Science.gov

Sample records for lupus erythematodes aseptic

  1. Association of autoimmune hepatitis and systemic lupus erythematodes: a case series and review of the literature.

    PubMed

    Beisel, Claudia; Weiler-Normann, Christina; Teufel, Andreas; Lohse, Ansgar W

    2014-09-21

    Liver test abnormalities have been described in up to 60% of patients with systemic lupus erythematodes (SLE) at some point during the course of their disease. Prior treatment with potentially hepatotoxic drugs or viral hepatitis is commonly considered to be the main cause of liver disease in SLE patients. However, in rare cases elevated liver enzymes may be due to concurrent autoimmune hepatitis (AIH). To distinguish whether the patient has primary liver disease with associated autoimmune clinical and laboratory features resembling SLE - such as AIH - or the elevation of liver enzymes is a manifestation of SLE remains a difficult challenge for the treating physician. Here, we present six female patients with complex autoimmune disorders and hepatitis. Patient charts were reviewed in order to investigate the complex relationship between SLE and AIH. All patients had coexisting autoimmune disease in their medical history. At the time of diagnosis of AIH, patients presented with arthralgia, abdominal complaints, cutaneous involvement and fatigue as common symptoms. All patients fulfilled the current diagnostic criteria of both, AIH and SLE. Remission of acute hepatitis was achieved in all cases after the initiation of immunosuppressive therapy. In addition to this case study a literature review was conducted.

  2. [Terbinafine : Drug-induced lupus erythematodes and triggering of psoriatic skin lesions].

    PubMed

    Mayser, P

    2016-09-01

    Based on the technical information that oral terbinafine must be used with caution in patients with pre-existing psoriasis or lupus erythematosus, the literature was summarized. Terbinafine belongs to the drugs able to induce subcutaneous lupus erythematosus (SCLE)-with a relatively high risk. The clinical picture of terbinafine-induced SCLE may be highly variable and can also include erythema exsudativum multiforme-like or bullous lesions. Thus, differentiation of terbinafine-induced Stevens-Johnson syndrome or toxic epidermal necrolysis may be difficult. Therefore, terbinafine should be prescribed with caution in patients who show light sensitivity, arthralgias, positive antinuclear antibodies or have a history of SLE or SCLE. Case reports include wide-spread, but mostly nonlife-threatening courses, which did not require systemic therapy with steroids or antimalarials in every case. Terbinafine is also able to induce or to aggravate psoriasis. The latency period seems to be rather short (<4 weeks). Terbinafine therefore is not first choice if a systemic therapy with antimycotics is indicated in a patient with psoriasis or psoriatic diathesis. Azole derivatives according to the guidelines may be used as an alternative.

  3. Lupus

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Lupus KidsHealth > For Teens > Lupus Print A A A ... dad that she might have lupus. What Is Lupus? Lupus (pronounced: LOO-pus) is a disease that ...

  4. Aseptic technique.

    PubMed

    Bykowski, Tomasz; Stevenson, Brian

    2008-11-01

    This chapter describes common laboratory procedures that can reduce the risk of culture contaminations (sepsis), collectively referred as "aseptic technique." Two major strategies of aseptic work are described: using a Bunsen burner and a laminar flow hood. Both methods are presented in the form of general protocols applicable to a variety of laboratory tasks such as pipetting and dispensing aliquots, preparing growth media, and inoculating, passaging, and spreading microorganisms on petri dishes.

  5. Lupus

    MedlinePlus

    ... use many tools to make a diagnosis: Medical history Complete exam Blood tests Skin biopsy (looking at skin samples under a microscope) Kidney biopsy (looking at tissue from your kidney under a microscope) What are the treatments for lupus? There is no cure for lupus, but medicines ...

  6. Lupus

    MedlinePlus

    ... bite or scratch of a wolf ("lupus" is Latin for wolf and "erythematosus" is Latin for red). SLE is the most serious form ... occurs more often in African-American, Asian-American, Latin-American, and Native-American women than in non- ...

  7. Pathogenicity of Aseptic Bursaphelenchus xylophilus

    PubMed Central

    Zhu, Li-hua; Ye, Jianren; Negi, Sapna; Xu, Xu-ling; Wang, Zhang-li; Ji, Jin-yi

    2012-01-01

    Pine wilt is a disease of pine (Pinus spp.) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus. However, the pathogenic mechanism of pine wilt disease (PWD) remains unclear. Although the PWN was thought to be the only pathogenic agent associated with this disease, a potential role for bacterial symbionts in the disease process was recently proposed. Studies have indicated that aseptic PWNs do not cause PWD in aseptic pine trees, while PWNs associated with bacteria cause wilting symptoms. To investigate the pathogenicity of the PWN and its associated bacteria, 3-month-old microcuttings derived from certain clones of Pinus densiflora Siebold & Zucc. produced in vitro were inoculated under aseptic conditions with aseptic PWNs, non-aseptic PWNs and bacteria isolated from the nematodes. Six-month-old aseptic P. densiflora microcuttings and 7-month-old P. massoniana seedlings were also inoculated under aseptic conditions with aseptic PWNs and non-aseptic PWNs. The results showed that the aseptic microcuttings and seedlings inoculated with aseptic PWNs or non-aseptic PWNs wilted, while those inoculated with bacterial isolates did not wilt. Nematodes were recovered from wilted microcuttings and seedlings inoculated with aseptic PWNs and non-aseptic PWNs, and the asepsis of nematodes recovered from aseptic PWN-inoculated microcuttings and seedlings was reconfirmed by culturing them in NB liquid medium at 30°C for more than 7 days. Taken together, the results indicate that the asepsis of PWN did not cause the loss of pathogenicity. PMID:22662271

  8. Pathogenicity of aseptic Bursaphelenchus xylophilus.

    PubMed

    Zhu, Li-hua; Ye, Jianren; Negi, Sapna; Xu, Xu-ling; Wang, Zhang-li; Ji, Jin-yi

    2012-01-01

    Pine wilt is a disease of pine (Pinus spp.) caused by the pine wood nematode (PWN), Bursaphelenchus xylophilus. However, the pathogenic mechanism of pine wilt disease (PWD) remains unclear. Although the PWN was thought to be the only pathogenic agent associated with this disease, a potential role for bacterial symbionts in the disease process was recently proposed. Studies have indicated that aseptic PWNs do not cause PWD in aseptic pine trees, while PWNs associated with bacteria cause wilting symptoms. To investigate the pathogenicity of the PWN and its associated bacteria, 3-month-old microcuttings derived from certain clones of Pinus densiflora Siebold & Zucc. produced in vitro were inoculated under aseptic conditions with aseptic PWNs, non-aseptic PWNs and bacteria isolated from the nematodes. Six-month-old aseptic P. densiflora microcuttings and 7-month-old P. massoniana seedlings were also inoculated under aseptic conditions with aseptic PWNs and non-aseptic PWNs. The results showed that the aseptic microcuttings and seedlings inoculated with aseptic PWNs or non-aseptic PWNs wilted, while those inoculated with bacterial isolates did not wilt. Nematodes were recovered from wilted microcuttings and seedlings inoculated with aseptic PWNs and non-aseptic PWNs, and the asepsis of nematodes recovered from aseptic PWN-inoculated microcuttings and seedlings was reconfirmed by culturing them in NB liquid medium at 30°C for more than 7 days. Taken together, the results indicate that the asepsis of PWN did not cause the loss of pathogenicity.

  9. Handling difficult materials: Aseptic packaging

    SciTech Connect

    Lieb, K.

    1994-03-01

    Since aseptic packages, or drink boxes, were introduced in the US in the early 1980s, they have been praised for their convenience and berated for their lack of recyclability. As a result, aseptic packaging collection has been linked with that of milk cartons to increase the volume. The intervening years since the introduction of aseptic packaging have seen the drink box industry aggressively trying to create a recycling market for the boxes. Communities and schools have initiated programs, and recycling firms have allocated resources to see whether recycling aseptic packaging can work. Drink boxes are now recycled in 2.3 million homes in 15 states, and in 1,655 schools in 17 states. They are typically collected in school and curbside programs with other polyethylene coated (laminated) paperboard products such a milk cartons, and then baled and shipped to five major paper companies for recycling at eight facilities.

  10. Aseptic technique in microgravity.

    PubMed

    McCuaig, K

    1992-11-01

    Within the next decade, the United States will launch a space station into low Earth orbit as a preliminary step toward a manned mission to Mars. Provision of asepsis in the unique microgravity environment, essential in operative and invasive procedures, is addressed. An assessment of conventional terrestrial aseptic methods and possible modifications for a microgravity environment was done during the microgravity portion of parabolic flight on NASA KC-135 aircraft. During 110 parabolas on three flight days, a "surgical team" (surgeon, scrub nurse and circulating nurse) using a life size mannequin fastened to a prototype surgical "work station" (operating table), evaluated open and closed gloving (ten parabolas), skin preparation (six parabolas), surgical scrub methods (24 parabolas), gowning (22 parabolas) and draping (48 parabolas). Evaluated were povidone iodine solution, 1 percent povidone iodine detergent, Chloroxylenol with detergent, wet prep soap sponge, a water insoluble iodophor polymer (DuraPrep, 3M), disposable towels, disposable and reusable gowns, large and small disposable drapes with and without adhesive edges, disposable latex surgeon's gloves with and without packaging modifications and restraint mechanisms (tether, swiss seat, waist and foot restraint devices, fairfield and wire clamps and clips). Ease of use, provision of restraint for supplies and personnel and waste disposal were assessed. The literature was reviewed and its relevance to the space environment discussed, including risk factors, environmental contamination, immune status and microbiology. The microgravity environment, limited water supply and restricted operating area mandated that modifications of fabrication and packaging of supplies and technique be made to create and preserve asepsis. Material must meet stringent flammability and off-gassing standards. Either a chlorhexidine or povidone iodine detergent prepackaged brush and sponge would provide an adequate scrub plus

  11. Lupus - resources

    MedlinePlus

    Resources - lupus ... The following organizations are good resources for information on systemic lupus erythematosus : The Lupus Foundation of America -- www.lupus.org The National Institute of Arthritis and Musculoskeletal ...

  12. Aseptic technique for cell culture.

    PubMed

    Coté, R J

    2001-05-01

    This unit describes some of the ways that a laboratory can deal with the constant threat of microbial contamination in cell cultures. A protocol on aseptic technique is described first. This catch-all term universally appears in any set of instructions pertaining to procedures in which noncontaminating conditions must be maintained. In reality, aseptic technique encompasses all aspects of environmental control, personal hygiene, equipment and media sterilization, and associated quality control procedures needed to ensure that a procedure is, indeed, performed with aseptic, noncontaminating technique. Although cell culture can theoretically be carried out on an open bench in a low-traffic area, most cell culture work is carried out using a horizontal laminar-flow clean bench or a vertical laminar-flow biosafety cabinet. Both are described here.

  13. Lupus Nephritis

    MedlinePlus

    ... can be a sign of lupus nephritis. What tests do health care professionals use to diagnose lupus nephritis? Lupus nephritis ... and blood tests and a kidney biopsy. Urine Test Your health care professional uses a urine sample to look for ...

  14. Amoxicillin-induced acute aseptic meningitis.

    PubMed

    Prieto-González, Sergio; Escoda, Rosa; Coloma, Emmanuel; Grau, Josep M

    2011-03-01

    A 58-year-old man presented to the hospital with fever and headache after amoxicillin intake. Physical examination, laboratory, and a cranial CT scan were unremarkable. Cerebrospinal fluid (CSF) testing revealed lymphocytic pleocytosis. After discontinuation of amoxicillin and symptomatic care, the patient quickly improved. Interestingly, he had had two prior episodes of aseptic meningitis that were probably also related to the administration of amoxicillin. Aseptic meningitis can be caused by multiple non-infectious conditions including drugs, malignancy, and autoimmune diseases. We report a case associated with amoxicillin that meets the criteria of drug-induced aseptic meningitis. Considering the wide utilization of amoxicillin, healthcare providers should be aware of it as a possible cause of drug-induced aseptic meningitis.

  15. Different Types of Lupus

    MedlinePlus

    ... Twitter Facebook Pinterest Email Print Different types of lupus Lupus Foundation of America February 24, 2017 Resource ... lupus. Learn more about each type below. Systemic Lupus Erythematosus Systemic lupus is the most common form ...

  16. Aseptic laboratory techniques: plating methods.

    PubMed

    Sanders, Erin R

    2012-05-11

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: Perform plating procedures without contaminating media. Isolate single bacterial colonies by the streak

  17. Aseptic Laboratory Techniques: Plating Methods

    PubMed Central

    Sanders, Erin R.

    2012-01-01

    Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: ● Perform plating procedures without contaminating media. ● Isolate single bacterial colonies by the

  18. Aseptic necrosis of the femoral head after pregnancy: a case report

    PubMed Central

    Nassar, Kawtar; Rachidi, Wafae; Janani, Saadia; Mkinsi, Ouafa

    2016-01-01

    A documented case of beginning aseptic necrosis of the femoral head associated with pregnancy together with a review of the literature about this rare complication of pregnancy is presented. The known risk factors of osteonecrosis are; steroid use, alcoholism, organ transplantation, especially after kidney transplant or bone marrow transplantation bone, systemic lupus erythematosus, dyslipidemia especially hypertriglyceridemia, dysbaric decompression sickness, drepanocytosis and Gaucher's disease. Among the less established factors, we mention procoagulations abnormalities, HIV infection, chemotherapy. We report a case of osteonecrosis of femoral head after pregnancy. PMID:27795792

  19. Lupus nephritis

    MedlinePlus

    ... American College of Rheumatology Guidelines for Screening, Case Definition, Treatment and Management of Lupus Nephritis. Arthritis Care Res (Hoboken) . ... kidney disease Immune response Incidence ...

  20. Lupus mastitis.

    PubMed

    Cerveira, Isabel; Costa Matos, L; Garrido, António; Oliveira, Elda; Solheiro, Helena; Bastos, Marina; Cortez Vaz, F; Nogueira Martins, F

    2006-10-01

    We report a case of a 28-year-old female with the diagnosis of systemic lupus erythematosus (SLE) referred to our breast pathology consultancy in 2002 due to a left breast nodule. Further investigation revealed bilateral coarse calcifications. Biopsy was consistent with a diagnosis of lupus mastitis.

  1. Early acute aseptic iritis after cataract extraction.

    PubMed

    Allen, H F; Grove, A S

    1976-01-01

    Severe iritis which occurs within the first five days after cataract extraction may be categorized as (1) bacterial endophthalmitis, (2) toxic iritis, or (3) aseptic iritis. These entities can sometimes be distinguished because of their clinical features. If bacterial endophthalmitis is suspected, anterior chamber paracentesis should be considered and appropriate antibiotic treatment should be initiated. Acute iritis may result from the introduction of toxic agents into the eye, and may follow the use of products sterilized with ethylene oxide. Early acute aseptic iritis probably occurs more often than has previously been recognized. Response to intensive anti-inflammatory treatment is usually prompt and dramatic. The judicious use of cryoextraction and the careful manipulation of intraocular tissues may minimize the incidence and the severity of postoperative inflammation.

  2. [Particle disease--aseptic loosening of the total hip endoprosthesis].

    PubMed

    Kolundzić, Robert; Orlić, Dubravko

    2008-01-01

    Total hip arthroplasty (THA) improves the ability and quality of life in patients with hip dysfunction due to different causes. Aseptic loosening is the major cause of the late hip endoprosthesis failure. It results from aseptic inflammatory reaction induced by the implant wear debris accumulating at the prosthesis interface, and is mediated by numerous cellular and humoral factors. Due to presence of wear debris we call aseptic loosening of the total hip endoprosthesis as "particle disease". In the most important of factors affecting the risk of aseptic instability include patient's age, sex, body mass index, underlying morbidity (reason for THA), endoprosthetic material and surgeon's skill. However, taken together, all these factors explain only a minor part of variability of this phenomenon. Factors that are decisive for the occurrence of aseptic instability are still largely unknown. The existence of "individual disposition" for development of aseptic instability that is not determined by demographic or biomechanical factors is well recognized.

  3. Sterile versus non-sterile glove use and aseptic technique.

    PubMed

    Flores, Ashley

    There is evidence indicating that improvements in infection control practice can reduce the incidence of healthcare-associated infection. This article explores the evidence base for glove use and aseptic technique. There is a lack of evidence regarding the influence of sterile versus clean gloves in clinical care. Therefore in practice, clean and aseptic techniques are often used interchangeably. Nurses must learn to select clean or aseptic technique, and therefore clean or sterile gloves, using a risk assessment protocol. Regular audits of aseptic technique and education are needed to improve care.

  4. Control of the aseptic processing environment.

    PubMed

    Frieben, W R

    1983-11-01

    Methods used by industry with applications to hospital pharmacy for maintaining an aseptic environment in production of sterile pharmaceutical products are discussed. A major source of product contamination is airborne microorganisms. The laminar-airflow workbench with a high-efficiency particulate air filter provides an ultraclean environment for preparation of sterile products. However, the workbench does not guarantee sterility of products and is not effective if not properly installed and maintained or if the operator uses poor aseptic technique. The laminar-airflow workbench should be tested for leaks, airflow velocity, and airflow patterns when installed, and the workbench should be checked periodically thereafter. The workbench should be placed in a cleanroom where traffic and air disturbances that might affect the laminar airflow are eliminated. A major source of airborne microbial contamination in cleanrooms is people. Personnel movement through an area and presence of personnel without lint-free, nonshedding protective garments increase the levels of microbial contaminants in an area. The transport of nonsterile products (bottles, boxes, paper products) into a cleanroom should be minimized. The cleanroom itself should be sanitized and should be immaculate. Microbial or particulate monitoring should be conducted in the cleanroom using a quantitative method, and corrective-action limits should be set. Hospital pharmacists should examine industrial sterile-processing techniques and apply them to the preparation of sterile products.

  5. Discoid Lupus Erythematosus

    MedlinePlus

    ... Name: Category: Share: Yes No, Keep Private Discoid Lupus Erythematosus Share | Discoid lupus erythematosus (DLE) is a chronic skin condition of ... occur. A small percentage of patients with discoid lupus can develop disease of the internal organs, which ...

  6. [Study on drawing aseptic gas in diluting drugs].

    PubMed

    Fan, Z C; Yu, F Y; Zou, F S

    1996-07-01

    In this study, the gas was drawn from sealed aseptic bottles, the blue flame of an alcohol lamp, and the air of the same treatment room. And the gas was put into aseptic solutions of 10% glucose separately and dripped. Then the samples were taken for bacteriaculture at appointed time-points. Meanwhile, the gases were drawn and put into aseptic solutions of 10% glucose separately. Then deactived penicillines were diluted with the solutions separately. Finally, the penicillines were mixed with 10% glucose and dripped. The samples were taken for bacteria-culture in the same way. The results showed that there was no colony existed in the gas from the sealed aseptic bottles and the flame of the alcohol lamp. However, colonies existed in the samples from the air of the treatment room. It is suggested that sealed aseptic gas should be drawn and kept for use in diluting drugs.

  7. Neonatal lupus.

    PubMed

    Robles, David T; Jaramillo, Lorena; Hornung, Robin L

    2006-12-10

    An otherwise healthy 5-week-old infant with erythematous plaques predominantly on the face and scalp presented to our dermatology clinic. The mother had been diagnosed with lupus erythematosus 2 years earlier but her disease was quiescent. Neonatal lupus is a rare condition associated with transplacental transfer of IgG anti-SSA/Ro and anti-SSB/La antibodies from the mother to the fetus. Active connective tissue disease in the mother does not have to be present and in fact is often absent. Although the cutaneous, hematologic and hepatic manifestations are transient, the potential for permanent heart block makes it necessary for this to be carefully ruled out. As in this case, the dermatologist may be the one to make the diagnosis and should be aware of the clinical presentation, work-up, and management of this important disease.

  8. Lupus erythematosus

    SciTech Connect

    Tuffanelli, D.L.

    1981-02-01

    Lupus erythematosus (LE) is a multisystem disease. Genetic predisposition, altered immunity, hormones, drugs, viruses, and ultraviolet light all may play a role in etiology. A wide range of cutaneous lesions occur, and variants such as subacute cutaneous LE, complement-deficient LE, and neonatal LE have recently been emphasized. Management of the LE patient, including appropriate diagnostic studies and therapy relevant to the dermatologist, is discussed in the review.

  9. S.L.E. Lupus Foundation

    MedlinePlus

    ... August 12, 2016 We've Moved! More News › Lupus News Tuesday, August 2, 2016 Congressional Lupus Caucus ... LUPUS RESEARCH ALLIANCE NYS Fall Calendar Living with Lupus Home | About Us | Our Programs | About Lupus | Lupus ...

  10. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery.

    PubMed

    Chen, Jenny X; Alkire, Blake C; Lam, Allen C; Curry, William T; Holbrook, Eric H

    2016-10-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics.

  11. Aseptic practice recommendations for circulating operating theatre nurses.

    PubMed

    Aholaakko, Teija-Kaisa; Metsälä, Eija

    Aseptic practices prevent exposure of a surgical wound to microbes, operating theatre environment and personnel. The circulating nurse assists the operating theatre personnel and supervises aseptic practices preventing surgical site infections. In the absence of analytical tools, few studies exist on intraoperative nursing-related aseptic practices. This study introduces recommendations to assess the role of the circulating nurse in aseptic practices. The authors used international recommendations and research findings to construct a 20-item self-report instrument with a demonstrated reliability across the scale. The authors structured the scale based on three phases: establishment; maintenance; and disestablishment of a sterile operating field. The tool was tested among operating theatre and day surgery nurses, and compared the differences in the mean acceptance rates of aseptic practice recommendations based on background characteristics. College-level nurses and nurses with 15 or more years' work experience accepted the recommendations at higher levels than bachelor-level nurses and nurses with less work experience. Continual assessment of the evidence base and comprehensive evaluation represent important components in further developing the tool. A reasonable number of items covering clinical practice are necessary for assessing the effectiveness and cost-effectiveness of aseptic practices, and a larger response rate is needed to validate the tool in future.

  12. Aseptic Meningitis with Craniopharyngioma Resection: Consideration after Endoscopic Surgery

    PubMed Central

    Chen, Jenny X.; Alkire, Blake C.; Lam, Allen C.; Curry, William T.; Holbrook, Eric H.

    2016-01-01

    Objectives While bacterial meningitis is a concerning complication after endoscopic skull base surgery, the diagnosis can be made without consideration for aseptic meningitis. This article aims to (1) present a patient with recurrent craniopharyngioma and multiple postoperative episodes of aseptic meningitis and (2) discuss the diagnosis and management of aseptic meningitis. Design Case report and literature review. Results A 65-year-old female patient with a symptomatic craniopharyngioma underwent transsphenoidal resection. She returned postoperatively with symptoms concerning for cerebrospinal fluid (CSF) leak and bacterial meningitis. Lumbar puncture demonstrated mildly elevated leukocytes with normal glucose levels. Cultures were sterile and she was discharged on antibiotics. She returned 18 days postoperatively with altered mental status and fever. Again, negative CSF cultures suggested aseptic meningitis. Radiological and intraoperative findings were now concerning for widespread cerebrovascular vasospasm due to leaked craniopharyngioma fluids. In the following months, her craniopharyngioma recurred and required multiple surgical resections. Days after her last operation, she returned with mental status changes and a sterile CSF culture. She was diagnosed with recurrent aseptic meningitis and antibiotics were discontinued. The patient experienced near complete resolution of symptoms. Conclusions Consideration of aseptic meningitis following craniopharyngioma resection is critical to avoid unnecessary surgical re-exploration and prolonged courses of antibiotics. PMID:27722072

  13. [Systemic lupus erythematosus in the pregnant patient. Implications for anesthesia].

    PubMed

    Pastor Tomás, E; Guillén Antón, J; Vaquerizo Gareta, A; Lirola Grajales, P; Martínez García, R; Cuartero Lobera, J

    2001-03-01

    A 28-year-old woman with systemic lupus erythematosus and a history of aseptic meningitis, digestive bleeding due to thrombopenia and deep venous thrombosis underwent elective cesarean for transverse presentation at 35 weeks. Preoperative blood work-up showed an antinuclear antibody titre that was slightly positive and steroid treatment was started. Surgery operation was performed with general anesthesia. The outcome was satisfactory even though serious complications can develop during the management of anesthesia in such patients. Systemic lupus erythematosus is a chronic, multisystemic disease that mainly affects women of childbearing age. Antibodies and immunocomplexes play a fundamental role. Given the multiorgan involvement in this disease, preoperative study of the lupus patient should assess all such involvement, including maternal-fetal risk, as well as consider the drug and anesthetic management to be applied. Among the clinical signs that can affect management of anesthesia are the following: aseptic meningitis, high blood pressure, pericarditis, pneumonitis and recurrent venous thrombosis. Anemia, thrombopenia and significantly altered coagulation events are common.

  14. Neurological Sequelae of Lupus

    MedlinePlus

    ... psychoses. A striking feature of lupus is a butterfly shaped rash over the cheeks. In addition to ... psychoses. A striking feature of lupus is a butterfly shaped rash over the cheeks. In addition to ...

  15. Living with Lupus

    MedlinePlus

    ... on your family article Stick to it: The benefits of exercise article Coping with hair loss article Lupus and ... leave your body, try turning inward. article Five benefits of exercise for managing lupus ​Whether or not a person ...

  16. What Is Lupus?

    MedlinePlus

    ... better about themselves Remain more active. Pregnancy and Contraception for Women With Lupus Women with lupus can ... harmful to an unborn baby may want reliable birth control. Recent studies have shown that oral contraceptives (birth ...

  17. Children & Teens (with Lupus)

    MedlinePlus

    ... How Lupus Affects the Body Lab Tests for Lupus Signs and Symptoms Treatment Options Financial Resources: Healthcare Family Life and Relationships Flares Exercise and Nutrition Mental Health and Wellbeing Personal Stories ...

  18. Can Lupus Cause Depression?

    MedlinePlus

    ... Adult Care 15 Questions – Pediatric Lupus 15 Questions - Reproduction and Contraception Health with Lupus 15 Questions - Men ... General slowing and clouding of mental functions Diminished sexual interest and/or performance Recurrent thoughts of death ...

  19. Cat scratch disease complicated with aseptic meningitis and neuroretinitis.

    PubMed

    Pinto Jr, Vitor Laerte; Curi, André Land; Pinto, Adriana da Silva; Nunes, Estevão Portela; Teixeira, Maria de Lourdes Benamor; Rozental, Tatiana; Favacho, Alexsandra Rodrigues; Castro, Elba Lemos de; Bóia, Márcio Neves

    2008-04-01

    Cat scratch disease (CSD) is a self limited condition characterized by fever, lymph node enlargement and less often eye involvement. Central nervous system involvement by Bartonella henselae infection is possibly an important cause of morbidity; its role as an agent of aseptic meningitis is unknown. We report a case of a 40 years-old man with CSD accompanied by aseptic meningitis and neuroretinitis. Serum indirect immmunofluorescence (IFI) assays for B. henselae were positive and the cerebrospinal fluid (CSF) analysis showed mononuclear pleocytosis and increased level of protein. Serological tests for other etiologies were negative. The patient responded well to antibiotic therapy with oral doxycicline plus rifampin and in the 12th day of hospitalization evolved to total regression of the headache and partial regression of the visual loss. Clinicians should consider CSD as a differential diagnosis when assessing previously healthy patients with aseptic meningitis associated with regional lymphadenopathy and epidemiological history of feline contact.

  20. Drug-induced lupus erythematosus

    MedlinePlus

    ... Causes Drug-induced lupus erythematosus is similar to systemic lupus erythematosus (SLE). It is an autoimmune disorder. This means ... 2015:chap 132. Wright B, Bharadwaj S, Abelson A. Systemic lupus erythematosus. In: Carey WD, ed. Cleveland Clinic: Current Clinical ...

  1. Stroke Secondary to Aseptic Meningitis After Endovascular Treatment of a Giant Aneurysm with Parent Artery Occlusion

    SciTech Connect

    Doenmez, Halil Mavili, Ertugrul Ikizceli, Tuerkan; Durak, Ahmet Candan; Kurtsoy, Ali

    2009-07-15

    Aseptic meningitis related to hydrogel-coated coils is a known complication, but it is extremely rare after platinum bare coil aseptic meningitis. Here we report the development of aseptic meningitis causing brain stem and cerebellar infarct in a patient with a giant aneurysm treated with bare platinum coils. We conclude that aneurysm size is an important factor affecting the occurrence of aseptic meningitis associated with stroke.

  2. Aseptic meningitis due to Frater type virus in Ontario.

    PubMed

    KELEN, A; LESIAK, J; LABZOFFSKY, N A

    1963-07-06

    During the summer and fall of 1959 and 1960 a virus was isolated on 14 occasions from the stool or cerebrospinal fluid or both of 12 patients with a clinical picture of non-paralytic poliomyelitis or aseptic meningitis. The patients were from eight different localities in Ontario. The isolated virus was not neutralized by antisera to any of the known enteroviruses, reoviruses or adenoviruses, nor did antiserum to the isolate neutralize any of these viruses. Antiserum to Frater virus, however, did neutralize this isolate and in turn was itself neutralized by antiserum to this virus. Frater virus was isolated in Scotland from cases of aseptic meningitis during the same period in 1959 and 1960. In Ontario this virus was not encountered before 1959. Isolation of the virus from cerebrospinal fluid and demonstration of immunological response in the patients establish its etiological significance. Biological characteristics indicate that it belongs to the Echo group.

  3. Living With Lupus

    MedlinePlus

    ... How Do You Find Out If You Have Lupus? Medical history. Telling a doctor about your symptoms and other ... she will talk to you and take a history of your health problems. Many people have lupus for a long time before they find out ...

  4. [Lupus nephritis treatment].

    PubMed

    Santos-Araújo, Carla; Pestana, Manuel

    2008-01-01

    Systemic lupus erithematosus (SLE) is a multiorganic inflammatory disease characterized by a significant morbidity and mortality related not just to disease evolution but also to therapeutic side effects. Sixty percent of SLE patients develop renal disease related to lupus. Moreover, several studies report that lupus nephritis is an important predictor of both renal impairment and global mortality in these patients. In lupus nephritis, the renal biopsy still represents a cornerstone for both histological grading and therapeutical management. Several classification schemes for lupus nephritis based mainly on morphological parameters have been proposed so far. In the WHO grading system the most severe form of lupus nephritis is the diffuse proliferative lupus nephritis or lupus nephritis class IV. In fact, several authors have documented an invariable course to end stage renal failure in these patients, in the absence of specific therapy. Despite the considerable improvement observed since the introduction of corticosteroid and cyclophosphamide treatment, a significant number of patients still present an incomplete response to therapy. Moreover, even in the cases of good response to therapy adverse events related to the treatment such as infertility, hemorrhagic cystitis or increased susceptibility to infection frequently supervenes.

  5. Causes of Aseptic Persistent Pain after Total Knee Arthroplasty

    PubMed Central

    Lim, Hong-An; Seon, Jong-Keun; Park, Kyung-Soon; Shin, Young-Joo; Yang, Hong-Yeol

    2017-01-01

    Background Persistent pain after total knee arthroplasty (TKA) is dissatisfying to the patient and frustrating to the surgeon. The purpose of this study is to evaluate the aseptic causes and clinical course of intractable pain following TKA. Methods Of the total 2,534 cases of primary TKA reviewed, 178 cases were classified as having aseptic persistent pain that was not resolved within 1 year after surgery. Except for the cases with periprosthetic fracture (56 knees), 122 cases of aseptic painful TKA were divided into two groups: intra-articular group (83 knees) and extra-articular group (39 knees). Results In the intra-articular group, the main reasons for pain were aseptic loosening (n = 40), polyethylene wear (n = 16), instability (n = 10), recurrent hemarthrosis (n = 5), patellar maltracking (n = 4), tendon ruptures (n = 4), and stiffness (n = 2). In the extraarticular group, 10 knees (25.6%) were found to have nerve entrapment in the spine, 6 knees (15.4%) were found to have hip osteoarthritis or femoral head avascular necrosis. The reasons for persistent knee pain in the remaining 23 knees (59.0%) still remain elusive. Conclusions Persistent pain after TKA originated from pathology of extra-articular origin in a considerable number of cases in this study. Therefore, it is important to perform thorough preoperative evaluations to reduce pain resulting from extra-articular causes. Furthermore, meticulous surgical procedures and optimal alignment are required to reduce pain of intra-articular origin related to implant wear, instability, and patellar maltracking. PMID:28261427

  6. Clinical decision rules to distinguish between bacterial and aseptic meningitis

    PubMed Central

    Dubos, F; Lamotte, B; Bibi‐Triki, F; Moulin, F; Raymond, J; Gendrel, D; Bréart, G; Chalumeau, M

    2006-01-01

    Background Clinical decision rules have been derived to distinguish between bacterial and aseptic meningitis in the emergency room to avoid unnecessary antibiotic treatments and hospitalisations. Aims To evaluate the reproducibility and to compare the diagnostic performance of five clinical decision rules. Methods All children hospitalised for bacterial meningitis between 1995 and 2004 or aseptic meningitis between 2000 and 2004 have been included in a retrospective cohort study. Sensitivity and specificity were calculated by applying each rule to the patients. The best rule was a priori defined as the one yielding 100% sensitivity for bacterial meningitis, the highest specificity, and the greatest simplicity for a bedside application. Results Among the 166 patients included, 20 had bacterial meningitis and 146 had aseptic meningitis. Although three rules achieved 100% sensitivity (95% CI 84–100), one had a significantly lower specificity (13%, 95% CI 8–19) than those of the other two rules (57%, 95% CI 48–65; and 66%, 95% CI 57–73), which were not statistically different. The ease of manual computation of the rule developed by Nigrovic et al (a simple list of five items: seizure, blood neutrophil count, cerebrospinal fluid (CSF) Gram stain, CSF protein, CSF neutrophil count) was higher than the one developed by Bonsu and Harper. Conclusion On our population, the rule derived by Nigrovic et al had the best balance between accuracy and simplicity of manual computation and could help to avoid two thirds of unnecessary antibiotic treatments and hospitalisations. PMID:16595647

  7. Idiopathic Facial Aseptic Granuloma: Review of an Evolving Clinical Entity.

    PubMed

    Zitelli, Kristine B; Sheil, Amy T; Fleck, Robert; Schwentker, Ann; Lucky, Anne W

    2015-01-01

    Idiopathic facial aseptic granuloma (IFAG), originally termed pyodermite froide du visage, describes a generally asymptomatic facial nodule presenting in childhood with clinical resemblance to pyoderma or cystic, granulomatous, or vascular lesions. Clinical understanding is constantly evolving, with recent observations indicating that IFAG may represent a subtype of childhood rosacea. We present a case of IFAG associated with eyelid chalazions in a 19-month-old boy. Although his clinical course paralleled previously reported IFAG cases, we observed a unique ultrasound variation during initial diagnostic examination. Further delineation of clinical, imaging, and histologic properties of IFAG may reveal insights into etiologic associations and ideal management.

  8. Aseptic Meningitis Caused by Lassa Virus: Case Series Report.

    PubMed

    Okokhere, Peter O; Bankole, Idowu A; Iruolagbe, Christopher O; Muoebonam, Benard E; Okonofua, Martha O; Dawodu, Simeon O; Akpede, George O

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications.

  9. Oligophilic Bacteria as Tools To Monitor Aseptic Pharmaceutical Production Units

    PubMed Central

    Nagarkar, Parag P.; Ravetkar, Satish D.; Watve, Milind G.

    2001-01-01

    The bacterial loads of air, surfaces, and personnel in clean rooms are routinely monitored using a set of standard media. Bacteria that can grow on these media are a tiny fraction of the total numbers in any environment. A substantial proportion of bacteria long thought to be unculturable were recently shown to be oligophilic. Oligophile counts in clean rooms in our studies exceeded the standard plate counts by up to 2 orders of magnitude. They responded to disinfection routines in ways similar to the responses of conventional bacteria. We suggest that oligophiles are better tools than conventional bacteria for environmental monitoring in aseptic pharmaceutical production units. PMID:11229934

  10. Lupus Foundation of America

    MedlinePlus

    ... of America Follow @LupusOrg Email Address: ZIP / Postal Code: Spam Control Text: Please leave this field empty ... up for email updates Email Address: ZIP / Postal Code: Spam Control Text: Please leave this field empty ...

  11. Performance analysis of exam gloves used for aseptic rodent surgery.

    PubMed

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-05-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP-PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham 'exertion' activity. According to these criteria, 94% of HP-PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP-PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries.

  12. The pathobiology and pathology of aseptic implant failure

    PubMed Central

    2016-01-01

    Pathological assessment of periprosthetic tissues is important, not only for diagnosis, but also for understanding the pathobiology of implant failure. The host response to wear particle deposition in periprosthetic tissues is characterised by cell and tissue injury, and a reparative and inflammatory response in which there is an innate and adaptive immune response to the material components of implant wear. Physical and chemical characteristics of implant wear influence the nature of the response in periprosthetic tissues and account for the development of particular complications that lead to implant failure, such as osteolysis which leads to aseptic loosening, and soft-tissue necrosis/inflammation, which can result in pseudotumour formation. The innate response involves phagocytosis of implant-derived wear particles by macrophages; this is determined by pattern recognition receptors and results in expression of cytokines, chemokines and growth factors promoting inflammation and osteoclastogenesis; phagocytosed particles can also be cytotoxic and cause cell and tissue necrosis. The adaptive immune response to wear debris is characterised by the presence of lymphoid cells and most likely occurs as a result of a cell-mediated hypersensitivity reaction to cell and tissue components altered by interaction with the material components of particulate wear, particularly metal ions released from cobalt-chrome wear particles. Cite this article: Professor N. A. Athanasou. The pathobiology and pathology of aseptic implant failure. Bone Joint Res 2016;5:162–168. DOI: 10.1302/2046-3758.55.BJR-2016-0086. PMID:27146314

  13. Role of cytokines in gonarthrosis and knee prosthesis aseptic loosening.

    PubMed

    Loria, Maria Paola; Dambra, Porzia; Moretti, Biagio; Patella, Vittorio; Capuzzimati, Laura; Cavallo, Elsa; Nettis, Eustachio; Pesce, Vito; Dell'Osso, Adriana; Simone, Carmelo; Tursi, Alfredo

    2004-01-01

    Cytokines, which have been demonstrated in synovial fluids during various joint diseases, play an important role in mediating synovial inflammation and in regulating the immune response of many inflammatory processes. We studied synovial fluid, serum, and synovial fragments obtained from 33 patients--10 affected by serious gonarthrosis re-quiring a prosthetic implant, 8 with knee prosthesis aseptic loosening, and (as controls) 15 affected by degenerative meniscopathies--to evaluate the degree of inflammation and level of interleukins (IL-2, IL-4, IL-6, IL-10) and interferon gamma secretion. Histological analysis revealed slightly more infiltration by inflammatory cells in the synovial tissue of patients with gonarthrosis and knee prosthesis aseptic loosening than in that of the control group, with a high prevalence of macrophages. Moreover, we observed enhanced production of the studied cytokines, especially in synovial fluid as compared to serum, indicating that in the pathological conditions examined the inflammatory events are mainly localized. Because the role of these cytokines is to modulate inflammation, better knowledge of the involvement of cells and their soluble mediators in articular damage could guide immunomodulating treatment.

