had prolonged effects on cytokine production by peritoneal APCs. However, high levels of IL-6, IL-12, and TNF?? production 2-3 months after intraperitoneal injection appeared to be associated with the ability to induce lupus autoantibodies. The ability to induce lupus autoantibodies is shared by several hydrocarbons and is not unique to pristane. It correlates with stimulation of the production of IL-12 and other cytokines, suggesting a relationship with a hydrocarbon's adjuvanticity. The potential to induce autoimmunity may complicate the use of oil adjuvants in human and veterinary vaccines. ?? 2003 Elsevier Ltd. All rights reserved.

  19. Gastrointestinal system involvement in systemic lupus erythematosus.

    PubMed

    Li, Z; Xu, D; Wang, Z; Wang, Y; Zhang, S; Li, M; Zeng, X

    2017-10-01

    Systemic lupus erythematosus (SLE) is a multisystem disorder which can affect the gastrointestinal (GI) system. Although GI symptoms can manifest in 50% of patients with SLE, these have barely been reviewed due to difficulty in identifying different causes. This study aims to clarify clinical characteristics, diagnosis and treatment of the four major SLE-related GI system complications: protein-losing enteropathy (PLE), intestinal pseudo-obstruction (IPO), hepatic involvement and pancreatitis. It is a systematic review using MEDLINE and EMBASE databases and the major search terms were SLE, PLE, IPO, hepatitis and pancreatitis. A total of 125 articles were chosen for our study. SLE-related PLE was characterized by edema and hypoalbuminemia, with Technetium 99m labeled human albumin scintigraphy ((99m)Tc HAS) and alpha-1-antitrypsin fecal clearance test commonly used as diagnostic test. The most common site of protein leakage was the small intestine and the least common site was the stomach. More than half of SLE-related IPO patients had ureterohydronephrosis, and sometimes they manifested as interstitial cystitis and hepatobiliary dilatation. Lupus hepatitis and SLE accompanied by autoimmune hepatitis (SLE-AIH overlap) shared similar clinical manifestations but had different autoantibodies and histopathological features, and positive anti-ribosome P antibody highly indicated the diagnosis of lupus hepatitis. Lupus pancreatitis was usually accompanied by high SLE activity with a relatively high mortality rate. Early diagnosis and timely intervention were crucial, and administration of corticosteroids and immunosuppressants was effective for most of the patients.

  20. Challenges for lupus management in emerging countries.

    PubMed

    Tazi Mezalek, Zoubida; Bono, Wafaa

    2014-06-01

    In emerging countries, systemic lupus erythematosus (SLE) has been associated with several unfavorable outcomes including disease activity, damage accrual, work disability and mortality. Poor socioeconomic status (SES) and lack of access to healthcare, especially in medically underserved communities, may be responsible for many of the observed disparities. Diagnostic delay of SLE or for severe organ damages (renal involvement) have a negative impact on those adverse outcomes in lupus patients who either belong to minority groups or live in emerging countries. Longitudinal and observational prospective studies and registries may help to identify the factors that influence poor SLE outcomes in emerging countries. Infection is an important cause of mortality and morbidity in SLE, particularly in low SES patients and tuberculosis appears to be frequent in SLE patients living in endemic areas (mainly emerging countries). Thus, tuberculosis screening should be systematically performed and prophylaxis discussed for patients from these areas. SLE treatment in the developing world is restricted by the availability and cost of some immunosuppressive drugs. Moreover, poor adherence has been associated to bad outcomes in lupus patients with a higher risk of flares, morbidity, hospitalization, and poor renal prognosis. Low education and the lack of money are identified as the main barrier to improve lupus prognosis. Newer therapeutic agents and new protocols had contributed to improve survival in SLE. The use of corticoid-sparing agents (hydroxychloroquine, methotrexate, azathioprine and mycophenolate mofetif) is one of the most useful strategy; availability of inexpensive generics may help to optimize access to these medications.

  1. Lupus-scleroderma syndrome induced by ethosuximide.

    PubMed Central

    Teoh, P C; Chan, H L

    1975-01-01

    Features of both systemic lupus erythematosus and scleroderma developed in a young Chinese girl while on multiple anticonvulsant therapy. These were reversed after withdrawal of the drugs. Readministration of ethosuximide for control of epilepsy caused a relapse with predominant sclerodermatous features. These clinical signs again resolved after ethosuximide withdrawal. Images FIG. 1 FIG. 2 PMID:812426

  2. Thrombotic thrombocytopenic purpura preceding systemic lupus erythematosus.

    PubMed Central

    Simeon-Aznar, C P; Cuenca-Luque, R; Fonollosa-Pla, V; Bosch-Gil, J A

    1992-01-01

    The case of a patient admitted with thrombotic thrombocytopenic purpura nine years after developing systemic lupus erythematosus (SLE) is reported. Thrombotic thrombocytopenic purpura associated with SLE has been described on other occasions, but in most patients the diagnosis of SLE precedes that of thrombotic thrombocytopenic purpura. The unusual sequence and the chronological separation of the two diseases is emphasised. PMID:1575591

  3. Systemic lupus erythematosus: the face of Asia.

    PubMed

    Feng, Pao-Hsii

    2007-06-01

    This review documents the remarkable progress systemic lupus erythematosus (SLE) has made in the past 40 years especially in Asia. It provides a kaleidoscope in terms of prevalence, ethnic and regional variations, disease manifestation, treatment strategies, and outcome. From a seminal paper on the use of intravenous cyclophosphamide in 1964 from Singapore to the use of mycophenolate mofetil in 2000 from Hong Kong and Guangzhou, the prognosis of lupus has changed dramatically in the last few decades. With more targeted therapies and better translational research, this progress is set to continue in the coming years. From an acute fulminating illness, lupus has now evolved to one with a chronic, relapsing course. The main causes of morbidity and mortality are now either treatment-related or patient-related rather than the disease itself. The present time is one of unprecedented growth of new therapeutic approaches and reevaluation of past treatment modalities. With improving socioeconomic conditions in the region, we anticipate further rapid progress in disease outcome. Although living with the wolf is still an ordeal for our patients, optimism has now replaced nihilism in the lupus world. There is light at the end of the tunnel.

  4. [Pulmonary hypertension in generalized lupus erythematosus].

    PubMed

    Bautista, G G; Cabral, A; Achurra, A F

    1992-01-01

    Two young women with systemic lupus erythematosus and pulmonary hypertension are reported. Both patients had Raynaud phenomenon and antibodies to cardiolipin. They seem to be potentially associated in the pathogenesis. Also, laboratory and hemodynamic findings were discussed. Although the treatment, the prognosis still bad.

  5. Systemic lupus erythematosus and Raynaud's phenomenon*

    PubMed Central

    Heimovski, Flavia Emilie; Simioni, Juliana A.; Skare, Thelma Larocca

    2015-01-01

    BACKGROUND Patients with systemic lupus erythematosus seem to belong to different serological and clinical subgroups of the disease. Genetic background can cause the appearance of these subgroups. OBJECTIVE To determine whether Brazilian patients who have systemic lupus erythematosus and Raynaud's phenomenon differ from those who do not. METHODS Retrospective analysis of 373 medical records of systemic lupus erythematosus patients studied for demographic, clinical and serological data. A comparative analysis was performed of individuals with and without RP. RESULTS There was a positive association between Raynaud's phenomenon and age at diagnosis (p=0.02), presence of anti-Sm (p=0.01) antibodies and anti-RNP (p<0.0001). Furthermore, a negative association was found between Raynaud's phenomenon and hemolysis (p=0.01), serositis (p=0.01), glomerulonephritis (p=0.0004) and IgM aCL (p=0.004) antibodies. CONCLUSION Raynaud's phenomenon patients appear to belong to a systemic lupus erythematosus subset with a spectrum of clinical manifestations located in a more benign pole of the disease. PMID:26734864

  6. ABIN1 dysfunction as a genetic basis for lupus nephritis.

    PubMed

    Caster, Dawn J; Korte, Erik A; Nanda, Sambit K; McLeish, Kenneth R; Oliver, Rebecca K; G'sell, Rachel T; Sheehan, Ryan M; Freeman, Darrell W; Coventry, Susan C; Kelly, Jennifer A; Guthridge, Joel M; James, Judith A; Sivils, Kathy L; Alarcon-Riquelme, Marta E; Scofield, R Hal; Adrianto, Indra; Gaffney, Patrick M; Stevens, Anne M; Freedman, Barry I; Langefeld, Carl D; Tsao, Betty P; Pons-Estel, Bernardo A; Jacob, Chaim O; Kamen, Diane L; Gilkeson, Gary S; Brown, Elizabeth E; Alarcon, Graciela S; Edberg, Jeffrey C; Kimberly, Robert P; Martin, Javier; Merrill, Joan T; Harley, John B; Kaufman, Kenneth M; Reveille, John D; Anaya, Juan-Manuel; Criswell, Lindsey A; Vila, Luis M; Petri, Michelle; Ramsey-Goldman, Rosalind; Bae, Sang-Cheol; Boackle, Susan A; Vyse, Timothy J; Niewold, Timothy B; Cohen, Philip; Powell, David W

    2013-11-01

    The genetic factors underlying the pathogenesis of lupus nephritis associated with systemic lupus erythematosus are largely unknown, although animal studies indicate that nuclear factor (NF)-κB is involved. We reported previously that a knockin mouse expressing an inactive form of ABIN1 (ABIN1[D485N]) develops lupus-like autoimmune disease and demonstrates enhanced activation of NF-κB and mitogen-activated protein kinases in immune cells after toll-like receptor stimulation. In the current study, we show that ABIN1[D485N] mice develop progressive GN similar to class III and IV lupus nephritis in humans. To investigate the clinical relevance of ABIN1 dysfunction, we genotyped five single-nucleotide polymorphisms in the gene encoding ABIN1, TNIP1, in samples from European-American, African American, Asian, Gullah, and Hispanic participants in the Large Lupus Association Study 2. Comparing cases of systemic lupus erythematosus with nephritis and cases of systemic lupus erythematosus without nephritis revealed strong associations with lupus nephritis at rs7708392 in European Americans and rs4958881 in African Americans. Comparing cases of systemic lupus erythematosus with nephritis and healthy controls revealed a stronger association at rs7708392 in European Americans but not at rs4958881 in African Americans. Our data suggest that variants in the TNIP1 gene are associated with the risk for lupus nephritis and could be mechanistically involved in disease development via aberrant regulation of NF-κB and mitogen-activated protein kinase activity.

  7. ABIN1 Dysfunction as a Genetic Basis for Lupus Nephritis

    PubMed Central

    Caster, Dawn J.; Korte, Erik A.; Nanda, Sambit K.; McLeish, Kenneth R.; Oliver, Rebecca K.; G'Sell, Rachel T.; Sheehan, Ryan M.; Freeman, Darrell W.; Coventry, Susan C.; Kelly, Jennifer A.; Guthridge, Joel M.; James, Judith A.; Sivils, Kathy L.; Alarcon-Riquelme, Marta E.; Scofield, R. Hal; Adrianto, Indra; Gaffney, Patrick M.; Stevens, Anne M.; Freedman, Barry I.; Langefeld, Carl D.; Tsao, Betty P.; Pons-Estel, Bernardo A.; Jacob, Chaim O.; Kamen, Diane L.; Gilkeson, Gary S.; Brown, Elizabeth E.; Alarcon, Graciela S.; Edberg, Jeffrey C.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Harley, John B.; Kaufman, Kenneth M.; Reveille, John D.; Anaya, Juan-Manuel; Criswell, Lindsey A.; Vila, Luis M.; Petri, Michelle; Ramsey-Goldman, Rosalind; Bae, Sang-Cheol; Boackle, Susan A.; Vyse, Timothy J.; Niewold, Timothy B.; Cohen, Philip

    2013-01-01

    The genetic factors underlying the pathogenesis of lupus nephritis associated with systemic lupus erythematosus are largely unknown, although animal studies indicate that nuclear factor (NF)-κB is involved. We reported previously that a knockin mouse expressing an inactive form of ABIN1 (ABIN1[D485N]) develops lupus-like autoimmune disease and demonstrates enhanced activation of NF-κB and mitogen-activated protein kinases in immune cells after toll-like receptor stimulation. In the current study, we show that ABIN1[D485N] mice develop progressive GN similar to class III and IV lupus nephritis in humans. To investigate the clinical relevance of ABIN1 dysfunction, we genotyped five single-nucleotide polymorphisms in the gene encoding ABIN1, TNIP1, in samples from European-American, African American, Asian, Gullah, and Hispanic participants in the Large Lupus Association Study 2. Comparing cases of systemic lupus erythematosus with nephritis and cases of systemic lupus erythematosus without nephritis revealed strong associations with lupus nephritis at rs7708392 in European Americans and rs4958881 in African Americans. Comparing cases of systemic lupus erythematosus with nephritis and healthy controls revealed a stronger association at rs7708392 in European Americans but not at rs4958881 in African Americans. Our data suggest that variants in the TNIP1 gene are associated with the risk for lupus nephritis and could be mechanistically involved in disease development via aberrant regulation of NF-κB and mitogen-activated protein kinase activity. PMID:23970121

  8. The lupus family registry and repository.

    PubMed

    Rasmussen, Astrid; Sevier, Sydney; Kelly, Jennifer A; Glenn, Stuart B; Aberle, Teresa; Cooney, Carisa M; Grether, Anya; James, Ellen; Ning, Jared; Tesiram, Joanne; Morrisey, Jean; Powe, Tiny; Drexel, Mark; Daniel, Wes; Namjou, Bahram; Ojwang, Joshua O; Nguyen, Kim L; Cavett, Joshua W; Te, Jeannie L; James, Judith A; Scofield, R Hal; Moser, Kathy; Gilkeson, Gary S; Kamen, Diane L; Carson, Craig W; Quintero-del-Rio, Ana I; del Carmen Ballesteros, Maria; Punaro, Marilynn G; Karp, David R; Wallace, Daniel J; Weisman, Michael; Merrill, Joan T; Rivera, Roberto; Petri, Michelle A; Albert, Daniel A; Espinoza, Luis R; Utset, Tammy O; Shaver, Timothy S; Arthur, Eugene; Anaya, Juan-Manuel; Bruner, Gail R; Harley, John B

    2011-01-01

    The Lupus Family Registry and Repository (LFRR) was established with the goal of assembling and distributing materials and data from families with one or more living members diagnosed with SLE, in order to address SLE genetics. In the present article, we describe the problems and solutions of the registry design and biometric data gathering; the protocols implemented to guarantee data quality and protection of participant privacy and consent; and the establishment of a local and international network of collaborators. At the same time, we illustrate how the LFRR has enabled progress in lupus genetics research, answering old scientific questions while laying out new challenges in the elucidation of the biologic mechanisms that underlie disease pathogenesis. Trained staff ascertain SLE cases, unaffected family members and population-based controls, proceeding in compliance with the relevant laws and standards; participant consent and privacy are central to the LFRR's effort. Data, DNA, serum, plasma, peripheral blood and transformed B-cell lines are collected and stored, and subject to strict quality control and safety measures. Coded data and materials derived from the registry are available for approved scientific users. The LFRR has contributed to the discovery of most of the 37 genetic associations now known to contribute to lupus through 104 publications. The LFRR contains 2618 lupus cases from 1954 pedigrees that are being studied by 76 approved users and their collaborators. The registry includes difficult to obtain populations, such as multiplex pedigrees, minority patients and affected males, and constitutes the largest collection of lupus pedigrees in the world. The LFRR is a useful resource for the discovery and characterization of genetic associations in SLE.