  14. Performance Analysis of Exam Gloves Used for Aseptic Rodent Surgery

    PubMed Central

    LeMoine, Dana M; Bergdall, Valerie K; Freed, Carrie

    2015-01-01

    Aseptic technique includes the use of sterile surgical gloves for survival surgeries in rodents to minimize the incidence of infections. Exam gloves are much less expensive than are surgical gloves and may represent a cost-effective, readily available option for use in rodent surgery. This study examined the effectiveness of surface disinfection of exam gloves with 70% isopropyl alcohol or a solution of hydrogen peroxide and peracetic acid (HP–PA) in reducing bacterial contamination. Performance levels for asepsis were met when gloves were negative for bacterial contamination after surface disinfection and sham ‘exertion’ activity. According to these criteria, 94% of HP–PA-disinfected gloves passed, compared with 47% of alcohol-disinfected gloves. In addition, the effect of autoclaving on the integrity of exam gloves was examined, given that autoclaving is another readily available option for aseptic preparation. Performance criteria for glove integrity after autoclaving consisted of: the ability to don the gloves followed by successful simulation of wound closure and completion of stretch tests without tearing or observable defects. Using this criteria, 98% of autoclaved nitrile exam gloves and 76% of autoclaved latex exam gloves met performance expectations compared with the performance of standard surgical gloves (88% nitrile, 100% latex). The results of this study support the use of HP–PA-disinfected latex and nitrile exam gloves or autoclaved nitrile exam gloves as viable cost-effective alternatives to sterile surgical gloves for rodent surgeries. PMID:26045458

  15. Lupus anticoagulants and antiphospholipid antibodies

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/000547.htm Lupus anticoagulants and antiphospholipid antibodies To use the sharing features on this page, please enable JavaScript. Lupus anticoagulants are antibodies against substances in the lining ...

  16. [Acute pancreatitis due to lupus].

    PubMed

    Hani, Mohamed Aziz; Guesmi, Fethi; Ben Achour, Jamel; Zribi, Riadh; Bouasker, Ibtissem; Zoghlami, Ayoub; Najah, Nabil

    2004-02-01

    Among digestive clinical presentations of systemic lupus erythematosus, acute pancreatitis remains a serious affection with very poor prognosis. To date, pathogenesis is still unclear. We report two cases of fatal acute pancreatitis related to systemic lupus erythematosus.

  17. Lupus vulgaris of external nose.

    PubMed

    Bhandary, Satheesh Kumar; Ranganna, B Usha

    2008-12-01

    Lupus vulgaris is the commonest form of cutaneous tuberculosis which commonly involve trunk and buttocks. Lupus vulgaris affecting nose and face, are rarely reported in India. This study reports an unusual case of lupus vulgaris involving the external nose that showed dramatic outcome after six months of anti- tubercular treatment.

  18. Lupus vulgaris: difficulties in diagnosis.

    PubMed

    Rhodes, Julia; Caccetta, Tony Philip; Tait, Clare

    2013-05-01

    Lupus vulgaris is one of the most common forms of cutaneous tuberculosis. It presents a diagnostic challenge due to its paucibacillary nature. This is a report of a case of a delayed diagnosis of lupus vulgaris, presenting as perianal and peristomal plaques, followed by a review of the diagnostic tools for lupus vulgaris and their limitations.

  19. 77 FR 38305 - Guidance for Industry on Lupus Nephritis Caused by Systemic Lupus Erythematosus-Developing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-27

    ... HUMAN SERVICES Food and Drug Administration Guidance for Industry on Lupus Nephritis Caused by Systemic Lupus Erythematosus--Developing Medical Products for Treatment; Withdrawal of Guidance AGENCY: Food and... availability of a guidance entitled ``Lupus Nephritis Caused By Systemic Lupus...

  20. Associations between Meteorological Factors and Aseptic Meningitis in Six Metropolitan Provinces of the Republic of Korea

    PubMed Central

    Joshi, Yadav Prasad; Kim, Eun-Hye; Kim, Jong-Hun; Kim, Ho; Cheong, Hae-Kwan

    2016-01-01

    We assessed the association between climate factors and a number of aseptic meningitis cases in six metropolitan provinces of the Republic of Korea using a weekly number of cases from January 2002 to December 2012. Generalized linear quasi-Poisson models were applied to estimate the effects of climate factors on the weekly number of aseptic meningitis cases. We used generalized additive and generalized additive mixed models to assess dose–response relationships. A 1 °C increase in mean temperature was associated with an 11.4% (95% confidence interval (CI): 9.6%–13.3%) increase in aseptic meningitis with a 0-week lag; a 10 mm rise in rainfall was associated with an 8.0% (95% CI: 7.2%–8.8%) increase in aseptic meningitis with a 7-week lag; and a 1 mJ/m2 increase of solar radiation was associated with a 5.8% (95% CI: 3.0%–8.7%) increase in aseptic meningitis with a 10-week lag. Nino3 showed positive effects in all lags, and its one unit increase was associated with an 18.9% (95% CI: 15.3%–22.6%) increase of aseptic meningitis at lag 9. The variability in the relationship between climate factors and aseptic meningitis could be used to initiate preventive measures for climate determinants of aseptic meningitis. PMID:27916923

  1. Recurrent aseptic encephalitis in periodic fever, aphthous stomatitis, pharyngitis and adenopathy (PFAPA) syndrome.

    PubMed

    Frye, Richard E

    2006-05-01

    An 11-year-old boy with episodes of periodic fever, aphthous stomatitis, pharyngitis and adenitis (PFAPA) is reported. Two PFAPA episodes were associated with aseptic encephalitis and seizures. Recurrent acute aseptic encephalitis or seizures have never been reported during the febrile episodes of PFAPA. This possible association is discussed within the context of the etiology of PFAPA.

  2. Cloning higher plants from aseptically cultured tissues and cells

    NASA Technical Reports Server (NTRS)

    Krikorian, A. D.

    1982-01-01

    A review of aseptic culture methods for higher plants is presented, which focuses on the existing problems that limit or prevent the full realization of cloning plants from free cells. It is shown that substantial progress in clonal multiplication has been made with explanted stem tips or lateral buds which can be stimulated to produce numerous precocious axillary branches. These branches can then be separated or subdivided and induced to root in order to yield populations of genetically and phenotypically uniorm plantlets. Similarly, undifferentiated calluses can sometimes be induced to form shoots and/or roots adventitiously. Although the cell culture techniques required to produce somatic embryos are presently rudimentary, steady advances are being made in learning how to stimulate formation of somatic or adventive embryos from totipotent cells grown in suspension cultures. It is concluded that many problems exist in the producing and growing of totipotent or morphogenetically competent cell suspensions, but the potential benefits are great.

  3. Aseptic Meningitis Caused by Lassa Virus: Case Series Report

    PubMed Central

    Bankole, Idowu A.; Iruolagbe, Christopher O.; Muoebonam, Benard E.; Okonofua, Martha O.; Dawodu, Simeon O.; Akpede, George O.

    2016-01-01

    The Lassa virus is known to cause disease in different organ systems of the human body, with varying clinical manifestations. The features of severe clinical disease may include bleeding and/or central nervous system manifestations. Whereas Lassa fever encephalopathy and encephalitis are well described in the literature, there is paucity of data on Lassa virus meningitis. We present the clinical description, laboratory diagnosis, and management of 4 consecutive cases of aseptic meningitis associated with Lassa virus infection without bleeding seen in a region of Nigeria known to be endemic for both the reservoir rodent and Lassa fever. The 4 patients recovered fully following intravenous ribavirin treatment and suffered no neurologic complications. PMID:27957363

  4. Aseptic multiplication of banana from excised floral apices.

    PubMed

    Cronauer, S S; Krikorian, A D

    1985-08-01

    Most economically important bananas and plantains are large triploid seedless herbs that must be propagated vegetatively by removing small side shoots or "suckers" from the parent plant or by planting seed pieces of larger corms. Consequently, multiplication of stock material is time consuming, Recently, the rapid production of young banana plantlets suitable for use as "seed" material has been described. Vegetative shoot apices were isolated and multiplied using aseptic tissue culture techniques. Although these multiplication systems, once established, can produce thousands of plants in a relatively short period of time, their establishment necessitates the initial sacrifice of an individual specimen, which may not always be desirable or prudent should a limited parent stock be available. We describe here the production and multiplication of rooted banana plantlets from the isolation and culture of terminal floral apices.

  5. Aseptic laboratory techniques: volume transfers with serological pipettes and micropipettors.

    PubMed

    Sanders, Erin R

    2012-05-31

    Microorganisms are everywhere - in the air, soil, and human body as well as on inanimate surfaces like laboratory benches and computer keyboards. The ubiquity of microbes creates a copious supply of potential contaminants in a laboratory. To ensure experimental success, the number of contaminants on equipment and work surfaces must be minimized. Common among many experiments in microbiology are techniques involving the measurement and transfer of cultures containing bacterial cells or viral particles. To do so without contacting non-sterile surfaces or contaminating sterile media requires (1) preparing a sterile workspace, (2) precisely setting and accurately reading instruments for aseptic transfer of liquids, and (3) properly manipulating instruments, cultures flasks, bottles and tubes within a sterile field. Learning these procedures calls for training and practice. At first, actions should be slow, deliberate, and controlled with the goal being for aseptic technique to become second nature when working at the bench. Here we present the steps for measuring volumes using serological pipettes and micropipettors within a sterile field created by a Bunsen burner. Volumes range from microliters (μl) to milliliters (ml) depending on the instrument used. Liquids commonly transferred include sterile broth or chemical solutions as well as bacterial cultures and phage stocks. By following these procedures, students should be able to: ·Work within the sterile field created by the Bunsen burner flame. ·Use serological pipettes without compromising instrument sterility. ·Aspirate liquids with serological pipettes, precisely reading calibrated volumes by aligning the meniscus formed by the liquid to the graduation marks on the pipette. ·Keep culture bottles, flasks, tubes and their respective caps sterile during liquid transfers. ·Identify different applications for plastic versus glass serological pipettes. ·State accuracy limitations for micropipettors.

  6. Psoriasiform lupus vulgaris.

    PubMed

    Padmavathy, L; Rao, L Lakshmana; Ethirajan, N; Dhanlaklshmi, M

    2008-04-01

    Tuberculosis is a major public health problem in both developing and developed countries. Cutaneous Tuberculosis constitutes a minor proportion of extra-pulmonary manifestations of Tuberculosis. Lupus Vulgaris (LV) is one of the clinical variants of Cutaneous Tuberculosis. A case of a large plaque type psoriasiform lesion of lupus vulgaris on the thigh, of 15 years' duration, in an 18-year-old girl is reported. This case highlights the ignorance level among the patients and consequent failure to avail proper anti-tuberculous treatment despite campaign in print and audio visual media.

  7. Drug-induced lupus.

    PubMed

    Rubin, Robert L

    2005-04-15

    Autoantibodies and, less commonly, systemic rheumatic symptoms are associated with treatment with numerous medications and other types of ingested compounds. Distinct syndromes can be distinguished, based on clinical and laboratory features, as well as exposure history. Drug-induced lupus has been reported as a side-effect of long-term therapy with over 40 medications. Its clinical and laboratory features are similar to systemic lupus erythematosus, except that patients fully recover after the offending medication is discontinued. This syndrome differs from typical drug hypersensitivity reactions in that drug-specific T-cells or antibodies are not involved in induction of autoimmunity, it usually requires many months to years of drug exposure, is drug dose-dependent and generally does not result in immune sensitization to the drug. Circumstantial evidence strongly suggests that oxidative metabolites of the parent compound trigger autoimmunity. Several mechanisms for induction of autoimmunity will be discussed, including bystander activation of autoreactive lymphocytes due to drug-specific immunity or to non-specific activation of lymphocytes, direct cytotoxicity with release of autoantigens and disruption of central T-cell tolerance. The latter hypothesis will be supported by a mouse model in which a reactive metabolite of procainamide introduced into the thymus results in lupus-like autoantibody induction. These findings, as well as evidence for thymic function in drug-induced lupus patients, support the concept that abnormalities during T-cell selection in the thymus initiate autoimmunity.

  8. Inoculation lupus vulgaris.

    PubMed

    Sehgal, V N; Jain, S; Gupta, R

    1992-01-01

    An 11-years-old girl with lupus vulgaris on the right buttock following inoculation is described. The diagnosis was formed by the history, morphological characteristics, Mantoux test, histopathology, and was supported by an affirmative response to short course intensive chemotherapy (6 months). This route of infection acquires special significance with the worldwide-spread of HIV infection.

  9. [Neonatal lupus. Case report].

    PubMed

    Alcántara-Salinas, Adriana; Solano-Fiesco, Liborio; Romero-Ramírez, Jorge Armando; Olivera-Solórzano, Florisela; Alonso-Pérez, Nancy Carmencita; Marcos-Cabrera, Liliana; González-Martínez, Rosa Ana

    2012-01-01

    Neonatal lupus has a rare incidence, distinct from systemic lupus erythematosus. This is an acquired autoimmune disease associated with maternal antibodies to proteins Ro / La (SSA /SSB), transferred by the placenta; it represents the prototype of passive transfer of antibodies from mother to child. The disease can affect the skin, heart, and rarely, the hepatobiliary or hematologic systems. Congenital complete heart block is the most severe form of neonatal lupus. In clinical practice it is important to distinguish in utero a complete from an incomplete atrioventricular block (AV) in order to render prompt care. We present the case of a new born female, who was diagnosed with an atrio-ventricular block at 26 weeksí gestation. When the baby was delivered at 38 weeksí gestation, she presented bradycardia (54 xí). On the suspicion of neonatal lupus, we required antinuclear antibodies, anti-Sm, anti-RNP, anti-SS-A and anti-SS-B, which were positive. A bicameral pacemaker was placed uneventfully.

  10. Progress Made in Lupus Diagnosis and Treatment

    MedlinePlus

    ... of this page please turn JavaScript on. Feature: Lupus Progress Made in Lupus Diagnosis and Treatment Past Issues / Spring 2014 Table ... W. Clark NIAMS For our readers who have lupus or are the loved ones of someone with ...

  11. Lupus Nephritis Susceptibility Loci in Women with Systemic Lupus Erythematosus

    PubMed Central

    Chung, Sharon A.; Brown, Elizabeth E.; Williams, Adrienne H.; Ramos, Paula S.; Berthier, Celine C.; Bhangale, Tushar; Alarcon-Riquelme, Marta E.; Behrens, Timothy W.; Criswell, Lindsey A.; Graham, Deborah Cunninghame; Demirci, F. Yesim; Edberg, Jeffrey C.; Gaffney, Patrick M.; Harley, John B.; Jacob, Chaim O.; Kamboh, M. Ilyas; Kelly, Jennifer A.; Manzi, Susan; Moser-Sivils, Kathy L.; Russell, Laurie P.; Petri, Michelle; Tsao, Betty P.; Vyse, Tim J.; Zidovetzki, Raphael; Kretzler, Matthias; Kimberly, Robert P.; Freedman, Barry I.; Graham, Robert R.

    2014-01-01

    Lupus nephritis is a manifestation of SLE resulting from glomerular immune complex deposition and inflammation. Lupus nephritis demonstrates familial aggregation and accounts for significant morbidity and mortality. We completed a meta-analysis of three genome-wide association studies of SLE to identify lupus nephritis–predisposing loci. Through genotyping and imputation, >1.6 million markers were assessed in 2000 unrelated women of European descent with SLE (588 patients with lupus nephritis and 1412 patients with lupus without nephritis). Tests of association were computed using logistic regression adjusting for population substructure. The strongest evidence for association was observed outside the MHC and included markers localized to 4q11-q13 (PDGFRA, GSX2; P=4.5×10−7), 16p12 (SLC5A11; P=5.1×10−7), 6p22 (ID4; P=7.4×10−7), and 8q24.12 (HAS2, SNTB1; P=1.1×10−6). Both HLA-DR2 and HLA-DR3, two well established lupus susceptibility loci, showed evidence of association with lupus nephritis (P=0.06 and P=3.7×10−5, respectively). Within the class I region, rs9263871 (C6orf15-HCG22) had the strongest evidence of association with lupus nephritis independent of HLA-DR2 and HLA-DR3 (P=8.5×10−6). Consistent with a functional role in lupus nephritis, intra-renal mRNA levels of PDGFRA and associated pathway members showed significant enrichment in patients with lupus nephritis (n=32) compared with controls (n=15). Results from this large-scale genome-wide investigation of lupus nephritis provide evidence of multiple biologically relevant lupus nephritis susceptibility loci. PMID:24925725

  12. Biomarkers for systemic lupus erythematosus.

    PubMed

    Ahearn, Joseph M; Liu, Chau-Ching; Kao, Amy H; Manzi, Susan

    2012-04-01

    The urgent need for lupus biomarkers was demonstrated in September 2011 during a Workshop sponsored by the Food and Drug Administration: Potential Biomarkers Predictive of Disease Flare. After 2 days of discussion and more than 2 dozen presentations from thought leaders in both industry and academia, it became apparent that highly sought biomarkers to predict lupus flare have not yet been identified. Even short of the elusive biomarker of flare, few biomarkers for systemic lupus erythematosus (SLE) diagnosis, monitoring, and stratification have been validated and employed for making clinical decisions. This lack of reliable, specific biomarkers for SLE hampers proper clinical management of patients with SLE and impedes development of new lupus therapeutics. As such, the intensity of investigation to identify lupus biomarkers is climbing a steep trajectory, lending cautious optimism that a validated panel of biomarkers for lupus diagnosis, monitoring, stratification, and prediction of flare may soon be in hand.

  13. Recurrent case of ibuprofen-induced aseptic meningitis in mixed connective tissue disease.

    PubMed

    Karmacharya, Paras; Mainali, Naba Raj; Aryal, Madan Raj; Lloyd, Benjamin

    2013-04-30

    Although relatively uncommon, the incidence of non-steroidal anti-inflammatory drug-induced aseptic meningitis appears to be increasing among patients with connective tissue disease and also among the healthy population. Ibuprofen is the most common culprit identified. We report a case of a 28-year-old woman with mixed connective tissue disease and recent intake of ibuprofen, presenting with a recurrent episode of ibuprofen-induced aseptic meningitis.

  14. Lung and lupus vulgaris.

    PubMed

    Mukta, V; Jayachandran, K

    2011-04-01

    Lupus vulgaris is chronic, postprimary, paucibacillary cutaneous tuberculosis found in individuals with moderate immunity and high degree of tuberculin sensitivity. Eighty percent of the lesions are on the head and neck. We present the case of a 38 year old lady who was admitted with complaints of worsening breathlessness and low grade fever of one month duration. Examination showed multiple, nontender skin ulcers on bilateral lumbar areas, two oozing serosanguinous discharge and others scarred in the centre. Respiratory system examination and chest X-ray revealed right sided pleural effusion. On investigation, pleural fluid was tuberculous in nature. Skin biopsy from the edge of ulcer was also suggestive of tuberculosis. Patient is doing well on antituberculous drugs. This case highlights the importance of cutaneous manifestations of systemic disease and is an example of the unusual presentation of lupus vulgaris in a case of pleural effusion.

  15. Treatment of Cutaneous Lupus

    PubMed Central

    Chang, Aileen Y.; Werth, Victoria P.

    2011-01-01

    Cutaneous lupus erythematosus (CLE) is an autoimmune, inflammatory skin disease seen in patients with or without systemic lupus erythematosus (SLE). The management of CLE includes treatment and prevention of lesions, as well as routine assessment for systemic disease. Treatment options include both topical and systemic therapies. Topical therapies include corticosteroids and calcineurin inhibitors. Systemic therapies generally fall under one of three categories: antimalarials, immunomodulators, such as dapsone and thalidomide, and immunosuppressives, such as methotrexate and mycophenolate. Evidence for the treatment of CLE is limited by few prospective studies, as well as lack of a validated outcome measure up until recently. There is good evidence to support the use of topical steroids and calcineurin inhibitors, though most of these trials have not used placebo or vehicle controls. There have been no randomized placebo-controlled trials evaluating systemic therapies for the treatment of CLE. PMID:21503694

  16. What Causes Lupus Flares?

    PubMed

    Fernandez, David; Kirou, Kyriakos A

    2016-03-01

    Systemic lupus erythematosus (SLE), the prototypic systemic autoimmune disease, follows a chronic disease course, punctuated by flares. Disease flares often occur without apparent cause, perhaps from progressive inherent buildup of autoimmunity. However, there is evidence that certain environmental factors may trigger the disease. These include exposure to UV light, infections, certain hormones, and drugs which may activate the innate and adaptive immune system, resulting in inflammation, cytotoxic effects, and clinical symptoms. Uncontrolled disease flares, as well as their treatment, especially with glucocorticoids, can cause significant organ damage. Tight surveillance and timely control of lupus flares with judicial use of effective treatments to adequately suppress the excessive immune system activation are required to bring about long term remission of the disease. We hope that new clinical trials will soon offer additional effective and target-specific biologic treatments for SLE.

  17. Apoptosis in chronic cutaneous lupus erythematosus, discoid lupus, and lupus profundus

    PubMed Central

    Sáenz-Corral, Claudia Ileana; Vega-Memíje, María Elisa; Martínez-Luna, Eduwiges; Cuevas-González, Juan Carlos; Rodríguez-Carreón, Alma Angélica; de la Rosa, Juan José Bollain-y-Goytia; del Muro, Felipe de Jesús Torres; Avalos-Díaz, Esperanza

    2015-01-01

    Introduction: Lupus erythematosus is a multisystemic disease that is characterized by autoantibody production and immune complex deposition in such tissues as the mucosa, joints, the central nervous system, and skin. Cutaneous lupus erythematosus is categorized as acute, subacute, and chronic. Chronic cutaneous lupus erythematosus comprises discoid lupus erythematosus (DLE) and lupus profundus (LP). Aim: To analyze the expression of proapoptotic molecules in patients with lupus erythematosus discoid and lupus profundus. Material and methods: Descriptive study, the study groups comprised 10 cases of LP and 10 cases of DLE, and a control. Skin samples of cases and controls were processed for immunohistochemistry and by TUNEL technique. The database and statistical analysis was performed (statistical test X2) SPSS (Chicago, IL, USA). Results: Apoptotic features were broadly distributed along the skin biopsies in epidermal keratinocytes as well as at dermis. By immunohistochemistry the expression of Fas receptor and Fas-L was higher in the skin of lupus patients compared with controls. We also noted differences in Fas-L, -Fas, and -Bax proteins expression intensity in discoid lupus erythematosus patients in the epidermis, and hair follicles. Conclusions: Fas and Fas-L are expressed similarly in LP and DLE. PMID:26261624

  18. IL-10 regulates murine lupus.

    PubMed

    Yin, Zhinan; Bahtiyar, Gul; Zhang, Na; Liu, Lanzhen; Zhu, Ping; Robert, Marie E; McNiff, Jennifer; Madaio, Michael P; Craft, Joe

    2002-08-15

    MRL/MpJ-Tnfrsf6(lpr) (MRL/MpJ-Fas(lpr); MRL-Fas(lpr)) mice develop a spontaneous lupus syndrome closely resembling human systemic lupus erythematosus. To define the role of IL-10 in the regulation of murine lupus, IL-10 gene-deficient (IL-10(-/-)) MRL-Fas(lpr) (MRL-Fas(lpr) IL-10(-/-)) mice were generated and their disease phenotype was compared with littermates with one or two copies of an intact IL-10 locus (MRL-Fas(lpr) IL-10(+/-) and MRL-Fas(lpr) IL-10(+/+) mice, respectively). MRL-Fas(lpr) IL-10(-/-) mice developed severe lupus, with earlier appearance of skin lesions, increased lymphadenopathy, more severe glomerulonephritis, and higher mortality than their IL-10-intact littermate controls. The increased severity of lupus in MRL-Fas(lpr) IL-10(-/-) mice was closely associated with enhanced IFN-gamma production by both CD4(+) and CD8(+) cells and increased serum concentration of IgG2a anti-dsDNA autoantibodies. The protective effect of IL-10 in this lupus model was further supported by the observation that administration of rIL-10 reduced IgG2a anti-dsDNA autoantibody production in wild-type MRL-Fas(lpr) animals. In summary, our results provide evidence that IL-10 can down-modulate murine lupus through inhibition of pathogenic Th1 cytokine responses. Modulation of the level of IL-10 may be of potential therapeutic benefit for human lupus.

  19. Lupus Alma Disk Survey

    NASA Astrophysics Data System (ADS)

    Ansdell, Megan

    2016-07-01

    We present the first unbiased ALMA survey of both dust and gas in a large sample of protoplanetary disks. We surveyed 100 sources in the nearby (150-200 pc), young (1-2 Myr) Lupus region to constrain M_dust to 2 M_Mars and M_gas to 1 M_Jup. Most disks have masses < MMSN and gas-to-dust ratios < ISM. Such rapid gas depletion may explain the prevalence of super-Earths in the exoplanet population.

  20. Pregnancy and Lupus Nephritis.

    PubMed

    Kattah, Andrea G; Garovic, Vesna D

    2015-09-01

    The management of lupus nephritis in pregnancy presents a diagnostic and therapeutic challenge for providers. Pregnancy creates a series of physiologic changes in the immune system and kidney that may result in an increased risk of disease flare and adverse maternal and fetal outcomes, such as preeclampsia, fetal loss, and preterm delivery. Conception should be delayed until disease is in remission to ensure the best pregnancy outcomes. Maternal disease activity and fetal well-being should be monitored closely by an interdisciplinary team, including obstetricians, rheumatologists, and nephrologists throughout pregnancy. Careful attention must be paid to the dosing and potential teratogenicity of medications.

  1. Epigenetics and lupus.

    PubMed

    Miceli-Richard, Corinne

    2015-03-01

    Systemic lupus erythematosus (SLE) is among the systemic autoimmune diseases whose complex pathogenesis involves both genetic and environmental factors. Epigenetic dysregulation resulting in overexpression of certain genes in some of the key immune cells, such as T cells, has been incriminated in the pathophysiology of SLE. Epigenetics is defined as transmissible and reversible modifications in gene expression without alterations in the nucleotide sequences. Epigenetic information is carried chiefly by DNA itself, histones, and noncoding RNAs. Several epigenetic mechanisms may play a role in SLE pathogenesis. This review discusses the various epigenetic mechanisms that regulate gene expression and provides examples relevant to SLE.

  2. Comparative Analysis of Direct Hospital Care Costs between Aseptic and Two-Stage Septic Knee Revision

    PubMed Central

    Kasch, Richard; Merk, Sebastian; Assmann, Grit; Lahm, Andreas; Napp, Matthias; Merk, Harry; Flessa, Steffen

    2017-01-01

    Background The most common intermediate and long-term complications of total knee arthroplasty (TKA) include aseptic and septic failure of prosthetic joints. These complications cause suffering, and their management is expensive. In the future the number of revision TKA will increase, which involves a greater financial burden. Little concrete data about direct costs for aseptic and two-stage septic knee revisions with an in depth-analysis of septic explantation and implantation is available. Questions/Purposes A retrospective consecutive analysis of the major partial costs involved in revision TKA for aseptic and septic failure was undertaken to compare 1) demographic and clinical characteristics, and 2) variable direct costs (from a hospital department’s perspective) between patients who underwent single-stage aseptic and two-stage septic revision of TKA in a hospital providing maximum care. We separately analyze the explantation and implantation procedures in septic revision cases and identify the major cost drivers of knee revision operations. Methods A total of 106 consecutive patients (71 aseptic and 35 septic) was included. All direct costs of diagnosis, surgery, and treatment from the hospital department’s perspective were calculated as real purchase prices. Personnel involvement was calculated in units of minutes. Results Aseptic versus septic revisions differed significantly in terms of length of hospital stay (15.2 vs. 39.9 days), number of reported secondary diagnoses (6.3 vs. 9.8) and incision-suture time (108.3 min vs. 193.2 min). The management of septic revision TKA was significantly more expensive than that of aseptic failure ($12,223.79 vs. $6,749.43) (p <.001). On the level of the separate hospitalizations the mean direct costs of explantation stage ($4,540.46) were lower than aseptic revision TKA ($6,749.43) which were again lower than those of the septic implantation stage ($7,683.33). All mean costs of stays were not comparable as they

  3. The Pathogenesis of Lupus Nephritis

    PubMed Central

    Lech, Maciej

    2013-01-01

    Lupus nephritis is an immune complex GN that develops as a frequent complication of SLE. The pathogenesis of lupus nephritis involves a variety of pathogenic mechanisms. The extrarenal etiology of systemic lupus is based on multiple combinations of genetic variants that compromise those mechanisms normally assuring immune tolerance to nuclear autoantigens. This loss of tolerance becomes clinically detectable by the presence of antinuclear antibodies. In addition, nucleic acids released from netting or apoptotic neutrophils activate innate and adaptive immunity via viral nucleic acid-specific Toll-like receptors. Therefore, many clinical manifestations of systemic lupus resemble those of viral infection. In lupus, endogenous nuclear particles trigger IFN-α signaling just like viral particles during viral infection. As such, dendritic cells, T helper cells, B cells, and plasma cells all contribute to the aberrant polyclonal autoimmunity. The intrarenal etiology of lupus nephritis involves antibody binding to multiple intrarenal autoantigens rather than the deposition of circulating immune complexes. Tertiary lymphoid tissue formation and local antibody production add to intrarenal complement activation as renal immunopathology progresses. Here we provide an update on the pathogenic mechanisms that lead to lupus nephritis and provide the rationale for the latest and novel treatment strategies. PMID:23929771

  4. microRNAs in lupus

    PubMed Central

    ZAN, HONG; TAT, CONNIE; CASALI, PAOLO

    2014-01-01

    Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by the production of an array of pathogenic autoantibodies, including high-affinity anti-dsDNA IgG antibodies, which plays an important role in disease development and progression. Lupus preferentially affects women during their reproductive years. The pathogenesis of lupus is contributed by both genetic factors and epigenetic modifications that arise from exposure to the environment. Epigenetic marks, including DNA methylation, histone post-translational modifications and microRNAs (miRNAs), interact with genetic programs to regulate immune responses. Epigenetic modifications influence gene expression and modulate B cell functions, such as class switch DNA recombination (CSR), somatic hypermutation (SHM) and plasma cell differentiation, thereby informing the antibody response. Epigenetic dysregulation can result in aberrant antibody responses to exogenous antigens or self-antigens, such as chromatin, histones and dsDNA in lupus. miRNAs play key roles in the post-transcriptional regulation of most gene-regulatory pathways and regulate both the innate and the adaptive immune responses. In mice, dysregulation of miRNAs leads to aberrant immune responses and development of systemic autoimmunity. Altered miRNA expression has been reported in human autoimmune diseases, including lupus. The dysregulation of miRNAs in lupus could be the result of multiple environmental factors, such as sex hormones and viral or bacterial infection. Modulation of miRNA is a potential therapeutic strategy for lupus. PMID:24826805

  5. Flexible walled container having membrane fitment for use with aseptic filling apparatus

    SciTech Connect

    Davis, J.C.; Reiss, R.J.; Rica, A.F.

    1984-05-01

    There is disclosed an aseptic flexible walled container having a rigid fitment member cooperative with an aseptic filling apparatus and including a neck, outer flanges surrounding the neck, a frangible membrane and an outer end rim receptive of an hermetically sealed lid. The neck is formed with an internal chamferred seating shoulder for fluid-tight engagement with a fill tube. One outer flange cooperates with clamping jaws of the aseptic filling apparatus for detachably sealing the fitment to a sterilizing chamber and placing it in position for insertion of the filling tube which ruptures the membrane and permits the aseptic introduction of product to the container's interior. The other outer flange is secured to an opening in a wall of the flexible container. The joined fitment and container are presterilized prior to filling. Selected materials for the multi-ply container walls and the fitment permit the container to withstand gamma ray and other sterilization treatment, heat and pressure while maintaining required strength. After the container is aseptically filled, such as with flowable food product, the fill tube is withdrawn and a lid is hermetically sealed onto the rim of the fitment. A heat shield adjacent a container wall surrounds the fitment to protect the container from excessive heat generated by the associated filling apparatus during filling.

  6. Cerebrospinal fluid lactate dehydrogenase isoenzymes in children with bacterial and aseptic meningitis.

    PubMed

    Nussinovitch, Moshe; Finkelstein, Yaron; Elishkevitz, Keren Politi; Volovitz, Benjamin; Harel, Daniella; Klinger, Gil; Razon, Yaron; Nussinovitch, Udi; Nussinovitch, Naomi

    2009-10-01

    Differentiation of bacterial from aseptic meningitis may be difficult. Our aim was to determine the pattern of distribution of lactate dehydrogenase (LDH) isoenzymes in the cerebrospinal fluid (CSF) of patients with bacterial and aseptic meningitis. One hundred and fifty-seven patients with suspected meningitis were enrolled in the study. They were divided into 3 groups according to the culture- or bacterial antigen assay-proven diagnosis and CSF findings: bacterial meningitis (n = 31), aseptic meningitis (n = 65), and non-meningitis (n = 61). Total LDH level and percentages of LDH isoenzymes in the CSF were measured in each patient. Each group showed a distinct LDH isoenzyme distribution pattern, with a statistically significant difference among the groups in the percentages of the various isoenzymes. Compared with the non-meningitis group, total LDH activity in the CSF was high in the aseptic meningitis group (49.82+/-35.59 U/L, P < 0.001) and exaggerated in the bacterial meningitis group (944.53+/-112.3 U/L, P < 0.001). Low LDH-2 levels were unique to bacterial meningitis (P < 0.01), whereas high LDH-3 levels were characteristic of aseptic meningitis (P < 0.05). Both groups had low levels of LDH-1 and high levels of LDH-4 and LDH-5. In conclusion, the LDH isoenzyme pattern may be of clinical diagnostic value in meningitis, particularly when culture results are pending.

  7. Male only Systemic Lupus

    PubMed Central

    Aggarwal, Rachna; Namjou, Bahram; Li, Shibo; D'Souza, Anil; Tsao, Betty P; Bruner, Ben; James, Judith A.; Scofield, R. Hal

    2010-01-01

    Systemic lupus erythematosus (SLE) is more common among women than men with a ratio of about 10 to 1. We undertook this study to describe familial male SLE within a large cohort of familial SLE. SLE families (two or more patients) were obtained from the Lupus Multiplex Registry and Repository. Genomic DNA and blood samples were obtained using standard methods. Autoantibodies were determined by multiple methods. Medical records were abstracted for SLE clinical data. Fluorescent in situ hybridization (FISH) was performed with X and Y centromere specific probes, and a probe specific for the toll-like receptor 7 gene on the X chromosome. Among 523 SLE families, we found five families in which all the SLE patients were male. FISH found no yaa gene equivalent in these families. SLE-unaffected primary female relatives from the five families with only-male SLE patients had a statistically increased rate of positive ANA compared to SLE-unaffected female relatives in other families. White men with SLE were 5 times more likely to have an offspring with SLE than were White women with SLE but there was no difference in this likelihood among Black men. These data suggest genetic susceptibility factors that act only in men. PMID:20472921

  8. Pre-Clinical Lupus

    PubMed Central

    Bourn, Rebecka; James, Judith A.

    2015-01-01

    Purpose of review Systemic lupus erythematosus (SLE) is often preceded by immune dysregulation and clinical manifestations below the threshold for SLE classification. This review discusses current and evolving concepts about the pre-classification period of SLE, including clinical and mechanistic observations, and potential avenues for early identification and intervention. Recent findings Although incomplete lupus erythematosus (ILE) involves fewer clinical manifestations than SLE, ILE can cause organ damage and mortality. Common clinical features in ILE include antinuclear antibody seropositivity, polyarthritis, immunologic manifestations, and hematological disorders. Despite having lower disease activity and damage scores than SLE patients, ILE patients may develop pulmonary arterial hypertension or renal, neurological, or peripheral vascular damage. The recently proposed SLICC SLE classification criteria could shift the period considered “preclinical SLE”. Murine studies suggest that the balance of T helper/T regulatory cells, peroxisome proliferator-activated receptor γ activity, and plasmacytoid dendritic cell pathways may be valuable targets for early intervention. Summary Advances in our understanding of early SLE, including stages before clinical features are fully developed, will improve our ability to identify individuals at high risk of classification for potential prevention trials, provide necessary information to improve diagnostic testing, and perhaps identify novel targets for directed therapeutics in clinical SLE. PMID:26125103

  9. Histopathology of lupus nephritis.

    PubMed

    Giannakakis, Konstantinos; Faraggiana, Tullio

    2011-06-01

    The spectrum of morphologic changes in lupus nephritis, either microscopic, ultrastructural, or immunohistological, closely reflects the great variety of immune complexes that are produced in the course of the disease. Every tissue component of the kidney can be affected, but glomeruli are the target structure in most patients. Several attempts have been made to correlate the clinical severity and the outcome of the nephritis with the pathologic features; the current classification and the six classes that resulted from an international study group are entirely based on glomerular changes. Major criteria of classification include the focal or diffuse involvement of the glomerulus, the site of hypercellularity, the site of immune complex deposition and the presence of active and/or sclerotic lesions. Even if less thoroughly investigated than the glomerulus, the interstitial compartment has revealed many interesting features as are vascular lesions, a common and often underestimated feature. Typing of subpopulation of lymphoid infiltrates supports the emerging evidence indicating that B cells are promoting autoimmunity in mechanisms other than autoAb secretion. Many aspects are still debated and/or poorly understood, such as the interpretation of the so-called "full house nephropathy" that closely mimic lupus nephritis in seronegative patients.

  10. [The indicators of immunity in patients with aseptic instability of knee joint].

    PubMed

    Chepeleva, M V; Chegurov, O K; Kuznetsova, E I; Shved, N S

    2014-08-01

    The examination was applied to sampling of 17 patients with stable implants after 18-36 months after endoprosthesis replacement of knee joint and to sampling of 17 patients with developed within this time-frame aseptic instability of endoprosthesis within the same time-frame. The typing of lymphocytes of peripheral blood was implemented using laser flow cytometry. The detection of immunoglobulins, cytokines, circulating immune complexes was made applying the technique of enzymoimmunoassay. In case of development of aseptic instability the signs testifying moderate activation of immune system and starting dysfunction of monocyte macrophage component of immune system. At that, IL-6, TNFα, CD14+HLA-DR provided the most complete information on the side of diagnostic of developing aseptic instability of joint.

  11. Aseptic meningitis outbreak associated with echovirus 9 among recreational vehicle campers--Connecticut, 2003.

    PubMed

    2004-08-13

    Aseptic meningitis is an inflammation of the tissues covering the brain and spinal cord and caused by a virus, most frequently an enterovirus. In August 2003, the Connecticut Department of Public Health (CDPH) received a report of three viral meningitis cases among recreational vehicle (RV) campers staying at a campground in northeastern Connecticut. CDPH, assisted by CDC, conducted an investigation, which 1) identified a total of 12 cases of aseptic meningitis and 24 cases of enterovirus-like illness among 201 campers interviewed, 2) demonstrated how transmission of enterovirus from persons with mild illness contributed to the aseptic meningitis outbreak, and 3) determined that crowded conditions inside RVs and in the campground swimming pool likely facilitated spread of enterovirus. Pool operators should check chlorine and pH levels frequently, particularly during peak pool occupancy; adults should take precautions against passing enterovirus to children, who are at greater risk for severe illness.

  12. An investigation of the aseptic loosening of an AISI 316L stainless steel hip prosthesis.

    PubMed

    Godec, Matjaz; Kocijan, Aleksandra; Dolinar, Drago; Mandrino, Djordje; Jenko, Monika; Antolic, Vane

    2010-08-01

    The total replacement of joints by the implantation of permanently indwelling prosthetic components has been one of the major successes of modern surgery in terms of relieving pain and correcting deformity. However, the aseptic loosening of a prosthetic-joint component is the most common reason for joint-revision surgery. Furthermore, it is thought that wear particles are one of the major contributors to the development and perpetuation of aseptic loosening. The aim of the present study was to identify the factors related to the aseptic loosening of an AISI 316L stainless steel total hip prosthesis. The stem was evaluated by x-ray photoelectron spectroscopy, with polished and rough regions being analyzed in order to establish the differences in the chemical compositions of both regions. Specific areas were examined using scanning electron microscopy with energy dispersive x-ray spectroscopy and light microscopy.

  13. Femoral cement within cement technique in carefully selected aseptic revision arthroplasties.

    PubMed

    Marcos, Lucas; Buttaro, Martin; Comba, Fernando; Piccaluga, Francisco

    2009-06-01

    The aim of this study was to evaluate the clinical and radiological results in a group of patients who underwent aseptic revision hip arthroplasty using the cement within cement (CWC) technique. Between 1999 and 2005, 37 aseptic revision hip operations were performed. There were 30 women and five men, with an average age of 68 years. The reasons for revision were femoral stem fracture, cup failure, acetabular protrusion after hemi-arthroplasty and recurrent dislocation. At an average follow-up of 46 months, none of the patients required further femoral revision. The average post-operative Merle D'Aubigne score was 16.6 points (p<0.05). No evidence of radiological stem failure was observed and no femoral component was considered to be at risk for loosening. In this series of patients, the CWC technique provided consistent with high functional outcomes. This valid and effective alternative should be considered in carefully selected aseptic cases.

  14. Diet and Nutrition With Lupus

    MedlinePlus

    ... and increase inflammation. If you plan to add herbs, dietary supplements, or vitamins to your diet, you ... lupus doctor first. This is especially important as herbs or supplements may interact with medicines used to ...

  15. Living with Lupus (For Parents)

    MedlinePlus

    ... other conditions, like juvenile idiopathic arthritis, Crohn's disease, Lyme disease, and mononucleosis. Cutaneous (or skin) lupus , which usually ... Muscles, and Joints Immune System Juvenile Idiopathic Arthritis Lyme Disease Guillain-Barré Syndrome Your Immune System Life With ...

  16. Lupus Erythematosus Panniculitis in Pregnancy

    PubMed Central

    Gondane, Swati; Kothiwala, Rajkumar; Dangi, Sapna; Meherda, Ashok

    2015-01-01

    A case of lupus erythematosus (LE) panniculitis in pregnancy without any lesions of discoid LE or systemic LE is being reported. There were no systemic symptoms. Her ANA, anti-dsDNA, anti-Ro/SSA, and anti-La/SSB antibodies were within normal limits. Diagnosis of lupus panniculitis was considered on clinical and histopathological grounds. The condition responded favorably to systemic steroid therapy. PMID:26677307

  17. True vasculitis in lupus nephritis.

    PubMed

    Abdellatif, A A; Waris, S; Lakhani, A; Kadikoy, H; Haque, W; Truong, L D

    2010-08-01

    Vascular lesions are encountered frequently in renal biopsy specimens of patients with systemic lupus erythematosus (SLE) and can present in a variety of morphologic forms. True renal lupus vasculitis (TRLV) is one of the rare vascular lesions associated with lupus nephritis that has been infrequently reported in the medical literature. The primary focus on glomerular pathology and collective classification of the vascular lesions under lupus vasculopathy is one of the reasons why this form of inflammatory vasculitis has been under-recognized as a separate disease entity. Here we have comprehensively reviewed the literature on renal vascular involvement in SLE for a better understanding of the epidemiology, morphologic features, pathogenesis, clinical course and treatment of TRLV. It can be morphologically differentiated from other forms of renal vascular lesions in lupus nephritis, i.e. arteriosclerosis, uncomplicated vascular immune deposits, non-inflammatory necrotizing vasculopathy, and thrombotic microangiopathy. Despite close similarities with antineutrophil cytoplasmic autoantibody associated vasculitis (AASV), there are certain morphological differences that warrant a thorough investigation of the possible pauci-immune mechanism of pathogenesis. The vasculitis follows a severe clinical course in general with rapid progression to renal failure, although favorable outcomes have been reported in certain cases. The standard use of steroids and cytotoxic drugs has yielded variable results in the treatment of TRLV. Current treatment modalities being used in lupus nephritis and AASV have been compared in this article with focus on drugs acting on the inflammatory cells implicated in TRLV pathogenesis.

  18. 75 FR 35492 - Guidance for Industry on Lupus Nephritis Caused By Systemic Lupus Erythematosus-Developing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-22

    ... HUMAN SERVICES Food and Drug Administration Guidance for Industry on Lupus Nephritis Caused By Systemic Lupus Erythematosus--Developing Medical Products for Treatment; Availability AGENCY: Food and Drug... availability of a guidance for industry entitled ``Lupus Nephritis Caused By Systemic Lupus...

  19. Early Cutaneous Lupus Erythematosus

    PubMed Central

    Sams, Wiley M.

    1966-01-01

    Cutaneous disorders which manifest themselves on the exposed parts are more likely than are hidden lesions to cause the patient to seek professional services promptly. Usually he consults his family physician or the community dermatologist. The physician who first sees the patient is dependent upon his own resources for management and diagnosis. A background of experience, a measure of energy and an inquisitive attitude are the necessary ingredients for successful management. The difficulties involved in differentiating early lupus erythematosus and polymorphic light eruptions cannot be invariably resolved even with the most complete review. The course of the disorder and the response to environmental factors supply important clues. Investigative work, especially in the field of immunology, offers hope for the solution of some of our problems. PMID:5909872

  20. Systemic lupus erythematosus.

    PubMed

    Shaikh, Maliha F; Jordan, Natasha; D'Cruz, David P

    2017-02-01

    Systemic lupus erythematosus (SLE) is a chronic multisystem autoimmune disease that is highly heterogeneous in its presentation. This can pose significant challenges for physicians responsible for the diagnosis and treatment of such patients. SLE arises from a combination of genetic, epigenetic and environmental factors. Pathologically, the disease is primarily driven by loss of immune tolerance and abnormal B- and T-cell function. Major organ involvement may lead to significant morbidity and mortality. Classification criteria for SLE have been developed largely for research purposes; however, these are also widely used in clinical practice. Antinuclear antibodies are the hallmark serological feature, occurring in over 95% of patients with SLE at some point during their disease. The mainstay of treatment is antimalarial drugs such as hydroxychloroquine, combined with corticosteroids and conventional immunosuppressive drugs. An increasing understanding of pathogenesis has facilitated a move towards the development of targeted biologic therapies, with the introduction of rituximab and belimumab into clinical practice.

  1. Lupus, discoid on a child's face (image)

    MedlinePlus

    The round or disk shaped (discoid) rash of lupus produces red, raised patches with scales. The pores ( ... The majority (approximately 90%) of individuals with discoid lupus have only skin involvement as compared to more ...

  2. Systemic lupus erythematosus and Klinefelter's syndrome.

    PubMed Central

    French, M A; Hughes, P

    1983-01-01

    A case of Klinefelter's syndrome presenting with systemic lupus erythematosus while receiving androgen replacement therapy is described. The association of systemic lupus erythematosus with Klinefelter's syndrome is discussed, particularly in terms of the effect of sex hormones. PMID:6882046

  3. Genetics Home Reference: systemic lupus erythematosus

    MedlinePlus

    ... Facebook Share on Twitter Your Guide to Understanding Genetic Conditions Search MENU Toggle navigation Home Page Search ... Conditions Genes Chromosomes & mtDNA Resources Help Me Understand Genetics Home Health Conditions systemic lupus erythematosus systemic lupus ...

  4. 76 FR 60847 - Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-30

    ... for the Agency's current good manufacturing practice regulations for PET drugs. DATES: Although you... HUMAN SERVICES Food and Drug Administration Draft Guidance on Media Fills for Validation of Aseptic Preparations for Positron Emission Tomography Drugs; Availability AGENCY: Food and Drug Administration,...

  5. Hepatitis C virus transmission in hemodialysis units: importance of infection control practices and aseptic technique.

    PubMed

    Thompson, Nicola D; Novak, Ryan T; Datta, Deblina; Cotter, Susanne; Arduino, Matthew J; Patel, Priti R; Williams, Ian T; Bialek, Stephanie R

    2009-09-01

    We investigated 4 hepatitis C virus (HCV) infection outbreaks at hemodialysis units to identify practices associated with transmission. Apparent failures to follow recommended infection control precautions resulted in patient-to-patient HCV transmission, through cross-contamination of the environment or intravenous medication vials. Fastidious attention to aseptic technique and infection control precautions are essential to prevent HCV transmission.

  6. Rapid and sensitive detection of enteroviruses in specimens from patients with aseptic meningitis.

    PubMed

    Yerly, S; Gervaix, A; Simonet, V; Caflisch, M; Perrin, L; Wunderli, W

    1996-01-01

    A 5-h PCR assay (Amplicor enterovirus test) was compared with viral culture for the detection of enteroviruses in cerebrospinal fluid. Of the cerebrospinal fluid specimens collected during a summer outbreak of aseptic meningitis, 34% were positive by viral culture whereas 66% were positive by the Amplicor PCR, suggesting that this technique improves the diagnosis of enteroviral meningitis.

  7. A low cost multi-level sampling device for synchronous aseptic collection of environmental water samples.

    PubMed

    McCormick, Michael L; Banishki, Nikola; Powell, Sarah; Rumack, Amy; Garrett, Jinnie M

    2014-10-01

    We describe a simple device for the aseptic collection of environmental water samples at high spatial resolution to depths of 50m. To demonstrate the utility of this technique we present geochemical and archaeal community data from samples collected throughout the water column of a stratified lake.

  8. Magnetic thermometry in the aseptic processing of foods containing particulates (abstract)

    NASA Astrophysics Data System (ADS)

    Ghiron, Kenneth; Litchfield, Bruce

    1997-04-01

    Aseptic processing of foods has many advantages over canning, including higher efficiency, lighter packaging, better taste, and higher nutritional value. Aseptic processing is different from canning where the food and container are sterilized together. Instead, a thin stream of food is heated and the packaging is independently sterilized before the food is placed in the package. However, no aseptic processes have been successfully filed with the FDA for foods containing sizable solid particles because of uncertainties in the thermal sterilization of the particles (e.g., soup). We have demonstrated that by inserting small paramagnetic particles in the interior of the simulated and real food particles, the local temperature can be measured. With this information, any questions about the adequate sterilization of the particles can be resolved. The measurements were done by directing the food stream through a magnetic field and sensing the voltages induced in a pickup coil by the motion of the magnetized particles. Details of the equipment design and data analysis will be discussed along with an introduction to the aseptic processing of foods.

  9. Expression of tenascin-C in aseptic loosening of total hip replacement

    PubMed Central

    Konttinen, Y.; Li, T.; Michelsson, O.; Xu, J.; Sorsa, T.; Santavirta, S.; Imai, S.; Virtanen, I.

    1998-01-01

    OBJECTIVE—To assess if the bonding interlayer between the implant and bone in aseptic loosening of total hip replacement (THR) is qualitatively deteriorated by excessive accumulation of anti-adhesive glycoprotein, tenascin-C.
METHODS—Alkaline phosphatase-anti-alkaline phosphatase (APAAP) method was used for immunohistochemical staining of tenascin-C in interface tissue and control synovial tissue.
RESULTS—Tenascin-C was found to be a major component of the extracellular matrix at a hitherto unrecognised site, namely the synovial membrane-like interface tissue between implant and bone in aseptic loosening of THR. The overall tenascin-C staining (median score 4.0) was greatly increased in aseptic loosening compared with synovial membrane (median score 2.0; p<0.001) and fibrous capsule (median score 2.0; p<0.001) from primary THR operations. Topological analysis disclosed that tenascin-C was also found at the critical implant-interface and interface-bone surfaces.
CONCLUSION—Local tenascin-C expression is increased as a result of a chronic foreign body type reaction associated with excessive cytokine production and tissue injury mediated by microtrauma and neutral endoproteinases. This qualitative and topological deterioration of the bonding interlayer by an increase of anti-adhesive tenascin-C expression may inadvertantly contribute to loosening.

 Keywords: tenascin; aseptic loosening; total hip replacement PMID:9893574

  10. Lupus vasculopathy: Diagnostic, pathogenetic and therapeutic considerations.

    PubMed

    Gonzalez-Suarez, M L; Waheed, A A; Andrews, D M; Ascherman, D P; Zeng, X; Nayer, A

    2014-04-01

    A rare form of vascular disease in systemic lupus erythematosus (SLE), lupus vasculopathy is characterized by necrosis and accumulation of immunoglobulins (IGs) and complements in the wall of arterioles and small arteries resulting in luminal narrowing. Lupus vasculopathy often accompanies lupus nephritis and portends a poor prognosis. Although there is general agreement on the treatment of lupus nephritis, effective treatment strategies for lupus vasculopathy remain to be defined. We report a 20-year-old woman with SLE who presented with generalized tonic-clonic seizure. Her immunosuppressive regimen consisted of mycophenolate mofetil, prednisone and hydroxychloroquine. On physical examination, she was Cushingoid in appearance and hypertensive. Laboratory tests indicated renal disease. Coagulation studies disclosed de novo lupus anticoagulant. Magnetic resonance imaging of the brain demonstrated acute focal cerebral hemorrhage. Echocardiography revealed reduced ejection fraction and severe mitral regurgitation. Despite high-dose glucocorticoids and mycophenolate mofetil, renal function remained poor. Kidney biopsy demonstrated lupus vasculopathy and glomerulonephritis. Plasma exchange therapy and intravenous cyclophosphamide were administered. Over the ensuing four weeks, renal function improved, complement levels increased, autoantibody titers decreased and lupus anticoagulant disappeared. In conclusion, lupus vasculopathy can occur in SLE despite a heavy immunosuppressive regimen. Antiphospholipid antibodies might be involved in the pathogenesis of lupus vasculopathy. Plasma exchange therapy in conjunction with intravenous cyclophosphamide may represent an effective treatment strategy for lupus vasculopathy.

  11. Heat transfer and lethality considerations in aseptic processing of liquid/particle mixtures: a review.

    PubMed

    Ramaswamy, H S; Awuah, G B; Simpson, B K

    1997-04-01

    Consumer awareness and demand for nutritious yet inexpensive food products call for innovative processing techniques that have both safety and quality as primary objectives. These challenges appear to have been met by aseptic processing techniques, especially for liquid and high-acid foods. However, the extension of aseptic processing principles to low-acid foods containing discrete particles in viscous sauces has not been approved by regulatory agencies, particularly in North America. This apparent limitation is due primarily to the lack of adequate temperature monitoring devices to keep track of particles in dynamic motion, as well as to the residence time distribution of particles flowing in the continuous heat-hold-cool sections of the aseptic processing system. These problems have prompted active research to describe the phenomenal behavior of particulates through sound mathematical modeling and computer simulators. The accuracy of mathematical models depends heavily on how accurate input parametric values are. These parameters include the thermophysical properties of the carrier fluid and particles, as well as the aseptic processing system characteristics in relation to residence time distribution and the fluid-to-particle interfacial heat transfer coefficient. Apparently, several contradictory findings have been reported in the literature with respect to the effect of various processing parameters on the above-mentioned input parametric values. The need therefore arises for more collaborative studies involving the industry and academia. This review brings to perspective, the current status on the aseptic processing of particulate foods with respect to the critical processing parameters which affect the fluid-to-particle convective heat transfer coefficient associated with particulate laden products.

  12. Pathways of macrophage apoptosis within the interface membrane in aseptic loosening of prostheses.

    PubMed

    Yang, Fei; Wu, Wen; Cao, Lei; Huang, Yan; Zhu, Zhenan; Tang, Tingting; Dai, Kerong

    2011-12-01

    Aseptic loosening is a major cause of failure of total hip arthroplasty (THA). Macrophage apoptosis in interface membrane has been proved to play an important role in the pathogenesis of aseptic loosening. The purpose of current study was to identify the apoptotic mechanism of macrophages in the interface membrane of aseptic loosening. We collected periprosthetic interface membrane from 23 patients undergoing the revision operations for aseptic loosening of hip joint prostheses. To serve as the control group, samples of capsule were collected from 18 patients undergoing the primary hip arthroplasties for osteoarthritis (OA). The ultrastructure of interface membrane was examined by transmission electron microscopy (TEM), and in situ apoptotic macrophage identification was performed by TUNEL staining. Furthermore, using immunohistochemical methods we investigated the expression of some apoptosis-related markers such as inducible nitric oxide synthase (iNOS), peroxynitrite (ONOO(-)), cleaved caspase-3/4/8/9, cytochrome c, glucose regulated protein 78 (GRP78), and growth arrest and DNA damage-inducible gene 153 (GADD153) in macrophages. These markers were regarded as apoptotic inducers or specific indicators of different apoptotic pathways such as death receptor pathway, mitochondrial pathway and endoplasmic reticulum (ER) stress pathway. TEM showed that a great deal of wear debris was phagocytosed by macrophages, which displayed morphological changes characteristic of apoptosis. The results of TUNEL staining demonstrated that there were more apoptotic macrophages in interface membrane. The expression levels of iNOS, ONOO(-), cleaved caspase-3/4/8/9, cytochrome c, GRP78 and GADD153 in macrophages in interface membrane were significantly higher than those in the control samples (p < 0.05). Our results suggest that death receptor pathway, mitochondria/cytochrosome c caspase-dependent pathway and ER stress pathway are involved in the process of macrophage apoptosis. A

  13. Is Sterile Better Than Aseptic? Comparing the Microbiology of Acellular Dermal Matrices

    PubMed Central

    Klein, Gabriel M.; Nasser, Ahmed E.; Phillips, Brett T.; Gersch, Robert P.; Fourman, Mitchell S.; Lilo, Sarit E.; Fritz, Jason R.; Khan, Sami U.; Dagum, Alexander B.

    2016-01-01

    Introduction: Postoperative infections are a major complication associated with tissue-expander-based breast reconstruction. The use of acellular dermal matrix (ADM) in this surgery has been identified as a potential reservoir of infection, prompting the development of sterile ADM. Although aseptic and sterile ADMs have been investigated, no study has focused on the occurrence and clinical outcome of bacterial colonization before implantation. Methods: Samples of aseptic AlloDerm, sterile Ready-To-Use AlloDerm, and AlloMax were taken before implantation. These samples were incubated in Tryptic soy broth overnight before being streaked on Trypticase soy agar, MacConkey agar, and 5% blood agar plates for culture and incubated for 48 hours. Culture results were cross-referenced with patient outcomes for 1 year postoperatively. Results: A total of 92 samples of ADM were collected from 63 patients. There were 15 cases of postoperative surgical site infection (16.3%). Only 1 sample of ADM (AlloMax) showed growth of Escherichia coli, which was likely a result of contamination. That patient did not develop any infectious sequelae. Patient outcomes showed no difference in the incidence of seroma or infection between sterile and aseptic ADMs. Conclusions: This study evaluates the microbiology of acellular dermal matrices before use in breast reconstruction. No difference was found in the preoperative bacterial load of either aseptic or sterile ADM. No significant difference was noted in infection or seroma formation. Given these results, we believe aseptic processing used on ADMs is equivalent to sterile processing in our patient cohort in terms of clinical infection and seroma occurrence postoperatively. PMID:27482500

  14. Lupus vasculopathy combined with acute renal failure in lupus nephritis.

    PubMed

    Wu, Chien-Te; Fu, Lin-Shien; Wen, Mei-Chin; Hung, Shein-Chung; Chi, Ching-Shiang

    2003-12-01

    Several risk factors have been associated with the prognosis of lupus nephritis. However, few studies have focused on renal vascular lesions (such as thrombi due to immune complexes) as a prognostic factor in this disease. Here we present a case of systemic lupus erythematosus (SLE) in a 12-year-old girl who exhibited acute renal failure and severe hypertension on admission. Renal pathology findings included diffuse proliferative glomerulonephritis (class IVb) and lupus vasculopathy (LV) with immune complex deposition within glomerular capillaries and the preglomerular arteriolar lumen. Her clinical condition deteriorated rapidly, even after cyclophosphamide and methylprednisolone pulse therapy. It improved after 5 days of plasmapheresis and remained stable for up to 6 months under regular treatment. We suggest that renal biopsy performed early in SLE patients with renal involvement should be studied carefully for the presence of vascular lesions. Additionally, plasmapheresis can be considered in patients with LV refractory to other modalities of therapy.

  15. The history of lupus erythematosus.

    PubMed

    Mallavarapu, Ravi K; Grimsley, Edwin W

    2007-09-01

    This article explores the history of lupus erythematosus from the origins of the name to the most modern therapeutic advances. The review includes information about the origin of the name "lupus," the first clear description of the skin lesions, the discovery of the systemic and discoid forms, and further advances which define our current view of this illness. The classical descriptions of Hippocrates, Paracelsus, Manardi, Rudolph Virchow, Cazenave, Robert Willan, and Moritz Kaposi are chronologically described. Later, the contributions of Sir William Osler, Jonathan Hutchinson, Sequira and Balean, Kraus and Bohac, Libman and Sacks, Malcolm Hargraves, and Edmund L. Dubois are highlighted. The major breakthroughs of the modern period, including the diagnostic tests, animal models, and genetics, are briefly described. The article ends with the history of drug-induced lupus, diagnostic criteria, and the history of the therapy of lupus erythematosus. With modern therapeutic advances, the mortality rate from lupus erythematosus has decreased substantially. It is hoped that current research will further improve the prognosis of this disease in the near future.

  16. Treatment of Cutaneous Lupus Erythematosus

    PubMed Central

    Kim, Grace K.; Del Rosso, James Q.

    2013-01-01

    The treatment of cutaneous lupus erythematosus is centered upon formulating a regimen of topical and systemic therapies designed to reduce disease activity and minimize cosmetic damage. Sun avoidance and sunscreen are important preventative measures proven to minimize cutaneous lupus erythematosus exacerbations. Limited disease is typically managed with topical corticosteroids or calcineurin inhibitors. Antimalarial therapy is the gold standard of systemic therapy. Many other treatments have been studied in patients with recalcitrant cutaneous lupus erythematosus, and their use must be evaluated based on individual risk-benefit concerns. R-salbutamol and pulsed dye laser therapy have proven to be effective topical alternatives. Additional systemic agents include retinoids, immunosuppressants, immunomodulators, biologics, and other experimental therapies with novel modes of action. According to the Oxford Centre for Evidence-based Medicine criteria for evaluating the strength of evidence supporting an individual treatment measure, no therapy for cutaneous lupus erythematosus has achieved Level 1 status. This demonstrates the need for randomized, controlled trials and systematic reviews of all cutaneous lupus erythematosus interventions in order to meet increasing standards and demand for evidence-based practice. PMID:23320123

  17. Systemic lupus erythematosus.

    PubMed

    Kaul, Arvind; Gordon, Caroline; Crow, Mary K; Touma, Zahi; Urowitz, Murray B; van Vollenhoven, Ronald; Ruiz-Irastorza, Guillermo; Hughes, Graham

    2016-06-16

    Systemic lupus erythematosus (SLE) is an autoimmune disease that can affect many organs, including the skin, joints, the central nervous system and the kidneys. Women of childbearing age and certain racial groups are typically predisposed to developing the condition. Rare, inherited, single-gene complement deficiencies are strongly associated with SLE, but the disease is inherited in a polygenic manner in most patients. Genetic interactions with environmental factors, particularly UV light exposure, Epstein-Barr virus infection and hormonal factors, might initiate the disease, resulting in immune dysregulation at the level of cytokines, T cells, B cells and macrophages. Diagnosis is primarily clinical and remains challenging because of the heterogeneity of SLE. Classification criteria have aided clinical trials, but, despite this, only one drug (that is, belimumab) has been approved for use in SLE in the past 60 years. The 10-year mortality has improved and toxic adverse effects of older medications such as cyclophosphamide and glucocorticoids have been partially offset by newer drugs such as mycophenolate mofetil and glucocorticoid-sparing regimes. However, further improvements have been hampered by the adverse effects of renal and neuropsychiatric involvement and late diagnosis. Adding to this burden is the increased risk of premature cardiovascular disease in SLE together with the risk of infection made worse by immunosuppressive therapy. Challenges remain with treatment-resistant disease and symptoms such as fatigue. Newer therapies may bring hope of better outcomes, and the refinement to stem cell and genetic techniques might offer a cure in the future.

  18. Lupus nephritis management guidelines compared.

    PubMed

    Wilhelmus, Suzanne; Bajema, Ingeborg M; Bertsias, George K; Boumpas, Dimitrios T; Gordon, Caroline; Lightstone, Liz; Tesar, Vladimir; Jayne, David R

    2016-06-01

    In the past years, many (randomized) trials have been performed comparing the treatment strategies for lupus nephritis. In 2012, these data were incorporated in six different guidelines for treating lupus nephritis. These guidelines are European, American and internationally based, with one separate guideline for children. They offer information on different aspects of the management of lupus nephritis including induction and maintenance treatment of the different histological classes, adjunctive treatment, monitoring of the patient, definitions of response and relapse, indications for (repeat) renal biopsy, and additional challenges such as the presence of vascular complications, the pregnant SLE patient, treatment in children and adolescents and considerations about end-stage renal disease and transplantation. In this review, we summarize the guidelines, determine the common ground between them, highlight the differences and discuss recent literature.

  19. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department.

    PubMed

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine.The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department.A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management.The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine.The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to viral agents or

  20. Etiologies and Management of Aseptic Meningitis in Patients Admitted to an Internal Medicine Department

    PubMed Central

    Jarrin, Irène; Sellier, Pierre; Lopes, Amanda; Morgand, Marjolaine; Makovec, Tamara; Delcey, Veronique; Champion, Karine; Simoneau, Guy; Green, Andrew; Mouly, Stéphane; Bergmann, Jean-François; Lloret-Linares, Célia

    2016-01-01

    Abstract Several studies have focused on the clinical and biological characteristics of meningitis in order to distinguish between bacterial and viral meningitis in the emergency setting. However, little is known about the etiologies and outcomes of aseptic meningitis in patients admitted to Internal Medicine. The aim of the study is to describe the etiologies, characteristics, and outcomes of aseptic meningitis with or without encephalitis in adults admitted to an Internal Medicine Department. A retrospective cohort study was conducted in the Internal Medicine Department of the Lariboisière Hospital in Paris, France, from January 2009 to December 2011. Clinical and biological characteristics of aseptic meningitis were recorded. These included cerebrospinal fluid analysis, results of polymerase chain reaction testing, final diagnoses, and therapeutic management. The cohort included 180 patients fulfilling the criteria for aseptic meningitis with (n = 56) or without (n = 124) encephalitis. A definitive etiological diagnosis was established in 83 of the 180 cases. Of the cases with a definitive diagnosis, 73 were due to infectious agents, mainly enteroviruses, Herpes Simplex Virus 2, and Varicella Zoster Virus (43.4%, 16.8%, and 14.5% respectively). Inflammatory diseases were diagnosed in 7 cases. Among the 97 cases without definitive diagnoses, 26 (26.8%) remained free of treatment throughout their management whereas antiviral or antibiotic therapy was initiated in the emergency department for the remaining 71 patients. The treatment was discontinued in only 10 patients deemed to have viral meningitis upon admission to Internal Medicine. The prevalence of inflammatory diseases among patients admitted to internal medicine for aseptic meningitis is not rare (4% of overall aseptic meningitis). The PCR upon admission to the emergency department is obviously of major importance for the prompt optimization of therapy and management. However, meningitis due to

  1. Neonatal lupus syndromes.

    PubMed

    Buyon, J P

    1994-09-01

    Neonatal lupus continues to generate considerable interest despite its rarity; more than 15 original contributions were made to the literature in the past year. Diverse aspects of this "syndrome" of passively acquired autoimmunity have been covered. Experiments using a rabbit model provided insights into the pathogenicity of maternal anti-Ro/SS-A and anti-La/SS-B antibodies. Perfusion of rabbit hearts with anti-Ro/SS-A and anti-La/SS-B sera resulted in conduction abnormalities in whole adult rabbit hearts and induced a reduction in the peak slow inward current in patch-clamp experiments of isolated rabbit ventricular myocytes, suggesting involvement of calcium channels. Clinical investigations are moving away from case reports, and recent studies now include substantial entries. Assuming that patients reported from the United States, Finland, and England are all separate, sera from at least 100 different mothers of infants with congenital heart block have been studied. Although there is apparently no serologic profile that is unique to mothers of affected children, compared with mothers of healthy children, anti-Ro/SS-A antibodies (anti-52-kD antibodies are more prevalent by immunoblot in congenital heart block, although all these sera are likely to have anti-60-kD antibodies by immunoprecipitation) are usually of high titer and associated with anti-La/SS-B antibodies. To date, the only maternal autoantibodies that have been associated with congenital heart block recognize Ro/SS-A or La/SS-B antigens. Mothers of affected infants are often asymptomatic, and when symptomatic, the clinical features are frequently characteristic of Sjögren's syndrome. Although treatment of affected fetuses with dexamethasone has successfully diminished associated effusions, there has been no report of reversal of established third-degree heart block.

  2. Neonatal lupus syndromes.

    PubMed

    Buyon, J P; Rupel, A; Clancy, R M

    2004-01-01

    The neonatal lupus syndromes (NLS), while quite rare, carry significant mortality and morbidity in cases of cardiac manifestations. Although anti-SSA/Ro-SSB/La antibodies are detected in > 85% of mothers whose fetuses are identified with congenital heart block (CHB) in a structurally normal heart, when clinicians applied this testing to their pregnant patients, the risk for a woman with the candidate antibodies to have a child with CHB was at or below 1 in 50. While the precise pathogenic mechanism of antibody-mediated injury remains unknown, it is clear that the antibodies alone are insufficient to cause disease and fetal factors are likely contributory. In vivo and in vitro evidence supports a pathologic cascade involving apoptosis of cardiocytes, surface translocation of Ro and La antigens, binding of maternal autoantibodies, secretion of profibrosing factors (e.g., TGFbeta) from the scavenging macrophages and modulation of cardiac fibroblasts to a myofibroflast scarring phenotype. The spectrum of cardiac abnormalities continues to expand, with varying degrees of block identified in utero and reports of late onset cardiomyopathy (some of which display endocardial fibroelastosis). Moreover, there is now clear documentation that incomplete blocks (including those improving in utero with dexamethasone) can progress postnatally, despite the clearance of the maternal antibodies from the neonatal circulation. Better echocardiographic measurements which identify first degree block in utero may be the optimal means of approaching pregnant women at risk. Prophylactic therapies, including treatment with intravenous immunoglobulin, await larger trials. In order to achieve advances at both the bench and bedside, national research registries established in the US and Canada are critical.

  3. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2015-12-01

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST.

  4. Transorbital superior ophthalmic vein sacrifice to preserve vision in ocular hypertension from aseptic cavernous sinus thrombosis.

    PubMed

    Ladner, Travis R; Davis, Brandon J; He, Lucy; Mawn, Louise A; Mocco, J

    2014-10-29

    Aseptic cavernous sinus thrombosis (CST) is rare and may clinically masquerade as a carotid cavernous fistula. Conventional management includes oral anticoagulation, but cases of ocular hypertension affecting vision may require more aggressive intervention. We report a case of a woman with spontaneous bilaterally occluded cavernous sinuses with elevated intraocular pressure (IOP), which resolved immediately following unilateral superior ophthalmic vein (SOV) sacrifice. She was subsequently placed on oral anticoagulants. By 4 months postoperatively her IOP was normalized and her vision had improved. Repeat angiography demonstrated stable venous filling, with some mild improvement of flow through the cavernous sinus. Coil-mediated sacrifice of the SOV might be an effective means to relieve ocular hypertension and preserve vision in the setting of aseptic CST.

  5. The thin blue line: a review and discussion of aseptic technique and postprocedural infections in rodents.

    PubMed

    Cooper, D M; McIver, R; Bianco, R

    2000-11-01

    A basic tenet of animal welfare philosophy is that pain and distress must be minimized whenever possible without interfering with the goals of the research. Aseptic technique during surgical procedures is essential to prevent pain and distress associated with post-procedural infections. However, many investigators have found that applying the aseptic techniques used for large animal and human surgery is not always practical when performing surgery on small rodents. Furthermore, the efficacy of some of these techniques for preventing post-procedural infections has been questioned. This review examines what is known about the development of postprocedural infections in animals and humans and the methods used to prevent them. Detection of postprocedural infections in rodents can be difficult unless objective measurements of physiologic indices are made. These measurements should be used experimentally to assess the relative benefits of various methods for preventing postprocedural infections. Measures of contamination, such as quantitative bacterial cultures, also can be used; however, they do not reliably predict infection rates. Much of the dogma about decontamination of skin and hair prior to surgery is not supported by valid experimental evidence. Hair removal may not be necessary. Alcohol may in fact be a better disinfectant than is often credited. Draping should be used when it contributes to the maintenance of the sterile field, but when it does not, modification of surgical technique may provide more protection from infection than the drape does. The contribution of surgical technique to the prevention of postprocedural infections is probably equal to that of aseptic technique. Further research needs to be done to assess various aseptic techniques for use in rodent surgery.

  6. [Aseptic bone necroses as a late complication following successful treatment of leukemias and severe aplastic anemia].

    PubMed

    Slavc, I; Urban, C; Schwingshandl, J; Ritter, G; Trauner, R

    1987-01-01

    Aseptic bone necrosis is a well known complication after corticosteroid treatment in adults and several hundred cases have been reported. Alterations in fat metabolism with vascular occlusion due to fat embolization, as well as microtraumata and osteoporosis are discussed as etiologic factors. In contrast, aseptic bone necrosis in relation to corticosteroid treatment is rare in children and adolescents. We therefore report 3 patients, aged from 10 to 18 years, suffering from severe aplastic anemia, meningeal relapse after acute lymphocytic leukemia and acute myelocytic leukemia respectively, who developed aseptic bone necrosis 6, 11, and 20 months following the onset of corticoid therapy. The patients survive from 28+ to 50+ months after diagnosis of their initial hematologic disease, as it can be expected today for increasing numbers of patients. We therefore believe, that aseptic bone necrosis may represent a serious therapy related complication and suggest that, diagnostic examination in patients with suspicious complaints of the hip, shoulder or knee should also exclude the possibility of a bone necrosis after leucemic relapse has been ruled out. Since radiological changes only develop several weeks to months after the onset of the clinical symptoms and because of the disabling consequences for patients, misdiagnosed at the beginning, a 99 technetium bone scan should be done as early as possible. Corticosteroids, despite their serious side effects are still being considered as a important part of hematologic therapy and are not being omitted in the near future, so that the earliest possible diagnosis of bone necrosis will remain of great importance.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Aseptic Bone Necrosis Among U.S. Navy Divers: Survey of 934 Nonrandomly Selected Personnel

    DTIC Science & Technology

    1977-06-01

    divers cannot be related to any specific index of diving activity, and may not be causally related to DCS. radiography dysbaric osteonecrosis ...other names, among them dysbaric osteonecrosis , caisson disease of bone, baro- traumatic arthropathy, and so forth.) For many years, the assumption was...underwater en- gineering group technical note 12. Davidson, J. K. 1976. Dysbaric osteonecrosis . Page 147, in J. K. Davidson, Ed. Aseptic necrosis of

  8. Behçet's disease complicated by multiple aseptic abscesses of the liver and spleen.

    PubMed

    Maeshima, Keisuke; Ishii, Koji; Inoue, Megumi; Himeno, Katsuro; Seike, Masataka

    2013-05-28

    Aseptic abscesses are an emergent entity and have been described in inflammatory bowel disease, especially in Crohn's disease, and in other diseases. However, aseptic abscesses associated with Behçet's disease are extremely rare. We report a Japanese male diagnosed with an incomplete type of Behçet's disease who developed multiple aseptic abscesses of the spleen and liver. In 2002, the spleen abscesses were accompanied by paroxysmal oral aphthous ulcers and erythema nodosum. As the patient's response to antibiotic treatment was inadequate, a splenectomy was performed. Severe inflammatory cell infiltration, largely of polymorphonuclear neutrophils, was observed without evidence of bacterial or fungal growth. Although the patient had no history of ocular symptoms or genital ulcers, a diagnosis of incomplete Behçet's disease was made according to the Japanese diagnostic criteria because of the presence of paroxysmal arthritis and epididymitis since 2002. In 2005, multiple liver abscesses developed with right hypochondrial pain and seemed to be attributed to Behçet's disease because the abscesses yielded negative results during a microbiologic investigation and failed to go into remission under antibiotic therapy. Oral prednisone (15 mg/d) was started in May 2006, and the abscesses dramatically disappeared 4 wk after treatment. Although the patient had a relapse of the liver abscesses in association with the tapering of prednisone, the augmentation of prednisone dosage yielded a response. The abscesses of the liver and spleen were strongly suggested to be attributed to Behçet's disease. Clinician should be aware of the existence of aseptic abscesses as uncommon manifestations of Behçet's disease.

  9. Detection of Leptospira DNA in Patients with Aseptic Meningitis by PCR

    PubMed Central

    Romero, Eliete C.; Billerbeck, Ana E. C.; Lando, Valéria S.; Camargo, Eide D.; Souza, Candida C.; Yasuda, Paulo H.

    1998-01-01

    Samples of cerebrospinal fluid from 103 patients with aseptic meningitis were tested by PCR for detection of leptospires, and the results were compared with those of the microscopic agglutination test (MAT) and an enzyme-linked immunosorbent assay for detection of immunoglobulin M (ELISA-IgM). Of these samples, 39.80% were positive by PCR and 8.74 and 3.88% were positive by MAT and ELISA-IgM, respectively. PMID:9574730

  10. Risk of aseptic meningitis after measles, mumps, and rubella vaccine in UK children.

    PubMed

    Miller, E; Goldacre, M; Pugh, S; Colville, A; Farrington, P; Flower, A; Nash, J; MacFarlane, L; Tettmar, R

    1993-04-17

    Cases of aseptic meningitis associated with measles/mumps/rubella vaccine were sought in thirteen UK health districts following a reported cluster in Nottingham which suggested a risk of 1 in 4000 doses, substantially higher than previous estimates based on cases reported by paediatricians (4 per million). Cases were ascertained by obtaining vaccination records of children with aseptic meningitis diagnosed from cerebrospinal fluid samples submitted to Public Health Laboratories or discharged from hospital with a diagnosis of viral meningitis. Both methods identified vaccination 15-35 days before onset as a significant risk factor and therefore indicative of a causal association. With both, half the aseptic meningitis cases identified in children aged 12-24 months were vaccine-associated with onset 15-35 days after vaccine. The study confirmed that the true risk was substantially higher than suggested by case reports from paediatricians, probably about 1 in 11,000 doses. However, the possibility that the aseptic meningitis induced by vaccination was largely asymptomatic and a chance laboratory finding in children investigated for other clinical conditions, particularly febrile convulsions, could not be excluded. Comparison of national reports of virus-positive mumps meningitis cases before and after the introduction of this vaccine indicated that the risk from wild mumps was about 4-fold higher than from vaccine. Altogether, 28 vaccine-associated cases were identified, all in recipients of vaccines containing the Urabe mumps strain. The absence of cases in recipients of vaccine containing the Jeryl Lynn strain, despite its 14% market share, suggested a higher risk from Urabe vaccine. A prospective adverse event surveillance system using the study methods is currently being established to assess the risk, if any, from the Jeryl Lynn strain which is now the only mumps vaccine used in the UK.