  9. The Lupus Family Registry and Repository

    PubMed Central

    Rasmussen, Astrid; Sevier, Sydney; Kelly, Jennifer A.; Glenn, Stuart B.; Aberle, Teresa; Cooney, Carisa M.; Grether, Anya; James, Ellen; Ning, Jared; Tesiram, Joanne; Morrisey, Jean; Powe, Tiny; Drexel, Mark; Daniel, Wes; Namjou, Bahram; Ojwang, Joshua O.; Nguyen, Kim L.; Cavett, Joshua W.; Te, Jeannie L.; James, Judith A.; Scofield, R. Hal; Moser, Kathy; Gilkeson, Gary S.; Kamen, Diane L.; Carson, Craig W.; Quintero-del-Rio, Ana I.; Ballesteros, Maria del Carmen; Punaro, Marilynn G.; Karp, David R.; Wallace, Daniel J.; Weisman, Michael; Merrill, Joan T.; Rivera, Roberto; Petri, Michelle A.; Albert, Daniel A.; Espinoza, Luis R.; Utset, Tammy O.; Shaver, Timothy S.; Arthur, Eugene; Anaya, Juan-Manuel; Bruner, Gail R.

    2011-01-01

    The Lupus Family Registry and Repository (LFRR) was established with the goal of assembling and distributing materials and data from families with one or more living members diagnosed with SLE, in order to address SLE genetics. In the present article, we describe the problems and solutions of the registry design and biometric data gathering; the protocols implemented to guarantee data quality and protection of participant privacy and consent; and the establishment of a local and international network of collaborators. At the same time, we illustrate how the LFRR has enabled progress in lupus genetics research, answering old scientific questions while laying out new challenges in the elucidation of the biologic mechanisms that underlie disease pathogenesis. Trained staff ascertain SLE cases, unaffected family members and population-based controls, proceeding in compliance with the relevant laws and standards; participant consent and privacy are central to the LFRR’s effort. Data, DNA, serum, plasma, peripheral blood and transformed B-cell lines are collected and stored, and subject to strict quality control and safety measures. Coded data and materials derived from the registry are available for approved scientific users. The LFRR has contributed to the discovery of most of the 37 genetic associations now known to contribute to lupus through 104 publications. The LFRR contains 2618 lupus cases from 1954 pedigrees that are being studied by 76 approved users and their collaborators. The registry includes difficult to obtain populations, such as multiplex pedigrees, minority patients and affected males, and constitutes the largest collection of lupus pedigrees in the world. The LFRR is a useful resource for the discovery and characterization of genetic associations in SLE. PMID:20864496

  10. Absolute identification of muramic acid, at trace levels, in human septic synovial fluids in vivo and absence in aseptic fluids.

    PubMed

    Fox, A; Fox, K; Christensson, B; Harrelson, D; Krahmer, M

    1996-09-01

    This is the first report of a study employing the state-of-the-art technique of gas chromatography-tandem mass spectrometry for absolute identification of muramic acid (a marker for peptidoglycan) at trace levels in a human or animal body fluid or tissue. Daughter mass spectra of synovial fluid muramic acid peaks (> or = 30 ng/ml) were identical to those of pure muramic acid. Absolute chemical identification at this level represents a 1,000-fold increase in sensitivity over previous gas chromatography-mass spectrometry identifications. Muramic acid was positively identified in synovial fluids during infection and was eliminated over time but was absent from aseptic fluids.

  11. Recurrent aseptic meningitis as a rare but important presentation of congenital petrous apex cholesteatoma: the value of appropriate imaging

    PubMed Central

    MacKeith, Samuel A; Soledad-Juarez, Maria; Tiberti, Liliana; Orfila, Daniel

    2014-01-01

    We describe the presentation, investigation and challenging management of a young adult with recurrent aseptic meningitis. The presence of cholesterol and triglycerides in the cerebrospinal fluid sample was recognised as a potential sign of an underlying dermoid or epidermoid cyst. We demonstrate how appropriate imaging of the skull base with diffusion-weighted imaging (DWI) MRI can help differentiate between lesions of the petrous apex, facilitating the diagnosis of a petrous apex congenital cholesteatoma/epidermoid cyst. Awareness of this unusual mode of presentation of a rare disease, as well as knowledge of key diagnostic investigations, may allow for earlier identification, treatment and reduced morbidity/mortality. PMID:24614768

  12. Respiratory manifestations of systemic lupus erythematosus: old and new concepts.

    PubMed

    Pego-Reigosa, José María; Medeiros, Dina A; Isenberg, David A

    2009-08-01

    The respiratory system is commonly involved in systemic lupus erythematosus. Lung disorders are classified as primary (due to lupus) and secondary to other conditions. Pleuritis and pulmonary infections are the most prevalent respiratory manifestations of each type. Other infrequent manifestations include interstitial lung disease, acute lupus pneumonitis, diffuse alveolar haemorrhage, pulmonary arterial hypertension, acute reversible hypoxaemia and shrinking lung syndrome. Even when current diagnostic tests contribute to an earlier diagnosis, the treatment of these manifestations is based on clinical experience and small series. Larger controlled trials of the different therapies in the treatment of those lung manifestations of lupus are needed. Overall malignancy is little increased in lupus, but lung cancer and non-Hodgkin's lymphoma are among the most frequent types of cancer found in these patients. As survival in lupus patients has improved over recent decades, avoiding pulmonary damage emerges as an important objective.

  13. Gestational outcomes in patients with neuropsychiatric systemic lupus erythematosus.

    PubMed

    de Jesus, G R; Rodrigues, B C; Lacerda, M I; Dos Santos, F C; de Jesus, N R; Klumb, E M; Levy, R A

    2017-04-01

    This study analyzed maternal and fetal outcomes of pregnancies of neuropsychiatric systemic lupus erythematosus patients followed in a reference unit. This retrospective cohort study included 26 pregnancies of patients seen between 2011 and 2015 included with history and/or active neuropsychiatric systemic lupus erythematosus among 135 pregnancies. Three patients had active neuropsychiatric systemic lupus erythematosus at conception, but only one remained with neurological activity during gestation, characteristically related to the inadvertent suspension of medications. Twenty six percent of the newborns were small for gestational age and 40% of live births were premature, with no neonatal death or early complications of prematurity. Preeclampsia was diagnosed in nine pregnancies, with two cases of early severe form that resulted in intrauterine fetal death. Patients with neuropsychiatric systemic lupus erythematosus had more prematurity and preeclampsia compared to patients without neuropsychiatric disease. However, when concomitant lupus nephritis was excluded, the gestational results of neuropsychiatric systemic lupus erythematosus patients were more favorable.

  14. Cardiovascular risk assessment and treatment in systemic lupus erythematosus.

    PubMed

    Elliott, Jennifer R; Manzi, Susan

    2009-08-01

    With improved treatment modalities and survival rates, patients with systemic lupus erythematosus live longer and their co-morbidities have become more apparent. Of great concern is cardiovascular disease, which has become a leading cause of death. Lupus patients prematurely develop atherosclerosis, which likely arises from an interaction among traditional cardiovascular risk factors, factors specific to lupus itself and inflammatory mediators. Despite these findings, lupus patients are not always adequately evaluated for traditional risk factors, many of which are treatable and reversible. We propose that lupus patients be assessed and managed regarding cardiovascular risk factors in the same manner as patients with known cardiovascular disease. As a result, preventive cardiology should be considered an essential component of the care for patients with lupus.

  15. Transcriptome-Wide High-Density Microarray Analysis Reveals Differential Gene Transcription in Periprosthetic Tissue From Hips With Chronic Periprosthetic Joint Infection vs Aseptic Loosening.

    PubMed

    Omar, Mohamed; Klawonn, Frank; Brand, Stephan; Stiesch, Meike; Krettek, Christian; Eberhard, Jörg

    2017-01-01

    Differentiating between periprosthetic hip infection and aseptic hip prosthesis loosening can be challenging, especially in patients with chronic infections. This study used whole-genome microarray analysis to investigate the transcriptomes of periprosthetic hip tissues to identify genes that are differentially transcripted between chronic periprosthetic hip infection and aseptic hip prosthesis loosening. In this pilot study, a total of 24 patients with either chronic periprosthetic hip infection (n = 12) or aseptic hip prosthesis loosening (n = 12) were analyzed. Periprosthetic hip infection was diagnosed based on modified criteria of the Musculoskeletal Infection Society. To evaluate differences in gene transcription, whole-genome microarray analysis was performed on the mRNA of periprosthetic tissue. Microarray analysis revealed differential gene transcription in periprosthetic hip tissue affected by chronic hip infection vs aseptic hip prosthesis loosening. A total of 39 genes had area under the curve values greater than 0.9 for diagnosing chronic periprosthetic hip infection; 5 genes had annotations relevant to infection and metabolism. The 39 genes also included 7 genes that were differentially transcribed but that have no apparent connection to immune response processes plus 27 genes with unknown function. Differences in gene transcription profiles might represent novel diagnostic targets that can be used to differentiate between chronic periprosthetic hip infections and aseptic hip prosthesis loosening. Secondary metabolites of differentially transcripted genes might serve as easily accessible markers for detecting chronic periprosthetic joint infection in future. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Autologous Fat Transfer in a Patient with Lupus Erythematosus Profundus

    PubMed Central

    Yoon, Jimi; Kim, Hwa Mi; Kim, Tae-Heung; Kim, Chung-Won; Sun, Young-Woo; Yoon, Tae-Jin

    2012-01-01

    Lupus erythematosus profundus, a form of chronic cutaneous lupus erythematosus, is a rare inflammatory disease involving in the lower dermis and subcutaneous tissues. It primarily affects the head, proximal upper arms, trunk, thighs, and presents as firm nodules, 1 to 3 cm in diameter. The overlying skin often becomes attached to the subcutaneous nodules and is drawn inward to produce deep, saucerized depressions. We present a rare case of lupus erythematosus profundus treated with autologous fat transfer. PMID:23139658

  17. T Tauri Disk Lifetime in the Lupus Association

    NASA Astrophysics Data System (ADS)

    Galli, P. A. B.; Bertout, C.; Teixeira, R.; Ducourant, C.

    2016-01-01

    In a recent study, we derived individual distances for a sample of pre-main sequence stars that define the comoving association of young stars in the Lupus star-forming region. Here, we use these new distances to investigate the mass and age distributions of Lupus T Tauri stars and derive the average disk lifetime in the Lupus association based on an empirical disk model.

  18. Toe walking as a presenting sign of systemic lupus erythematosus.

    PubMed

    Basiaga, M; Sherry, D

    2015-10-01

    Toe walking is a previously unreported presentation of systemic lupus erythematosus (SLE). We describe a patient who presented with profound multisystem involvement that was preceded by one month of toe walking and multiple flexion contractures without arthritis. Her lupus is now under control after aggressive therapy, yet she continues to struggle with tendinopathy despite continued physical and occupational therapy. Lupus should be considered in the appropriate clinical context in children who have new-onset contractures due to tight tendons.

  19. Moving East: the Euro-Lupus Nephritis regimen in Asia.

    PubMed

    Houssiau, Frédéric A

    2016-01-01

    Treatment of lupus nephritis is more evidenced-based than ever. Yet many areas of uncertainty persist. The article by Rathi et al. brings a piece to the puzzle by comparing, in a group of Indian patients, the Euro-Lupus low-dose i.v. cyclophosphamide regimen with mycophenolate mofetil. Although some caveats must be raised, the results suggest that, after crossing the Atlantic, the Euro-Lupus regimen may well be moving East.

  20. Novel Therapeutic Target for the Treatment of Lupus

    DTIC Science & Technology

    2014-09-01

    Systemic lupus erythematosus , autoantibodies. 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 7 19a. NAME OF...KEYWORDS: RhoB, animal model, antibody secretion, antibody therapy, Systemic lupus erythematosus , autoantibodies. 3. OVERALL PROJECT SUMMARY: Through... lupus erythematosus (SLE) affects approximately 300,000 to over a million individuals in the United States with a female gender bias of 90%. Many

  1. Elevated sacroilac joint uptake ratios in systemic lupus erythematosus

    SciTech Connect

    De Smet, A.A.; Mahmood, T.; Robinson, R.G.; Lindsley, H.B.