  11. Living with Lupus (For Parents)

    MedlinePlus

    ... may trigger the disease. Genetics might play a role. Some people may have a genetic predisposition to lupus that is then activated by an infection, certain medications, or extreme physical or emotional stress. The hormone estrogen also may play a role and could help explain why it's more common ...

  12. Dyslipidemia in systemic lupus erythematosus.

    PubMed

    Szabó, Melinda Zsuzsanna; Szodoray, Peter; Kiss, Emese

    2017-02-07

    Cardiovascular disease is one of the major causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE). Accelerated atherosclerosis is related to traditional (age, hypertension, diabetes mellitus, dyslipidemia, obesity, smoking, and positive family history) and non-traditional, disease-related factors. Traditional risk factors are still more prominent in patients with lupus, as both hypertension and hypercholesterinemia were independently associated with premature atherosclerosis in several SLE cohorts. In this work, the authors summarize the epidemiology of dyslipidemia in lupus patients and review the latest results in the pathogenesis of lipid abnormalities. The prevalence of dyslipidemia, with elevations in total cholesterol (TC), low-density lipoprotein (LDL), triglyceride (TG), and apolipoprotein B (ApoB), and a reduction in low-density lipoprotein (LDL) levels are about 30% at the diagnosis of SLE rising to 60% after 3 years. Multiple pathogenetic mechanism is included, C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR) can suppress HDL and increase TG, auto-antibodies can cause the injury of the endothelium, lipoprotein lipase (LPL) activity can be reduced by circulating inflammatory mediators and antibodies, and increased oxidative stress may trigger a wide range of pro-atherogenic lipid modifications. As a major risk factor, dyslipidemia should be treated aggressively to minimize the risk of atherosclerosis and cardiovascular events. Randomized controlled trials with statins are controversial in the detention of atherosclerosis progression, but can be favorable by inhibiting immune activation that is the arterial wall and by decreasing lupus activity.

  13. Evaluating the Effects of Flexible Learning about Aseptic Compounding on First-year Students in a Pharmacy Skills Laboratory

    PubMed Central

    Palmer, Russ; Elder, Deborah; Fulford, Michael; Morris, Steve; Sappington, Kellie

    2015-01-01

    Objective. To evaluate how flexible learning via online video review affects the ability and confidence of first-year (P1) pharmacy students to accurately compound aseptic preparations. Design. Customary instructions and assignments for aseptic compounding were provided to students, who were given unlimited access to 5 short review videos in addition to customary instruction. Student self-confidence was assessed online, and faculty members evaluated students’ aseptic technique at the conclusion of the semester. Assessment. No significant difference on final assessment scores was observed between those who viewed videos and those who did not. Student self-confidence scores increased significantly from baseline, but were not significantly higher for those who viewed videos than for those who did not. Conclusion. First-year students performed well on final aseptic compounding assessments, and those who viewed videos had a slight advantage. Student self-confidence improved over the semester regardless of whether or not students accessed review videos. PMID:26430278

  14. A Rare Complication of Trimethoprim-Sulfamethoxazole: Drug Induced Aseptic Meningitis

    PubMed Central

    Stromich, Jeremiah; Cohen, Mallory; Wainaina, Jane Njeri

    2016-01-01

    Drug induced aseptic meningitis is a rare but challenging diagnosis, most commonly reported with nonsteroidal anti-inflammatory drugs and antibiotics. Trimethoprim/sulfamethoxazole is a sulfonamide that is widely used in clinical practice for the treatment and prophylaxis of various infections. Drug induced aseptic meningitis, when seen with trimethoprim/sulfamethoxazole, occurs predominantly in patients with some degree of immune compromise and is less commonly seen in immune competent individuals. The patient often exhibits the classic symptoms of meningitis. Early diagnosis is important, since the cessation of the antibiotic leads to rapid clinical improvement. Trimethoprim/sulfamethoxazole induced aseptic meningitis has been underreported to FDA/MED-WATCH program. Here we report two cases of trimethoprim/sulfamethoxazole: an immune competent individual and immune compromised individual, both of which presented with signs of meningitis and a negative infectious workup. Trimethoprim/sulfamethoxazole is an uncommon and mysterious adverse reaction to a commonly used antibiotic. It should be considered in the differential diagnosis of patients presenting with acute signs and symptoms of meningitis especially after infectious causes have been ruled out. PMID:27579194

  15. Leptomeningeal contrast enhancement and blood-CSF barrier dysfunction in aseptic meningitis

    PubMed Central

    Eisele, Philipp; Ebert, Anne D.; Griebe, Martin; Engelhardt, Britta; Szabo, Kristina; Hennerici, Michael G.; Gass, Achim

    2015-01-01

    Objective: To investigate the blood-CSF barrier (BCSFB) dysfunction in aseptic meningitis. Methods: In our case series of 14 patients with acute aseptic meningitis, we compared MRI characteristics with CSF findings. Results: Contrast enhancement in the sulcal space in a leptomeningeal pattern was visualized in 7 patients with BCSFB dysfunction categorized as moderate to severe as evidenced by the CSF/serum albumin ratio (Qalb) but was not present in those with mild or no barrier disturbance (p = 0.001). The Qalb as a marker for the leakiness of the BCSFB and, more indirectly, of the blood-brain barrier (BBB) was positively correlated with the incidence of leptomeningeal contrast enhancement seen on postcontrast fluid-attenuated inversion recovery (FLAIR) MRI (p = 0.003). Patients with a more pronounced brain barrier dysfunction recovered more slowly and stayed longer in the hospital. Conclusions: The severity of meningeal BBB disturbance can be estimated on postcontrast FLAIR MRI, which may be of diagnostic value in patients with aseptic meningitis. PMID:26516629

  16. The neurochemical markers in cerebrospinal fluid to differentiate between aseptic and tuberculous meningitis.

    PubMed

    Qureshi, G A; Baig, S M; Bednar, I; Halawa, A; Parvez, S H

    1998-02-01

    In this study, the use of neurochemical markers in patients with aseptic and tuberculous meningitis has been investigated. The cerebrospinal fluid levels of amino acids, nitrite (a metabolite of nitric oxide), vitamin B12 and homocysteine were quantitated in both groups of patients. Among the amino acids, aspartic acid and glutamic acid both excitatory amino acid, GABA, glycine and tryptophan were all significantly increased in both patient groups whereas decreased level of taurine and increased level of phenylalanine were only found in patients with tuberculous meningitis. The levels of nitrite and its precursor arginine were significantly higher in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. A significantly increased homocysteine level and a decreased level of vitamin B12 were found only in patients with tuberculous meningitis whereas unchanged levels were found in patients with aseptic meningitis. This indicates that patients with tuberculous meningitis are particularly prone to vitamin B12 deficiency resulting into increased level of HC, and involvement of free radical showing the importance of these biological markers for promoting the possibility for the design of therapeutic approach.

  17. Varicella Zoster Aseptic Meningitis: Report of an Atypical Case and Literature Review

    PubMed Central

    Ibrahim, Walid; Elzouki, Abdel-Naser; Husain, Ahmed; Osman, Lubna

    2015-01-01

    Patient: Female, 15 Final Diagnosis: Varicella Zoster aseptic meningitis Symptoms: — Medication: — Clinical Procedure: Lumber punctur Specialty: Infectious Diseases Objective: Unusual clinical course Background: Neurologic complications can occur with varicella zoster virus (VZV) infection, usually after vesicular exanthem. A review of the literature revealed 3 cases of viral meningitis associated with 6th nerve palsy but without significantly increased intracranial pressure. Case Report: We report a case of a previously healthy 15-year-old girl with aseptic meningitis as a result of reactivated-VZV infection with symptoms of increased intracranial pressure and reversible 6th cranial nerve palsy but without exanthema. Diagnosis was made by detection of VZV-DNA in cerebrospinal fluid using polymerase chain reaction and documented high intracranial pressure. Full recovery was achieved after a course of acyclovir and acetazolamide. Conclusions: This case demonstrates that VZV may be considered in cases of aseptic meningitis in immunocompetent individuals, even without exanthema, and it may increase the intracranial pressure, leading to symptoms, and causing reversible neurological deficit. PMID:26342350

  18. Renal biopsy in patients with systemic lupus erythematosus: Not just lupus glomerulonephritis!

    PubMed

    Howell, David N

    2017-01-01

    Kidney biopsy is a mainstay in the diagnosis and management of renal disease in patients with systemic lupus erythematosus. Though biopsies from patients with lupus typically show various forms of immune complex glomerulonephritis, other pathologies are occasionally encountered, including unusual lupus-related nephropathies, other forms of autoimmune disease, and occasional renal disorders without any direct connection with lupus or autoimmunity. Electron microscopy is a powerful tool for detecting and classifying these unusual conditions, which frequently have important therapeutic and prognostic implications.

  19. Disseminated lupus vulgaris.

    PubMed

    Garg, Taru; Ramchander; Shrihar, Rashmi; Gupta, Tanvi Pal; Aggarwal, Shilpi

    2011-01-01

    follicular plugging and multiple epithelioid cell granulomas, rimmed by lymphocytes in the deeper portion of the dermis, mainly peri-appendageal. Stain for acid-fast bacteria was negative. Cultures from the skin lesions were negative. The patient was diagnosed as having lupus vulgaris with multiple lesions of varying morphology at different sites with pulmonary tuberculosis and healed lymph node involvement.

  20. Probabilistic exposure assessment model to estimate aseptic-UHT product failure rate.

    PubMed

    Pujol, Laure; Albert, Isabelle; Magras, Catherine; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2015-01-02

    Aseptic-Ultra-High-Temperature (UHT) products are manufactured to be free of microorganisms capable of growing in the food at normal non-refrigerated conditions at which the food is likely to be held during manufacture, distribution and storage. Two important phases within the process are widely recognised as critical in controlling microbial contamination: the sterilisation steps and the following aseptic steps. Of the microbial hazards, the pathogen spore formers Clostridium botulinum and Bacillus cereus are deemed the most pertinent to be controlled. In addition, due to a relatively high thermal resistance, Geobacillus stearothermophilus spores are considered a concern for spoilage of low acid aseptic-UHT products. A probabilistic exposure assessment model has been developed in order to assess the aseptic-UHT product failure rate associated with these three bacteria. It was a Modular Process Risk Model, based on nine modules. They described: i) the microbial contamination introduced by the raw materials, either from the product (i.e. milk, cocoa and dextrose powders and water) or the packaging (i.e. bottle and sealing component), ii) the sterilisation processes, of either the product or the packaging material, iii) the possible recontamination during subsequent processing of both product and packaging. The Sterility Failure Rate (SFR) was defined as the sum of bottles contaminated for each batch, divided by the total number of bottles produced per process line run (10(6) batches simulated per process line). The SFR associated with the three bacteria was estimated at the last step of the process (i.e. after Module 9) but also after each module, allowing for the identification of modules, and responsible contamination pathways, with higher or lower intermediate SFR. The model contained 42 controlled settings associated with factory environment, process line or product formulation, and more than 55 probabilistic inputs corresponding to inputs with variability

  1. Successful treatment of severe refractory lupus hepatitis with mycophenolate mofetil.

    PubMed

    Tagawa, Y; Saito, T; Takada, K; Kawahata, K; Kohsaka, H

    2016-04-01

    Systemic lupus erythematosus-related hepatitis, known as lupus hepatitis, is a rare manifestation of systemic lupus erythematosus, and is usually subclinical with mild abnormalities of serum liver enzymes. While cases with clinically significant and refractory lupus hepatitis are uncommon, treatment options for lupus hepatitis are to be established. Here, we report the case of a 45-year-old man with progressive lupus hepatitis accompanied by autoimmune haemolytic anaemia. Lupus hepatitis of this patient was refractory to tacrolimus, azathioprine and cyclophosphamide, but was successfully treated by mycophenolate mofetil. Mycophenolate mofetil might be an effective therapeutic option for refractory lupus hepatitis.

  2. Living Well with Lupus: Can I Still Plan a Pregnancy?

    MedlinePlus

    ... History of low platelets History of blood clots History or presence of antiphospholipid antibodies Planning Your Pregnancy Although many lupus pregnancies will have no complications, all lupus pregnancies ...

  3. Cutaneous lupus erythematosus: diagnosis and treatment.

    PubMed

    Okon, L G; Werth, V P

    2013-06-01

    Cutaneous lupus erythematosus (CLE) encompasses a wide range of dermatologic manifestations, which may or may not be associated with the development of systemic disease. Cutaneous lupus is divided into several sub-types, including acute CLE (ACLE), sub-acute CLE (SCLE) and chronic CLE (CCLE). CCLE includes discoid lupus erythematosus (DLE), LE profundus (LEP), chilblain cutaneous lupus and lupus tumidus. The diagnosis of these diseases requires proper classification of the sub-type, through a combination of physical examination, laboratory studies, histology, antibody serology and occasionally direct immunofluorescence, while ensuring to exclude systemic disease. The treatment of cutaneous lupus consists of patient education on proper sun protection along with appropriate topical and systemic agents. Systemic agents are indicated in cases of widespread, scarring or treatment-refractory disease. In this chapter, we discuss issues in classification and diagnosis of the various sub-types of CLE, as well as provide an update on therapeutic management.

  4. Lupus tumidus: a report of two cases*

    PubMed Central

    Bousquet Muylaert, Bianca Pinheiro; Braga, Bruna Backsmann; Esteves, Eduarda Braga; Garbelini, Luciana Elisa Barandas; Michalany, Alexandre Ozores; de Oliveira Filho, Jayme

    2016-01-01

    Lupus tumidus is considered a rare subtype of chronic cutaneous lupus erythematosus, characterized by erythema and bright urticarial erythematous-violaceous lesions that leave no scars after regression. Histopathology reveals perivascular and periannexal lymphohistiocytic infiltrates in the papillary and reticular dermis and interstitial mucin deposition. Treatment is based on photoprotection, topical corticosteroids and antimalarials. We report two cases of lupus tumidus, which deserve attention for their low frequency in the literature, in addition to their relevance as a differential diagnosis among dermatologic disorders.

  5. Renal infarction due to lupus vasculopathy.

    PubMed

    Varalaxmi, B; Sandeep, P; Sridhar, A V S S N; Raveendra, P; Kishore, C Krishna; Ram, R; Kumar, V Siva

    2015-08-01

    In the ISN/RPS 2003 classification of lupus nephritis (LN) renal vascular lesions are not mentioned. We present a patient with postpartum lupus vasculopathy. The renal biopsy in our patient showed concentric intimal thickening with narrowed lumen. No inflammatory changes were found. It also revealed immunoglobulin and complement deposition on the wall of the arteriole. These changes indicate lupus vasculopathy. The glomeruli revealed diffuse proliferative glomerulonephritis, with wire loops and cellular crescent in one glomerulus. The patient showed improvement with immunosuppression.

  6. Pulmonary neuroendocrine tumor in a female wolf (Canis lupus lupus)

    PubMed Central

    SHIRAKI, Ayako; YOSHIDA, Toshinori; KAWASHIMA, Masahi; MURAYAMA, Hirotada; NAGAHARA, Rei; ITO, Nanao; SHIBUTANI, Makoto

    2017-01-01

    A 17-year-old female wolf (Canis lupus lupus) had a right lung mass that was adhered to the thoracic cavity. Histopathological examination revealed that the mass consisted of sheets, cord or ribbon-like structures of monotonous, small, cuboidal cells with round, oval or short-spindle nuclei and scant clear cytoplasm, demarcated by a fine fibrovascular stroma. Focal necrosis, congestion and thrombi were observed. Immunohistochemically, the tumor cells diffusely expressed cytokeratin AE1/AE3, and some expressed chromogranin A, neural cell adhesion molecule (CD56) and thyroid transcription factor-1. The number of proliferating cell nuclear antigen-positive tumor cells was low. A diagnosis of pulmonary neuroendocrine tumor was based on the resemblance to carcinoids. PMID:28190820

  7. Neurological Manifestations in Systemic Lupus Erythematosus: A Single Centre Study from North East India

    PubMed Central

    Kakati, Sanjeeb; Ahmed, Sobur U; Hussain, Masaraf

    2017-01-01

    Introduction Neurological manifestations although common in Systemic Lupus Erythematosus (SLE), are often not recognized due to their diversed and varied presentation. Therefore, the study was planned to highlight the pattern of neurological involvement in SLE to help in early recognition. Aim To study the pattern of neurological involvement in SLE and its correlation with disease activity and different investigation. Materials and Methods This hospital based prospective observational study was carried out from August 2009 to July 2010. Diagnosed cases of SLE [based upon American Rheumatism Association (ARA) criteria] who presented with neurological manifestations at the time of diagnosis or develop during the course of the disease were included in the study. They were assessed clinically and investigated with neuroimaging and neurophysiological tests as applicable. Results In total, 52 consecutive patients with SLE were evaluated, 92% were female. The most common age group was 21 to 25 years. Nervous system involvement was found in 19 (36.54%) patients. Cognitive impairment was the most frequent manifestation, present in 11 (57.89%) patients followed by seizure disorder in eight patients (42.1%). Peripheral neuropathy was diagnosed in eight (42.1%), acute confusional state in six (31.57%) and headache and depression was diagnosed in five (26.31%) patients each. Less common manifestations were psychosis, movement disorder and aseptic meningitis. Percentage of neurological manifestations directly correlated with disease activity. A significant difference was found in Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) score between the patients with Neuro Psychiatric Systemic Lupus Erythematosus (NPSLE) and those without NPSLE (32.42±16.34 Vs 17.3±10.6). Conclusion Neurological involvement in SLE is seen relatively early in the course of the disease with cognitive impairment being the most common manifestation and correlate with disease activity. PMID

  8. Fatigue in systemic lupus erythematosus.

    PubMed

    Ahn, Grace E; Ramsey-Goldman, Rosalind

    2012-04-01

    Systemic lupus erythematosus is a chronic inflammatory autoimmune disease often characterized by fatigue, with significant effects on physical functioning and wellbeing. The definition, prevalence and factors associated with fatigue, including physical activity, obesity, sleep, depression, anxiety, mood, cognitive dysfunction, vitamin D deficiency/insufficiency, pain, effects of medications and comorbidities, as well as potential therapeutic options of fatigue in the systemic lupus erythematosus population are reviewed. Due to variability in the reliability and validity of various fatigue measures used in clinical studies, clinical trial data have been challenging to interpret. Further investigation into the relationships between these risk factors and fatigue, and improved measures of fatigue, may lead to an improvement in the management of this chronic inflammatory disease.

  9. Manifestations of Systemic Lupus Erythematosus

    PubMed Central

    COJOCARU, Manole; COJOCARU, Inimioara Mihaela; SILOSI, Isabela; VRABIE, Camelia Doina

    2011-01-01

    ABSTRACT Systemic lupus erythematosus (SLE) is a chronic, multifaceted autoimmune inflammatory disease that can affect any part of the body. SLE is a disease of unknown aetiology with a variety of presenting features and manifestations. Interest in the disease has been stimulated in recent years, and improved methods of diagnosis have resulted in a significant increase in the number of cases recognized. It is apparent that it can no longer be regarded as a rare disease. The majority of the pathology in SLE is related to deposits of immune complexes in various organs, which triggers complement and other mediators of inflammation. Symptoms vary from person to person, and may come and go, depend on what part of the body is affected, can be mild, moderate, or severe. Diagnosis can be difficult because lupus mimics many other diseases; it requires clinical and serologic criteria. PMID:22879850

  10. Infections and systemic lupus erythematosus

    PubMed Central

    Skare, Thelma Larocca; Dagostini, Jéssica Scherer; Zanardi, Patricia Imai; Nisihara, Renato Mitsunori

    2016-01-01

    ABSTRACT Objective To determine the incidence of infections in a population of systemic lupus erythematosus individuals and the characteristics of infections regarding original site, as well as to study the possible associations between infections and treatment. Methods An analytical retrospective study using data from medical charts of systemic lupus erythematosus patients from a single university hospital. A total of 144 patients followed up for five years were included. Data collected comprised age of patients and age at onset of lupus, sex and ethnicity, disease duration before the study period, medications, cumulative dose of prednisone, occurrence of infections and their original site. Results The most frequent infections were urinary tract infections (correlated to use of prednisone − p<0.0001 and cyclophosphamide − p=0.045), upper airways infections (correlated to use of prednisone − p=0.0004, mycophenolate mofetil − p=0.0005, and cyclosporine − p=0.025), and pneumonia (associated to prednisone − p=0.017). Conclusion Prednisone was the drug more often associated with presence of infections, pointing to the need for a more judicious management of this drug. PMID:27074234

  11. [Management of systemic lupus erythematosus].

    PubMed

    Aringer, M; Schneider, M

    2016-11-01

    In the last few decades a number of small, often largely unrecognized steps have fundamentally changed the management of systemic lupus erythematosus (SLE). The current goal is to stop all disease activity without long-term use of more than 5 mg prednisolone per day. Remission, i.e. absence of activity in the SLE activity score of choice, is the defined target in the treat to target approach. The essential basic measures include life-long hydroxychloroquine as well as protection from sunlight (UV) and vitamin D substitution. Patients suffering from SLE need more vaccinations than the healthy population and control of risk factors for atherosclerosis is critical for long-term survival. Methotrexate is on par with azathioprine. If disease activity cannot be controlled in this way, belimumab is an approved therapeutic option. Cyclophosphamide is still used but only in life-threatening situations, such as lupus nephritis or central nervous system (CNS) vasculitis and in drastically reduced doses. Alternatively, off-label mycophenolate mofetil (MMF) can be used particularly for lupus nephritis and off-label rituximab in refractory disease courses. Numerous novel approaches are being tested in controlled trials and it is hoped that new drugs will be available for SLE patients within a few years.

  12. Legal, ethical, and procedural bases for the use of aseptic techniques to implant electronic devices

    USGS Publications Warehouse

    Mulcahy, Daniel M.

    2013-01-01

    animals often mask the signs of infection to avoid attracting predators (Wobeser 2006). Guidance specific to sterilization of electronic devices for implantation is limited in the wildlife record (Burger et al. 1994; Mulcahy 2003). Few biologists have been formally trained in aseptic technique, but most biologists know that electronic devices should be treated in some way to reduce the chance for infection of the host animal by bacteria, viruses, parasites, and fungi. Most biologists (73%) who implant devices into fishes believe aseptic techniques are important (Wagner and Cooke 2005). However, I maintain that many biologists find it difficult to place the concept of asepsis into practice in their work because of confusion about what constitutes aseptic technique, a lack of surgical knowledge and training, the perception of increased costs, or the belief that aseptic surgeries are impractical or unnecessary for their application. Some have even argued that, while compromising surgical techniques in the field might result in complications or mortalities, the money saved would allow for a compensatory increase in sample size (Anderson and Talcott 2006). In this paper I define aseptic surgical techniques, document the legal and professional guidance for performing aseptic surgeries on wild animals, and present options for sterilizing electronic devices and surgical instruments for field use.

  13. Regulation of Extracellular Matrix Remodeling Proteins by Osteoblasts in Titanium Nanoparticle-Induced Aseptic Loosening Model.

    PubMed

    Xie, Jing; Hou, Yanhua; Fu, Na; Cai, Xiaoxiao; Li, Guo; Peng, Qiang; Lin, Yunfeng

    2015-10-01

    Titanium (Ti)-wear particles, formed at the bone-implant interface, are responsible for aseptic loosening, which is a main cause of total joint replacement failure. There have been many studies on Ti particle-induced function changes in mono-cultured osteoblasts and synovial cells. However, little is known on extracellular matrix remodeling displayed by osteoblasts when in coexistence with Synovial cells. To further mimic the bone-implant interface environment, we firstly established a nanoscaled-Ti particle-induced aseptic loosening system by co-culturing osteoblasts and Synovial cells. We then explored the impact of the Synovial cells on Ti particle-engulfed osteoblasts in the mimicked flamed niche. The matrix metalloproteinases and lysyl oxidases expression levels, two protein families which are critical in osseointegration, were examined under induction by tumor necrosis factor-alpha. It was found that the co-culture between the osteoblasts and Synovial cells markedly increased the migration and proliferation of the osteoblasts, even in the Ti-particle engulfed osteoblasts. Importantly, the Ti-particle engulfed osteoblasts, induced by TNF-alpha after the co-culture, enhanced the release of the matrix metalloproteinases and reduced the expressions of lysyl oxidases. The regulation of extracellular matrix remodeling at the protein level was further assessed by investigations on gene expression of the matrix metalloproteinases and lysyl oxidases, which also suggested that the regulation started at the genetic level. Our research work has therefore revealed the critical role of multi cell-type interactions in the extracellular matrix remodeling within the peri-prosthetic tissues, which provides new insights on aseptic loosening and brings new clues about incomplete osseointegration between the implantation materials and their surrounding bones.

  14. Growth and toxin production by Clostridium botulinum in steamed rice aseptically packed under modified atmosphere.

    PubMed

    Kasai, Yoshiaki; Kimura, Bon; Kawasaki, Susumu; Fukaya, Tetsuya; Sakuma, Kinya; Fujii, Tateo

    2005-05-01

    Sales and consumption of ready-to-eat aseptic steamed rice products have increased manyfold in Japan over the past 10 years. To determine the safety of steamed rice (water content 60%, pH 6.5) aseptically packaged under modified atmosphere, challenge studies were performed using a mixture of Clostridium botulinum proteolytic strains (five strains of type A and five strains of type B). Atmospheric conditions of 0 and 15% oxygen (with 5% CO2 and 5% N2 as the balance) were used. No neurotoxins were detected, and organoleptically acceptable conditions persisted for 24 weeks at 15% oxygen conditions. However, botulinum neurotoxin was found in one of three samples at 12 weeks and in one of two samples at 24 weeks at 0% oxygen and 30 degrees C. When samples were inoculated with C. botulinum with amylase (0% oxygen), neurotoxin and sample spoilage was detected after only 1 week of storage. Challenge studies using proteolytic strains of C. botulinum mixed with Bacillus subtilis (amylase formers) also were performed with atmosphere conditions of oxygen at 0, 5, 10, and 15% (with 5% CO2 and 5% N2 as the balance). Under 10 and 15% oxygen conditions, neurotoxin was not detected after 1 week of storage, but sample spoilage was detected after the same period. Under 0% oxygen conditions, neurotoxin was detected at 1 week, but the sample remained organoleptically acceptable even after 2 weeks of storage. Both neurotoxin and sample spoilage were detected at 1 week of storage under 5% oxygen conditions. Based on these results, cocontamination of amylase-producing Bacillus with C. botulinum would increase the risk of foodborne botulism when aseptic rice samples are packed under low-oxygen conditions (<5%). Therefore, to ensure the safety of these products, packing under atmospheric containing more than 10% oxygen is recommended.

  15. Solvent effect in the polyethylene recovery from multilayer postconsumer aseptic packaging.

    PubMed

    Cervantes-Reyes, Alejandro; Núñez-Pineda, Alejandra; Barrera-Díaz, Carlos; Varela-Guerrero, Víctor; Martínez-Barrera, Gonzalo; Cuevas-Yañez, Erick

    2015-04-01

    Polyethylene films were separated and recovered from polyethylene-aluminum composites derived from recycling multilayer postconsumer aseptic packaging. A brief study about the separation process by dissolving PE-aluminum (PE-Al) composites into a series of organic solvents with a combination of time and temperature is presented. Through this procedure, 56% polyethylene is recovered from this kind of composites in optimized conditions. DSC and TGA studies were performed to determine the thermal stability of recovered polyethylene films and to establish a comparison with a PE reference commercial product, demonstrating that recovered polyethylene films kept their thermal properties.

  16. Somatic embryogenesis ofCyclamen persicum Mill. 'Anneke' from aseptic seedlings.

    PubMed

    Takamura, T; Miyajima, I; Matsuo, E

    1995-01-01

    InCyclamen persicum 'Anneke', explants from the various vegetative organs of aseptic seedling formed embryoids. The optimal responses were recorded in Murashige and Skoog (MS) medium enriched with 5.0µM 2,4-dichlorophenoxyacetic acid (2,4-D), 0.5µM kinetin and 3-6% sucrose. Embryogenesis was enhanced at higher temperature of 25-30°C. On the other hand, light inhibited embryogenesis. Histological and morphological studies confirmed that the embryoids were indeed somatic embryos.

  17. Sporotrichoid lupus vulgaris: A rare presentation.

    PubMed

    Maheshwari, Anshul; Tiwari, Siddhi; Mathur, Deepak K; Bhargava, Puneet

    2015-01-01

    Lupus vulgaris is the most common presentation of cutaneous tuberculosis in India and can present as papular, nodular, plaque, ulcerative, vegetating, and tumid forms. Unusual variants include the frambesiform, gangrenous, ulcerovegetating, lichen simplex chronicus, myxomatous, and sporotrichoid types. We describe a rare sporotrichoid presentation of lupus vulgaris on the leg of a 28-year-old female of 12 years duration.

  18. Low Level of Haptoglobin in Lupus

    PubMed Central

    Timlin, Homa; Machireddy, Kirthi; Petri, Michelle

    2017-01-01

    Haptoglobin levels are measured in systematic lupus erythematosus patients as part of the workup for anemia, with low levels indicating hemolysis. Haptoglobin is an acute phase protein. We present 2 lupus patients who were found to have low haptoglobin levels in the absence of other evidence of hemolysis. PMID:28203576

  19. Acute transverse myelopathy complicating systemic lupus erythematosus.

    PubMed Central

    Propper, D J; Bucknall, R C

    1989-01-01

    A sixteen year old girl with systemic lupus erythematosus developed acute transverse myelopathy. She was treated with high dose steroids, cyclophosphamide, and plasma exchange and regained partial neurological function. Previous descriptions of transverse myelopathy complicating systemic lupus erythematosus are reviewed, with particular reference to the efficacy of high dose steroid treatment. PMID:2662918

  20. Lupus update: perspective and clinical pearls.

    PubMed

    Manzi, Susan

    2009-02-01

    Patients with systemic lupus erythematosus (SLE, lupus) have a markedly better survival rate today than they did 50 years ago, but they face a greater risk of cancer, cardiovascular disease, and osteoporosis at early ages. With better understanding of the immunological mechanisms of the disease, new avenues of therapy are emerging.

  1. Discoid lupus erythematosus presenting as unilateral blepharitis.

    PubMed

    Au, Leon

    2006-01-01

    A 39-year-old man presented with a 4-month history of unilateral blepharitis that did not respond to conventional treatment. Punch biopsy confirmed the diagnosis of discoid lupus erythematosus. Unilateral blepharitis as the only presenting sign of discoid lupus erythematosus is uncommon but should be considered in the differential diagnosis in patients with asymmetric blepharitis.

  2. Drug-induced subacute cutaneous lupus erythematosus.

    PubMed

    Callen, J P

    2010-08-01

    Subacute cutaneous lupus erythematosus (SCLE) is a subset of cutaneous lupus erythematosus with unique immunologic and clinical features. The first description dates back to 1985 when a series of five patients were found to have hydrochlorothiazide-induced SCLE. Since that time, at least 40 other drugs have been implicated in the induction of SCLE.

  3. Subacute Cutaneous Lupus Erythematosus Presenting as Erythroderma

    PubMed Central

    Pai, Varadraj V; Naveen, KN; Athanikar, SB; Dinesh, US; Reshme, Priyanka; Divyashree, RA

    2014-01-01

    Subacute cutaneous lupus erythematosus (SCLE) is a type of lupus erythematosus having distinct characteristic clinical, serologic, and genetic features. Other than the commonly occurring papulosquamous and annular polycyclic lesion, rarely it may present as erythema multiformae, toxic epidermo necrolysis like lesion (Rowell syndrome), erythroderma, and generalized poikiloderma. Herein, we report a case of SCLE presenting as erythroderma. PMID:25484433

  4. Large artery inflammation in systemic lupus erythematosus.

    PubMed

    Sokalski, D G; Copsey Spring, T R; Roberts, W N

    2013-08-01

    A 23-year-old African-American woman with a history of recurrent pneumonias presented to the hospital with 2 weeks of shortness of breath, chest pain, fevers, and lightheadedness. The histologic diagnosis proved to be lupus aortitis. Optimal Framingham risk factor management by itself may not be a completely successful approach in diminishing the extra risk of atherosclerosis conferred by systemic lupus erythematosus (SLE). Therefore it remains possible that important modifiable cardiovascular risk factors may include low-grade SLE disease activity in medium-sized vessels. The implication of the idea that subclinical vessel inflammation is widespread in patients with lupus-and that this inflammation confers a significant part of the patients' risk of accelerated atherosclerosis-might be a lowering of the threshold for aggressive disease-modifying treatment of lupus, essentially a "treat-to-target" approach to systemic lupus.

  5. Lupus vulgaris with squamous cell carcinoma.

    PubMed

    Motswaledi, Mojakgomo Hendrick; Doman, Chantal

    2007-12-01

    Tuberculosis is still a significant problem in developing countries. Cutaneous forms of tuberculosis account for approximately 10% of all cases of extrapulmonary tuberculosis. Cutaneous tuberculosis may be because of true infection with Mycobacterium tuberculosis or because of tuberculids. Tuberculids are immunological reactions to haematogenously spread antigenic components of M. tuberculosis. True cutaneous tuberculosis may be because of inoculation or haematogenous spread of M. tuberculosis to the skin. Lupus vulgaris is the commonest form of true cutaneous tuberculosis. Other forms of true cutaneous tuberculosis are tuberculous chancre, tuberculosis verrucosa cutis, scrofuloderma, periorificial tuberculosis and miliary tuberculosis of the skin. Lupus vulgaris is usually chronic and progressive. It occurs in patients with moderate to high immunity against M. tuberculosis as evidenced by strongly positive tuberculin test. Long-standing cases of lupus vulgaris may be complicated by squamous cell carcinoma (SCC). We describe a patient who had undiagnosed lupus vulgaris for 35 years until she developed SCC on the lesion of lupus vulgaris.

  6. Outbreak of aseptic meningitis by echo 4: prevalence of clinical cases among adults.

    PubMed

    Portolani, M; Pecorari, M; Pietrosemoli, P; Bartoletti, A; Sabbatini, A M; Meacci, M; Gennari, W; Bazzani, E; Beretti, F; Guaraldi, G

    2001-01-01

    Twenty five cases of meningitis occurred in urban areas surrounding a city (Modena) in Northern Italy, in the period May-July 1999. When the patients were admitted to the Infectious Diseases Division of the University of Modena and Reggio Emilia Hospital and studied by virological and serological methods, the meningitis proved to have an enteroviral origin and enterovirus ECHO 4 type was responsible for all cases of illness. An epidemiological characteristic of the enteroviral meninigitis outbreak was the adult age in 23 out of the 25 patients (mean age 24.50 +/- 7.84 years). The monthly distribution of the aseptic meningitis cases was the following: five cases occurred in May, 13 in June and seven in July. The origin of the spread of the virus infection and the reason for its sudden end remained unknown. The unusual drop in temperature which occurred in the geographic area involved in the aseptic meningitis outbreak at the beginning of August could have interfered with the slowdown in virus circulation.

  7. Intravenous Immunoglobulin with Enhanced Polyspecificity Improves Survival in Experimental Sepsis and Aseptic Systemic Inflammatory Response Syndromes

    PubMed Central

    Djoumerska-Alexieva, Iglika; Roumenina, Lubka; Pashov, Anastas; Dimitrov, Jordan; Hadzhieva, Maya; Lindig, Sandro; Voynova, Elisaveta; Dimitrova, Petya; Ivanovska, Nina; Bockmeyer, Clemens; Stefanova, Zvetanka; Fitting, Catherine; Bläss, Markus; Claus, Ralf; von Gunten, Stephan; Kaveri, Srini; Cavaillon, Jean-Marc; Bauer, Michael; Vassilev, Tchavdar

    2015-01-01

    Sepsis is a major cause for death worldwide. Numerous interventional trials with agents neutralizing single proinflammatory mediators have failed to improve survival in sepsis and aseptic systemic inflammatory response syndromes. This failure could be explained by the widespread gene expression dysregulation known as “genomic storm” in these patients. A multifunctional polyspecific therapeutic agent might be needed to thwart the effects of this storm. Licensed pooled intravenous immunoglobulin preparations seemed to be a promising candidate, but they have also failed in their present form to prevent sepsis-related death. We report here the protective effect of a single dose of intravenous immunoglobulin preparations with additionally enhanced polyspecificity in three models of sepsis and aseptic systemic inflammation. The modification of the pooled immunoglobulin G molecules by exposure to ferrous ions resulted in their newly acquired ability to bind some proinflammatory molecules, complement components and endogenous “danger” signals. The improved survival in endotoxemia was associated with serum levels of proinflammatory cytokines, diminished complement consumption and normalization of the coagulation time. We suggest that intravenous immunoglobulin preparations with additionally enhanced polyspecificity have a clinical potential in sepsis and related systemic inflammatory syndromes. PMID:26701312

  8. SIRT1 protects osteoblasts against particle-induced inflammatory responses and apoptosis in aseptic prosthesis loosening.

    PubMed

    Deng, Zhantao; Wang, Zhenheng; Jin, Jiewen; Wang, Yong; Bao, Nirong; Gao, Qian; Zhao, Jianning

    2017-02-01

    We hypothesized that SIRT1 downregulation in osteoblasts induced by wear particles was one of the reasons for particle-induced osteolysis (PIO) in total joint arthroplasty failure. In the present study, the expression of SIRT1 was examined in osteoblasts treated with TiAl6V4 particles (TiPs) and CoCrMo particles (CoPs) from materials used in prosthetics and specimens from PIO animal models. To address whether SIRT1 downregulation triggers inflammatory responses and apoptosis in osteoblasts, the effect of a SIRT1 activator, resveratrol on the expression of inflammatory cytokines and apoptosis in particle-treated osteoblasts was tested. The results demonstrated that SIRT1 expression was significantly downregulated in particle-treated osteoblasts and PIO animal models. Both pharmacological activation and overexpression of SIRT1 dramatically reduced the particle-induced expression of inflammatory cytokines and osteoblast apoptosis through NF-κB and p53 signaling, respectively. Furthermore, in PIO animal models, resveratrol significantly reduced the severity of osteolysis. Collectively, the results of the present study indicated that SIRT1 plays a vital role in the pathogenesis of aseptic loosening, and further treatment targeted at SIRT1 possibly lead to novel approaches for prevention of aseptic prosthesis loosening.

  9. Aseptic Culture Systems of Radopholus similis for In Vitro Assays on Musa spp. and Arabidopsis thaliana.

    PubMed

    Elsen, A; Lens, K; Nguyet, D T; Broos, S; Stoffelen, R; De Waele, D

    2001-06-01

    Radopholus similis is one of the most damaging nematodes in bananas. Chemical control is currently the most-used method, but nematode control through genetic improvement is widely encouraged. The objective of this study was to establish an aseptic culture system for R. similis and determine whether R. similis can infect and reproduce on in vitro banana plantlets and in vitro Arabidopsis thaliana. In the study's first part, a suitable aseptic culture system was developed using alfalfa callus. Radopholus similis could penetrate and reproduce in the callus. Six weeks after inoculation with 25 females, the reproduction ratio was 26.3 and all vermiform stages were present. The reproduction ratio increased to 223.2 after 12 weeks. Results of a greenhouse test showed that R. similis did not lose its pathogenicity after culturing on alfalfa callus. In the study's second part, the infection and reproduction of the nematodes cultured on the callus were studied on both in vitro banana plantlets and A. thaliana. Radopholus similis infected and reproduced on both banana and A. thaliana. Furthermore, nematode damage was observed in the root systems of both hosts. These successful infections open new perspectives for rapid in vitro screening for resistance in banana cultivars and anti-nematode proteins expressed in A. thaliana.

  10. Vascular lesions in lupus nephritis.

    PubMed

    Grishman, E; Venkataseshan, V S

    1988-05-01

    Three groups of kidney specimens from patients with systemic lupus erythematosus (SLE) were examined for histologic evidence of vascular lesions in small arteries and arterioles. Group 1 consisted of 24 autopsy kidneys from patients who died before the advent of steroid therapy, and Group 2, of 26 more recent autopsy specimens from patients treated with steroids and/or immunosuppressive drugs. Group 3 comprised 276 renal biopsies. Group 1 showed characteristic subendothelial eosinophilic deposits in small arteries and arterioles of 8 cases; Group 2 showed similar lesions in 5 specimens, while 3 others revealed evidence of resorption of deposits. Deposits were characterized by clumping and were delimited toward the media by a thick basement membrane. Only one case showed necrotizing arteritis resembling polyarteritis nodosa. Group 3 presented vascular deposits in 19 cases and thrombotic microangiopathy in 2. Electron microscopic appearance of some of the deposits is described. Immunofluorescence microscopy showed a mixture of IgG, IgA, and IgM in 7 cases, a finding that was not seen in a group of non-lupus patients with various vascular lesions. Vascular deposits are generally rare in systemic lupus erythematosus, although in autopsies widely scattered involvement of arteries and arterioles was seen in nearly 1/3 of the cases. The deposits were more common in male patients. The evolution of the lesions could be followed through various stages to eventual sclerosis, particularly in patients treated with steroids or immunosuppressants. Some deposits appeared to resolve after treatment. Patients with vascular deposits had more severe glomerular disease and a more serious clinical course. Thrombotic microangiopathy appears to be a secondary phenomenon whose pathogenesis is unknown.

  11. Systemic lupus erythematosus and exercise.

    PubMed

    Ayán, C; Martín, V

    2007-01-01

    Systemic lupus erythematosus (SLE) is a rheumatic disease characterized by a variety of symptoms, especially fatigue, pain and reduced quality of life. Physical exercise is a useful tool for improving cardiovascular fitness, reducing metabolic abnormalities and fatigue and improving quality of life. However, very few studies have focused on the relationship between SLE and physical exercise. This paper reviews the main SLE symptoms that can be alleviated by exercising, as well as the results of studies seeking to analyse the exercise capacity and physical training possibilities of SLE patients. Considerations for future research are also discussed.

  12. Transition circumnstellar disks in Lupus

    NASA Astrophysics Data System (ADS)

    Romero, G. A.; Schreiber, M. R.; Cieza, L. A.; Rebassa-Manssergas, A.; Williams, J. P.; Merin, B.; Smith-Castelli, A.; Orellana, M.

    2011-10-01

    Based on Spitzer selected YSOs, we present a study of transition disks located in Lupus. Several mechanisms have been proposed to explain their defining characteristic: an inner opacity hole and an optically thick outer disk. These processes are: planet formation, grain growth, photoevaporation, tidal truncation in close binaries. We have carried out Adaptive Optics (AO) imaging, submillimeter photometry, and echelle spectroscopy in order to observationally characterize our transition disk sample. With the analyzed data we can distinguish the four scenarios and identify candidate transition disk systems that are currently forming planets. Such objects are excellent targets to be followed-up with Herschel and ALMA.

  13. Belimumab in Systemic Lupus Erythematosus

    PubMed Central

    Srivastava, Ankita

    2016-01-01

    Belimumab is the only approved biological agent for the treatment of systemic lupus erythematosus (SLE). It is a fully humanized IgG1γ monoclonal antibody directed against soluble B lymphocyte stimulator (BLyS). It is indicated as an add-on therapy for the treatment of adult patients with active, autoantibody-positive SLE, who are receiving standard therapy. Belimumab is generally well-tolerated, common adverse effects include infections, infusion reactions, hypersensitivity, headache, nausea, and fatigue. Psychiatric events including suicidal tendency, progressive multifocal leukoencephalopathy and malignancies too have been reported. Apart from SLE, the drug is also being tried for other autoimmune disorders. PMID:27688447

  14. Potential application of quantitative microbiological risk assessment techniques to an aseptic-UHT process in the food industry.

    PubMed

    Pujol, Laure; Albert, Isabelle; Johnson, Nicholas Brian; Membré, Jeanne-Marie

    2013-04-01

    Aseptic ultra-high-temperature (UHT)-type processed food products (e.g., milk or soup) are ready to eat products which are consumed extensively globally due to a combination of their comparative high quality and long shelf life, with no cold chain or other preservation requirements. Due to the inherent microbial vulnerability of aseptic-UHT product formulations, the safety and stability-related performance objectives (POs) required at the end of the manufacturing process are the most demanding found in the food industry. The key determinants to achieving sterility, and which also differentiates aseptic-UHT from in-pack sterilised products, are the challenges associated with the processes of aseptic filling and sealing. This is a complex process that has traditionally been run using deterministic or empirical process settings. Quantifying the risk of microbial contamination and recontamination along the aseptic-UHT process, using the scientifically based process quantitative microbial risk assessment (QMRA), offers the possibility to improve on the currently tolerable sterility failure rate (i.e., 1 defect per 10,000 units). In addition, benefits of applying QMRA are (i) to implement process settings in a transparent and scientific manner; (ii) to develop a uniform common structure whatever the production line, leading to a harmonisation of these process settings, and; (iii) to bring elements of a cost-benefit analysis of the management measures. The objective of this article is to explore how QMRA techniques and risk management metrics may be applied to aseptic-UHT-type processed food products. In particular, the aseptic-UHT process should benefit from a number of novel mathematical and statistical concepts that have been developed in the field of QMRA. Probabilistic techniques such as Monte Carlo simulation, Bayesian inference and sensitivity analysis, should help in assessing the compliance with safety and stability-related POs set at the end of the manufacturing

  15. The lupus band test in systemic lupus erythematosus patients

    PubMed Central

    Reich, Adam; Marcinow, Katarzyna; Bialynicki-Birula, Rafal

    2011-01-01

    The lupus band test (LBT) is a diagnostic procedure that is used to detect deposits of immunoglobulins and complement components along the dermoepidermal junction in patients with lupus erythematosus (LE). The LBT is positive in about 70%–80% of sun-exposed non-lesional skin specimens obtained from patients with systemic LE (SLE), and in about 55% of SLE cases if sun-protected nonlesional skin is analyzed. In patients with cutaneous LE only, the lesional skin usually shows a positive LBT. The LBT helps in differentiating LE from other similar skin conditions and may also be helpful in making the diagnosis of SLE in subjects with no specific cutaneous lesions. Furthermore, a positive LBT may be applied as a prognostic parameter for LE patients. However, the correct interpretation of this test requires detailed knowledge of the site of the biopsy, deposit components, morphology and brightness of the immunofluorescent band, and other associated serologic findings, as well as the response to treatment. It must be emphasized that LBT is a laboratory procedure that should always be interpreted in conjunction with clinical findings and other serological and immunopathological parameters. PMID:21339940

  16. The stellar population of the Lupus clouds

    NASA Technical Reports Server (NTRS)

    Hughes, Joanne; Hartigan, Patrick; Krautter, Joachim; Kelemen, Janos

    1994-01-01

    We present photometric and spectroscopic observations of the H alpha emission stars in the Lupus dark cloud complex. We estimate the effective temperatures of the stars from their spectral types and calculate the reddening towards each object from the (R-I) colors. From these data, we derive mass and age distributions for the Lupus stars using a new set of pre-main sequence evolutionar tracks. We compare the results for the Lupus stars with those for a similar population of young stellar objects in Taurus-Auriga and Chamaeleon and with the initial mass function for field stars in the solar neighborhood. From the H-R diagrams, Lupus appears to contain older stars than Taurus. The Lupus dark clouds form a greater proportion of low mass stars than the Taurus complex. Also, the proportion of low mass stars in Lupus is higher than that predicted by the Miller-Scalo initial mass function, and the lowest mass stars in Lupus are less active than similar T Tauri stars in other regions.

  17. Lupus vulgaris in a patient with systemic lupus erythematosus and persistent IgG deficiency.

    PubMed

    Düzgün, N; Duman, M; Sonel, B; Peksari, Y; Erdem, C; Tokgöz, G

    1997-01-01

    We present the case of a patient with juvenile onset systemic lupus erythematosus (SLE) who developed a persistent, acquired hypogammaglobulinaemia with IgG deficiency. The hypogammaglobulinaemia was probably a complication of high dose corticosteroid treatment. The serum IgG level remained subnormal despite intravenous immunoglobulin therapy. Lupus vulgaris, which developed on the nasal cartilage in this patient with SLE, is not an expected finding. This patient is probably the first reported case of SLE associated with lupus vulgaris.

  18. Childhood-onset bullous systemic lupus erythematosus.

    PubMed

    Lourenço, D M R; Gomes, R Cunha; Aikawa, N E; Campos, L M A; Romiti, R; Silva, C A

    2014-11-01

    Bullous systemic lupus erythematosus has rarely been described in pediatric lupus population and the real prevalence of childhood-onset bullous systemic lupus erythematosus has not been reported. From January 1983 to November 2013, 303 childhood-onset SLE (c-SLE) patients were followed at the Pediatric Rheumatology Unit of the Childreńs Institute of Hospital das Clínicas da Faculdade de Medicina Universidade da Universidade de São Paulo, three of them (1%) diagnosed as childhood-onset bullous systemic lupus erythematosus. All three cases presented tense vesiculobullous lesions unassociated with lupus erythematosus lesions, with the median duration of 60 days (30-60). All patients fulfilled bullous systemic lupus erythematosus criteria. Two had nephritis and serositis and presented specific autoantibodies. The histological pattern demonstrated subepidermal blisters with neutrophils-predominant infiltrates within the upper dermis. Direct immunofluorescence (DIF) showed deposits of IgG and complement along the epidermal basement membrane, in the presence or absence of IgA and/or IgM. A positive indirect immunofluorescence on salt-split skin demonstrating dermal binding was observed in two cases. All of them had moderate/severe disease activity at diagnosis with median Systemic Lupus Erythematosus Disease Activity Index 2000 (SLEDAI-2K) of 18 (14-24). Two patients received dapsone and one with severe nephritis received immunosuppressive drugs. In conclusion, in the last 30 years the prevalence of bullous lupus in childhood-onset lupus population was low (1%) in our tertiary University Hospital. A diagnosis of SLE should always be considered in children with recurrent tense vesiculobullous lesions with or without systemic manifestations.

  19. Mechanical properties of human bone-implant interface tissue in aseptically loose hip implants.

    PubMed

    Kraaij, Gert; Zadpoor, Amir A; Tuijthof, Gabrielle J M; Dankelman, Jenny; Nelissen, Rob G H H; Valstar, Edward R

    2014-10-01

    The main cause of failure in total hip replacement is aseptic loosening which is associated with the formation of a periprosthetic fibrous (interface) tissue. Despite important applications for finite element modeling of loose implants, the mechanical properties of the bone-implant interface tissue have never been measured in humans. In this study, we performed unconfined compression tests to characterize the mechanical properties of the interface tissue and to determine the parameters of various hyperelastic material models which were fitted to the measurements. Human interface tissues were retrieved during 21 elective revision surgeries from aseptically loosened cemented (N=10) and uncemented hip implants (N=11). Specimens were tested at a fixed deformation rate of 0.1mm/min up to a maximum force of 10N. Elastic moduli for low and high strain regions of the stress-strain curves were determined. Interface tissue from aseptically loose cemented prostheses shows higher elastic moduli (mean=1.85MPa, 95% C.I.=1.76-1.95MPa) in the high strain region as compared to that of the interface tissue from the cementless group (mean=1.65MPa, 95% C.I.=1.43-1.88MPa). The 5-terms Mooney-Rivlin model ( [Formula: see text] ) described the stress-strain behavior the best. Large variations in the mechanical behavior were observed both between specimens from the same patient as between those of different patients. The material model parameters were therefore estimated for the mean data as well as for the curves with the highest and lowest strain at the maximum load. The model parameters found for the mean data were C1=-0.0074MPa, C2=0.0019MPa, C3=0MPa, C4=-0.0032MPa and C5=0MPa in the cemented group and C1=-0.0137MPa, C2=0.0069MPa, C3=0.0026MPa, C4=-0.0094MPa and C5=0MPa in the cementless group. The results of this study can be used in finite element computer.

  20. Magnetic resonance imaging of the brain in neuropsychiatric systemic lupus erythematosus.

    PubMed

    Stimmler, M M; Coletti, P M; Quismorio, F P

    1993-04-01

    To determine the utility of magnetic resonance imaging (MRI) of the brain in diagnosing active neuropsychiatric disease in systemic lupus erythematosus (NP-SLE), a prospective study of 51 hospitalized systemic lupus erythematosus (SLE) patients during 64 separate episodes of suspected NP-SLE was initiated. In addition to standard hematology, chemistry, and serological tests, the workup included MRI in all patients. A computed tomographic scan of the brain was obtained in patients enrolled in the first year of the study. Of the 64 neuropsychiatric episodes, 42 were attributable to NP-SLE and 22 were attributed to causes other than SLE. Neuropsychiatric complaints unrelated to lupus included depression (n = 6), seizures (n = 5), headache (n = 3), altered mental status (n = 2), aseptic meningitis (n = 2), cardiovascular accident (n = 2), transient ischemic attack (n = 1), and vertigo (n = 1). The MRI was abnormal in 34 of 64 (53%) episodes. MRI abnormalities were more common in patients with focal neurological deficits (19/26) than in those without focal findings (15/38; P = .008) and in patients with nephritis (19/24) than in those without renal disease (15/40; P = .002). MRI abnormalities were as frequent in NP-SLE (25/42) as in cases with non-NP-SLE-related causes (9/22). Periventricular increased signal (PIS) was a frequent MRI finding (10/64). Enlargement of the prepontine cistern, an MRI finding not previously described in NP-SLE, was seen (14/64). Both findings were associated with the presence of hypertension and lupus nephritis. PIS similar to that seen in our patients has been described in otherwise healthy elderly individuals with risk factors for stroke, suggesting that vascular abnormalities may be important in the etiology of these lesions. In conclusion, abnormalities in brain MRI occur frequently in NP-SLE, especially in patients with focal neurological deficits. However, the presence of similar MRI abnormalities in SLE patients with neuropsychiatric

  1. Hypertrophic lupus vulgaris: an unusual presentation.

    PubMed

    Jain, Vijay K; Aggarwal, Kamal; Jain, Sarika; Singh, Sunita

    2009-07-01

    Lupus vulgaris is the most common form of cutaneous tuberculosis occurring in previously sensitized individuals with a high degree of tuberculin sensitivity. Various forms including plaque, ulcerative, hypertrophic, vegetative, papular, and nodular forms have been described. A 30-year-old male patient presented with a very large hypertrophic lupus vulgaris lesion over left side of chest since 22 years. Histopathological examination showed granulomatous infiltration without caseation necrosis. The Mantoux reaction was strongly positive. Hypertrophic lupus vulgaris of such a giant size and that too at an unusual site is extremely rare and hence is being reported.

  2. [Cutaneous lupus erythematosus, a multidimensional entity].

    PubMed

    Méndez-Flores, Silvia; Tinoco-Fragoso, Fátima; Hernández-Molina, Gabriela

    2015-01-01

    Skin lesions caused by systemic lupus erythematosus are among the most frequent manifestations of this disease. These lesions show great variability in both their clinical and histological expression, making their understanding and study difficult. Patients presenting with cutaneous lupus do not necessarily have serious systemic complications, but they do have significant morbidity from impact on quality of life given the extent of the lesions, chronic tendency, and the risk of scarring; hence the importance of establishing a fast and effective treatment. This paper addresses the different varieties of specific injuries attributed to lupus erythematosus, correlation with systemic activity, quality of life, and the treatments available.

  3. Concurrent Kimura disease and lupus nephritis

    PubMed Central

    Wang, Haitao; Fang, Fang; Sun, Ying; Wang, Songlan; Mao, Yonghui

    2016-01-01

    Abstract Background: Kimura disease is a rare chronic inflammatory disorder with peripheral eosinophilia and elevated serum IgE and is also frequently complicated by nephropathy. Methods: We report a rare case of Kimura disease concomitant with lupus nephritis in a 72-year old male patient with recurrent unexplained lymphadenopathy, renal lesions, and immunologic abnormalities. Results: The patient was successfully managed with gamma immunoglobulin, intravenous pulse methylprednisolone therapy, hydroxychloroquine, and prednisone. Conclusion: This is the first report of a case of Kimura disease concomitant with lupus nephritis and highlights the importance of considering lupus nephritis as a possible concurrent disease in patients with Kimura disease that have immunologic abnormalities. PMID:27741124

  4. Innovative food processing technology using ohmic heating and aseptic packaging for meat.

    PubMed

    Ito, Ruri; Fukuoka, Mika; Hamada-Sato, Naoko

    2014-02-01

    Since the Tohoku earthquake, there is much interest in processed foods, which can be stored for long periods at room temperature. Retort heating is one of the main technologies employed for producing it. We developed the innovative food processing technology, which supersede retort, using ohmic heating and aseptic packaging. Electrical heating involves the application of alternating voltage to food. Compared with retort heating, which uses a heat transfer medium, ohmic heating allows for high heating efficiency and rapid heating. In this paper we ohmically heated chicken breast samples and conducted various tests on the heated samples. The measurement results of water content, IMP, and glutamic acid suggest that the quality of the ohmically heated samples was similar or superior to that of the retort-heated samples. Furthermore, based on the monitoring of these samples, it was observed that sample quality did not deteriorate during storage.

  5. First epidemic of aseptic meningitis due to echovirus type 13 among Spanish children.

    PubMed Central

    Trallero, G.; Casas, I.; Avellón, A.; Pérez, C.; Tenorio, A.; De La Loma, A.

    2003-01-01

    Echoviruses are the commonest cause of aseptic meningitis (AM). Echovirus type 13 (EV-13) was the second enterovirus serotype associated with different local outbreaks of AM in Spain between February and October 2000. It was the first time that an epidemic AM caused by this virus was recognized in Spain. The index case appeared in the Canary Islands (Canarias). The EV-13 virus was isolated from 135 patients, predominantly from cerebrospinal fluid (CSF). All isolates were from children under 13 years. The age specific peak incidence was in infants under 1 year. Most patients had fever, headache and other meningeal signs. This enterovirus serotype, not previously detected in Spain, caused severe illness with a high attack rate. PMID:12729193

  6. Aseptic meningitis in a patient taking etanercept for rheumatoid arthritis: a case report

    PubMed Central

    Booker, Matthew J; Flint, Julia; Saravana, Shanmugam

    2008-01-01

    Background We report a case of a 53 year old lady recently commenced on etanercept, an anti-TNF (tumour necrosis factor) therapy for rheumatoid arthritis presenting with confusion, pyrexia and an erythematous rash. Case presentation A lumbar puncture was highly suggestive of bacterial meningitis, but CSF cultures produced no growth, and polymerase chain reactions (PCR) for all previously reported bacterial, fungal and viral causes of meningitis were negative. Conclusion This case report describes aseptic meningitis as a previously unreported complication of etanercept therapy, and serves as a reminder of the rare but potentially life-threatening risk of serious infections in patients taking anti-TNF therapy for a variety of conditions. PMID:19046446

  7. [Acute disseminated encephalomyelitis in children as the result of aseptic meningitis - a report of two cases].

    PubMed

    Gołąbek, Violetta; Woźniakowska-Gęsicka, Teresa; Sokołowska, Dorota

    2011-01-01

    Acute disseminated encephalomyelitis (ADEM) is an inflammation of the spinal cord and brain. Diagnosis of ADEM, due to its rare occurrence and lack of definite laboratory indices, is difficult and is never totally certain. The clinical criterion required for the diagnosis is presence of acute symptoms from the brain and/or spine with fever, occurring after viral or bacterial infection, vaccination or serum administration. Differentiation between ADEM and acute multiple sclerosis in children is difficult, and diagnosis of ADEM may only be confirmed after years of observation, especially as multiple sclerosis is more common than ADEM. The most useful tool in differentiation between the two diseases is MRI. The aim of the study was to present two cases of ADEM with unknown aetiology after aseptic meningitis in children.

  8. Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

    PubMed

    Glimåker, M; Johansson, B; Olcén, P; Ehrnst, A; Forsgren, M

    1993-01-01

    An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

  9. Techniques and clinical effect of aseptic procedures on patients with acute leukemia in laminar airflow rooms.

    PubMed

    Takeo, H; Sakurai, T; Amaki, I

    1983-01-01

    The techniques of aseptic procedures in the laminar airflow room (LAF) were evaluated in 110 adult patients undergoing antileukemic chemotherapy for remission induction. The patients were divided into three groups according to the regimens: Group A, consisting of 20 patients who stayed in the LAF and received the gown technique + sterile food + prophylactic oral and topical antibiotics; Group B, consisting of 12 patients who stayed in the LAF and received sterile food + prophylactic oral antibiotics; and Group C, consisting of 78 patients in open wards, who received prophylactic oral antibiotics alone. Species and numbers of microorganisms on the skin surface were far less in the patients in Group A than in those in Group B. Airborne microorganisms were counted by the air sampling method. No microorganisms could be detected at the time of the patient's rest and of blood collection in either Group A or B. Electrocardiography and X-ray examination caused an increase in the number of colonies to more than one colony in Group B, but Group A had a count of less than 0.5 colony. The colony counts became negative within 5 min after the cessation of each operation. The percentage of febrile days for patients with a peripheral granulocyte count of less than 100/microliter was 29% in Group A, 21% in Group B and 44% in Group C. The incidence of documented infections during the total hospital stay was 25% (5/20), 42% (5/12) and 86% (67/78), respectively. The aseptic procedures in Group B were not as strict as in Group A, but the incidence of infections in Group B was significantly lower than in Group C.

  10. Establishing and monitoring an aseptic workspace for building the MOMA mass spectrometer

    NASA Astrophysics Data System (ADS)

    Lalime, Erin N.; Berlin, David

    2016-09-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  11. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin N.; Berlin, David

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the European Space Agency (ESA) ExoMars 2020 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). MOMA-MS is a life-detection instrument and thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 spore/m2 are allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three clean rooms with varying levels of bioburden control. The Aseptic Assembly Clean room has the highest level of control, applying three different bioburden reducing methods: 70% Isopropyl Alcohol (IPA), 7.5% Hydrogen Peroxide, and Ultra-Violet C (UVC) light. The three methods are used in rotation and each kills microorganisms by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Clean rooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of clean rooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and Dry Heat microbial Reduction (DHMR) verification. The clean rooms are monitored for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic and other clean room.

  12. Aseptically Processed Placental Membrane Improves Healing of Diabetic Foot Ulcerations: Prospective, Randomized Clinical Trial

    PubMed Central

    DiDomenico, Lawrence A.; Orgill, Dennis P.; Galiano, Robert D.; Serena, Thomas E.; Carter, Marissa J.; Kaufman, Jarrod P.; Young, Nathan J.

    2016-01-01

    Background: Allogeneic grafts derived from amnion/chorion are known to be efficacious in healing chronic diabetic foot ulcerations (DFUs). The goal of this study was to compare aseptically processed dehydrated human amnion and chorion allograft (dHACA) versus standard of care (SOC) in facilitating wound closure in nonhealing DFUs. Methods: Patients with DFUs treated with SOC (off-loading, appropriate debridement, and moist wound care) after a 2-week screening period were randomized to either SOC or wound-size-specific dHACA (AmnioBand, Musculoskeletal Transplant Foundation, Edison, N.J.) applied weekly for up to 12 weeks plus SOC. Primary endpoint was the percentage of wounds healed at 6 weeks between groups. Results: At 6 weeks, 70% (14/20) of the dHACA-treated DFUs healed compared with 15% (3/20) treated with SOC alone. Furthermore, at 12 weeks, 85% (17/20) of the DFUs in the dHACA group healed compared with 25% (5/20) in the SOC group, with a corresponding mean time to heal of 36 and 70 days, respectively. At 12 weeks, the mean number of grafts used per healed wound for the dHACA group was 3.8 (median 3.0), and mean cost of the tissue to heal a DFU was $1400. The mean wastage at 12 weeks was 40%. One adverse event and 1 serious adverse event occurred in the dHACA group; neither was graft related. Three adverse events and 1 serious adverse event occurred in the SOC group. Conclusion: Aseptically processed dHACA heals diabetic foot wounds significantly faster than SOC at 6 and 12 weeks with minimal graft wastage. PMID:27826487

  13. Shoot growth in aseptically cultivated daylily and haplopappus plantlets after a 5-day spaceflight

    NASA Technical Reports Server (NTRS)

    Levine, H. G.; Krikorian, A. D.

    1992-01-01

    Plantlets of daylily (Hemerocallis cv. Autumn Blaze) regenerated from cell suspensions, and 4 clonal populations of Haplopappus gracilis were aseptically cultivated aboard the Shuttle "Discovery" during a 5-day mission within NASA's Plant Growth Unit (PGU) apparatus. Daylily was selected as a representative herbaceous perennial monocotyledon and the haplopappus clones represented an annual dicotyledon. The latter included 4 strains with different physiological and morphological characteristics: two aseptic seedling clones (each generated from a single seedling) and two tissue culture-derived lines. Mean daily growth rates for the primary shoots of all plantlets averaged 4.13 mm day-1 (SD = 2.20) for the flight experiment and 4.68 mm day-1 (SD = 2.59) for the ground control. Comparable growth rates calculated by summing both the primary and secondary shoots for all plantlets were 5.94 mm day-1 (SD = 2.89) for the flight experiment and 6.38 mm day-1 (SD = 3.71) for the control. Statistically significant differences existed between: (1) flight vs control primary shoot growth (the controls growing more than plantlets subjected to spaceflight conditions), (2) the different populations (the daylily gaining more shoot material than any of the haplopappus populations and the haplopappus seedling clones outperforming the tissue culture-derived haplopappus lines), and (3) the individual Plant Growth Chambers contained within the PGU. The data suggest that some spaceflight-associated factor(s) increased the tendency for primary shoot apices to degrade or senesce, resulting in the release of apical dominance and permitting the emergence of axillary branches, which subsequently partially compensated for the reduced primary axis growth. In addition to spaceflight-associated factors, the physiologically diverse nature of the experimental material as well as environmental heterogeneities within the culture apparatus contributed to the variation in growth results. The findings

  14. Detection of early stage changes associated with adipogenesis using Raman spectroscopy under aseptic conditions.

    PubMed

    Mitchell, Adam; Ashton, Lorna; Yang, Xuebin B; Goodacre, Royston; Smith, Alistair; Kirkham, Jennifer

    2015-11-01

    There is growing interest in the development of methods capable of non-invasive characterization of stem cells prior to their use in cell-based therapies. Raman spectroscopy has previously been used to detect biochemical changes commensurate with the osteogenic, cardiogenic, and neurogenic differentiation of stem cells. The aim of this study was to characterize the adipogenic differentiation of live adipose derived stem cells (ASCs) under aseptic conditions. ASCs were cultured in adipogenic or basal culture medium for 14 days in customized culture flasks containing quartz windows. Raman spectra were acquired every 3 days. Principal component analysis (PCA) was used to identify spectral changes in the cultures over time. Adipogenic differentiation was confirmed using quantitative reverse transcription polymerase chain reaction for the marker genes PPARγ and ADIPOQ and Oil red O staining performed. PCA demonstrated that lipid associated spectral features varied throughout ASC differentiation with the earliest detection of the lipid associated peak at 1,438 cm(-1) after 3 days of induction. After 7 days of culture there were clear differences between the spectra acquired from ASCs in adipogenic or basal culture medium. No changes were observed in the spectra acquired from undifferentiated ASCs. Significant up-regulation in the expression of both PPARγ and ADIPOQ genes (P < 0.001) was observed after 14 days of differentiation as was prominent Oil red O staining. However, the Raman sampling process resulted in weaker gene expression compared with ASCs that had not undergone Raman analysis. This study demonstrated that Raman spectroscopy can be used to detect biochemical changes associated with adipogenic differentiation in a non-invasive and aseptic manner and that this can be achieved as early as three days into the differentiation process.

  15. Establishing and Monitoring an Aseptic Workspace for Building the MOMA Mass Spectrometer

    NASA Technical Reports Server (NTRS)

    Lalime, Erin

    2016-01-01

    Mars Organic Molecule Analyzer (MOMA) is an instrument suite on the ESA ExoMars 2018 Rover, and the Mass Spectrometer (MOMA-MS) is being built at Goddard Space Flight Center (GSFC). As MOMA-MS is a life-detection instrument and it thus falls in the most stringent category of Planetary Protection (PP) biological cleanliness requirements. Less than 0.03 sporem2 is allowed in the instrument sample path. In order to meet these PP requirements, MOMA-MS must be built and maintained in a low bioburden environment. The MOMA-MS project at GSFC maintains three cleanrooms with varying levels of bioburden control. The Aseptic Assembly Cleanroom has the highest level of control, applying three different bioburden reducing methods: 70 IPA, 7.5 Hydrogen Peroxide, and Ultra-Violet C light. The three methods are used in rotation and each kills microbes by a different mechanism, reducing the likelihood of microorganisms developing resistance to all three. The Integration and Mars Chamber Cleanrooms use less biocidal cleaning, with the option to deploy extra techniques as necessary. To support the monitoring of cleanrooms and verification that MOMA-MS hardware meets PP requirements, a new Planetary Protection lab was established that currently has the capabilities of standard growth assays for spore or vegetative bacteria, rapid bioburden analysis that detects Adenosine Triphosphate (ATP), plus autoclave and DHMR verification. The cleanrooms are monitored both for vegetative microorganisms and by rapid ATP assay, and a clear difference in bioburden is observed between the aseptic the other cleanroom.

  16. Report of Two Cases of Aseptic Meningitis with Persistence of Pneumococcal Cell Wall Components in Cerebrospinal Fluid after Pneumococcal Meningitis▿

    PubMed Central

    Angoulvant, François; Lachenaud, Julie; Mariani-Kurkdjian, Patricia; Aubertin, Guillaume; Houdouin, Véronique; Lorrot, Mathie; de Los Angeles, Laure; Bingen, Edouard; Bourrillon, Antoine; Faye, Albert

    2006-01-01

    We describe two cases of aseptic meningitis occurring some time after pneumococcal meningitis. Both cases may have resulted from an inflammatory response to persistent pneumococcal cell membrane components, as the cerebrospinal fluid samples were positive by the Binax NOW Streptococcus pneumoniae antigen test. Potential mechanisms and diagnostic impact are discussed. PMID:17005744

  17. Complete Genome Sequence Analysis of Echovirus 18 Associated with Aseptic Meningitis in Hebei Province, China, in 2015

    PubMed Central

    Sun, Su-zhen; Guo, Jia-yun; Li, Jing-jie

    2016-01-01

    Echovirus 18 is a member of the genus Enterovirus, family Picornaviridae, which can cause meningitis in children. Here, we report the echovirus 18 complete genome sequence, which was isolated from the cerebrospinal fluid of a child with aseptic meningitis in Hebei Province, China. PMID:27789638

  18. Lupus cystitis in Korean patients with systemic lupus erythematosus: risk factors and clinical outcomes.

    PubMed

    Koh, J H; Lee, J; Jung, S M; Ju, J H; Park, S-H; Kim, H-Y; Kwok, S-K

    2015-10-01

    This study was performed to investigate the clinical characteristics of lupus cystitis and determine the risk factors and clinical outcomes of lupus cystitis in patients with systemic lupus erythematosus (SLE). We retrospectively reviewed 1064 patients at Seoul St. Mary's Hospital in Seoul, Korea, from 1998 to 2013. Twenty-four patients had lupus cystitis. Lupus cystitis was defined as unexplained ureteritis and/or cystitis as detected by imaging studies, cystoscopy, or bladder histopathology without urinary microorganisms or stones. Three-fourths of patients with lupus cystitis had concurrent lupus mesenteric vasculitis (LMV). The initial symptoms were gastrointestinal in nature for most patients (79.2%). High-dose methylprednisolone was initially administered to most patients (91.7%) with lupus cystitis. Two patients (8.3%) died of urinary tract infections. Sixty-five age- and sex-matched patients with SLE who were admitted with other manifestations were included as the control group. Patients with lupus cystitis showed a lower C3 level (p = 0.031), higher SLE Disease Activity Index score (p = 0.006), and higher ESR (p = 0.05) upon admission; more frequently had a history of LMV prior to admission (p < 0.001); and less frequently had a history of neuropsychiatric lupus (p = 0.031) than did patients with SLE but without lupus cystitis. The occurrence of lupus cystitis was associated with a history of LMV (OR, 21.794; 95% CI, 4.061-116.963). The median follow-up period was 3.4 years, and the cumulative one-year mortality rate was 20%. Complications developed in 33.3% of patients with lupus cystitis and were related to survival (log-rank p = 0.021). Our results suggest that the possibility of lupus cystitis should be considered when a patient with SLE and history of LMV presents with gastrointestinal symptoms or lower urinary tract symptoms. Development of complications in patients with lupus cystitis can be fatal. Thus, intensive treatment

  19. Central nervous system manifestations of neonatal lupus: a systematic review.

    PubMed

    Chen, C C; Lin, K-L; Chen, C-L; Wong, A May-Kuen; Huang, J-L

    2013-12-01

    Neonatal lupus is a rare and acquired autoimmune disease. Central nervous system abnormalities are potential manifestations in neonatal lupus. Through a systematic literature review, we analyzed the clinical features of previously reported neonatal lupus cases where central nervous system abnormalities had been identified. Most reported neonatal lupus patients with central nervous system involvement were neuroimaging-determined and asymptomatic. Only seven neonatal lupus cases were identified as having a symptomatic central nervous system abnormality which caused physical disability or required neurosurgery. A high percentage of these neurosymptomatic neonatal lupus patients had experienced a transient cutaneous skin rash and had no maternal history of autoimmune disease before pregnancy.

  20. Recurrent podocytopathy in a patient with systemic lupus erythematosus.

    PubMed

    Paramalingam, Shereen; Wong, Daniel D; Dogra, Gursharan K; Nossent, Johannes C

    2017-01-01

    Podocytopathy in systemic lupus erythematosus is characterised by diffuse foot process effacement without significant peripheral capillary wall immune deposits as seen on electron microscopy. Lupus podocytopathy falls outside the scope of the current International Society of Nephrology and the Renal Pathology Society classification of lupus nephritis. We present a case of relapsing podocytopathy with nephrotic syndrome occurring simultaneously with two extra-renal and serological disease flares, which makes it likely that podocytopathy was related to systemic lupus erythematosus activity. This case adds to the growing body of evidence that lupus podocytopathy must be considered in the differential diagnosis of systemic lupus erythematosus patients presenting with nephrotic syndrome.

  1. Recurrent podocytopathy in a patient with systemic lupus erythematosus

    PubMed Central

    Paramalingam, Shereen; Wong, Daniel D; Dogra, Gursharan K; Nossent, Johannes C

    2017-01-01

    Podocytopathy in systemic lupus erythematosus is characterised by diffuse foot process effacement without significant peripheral capillary wall immune deposits as seen on electron microscopy. Lupus podocytopathy falls outside the scope of the current International Society of Nephrology and the Renal Pathology Society classification of lupus nephritis. We present a case of relapsing podocytopathy with nephrotic syndrome occurring simultaneously with two extra-renal and serological disease flares, which makes it likely that podocytopathy was related to systemic lupus erythematosus activity. This case adds to the growing body of evidence that lupus podocytopathy must be considered in the differential diagnosis of systemic lupus erythematosus patients presenting with nephrotic syndrome. PMID:28321309

  2. Cystinosis and lupus erythematosus: coincidence or causation.

    PubMed

    Ahmad, Zahida P; Johnstone, Lilian M; Walker, Amanda M

    2010-08-01

    A 14-year-old boy with known stable cystinosis, treated with cysteamine since infancy, presented with a deterioration of renal function with haematuria in conjunction with a nodular rash, arthralgia, leucopenia, hypocomplementaemia and raised antinuclear antibodies. He was diagnosed with spontaneous onset of systemic lupus erythematosus (SLE), and his renal biopsy was consistent with lupus nephritis. It is unusual for patients with one severe disease to develop another disease process completely unrelated to their original condition, but it can occur. However, other distinct variants of lupus have been described, including drug-induced lupus (DIL), which have features that over-lap with SLE. The potential differential diagnosis of the SLE as a form of DIL in association with cysteamine is discussed.

  3. CO observations of dark clouds in Lupus

    NASA Technical Reports Server (NTRS)

    Murphy, D. C.; Cohen, R.; May, J.

    1986-01-01

    C-12O observations covering 170 square degrees toward the southern T Association Lupus have revealed the presence of an extended physically related complex of dark clouds which have recently formed low mass stars. The estimated mass of the clouds (about 30,000 solar masses) is comparable to that of the nearby Ophiuchus dust clouds. The Lupus clouds are projected onto a gap between two subgroups of the Scorpio-Centaurus OB association suggesting that this long accepted subgrouping may require reinterpretation.

  4. Mucormycosis complications in systemic lupus erythematosus.

    PubMed

    Arce-Salinas, C A; Pérez-Silva, E

    2010-07-01

    This case involved a 75-year-old woman with systemic lupus erythematosus. Two months previously, she had a flare that was treated successfully by increasing the dosages of prednisone and azathioprine. A sudden onset of ocular pain, diplopia, and loss of vision suggestive of optical neuritis or vascular involvement confused the issue, and rhinocerebral zygomycosis was demonstrated later. We review the presentations of this fungal infection in patients with systemic lupus erythematosus with emphasis on its initial features.