    1984-08-01

    Sacroiliac joint radiographs and radionuclide sacroiliac joint uptake ratios were obtained on 14 patients with active systemic lupus erythematosus. Elevated joint ratios were found unilaterally in two patients and bilaterally in seven patients when their lupus was active. In patients whose disease became quiescent, the uptake ratios returned to normal. Two patients had persistently elevated ratios with continued clinical and laboratory evidence of active lupus. Mild sacroiliac joint sclerosis and erosions were detected on pelvic radiographs in these same two patients. Elevated quantitative sacroiliac joint uptake ratios may occur as a manifestation of active systemic lupus erythematosus.

  2. Diagnosis: a liminal state for women living with lupus.

    PubMed

    Mendelson, Cindy

    2009-05-01

    Women with systemic lupus erythematosus (SLE or lupus) often experience a protracted diagnostic period in which their symptoms are treated as medically unexplained. Although they know they are ill, their symptoms have not been validated as indicative of disease by a health care professional. Consequently, the diagnostic period can be viewed as liminal, the middle stage in the rites of passage and what Turner (1969/1997) has labeled "betwixt and between." Drawing on the analysis of narratives solicited from 23 women recruited from online lupus support groups, I explore the gendered nature of diagnosis for women with lupus using van Gennep's (1960) rites of passage as a conceptual framework.

  3. Pregnancy and contraception in systemic and cutaneous lupus erythematosus.

    PubMed

    Guettrot-Imbert, G; Morel, N; Le Guern, V; Plu-Bureau, G; Frances, C; Costedoat-Chalumeau, N

    2016-10-01

    A causal link has long been described between estrogen and systemic lupus erythematosus activity. Contraceptive and pregnancy management is now common for lupus patients, but pregnancy continues to be associated with higher maternal and fetal mortality/morbidity in systemic lupus erythematosus patients than among the general population. Potential complications include lupus flares, obstetric complications (fetal loss, in utero growth retardation, premature birth) and neonatal lupus syndrome. Association with antiphospholipid antibodies or antiphospholipid syndrome increases the risk of obstetric complications. Anti-SSA and/or anti-SSB antibodies put fetuses at risk for neonatal lupus. Improving the outcome of such pregnancies depends upon optimal systematic planning of pregnancy at a preconception counseling visit coupled with a multidisciplinary approach. Absence of lupus activity, use of appropriate medication during pregnancy based on the patient's medical history and risk factors, and regular monitoring constitute the best tools for achieving a favorable outcome in such high-risk pregnancies. The aim of this review is to provide an update on the management of contraception and pregnancy in systemic lupus erythematosus, cutaneous lupus and/or antiphospholipid syndrome in order to reduce the risk of complications and to ensure the best maternal and fetal prognosis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  4. Isoniazid Induced Lupus Presenting as Oral Mucosal Ulcers with Pancytopenia

    PubMed Central

    Ankale, Padmaraj; Sinha, Kanishk; Iyer, Aparna; Jayalakshmi, T.K

    2016-01-01

    Drug Induced Lupus Erythematous (DILE) is a rare adverse reaction to a large variety of drugs including Isoniazid (INH), with features resembling idiopathic Systemic Lupus Erythematosus (SLE). Diagnosis require identification of a temporal relationship between drug administered and symptom. It is an idiosyncratic reaction, with no pre-existing lupus. Our case highlights a rare presentation of isoniazid induced lupus with profound pancytopenia and mucosal ulcers, thus posing a diagnostic challenge. The patient was on multidrug treatment for pulmonary and knee joint tuberculosis. DILE was diagnosed on basis of strongly positive Anti Nuclear Antibodies (ANA), anti ds DNA and antihistone antibodies with clinical response to cessation of INH. PMID:27891378

  5. [Lupus erythematosus panniculitis presenting as palpebral edema and parotiditis].

    PubMed

    Pérez-Pastor, G; Valcuende, F; Tomás, G; Moreno, M

    2007-10-01

    Lupus erythematosus panniculitis or lupus erythematosus profundus is characterized by inflammation of the deep dermis and subcutaneous tissue. It can occur in isolation or associated with chronic systemic or discoid lupus erythematosus. It usually consists of nodules and hardened subcutaneous plaques on the forehead, cheeks, proximal extremities, and buttocks. Periorbital and parotid involvement are rare and can lead to misdiagnosis. We present the case of a patient with lupus erythematosus panniculitis who presented with palpebral edema and involvement of the periocular fat and parotid gland.

  6. Lupus-related advanced liver involvement as the initial presentation of systemic lupus erythematosus.

    PubMed

    Lu, Ming-Chi; Li, Ko-Jen; Hsieh, Song-Chou; Wu, Cheng-Han; Yu, Chia-Li

    2006-12-01

    Systemic lupus erythematosus (SLE), a prototype of systemic autoimmune disease characterized by multiorgan involvement with diverse clinical and serological manifestations, principally affects women in their child-bearing years. Clinically significant hepatic abnormality as the initial presentation of SLE has rarely been reported. Eleven patients with lupus with initial presentation of lupus-related hepatitis were included in this retrospective review. Clinical manifestation, immunological profiles, and risk factors for poor prognosis were analyzed. The most commonly associated clinical manifestations were found to be thrombocytopenia, leukopenia, advancing age, and presence of anti-SSA/Ro antibody and anti-thyroid antibodies. The diagnosis of SLE was delayed due to dominant hepatic abnormalities. Age greater than 50 years and marked hepatic decompensation in accordance with Child classification B and C might suggest poor prognosis (p=0.06). However, the p value was not statistically significant because of the small sample size. Lupus-related hepatitis, particularly in late-onset lupus, is common. In addition, the presence of anti-SSA, anti-thyroglobulin, and anti-microsomal antibodies is indicative of hepatic involvement in patients with SLE.

  7. [Systemic lupus erythematous and CD24v].

    PubMed

    Jiménez-Uscanga, Rubén Darío; Carsolio-Trujano, Margarita; Herrera-Sánchez, Diana Andrea; Castrejón-Vázquez, María Isabel; Irazoque-Palacios, Fedra; Vargas-Camaño, María Eugenia; Martínez-Aguilar, Nora; Chima-Galán, María Carmen

    2015-01-01

    Antecedentes: el lupus eritematoso sistémico es un padecimiento autoinmunitario, de origen multifactorial, con predisposición genética; más de 100 genes participan en su etiopatogenia. El gen de CD24 puede mediar varias funciones, como su actividad coestimuladora en la expansión clonal de las células T. El polimorfismo de un simple nucleótido de CD24, que resulta en un reemplazo no conservador de alanina a valina (CD24v), que precede inmediatamente al sitio de anclaje GPI (posición ω-1), condiciona la pérdida de actividad de CD24. Se ha descrito que CD24v está asociado con esclerosis múltiple y lupus eritematoso sistémico en otras poblaciones. Objetivo: encontrar la existencia de CD24v en pacientes mexicanos con lupus eritematoso sistémico. Material y método: estudio de genotipificación de CD24v en el que se incluyeron 64 sujetos, 32 casos con lupus eritematoso sistémico: 28 mujeres y 4 hombres; y 32 controles: 9 mujeres y 23 hombres; todos eran pacientes con lupus eritematoso sistémico del Centro Médico Nacional 20 de Noviembre, del ISSSTE, atendidos en los servicios de Inmunología Clínica y Reumatología. Resultados: de los casos, 19 pacientes tenían genotipo homocigoto silvestre, 12 con genotipo heterocigotos y sólo un paciente mostró el polimorfismo en estado homocigoto. De los controles, 17 sujetos mostraron genotipos heterocigotos silvestres, 14 eran heterocigotos y sólo en uno se encontró que era homocigoto polimórfico. Se obtuvo una razón de momios de 0.84 y chi cuadrada de 0.17, por lo que no hubo diferencia estadísticamente significativa. Conclusiones: se demostró que no hay diferencia estadísticamente significativa entre pacientes con lupus eritematoso sistémico y controles respecto a la existencia de CD24v.

  8. Vitrified sperm banks: the new aseptic technique for human spermatozoa allows cryopreservation at -86 °C.

    PubMed

    Sánchez, R; Risopatrón, J; Schulz, M; Villegas, J V; Isachenko, V; Isachenko, E

    2012-12-01

    The vitrification technique is simple, quick, cost-effective and has showed a significantly stronger cryoprotective effect in contrast to conventional freezing. The method is based on the rapid cooling of the cell by direct immersion in liquid nitrogen (LN (2) ), thereby avoiding the formation of ice crystals, due to the lower risk of water thawing, which impairs cell function. The aim of this study was to evaluate the effect of storage at -86 °C compared to the conventional -196 °C (under LN (2) ) on essential parameters of the functioning of aseptically vitrified human sperm. Sperm motility, integrity of mitochondrial membrane potential and the rate of DNA fragmentation were determined. The comparison of -86 °C and -196 °C demonstrated no statistical difference in sperm progressive motility (73% vs. 77%), integrity of mitochondrial membrane potential (71% vs. 74%) or DNA fragmentation (3.1% vs. 2.9%). In conclusion, aseptically vitrified sperm can be preserved at -86 °C; eliminating the use of LN (2) simplifies and significantly reduces the costs associated with storage in sperm banks by decreasing the time and space needed for storage, the effort in finding stored samples, and by improving safety for the operator. However, for prolonged storage further studies are needed.

  9. [Detection of enterovirus RNA in cerebrospinal fluid from patients with aseptic meningitis and encephalitis and its clinical significance].

    PubMed

    Li, A; Chen, Z; Liu, Q

    2001-12-01

    To study the pathogenicity of enterovirus (EV) infection in central nervous system and the method for its detection. Using reverse transcription polymerase chain reaction (RT-PCR) and viral culture techniques to detect EV from 46 cerebrospinal fluid (CSF) samples of aseptic meningitis and encephalitis patients. The sensitivity and specificity of RT-PCR for EV RNA detection was affirmed by specific RNA identification of 40 strains of prototype enterovirus. By the virus culture method, 14 out of the 46 CSF sample were tested to beEV positive (26.1%) including 6 Echovirus type 2 (ECV2), 2 Coxackie virus type B2 (CVB2), 2CVB6, 1 ECV3 and 1 ECV11. By RT-PCR method, 31 of 46 CSF sample were tested EV RNA positive (67.4%) through amplified product agarose electrophoresis and northern blot hybridizition. The positive CSF included 14 samples that had been tested positive by virus culture and 17 samples that accounted for 53.9% of the 32 CSF samples which were negetive by virus culture. The sensitivity of RT-PCR was statistically higher than that of the virus culture method, Chi(2) =12.57, P <0.01. EV is known as important etiological agents of aseptic meningitis and encephalitis. RT-PCR is sensitivity, specificity and rapidity, it may be popularized as an effective method to the detection of enterovirus.

  10. [FDG PET as an early nuclear medical diagnostic tool for aseptic wear-induced loosening of hip joint endoprostheses--a report of two cases].

    PubMed

    Mumme, T; Cremerius, U; Hermanns, B; Neuss, M; Müller-Rath, R; Büll, U; Wirtz, D C

    2003-07-01

    To date, 2-[F-18]fluoro-2-deoxy-D-glucose PET (FDG PET) is used as a tool in oncology as well as myocardiological and cerebral functional diagnostics in the clinical routine. False positive results of tumor search imply new possibilities for use in diagnostics of inflammation. The two case reports presented here on aseptic loosening of endoprostheses caused by the rub of polyethylene with histological and immunohistological refurbishing call attention to the possible diagnostic valency of FDG PET as an early warning system regarding aseptic artificial limb loosening induced by the rub of polyethylene. By quantification of glucose metabolism with the "standard uptake value" (SUV) as well as specific storage samples from around the artificial limb, it is the aim of our study group in further examinations to develop an algorithm which permits to distinguish between septic and aseptic loosening.

  11. Lupus Gastrointestinal Tract Vasculopathy: Lupus “Enteritis” Involving the Entire Gastrointestinal Tract from Esophagus to Rectum

    PubMed Central

    Bert, Joseph; Gertner, Elie

    2017-01-01

    Gastrointestinal symptoms are very common in systemic lupus erythematosus (SLE). Lupus “enteritis” is very responsive to treatment but can have devastating consequences if not detected. Most descriptions of enteritis involve the small and large bowel. This is the first report of lupus “enteritis” involving the entire gastrointestinal tract from the esophagus and stomach to the rectum. Lupus “enteritis” is another cause of upper gastrointestinal involvement in SLE (involving even the esophagus and stomach) in addition to involvement of the lower intestinal tract. PMID:28203138

  12. Psoriasiform lupus vulgaris with 30 years duration.

    PubMed

    Reich, Adam; Kobierzycka, Monika; Cisło, Maria; Schwartz, Robert A; Szepietowski, Jacek C

    2006-01-01

    Lupus vulgaris is a progressive form of cutaneous tuberculosis occurring in a person with a moderate to high degree of immunity. It is the most common type of cutaneous tuberculosis. Lupus vulgaris can be mimicked by several other skin conditions, and a 69-y-old female is described with an extremely long history of extensive infiltrative skin lesions with abundant scaling. The lesions were localized on the right arm and forearm, and on the right lateral surface of the chest. The diascopic test was positive. Moreover, a large atrophic scar was seen in the region of right cubital fossa resulting in contracture of the right elbow joint. The histopathology strongly suggested the diagnosis of tuberculosis. The final diagnosis of tuberculosis was confirmed by PCR examination. A polychemotherapeutic regimen (ethambutol 1250 mg/d, rifampicin 600 mg/d and isoniazid 300 mg/d) was successfully employed for the treatment of skin lesions.

  13. Disseminated lupus vulgaris presenting as granulomatous folliculitis.

    PubMed

    Hruza, G J; Posnick, R B; Weltman, R E

    1989-01-01

    A 69-year-old man presented with a 3-year history of scattered, grouped, asymptomatic follicular papules, pustules, and nodules tending toward coalescence into large geographic aggregates. Repeated cutaneous biopsy specimens showed granulomatous folliculitis with negative Ziehl-Neelsen stains. Finally, biopsy material submitted for mycobacterial culture grew Mycobacterium tuberculosis. No evidence of active systemic tuberculosis was found. The patient had a very rare form of tuberculosis, disseminated lupus vulgaris, presenting with granulomatous folliculitis, which is usually not seen in lupus vulgaris. The lesions resolved after an 18-month course of isoniazid and rifampin. The unusual clinical and histologic presentation as well as occasional partial remissions following a variety of nonspecific empiric therapies delayed diagnosis despite multiple evaluations. This case illustrates the importance of obtaining mycobacterial cultures from skin biopsy specimens in addition to special stains whenever cutaneous tuberculosis is suspected.