  5. Lupus mastitis: a mimicker of breast carcinoma

    PubMed Central

    Warne, Richard Roger; Taylor, Donna; Segal, Amanda; Irish, Ashley

    2011-01-01

    The authors present a case of lupus mastitis which was initially diagnosed following an incisional biopsy of a breast lump, with similar pathology found 2 years later after an ultrasound guided biopsy of the same lump. The woman had been diagnosed 7 years before with systemic lupus erythematosus. The radiological and pathological features are presented in this report with discussion of similar cases in the literature. PMID:22669997

  6. Targeting cancer with a lupus autoantibody.

    PubMed

    Hansen, James E; Chan, Grace; Liu, Yanfeng; Hegan, Denise C; Dalal, Shibani; Dray, Eloise; Kwon, Youngho; Xu, Yuanyuan; Xu, Xiaohua; Peterson-Roth, Elizabeth; Geiger, Erik; Liu, Yilun; Gera, Joseph; Sweasy, Joann B; Sung, Patrick; Rockwell, Sara; Nishimura, Robert N; Weisbart, Richard H; Glazer, Peter M

    2012-10-24

    Systemic lupus erythematosus (SLE) is distinct among autoimmune diseases because of its association with circulating autoantibodies reactive against host DNA. The precise role that anti-DNA antibodies play in SLE pathophysiology remains to be elucidated, and potential applications of lupus autoantibodies in cancer therapy have not previously been explored. We report the unexpected finding that a cell-penetrating lupus autoantibody, 3E10, has potential as a targeted therapy for DNA repair-deficient malignancies. We find that 3E10 preferentially binds DNA single-strand tails, inhibits key steps in DNA single-strand and double-strand break repair, and sensitizes cultured tumor cells and human tumor xenografts to DNA-damaging therapy, including doxorubicin and radiation. Moreover, we demonstrate that 3E10 alone is synthetically lethal to BRCA2-deficient human cancer cells and selectively sensitizes such cells to low-dose doxorubicin. Our results establish an approach to cancer therapy that we expect will be particularly applicable to BRCA2-related malignancies such as breast, ovarian, and prostate cancers. In addition, our findings raise the possibility that lupus autoantibodies may be partly responsible for the intrinsic deficiencies in DNA repair and the unexpectedly low rates of breast, ovarian, and prostate cancers observed in SLE patients. In summary, this study provides the basis for the potential use of a lupus anti-DNA antibody in cancer therapy and identifies lupus autoantibodies as a potentially rich source of therapeutic agents.

  7. Targeting cancer with a lupus autoantibody#

    PubMed Central

    Hansen, James E.; Chan, Grace; Liu, Yanfeng; Hegan, Denise C.; Dalal, Shibani; Dray, Eloise; Kwon, Youngho; Xu, Yuanyuan; Xu, Xiaohua; Peterson-Roth, Elizabeth; Geiger, Erik; Liu, Yilun; Gera, Joseph; Sweasy, Joann B.; Sung, Patrick; Rockwell, Sara; Nishimura, Robert N.; Weisbart, Richard H.; Glazer, Peter M.

    2013-01-01

    Systemic lupus erythematosus (SLE) is distinct among autoimmune diseases due to its association with circulating autoantibodies reactive against host DNA. The precise role that anti-DNA antibodies play in SLE pathophysiology remains to be elucidated, and potential applications of lupus autoantibodies in cancer therapy have not previously been explored. Here we report the unexpected finding that a cell-penetrating lupus autoantibody, 3E10, has potential as a targeted therapy for DNA-repair deficient malignancies. We find that 3E10 preferentially binds DNA single-strand tails, inhibits key steps in DNA single-strand and double-strand break repair, and sensitizes cultured tumor cells and human tumor xenografts to DNA-damaging therapy, including doxorubicin and radiation. Moreover, we demonstrate that 3E10 alone is synthetically lethal to BRCA2-deficient human cancer cells and selectively sensitizes such cells to low dose doxorubicin. Our results establish an approach to cancer therapy that we expect will be particularly applicable to BRCA2-related malignancies such as breast, ovarian, and prostate cancers. In addition, our findings raise the possibility that lupus autoantibodies may be partly responsible for the intrinsic deficiencies in DNA repair and the unexpectedly low rates of breast, ovarian, and prostate cancers observed in SLE patients. In summary, this study provides the basis for the potential use of a lupus anti-DNA antibody in cancer therapy and identifies lupus autoantibodies as a potentially rich source of therapeutic agents. PMID:23100628

  8. Renoprotective strategies in lupus nephritis: beyond immunosuppression.

    PubMed

    Griffin, B; Lightstone, L

    2013-10-01

    Lupus nephritis needs to be diagnosed promptly and treated specifically with appropriate immunosuppression. However, all patients with lupus nephritis have by definition chronic kidney disease (CKD) as they will have proteinuria with varying degrees of renal impairment. CKD requires careful additional management, not only to reduce the risk of progression to end-stage renal disease but also because it is probably the strongest risk for cardiovascular morbidity and mortality. This review focuses on the evidence underscoring strategies to prevent progression of CKD beyond the "simple" treatment of the lupus nephritis. The strategies include immaculate control of blood pressure, inhibition of the renin-angiotensin system to reduce blood pressure and proteinuria, and the benefits of lifestyle modifications such as tackling smoking, obesity and exercise. We also review the literature on control of dyslipidaemias which, although clearly of cardiovascular benefit, provide less compelling data for offering renoprotection. We touch on the emerging area of the importance of controlling urate levels in protecting against progressive renal impairment. Finally, there is a reminder about the importance of considering the nephrotoxicity of all medications prescribed for patients with lupus nephritis - above all the need to avoid the use of non-steroidal anti-inflammatory drugs. Overall, the theme is that there is much more to the management of patients with lupus nephritis than "just" the nephritis - a multidisciplinary approach involving nephrologists as well as rheumatologists is more likely to provide the appropriate wider care required for all patients with lupus nephritis.

  9. Hydroxychloroquine and pregnancy on lupus flares in Korean patients with systemic lupus erythematosus.

    PubMed

    Koh, J H; Ko, H S; Kwok, S-K; Ju, J H; Park, S-H

    2015-02-01

    We investigated the clinical and laboratory characteristics of pregnancies with systemic lupus erythematosus (SLE) and identified lupus flare predictors during pregnancy. Additionally, we examined lupus activity and pregnancy outcomes in SLE patients who continued, discontinued or underwent no hydroxychloroquine (HCQ) treatment during pregnancy. We retrospectively analyzed 179 pregnancies in 128 SLE patients at Seoul St. Mary's Hospital, Korea, between 1998 and 2012 and then assessed the clinical profiles and maternal and fetal outcomes. Overall, 90.5% of pregnancies resulted in a successful delivery and were divided into two groups: those who experienced lupus flares (80 pregnancies, 44.7%) and those who did not (99 pregnancies, 55.3%). Increased preeclampsia, preterm births, low birth weight, intrauterine growth restriction (IUGR), and low 1-minute Apgar scores occurred in pregnancies with lupus flares compared to pregnancies in quiescent disease. Lupus flares were predicted by HCQ discontinuation, a history of lupus nephritis, high pre-pregnancy serum uric acid and low C4 levels. Our study indicates that achieving pre-pregnancy remission and continuing HCQ treatment during pregnancy are important for preventing lupus flares.

  10. Lupus pneumonitis as the initial presentation of systemic lupus erythematosus: case series from a single institution.

    PubMed

    Wan, S A; Teh, C L; Jobli, A T

    2016-11-01

    Objective The aim of this study was to examine the clinical features, treatment and outcome of systemic lupus erythematosus (SLE) patients in our centre who presented with lupus pneumonitis as the initial manifestation. Methods We performed a retrospective review of all patients who presented with lupus pneumonitis during the initial SLE manifestation from March 2006 to March 2015. Results There were a total of five patients in our study who presented with fever and cough as the main clinical features. All patients had pulmonary infiltrates on chest radiographs. High-resolution computed tomography, which was performed in two patients, showed ground glass opacities with patchy consolidations bilaterally. All patients received high-dose steroids, 80% received intravenous cyclophosphamide and 60% received intravenous immunoglobulin. Two patients died from severe lupus pneumonitis within 2 weeks of admission despite treatment with ventilation, steroids, cyclophosphamide and intravenous immunoglobulin. Conclusions Acute lupus pneumonitis is an uncommon presentation of SLE. Mortality in this case series is 40%.

  11. A 12-year retrospective review of bullous systemic lupus erythematosus in cutaneous and systemic lupus erythematosus patients.

    PubMed

    Chanprapaph, K; Sawatwarakul, S; Vachiramon, V

    2017-01-01

    Objective The aim of this study was to investigate the clinical features, laboratory findings, systemic manifestations, treatment and outcome of patients with bullous systemic lupus erythematosus in a tertiary care center in Thailand. Methods We performed a retrospective review from 2002 to 2014 of all patients who fulfilled the diagnostic criteria for bullous systemic lupus erythematosus to evaluate for the clinical characteristics, extracutaneous involvement, histopathologic features, immunofluorescence pattern, serological abnormalities, internal organ involvement, treatments and outcome. Results Among 5149 patients with cutaneous lupus erythematosus and/or systemic lupus erythematosus, 15 developed vesiculobullous lesions. Ten patients had validation of the diagnosis of bullous systemic lupus erythematosus, accounting for 0.19%. Bullous systemic lupus erythematosus occurred after the diagnosis of systemic lupus erythematosus in six patients with a median onset of 2.5 months (0-89). Four out of 10 patients developed bullous systemic lupus erythematosus simultaneously with systemic lupus erythematosus. Hematologic abnormalities and renal involvement were found in 100% and 90%, respectively. Polyarthritis (40%) and serositis (40%) were less frequently seen. Systemic corticosteroids, immunosuppressants, antimalarials and dapsone offered resolution of cutaneous lesions. Conclusion Bullous systemic lupus erythematosus is an uncommon presentation of systemic lupus erythematosus. Blistering can occur following or simultaneously with established systemic lupus erythematosus. We propose that clinicians should carefully search for systemic involvement, especially hematologic and renal impairment, in patients presenting with bullous systemic lupus erythematosus.

  12. Spontaneous ureteral rupture in a patient with systemic lupus erythematosus

    SciTech Connect

    Benson, C.H.; Pennebaker, J.B.; Harisdangkul, V.; Songcharoen, S.

    1983-08-01

    A patient with known systemic lupus erythematosus had fever and symptoms of a lower urinary tract infection. Bone scintigraphy showed left ureteral perforation and necrosis with no demonstrable nephrolithiasis. It is speculated that this episode was due to lupus vasculitis.

  13. Lupus

    MedlinePlus

    ... Be careful with supplements Never take vitamins or herbal supplements without talking to your doctor first. They might ... you to take a vitamin for this reason. Herbal supplements have no proven benefit and can cause harm. ...

  14. Pauci-immune lupus nephritis: possibility or co-incidence?

    PubMed Central

    Cansu, Döndü Üsküdar; Temiz, Gökhan; Açıkalın, Mustafa F.; Korkmaz, Cengiz

    2017-01-01

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized with immune complex formation and renal involvement of lupus and may include several kinds of pathological conditions, but mostly, it is associated with immune complex-induced glomerular disease. Pauci-immune lupus nephritis is a very rare condition. We describe a 45-year-old female patient with pauci-immune crescentic necrotizing lupus nephritis and briefly discuss the possible mechanism and pathogenesis. PMID:28293460

  15. Lupus vulgaris: report of two cases.

    PubMed

    Wozniacka, Anna; Schwartz, Robert A; Sysa-Jedrzejowska, Anna; Borun, Marta; Arkuszewska, Cecylia

    2005-04-01

    Although there has been a steady decline in the incidence of tuberculosis in recent years, it persists in some regions, and where AIDS is especially prevalent, the number of new cases has been increasing. Thus, cutaneous tuberculosis has re-emerged in areas with a high incidence of HIV infection and multidrug-resistant pulmonary tuberculosis. Lupus vulgaris has been and remains the most common form of cutaneous tuberculosis. Cutaneous manifestations of disseminated tuberculosis are unusual, being seen in less than 0.5% of cases. Scrofuloderma, tuberculosis verrucosa cutis and lupus vulgaris comprise most cutaneous tuberculosis cases. Bacillus Calmette-Guerin (BCG) is derived from an attenuated strain of Mycobacterium bovis and is employed beneficially as a relatively safe vaccination in Poland and other countries in which the prevalence of tuberculosis is high. However, BCG vaccination may produce complications, including disseminated BCG and lupus vulgaris, the latter seen in one of our two patients in whom lupus vulgaris at the inoculation site followed a second vaccination with BCG 12 years after the initial one. A similar phenomenon has been described after immunotherapy with BCG vaccination. Re-infection (secondary) inoculation cutaneous tuberculosis may also occur as a result of BCG vaccination, producing either lupus vulgaris or tuberculosis verrucosa cutis, probably depending upon the patient's degree of cell-mediated immunity. However, most lupus vulgaris cases are not associated with vaccination with BCG, as occurred in our first patient. For those who do develop lupus vulgaris, it can be persistent for a long period, in some cases for many decades. In the second patient we describe a lengthy duration and cutaneous reactivation at distant sites after more than 40 years.

  16. Obstetric nephrology: lupus and lupus nephritis in pregnancy.

    PubMed

    Stanhope, Todd J; White, Wendy M; Moder, Kevin G; Smyth, Andrew; Garovic, Vesna D

    2012-12-01

    SLE is a multi-organ autoimmune disease that affects women of childbearing age. Renal involvement in the form of either active lupus nephritis (LN) at the time of conception, or a LN new onset or flare during pregnancy increases the risks of preterm delivery, pre-eclampsia, maternal mortality, fetal/neonatal demise, and intrauterine growth restriction. Consequently, current recommendations advise that the affected woman achieve a stable remission of her renal disease for at least 6 months before conception. Hormonal and immune system changes in pregnancy may affect disease activity and progression, and published evidence suggests that there is an increased risk for a LN flare during pregnancy. The major goal of immunosuppressive therapy in pregnancy is control of disease activity with medications that are relatively safe for a growing fetus. Therefore, the use of mycophenolate mofetil, due to increasing evidence supporting its teratogenicity, is contraindicated during pregnancy. Worsening proteinuria, which commonly occurs in proteinuric renal diseases toward the end of pregnancy, should be differentiated from a LN flare and/or pre-eclampsia, a pregnancy-specific condition clinically characterized by hypertension and proteinuria. These considerations present challenges that underscore the importance of a multidisciplinary team approach when caring for these patients, including a nephrologist, rheumatologist, and obstetrician who have experience with these pregnancy-related complications. This review discusses the pathogenesis, maternal and fetal risks, and management pertinent to SLE patients with new onset or a history of LN predating pregnancy.

  17. Pyomyositis in childhood-systemic lupus erythematosus.

    PubMed

    Blay, Gabriela; Ferriani, Mariana P L; Buscatti, Izabel M; França, Camila M P; Campos, Lucia M A; Silva, Clovis A

    2016-01-01

    Pyomyositis is a pyogenic infection of skeletal muscle that arises from hematogenous spread and usually presents with localized abscess. This muscle infection has been rarely reported in adult-onset systemic lupus erythematous and, to the best of our knowledge, has not been diagnosed in pediatric lupus population. Among our childhood-onset systemic lupus erythematous population, including 289 patients, one presented pyomyositis. This patient was diagnosed with childhood-onset systemic lupus erythematous at the age of 10 years-old. After six years, while being treated with prednisone, azathioprine and hydroxychloroquine, she was hospitalized due to a 30-day history of insidious pain in the left thigh and no apparent trauma or fever were reported. Her physical examination showed muscle tenderness and woody induration. Laboratory tests revealed anemia, increased acute phase reactants and normal muscle enzymes. Computer tomography of the left thigh showed collection on the middle third of the vastus intermedius, suggesting purulent stage of pyomyositis. Treatment with broad-spectrum antibiotic was initiated, leading to a complete clinical resolution. In conclusion, we described the first case of pyomyositis during childhood in pediatric lupus population. This report reinforces that the presence of localized muscle pain in immunocompromised patients, even without elevation of muscle enzymes, should raise the suspicion of pyomyositis. A prompt antibiotic therapy is strongly recommended.

  18. PKK deficiency in B cells prevents lupus development in Sle lupus mice.

    PubMed

    Oleksyn, D; Zhao, J; Vosoughi, A; Zhao, J C; Misra, R; Pentland, A P; Ryan, D; Anolik, J; Ritchlin, C; Looney, J; Anandarajah, A P; Schwartz, G; Calvi, L M; Georger, M; Mohan, C; Sanz, I; Chen, L

    2017-03-06

    Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by the production of autoantibodies that can result in damage to multiple organs. It is well documented that B cells play a critical role in the development of the disease. We previously showed that protein kinase C associated kinase (PKK) is required for B1 cell development as well as for the survival of recirculating mature B cells and B-lymphoma cells. Here, we investigated the role of PKK in lupus development in a lupus mouse model. We demonstrate that the conditional deletion of PKK in B cells prevents lupus development in Sle1Sle3 mice. The loss of PKK in Sle mice resulted in the amelioration of multiple classical lupus-associated phenotypes and histologic features of lupus nephritis, including marked reduction in the levels of serum autoantibodies, proteinuria, spleen size, peritoneal B-1 cell population and the number of activated CD4 T cells. In addition, the abundance of autoreactive plasma cells normally seen in Sle lupus mice was also significantly decreased in the PKK-deficient Sle mice. Sle B cells deficient in PKK display defective proliferation responses to BCR and LPS stimulation. Consistently, B cell receptor-mediated NF-κB activation, which is required for the survival of activated B cells, was impaired in the PKK-deficient B cells. Taken together, our work uncovers a critical role of PKK in lupus development and suggests that targeting the PKK-mediated pathway may represent a promising therapeutic strategy for lupus treatment.

  19. A case of cerebral salt-wasting syndrome associated with aseptic meningitis in an 8-year-old boy.

    PubMed

    Inatomi, Jun; Yokoyama, Yoshiki; Sekine, Takashi; Igarashi, Takashi

    2008-04-01

    Cerebral salt-wasting syndrome is a disorder in which excessive natriuresis and subsequent hyponatremic dehydration occur in patients with intracranial diseases. Cerebral salt-wasting syndrome often develops in patients with severe neurosurgical disorders, such as hydrocephalus, cerebral infarction, and tuberculous meningitis. Here, we report on the case of an 8-year-old boy with cerebral salt-wasting syndrome associated with aseptic meningitis. He showed mild developmental retardation and had a history of convulsion. Four days after his admission, cerebral salt-wasting syndrome abruptly started: natriuresis and hyponatremia gradually improved over 10 days. To the best of our knowledge, this is the first report on cerebral salt-wasting syndrome associated with clinically benign aseptic meningitis.

  20. Vitrification of human laser treated blastocysts within cut standard straws (CSS): novel aseptic packaging and reduced concentrations of cryoprotectants.

    PubMed

    Isachenko, Vladimir; Katkov, Igor I; Yakovenko, Sergey; Lulat, Ayub G-M I; Ulug, Murat; Arvas, Ayse; Isachenko, Evgenia

    2007-06-01

    Vitrification of laser treated human blastocysts using reduced concentrations of permeable cryoprotectants was carried out by submerging cut standard straws (CSS) into liquid nitrogen. The CSS were made by cutting a standard 0.25 ml straw at an angle of approximately 45 degrees . After laser assisted hatching, 6 day blastocysts (n=250) were loaded into droplets of approximately 0.75 microl in the CSS and were either plunged directly into liquid nitrogen or first encased in a standard 0.5 ml straw (aseptic technique) before being vitrified. Permeable cryoprotectants (ethylene glycol+Me(2)SO) at concentrations of 15% and 20% v:v were tested for their effect on post warming re-expansion and post transfer pregnancy rates. Our results indicate that the use of reduced concentrations of cryoprotectants and aseptic packaging of blastocysts did not have any statistically significant impact on the study outcomes.

  1. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature

    PubMed Central

    Scaffidi, Michael A.; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon. PMID:28265555

  2. Aseptic colon resection by an invagination technique. Experimental study on dogs.

    PubMed

    Jørgensen, L S; Raundahl, U; Knudsen, L L; Aksglaede, K; Søgaard, P

    1991-07-01

    A new aseptic colon resection by an invagination technique is presented. The bowel to be resected is invaginated down into the healthy intestine, and the anastomosis is sutured in one layer of continuous suture before transection by a diathermy wire, placed in the intestinal lumen via the anus. Sections of bowel that cannot be invaginated, e.g., because of a tumor, are first removed by transection between pairs of cable ties, which close the lumen. Twenty dogs were operated on without receiving prophylactic antibiotics. In 10, the intestine was transected between cable ties. An imprint, taken from the anastomosis and subcutis, was cultured. The bacterial count at the anastomosis exceeded 100 in only three cases; in the subcutis, this was the case in one dog. One wound infection developed. Serial barium enemas at 1, 2, 3, and 4 weeks revealed no anastomotic leakage. One early death because of a total anastomotic dehiscence was encountered, and two dogs were killed because of wound dehiscence and anastomotic stricture, respectively. It is concluded that, in dogs, the method is easily and safely performed, but further experimental studies are needed.

  3. Aseptic Abscesses and Inflammatory Bowel Disease: Two Cases and Review of Literature.

    PubMed

    Bollegala, Natasha; Khan, Rishad; Scaffidi, Michael A; Al-Mazroui, Ahmed; Tessolini, Jenna; Showler, Adrienne; Colak, Errol; Grover, Samir C

    2017-01-01

    Background. Aseptic abscesses (AA) are sterile lesions that represent an extraintestinal manifestation (EIM) of inflammatory bowel disease (IBD). Though Canada has the highest prevalence of IBD in the world, reports of IBD-associated AA are absent in Canada. This may represent a different IBD phenotype or underrecognition and underreporting. Purpose. To explore AA as a possible EIM of IBD and evaluate clinical and investigative findings among patients with IBD-associated AA. Methods. Retrospective chart and literature reviews were performed to find cases of IBD-associated AA at our institution and in the literature. Results. We identified 2 cases of IBD-associated AA in our institution. Both patients had ulcerative colitis and presented with fever, abdominal pain, and weight loss. Radiological workup and aspiration showed sterile splenic abscesses. The AA were unresponsive to antibiotics. One patient improved on corticosteroids and one underwent splenectomy. We retrieved 37 cases of IBD-associated AA from the literature. All patients showed no evidence of infection, failed to resolve with antibiotics, and, if attempted, improved on corticosteroids. Conclusions. Our cases are the first reported in Canada. They support literature which suggests AA as an EIM of IBD and may help increase recognition and reporting of this phenomenon.

  4. [Clinical, epidemiological and etiological studies of adult aseptic meningitis: Report of 13 cases with mumps meningitis].

    PubMed

    Takeshima, Shinichi; Yoshimoto, Takeshi; Shiga, Yuji; Kanaya, Yuhei; Neshige, Shuichiro; Himeno, Takahiro; Kono, Ryuhei; Takamatsu, Kazuhiro; Shimoe, Yutaka; Kuriyama, Masaru

    2015-01-01

    We experienced 13 cases (29.8 ± 7.0 years) of mumps meningitis and 365 cases of adult aseptic meningitis during 11 years from 2004 to 2014. A small epidemic of mumps occurred for 3-4 years, and the incidence rate of adult mumps meningitis coincided with the epidemic without seasonal fluctuation. Parotitis was observed in 8 of the 13 mumps meningitis patients (61.5%) and orchitis in 2 of 7 male patients (28.6%). There were no differences in clinical manifestations, laboratory findings, and outcome between patients with adult mumps meningitis and those with echovirus 9 meningitis (9 patients), except for the low frequency of nausea/vomiting and a high percentage of mononuclear cells of the cerebrospinal fluid in those with mumps. Eight patients had contact with persons with mumps before the symptomatic stage of meningitis. Only one patient had received mumps vaccination in childhood. On the basis of the values of the anti-mumps IgM and IgG antibodies, we speculated primary infection and the re-infection of mumps in 6 and 2 patients, respectively. Moreover, second vaccine failure was suggested in the vaccinated patient.

  5. Molecular phylogeny and surface morphology of marine aseptate gregarines (Apicomplexa): Selenidium spp. and Lecudina spp.

    PubMed

    Leander, B S; Harper, J T; Keeling, P J

    2003-12-01

    Many aseptate gregarines from marine invertebrate hosts are thought to have retained several plesiomorphic characteristics and are instrumental in understanding the early evolution of intracellular parasitism in apicomplexans and the phylogenetic position of cryptosporidians. We sequenced the small-subunit (SSU) ribosomal RNA genes from 2 archigregarines, Selenidium terebellae and Selenidium vivax, and 2 morphotypes of the marine eugregarine Lecudina polymorpha. We also used scanning electron microscopy to investigate the surface morphology of trophozoites from Lecudina tuzetae, Monocystis agilis, the 2 species of Selenidium, and the 2 morphotypes of L. polymorpha. The SSU ribosomal DNA sequences from S. vivax and L. polymorpha had long branch lengths characteristic of other gregarine sequences. However, the sequence from S. terebellae was not exceptionally divergent and consistently emerged as 1 of the earliest 'true' gregarines in phylogenetic analyses. Statistical support for the sister relationship between Cryptosporidium spp. and gregarines was significantly bolstered in analyses including the sequence from S. terebellae but excluding the longest branches in the alignment. Eugregarines formed a monophyletic group with the neogregarine Ophryocystis, suggesting that trophozoites with elaborate cortex folds and gliding motility evolved only once. The trophozoites from the 2 species of Selenidium shared novel transverse striations but differed from one another in overall cell morphologies and writhing behavior.

  6. Bilateral non-traumatic aseptic osteonecrosis in the femoral head. An experimental study of incidence

    SciTech Connect

    Hauzeur, J.P.; Pasteels, J.L.; Orloff, S.

    1987-10-01

    Thirty-five patients who were seen with non-traumatic aseptic osteonecrosis of the femoral head were included in a study of the contralateral hip to evaluate the incidence of bilateral disease. We used not only conventional radiography and scintigraphy but also measurement of intramedullary pressure and core biopsy. Pain was caused by 14.3 per cent of the contralateral hips, a lesion was demonstrated on plain radiographs in 51.4 per cent, and increased isotopic uptake was seen in 31.4 per cent. Histological study of specimens obtained by osteomedullary biopsy (after special procedure) showed bilateral necrosis in 88.5 per cent of the patients. After a mean follow-up of thirty-four months, only one of nine hips that were painless and had negative radiographic and isotopic findings, but had positive findings on biopsy, became painful and radiographically positive. The intramedullary pressure in the intertrochanteric area was recorded in each hip, and no correlation was found with the radiographic stage or with pain.

  7. Growth and colour development of some surface ripening bacteria with Debaryomyces hansenii on aseptic cheese curd.

    PubMed

    Mounier, Jérôme; Irlinger, Françoise; Leclercq-Perlat, Marie-Noëlle; Sarthou, Anne-Sophie; Spinnler, Henry-Eric; Fitzgerald, Gerald F; Cogan, Timothy M

    2006-11-01

    The growth of five bacteria isolated from red-smear cheeses, Brevibacterium aurantiacum, Corynebacterium casei, Corynebacterium variabile, Microbacterium gubbeenense and Staphylococcus saprophyticus in mixed cultures with Debaryomyces hansenii on aseptic model cheese curd at 10 and 14 degrees C was investigated. At both temperatures, C. casei and Micro. gubbeenense had a longer lag phase than C. variabile, Brevi. aurantiacum and Staph. saprophyticus. In all cultures, lactose was utilised first and was consumed more rapidly at 14 degrees C than at 10 degrees C, i.e., 6 d at 14 degrees C and 10 d at 10 degrees C. This utilisation coincided with the exponential growth of Deb. hansenii on the cheese surface. Lactate was also used as a carbon source and was totally consumed after 21 d at 14 degrees C and approximately 90% was consumed after 21 d at 10 degrees C regardless of the ripening culture. Small differences (<0.5 pH unit) in the surface-pH during ripening were noticeable between ripening cultures. Differences in the colour development of the mixed cultures with the yeast control were only noticeable after 15 d for Brevi. aurantiacum and after 21 d for the other bacteria. Regardless of the organisms tested, colour development and colour intensity were also greater at 14 degrees C than at 10 degrees C. This study has provided useful information on the growth and contribution to colour development of these bacteria on cheese.

  8. Adhesion molecules in gonarthrosis and knee prosthesis aseptic loosening follow-up: possible therapeutic implications.

    PubMed

    Dambra, P; Loria, M P; Moretti, B; D'Oronzio, L; Patella, V; Pannofino, A; Cavallo, E; Pesce, V; Dell'Osso, A; Simone, C

    2003-05-01

    The involvement of the synovium is common in phlogistic processes of various joint diseases. Apart from synoviocytes and the other cells in the synovial tissue, circulating cells recruited from peripheral blood also participate in the phlogistic process. The increased expression of adhesion molecules on both circulating and endothelial cell surface may further this recruitment. We studied 15 patients affected by serious gonarthrosis requiring a prosthetic implant (GPI) and 7 with knee prosthesis aseptic loosening (KPL) to evaluate adhesion molecule expression and phlogistic infiltration in the synovium using immunohistochemistry and microscopic analysis. As control we studied 10 subjects affected by degenerative meniscopathies undergoing a selective arthroscopic surgical meniscectomy. Analysis with Kruskal-Wallis test showed no statistical significant differences in the expression of CD54, CD11a, CD11b and CD18 in three groups examined. The model of variance analysis (Friedman test), showed that CD54 expression is greater in patients with GPI and KPL in comparison with the other molecules. Adhesion molecules and their functions are important in arthropathies not only because their evaluation can allow us to identify the degree of inflammation and to predict its evolution, but also because pharmacological control of their expression could have important therapeutic implications.

  9. Iron Supplementation Effects on Redox Status following Aseptic Skeletal Muscle Trauma in Adults and Children

    PubMed Central

    Tsiokanos, Athanasios; Georgakouli, Kalliopi; Zalavras, Athanasios; Avloniti, Alexandra; Koutedakis, Yiannis

    2017-01-01

    Exercise-induced skeletal muscle microtrauma is characterized by loss of muscle cell integrity, marked aseptic inflammatory response, and oxidative stress. We examined if iron supplementation would alter redox status after eccentric exercise. In a randomized, double blind crossover study, that was conducted in two cycles, healthy adults (n = 14) and children (n = 11) received daily either 37 mg of elemental iron or placebo for 3 weeks prior to and up to 72 h after an acute eccentric exercise bout. Blood was drawn at baseline, before exercise, and 72 h after exercise for the assessment of iron status, creatine kinase activity (CK), and redox status. Iron supplementation at rest increased iron concentration and transferrin saturation (p < 0.01). In adults, CK activity increased at 72 h after exercise, while no changes occurred in children. Iron supplementation increased TBARS at 72 h after exercise in both adults and children; no changes occurred under placebo condition. Eccentric exercise decreased bilirubin concentration at 72 h in all groups. Iron supplementation can alter redox responses after muscle-damaging exercise in both adults and children. This could be of great importance not only for healthy exercising individuals, but also in clinical conditions which are characterized by skeletal muscle injury and inflammation, yet iron supplementation is crucial for maintaining iron homeostasis. This study was registered at Clinicaltrials.gov Identifier: NCT02374619. PMID:28203319

  10. Periorbital discoid lupus: a rare localization in a patient with systemic lupus erythematosus*

    PubMed Central

    Cakici, Ozgur; Karadag, Remzi; Bayramlar, Huseyin; Ozkanli, Seyma; Uzuncakmak, Tugba Kevser; Karadag, Ayse Serap

    2016-01-01

    A 40-year-old female patient with a 5-year history of systemic lupus erythematosus was referred to our policlinic with complaints of erythema, atrophy, and telangiectasia on the upper eyelids for 8 months. No associated mucocutaneous lesion was present. Biopsy taken by our ophthalmology department revealed discoid lupus erythematosus. Topical tacrolimus was augmented to the systemic therapeutic regimen of the patient, which consisted of continuous antimalarial treatment and intermittent corticosteroid drugs. We observed no remission in spite of the 6-month supervised therapy. Periorbital discoid lupus erythematosus is very unusual and should be considered in the differential diagnosis of erythematous lesions of the periorbital area.. PMID:28300917

  11. Periorbital discoid lupus: a rare localization in a patient with systemic lupus erythematosus.

    PubMed

    Cakici, Ozgur; Karadag, Remzi; Bayramlar, Huseyin; Ozkanli, Seyma; Uzuncakmak, Tugba Kevser; Karadag, Ayse Serap

    2016-01-01

    A 40-year-old female patient with a 5-year history of systemic lupus erythematosus was referred to our policlinic with complaints of erythema, atrophy, and telangiectasia on the upper eyelids for 8 months. No associated mucocutaneous lesion was present. Biopsy taken by our ophthalmology department revealed discoid lupus erythematosus. Topical tacrolimus was augmented to the systemic therapeutic regimen of the patient, which consisted of continuous antimalarial treatment and intermittent corticosteroid drugs. We observed no remission in spite of the 6-month supervised therapy. Periorbital discoid lupus erythematosus is very unusual and should be considered in the differential diagnosis of erythematous lesions of the periorbital area..

  12. Breast cancer in systemic lupus.

    PubMed

    Bernatsky, S; Ramsey-Goldman, R; Petri, M; Urowitz, M B; Gladman, D D; Fortin, P F; Ginzler, E; Romero-Diaz, J; Peschken, C; Jacobsen, S; Hanly, J G; Gordon, C; Nived, O; Yelin, E H; Isenberg, D; Rahman, A; Bae, S-C; Joseph, L; Witte, T; Ruiz-Irastorza, G; Aranow, C; Kamen, D; Sturfeldt, G; Foulkes, W D; Hansen, J E; St Pierre, Y; Raymer, P Chrétien; Tessier-Cloutier, B; Clarke, A E

    2017-03-01

    Objective There is a decreased breast cancer risk in systemic lupus erythematosus (SLE) versus the general population. We assessed a large sample of SLE patients, evaluating demographic and clinical characteristics and breast cancer risk. Methods We performed case-cohort analyses within a multi-center international SLE sample. We calculated the breast cancer hazard ratio (HR) in female SLE patients, relative to demographics, reproductive history, family history of breast cancer, and time-dependent measures of anti-dsDNA positivity, cumulative disease activity, and drugs, adjusted for SLE duration. Results There were 86 SLE breast cancers and 4498 female SLE cancer-free controls. Patients were followed on average for 7.6 years. Versus controls, SLE breast cancer cases tended to be white and older. Breast cancer cases were similar to controls regarding anti-dsDNA positivity, disease activity, and most drug exposures over time. In univariate and multivariate models, the principal factor associated with breast cancers was older age at cohort entry. Conclusions There was little evidence that breast cancer risk in this SLE sample was strongly driven by any of the clinical factors that we studied. Further search for factors that determine the lower risk of breast cancer in SLE may be warranted.

  13. Periodontitis and systemic lupus erythematosus.

    PubMed

    Sete, Manuela Rubim Camara; Figueredo, Carlos Marcelo da Silva; Sztajnbok, Flavio

    2016-01-01

    A large number of studies have shown a potential association between periodontal and autoimmune diseases, such as rheumatoid arthritis and systemic lupus erythematosus (SLE). Similar mechanisms of tissue destruction concerning periodontitis and other autoimmune diseases have stimulated the study of a possible relationship between these conditions. This study aims to review the literature about this potential association and their different pathogenic mechanisms. Considering that periodontal disease is a disease characterized by inflammation influenced by infectious factors, such as SLE, it is plausible to suggest that SLE would influence periodontal disease and vice versa. However, this issue is not yet fully elucidated and several mechanisms have been proposed to explain this association, as deregulation mainly in innate immune system, with action of phagocytic cells and proinflammatory cytokines such as IL-1β and IL-18 in both conditions' pathogenesis, leading to tissue destruction. However, studies assessing the relationship between these diseases are scarce, and more studies focused on common immunological mechanisms should be conducted to further understanding.

  14. Cutaneous lupus erythematosus: An update

    PubMed Central

    Grönhagen, Carina M; Nyberg, Filippa

    2014-01-01

    Lupus erythematosus (LE) is a chronic, autoimmune, multisystem disease that displays many diverse symptoms in which localized cutaneous LE (CLE) is on one end of the spectrum and severe systemic LE (SLE) on the other end. The underlying cause of LE is unknown but the etiology is thought to be multifactorial and polygenic. CLE is a disfiguring, chronic skin disease, with a significant impact on the patients’ everyday life. CLE are further divided into three main subsets: Acute CLE (ACLE), subacute CLE (SCLE) and chronic CLE (CCLE), where classic discoid LE (DLE) is the most common form. These subsets are defined by clinical symptoms, average duration of symptoms and histological and serological findings, although, the three subtypes can have overlapping clinical features. CLE patients display well-defined skin lesions, often in sun-exposed areas. The disease often has a chronic and relapsing course that can be induced or aggravated by UV light. It is important to confirm a CLE diagnosis histopathologically by a biopsy and in that there are several differential diagnoses and because CLE is a chronic disease in which regular follow-up is important and systemic treatment is sometimes indicated. PMID:24616847

  15. Biomarkers for CNS involvement in pediatric lupus

    PubMed Central

    Rubinstein, Tamar B; Putterman, Chaim; Goilav, Beatrice

    2015-01-01

    CNS disease, or central neuropsychiatric lupus erythematosus (cNPSLE), occurs frequently in pediatric lupus, leading to significant morbidity and poor long-term outcomes. Diagnosing cNPSLE is especially difficult in pediatrics; many current diagnostic tools are invasive and/or costly, and there are no current accepted screening mechanisms. The most complicated aspect of diagnosis is differentiating primary disease from other etiologies; research to discover new biomarkers is attempting to address this dilemma. With many mechanisms involved in the pathogenesis of cNPSLE, biomarker profiles across several modalities (molecular, psychometric and neuroimaging) will need to be used. For the care of children with lupus, the challenge will be to develop biomarkers that are accessible by noninvasive measures and reliable in a pediatric population. PMID:26079959

  16. Cutaneous lupus erythematosus in skin of color.

    PubMed

    Nozile, Wallace; Adgerson, Cheri N; Cohen, George F

    2015-04-01

    Cutaneous Lupus Erythematosus (CLE) is a common manifestation in patients with Systemic Lupus Erythematosus. In a significant population of patients, CLE is the predominant feature and, in some cases, patients suffer from cutaneous disease alone. Chronic Cutaneous Lupus Erythematosus (CCLE) is a scarring subtype, more prevalent in blacks. Patients with skin of color may pose a challenge to physicians due to exaggerated cutaneous findings and increased risk of post-inflammatory hyperpigmentation and hypertrophic scarring. With the demographics of the United States rapidly shifting towards a greater population of non-Caucasian racial and ethnic groups, it is imperative that we expand on the limited research into molecular variation, clinical presentation, and therapeutic efficacy in CLE. The purpose of this review is to bring attention to the unique and severe aspects of CLE in persons of color, which calls for early and aggressive treatment.

  17. Antiphospholipid syndrome nephropathy in systemic lupus erythematosus.

    PubMed

    Daugas, Eric; Nochy, Dominique; Huong, Du Le Thi; Duhaut, Pierre; Beaufils, Hélène; Caudwell, Valérie; Bariety, Jean; Piette, Jean-Charles; Hill, Gary

    2002-01-01

    In the course of the antiphospholipid syndrome (APS), the existence of vaso-occlusive lesions capable of affecting numerous organs is now well established. The renal involvement attributable to primary APS, APS nephropathy (APSN), corresponds to vaso-occlusive lesions of the intrarenal vessels, associating side-by-side, acute thromboses with chronic arterial and arteriolar lesions, leading to zones of cortical ischemic atrophy. A retrospective study of 114 lupus patients undergoing renal biopsy was undertaken to determine the following: (1) if APSN can be found in the course of systemic lupus erythematosus (SLE); (2) if certain clinical and biologic factors can permit the prediction of the presence of APSN; and (3) if APSN is a superadded renal morbidity factor in lupus patients. This study shows the following: (1) APSN occurs in SLE (32% of patients with renal biopsies) in addition to, and independently of, lupus nephritis; (2) APSN is statistically associated with lupus anticoagulant but not with anticardiolipin antibodies; (3) APSN is associated with extrarenal APS, mainly arterial thromboses and obstetrical fetal loss, but not with the venous thromboses of APS; (4) APSN is an independent risk factor, over and above lupus nephritis, that contributes to an elevated prevalence of hypertension, elevated serum creatinine, and increased interstitial fibrosis. Thus, it seems likely that, because of its associations with hypertension, elevated serum creatinine, and increased interstitial fibrosis, APSN may worsen the prognosis in these patients. APSN may also have therapeutic significance in that its recognition should permit a better balance between immunosuppressor and antithrombotic and/or vasoprotective therapy. Finally, this study suggests that APSN should be considered as an element to be included in the classification criteria of APS.

  18. Shining light on lupus and UV.

    PubMed

    Kuechle, Melanie K; Elkon, Keith B

    2007-01-01

    People exposed to sunlight can develop erythema, DNA damage, and photoimmunosupression. Extended exposure of normal epidermis to sunlight will induce dysmorphic keratinocytes with pyknotic nuclei scattered throughout the spinous layer. These 'sunburn cells' are apoptotic keratinocytes and are usually cleared within 48 hours after sunburn. Patients with lupus erythematosus, however, whether it be the discoid, subacute cutaneous, systemic, or tumid form, develop new cutaneous lesions and can experience systemic worsening of their disease. Are sunlight-induced keratinocyte apoptosis and the immune response to these cells abnormal in lupus patients?

  19. Systemic lupus erythematosus: Is it one disease?

    PubMed

    Rivas-Larrauri, Francisco; Yamazaki-Nakashimada, Marco Antonio

    2016-01-01

    Systemic lupus erythematosus (SLE) is a multisystemic disease with a variety of clinical presentations. Monogenic predisposing conditions to the development of this disease have been described. As examples, an impaired expression of interferon-α regulated genes or complement deficiencies have been reported in patients with SLE, with particular clinical presentations. Those defects present particular presentations and a different severity, making an argument that lupus is not a single disease but many. Treatment could be individualized depending on the underlying defect generating the subtype of the disease.

  20. Lupus vulgaris: unusual presentations over the face.

    PubMed

    Khandpur, S; Reddy, B S N

    2003-11-01

    Lupus vulgaris (LV) is the most common morphological variant of cutaneous tuberculosis. However, the occurrence of bizarre clinical presentations over atypical sites often leads to misdiagnosis and inappropriate treatment causing significant morbidity. This report seeks to highlight two unusual cases of lupus vulgaris occurring on the face of immunocompetent women and remarkably mimicking periorbital cellulitis and basal cell carcinoma, respectively. The diagnosis was confirmed by histopathology, an enzyme-linked immunosorbent assay (ELISA) test for Mycobacterium tuberculosis and polymerase chain reaction (PCR). With four-drug antitubercular therapy, both patients had a dramatic response.

  1. Transmission of seasonal outbreak of childhood enteroviral aseptic meningitis and hand-foot-mouth disease.

    PubMed

    Park, Sue K; Park, Boyoung; Ki, Moran; Kim, Ho; Lee, Kwan; Jung, Cheoll; Sohn, Young Mo; Choi, Sung-Min; Kim, Doo-Kwun; Lee, Dong Seok; Ko, Joon Tae; Kim, Moon Kyu; Cheong, Hae-Kwan

    2010-05-01

    This study was conducted to evaluate the modes of transmission of aseptic meningitis (AM) and hand-foot-mouth disease (HFMD) using a case-control and a case-crossover design. We recruited 205 childhood AM and 116 HFMD cases and 170 non-enteroviral disease controls from three general hospitals in Gyeongju, Pohang, and Seoul between May and August in both 2002 and 2003. For the case-crossover design, we established the hazard and non-hazard periods as week one and week four before admission, respectively. In the case-control design, drinking water that had not been boiled, not using a water purifier, changes in water quality, and contact with AM patients were significantly associated with the risk of AM (odds ratio [OR]=2.8, 2.9, 4.6, and 10.9, respectively), while drinking water that had not been boiled, having a non-water closet toilet, changes in water quality, and contact with HFMD patients were associated with risk of HFMD (OR=3.3, 2.8, 6.9, and 5.0, respectively). In the case-crossover design, many life-style variables such as contact with AM or HFMD patients, visiting a hospital, changes in water quality, presence of a skin wound, eating out, and going shopping were significantly associated with the risk of AM (OR=18.0, 7.0, 8.0, 2.2, 22.3, and 3.0, respectively) and HFMD (OR=9.0, 37.0, 11.0, 12.0, 37.0, and 5.0, respectively). Our findings suggest that person-to-person contact and contaminated water could be the principal modes of transmission of AM and HFMD.

  2. Evaluation of disinfecting procedures for aseptic transfer in hospital pharmacy departments.

    PubMed

    Mehmi, Manita; Marshall, Lindsay J; Lambert, Peter A; Smith, Julian C

    2009-01-01

    Current practice in National Health Service (NHS) hospitals employs 70% Industrial Methylated Spirit spray for surface disinfection of components required in Grade A pharmaceutical environments. This study seeks to investigate other agents and procedures that may provide more effective sanitisation. Several methods are available to test the efficacy of disinfectants against vegetative organisms. However, no methods currently available test the efficacy of disinfectants against spores on the hard surfaces encountered in the pharmacy aseptic processing environment. Therefore, a method has been developed to test the efficacy of disinfectants against spores, modified from British Standard 13697 and Association of Analytical Chemists standards. The testing procedure was used to evaluate alternative biocides and disinfection methods for transferring components into hospital pharmacy cleanrooms, and to determine which combinations of biocide and application method have the greatest efficacy against spores of Bacillus subtilis subspecies subtilis 168, Bacillus subtilis American Type Culture Collection (ATCC) 6633, and Bacillus pumilis ATCC 27142. Stainless steel carrier test plates were used to represent the hard surfaces in hospital pharmacy cleanrooms. Plates were inoculated with 10(7)-10(8) colony-forming units per milliliter (CFU/mL) and treated with the various biocide formulations, using different disinfection methods. Sporicidal activity was calculated as log reduction in CFU. Of the biocides tested, 6% hydrogen peroxide and a quaternary ammonium compound/chlorine dioxide combination were most effective compared to a Quat/biguanide, amphoteric surfactant, 70% v/v ethanol in deionised water and isopropyl alcohol in water for injection. Of the different application methods tested, spraying followed by wiping was the most effective, followed closely by wiping alone. Spraying alone was least effective.

  3. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive.

  4. Characteristics of pleural effusions in systemic lupus erythematosus: differential diagnosis of lupus pleuritis.

    PubMed

    Choi, B Y; Yoon, M J; Shin, K; Lee, Y J; Song, Y W

    2015-03-01

    We investigated the clinical characteristics of pleural effusion in systemic lupus erythematosus (SLE). A prospective analysis of 17 SLE patients with pleural effusion (seven lupus pleuritis, eight transudative effusions and two parapneumonic effusions) was performed. Thirty non-SLE patients with pleural effusion were recruited as controls. A pleural fluid ANA titer ≥1:160 was found in 8/17 (47.1%) SLE patients and none of the 30 non-SLE patients (p = 0.0001). Pleural fluid to serum C3 ratios were significantly lower in SLE than in non-SLE (median (minimum-maximum) 0.29 (0.03-0.43) versus 0.52 (0.26-0.73), p = 0.0002). Among SLE patients, pleural fluid ANA titers ≥1:160 were more frequently found in patients with lupus pleuritis than in those with pleural effusion from causes other than lupus itself (85.7% versus 20.0%, p = 0.0152). Serum CRP levels were significantly increased in patients with lupus pleuritis compared with SLE patients with transudative pleural effusion (2.30 (0.30-5.66) versus 0.7 (0.12-1.47) mg/dl, p = 0.0062). In conclusion, pleural fluid ANA titer and serum CRP levels are significantly increased in lupus pleuritis.

  5. [Case of lupus vasculopathy associated with lupus nephritis class IV-G (A)].

    PubMed

    Eguchi, Eriko; Shimazu, Keiji; Takaori, Kouji; Nishiguchi, Kensuke; Mori, Keita; Yorifuji, Soushi; Murakami, Toru; Koshikawa, Masao; Tanaka, Atsuo; Kuwahara, Takashi

    2010-01-01

    Various renal vascular lesions are complicated with systemic lupus erythematosus (SLE), and are often overlooked in the actual renal biopsy specimen. We report a case of biopsy-proven lupus vasculopathy, with lupus nephritis class IV-G (A). She developed SLE at 15 years of age, and was treated with prednisolone(PSL) and cyclophosphamide (CTX). Sometimes she experienced a flare-up clinically or serologically, requiring a dose increase of oral PSL. At 40 years of age, she visited our hospital after discontinuation of hospital visits for about 4 months. Oral PSL at 30 mg per day was not effective for urinary abnormalities, increase of anti double-stranded DNA (ds-DNA) antibody titer and decrease in complement components. On admission she had hypertension (180/92 mmHg) and signs of microangiopathic hemolytic anemia. Renal biopsy findings showed the glomerular changes of lupus nephritis, WHO class IV-G (A), and lupus vasculopathy, which is marked luminal narrowing or total occlusion by abundant subendothelial accumulation of immunoglobulins and complement components. In addition to PSL, intravenous pulse CTX promptly achieved clinical remission. When lupus vasculopathy is complicated, CTX may be useful.

  6. Kawasaki disease and juvenile systemic lupus erythematosus.

    PubMed

    Diniz, J C; Almeida, R T; Aikawa, N E; Sallum, A M E; Sakane, P T; Silva, C A

    2012-01-01

    Kawasaki disease (KD) is a common vasculitis in childhood. To the authors' knowledge, only one case of juvenile systemic lupus erythematosus (JSLE)-like onset mimicking KD and another case of KD and JSLE association have previously been described. However, the prevalence of this association of the two diseases was not reported. Therefore, over 27 consecutive years, 5419 patients were followed at the Pediatric Rheumatology Unit and 271 (5%) of them met the ACR classification criteria for JSLE. Two (0.7%) of them were female. These also had KD according to European League against Rheumatism / Paediatric Rheumatology European Society (EULAR/PReS) consensus criteria and are described in this report. One case was a 13-year-old who presented all six KD criteria. Echocardiogram showed pericardial effusion, dilatation and tortuosity of right and left coronary, and her symptoms promptly improved after treatment with intravenous immunoglobulin (IVIG). Lupus diagnosis was established a few days later. Another case was a 4-year-old who had also met all six KD criteria, with improvement after IVIG, and lupus diagnosis was made 1 year later. In conclusion, the frequency of the association between these two autoimmune diseases was rare. The occurrence of a second autoimmune systemic disease in a patient with a history of KD should also be considered. Furthermore, the initial presentation of lupus may mimic KD.

  7. Autoinoculation lupus vulgaris of the perineum.

    PubMed

    Sehgal, V N; Chaudhry, A K; Gupta, R

    1991-08-01

    The case of a young heterosexual male, with a 7 year history of an asymptomatic progressive plaque over the right side of the perineum is described, which 4 years later involved the left perineum and scrotal skin, indicating autoinoculation. The diagnosis of lupus vulgaris was made by strongly positive tuberculin test, histopathology, and a favourable response to a short course of intensive antitubercular therapy.

  8. Induction of lupus autoantibodies by adjuvants

    USGS Publications Warehouse

    Satoh, M.; Kuroda, Y.; Yoshida, H.; Behney, K.M.; Mizutani, A.; Akaogi, J.; Nacionales, D.C.; Lorenson, T.D.; Rosenbauer, R.J.; Reeves, W.H.

    2003-01-01

    Exposure to the hydrocarbon oil pristane induces lupus specific autoantibodies in non-autoimmune mice. We investigated whether the capacity to induce lupus-like autoimmunity is a unique property of pristane or is shared by other adjuvant oils. Seven groups of 3-month-old female BALB/cJ mice received a single intraperitoneal injection of pristane, squalene (used in the adjuvant MF59), incomplete Freund's adjuvant (IFA), three different medicinal mineral oils, or saline, respectively. Serum autoantibodies and peritoneal cytokine production were measured. In addition to pristane, the mineral oil Bayol F (IFA) and the endogenous hydrocarbon squalene both induced anti-nRNP/Sm and -Su autoantibodies (20% and 25% of mice, respectively). All of these hydrocarbons had prolonged effects on cytokine production by peritoneal APCs. However, high levels of IL-6, IL-12, and TNF?? production 2-3 months after intraperitoneal injection appeared to be associated with the ability to induce lupus autoantibodies. The ability to induce lupus autoantibodies is shared by several hydrocarbons and is not unique to pristane. It correlates with stimulation of the production of IL-12 and other cytokines, suggesting a relationship with a hydrocarbon's adjuvanticity. The potential to induce autoimmunity may complicate the use of oil adjuvants in human and veterinary vaccines. ?? 2003 Elsevier Ltd. All rights reserved.

  9. Challenges for lupus management in emerging countries.

    PubMed

    Tazi Mezalek, Zoubida; Bono, Wafaa

    2014-06-01

    In emerging countries, systemic lupus erythematosus (SLE) has been associated with several unfavorable outcomes including disease activity, damage accrual, work disability and mortality. Poor socioeconomic status (SES) and lack of access to healthcare, especially in medically underserved communities, may be responsible for many of the observed disparities. Diagnostic delay of SLE or for severe organ damages (renal involvement) have a negative impact on those adverse outcomes in lupus patients who either belong to minority groups or live in emerging countries. Longitudinal and observational prospective studies and registries may help to identify the factors that influence poor SLE outcomes in emerging countries. Infection is an important cause of mortality and morbidity in SLE, particularly in low SES patients and tuberculosis appears to be frequent in SLE patients living in endemic areas (mainly emerging countries). Thus, tuberculosis screening should be systematically performed and prophylaxis discussed for patients from these areas. SLE treatment in the developing world is restricted by the availability and cost of some immunosuppressive drugs. Moreover, poor adherence has been associated to bad outcomes in lupus patients with a higher risk of flares, morbidity, hospitalization, and poor renal prognosis. Low education and the lack of money are identified as the main barrier to improve lupus prognosis. Newer therapeutic agents and new protocols had contributed to improve survival in SLE. The use of corticoid-sparing agents (hydroxychloroquine, methotrexate, azathioprine and mycophenolate mofetif) is one of the most useful strategy; availability of inexpensive generics may help to optimize access to these medications.

  10. Thrombotic thrombocytopenic purpura preceding systemic lupus erythematosus.

    PubMed Central

    Simeon-Aznar, C P; Cuenca-Luque, R; Fonollosa-Pla, V; Bosch-Gil, J A

    1992-01-01

    The case of a patient admitted with thrombotic thrombocytopenic purpura nine years after developing systemic lupus erythematosus (SLE) is reported. Thrombotic thrombocytopenic purpura associated with SLE has been described on other occasions, but in most patients the diagnosis of SLE precedes that of thrombotic thrombocytopenic purpura. The unusual sequence and the chronological separation of the two diseases is emphasised. PMID:1575591

  11. Squamous cell carcinoma associated with lupus vulgaris.

    PubMed

    Gooptu, C; Marks, N; Thomas, J; James, M P

    1998-05-01

    Squamous cell carcinomas are known to arise in certain chronic, scarring dermatoses and also to be associated with exposure to ultraviolet radiation. We now report a case arising in a plaque of lupus vulgaris, the patient having received radiation from a Finsen lamp as a child for a tuberculous abscess in that region.

  12. Lupus - Multiple Languages: MedlinePlus

    MedlinePlus

    ... XYZ List of All Topics All Lupus - Multiple Languages To use the sharing features on this page, please enable JavaScript. Chinese - Traditional (繁體中文) Korean (한국어) Spanish (español) Vietnamese (Tiếng Việt) Chinese - Traditional ( ...

  13. Mycophenolate mofetil inducing remission of lupus enteritis.

    PubMed

    Al Balushi, F; Humby, F; Mahto, A; Kelly, C; Jawad, A

    2012-04-01

    We report the case of a young woman with a background history of discoid lupus who presented with abdominal pain, vomiting and intermittent diarrhoea. Physical examination revealed tenderness in the right upper quadrant with a palpable right inguinal lymph node without any other clinical signs of active lupus. Laboratory investigations showed normal inflammatory markers, positive ANA and Anti-Ro antibodies, persistent hypocomplementemia and lymphopenia, CT showed marked bowel oedema involving the small and large bowel (halo sign) with massive ascites and moderate right-sided pleural effusion. Mantoux test, AFB and TB cultures were negative. A diagnosis of lupus enteritis was made and treatment with high-dose steroids was commenced with little improvement. Treatment with cyclophosphamide was discussed but declined by the patient. Mycophenolate mofetil was commenced and resulted in significant clinical and radiological resolution. To the best of the authors' knowledge this is the first report of the successful use of mycophenolate mofetil in inducing and maintaining remission in lupus enteritis.

  14. Lupus: When the Body Attacks Itself | NIH MedlinePlus the Magazine

    MedlinePlus

    ... of this page please turn JavaScript on. Feature: Lupus Lupus: When the Body Attacks Itself Past Issues / Spring 2014 Table of Contents fast facts 1 Lupus occurs when the body's immune system attacks the ...

  15. Gestational outcomes in patients with neuropsychiatric systemic lupus erythematosus.

    PubMed

    de Jesus, G R; Rodrigues, B C; Lacerda, M I; Dos Santos, F C; de Jesus, N R; Klumb, E M; Levy, R A

    2017-04-01

    This study analyzed maternal and fetal outcomes of pregnancies of neuropsychiatric systemic lupus erythematosus patients followed in a reference unit. This retrospective cohort study included 26 pregnancies of patients seen between 2011 and 2015 included with history and/or active neuropsychiatric systemic lupus erythematosus among 135 pregnancies. Three patients had active neuropsychiatric systemic lupus erythematosus at conception, but only one remained with neurological activity during gestation, characteristically related to the inadvertent suspension of medications. Twenty six percent of the newborns were small for gestational age and 40% of live births were premature, with no neonatal death or early complications of prematurity. Preeclampsia was diagnosed in nine pregnancies, with two cases of early severe form that resulted in intrauterine fetal death. Patients with neuropsychiatric systemic lupus erythematosus had more prematurity and preeclampsia compared to patients without neuropsychiatric disease. However, when concomitant lupus nephritis was excluded, the gestational results of neuropsychiatric systemic lupus erythematosus patients were more favorable.

  16. Cardiovascular risk assessment and treatment in systemic lupus erythematosus.

    PubMed

    Elliott, Jennifer R; Manzi, Susan

    2009-08-01

    With improved treatment modalities and survival rates, patients with systemic lupus erythematosus live longer and their co-morbidities have become more apparent. Of great concern is cardiovascular disease, which has become a leading cause of death. Lupus patients prematurely develop atherosclerosis, which likely arises from an interaction among traditional cardiovascular risk factors, factors specific to lupus itself and inflammatory mediators. Despite these findings, lupus patients are not always adequately evaluated for traditional risk factors, many of which are treatable and reversible. We propose that lupus patients be assessed and managed regarding cardiovascular risk factors in the same manner as patients with known cardiovascular disease. As a result, preventive cardiology should be considered an essential component of the care for patients with lupus.

  17. Absolute identification of muramic acid, at trace levels, in human septic synovial fluids in vivo and absence in aseptic fluids.

    PubMed

    Fox, A; Fox, K; Christensson, B; Harrelson, D; Krahmer, M

    1996-09-01

    This is the first report of a study employing the state-of-the-art technique of gas chromatography-tandem mass spectrometry for absolute identification of muramic acid (a marker for peptidoglycan) at trace levels in a human or animal body fluid or tissue. Daughter mass spectra of synovial fluid muramic acid peaks (> or = 30 ng/ml) were identical to those of pure muramic acid. Absolute chemical identification at this level represents a 1,000-fold increase in sensitivity over previous gas chromatography-mass spectrometry identifications. Muramic acid was positively identified in synovial fluids during infection and was eliminated over time but was absent from aseptic fluids.

  18. Recurrent aseptic meningitis as a rare but important presentation of congenital petrous apex cholesteatoma: the value of appropriate imaging

    PubMed Central

    MacKeith, Samuel A; Soledad-Juarez, Maria; Tiberti, Liliana; Orfila, Daniel

    2014-01-01

    We describe the presentation, investigation and challenging management of a young adult with recurrent aseptic meningitis. The presence of cholesterol and triglycerides in the cerebrospinal fluid sample was recognised as a potential sign of an underlying dermoid or epidermoid cyst. We demonstrate how appropriate imaging of the skull base with diffusion-weighted imaging (DWI) MRI can help differentiate between lesions of the petrous apex, facilitating the diagnosis of a petrous apex congenital cholesteatoma/epidermoid cyst. Awareness of this unusual mode of presentation of a rare disease, as well as knowledge of key diagnostic investigations, may allow for earlier identification, treatment and reduced morbidity/mortality. PMID:24614768

  19. Novel Therapeutic Target for the Treatment of Lupus

    DTIC Science & Technology

    2013-08-01

    Treatment of Lupus PRINCIPAL INVESTIGATOR: Lisa Laury-Kleintop, Ph.D. Laura Mandik-Nayak, Ph.D...31 July 2013 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Novel Therapeutic Target for the Treatment of Lupus 5b. GRANT NUMBER W81XWH-12-1-0205...RhoB, animal model, antibody secretion, antibody therapy, Systemic lupus erythematosus, autoantibodies. 16. SECURITY CLASSIFICATION OF: 17

  20. T Tauri Disk Lifetime in the Lupus Association

    NASA Astrophysics Data System (ADS)

    Galli, P. A. B.; Bertout, C.; Teixeira, R.; Ducourant, C.

    2016-01-01

    In a recent study, we derived individual distances for a sample of pre-main sequence stars that define the comoving association of young stars in the Lupus star-forming region. Here, we use these new distances to investigate the mass and age distributions of Lupus T Tauri stars and derive the average disk lifetime in the Lupus association based on an empirical disk model.

  1. Novel Therapeutic Target for the Treatment of Lupus

    DTIC Science & Technology

    2013-12-01

    Treatment of Lupus PRINCIPAL INVESTIGATOR: Lisa Laury-Kleintop, PhD RECIPIENT: Lankenau Institute for Medical Research, Wynnewood...SUBTITLE 5a. CONTRACT NUMBER Novel Therapeutic Target for the Treatment of Lupus 5b. GRANT NUMBER W81XWH-12-1-0205 5c. PROGRAM ELEMENT NUMBER...RhoB. 15. SUBJECT TERMS RhoB, animal model, antibody secretion, antibody therapy, Systemic lupus erythematosus, autoantibodies. 16. SECURITY

  2. Moving East: the Euro-Lupus Nephritis regimen in Asia.

    PubMed

    Houssiau, Frédéric A

    2016-01-01

    Treatment of lupus nephritis is more evidenced-based than ever. Yet many areas of uncertainty persist. The article by Rathi et al. brings a piece to the puzzle by comparing, in a group of Indian patients, the Euro-Lupus low-dose i.v. cyclophosphamide regimen with mycophenolate mofetil. Although some caveats must be raised, the results suggest that, after crossing the Atlantic, the Euro-Lupus regimen may well be moving East.

  3. Autologous Fat Transfer in a Patient with Lupus Erythematosus Profundus

    PubMed Central

    Yoon, Jimi; Kim, Hwa Mi; Kim, Tae-Heung; Kim, Chung-Won; Sun, Young-Woo; Yoon, Tae-Jin

    2012-01-01

    Lupus erythematosus profundus, a form of chronic cutaneous lupus erythematosus, is a rare inflammatory disease involving in the lower dermis and subcutaneous tissues. It primarily affects the head, proximal upper arms, trunk, thighs, and presents as firm nodules, 1 to 3 cm in diameter. The overlying skin often becomes attached to the subcutaneous nodules and is drawn inward to produce deep, saucerized depressions. We present a rare case of lupus erythematosus profundus treated with autologous fat transfer. PMID:23139658

  4. Toe walking as a presenting sign of systemic lupus erythematosus.

    PubMed

    Basiaga, M; Sherry, D

    2015-10-01

    Toe walking is a previously unreported presentation of systemic lupus erythematosus (SLE). We describe a patient who presented with profound multisystem involvement that was preceded by one month of toe walking and multiple flexion contractures without arthritis. Her lupus is now under control after aggressive therapy, yet she continues to struggle with tendinopathy despite continued physical and occupational therapy. Lupus should be considered in the appropriate clinical context in children who have new-onset contractures due to tight tendons.

  5. [Systemic lupus erythematous and CD24v].

    PubMed

    Jiménez-Uscanga, Rubén Darío; Carsolio-Trujano, Margarita; Herrera-Sánchez, Diana Andrea; Castrejón-Vázquez, María Isabel; Irazoque-Palacios, Fedra; Vargas-Camaño, María Eugenia; Martínez-Aguilar, Nora; Chima-Galán, María Carmen

    2015-01-01

    Antecedentes: el lupus eritematoso sistémico es un padecimiento autoinmunitario, de origen multifactorial, con predisposición genética; más de 100 genes participan en su etiopatogenia. El gen de CD24 puede mediar varias funciones, como su actividad coestimuladora en la expansión clonal de las células T. El polimorfismo de un simple nucleótido de CD24, que resulta en un reemplazo no conservador de alanina a valina (CD24v), que precede inmediatamente al sitio de anclaje GPI (posición ω-1), condiciona la pérdida de actividad de CD24. Se ha descrito que CD24v está asociado con esclerosis múltiple y lupus eritematoso sistémico en otras poblaciones. Objetivo: encontrar la existencia de CD24v en pacientes mexicanos con lupus eritematoso sistémico. Material y método: estudio de genotipificación de CD24v en el que se incluyeron 64 sujetos, 32 casos con lupus eritematoso sistémico: 28 mujeres y 4 hombres; y 32 controles: 9 mujeres y 23 hombres; todos eran pacientes con lupus eritematoso sistémico del Centro Médico Nacional 20 de Noviembre, del ISSSTE, atendidos en los servicios de Inmunología Clínica y Reumatología. Resultados: de los casos, 19 pacientes tenían genotipo homocigoto silvestre, 12 con genotipo heterocigotos y sólo un paciente mostró el polimorfismo en estado homocigoto. De los controles, 17 sujetos mostraron genotipos heterocigotos silvestres, 14 eran heterocigotos y sólo en uno se encontró que era homocigoto polimórfico. Se obtuvo una razón de momios de 0.84 y chi cuadrada de 0.17, por lo que no hubo diferencia estadísticamente significativa. Conclusiones: se demostró que no hay diferencia estadísticamente significativa entre pacientes con lupus eritematoso sistémico y controles respecto a la existencia de CD24v.

  6. [Lupus erythematosus panniculitis presenting as palpebral edema and parotiditis].

    PubMed

    Pérez-Pastor, G; Valcuende, F; Tomás, G; Moreno, M

    2007-10-01

    Lupus erythematosus panniculitis or lupus erythematosus profundus is characterized by inflammation of the deep dermis and subcutaneous tissue. It can occur in isolation or associated with chronic systemic or discoid lupus erythematosus. It usually consists of nodules and hardened subcutaneous plaques on the forehead, cheeks, proximal extremities, and buttocks. Periorbital and parotid involvement are rare and can lead to misdiagnosis. We present the case of a patient with lupus erythematosus panniculitis who presented with palpebral edema and involvement of the periocular fat and parotid gland.

  7. Pregnancy and contraception in systemic and cutaneous lupus erythematosus.

    PubMed

    Guettrot-Imbert, G; Morel, N; Le Guern, V; Plu-Bureau, G; Frances, C; Costedoat-Chalumeau, N

    2016-10-01

    A causal link has long been described between estrogen and systemic lupus erythematosus activity. Contraceptive and pregnancy management is now common for lupus patients, but pregnancy continues to be associated with higher maternal and fetal mortality/morbidity in systemic lupus erythematosus patients than among the general population. Potential complications include lupus flares, obstetric complications (fetal loss, in utero growth retardation, premature birth) and neonatal lupus syndrome. Association with antiphospholipid antibodies or antiphospholipid syndrome increases the risk of obstetric complications. Anti-SSA and/or anti-SSB antibodies put fetuses at risk for neonatal lupus. Improving the outcome of such pregnancies depends upon optimal systematic planning of pregnancy at a preconception counseling visit coupled with a multidisciplinary approach. Absence of lupus activity, use of appropriate medication during pregnancy based on the patient's medical history and risk factors, and regular monitoring constitute the best tools for achieving a favorable outcome in such high-risk pregnancies. The aim of this review is to provide an update on the management of contraception and pregnancy in systemic lupus erythematosus, cutaneous lupus and/or antiphospholipid syndrome in order to reduce the risk of complications and to ensure the best maternal and fetal prognosis.

  8. Diagnosis: a liminal state for women living with lupus.

    PubMed

    Mendelson, Cindy

    2009-05-01

    Women with systemic lupus erythematosus (SLE or lupus) often experience a protracted diagnostic period in which their symptoms are treated as medically unexplained. Although they know they are ill, their symptoms have not been validated as indicative of disease by a health care professional. Consequently, the diagnostic period can be viewed as liminal, the middle stage in the rites of passage and what Turner (1969/1997) has labeled "betwixt and between." Drawing on the analysis of narratives solicited from 23 women recruited from online lupus support groups, I explore the gendered nature of diagnosis for women with lupus using van Gennep's (1960) rites of passage as a conceptual framework.

  9. Elevated sacroilac joint uptake ratios in systemic lupus erythematosus

    SciTech Connect

    De Smet, A.A.; Mahmood, T.; Robinson, R.G.; Lindsley, H.B.

    1984-08-01

    Sacroiliac joint radiographs and radionuclide sacroiliac joint uptake ratios were obtained on 14 patients with active systemic lupus erythematosus. Elevated joint ratios were found unilaterally in two patients and bilaterally in seven patients when their lupus was active. In patients whose disease became quiescent, the uptake ratios returned to normal. Two patients had persistently elevated ratios with continued clinical and laboratory evidence of active lupus. Mild sacroiliac joint sclerosis and erosions were detected on pelvic radiographs in these same two patients. Elevated quantitative sacroiliac joint uptake ratios may occur as a manifestation of active systemic lupus erythematosus.

  10. Isoniazid Induced Lupus Presenting as Oral Mucosal Ulcers with Pancytopenia

    PubMed Central

    Ankale, Padmaraj; Sinha, Kanishk; Iyer, Aparna; Jayalakshmi, T.K

    2016-01-01

    Drug Induced Lupus Erythematous (DILE) is a rare adverse reaction to a large variety of drugs including Isoniazid (INH), with features resembling idiopathic Systemic Lupus Erythematosus (SLE). Diagnosis require identification of a temporal relationship between drug administered and symptom. It is an idiosyncratic reaction, with no pre-existing lupus. Our case highlights a rare presentation of isoniazid induced lupus with profound pancytopenia and mucosal ulcers, thus posing a diagnostic challenge. The patient was on multidrug treatment for pulmonary and knee joint tuberculosis. DILE was diagnosed on basis of strongly positive Anti Nuclear Antibodies (ANA), anti ds DNA and antihistone antibodies with clinical response to cessation of INH. PMID:27891378

  11. Lupus Gastrointestinal Tract Vasculopathy: Lupus “Enteritis” Involving the Entire Gastrointestinal Tract from Esophagus to Rectum

    PubMed Central

    Bert, Joseph; Gertner, Elie

    2017-01-01

    Gastrointestinal symptoms are very common in systemic lupus erythematosus (SLE). Lupus “enteritis” is very responsive to treatment but can have devastating consequences if not detected. Most descriptions of enteritis involve the small and large bowel. This is the first report of lupus “enteritis” involving the entire gastrointestinal tract from the esophagus and stomach to the rectum. Lupus “enteritis” is another cause of upper gastrointestinal involvement in SLE (involving even the esophagus and stomach) in addition to involvement of the lower intestinal tract. PMID:28203138

  12. Psoriasiform lupus vulgaris with 30 years duration.

    PubMed

    Reich, Adam; Kobierzycka, Monika; Cisło, Maria; Schwartz, Robert A; Szepietowski, Jacek C

    2006-01-01

    Lupus vulgaris is a progressive form of cutaneous tuberculosis occurring in a person with a moderate to high degree of immunity. It is the most common type of cutaneous tuberculosis. Lupus vulgaris can be mimicked by several other skin conditions, and a 69-y-old female is described with an extremely long history of extensive infiltrative skin lesions with abundant scaling. The lesions were localized on the right arm and forearm, and on the right lateral surface of the chest. The diascopic test was positive. Moreover, a large atrophic scar was seen in the region of right cubital fossa resulting in contracture of the right elbow joint. The histopathology strongly suggested the diagnosis of tuberculosis. The final diagnosis of tuberculosis was confirmed by PCR examination. A polychemotherapeutic regimen (ethambutol 1250 mg/d, rifampicin 600 mg/d and isoniazid 300 mg/d) was successfully employed for the treatment of skin lesions.

  13. Disseminated lupus vulgaris presenting as granulomatous folliculitis.

    PubMed

    Hruza, G J; Posnick, R B; Weltman, R E

    1989-01-01

    A 69-year-old man presented with a 3-year history of scattered, grouped, asymptomatic follicular papules, pustules, and nodules tending toward coalescence into large geographic aggregates. Repeated cutaneous biopsy specimens showed granulomatous folliculitis with negative Ziehl-Neelsen stains. Finally, biopsy material submitted for mycobacterial culture grew Mycobacterium tuberculosis. No evidence of active systemic tuberculosis was found. The patient had a very rare form of tuberculosis, disseminated lupus vulgaris, presenting with granulomatous folliculitis, which is usually not seen in lupus vulgaris. The lesions resolved after an 18-month course of isoniazid and rifampin. The unusual clinical and histologic presentation as well as occasional partial remissions following a variety of nonspecific empiric therapies delayed diagnosis despite multiple evaluations. This case illustrates the importance of obtaining mycobacterial cultures from skin biopsy specimens in addition to special stains whenever cutaneous tuberculosis is suspected.

  14. Giant lupus vulgaris: A rare presentation.

    PubMed

    Sacchidanand, S; Sharavana, S; Mallikarjun, M; Nataraja, H V

    2012-01-01

    Cutaneous tuberculosis continues to be an important public health problem even with the availability of highly effective anti-tuberculous drugs. It constitutes 0.1% of all cases of extrapulmonary tuberculosis. Lupus vulgaris is the most common form of cutaneous tuberculosis that occurs in previously sensitized individuals with a moderate degree of immunity against tubercle bacilli. The different types of lupus vulgaris include plaque, ulcerative, vegetative, papular and nodular, and tumor forms. A 40-year-old man presented with large multiple plaques over right upper limb, right side of chest and back, and right lower limb for the past 30 years. Histopathology showed numerous noncaseating granulomas with Langhan's type of giant cells. The Mantoux test showed strong positivity and there was excellent response to anti-tuberculous treatment. This case is being reported because of its extreme chronicity of 30 years duration, unusually large size and multiplicity of lesions.

  15. Acquired enophthalmos with systemic lupus erythematosus.

    PubMed

    Park, K R; Seo, M R; Ryu, H J; Chi, M J; Baek, H J; Choi, H J

    2016-01-01

    Ocular involvement sometimes occurs with systemic lupus erythematosus (SLE) but enophthalmos with SLE is rare. We report a case of enophthalmos with SLE. A 25-year-old male was admitted for two weeks of fever, sore throat, arthralgia, chest pain and right arm weakness with pain. We diagnosed him with SLE with malar rash, arthritis, pleural effusion, proteinuria, leukopenia, positive antinuclear antibody, anti-dsDNA, and lupus anticoagulant. The patient was prescribed high-dose prednisolone and hydroxychloroquine 400 mg. One week after discharge, he complained about a sensation of a sunken right eye. CT showed right enophthalmos, a post-inflammatory change and chronic inflammation. Proteinuria increased to 3.8 g/day after the patient stopped taking prednisolone. Cyclophosphamide therapy was administered for three months without improvement. We decided to restart prednisolone and change cyclophosphamide to mycophenolate mofetil. Proteinuria decreased but enophthalmos remains as of this reporting.

  16. Ultraviolet radiation and systemic lupus erythematosus.

    PubMed

    Barbhaiya, M; Costenbader, K H

    2014-05-01

    Exposure to ultraviolet (UV) radiation is among the environmental factors that have been proposed and studied in association with systemic lupus erythematosus (SLE). While it is known that UV radiation exposure may exacerbate pre-existing lupus, it remains unclear whether UV exposure is a risk factor for the development of SLE. Experimental studies show a significant immunomodulatory role for UV radiation, but strong epidemiologic data regarding its role in triggering SLE onset are lacking. Further studies are needed to assess the role of UV radiation in relation to development of incident SLE, yet they are challenging to design due to difficulties in accurate exposure assessment, the heterogeneous nature of SLE, and the challenge of assessing photosensitivity, a feature of SLE, which often precedes its diagnosis.

  17. Cutaneous Manifestations of Systemic Lupus Erythematosus

    PubMed Central

    Uva, Luís; Miguel, Diana; Pinheiro, Catarina; Freitas, João Pedro; Marques Gomes, Manuel; Filipe, Paulo

    2012-01-01

    Systemic lupus erythematosus (SLE) is a multiorgan autoimmune disease of unknown etiology with many clinical manifestations. The skin is one of the target organs most variably affected by the disease. The American College of Rheumatology (ACR) established 11 criteria as a classificatory instrument to operationalise the definition of SLE in clinical trials. They were not intended to be used to diagnose individuals and do not do well in that capacity. Cutaneous lesions account for four of these 11 revised criteria of SLE. Skin lesions in patients with lupus may be specific or nonspecific. This paper covers the SLE-specific cutaneous changes: malar rash, discoid rash, photosensitivity, and oral mucosal lesions as well as SLE nonspecific skin manifestations, their pathophysiology, and management. A deeper thorough understanding of the cutaneous manifestations of SLE is essential for diagnosis, prognosis, and efficient management. Thus, dermatologists should cooperate with other specialties to provide optimal care of SLE patient. PMID:22888407

  18. Systemic lupus erythematosus in Nepal: A review.

    PubMed

    Kafle, M P; Lee, Vws

    2016-08-01

    Nepal is a small country that is landlocked between India and China. Several ethnic groups live within the 147,181 km(2) of this country. Geographic diversity ranges from the high Himalayas to the flatlands of the Ganges plains. Lupus nephritis (LN), a complication of systemic lupus erythematosus (SLE), is a common kidney problem in Nepal; but the real incidence and prevalence of SLE in Nepal is largely not known. Here, it more commonly affects people (mostly women) living in the southern flatlands, but SLE is reported to be uncommon further south in India. Even though the disease appears to be common, good quality research is uncommon in Nepali literature. This article was written to provide a review of the articles published to date about SLE in Nepal and to discuss the gaps in knowledge that require further evaluation.