  14. Giant lupus vulgaris: A rare presentation.

    PubMed

    Sacchidanand, S; Sharavana, S; Mallikarjun, M; Nataraja, H V

    2012-01-01

    Cutaneous tuberculosis continues to be an important public health problem even with the availability of highly effective anti-tuberculous drugs. It constitutes 0.1% of all cases of extrapulmonary tuberculosis. Lupus vulgaris is the most common form of cutaneous tuberculosis that occurs in previously sensitized individuals with a moderate degree of immunity against tubercle bacilli. The different types of lupus vulgaris include plaque, ulcerative, vegetative, papular and nodular, and tumor forms. A 40-year-old man presented with large multiple plaques over right upper limb, right side of chest and back, and right lower limb for the past 30 years. Histopathology showed numerous noncaseating granulomas with Langhan's type of giant cells. The Mantoux test showed strong positivity and there was excellent response to anti-tuberculous treatment. This case is being reported because of its extreme chronicity of 30 years duration, unusually large size and multiplicity of lesions.

  15. Giant lupus vulgaris: A rare presentation

    PubMed Central

    Sacchidanand, S.; Sharavana, S.; Mallikarjun, M.; Nataraja, H. V.

    2012-01-01

    Cutaneous tuberculosis continues to be an important public health problem even with the availability of highly effective anti-tuberculous drugs. It constitutes 0.1% of all cases of extrapulmonary tuberculosis. Lupus vulgaris is the most common form of cutaneous tuberculosis that occurs in previously sensitized individuals with a moderate degree of immunity against tubercle bacilli. The different types of lupus vulgaris include plaque, ulcerative, vegetative, papular and nodular, and tumor forms. A 40-year-old man presented with large multiple plaques over right upper limb, right side of chest and back, and right lower limb for the past 30 years. Histopathology showed numerous noncaseating granulomas with Langhan's type of giant cells. The Mantoux test showed strong positivity and there was excellent response to anti-tuberculous treatment. This case is being reported because of its extreme chronicity of 30 years duration, unusually large size and multiplicity of lesions. PMID:23130259

  16. Anastrozole-induced subacute cutaneous lupus erythematosus.

    PubMed

    Fisher, Juliya; Patel, Mital; Miller, Michael; Burris, Katy

    2016-08-01

    Drug-induced subacute cutaneous lupus erythematosus (DI-SCLE) has been associated with numerous drugs, but there are limited reports of its association with aromatase inhibitor anastrozole. We report the case of a patient undergoing treatment with anastrozole for breast cancer who presented with clinical, serological, and histological evidence consistent with DI-SCLE. Her condition quickly began to improve after the use of anastrozole was discontinued and hydroxychloroquine therapy was initiated. Cases such as ours as well as several others that implicate antiestrogen drugs in association with DI-SCLE seem to be contradictory to studies looking at the usefulness of treating systemic lupus erythematosus (SLE) with antiestrogen therapy. Further research on this relationship is warranted.

  17. Novel therapeutic agents for systemic lupus erythematosus.

    PubMed

    Gescuk, Bryan D; Davis, John C

    2002-09-01

    The last significant breakthrough in the treatment of systemic lupus erythematosus (SLE) was the use of cyclophosphamide and methylprednisolone in the treatment of lupus nephritis. Recent advances in immunology, oncology, and endocrinology have resulted in many potential therapies for SLE. These therapies include new immunosuppressants, biologic medications, tolerizing agents, immunoablation techniques, and hormonal medications. Each of these approaches will be discussed in this review. Some therapies are currently in use in clinical rheumatology practice (mycophenolate mofetil) and others are entering phase I trials (anti-BLyS monoclonal antibody). While some of these new therapies target specific inflammatory mechanisms in SLE (anti-CD40L monoclonal antibody), others work by nonspecific inhibition of the immune system (immunoablation).

  18. Systemic lupus erythematosus: Is it one disease?

    PubMed

    Rivas-Larrauri, Francisco; Yamazaki-Nakashimada, Marco Antonio

    2016-01-01

    Systemic lupus erythematosus (SLE) is a multisystemic disease with a variety of clinical presentations. Monogenic predisposing conditions to the development of this disease have been described. As examples, an impaired expression of interferon-α regulated genes or complement deficiencies have been reported in patients with SLE, with particular clinical presentations. Those defects present particular presentations and a different severity, making an argument that lupus is not a single disease but many. Treatment could be individualized depending on the underlying defect generating the subtype of the disease. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Reumatología y Colegio Mexicano de Reumatología. All rights reserved.

  19. Ultraviolet radiation and systemic lupus erythematosus.

    PubMed

    Barbhaiya, M; Costenbader, K H

    2014-05-01

    Exposure to ultraviolet (UV) radiation is among the environmental factors that have been proposed and studied in association with systemic lupus erythematosus (SLE). While it is known that UV radiation exposure may exacerbate pre-existing lupus, it remains unclear whether UV exposure is a risk factor for the development of SLE. Experimental studies show a significant immunomodulatory role for UV radiation, but strong epidemiologic data regarding its role in triggering SLE onset are lacking. Further studies are needed to assess the role of UV radiation in relation to development of incident SLE, yet they are challenging to design due to difficulties in accurate exposure assessment, the heterogeneous nature of SLE, and the challenge of assessing photosensitivity, a feature of SLE, which often precedes its diagnosis.

  20. Acquired enophthalmos with systemic lupus erythematosus.

    PubMed

    Park, K R; Seo, M R; Ryu, H J; Chi, M J; Baek, H J; Choi, H J

    2016-01-01

    Ocular involvement sometimes occurs with systemic lupus erythematosus (SLE) but enophthalmos with SLE is rare. We report a case of enophthalmos with SLE. A 25-year-old male was admitted for two weeks of fever, sore throat, arthralgia, chest pain and right arm weakness with pain. We diagnosed him with SLE with malar rash, arthritis, pleural effusion, proteinuria, leukopenia, positive antinuclear antibody, anti-dsDNA, and lupus anticoagulant. The patient was prescribed high-dose prednisolone and hydroxychloroquine 400 mg. One week after discharge, he complained about a sensation of a sunken right eye. CT showed right enophthalmos, a post-inflammatory change and chronic inflammation. Proteinuria increased to 3.8 g/day after the patient stopped taking prednisolone. Cyclophosphamide therapy was administered for three months without improvement. We decided to restart prednisolone and change cyclophosphamide to mycophenolate mofetil. Proteinuria decreased but enophthalmos remains as of this reporting.

  1. Update on cardiovascular disease in lupus.

    PubMed

    Lewandowski, Laura B; Kaplan, Mariana J

    2016-09-01

    Atherosclerotic cardiovascular disease confers significant morbidity and mortality in patients with systemic lupus erythematosus (SLE) and cannot be fully explained by traditional cardiovascular risk factors. Recent immunologic discoveries have outlined putative pathways in SLE that may also accelerate the development of atherosclerosis. Aberrant innate and adaptive immune responses implicated in lupus pathogenesis may also contribute to the development of accelerated atherosclerosis in these patients. Defective apoptosis, abnormal lipoprotein function, autoantibodies, aberrant neutrophil responses, and a dysregulated type I interferon pathway likely contribute to endothelial dysfunction. SLE macrophages have an inflammatory phenotype that may drive progression of plaque. Recent discoveries have placed increased emphasis on the immunology of atherosclerotic cardiovascular disease. Understanding the factors that drive the increased risk for cardiovascular disease in SLE patients may provide selective therapeutic targets for reducing inflammation and improving outcomes in atherosclerosis.

  2. Systemic lupus erythematosus in Nepal: A review.

    PubMed

    Kafle, M P; Lee, Vws

    2016-08-01

    Nepal is a small country that is landlocked between India and China. Several ethnic groups live within the 147,181 km(2) of this country. Geographic diversity ranges from the high Himalayas to the flatlands of the Ganges plains. Lupus nephritis (LN), a complication of systemic lupus erythematosus (SLE), is a common kidney problem in Nepal; but the real incidence and prevalence of SLE in Nepal is largely not known. Here, it more commonly affects people (mostly women) living in the southern flatlands, but SLE is reported to be uncommon further south in India. Even though the disease appears to be common, good quality research is uncommon in Nepali literature. This article was written to provide a review of the articles published to date about SLE in Nepal and to discuss the gaps in knowledge that require further evaluation.

  3. Lupus Nephritis: An Overview of Recent Findings

    PubMed Central

    de Zubiria Salgado, Alberto; Herrera-Diaz, Catalina

    2012-01-01

    Lupus nephritis (LN) is one of the most serious complications of systemic lupus erythematosus (SLE) since it is the major predictor of poor prognosis. In susceptible individuals suffering of SLE, in situ formation and deposit of immune complexes (ICs) from apoptotic bodies occur in the kidneys as a result of an amplified epitope immunological response. IC glomerular deposits generate release of proinflammatory cytokines and cell adhesion molecules causing inflammation. This leads to monocytes and polymorphonuclear cells chemotaxis. Subsequent release of proteases generates endothelial injury and mesangial proliferation. Presence of ICs promotes adaptive immune response and causes dendritic cells to release type I interferon. This induces maturation and activation of infiltrating T cells, and amplification of Th2, Th1 and Th17 lymphocytes. Each of them, amplify B cells and activates macrophages to release more proinflammatory molecules, generating effector cells that cannot be modulated promoting kidney epithelial proliferation and fibrosis. Herein immunopathological findings of LN are reviewed. PMID:22536486

  4. Cutaneous Manifestations of Systemic Lupus Erythematosus

    PubMed Central

    Uva, Luís; Miguel, Diana; Pinheiro, Catarina; Freitas, João Pedro; Marques Gomes, Manuel; Filipe, Paulo

    2012-01-01

    Systemic lupus erythematosus (SLE) is a multiorgan autoimmune disease of unknown etiology with many clinical manifestations. The skin is one of the target organs most variably affected by the disease. The American College of Rheumatology (ACR) established 11 criteria as a classificatory instrument to operationalise the definition of SLE in clinical trials. They were not intended to be used to diagnose individuals and do not do well in that capacity. Cutaneous lesions account for four of these 11 revised criteria of SLE. Skin lesions in patients with lupus may be specific or nonspecific. This paper covers the SLE-specific cutaneous changes: malar rash, discoid rash, photosensitivity, and oral mucosal lesions as well as SLE nonspecific skin manifestations, their pathophysiology, and management. A deeper thorough understanding of the cutaneous manifestations of SLE is essential for diagnosis, prognosis, and efficient management. Thus, dermatologists should cooperate with other specialties to provide optimal care of SLE patient. PMID:22888407

  5. Biomarkers for kidney involvement in pediatric lupus

    PubMed Central

    Goilav, Beatrice; Putterman, Chaim; Rubinstein, Tamar B

    2015-01-01

    Lupus nephritis (LN), the renal involvement in systemic lupus erythematosus, is currently diagnosed by histopathology obtained by percutaneous renal biopsy and is associated with increased morbidity and mortality in both adults and children. LN is more prevalent and severe in children, requiring aggressive and prolonged immunosuppression. The consequences of the diagnosis and its treatment have devastating long-term effects on the growth, well-being and quality of life of affected children. The paucity of reliable clinical indicators of the presence and severity of renal involvement have contributed to a halt in the reduction of progression to end-stage renal disease in recent years. Here, we discuss the recent development of biomarkers in the management of LN and their role as therapeutic targets. PMID:26079958

  6. Renal vascular lesions in lupus nephritis.

    PubMed

    Descombes, E; Droz, D; Drouet, L; Grünfeld, J P; Lesavre, P

    1997-09-01

    We retrospectively studied the prevalence, histologic features, clinical correlations, and long-term outcome of the intrarenal vascular lesions of lupus nephritis (LN) in a series of 169 renal biopsies performed between 1980 and 1994 in 132 patients with systemic lupus erythematosus. The most common vascular lesions were nonspecific sclerotic changes, found in 37% of the biopsies (24% if only the cases with moderate to severe changes are considered). The other common vascular lesions were "immunoglobulin microvascular casts," found in 24% of the biopsies. Vasculitis and thrombotic microangiopathy were rare lesions and were seen in only 4 (2.4%) and 1 (0.6%) cases, respectively. Isolated sclerotic vascular changes were present in biopsies from older patients with a longer duration of LN, compared with the group with no vascular lesions, and were associated with a significantly higher prevalence of hypertension. Overall, however, the long-term renal and patient survival of this group did not differ significantly from that of the patients without vascular changes. Immunoglobulin microvascular casts (IMCs) ("lupus vasculopathy") were characterized by the presence of immunoglobulin deposition within the glomerular capillaries and small arterioles. In the present study we extensively investigated the morphologic and immunologic features of this lesion. The lesions were notable for the absence of endothelial or parietal vascular lesions and of fibrin, platelets, and leukocytes, which indicates that thrombosis is not involved in the vascular obstruction. According to our data immunoglobulin precipitation in the microvasculature seems to play a central role in the pathogenesis of this lesion, which is why we propose the term "immunoglobulin microvascular casts." In general, IMCs were associated with the most severe and active forms of diffuse proliferative lupus nephritis (World Health Organization [WHO] class IV). However our data show that, in contrast to previous studies

  7. The Euro-lupus project: epidemiology of systemic lupus erythematosus in Europe.

    PubMed

    Cervera, R; Khamashta, M A; Hughes, G R V

    2009-09-01

    The Euro-lupus project provides updated information on the epidemiologic characteristics of systemic lupus erythematosus (SLE) at the change of the millennium and defines several clinical and immunological prognostic factors. The Euro-lupus cohort is composed of 1000 patients with SLE who have been followed prospectively since 1991. Among other findings, this project has shown that a) the age at onset of the disease, the gender and the autoantibody pattern, among other factors, modify the disease expression and define some specific SLE subsets; b) most of the SLE inflammatory manifestations are less common after long-term evolution of the disease, thus probably reflecting the effect of therapy as well as the progressive remission of the disease in many patients and c) a more prominent role of thrombotic events is becoming evident affecting both morbidity and mortality in SLE.

  8. Lupus vasculopathy combined with renal infarction: unusual manifestation of lupus nephritis.

    PubMed

    Sugimoto, Toshiro; Kanasaki, Keizo; Morita, Yoshikata; Yokomaku, Yukiyo; Narita, Mitsuhiro; Koyama, Tetsuro; Tanaka, Yuki; Kashiwagi, Atsunori; Koya, Daisuke

    2005-11-01

    A 30-year-old woman with a 10-year history of systemic lupus erythematosus was admitted to our hospital because of the onset of hypertension and renal dysfunction. Renal arteriogram revealed multiple renal infarctions, and cut-off or tapering-stenosis in the interlobular arteries. Renal biopsy showed concentric intimal thickening with narrowed lumen in some arterioles and deposition of IgG/IgM/complement 3 in the wall of arteriole without any active lesions or immune complex deposition in glomeruli. The present case indicates that this type of renal vascular lesion in lupus nephritis, lupus vasculopathy, may cause renal infarction and the loss of renal function without active glomerular lesions.

  9. Low Rates of Aseptic Tibial Loosening in Obese Patients With Use of High-Viscosity Cement and Standard Tibial Tray: 2-Year Minimum Follow-Up.

    PubMed

    Crawford, David A; Berend, Keith R; Nam, Denis; Barrack, Robert L; Adams, Joanne B; Lombardi, Adolph V

    2017-09-01

    Total knee arthroplasty is overall a very successful surgery, but complications do occur. These complications include aseptic loosening of the tibial component, and obese patients are among the highest risk group. High-viscosity cement (HVC) has been implicated as a possible cause for aseptic loosening of the tibial component. The purpose of this study was to evaluate the incidence of aseptic loosening of the tibial component in obese patients with the use of HVC and standard tibial tray. We identified 1366 obese patients (1851 knees) with a body mass index >35 kg/m(2) and 2-year minimum follow-up who underwent primary total knee arthroplasty using HVC and a symmetrical, grit-blasted, cobalt-chrome tibial component with 40-mm stem. Preoperative and postoperative range of motion, Knee Society (KS) scores, complications, and reoperations were evaluated. Specifically, we assessed the rate of tibial aseptic loosening. At a mean 5.4 years follow-up, only 1 in 1851 knees had aseptic loosening of the tibial component for an incidence of 0.054%. There was a mean increase of 3.3 degrees of knee range of motion. KS pain level decreased by 38.6 points (50 point scale). KS clinical scores improved by 52.2, Knee Society functional scores improved by 19.5, University of California, Los Angeles, activity score improved by 0.9, and Oxford Knee Score by 15.7. All these improvements were statistically significant with P < .001. Standard tibial components and HVC can be used in most patients, including the high-risk obese group, with low rates of tibial aseptic loosening. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Lupus vulgaris--a case report.

    PubMed

    Munn, S E; Basarab, T; Russell Jones, R

    1995-01-01

    Although lupus vulgaris is the most common form of cutaneous tuberculosis seen in Europe, the incidence has steadily declined and it is now rarely seen. We report a case in a 69-year-old lady who presented with a 10-year history of a slowly growing plaque on the left cheek. Skin biopsy confirmed caseating granulomata, and acid-fast bacilli were seen. She was commenced on triple antituberculous therapy with good effect.

  11. Autoinoculation lupus vulgaris of the perineum.

    PubMed Central

    Sehgal, V N; Chaudhry, A K; Gupta, R

    1991-01-01

    The case of a young heterosexual male, with a 7 year history of an asymptomatic progressive plaque over the right side of the perineum is described, which 4 years later involved the left perineum and scrotal skin, indicating autoinoculation. The diagnosis of lupus vulgaris was made by strongly positive tuberculin test, histopathology, and a favourable response to a short course of intensive antitubercular therapy. Images PMID:1916800

  12. Systemic lupus, folie a trois and homicide.

    PubMed

    Caribé, André C; Daltro-Oliveira, Renato; Araújo, Ricardo Henrique; Cardoso, Ana Paula; Guimarães, Paulo Barreto; Miranda-Scippa, Angela; Quarantini, Lucas C

    2013-10-01

    Folie a trois is a syndrome characterized by the transfer of delusional ideas from one person to two other persons. This condition rarely ends in the murder of any involved and we are unaware of where the primary case had the diagnosis of acute psychosis in systemic lupus erythematosus (SLE). We present a case report of folie a trois resulting in murder, secondary to acute psychosis in SLE. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Concomitant systemic lupus erythematosus and ankylosing spondylitis.

    PubMed Central

    Olivieri, I; Gemignani, G; Balagi, M; Pasquariello, A; Gremignai, G; Pasero, G

    1990-01-01

    The case is reported of a 42 year old white woman meeting currently used diagnostic criteria for both ankylosing spondylitis and systemic lupus erythematosus (SLE). As found in a previously described similar case of a black man, HLA typing showed antigens associated with both SLE and seronegative spondyloarthropathy. This case thus supports the hypothesis that the two diseases occur together only when this rare combination of HLA antigens is present. Images PMID:2344214

  14. What is new in systemic lupus erythematosus.

    PubMed

    Rúa-Figueroa Fernández de Larrinoa, Iñigo

    2015-01-01

    Systemic lupus erythematosus is a heterogeneous rheumatic systemic disease with extremely varied clinical manifestations and a diverse pathogenesis, as illustrated in this review on the most relevant new knowledge related to the disease. Topics such as anemia, pathogenesis, cardiovascular risk assessment, antiphospholipid syndrome, prediction of damage and recent advances in treatment, including tolerogenic and biological agents, are discussed. Relevant contributions regarding classical therapies such as corticosteroid and antimalarials and their optimal use, as well as the roll of vitamin D, are also referred.

  15. Clinical characteristics of cutaneous lupus erythematosus

    PubMed Central

    Szczęch, Justyna; Rutka, Maja; Samotij, Dominik; Zalewska, Agnieszka

    2016-01-01

    Introduction Lupus erythematosus (LE) shows a wide variety of clinical manifestations, skin involvement being one of the most important. Aim To analyze the clinical presentation of cutaneous variants of lupus erythematosus in terms of skin lesion spectrum and extracutaneous involvement. Material and methods A total of 64 patients with cutaneous LE (CLE) were included. The study was based on the “Core Set Questionnaire” developed by the European Society of Cutaneous Lupus Erythematosus (EUSCLE). Clinical severity of skin lesions was evaluated with the Cutaneous Lupus Erythematosus Disease Area and Severity Index (CLASI). All results were subjected to statistical analysis. Results Fifteen (23.4%) patients had an acute CLE (ACLE), 26 (40.6%) subacute CLE (SCLE) and 21 (32.8%) chronic CLE (CCLE). Two (3.2%) individuals only demonstrated urticarial vasculitis as a cutaneous manifestation of LE and these patients were excluded. Patients with ACLE were characterized by the earliest onset of the disease (mean age of 31.9 ±15.0 years; p < 0.001). On average, 4.8 ±1.8 criteria of systemic LE were found in the ACLE group compared to 2.7 ±1.3 criteria in SCLE and 2.5 ±1.5 criteria in CCLE (p < 0.001). The highest activity of skin lesions according to CLASI was found in the SCLE group (p = 0.002). On the other hand, the most severe skin damage was observed in CCLE (p < 0.01). Conclusions Each variant of CLE differs significantly from the others in respect of various aspects of clinical manifestations. Due to a number of different variants of LE skin lesions, a unified classification of CLE still remains a challenge. PMID:26985173

  16. Familial Chilblain Lupus, a Monogenic Form of Cutaneous Lupus Erythematosus, Maps to Chromosome 3p

    PubMed Central

    Lee-Kirsch, Min Ae; Gong, Maolian; Schulz, Herbert; Rüschendorf, Franz; Stein, Annette; Pfeiffer, Christiane; Ballarini, Annalisa; Gahr, Manfred; Hubner, Norbert; Linné, Maja

    2006-01-01

    Systemic lupus erythematosus is a prototypic autoimmune disease. Apart from rare monogenic deficiencies of complement factors, where lupuslike disease may occur in association with other autoimmune diseases or high susceptibility to bacterial infections, its etiology is multifactorial in nature. Cutaneous findings are a hallmark of the disease and manifest either alone or in association with internal-organ disease. We describe a novel genodermatosis characterized by painful bluish-red inflammatory papular or nodular lesions in acral locations such as fingers, toes, nose, cheeks, and ears. The lesions sometimes appear plaquelike and tend to ulcerate. Manifestation usually begins in early childhood and is precipitated by cold and wet exposure. Apart from arthralgias, there is no evidence for internal-organ disease or an increased susceptibility to infection. Histological findings include a deep inflammatory infiltrate with perivascular distribution and granular deposits of immunoglobulins and complement along the basement membrane. Some affected individuals show antinuclear antibodies or immune complex formation, whereas cryoglobulins or cold agglutinins are absent. Thus, the findings are consistent with chilblain lupus, a rare form of cutaneous lupus erythematosus. Investigation of a large German kindred with 18 affected members suggests a highly penetrant trait with autosomal dominant inheritance. By single-nucleotide-polymorphism–based genomewide linkage analysis, the locus was mapped to chromosome 3p. Haplotype analysis defined the locus to a 13.8-cM interval with a LOD score of 5.04. This is the first description of a monogenic form of cutaneous lupus erythematosus. Identification of the gene responsible for familial chilblain lupus may shed light on the pathogenesis of common forms of connective-tissue disease such as systemic lupus erythematosus. PMID:16960810

  17. Lupus nephritis in children in Malaysia.

    PubMed

    Khoo, J J; Pee, S; Thevarajah, B; Yap, Y C; Chin, C K

    2005-01-01

    To determine the pattern of renal histology, clinical outcome of children with lupus nephritis and to identify any associated risk factors predicting renal failure in these children. Retrospectively, 27 children under 16 years of age with lupus nephritis who had renal biopsies done at Sultanah Aminah Hospital Johor, Malaysia from 1994 to 2002 were studied. The renal histology was graded according to WHO classification system (1982). The medical records, laboratory data and the clinical outcome of the patients were studied. There were 24 cases of WHO Class IV, two cases of WHO Class II and a case of WHO Class V. Twenty children were in the good renal outcome group while six children progressed into the poor renal outcome group and required renal replacement. One child was lost to follow-up. All six children in the poor renal outcome group had WHO Class IV histology. The 5-year patient and renal survival rates were 84% and 75%, respectively. Age, sex, activity and chronicity indices in the renal histology, anaemia, elevated serum creatinine, depressed levels of C3 and C4, heavy proteinuria or presence of urinary active sediments were not associated with progression to renal failure. Presently, children with lupus nephritis appeared to have better patient and renal survival rates. Assessment of renal histology in these children was important for diagnosis, treatment and probably prognosis. In this study, there was a 25% incidence of loss of renal function over 5 years in children with WHO Class IV renal histology.

  18. Estrogen therapy in systemic lupus erythematosus.

    PubMed

    Askanase, Anca D

    2004-01-01

    Given the female preponderance of systemic lupus erythematosus (SLE) in humans, the adverse effects of female gender and sex hormones in murine lupus, and numerous reports (retrospective, often anecdotal and uncontrolled) that describe a temporal association between estrogen exposure and development or exacerbation of SLE, it is tempting to accept that estrogens and SLE simply do not mix. While there are valid concerns regarding the use of exogenous estrogens in women with SLE, there are also potential health benefits to be considered. Oral contraceptives (OCs) offer effective birth control and may be bone protective in corticosteroid-treated patients. Recent studies, albeit retrospective, suggest that OCs are well tolerated in patients with SLE. Several salutary effects of postmenopausal estrogens assume particular importance in SLE where the risks of osteoporosis, exaggerated by menopause (natural or cyclophosphamide-induced) and corticosteroids, are substantial. However, the results of the Women's Health Initiative trial significantly limit the use of hormone replacement therapy in the general population, and raise particular concern for SLE patients. Other exogenous hormones (clomifene, gonadotropins, gonadotropin-releasing hormones) may be used to elevate levels of endogenous estrogen and to stimulate ovulation in patients with diminished fertility. Patients with inactive or stable/moderate disease and at low risk for thrombosis may benefit from OCs and other hormonal therapies without a change in lupus activity. Large prospective, double-blind, placebo-controlled studies inclusive of all ethnic groups should provide the basis for more definitive recommendations.

  19. Filaments in the Lupus molecular clouds

    NASA Astrophysics Data System (ADS)

    Benedettini, M.; Schisano, E.; Pezzuto, S.; Elia, D.; André, P.; Könyves, V.; Schneider, N.; Tremblin, P.; Arzoumanian, D.; di Giorgio, A. M.; Di Francesco, J.; Hill, T.; Molinari, S.; Motte, F.; Nguyen-Luong, Q.; Palmeirim, P.; Rivera-Ingraham, A.; Roy, A.; Rygl, K. L. J.; Spinoglio, L.; Ward-Thompson, D.; White, G. J.

    2015-10-01

    We have studied the filaments extracted from the column density maps of the nearby Lupus 1, 3, and 4 molecular clouds, derived from photometric maps observed with the Herschel satellite. Filaments in the Lupus clouds have quite low column densities, with a median value of ˜1.5 × 1021 cm-2 and most have masses per unit length lower than the maximum critical value for radial gravitational collapse. Indeed, no evidence of filament contraction has been seen in the gas kinematics. We find that some filaments, that on average are thermally subcritical, contain dense cores that may eventually form stars. This is an indication that in the low column density regime, the critical condition for the formation of stars may be reached only locally and this condition is not a global property of the filament. Finally, in Lupus we find multiple observational evidences of the key role that the magnetic field plays in forming filaments, and determining their confinement and dynamical evolution.

  20. [Lupus nephritis: up-to-date].

    PubMed

    Karras, A

    2015-02-01

    Renal involvement is frequent during natural history of systemic lupus erythematosus (SLE) and has a major prognostic value in this systemic disease. Screening for renal symptoms, such as proteinuria, micro-haematuria or renal failure must be performed at initial diagnosis and repeated during subsequent follow-ups. Any significant abnormality of these parameters may reveal active glomerulonephritis (GN) and should lead to a renal biopsy, which will significantly impact the therapeutic choices. Proliferative GN, defined as class III or IV by the actual histo-pathological classification, is the most severe form of SLE-associated nephropathy and can lead to end-stage renal disease (ESRD) in up to 60% of cases, according to ethnicity and follow-up duration. Standard induction treatment of active proliferative GN includes corticosteroids combined with an immunosuppressive drug, which can either be cyclophosphamide or mycophenolate mofetil (MMF). Even though, recent biotherapies have not yet proved their efficacy in the field of lupus nephritis, new protocols are expected, aiming higher remission rates and avoidance of high-dose corticosteroids regimens. When remission is achieved in proliferative GN, a maintenance therapy is required to decrease the risk of relapse, using either azathioprine or MMF. Immunosuppressive drugs are responsible for an increased risk of infectious or neoplastic complications but cardiovascular disease is actually one of the main causes of mortality among lupus patients, especially for patients with SLE-related kidney disease, well before reaching ESRD.

  1. Evaluation of magnetic resonance imaging abnormalities in juvenile onset neuropsychiatric systemic lupus erythematosus.

    PubMed

    Al-Obaidi, M; Saunders, D; Brown, S; Ramsden, L; Martin, N; Moraitis, E; Pilkington, C A; Brogan, P A; Eleftheriou, D

    2016-10-01

    The aim of this study was to describe the abnormalities identified with conventional MRI in children with neuropsychiatric systemic lupus erythematosus (NPSLE). This was single-centre (Great Ormond Street Hospital, London) retrospective case series of patients with juvenile NPSLE seen in 2003-2013. Brain MR images of the first episode of active NPSLE were reviewed. All patients fulfilled the 1999 ACR case definitions for NPSLE syndromes. Presenting neuropsychiatric manifestations, immunological findings and treatment are reported. Results are expressed as median and ranges or percentages. Fisher's exact test was used to identify clinical predictors of abnormal MRI. A total of 27 patients (22 females), median age 11 years (4-15), were identified. Presenting clinical symptoms included the following: headaches (85.1 %), mood disorder/depression (62.9 %), seizures (22.2 %), acute psychosis (18.5 %), cognitive dysfunction (14.8 %), movement disorder (14.8 %), acute confusional state (14.8 %), aseptic meningitis (7.4 %), demyelinating syndrome (3.7 %), myelopathy (3.7 %), dysautonomia (3.7 %) and cranial neuropathy (3.7 %). The principal MR findings were as follows: (1) absence of MRI abnormalities despite signs and symptoms of active NPSLE (59 %); (2) basilar artery territory infarction (3 %); (3) focal white matter hyperintensities on T2-weighted imaging (33 %); (4) cortical grey matter lesions (3 %); and (5) brain atrophy (18.5 %). The presence of an anxiety disorder strongly associated with abnormal MRI findings (p = 0.008). In over half the children with NPSLE, no conventional MRI abnormalities were observed; white matter hyperintensities were the most commonly described abnormalities. Improved MR techniques coupled with other alternative diagnostic imaging modalities may improve the detection rate of brain involvement in juvenile NPSLE.

  2. Lupus vulgaris secondary to single BCG vaccination. A case report.

    PubMed

    Selimoğlu, M A; Erdem, T; Parlak, M; Eşrefoğlu, M

    1998-01-01

    A 10-year-old girl with lupus vulgaris following single BCG vaccination is reported. She had a 15 x 20 cm painless lesion covering her left shoulder, axilla, triceps and biceps region. PPD test was positive. Histopathological picture was identical to lupus vulgaris.

  3. Lupus erythematosus--a case of facial swelling.

    PubMed

    Loescher, A; Edmondson, H D

    1988-04-01

    A case is reported of acute facial swelling following tooth extraction that failed to respond in a normal manner. The patient developed systemic signs and symptoms ultimately revealing the diagnosis of lupus erythematosus. The possibility of soft tissue lesions arising in some forms of lupus is emphasised by this report.

  4. Cutaneous lupus erythematosus: a personal approach to management.

    PubMed

    Callen, Jeffrey P

    2006-02-01

    SUMMARY Skin disease in patients with lupus erythematosus may be subdivided into two broad categories - those lesions that when biopsied demonstrate interface dermatitis and those that do not demonstrate interface dermatitis. The skin lesions that are represented by the interface dermatitis include discoid lupus erythematosus, subacute cutaneous lupus erythematosus and acute cutaneous lupus erythematosus. Patients with these 'specific' manifestations have varying degrees of systemic involvement from rare systemic disease in patients with localized discoid lupus erythematosus to common and often severe involvement in patients with acute cutaneous lupus erythematosus. Patients who do not demonstrate interface dermatitis also may have systemic disease and in some instances the skin manifestations are linked to some of the more severe systemic manifestations. Many patients with cutaneous lesions characterized by the interface dermatitis can be controlled with 'standard' therapies including sunscreens, protective clothing and behavioural alteration, and topical corticosteroids with or without an oral antimalarial agent. This review presents a brief summary of each common cutaneous manifestation of lupus erythematosus, its relationship to systemic involvement and treatment issues to effectively deal with the lupus erythematosus patient who has skin disease.

  5. Cardiac tamponade as an initial manifestation of systemic lupus erythematosus.

    PubMed

    Carrion, Diego M; Carrion, Andres F

    2012-06-12

    Clinical manifestations of pericardial disease may precede other signs and symptoms associated with systemic lupus erythematosus. Although pericardial effusion is one of the most common cardiac problems in patients with systemic lupus erythematosus, haemodynamically significant effusions manifesting as cardiac tamponade are rare and require prompt diagnosis and treatment.

  6. Raynaud's phenomenon with oral manifestation in systemic lupus erythematosus.

    PubMed

    da Cunha Bang, F; Lange Wantzin, G; Dahl Christensen, J

    1985-01-01

    A 24-year-old woman with discoid lupus erythematosus developed systemic lupus erythematosus after 6 years. One of the clinical features was Raynaud's phenomenon in the fingers and toes, and furthermore Raynaud's phenomenon appeared in the tongue when exposed to cold and windy weather.

  7. [An update on neuropsychiatric lupus with emphasis in cognitive dysfunction].

    PubMed

    León, Tomás; Henríquez, Carla; Calderón, Jorge; Massardo, Loreto

    2012-10-01

    Patients with systemic lupus erythematosus (SLE) suffer from a number of neuropsychiatric (NP) symptoms throughout their disease affecting them both physically and psychologically. We review herein the nomenclature and case definitions for neuropsychiatric lupus syndromes proposed by the American College of Rheumatology in 1999. We emphasize cognitive dysfunction and discuss etiological hypotheses, especially those related to the presence of antineuronal autoantibodies.

  8. Role of electronmicroscopy in the classification of lupus nephritis.

    PubMed

    Pirani, C L; Olesnicky, L

    1982-07-01

    The role of transmission electronmicroscopy in the clarification of the pleomorphic lesions of lupus nephritis is reviewed. Emphasis is placed on the WHO classification of glomerular lesions and in the importance of electronmicroscopy, particularly the precise identification of the milder forms of glomerular involvement. This is essential for the proper therapeutic management of patients with lupus nephritis and to establish a more accurate prognosis.

  9. Lupus: An Overview of the Disease And Management Options

    PubMed Central

    Maidhof, William; Hilas, Olga

    2012-01-01

    Lupus is a chronic inflammatory autoimmune disease with a wide range of clinical presentations resulting from its effect on multiple organ systems. There are four main types of lupus: neonatal, discoid, drug-induced, and systemic lupus erythematosus (SLE), the type that affects the majority of patients. Patients with lupus experience a loss of self-tolerance as a result of abnormal immunological function and the production of autoantibodies, which lead to the formation of immune complexes that may adversely affect healthy tissue. Although the precise etiologic mechanism is unknown, genetic, hormonal, and environmental factors, as well as immune abnormalities, have been identified. Associations between lupus onset and age, sex, geography, and race have also been established. Management of this disease should be individualized and should include both pharmacological and nonpharmacological modalities for symptom relief and resolution as well as improved quality of life. PMID:22593636

  10. Clinical Perspectives on Lupus Genetics: Advances and Opportunities

    PubMed Central

    James, Judith A.

    2014-01-01

    Synopsis In recent years, genome wide association studies have led to an explosion in the identification of regions containing confirmed genetic risk variants within complex human diseases, for example in systemic lupus erythematosus (SLE). Many of these strongest SLE genetic associations can be divided into groups based upon their potential roles in different processes implicated in lupus pathogenesis, including ubiquitination (a process of marking proteins for degradation), DNA degradation, innate immunity, cellular immunity (B cell, T cell, neutrophil, monocytes), lymphocyte development, and antigen presentation. Recent advances have also demonstrated several genetic associations with SLE subphenotypes and subcriteria, such as autoantibody production, lupus nephritis, serositis, and arthritis. Despite the broad range of lupus genetic studies to date, many areas for further exploration remain to move lupus genetic studies toward clinically informative endpoints, such as identifying individuals at the greatest risk of end-organ damage, early mortality or poor response to a specific therapeutic regimen. PMID:25034154

  11. [Systemic lupus erythematosus and antiphospholipid syndrome: How to manage pregnancy?].

    PubMed

    Guettrot-Imbert, G; Le Guern, V; Morel, N; Vauthier, D; Tsatsaris, V; Pannier, E; Piette, J-C; Costedoat-Chalumeau, N

    2015-03-01

    Pregnancy in systemic lupus erythematosus patients is a common situation that remains associated with higher maternal and fetal mortality/morbidity than in the general population. Complications include lupus flares, obstetrical complications (fetal loss, in utero growth retardation, prematurity) and neonatal lupus syndrome. The association with antiphospholipid antibodies or antiphospholipid syndrome increases the risk of obstetrical complications. Improving the care of these pregnancies depends upon a systematic pregnancy planning, ideally during a preconception counseling visit and a multidisciplinary approach (internist/rheumatologist, obstetrician and anesthetist). The absence of lupus activity, the use of appropriate medications during pregnancy adjusted to the patient's medical history and risk factors, and a regular monitoring are the best tools for a favorable outcome for these high-risk pregnancies. The aim of this review article is to perform an update on the medical care of pregnancy in systemic lupus erythematosus or antiphospholipid syndrome to reduce the risk of complications and to ensure the best maternal and fetal prognosis.

  12. Prognosis and predictors of convulsion among pediatric lupus nephritis patients.

    PubMed

    Beiraghdar, Fatemeh; Maddani, Abbas; Taheri, Saeed; Sharifi-Bonab, Mir Mohsen; Esfahani, Taher; Panahi, Yunes; Einollahi, Behzad

    2009-05-01

    In this study, we aimed to analyze features and outcome of convulsion in pediatric lupus nephritis patients. We retrospectively reviewed data of 14 Iranian children with lupus nephritis who developed seizures and compared them with a group of the same number of well matched pediatric lupus nephritis patients. Higher serum creatinine levels and higher frequencies of anemia and lymphopenia were observed in the convulsion group. Multivariable logistic regression analysis revealed that the only risk factor for development of convulsion in pediatric lupus patients with nephritis was lymphopenia. Survival analysis showed that convulsion had no impact on patient and renal function outcomes in our pediatric lupus nephritis subjects. In conclusion, we found that lymphopenia is a predictive factor for convulsion occurrence in our patients and special attention to neurological status assessment may be needed in this situation.

  13. Lupus erythematosus. Are residential insecticides exposure the missing link?

    PubMed

    Fortes, Cristina

    2010-12-01

    Although the etiology of systemic lupus erythematosus (SLE) remains to be fully elucidated, it is now apparent that multiple genetic and environmental factors are at play. Because lupus has a strong female preponderance, several studies have examined the role of female hormones in disease etiology. Yet this knowledge has not helped to explain lupus etiology or to prevent it. Estrogens exist not only as natural or drug compounds, but also as environmental chemical contaminant and women are highly exposed to all of them. Estrogenic activity has been found in a number of pesticides including pyrethroids that are largely used in the household. Although there is only a small amount of published data examining a possible causal relationship between lupus and pesticides it can be hypothesized that pesticides, in particular insecticides, through their estrogenic activity and capacity to induce oxidative stress provoke autoimmune reaction influencing lupus development.

  14. Exacerbation of lupus panniculitis following anti-hepatitis-B vaccination.

    PubMed

    Choffray, A; Pinquier, L; Bachelez, H

    2007-01-01

    Even though benefits of vaccination policies have been widely demonstrated, vaccine injections might be associated with rare side effects. In this setting, the potential role of vaccines, mostly against hepatitis B virus, in the induction of autoimmunity has been a matter of controversy. We report the case of a woman followed for a lupus panniculitis which had been in remission for 3 years, who developed a lupus flare following an anti-hepatitis-B vaccine injection. The topography of recurring lupus lesions, the chronology of the flare and the increase in the antinuclear autoantibody serum level all supported a causal role for vaccination in the relapse of the lupus lesions. We believe that the present case might provide a first observation of lupus panniculitis possibly induced by hepatitis B vaccination, and this should be added to the range of dysimmune manifestations caused by vaccinations.

  15. Con: Cyclophosphamide for the treatment of lupus nephritis.

    PubMed

    Mok, Chi Chiu

    2016-07-01

    Kidney involvement is a major determinant for morbidity and mortality in patients with systemic lupus erythematosus. The treatment target of lupus renal disease is to induce and maintain remission and to minimize disease or treatment-related comorbidities. Cyclophosphamide (CYC), in conjunction with glucocorticoids, has conventionally been used for the initial treatment of lupus nephritis. However, the major concerns of CYC are its toxicities, such as infertility, urotoxicity and oncogenicity, which are particularly relevant in women of childbearing age. As a result, maintenance therapy of lupus nephritis with an extended course of CYC pulses has largely been replaced by other immunosuppressive agents such as mycophenolate mofetil (MMF) and azathioprine. Recent randomized controlled trials have demonstrated non-inferiority of MMF to pulse CYC as induction therapy of lupus nephritis. Although MMF as induction-maintenance therapy has been increasingly used in lupus nephritis, its efficacy in the long-term preservation of renal function remains to be elucidated. MMF is not necessarily less toxic than CYC. Meta-analyses of clinical trials show similar incidence of infective complications and gastrointestinal adverse events in both MMF- and CYC-based regimens. However, considering the reduction in gonadal toxicity and the risk of oncogenicity, MMF may be used as first-line therapy of lupus nephritis. Tacrolimus (TAC) has recently been shown to be equivalent to either MMF or CYC for inducing remission of lupus nephritis and may be considered as another non-CYC alternative. Combined low-dose MMF and TAC appears to be more effective than CYC pulses in Chinese patients with lupus nephritis and has the potential to replace the more toxic CYC regimens in high-risk patients. Currently, CYC still plays an important role in the management of lupus nephritis patients with impaired or rapidly deteriorating renal function, crescentic glomerulonephritis or as salvage therapy for

  16. Treatment of young patients with lupus nephritis using calcineurin inhibitors

    PubMed Central

    Tanaka, Hiroshi; Tsuruga, Kazushi; Aizawa-Yashiro, Tomomi; Watanabe, Shojiro; Imaizumi, Tadaatsu

    2012-01-01

    Recent advances in the management of lupus nephritis, together with earlier renal biopsy and selective use of aggressive immunosuppressive therapy, have contributed to a favorable outcome in children and adolescents with systemic lupus erythematosus (SLE). Nevertheless, we believe that a more effective and less toxic treatment is needed to attain an optimal control of the activity of lupus nephritis. Recent published papers and our experiences regarding treatment of young patients with lupus nephritis using calcineurin inhibitors are reviewed. Although it has been reported that intermittent monthly pulses of intravenous cyclophosphamide (IVCY) are effective for preserving renal function in adult patients, CPA is a potent immunosuppressive agent that induces severe toxicity, including myelo- and gonadal toxicity, and increases the risk of secondary malignancy. Thus, treatment for controlling lupus nephritis activity, especially in children and adolescents, remains challenging. Cyclosporine A (CsA) and tacrolimus (Tac) are T-cell-specific calcineurin inhibitors that prevent the activation of helper T cells, thereby inhibiting the transcription of the early activation genes of interleukin (IL)-2 and suppressing T cell-induced activation of tumor necrosis factor-α, IL-1β and IL-6. Therefore, both drugs, which we believe may be less cytotoxic, are attractive therapeutic options for young patients with lupus nephritis. Recently, a multidrug regimen of prednisolone (PDN), Tac, and mycophenolate mofetile (MMF) has been found effective and relatively safe in adult lupus nephritis. Since the mechanisms of action of MMF and Tac are probably complementary, multidrug therapy for lupus nephritis may be useful. We propose as an alternative to IVCY, a multidrug therapy with mizoribine, which acts very similarly to MMF, and Tac, which has a different mode of action, combined with PDN for pediatric-onset lupus nephritis. We also believe that a multidrug therapy including CsA and

  17. Murine lupus strains differentially model unique facets of human lupus serology.

    PubMed

    Li, L; Nukala, S; Du, Y; Han, J; Liu, K; Hutcheson, J; Pathak, S; Li, Q; Mohan, C

    2012-05-01

    Systemic lupus erythematosus (SLE) is a polygenic autoimmune disease characterized by the production of anti-nuclear autoantibodies that lead to subsequent end organ damage. Previous array-based studies in patients with SLE have shown that high immunoglobulin (Ig)G anti-nuclear autoantibody reactivity was associated with severe renal lupus, whereas IgM polyreactivity was associated with less severe disease. To ascertain how different murine lupus strains recapitulate these different autoantibody profiles seen in patients, serum from New Zealand black (NZB)/NZ white (W) F(1), Murphy Roths large (MRL)/lpr, NZ mixed (M)2410 and BXSB strains were compared using a comprehensive array-based screen. The array results were verified using enzyme-linked immunosorbent assays (ELISAs). Serum from MRL/lpr mice exhibited high levels of IgG anti-nuclear antibodies as well as anti-glomerular antibodies and variable levels of antibodies to myosin, Matrigel and thyroglobulin. Elevated anti-nuclear IgG antibodies were associated with severe nephritis in this strain. In contrast, NZM2410 mice exhibited lower IgG autoantibody levels with less severe nephritis but a significantly higher polyreactive IgM autoantibody profile. ELISA analysis confirmed these results. The NZB/NZW F(1) and BXSB strains exhibited an intermediate serological profile. Hence, just as in patients with SLE, whereas strong IgG reactivity to nuclear antigens is associated with severe renal disease, a polyreactive IgM seroprofile is also less ominous in murine lupus.

  18. Tir8/Sigirr prevents murine lupus by suppressing the immunostimulatory effects of lupus autoantigens

    PubMed Central

    Lech, Maciej; Kulkarni, Onkar P.; Pfeiffer, Stephanie; Savarese, Emina; Krug, Anne; Garlanda, Cecilia; Mantovani, Alberto; Anders, Hans-Joachim

    2008-01-01

    The Sigirr gene (also known as Tir8) encodes for an orphan receptor of the Toll-like receptor (TLR)/interleukin 1 receptor family that inhibits TLR-mediated pathogen recognition in dendritic cells. Here, we show that Sigirr also inhibits the activation of dendritic cells and B cells upon exposure to RNA and DNA lupus autoantigens. To evaluate the functional role of Sigirr in the pathogenesis of systemic lupus erythematosus (SLE), we generated Sigirr-deficient C57BL/6-lpr/lpr mice. These mice developed a progressive lymphoproliferative syndrome followed by severe autoimmune lung disease and lupus nephritis within 6 mo of age as compared with the minor abnormalities observed in C57BL/6-lpr/lpr mice. Lack of Sigirr was associated with enhanced activation of dendritic cells and increased expression of multiple proinflammatory and antiapoptotic mediators. In the absence of Sigirr, CD4 T cell numbers were increased and CD4+CD25+ T cell numbers were reduced. Furthermore, lack of Sigirr enhanced the activation and proliferation of B cells, including the production of autoantibodies against multiple nuclear lupus autoantigens. These data identify Sigirr as a novel SLE susceptibility gene in mice. PMID:18644972

  19. Tir8/Sigirr prevents murine lupus by suppressing the immunostimulatory effects of lupus autoantigens.

    PubMed

    Lech, Maciej; Kulkarni, Onkar P; Pfeiffer, Stephanie; Savarese, Emina; Krug, Anne; Garlanda, Cecilia; Mantovani, Alberto; Anders, Hans-Joachim

    2008-08-04

    The Sigirr gene (also known as Tir8) encodes for an orphan receptor of the Toll-like receptor (TLR)/interleukin 1 receptor family that inhibits TLR-mediated pathogen recognition in dendritic cells. Here, we show that Sigirr also inhibits the activation of dendritic cells and B cells upon exposure to RNA and DNA lupus autoantigens. To evaluate the functional role of Sigirr in the pathogenesis of systemic lupus erythematosus (SLE), we generated Sigirr-deficient C57BL/6-lpr/lpr mice. These mice developed a progressive lymphoproliferative syndrome followed by severe autoimmune lung disease and lupus nephritis within 6 mo of age as compared with the minor abnormalities observed in C57BL/6-lpr/lpr mice. Lack of Sigirr was associated with enhanced activation of dendritic cells and increased expression of multiple proinflammatory and antiapoptotic mediators. In the absence of Sigirr, CD4 T cell numbers were increased and CD4(+)CD25(+) T cell numbers were reduced. Furthermore, lack of Sigirr enhanced the activation and proliferation of B cells, including the production of autoantibodies against multiple nuclear lupus autoantigens. These data identify Sigirr as a novel SLE susceptibility gene in mice.

  20. Metal is not inert: role of metal ions released by biocorrosion in aseptic loosening--current concepts.

    PubMed

    Cadosch, Dieter; Chan, Erwin; Gautschi, Oliver P; Filgueira, Luis

    2009-12-15

    Metal implants are essential therapeutic tools for the treatment of bone fractures and joint replacements. The metals and metal alloys used in contemporary orthopedic and trauma surgery are well tolerated by the majority of patients. However, complications resulting from inflammatory and immune reactions to metal implants have been well documented. This review briefly discusses the different mechanisms of metal implant corrosion in the human body, which lead to the release of significant levels of metal ions into the peri-implant tissues and the systemic blood circulation. Additionally, this article reviews the effects of the released ions on bone metabolism and the immune system and discusses their involvement in the pathophysiological mechanisms of aseptic loosening and metal hypersensitivity in patients with metal implants.

  1. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling

    PubMed Central

    Bhadane, Bhushan S.; Patil, Ravindra H.

    2016-01-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  2. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  3. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination.

    PubMed

    Atwater, J E; Michalek, W F; Wheeler, R R; Dahl, R; Lunsford, T D; Garmon, F C; Sauer, R L

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  4. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    PubMed

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared.

  5. Aseptic lymphocyte dominated vasculitis-associated lesion resulting from trunnion corrosion in a cobalt-chrome unipolar hemiarthroplasty.

    PubMed

    Khair, M Michael; Nam, Denis; DiCarlo, Edward; Su, Edwin

    2013-01-01

    Most of the published descriptions of adverse soft tissue reactions that have been reported in the context of a metal-on-metal articulation have been in cases of total hip arthroplasty or resurfacing arthroplasty. Recently, several case reports have been published describing aseptic lymphocyte dominated vasculitis-associated lesions (ALVAL) in metal-on-polyethylene. To our knowledge, there has not been a description of a similar, aggressive reaction secondary to metal debris from the head-neck junction of a unipolar hemiarthroplasty component. In this case report, we describe a patient with a catastrophic failure of a unipolar hip hemiarthroplasty, secondary to aggressive osteolysis and an inflammatory mediated immunological reaction to metal debris. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  7. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    SciTech Connect

    Haydary, J.; Susa, D.; Dudáš, J.

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  8. The metal nanoparticle-induced inflammatory response is regulated by SIRT1 through NF-κB deacetylation in aseptic loosening.

    PubMed

    Deng, Zhantao; Jin, Jiewen; Wang, Zhenheng; Wang, Yong; Gao, Qian; Zhao, Jianning

    2017-01-01

    Aseptic loosening is the most common cause of total hip arthroplasty (THA) failure, and osteolysis induced by wear particles plays a major role in aseptic loosening. Various pathways in multiple cell types contribute to the pathogenesis of osteolysis, but the role of Sirtuin 1 (SIRT1), which can regulate inflammatory responses through its deacetylation, has never been investigated. We hypothesized that the downregulation of SIRT1 in macrophages induced by metal nanoparticles was one of the reasons for osteolysis in THA failure. In this study, the expression of SIRT1 was examined in macrophages stimulated with metal nanoparticles from materials used in prosthetics and in specimens from patients suffering from aseptic loosening. To address whether SIRT1 downregulation triggers these inflammatory responses, the effects of the SIRT1 activator resveratrol on the expression of inflammatory cytokines in metal nanoparticle-stimulated macrophages were tested. The results demonstrated that SIRT1 expression was significantly downregulated in metal nanoparticle-stimulated macrophages and clinical specimens of prosthesis loosening. Pharmacological activation of SIRT1 dramatically reduced the particle-induced expression of inflammatory cytokines in vitro and osteolysis in vivo. Furthermore, SIRT1 regulated particle-induced inflammatory responses through nuclear factor kappa B (NF-κB) acetylation. Thus, the results of this study suggest that SIRT1 plays a key role in metal nanoparticle-induced inflammatory responses and that targeting the SIRT1 pathway may lead to novel therapeutic approaches for the treatment of aseptic prosthesis loosening.

  9. [Determinant Factors of Morbidity in Patients with Systemic Lupus Erythematosus].

    PubMed

    Jacinto, Margarida; Silva, Eliana; Riso, Nuno; Moraes-Fontes, Maria Francisca

    2017-05-31

    Severity in systemic lupus erythematosus may vary from mild to even fatal consequences. There are no biomarkers to predict the disease's prognosis. The Systemic Lupus International Collaborating Clinics/ Systemic Damage Index defines systemic lupus erythematosus disease severity and is found to predict prognosis. To test damage determinants in a single-centre systemic lupus erythematosus cohort. Retrospectively followed systemic lupus erythematosus female patients (defined by the identification of at least four systemic lupus erythematosus American College of Rheumatology criteria - fulfillment 100%, n = 76) over the past five years. Age of onset, ethnicity, disease duration, number of American College of Rheumatology criteria at the end of follow-up, cumulative: renal, neuropsychiatric and articular phenotypes, hypertension, dyslipidaemia, smoking and Systemic Lupus Erythematosus Disease Activity Index 2K were correlated to the presence and degree of irreversible damage (Systemic Lupus International Collaborating Clinics Damage Index). Accumulation of American College of Rheumatology criteria was measured in a sub-group of patients followed from disease onset (within a year of the first symptom ascribed to systemic lupus erythematosus) (n = 39 - 51%); Systemic Lupus Erythematosus Disease Activity Index and Systemic Lupus International Collaborating Clinics Damage Index were performed. Statistical analysis was performed using Chi-square, Wilcoxon Mann-Whitney tests and Spearman correlation rho (Sig. 2-tailed p < 0.05). Systemic Lupus International Collaborating Clinics/Systemic Damage Index > 0 was present in 56.6% and significantly associated to a longer duration, a higher number of American College of Rheumatology criteria and a neuropsychiatric phenotype when compared with those with no damage. The final number of American College of Rheumatology criteria accrued was positively correlated to a higher disease activity over the past five years of follow

  10. Shrinking lung syndrome in systemic lupus erythematosus

    PubMed Central

    Borrell, Helena; Narváez, Javier; Alegre, Juan José; Castellví, Ivan; Mitjavila, Francesca; Aparicio, María; Armengol, Eulàlia; Molina-Molina, María; Nolla, Joan M.

    2016-01-01

    Abstract Shrinking lung syndrome (SLS) is a rare and less known complication mainly associated with systemic lupus erythematosus (SLE). In this study, we analyze the clinical features, investigation findings, approaches to management, and outcome in a case series of 9 adult patients with SLE and SLS diagnosed during a 35-year period in 3 referral tertiary care hospitals in Spain. Additionally, we reviewed 80 additional cases previously reported (PubMed 1965–2015). These 80 cases, together with our 9 patients, form the basis of the present analysis. The overall SLS prevalence in our SLE population was 1.1% (9/829). SLS may complicate SLE at any time over its course, and it usually occurs in patients without previous or concomitant major organ involvement. More than half of the patients had inactive lupus according to SELENA-systemic lupus erythematosus disease activity index (SLEDAI) scores. Typically, it presents with progressive exertional dyspnea of variable severity, accompanied by pleuritic chest pain in 76% of the cases. An important diagnostic delay is common. The diagnostic tools that showed better yield for SLS detection are the imaging techniques (chest x-ray and high-resolution computed tomography) along with pulmonary and diaphragmatic function tests. Evaluation of diaphragm dome motion by M-mode ultrasonography and phrenic nerve conduction studies are less useful. There are no standardized guidelines for the treatment of SLS in SLE. The majority of patients were treated with medium or high doses of glucocorticoids. Several immunosuppressive agents have been used in conjunction with steroids either if the patient fails to improve or since the beginning of the treatment. Theophylline and beta-agonists, alone or in combination with glucocorticoids, have been suggested with the intent to increase diaphragmatic strength. The overall long-term prognosis was good. The great majority of patients had significant clinical improvement and stabilization, or mild

  11. Refractory disease in systemic lupus erythematosus.

    PubMed

    Campar, Ana; Farinha, Fátima; Vasconcelos, Carlos

    2011-09-01

    There is no definition or guidelines for refractory disease (RD) in Systemic Lupus Erythematosus (SLE). However, new therapies have been tested mainly in refractory patients. The concept, like the disease, is complex and implies deeper knowledge on the disease pathogenesis and patients' subsets. RD is not included in current activity indices of the disease, what raises the question of how are we monitoring its response to new drugs. In this paper, we analyse some concepts considered important for the global definition of RD in SLE and in some specific organ involvements, excluding lupus nephritis. Management issues will be addressed also. Finally, we review therapeutic options in particular subsets of the disease, namely, cutaneous, articular, haematological and neuropsychiatric lupus. Crucial to the management of a patient suspected to be refractory is an accurate diagnosis, assuring that the persistent clinical manifestations are derived primarily from SLE and not from a concomitant or alternative process. Likewise, certainty about the patient compliance with the therapy prescribed is a frequent unrecognized problem that erroneously might lead to a classification of RD. Therapy of RD for SLE, in general and in most particular involvements, is currently based mainly on the clinician's own experience and judgement, with few randomized trials effectively addressing the issue. In such a heterogeneous disease, consideration of approval of drugs for single-organ indications may pave the way for new therapies. Better biomarkers are needed to add accuracy to the currently used activity indices in order to monitor RD and consolidate its definition. Prospective studies directed to RD in the main SLE involvements are needed to improve our understanding on the management of the disease and foster the development of targeted new drugs. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Lupus Erythematosus and Neutrophilic Urticarial Dermatosis

    PubMed Central

    Gusdorf, Laurence; Bessis, Didier; Lipsker, Dan

    2014-01-01

    Abstract Neutrophilic urticarial dermatosis (NUD) resembles urticaria clinically but is a neutrophilic dermatosis histopathologically. The majority of patients with NUD have an underlying systemic condition, mainly, autoinflammatory disorders such as cryopyrin-associated periodic syndromes, Schnitzler syndrome, and adult-onset Still disease, but a few also have systemic lupus erythematosus (LE). Here, we confirm these data and we report relevant clinical and histopathological data of 7 patients with LE and NUD. We retrospectively retrieved the medical records of all patients with LE in whom skin biopsy showed NUD in registers of Strasbourg and Montpellier University hospitals since 2000. All were female and aged between 13 and 45 years. Skin lesions were typically rose or red macules or slightly elevated papules occurring in a wide distribution. Individual lesions resolved within 24 hours and were not or only slightly itchy. Every patient had associated signs, most of the time polyarthritis and/or fever. NUD was the presenting mode of LE in 2 patients. NUD was misdiagnosed as a classic lupus flare and led to therapeutic intensification with the introduction of immunosuppressive drugs in 4 patients. Histopathological findings consisted of intense neutrophilic interstitial and perivascular infiltrate with leukocytoclasia and without fibrinoid necrosis of vessel walls. Direct immunofluorescence testing showed a lupus band in 4 patients. Antinuclear antibodies were always positive, anti-dsDNA antibodies were positive in 5 patients, and anti-Ro/SSA antibodies in 6 patients. Immunosuppressive drugs such as prednisone, hydroxychloroquine, mycophenolate mofetil, and methotrexate were never effective to treat NUD. Antihistamines were effective in 1 patient and dapsone or colchicine was effective in 5 patients. NUD is not exceptional in patients with systemic LE and is easily misdiagnosed as an acute LE flare. Furthermore, we show that conventional immunosuppressive LE

  13. Hypogammaglobulinemia in pediatric systemic lupus erythematosus.

    PubMed

    Lim, E; Tao, Y; White, A J; French, A R; Cooper, M A

    2013-11-01

    Systemic lupus erythematosus (SLE) is a systemic autoimmune disease typically associated with elevated serum immunoglobulin G (IgG). Hypogammaglobulinemia in SLE patients has been attributed to immunosuppressive treatment or a transient effect associated with nephrotic syndrome. We retrospectively reviewed pediatric SLE patients from a single institution to identify patients with hypogammaglobulinemia and risk factors for hypogammaglobulinemia. A total of 116 pediatric SLE cases from 1997 to 2011 were reviewed and patients with hypogammaglobulinemia (IgG < 500 mg/dl) were identified. The two cohorts were evaluated for association with age, sex, presence of lupus nephritis at SLE diagnosis, disease activity at diagnosis, initial IgG level, and drug treatment. Eighty-six patients were included in our study, with a median age of 15 years and a median follow-up of 39.5 months. Seven percent (six of 86) of patients had hypogammaglobulinemia with a median onset of 27 months (0-72 months) after SLE diagnosis. Significant associations were noted for white race (p value 0.029), male sex (p value 0.009), and the presence of lupus nephritis at SLE diagnosis (p value 0.004). Use of immunosuppressive treatment did not show a statistical association with hypogammaglobulinemia, although two of the patients with hypogammaglobulinemia did receive rituximab. Most patients with hypogammaglobulinemia received intravenous immunoglobulin (IVIG) replacement therapy because of infections and/or concern for infection. Measurement of immunoglobulin levels during treatment in SLE could help identify patients with hypogammaglobulinemia who might require more aggressive follow-up to monitor for increased risk of infection and need for IVIG treatment. A prospective study is needed to validate associated risk factors identified in this study.

  14. Treatment Algorithms in Systemic Lupus Erythematosus.

    PubMed

    Muangchan, Chayawee; van Vollenhoven, Ronald F; Bernatsky, Sasha R; Smith, C Douglas; Hudson, Marie; Inanç, Murat; Rothfield, Naomi F; Nash, Peter T; Furie, Richard A; Senécal, Jean-Luc; Chandran, Vinod; Burgos-Vargas, Ruben; Ramsey-Goldman, Rosalind; Pope, Janet E

    2015-09-01

    To establish agreement on systemic lupus erythematosus (SLE) treatment. SLE experts (n = 69) were e-mailed scenarios and indicated preferred treatments. Algorithms were constructed and agreement determined (≥50% respondents indicating ≥70% agreement). Initially, 54% (n = 37) responded suggesting treatment for scenarios; 13 experts rated agreement with scenarios. Fourteen of 16 scenarios had agreement as follows: discoid lupus: first-line therapy was topical agents and hydroxychloroquine and/or glucocorticoids then azathioprine and subsequently mycophenolate (mofetil); uncomplicated cutaneous vasculitis: initial treatment was glucocorticoids ± hydroxychloroquine ± methotrexate, followed by azathioprine or mycophenolate and then cyclophosphamide; arthritis: initial therapy was hydroxychloroquine and/or glucocorticoids, then methotrexate and subsequently rituximab; pericarditis: first-line therapy was nonsteroidal antiinflammatory drugs, then glucocorticoids with/without hydroxychloroquine, then azathioprine, mycophenolate, or methotrexate and finally belimumab or rituximab, and/or a pericardial window; interstitial lung disease/alveolitis: induction was glucocorticoids and mycophenolate or cyclophosphamide, then rituximab or intravenous gamma globulin (IVIG), and maintenance followed with azathioprine or mycophenolate; pulmonary hypertension: glucocorticoids and mycophenolate or cyclophosphamide and an endothelin receptor antagonist were initial therapies, subsequent treatments were phosphodiesterase-5 inhibitors and then prostanoids and rituximab; antiphospholipid antibody syndrome: standard anticoagulation with/without hydroxychloroquine, then a thrombin inhibitor for venous thrombosis, versus adding aspirin or platelet inhibition drugs for arterial events; mononeuritis multiplex and central nervous system vasculitis: first-line therapy was glucocorticoids and cyclophosphamide followed by maintenance with azathioprine or mycophenolate, and

  15. Disseminated lupus vulgaris: a case report.

    PubMed

    Can, Burce; Zindanci, Ilkin; Turkoglu, Zafer; Kavala, Mukaddes; Ulucay, Vasfiye; Demir, Filiz Topaloglu

    2014-01-01

    Lupus vulgaris is a secondary form of cutaneous tuberculosis which persists for years if not treated. The head and neck are the most commonly affected sites. While less frequently arms and legs, and rarely the trunk and the scalp are involved. Herein, we describe a 73-year-old man with a 5-year history of slowly growing, atrophic, some eroded and ulcerated, red-brown plaques on his forehead, nose, cheeks, ear lobes, trunk and extremites. All of his disseminated lesions healed after antituberculosis therapy.

  16. Systemic lupus erythematosus: Clinical and experimental aspects

    SciTech Connect

    Smolen, J.S.

    1987-01-01

    This text covers questions related to the history, etiology, pathogenesis, clinical aspects and therapy of systematic lupus erythematosus (SLE). Both animal models and human SLE are considered. With regard to basic science, concise information on cellular immunology, autoantibodies, viral aspects and molecular biology in SLE is provided. Clinical topics then deal with medical, dermatologic, neurologic, radiologic, pathologic, and therapeutic aspects. The book not only presents the most recent information on clinical and experimental insights, but also looks at future aspects related to the diagnosis and therapy of SLE.

  17. Annular Lupus Vulgaris Mimicking Tinea Cruris

    PubMed Central

    Heo, Young Soo; Shin, Won Woong; Kim, Yong Ju; Song, Hae Jun

    2010-01-01

    Cutaneous tuberculosis is an infrequent form of extrapulmonary tuberculosis. It is often clinically and histopathologically confused with various cutaneous disorders. A 36-year-old man attended our clinic with slowly progressive, asymptomatic, annular skin lesions on both the thighs and buttocks for 10 years. He consulted with many physicians and was improperly treated with an oral antifungal agent for several months under the diagnosis of tinea cruris, but no resolution of his condition was observed. A diagnosis of lupus vulgaris was made based on the histopathologic examination and the polymerase chain reaction assay. Anti-tuberculosis therapy was administered and the lesions started to regress. PMID:20548922

  18. Disseminated lupus vulgaris: a case report

    PubMed Central

    Can, Burce; Zindanci, Ilkin; Turkoglu, Zafer; Kavala, Mukaddes; Ulucay, Vasfiye; Demir, Filiz Topaloglu

    2014-01-01

    Lupus vulgaris is a secondary form of cutaneous tuberculosis which persists for years if not treated. The head and neck are the most commonly affected sites. While less frequently arms and legs, and rarely the trunk and the scalp are involved. Herein, we describe a 73-year-old man with a 5-year history of slowly growing, atrophic, some eroded and ulcerated, red-brown plaques on his forehead, nose, cheeks, ear lobes, trunk and extremites. All of his disseminated lesions healed after antituberculosis therapy. PMID:28058303

  19. Anticytokine therapies in systemic lupus erythematosus

    PubMed Central

    Cava, Antonio La

    2010-01-01

    The dysfunctional immune response that characterizes systemic lupus erythematosus (SLE) associates with an unbalanced production of soluble mediators that are crucial in promoting and sustaining chronic inflammation. The successful use of biologics in several autoimmune diseases has led to studies in SLE aimed at contrasting the proinflammatory responses that contribute to tissue and organ damage in the disease. Several approaches have been developed and tested as potential therapeutic agents in SLE in preclinical studies and in clinical trials. This article provides an overview on antibody-based approaches in SLE that, although preliminary, have the potential to expand the current therapeutic possibilities in the disease. PMID:20636010

  20. Review of treatment for discoid lupus erythematosus.

    PubMed

    Garza-Mayers, Anna Cristina; McClurkin, Michael; Smith, Gideon P

    2016-07-01

    Discoid lupus erythematosus (DLE) is a chronic cutaneous disease characterized by inflammatory plaques that, in the absence of prompt diagnosis and treatment, may lead to disfiguring scarring and skin atrophy. However, there is limited evidence for which treatments are most effective. Currently, no medications have been approved specifically for the treatment of DLE. Many of the drugs described in the literature were developed for use in other immune disorders. This review will summarize current therapeutic options for DLE and their supporting evidence with discussion of prevention, topical measures, physical modalities, and systemic therapies, including newer potential therapies.