  19. Renal vascular lesions in lupus nephritis.

    PubMed

    Descombes, E; Droz, D; Drouet, L; Grünfeld, J P; Lesavre, P

    1997-09-01

    We retrospectively studied the prevalence, histologic features, clinical correlations, and long-term outcome of the intrarenal vascular lesions of lupus nephritis (LN) in a series of 169 renal biopsies performed between 1980 and 1994 in 132 patients with systemic lupus erythematosus. The most common vascular lesions were nonspecific sclerotic changes, found in 37% of the biopsies (24% if only the cases with moderate to severe changes are considered). The other common vascular lesions were "immunoglobulin microvascular casts," found in 24% of the biopsies. Vasculitis and thrombotic microangiopathy were rare lesions and were seen in only 4 (2.4%) and 1 (0.6%) cases, respectively. Isolated sclerotic vascular changes were present in biopsies from older patients with a longer duration of LN, compared with the group with no vascular lesions, and were associated with a significantly higher prevalence of hypertension. Overall, however, the long-term renal and patient survival of this group did not differ significantly from that of the patients without vascular changes. Immunoglobulin microvascular casts (IMCs) ("lupus vasculopathy") were characterized by the presence of immunoglobulin deposition within the glomerular capillaries and small arterioles. In the present study we extensively investigated the morphologic and immunologic features of this lesion. The lesions were notable for the absence of endothelial or parietal vascular lesions and of fibrin, platelets, and leukocytes, which indicates that thrombosis is not involved in the vascular obstruction. According to our data immunoglobulin precipitation in the microvasculature seems to play a central role in the pathogenesis of this lesion, which is why we propose the term "immunoglobulin microvascular casts." In general, IMCs were associated with the most severe and active forms of diffuse proliferative lupus nephritis (World Health Organization [WHO] class IV). However our data show that, in contrast to previous studies

  20. Novel therapeutic agents for systemic lupus erythematosus.

    PubMed

    Gescuk, Bryan D; Davis, John C

    2002-09-01

    The last significant breakthrough in the treatment of systemic lupus erythematosus (SLE) was the use of cyclophosphamide and methylprednisolone in the treatment of lupus nephritis. Recent advances in immunology, oncology, and endocrinology have resulted in many potential therapies for SLE. These therapies include new immunosuppressants, biologic medications, tolerizing agents, immunoablation techniques, and hormonal medications. Each of these approaches will be discussed in this review. Some therapies are currently in use in clinical rheumatology practice (mycophenolate mofetil) and others are entering phase I trials (anti-BLyS monoclonal antibody). While some of these new therapies target specific inflammatory mechanisms in SLE (anti-CD40L monoclonal antibody), others work by nonspecific inhibition of the immune system (immunoablation).

  1. Anastrozole-induced subacute cutaneous lupus erythematosus.

    PubMed

    Fisher, Juliya; Patel, Mital; Miller, Michael; Burris, Katy

    2016-08-01

    Drug-induced subacute cutaneous lupus erythematosus (DI-SCLE) has been associated with numerous drugs, but there are limited reports of its association with aromatase inhibitor anastrozole. We report the case of a patient undergoing treatment with anastrozole for breast cancer who presented with clinical, serological, and histological evidence consistent with DI-SCLE. Her condition quickly began to improve after the use of anastrozole was discontinued and hydroxychloroquine therapy was initiated. Cases such as ours as well as several others that implicate antiestrogen drugs in association with DI-SCLE seem to be contradictory to studies looking at the usefulness of treating systemic lupus erythematosus (SLE) with antiestrogen therapy. Further research on this relationship is warranted.

  2. Biomarkers for kidney involvement in pediatric lupus

    PubMed Central

    Goilav, Beatrice; Putterman, Chaim; Rubinstein, Tamar B

    2015-01-01

    Lupus nephritis (LN), the renal involvement in systemic lupus erythematosus, is currently diagnosed by histopathology obtained by percutaneous renal biopsy and is associated with increased morbidity and mortality in both adults and children. LN is more prevalent and severe in children, requiring aggressive and prolonged immunosuppression. The consequences of the diagnosis and its treatment have devastating long-term effects on the growth, well-being and quality of life of affected children. The paucity of reliable clinical indicators of the presence and severity of renal involvement have contributed to a halt in the reduction of progression to end-stage renal disease in recent years. Here, we discuss the recent development of biomarkers in the management of LN and their role as therapeutic targets. PMID:26079958

  3. Lupus vasculopathy combined with renal infarction: unusual manifestation of lupus nephritis.

    PubMed

    Sugimoto, Toshiro; Kanasaki, Keizo; Morita, Yoshikata; Yokomaku, Yukiyo; Narita, Mitsuhiro; Koyama, Tetsuro; Tanaka, Yuki; Kashiwagi, Atsunori; Koya, Daisuke

    2005-11-01

    A 30-year-old woman with a 10-year history of systemic lupus erythematosus was admitted to our hospital because of the onset of hypertension and renal dysfunction. Renal arteriogram revealed multiple renal infarctions, and cut-off or tapering-stenosis in the interlobular arteries. Renal biopsy showed concentric intimal thickening with narrowed lumen in some arterioles and deposition of IgG/IgM/complement 3 in the wall of arteriole without any active lesions or immune complex deposition in glomeruli. The present case indicates that this type of renal vascular lesion in lupus nephritis, lupus vasculopathy, may cause renal infarction and the loss of renal function without active glomerular lesions.

  4. Vitrified sperm banks: the new aseptic technique for human spermatozoa allows cryopreservation at -86 °C.

    PubMed

    Sánchez, R; Risopatrón, J; Schulz, M; Villegas, J V; Isachenko, V; Isachenko, E

    2012-12-01

    The vitrification technique is simple, quick, cost-effective and has showed a significantly stronger cryoprotective effect in contrast to conventional freezing. The method is based on the rapid cooling of the cell by direct immersion in liquid nitrogen (LN (2) ), thereby avoiding the formation of ice crystals, due to the lower risk of water thawing, which impairs cell function. The aim of this study was to evaluate the effect of storage at -86 °C compared to the conventional -196 °C (under LN (2) ) on essential parameters of the functioning of aseptically vitrified human sperm. Sperm motility, integrity of mitochondrial membrane potential and the rate of DNA fragmentation were determined. The comparison of -86 °C and -196 °C demonstrated no statistical difference in sperm progressive motility (73% vs. 77%), integrity of mitochondrial membrane potential (71% vs. 74%) or DNA fragmentation (3.1% vs. 2.9%). In conclusion, aseptically vitrified sperm can be preserved at -86 °C; eliminating the use of LN (2) simplifies and significantly reduces the costs associated with storage in sperm banks by decreasing the time and space needed for storage, the effort in finding stored samples, and by improving safety for the operator. However, for prolonged storage further studies are needed.

  5. Lupus vulgaris--a case report.

    PubMed

    Munn, S E; Basarab, T; Russell Jones, R

    1995-01-01

    Although lupus vulgaris is the most common form of cutaneous tuberculosis seen in Europe, the incidence has steadily declined and it is now rarely seen. We report a case in a 69-year-old lady who presented with a 10-year history of a slowly growing plaque on the left cheek. Skin biopsy confirmed caseating granulomata, and acid-fast bacilli were seen. She was commenced on triple antituberculous therapy with good effect.

  6. What is new in systemic lupus erythematosus.

    PubMed

    Rúa-Figueroa Fernández de Larrinoa, Iñigo

    2015-01-01

    Systemic lupus erythematosus is a heterogeneous rheumatic systemic disease with extremely varied clinical manifestations and a diverse pathogenesis, as illustrated in this review on the most relevant new knowledge related to the disease. Topics such as anemia, pathogenesis, cardiovascular risk assessment, antiphospholipid syndrome, prediction of damage and recent advances in treatment, including tolerogenic and biological agents, are discussed. Relevant contributions regarding classical therapies such as corticosteroid and antimalarials and their optimal use, as well as the roll of vitamin D, are also referred.

  7. Concomitant systemic lupus erythematosus and ankylosing spondylitis.

    PubMed Central

    Olivieri, I; Gemignani, G; Balagi, M; Pasquariello, A; Gremignai, G; Pasero, G

    1990-01-01

    The case is reported of a 42 year old white woman meeting currently used diagnostic criteria for both ankylosing spondylitis and systemic lupus erythematosus (SLE). As found in a previously described similar case of a black man, HLA typing showed antigens associated with both SLE and seronegative spondyloarthropathy. This case thus supports the hypothesis that the two diseases occur together only when this rare combination of HLA antigens is present. Images PMID:2344214

  8. Clinical characteristics of cutaneous lupus erythematosus

    PubMed Central

    Szczęch, Justyna; Rutka, Maja; Samotij, Dominik; Zalewska, Agnieszka

    2016-01-01

    Introduction Lupus erythematosus (LE) shows a wide variety of clinical manifestations, skin involvement being one of the most important. Aim To analyze the clinical presentation of cutaneous variants of lupus erythematosus in terms of skin lesion spectrum and extracutaneous involvement. Material and methods A total of 64 patients with cutaneous LE (CLE) were included. The study was based on the “Core Set Questionnaire” developed by the European Society of Cutaneous Lupus Erythematosus (EUSCLE). Clinical severity of skin lesions was evaluated with the Cutaneous Lupus Erythematosus Disease Area and Severity Index (CLASI). All results were subjected to statistical analysis. Results Fifteen (23.4%) patients had an acute CLE (ACLE), 26 (40.6%) subacute CLE (SCLE) and 21 (32.8%) chronic CLE (CCLE). Two (3.2%) individuals only demonstrated urticarial vasculitis as a cutaneous manifestation of LE and these patients were excluded. Patients with ACLE were characterized by the earliest onset of the disease (mean age of 31.9 ±15.0 years; p < 0.001). On average, 4.8 ±1.8 criteria of systemic LE were found in the ACLE group compared to 2.7 ±1.3 criteria in SCLE and 2.5 ±1.5 criteria in CCLE (p < 0.001). The highest activity of skin lesions according to CLASI was found in the SCLE group (p = 0.002). On the other hand, the most severe skin damage was observed in CCLE (p < 0.01). Conclusions Each variant of CLE differs significantly from the others in respect of various aspects of clinical manifestations. Due to a number of different variants of LE skin lesions, a unified classification of CLE still remains a challenge. PMID:26985173

  9. Familial Chilblain Lupus, a Monogenic Form of Cutaneous Lupus Erythematosus, Maps to Chromosome 3p

    PubMed Central

    Lee-Kirsch, Min Ae; Gong, Maolian; Schulz, Herbert; Rüschendorf, Franz; Stein, Annette; Pfeiffer, Christiane; Ballarini, Annalisa; Gahr, Manfred; Hubner, Norbert; Linné, Maja

    2006-01-01

    Systemic lupus erythematosus is a prototypic autoimmune disease. Apart from rare monogenic deficiencies of complement factors, where lupuslike disease may occur in association with other autoimmune diseases or high susceptibility to bacterial infections, its etiology is multifactorial in nature. Cutaneous findings are a hallmark of the disease and manifest either alone or in association with internal-organ disease. We describe a novel genodermatosis characterized by painful bluish-red inflammatory papular or nodular lesions in acral locations such as fingers, toes, nose, cheeks, and ears. The lesions sometimes appear plaquelike and tend to ulcerate. Manifestation usually begins in early childhood and is precipitated by cold and wet exposure. Apart from arthralgias, there is no evidence for internal-organ disease or an increased susceptibility to infection. Histological findings include a deep inflammatory infiltrate with perivascular distribution and granular deposits of immunoglobulins and complement along the basement membrane. Some affected individuals show antinuclear antibodies or immune complex formation, whereas cryoglobulins or cold agglutinins are absent. Thus, the findings are consistent with chilblain lupus, a rare form of cutaneous lupus erythematosus. Investigation of a large German kindred with 18 affected members suggests a highly penetrant trait with autosomal dominant inheritance. By single-nucleotide-polymorphism–based genomewide linkage analysis, the locus was mapped to chromosome 3p. Haplotype analysis defined the locus to a 13.8-cM interval with a LOD score of 5.04. This is the first description of a monogenic form of cutaneous lupus erythematosus. Identification of the gene responsible for familial chilblain lupus may shed light on the pathogenesis of common forms of connective-tissue disease such as systemic lupus erythematosus. PMID:16960810

  10. Filaments in the Lupus molecular clouds

    NASA Astrophysics Data System (ADS)

    Benedettini, M.; Schisano, E.; Pezzuto, S.; Elia, D.; André, P.; Könyves, V.; Schneider, N.; Tremblin, P.; Arzoumanian, D.; di Giorgio, A. M.; Di Francesco, J.; Hill, T.; Molinari, S.; Motte, F.; Nguyen-Luong, Q.; Palmeirim, P.; Rivera-Ingraham, A.; Roy, A.; Rygl, K. L. J.; Spinoglio, L.; Ward-Thompson, D.; White, G. J.

    2015-10-01

    We have studied the filaments extracted from the column density maps of the nearby Lupus 1, 3, and 4 molecular clouds, derived from photometric maps observed with the Herschel satellite. Filaments in the Lupus clouds have quite low column densities, with a median value of ˜1.5 × 1021 cm-2 and most have masses per unit length lower than the maximum critical value for radial gravitational collapse. Indeed, no evidence of filament contraction has been seen in the gas kinematics. We find that some filaments, that on average are thermally subcritical, contain dense cores that may eventually form stars. This is an indication that in the low column density regime, the critical condition for the formation of stars may be reached only locally and this condition is not a global property of the filament. Finally, in Lupus we find multiple observational evidences of the key role that the magnetic field plays in forming filaments, and determining their confinement and dynamical evolution.

  11. Estrogen therapy in systemic lupus erythematosus.

    PubMed

    Askanase, Anca D

    2004-01-01

    Given the female preponderance of systemic lupus erythematosus (SLE) in humans, the adverse effects of female gender and sex hormones in murine lupus, and numerous reports (retrospective, often anecdotal and uncontrolled) that describe a temporal association between estrogen exposure and development or exacerbation of SLE, it is tempting to accept that estrogens and SLE simply do not mix. While there are valid concerns regarding the use of exogenous estrogens in women with SLE, there are also potential health benefits to be considered. Oral contraceptives (OCs) offer effective birth control and may be bone protective in corticosteroid-treated patients. Recent studies, albeit retrospective, suggest that OCs are well tolerated in patients with SLE. Several salutary effects of postmenopausal estrogens assume particular importance in SLE where the risks of osteoporosis, exaggerated by menopause (natural or cyclophosphamide-induced) and corticosteroids, are substantial. However, the results of the Women's Health Initiative trial significantly limit the use of hormone replacement therapy in the general population, and raise particular concern for SLE patients. Other exogenous hormones (clomifene, gonadotropins, gonadotropin-releasing hormones) may be used to elevate levels of endogenous estrogen and to stimulate ovulation in patients with diminished fertility. Patients with inactive or stable/moderate disease and at low risk for thrombosis may benefit from OCs and other hormonal therapies without a change in lupus activity. Large prospective, double-blind, placebo-controlled studies inclusive of all ethnic groups should provide the basis for more definitive recommendations.

  12. [Lupus nephritis: up-to-date].

    PubMed

    Karras, A

    2015-02-01

    Renal involvement is frequent during natural history of systemic lupus erythematosus (SLE) and has a major prognostic value in this systemic disease. Screening for renal symptoms, such as proteinuria, micro-haematuria or renal failure must be performed at initial diagnosis and repeated during subsequent follow-ups. Any significant abnormality of these parameters may reveal active glomerulonephritis (GN) and should lead to a renal biopsy, which will significantly impact the therapeutic choices. Proliferative GN, defined as class III or IV by the actual histo-pathological classification, is the most severe form of SLE-associated nephropathy and can lead to end-stage renal disease (ESRD) in up to 60% of cases, according to ethnicity and follow-up duration. Standard induction treatment of active proliferative GN includes corticosteroids combined with an immunosuppressive drug, which can either be cyclophosphamide or mycophenolate mofetil (MMF). Even though, recent biotherapies have not yet proved their efficacy in the field of lupus nephritis, new protocols are expected, aiming higher remission rates and avoidance of high-dose corticosteroids regimens. When remission is achieved in proliferative GN, a maintenance therapy is required to decrease the risk of relapse, using either azathioprine or MMF. Immunosuppressive drugs are responsible for an increased risk of infectious or neoplastic complications but cardiovascular disease is actually one of the main causes of mortality among lupus patients, especially for patients with SLE-related kidney disease, well before reaching ESRD.

  13. Cardiac tamponade as an initial manifestation of systemic lupus erythematosus.

    PubMed

    Carrion, Diego M; Carrion, Andres F

    2012-06-12

    Clinical manifestations of pericardial disease may precede other signs and symptoms associated with systemic lupus erythematosus. Although pericardial effusion is one of the most common cardiac problems in patients with systemic lupus erythematosus, haemodynamically significant effusions manifesting as cardiac tamponade are rare and require prompt diagnosis and treatment.

  14. Raynaud's phenomenon with oral manifestation in systemic lupus erythematosus.

    PubMed

    da Cunha Bang, F; Lange Wantzin, G; Dahl Christensen, J

    1985-01-01

    A 24-year-old woman with discoid lupus erythematosus developed systemic lupus erythematosus after 6 years. One of the clinical features was Raynaud's phenomenon in the fingers and toes, and furthermore Raynaud's phenomenon appeared in the tongue when exposed to cold and windy weather.

  15. Lupus vulgaris secondary to single BCG vaccination. A case report.

    PubMed

    Selimoğlu, M A; Erdem, T; Parlak, M; Eşrefoğlu, M

    1998-01-01

    A 10-year-old girl with lupus vulgaris following single BCG vaccination is reported. She had a 15 x 20 cm painless lesion covering her left shoulder, axilla, triceps and biceps region. PPD test was positive. Histopathological picture was identical to lupus vulgaris.

  16. Lupus erythematosus--a case of facial swelling.

    PubMed

    Loescher, A; Edmondson, H D

    1988-04-01

    A case is reported of acute facial swelling following tooth extraction that failed to respond in a normal manner. The patient developed systemic signs and symptoms ultimately revealing the diagnosis of lupus erythematosus. The possibility of soft tissue lesions arising in some forms of lupus is emphasised by this report.

  17. Cutaneous lupus erythematosus: a personal approach to management.

    PubMed

    Callen, Jeffrey P

    2006-02-01

    SUMMARY Skin disease in patients with lupus erythematosus may be subdivided into two broad categories - those lesions that when biopsied demonstrate interface dermatitis and those that do not demonstrate interface dermatitis. The skin lesions that are represented by the interface dermatitis include discoid lupus erythematosus, subacute cutaneous lupus erythematosus and acute cutaneous lupus erythematosus. Patients with these 'specific' manifestations have varying degrees of systemic involvement from rare systemic disease in patients with localized discoid lupus erythematosus to common and often severe involvement in patients with acute cutaneous lupus erythematosus. Patients who do not demonstrate interface dermatitis also may have systemic disease and in some instances the skin manifestations are linked to some of the more severe systemic manifestations. Many patients with cutaneous lesions characterized by the interface dermatitis can be controlled with 'standard' therapies including sunscreens, protective clothing and behavioural alteration, and topical corticosteroids with or without an oral antimalarial agent. This review presents a brief summary of each common cutaneous manifestation of lupus erythematosus, its relationship to systemic involvement and treatment issues to effectively deal with the lupus erythematosus patient who has skin disease.

  18. Role of electronmicroscopy in the classification of lupus nephritis.

    PubMed

    Pirani, C L; Olesnicky, L

    1982-07-01

    The role of transmission electronmicroscopy in the clarification of the pleomorphic lesions of lupus nephritis is reviewed. Emphasis is placed on the WHO classification of glomerular lesions and in the importance of electronmicroscopy, particularly the precise identification of the milder forms of glomerular involvement. This is essential for the proper therapeutic management of patients with lupus nephritis and to establish a more accurate prognosis.

  19. Genome-Wide Association Study in African-Americans with Systemic Lupus Erythematosus

    DTIC Science & Technology

    2013-09-01

    Americans with Systemic Lupus Erythematosus PRINCIPAL INVESTIGATOR: John Harley, M.D., Ph.D...September 2012 – 31 August 2013 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Genome-Wide Association Study in African-Americans with Systemic Lupus ...SUPPLEMENTARY NOTES 14. ABSTRACT Systemic lupus erythematosus ( lupus ) is a potentially deadly systemic autoimmune disease that disproportionately

  20. Exacerbation of lupus panniculitis following anti-hepatitis-B vaccination.

    PubMed

    Choffray, A; Pinquier, L; Bachelez, H

    2007-01-01

    Even though benefits of vaccination policies have been widely demonstrated, vaccine injections might be associated with rare side effects. In this setting, the potential role of vaccines, mostly against hepatitis B virus, in the induction of autoimmunity has been a matter of controversy. We report the case of a woman followed for a lupus panniculitis which had been in remission for 3 years, who developed a lupus flare following an anti-hepatitis-B vaccine injection. The topography of recurring lupus lesions, the chronology of the flare and the increase in the antinuclear autoantibody serum level all supported a causal role for vaccination in the relapse of the lupus lesions. We believe that the present case might provide a first observation of lupus panniculitis possibly induced by hepatitis B vaccination, and this should be added to the range of dysimmune manifestations caused by vaccinations.

  1. Lupus erythematosus. Are residential insecticides exposure the missing link?

    PubMed

    Fortes, Cristina

    2010-12-01

    Although the etiology of systemic lupus erythematosus (SLE) remains to be fully elucidated, it is now apparent that multiple genetic and environmental factors are at play. Because lupus has a strong female preponderance, several studies have examined the role of female hormones in disease etiology. Yet this knowledge has not helped to explain lupus etiology or to prevent it. Estrogens exist not only as natural or drug compounds, but also as environmental chemical contaminant and women are highly exposed to all of them. Estrogenic activity has been found in a number of pesticides including pyrethroids that are largely used in the household. Although there is only a small amount of published data examining a possible causal relationship between lupus and pesticides it can be hypothesized that pesticides, in particular insecticides, through their estrogenic activity and capacity to induce oxidative stress provoke autoimmune reaction influencing lupus development.

  2. [Systemic lupus erythematosus and antiphospholipid syndrome: How to manage pregnancy?].

    PubMed

    Guettrot-Imbert, G; Le Guern, V; Morel, N; Vauthier, D; Tsatsaris, V; Pannier, E; Piette, J-C; Costedoat-Chalumeau, N

    2015-03-01

    Pregnancy in systemic lupus erythematosus patients is a common situation that remains associated with higher maternal and fetal mortality/morbidity than in the general population. Complications include lupus flares, obstetrical complications (fetal loss, in utero growth retardation, prematurity) and neonatal lupus syndrome. The association with antiphospholipid antibodies or antiphospholipid syndrome increases the risk of obstetrical complications. Improving the care of these pregnancies depends upon a systematic pregnancy planning, ideally during a preconception counseling visit and a multidisciplinary approach (internist/rheumatologist, obstetrician and anesthetist). The absence of lupus activity, the use of appropriate medications during pregnancy adjusted to the patient's medical history and risk factors, and a regular monitoring are the best tools for a favorable outcome for these high-risk pregnancies. The aim of this review article is to perform an update on the medical care of pregnancy in systemic lupus erythematosus or antiphospholipid syndrome to reduce the risk of complications and to ensure the best maternal and fetal prognosis.

  3. Prognosis and predictors of convulsion among pediatric lupus nephritis patients.

    PubMed

    Beiraghdar, Fatemeh; Maddani, Abbas; Taheri, Saeed; Sharifi-Bonab, Mir Mohsen; Esfahani, Taher; Panahi, Yunes; Einollahi, Behzad

    2009-05-01

    In this study, we aimed to analyze features and outcome of convulsion in pediatric lupus nephritis patients. We retrospectively reviewed data of 14 Iranian children with lupus nephritis who developed seizures and compared them with a group of the same number of well matched pediatric lupus nephritis patients. Higher serum creatinine levels and higher frequencies of anemia and lymphopenia were observed in the convulsion group. Multivariable logistic regression analysis revealed that the only risk factor for development of convulsion in pediatric lupus patients with nephritis was lymphopenia. Survival analysis showed that convulsion had no impact on patient and renal function outcomes in our pediatric lupus nephritis subjects. In conclusion, we found that lymphopenia is a predictive factor for convulsion occurrence in our patients and special attention to neurological status assessment may be needed in this situation.

  4. Murine lupus strains differentially model unique facets of human lupus serology.

    PubMed

    Li, L; Nukala, S; Du, Y; Han, J; Liu, K; Hutcheson, J; Pathak, S; Li, Q; Mohan, C

    2012-05-01

    Systemic lupus erythematosus (SLE) is a polygenic autoimmune disease characterized by the production of anti-nuclear autoantibodies that lead to subsequent end organ damage. Previous array-based studies in patients with SLE have shown that high immunoglobulin (Ig)G anti-nuclear autoantibody reactivity was associated with severe renal lupus, whereas IgM polyreactivity was associated with less severe disease. To ascertain how different murine lupus strains recapitulate these different autoantibody profiles seen in patients, serum from New Zealand black (NZB)/NZ white (W) F(1), Murphy Roths large (MRL)/lpr, NZ mixed (M)2410 and BXSB strains were compared using a comprehensive array-based screen. The array results were verified using enzyme-linked immunosorbent assays (ELISAs). Serum from MRL/lpr mice exhibited high levels of IgG anti-nuclear antibodies as well as anti-glomerular antibodies and variable levels of antibodies to myosin, Matrigel and thyroglobulin. Elevated anti-nuclear IgG antibodies were associated with severe nephritis in this strain. In contrast, NZM2410 mice exhibited lower IgG autoantibody levels with less severe nephritis but a significantly higher polyreactive IgM autoantibody profile. ELISA analysis confirmed these results. The NZB/NZW F(1) and BXSB strains exhibited an intermediate serological profile. Hence, just as in patients with SLE, whereas strong IgG reactivity to nuclear antigens is associated with severe renal disease, a polyreactive IgM seroprofile is also less ominous in murine lupus.

  5. Con: Cyclophosphamide for the treatment of lupus nephritis.

    PubMed

    Mok, Chi Chiu

    2016-07-01

    Kidney involvement is a major determinant for morbidity and mortality in patients with systemic lupus erythematosus. The treatment target of lupus renal disease is to induce and maintain remission and to minimize disease or treatment-related comorbidities. Cyclophosphamide (CYC), in conjunction with glucocorticoids, has conventionally been used for the initial treatment of lupus nephritis. However, the major concerns of CYC are its toxicities, such as infertility, urotoxicity and oncogenicity, which are particularly relevant in women of childbearing age. As a result, maintenance therapy of lupus nephritis with an extended course of CYC pulses has largely been replaced by other immunosuppressive agents such as mycophenolate mofetil (MMF) and azathioprine. Recent randomized controlled trials have demonstrated non-inferiority of MMF to pulse CYC as induction therapy of lupus nephritis. Although MMF as induction-maintenance therapy has been increasingly used in lupus nephritis, its efficacy in the long-term preservation of renal function remains to be elucidated. MMF is not necessarily less toxic than CYC. Meta-analyses of clinical trials show similar incidence of infective complications and gastrointestinal adverse events in both MMF- and CYC-based regimens. However, considering the reduction in gonadal toxicity and the risk of oncogenicity, MMF may be used as first-line therapy of lupus nephritis. Tacrolimus (TAC) has recently been shown to be equivalent to either MMF or CYC for inducing remission of lupus nephritis and may be considered as another non-CYC alternative. Combined low-dose MMF and TAC appears to be more effective than CYC pulses in Chinese patients with lupus nephritis and has the potential to replace the more toxic CYC regimens in high-risk patients. Currently, CYC still plays an important role in the management of lupus nephritis patients with impaired or rapidly deteriorating renal function, crescentic glomerulonephritis or as salvage therapy for

  6. Treatment of young patients with lupus nephritis using calcineurin inhibitors

    PubMed Central

    Tanaka, Hiroshi; Tsuruga, Kazushi; Aizawa-Yashiro, Tomomi; Watanabe, Shojiro; Imaizumi, Tadaatsu

    2012-01-01

    Recent advances in the management of lupus nephritis, together with earlier renal biopsy and selective use of aggressive immunosuppressive therapy, have contributed to a favorable outcome in children and adolescents with systemic lupus erythematosus (SLE). Nevertheless, we believe that a more effective and less toxic treatment is needed to attain an optimal control of the activity of lupus nephritis. Recent published papers and our experiences regarding treatment of young patients with lupus nephritis using calcineurin inhibitors are reviewed. Although it has been reported that intermittent monthly pulses of intravenous cyclophosphamide (IVCY) are effective for preserving renal function in adult patients, CPA is a potent immunosuppressive agent that induces severe toxicity, including myelo- and gonadal toxicity, and increases the risk of secondary malignancy. Thus, treatment for controlling lupus nephritis activity, especially in children and adolescents, remains challenging. Cyclosporine A (CsA) and tacrolimus (Tac) are T-cell-specific calcineurin inhibitors that prevent the activation of helper T cells, thereby inhibiting the transcription of the early activation genes of interleukin (IL)-2 and suppressing T cell-induced activation of tumor necrosis factor-α, IL-1β and IL-6. Therefore, both drugs, which we believe may be less cytotoxic, are attractive therapeutic options for young patients with lupus nephritis. Recently, a multidrug regimen of prednisolone (PDN), Tac, and mycophenolate mofetile (MMF) has been found effective and relatively safe in adult lupus nephritis. Since the mechanisms of action of MMF and Tac are probably complementary, multidrug therapy for lupus nephritis may be useful. We propose as an alternative to IVCY, a multidrug therapy with mizoribine, which acts very similarly to MMF, and Tac, which has a different mode of action, combined with PDN for pediatric-onset lupus nephritis. We also believe that a multidrug therapy including CsA and

  7. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination

    NASA Technical Reports Server (NTRS)

    Atwater, J. E.; Michalek, W. F.; Wheeler, R. R. Jr; Dahl, R.; Lunsford, T. D.; Garmon, F. C.; Sauer, R. L.

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  8. A microwave-powered sterilizable interface for aseptic access to bioreactors that are vulnerable to microbial contamination.

    PubMed

    Atwater, J E; Michalek, W F; Wheeler, R R; Dahl, R; Lunsford, T D; Garmon, F C; Sauer, R L

    2001-01-01

    Novel methods and apparatus that employ the rapid heating characteristics of microwave irradiation to facilitate the aseptic transfer of nutrients, products, and other materials between microbially sensitive systems and the external environment are described. The microwave-sterilizable access port (MSAP) consists of a 600-W magnetron emitting at a frequency of 2.45 GHz, a sterilization chamber with inlet and outlet flow lines, and a specimen transfer interface. Energy is routed to the sterilization chamber via a coaxial transmission line where small quantities of water couple strongly with the incident radiation to produce a superheated vapor phase. The efficiency of energy transfer is enhanced through the use of microwave susceptors within the sterilization chamber. Mating surfaces are thermally sterilized through direct contact with the hot gas. Efficacy has been demonstrated using the thermophile Bacillus stearothermophilus.

  9. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling

    PubMed Central

    Bhadane, Bhushan S.; Patil, Ravindra H.

    2016-01-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared. PMID:27222851

  10. Data on the cost effective surface sterilization method for C.carandas (L.) seeds and callus induction from aseptic seedling.

    PubMed

    Bhadane, Bhushan S; Patil, Ravindra H

    2016-06-01

    Surface sterilization of explant is an important and most sensitive step in plant tissue culture. Inappropriate concentrations of sterilants have lethal effect in cell division and it restricts growth and development of explant. Therefore, suitable concentration, combinations and duration of exposure of sterilant is essential to raise in vitro cultures successfully. This data demonstrates use of various sterilizing agents for aseptic plantlet germination from seed of Carissa carandas (Apocynaceae). The present dataset provides information in support of cost-effective explant sterilization potential of benzalkonium chloride containing commercial bleach (Lizol) and its comparison with traditionally used surface sterilants in plant tissue culture i.e. 0.1% HgCl2 alone and in combination with 70% alcohol. The data on callogenic response using MS medium supplemented with plant growth regulators is also shared.

  11. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  12. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition

    SciTech Connect

    Haydary, J.; Susa, D.; Dudáš, J.

    2013-05-15

    Highlights: ► Pyrolysis of aseptic packages was carried out in a laboratory flow reactor. ► Distribution of tetrapak into the product yields was obtained. ► Composition of the pyrolysis products was estimated. ► Secondary thermal and catalytic decomposition of tars was studied. ► Two types of catalysts (dolomite and red clay marked AFRC) were used. - Abstract: Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H{sub 2}, CO, CH{sub 4}, CO{sub 2} and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  13. Lupus Erythematosus and Neutrophilic Urticarial Dermatosis

    PubMed Central

    Gusdorf, Laurence; Bessis, Didier; Lipsker, Dan

    2014-01-01

    Abstract Neutrophilic urticarial dermatosis (NUD) resembles urticaria clinically but is a neutrophilic dermatosis histopathologically. The majority of patients with NUD have an underlying systemic condition, mainly, autoinflammatory disorders such as cryopyrin-associated periodic syndromes, Schnitzler syndrome, and adult-onset Still disease, but a few also have systemic lupus erythematosus (LE). Here, we confirm these data and we report relevant clinical and histopathological data of 7 patients with LE and NUD. We retrospectively retrieved the medical records of all patients with LE in whom skin biopsy showed NUD in registers of Strasbourg and Montpellier University hospitals since 2000. All were female and aged between 13 and 45 years. Skin lesions were typically rose or red macules or slightly elevated papules occurring in a wide distribution. Individual lesions resolved within 24 hours and were not or only slightly itchy. Every patient had associated signs, most of the time polyarthritis and/or fever. NUD was the presenting mode of LE in 2 patients. NUD was misdiagnosed as a classic lupus flare and led to therapeutic intensification with the introduction of immunosuppressive drugs in 4 patients. Histopathological findings consisted of intense neutrophilic interstitial and perivascular infiltrate with leukocytoclasia and without fibrinoid necrosis of vessel walls. Direct immunofluorescence testing showed a lupus band in 4 patients. Antinuclear antibodies were always positive, anti-dsDNA antibodies were positive in 5 patients, and anti-Ro/SSA antibodies in 6 patients. Immunosuppressive drugs such as prednisone, hydroxychloroquine, mycophenolate mofetil, and methotrexate were never effective to treat NUD. Antihistamines were effective in 1 patient and dapsone or colchicine was effective in 5 patients. NUD is not exceptional in patients with systemic LE and is easily misdiagnosed as an acute LE flare. Furthermore, we show that conventional immunosuppressive LE

  14. Shrinking lung syndrome in systemic lupus erythematosus

    PubMed Central

    Borrell, Helena; Narváez, Javier; Alegre, Juan José; Castellví, Ivan; Mitjavila, Francesca; Aparicio, María; Armengol, Eulàlia; Molina-Molina, María; Nolla, Joan M.

    2016-01-01

    Abstract Shrinking lung syndrome (SLS) is a rare and less known complication mainly associated with systemic lupus erythematosus (SLE). In this study, we analyze the clinical features, investigation findings, approaches to management, and outcome in a case series of 9 adult patients with SLE and SLS diagnosed during a 35-year period in 3 referral tertiary care hospitals in Spain. Additionally, we reviewed 80 additional cases previously reported (PubMed 1965–2015). These 80 cases, together with our 9 patients, form the basis of the present analysis. The overall SLS prevalence in our SLE population was 1.1% (9/829). SLS may complicate SLE at any time over its course, and it usually occurs in patients without previous or concomitant major organ involvement. More than half of the patients had inactive lupus according to SELENA-systemic lupus erythematosus disease activity index (SLEDAI) scores. Typically, it presents with progressive exertional dyspnea of variable severity, accompanied by pleuritic chest pain in 76% of the cases. An important diagnostic delay is common. The diagnostic tools that showed better yield for SLS detection are the imaging techniques (chest x-ray and high-resolution computed tomography) along with pulmonary and diaphragmatic function tests. Evaluation of diaphragm dome motion by M-mode ultrasonography and phrenic nerve conduction studies are less useful. There are no standardized guidelines for the treatment of SLS in SLE. The majority of patients were treated with medium or high doses of glucocorticoids. Several immunosuppressive agents have been used in conjunction with steroids either if the patient fails to improve or since the beginning of the treatment. Theophylline and beta-agonists, alone or in combination with glucocorticoids, have been suggested with the intent to increase diaphragmatic strength. The overall long-term prognosis was good. The great majority of patients had significant clinical improvement and stabilization, or mild

  15. Disseminated lupus vulgaris: a case report.

    PubMed

    Can, Burce; Zindanci, Ilkin; Turkoglu, Zafer; Kavala, Mukaddes; Ulucay, Vasfiye; Demir, Filiz Topaloglu

    2014-01-01

    Lupus vulgaris is a secondary form of cutaneous tuberculosis which persists for years if not treated. The head and neck are the most commonly affected sites. While less frequently arms and legs, and rarely the trunk and the scalp are involved. Herein, we describe a 73-year-old man with a 5-year history of slowly growing, atrophic, some eroded and ulcerated, red-brown plaques on his forehead, nose, cheeks, ear lobes, trunk and extremites. All of his disseminated lesions healed after antituberculosis therapy.

  16. Systemic lupus erythematosus: Clinical and experimental aspects

    SciTech Connect

    Smolen, J.S.

    1987-01-01

    This text covers questions related to the history, etiology, pathogenesis, clinical aspects and therapy of systematic lupus erythematosus (SLE). Both animal models and human SLE are considered. With regard to basic science, concise information on cellular immunology, autoantibodies, viral aspects and molecular biology in SLE is provided. Clinical topics then deal with medical, dermatologic, neurologic, radiologic, pathologic, and therapeutic aspects. The book not only presents the most recent information on clinical and experimental insights, but also looks at future aspects related to the diagnosis and therapy of SLE.

  17. Bone health, vitamin D and lupus.

    PubMed

    Sangüesa Gómez, Clara; Flores Robles, Bryan Josué; Andréu, José Luis

    2015-01-01

    The prevalence of vitamin D deficiency and insufficiency among patients with systemic lupus erythematosus is high. This is likely due to photoprotection measures in addition to intrinsic factors of the disease. Low levels of vitamin D increase the risk of low bone mineral density and fracture. Vitamin D deficiency could also have undesirable effects on patients' immune response, enhancing mechanisms of loss of tolerance and autoimmunity. Vitamin D levels should be periodically monitored and patients should be treated with the objective of reaching vitamin D levels higher than 30-40 ng/ml.

  18. RECENT CLINICAL TRIALS IN LUPUS NEPHRITIS

    PubMed Central

    Ward, Michael M.

    2014-01-01

    SYNOPSIS Recent clinical trials have provided evidence for the efficacy of low-dose intravenous cyclophosphamide and mycophenolate mofetil as induction treatment for patients with proliferative lupus nephritis in comparative trials with standard-dose intravenous cyclophosphamide. Trials of maintenance treatments have had more variable results, but suggest that mycophenolate mofetil may be similar to quarterly standard-dose intravenous cyclophosphamide and somewhat more efficacious than azathioprine. Differential responses to mycophenolate mofetil based on ethnicity suggest that it may be more effective in black and Hispanic patients. Rituximab was not efficacious as an adjunct to induction treatment with mycophenolate mofetil. PMID:25034160

  19. Leadership in wolf, Canis lupus, packs

    USGS Publications Warehouse

    Mech, L. David

    2000-01-01

    I examine leadership in Wolf (Canis lupus) packs based on published observations and data gathered during summers from 1986 to 1998 studying a free-ranging pack of Wolves on Ellesmere Island that were habituated to my presence. The breeding male tended to initiate activities associated with foraging and travel, and the breeding female to initiate, and predominate in, pup care and protection. However, there was considerable overlap and interaction during these activities such that leadership could be considered a joint function. In packs with multiple breeders, quantitative information about leadership is needed.

  20. Collapsing glomerulopathy in systemic lupus erythematosus.

    PubMed

    Abadeer, Kerolos; Alsaad, Ali A; Geiger, Xochiquetzal J; Porter, Ivan E

    2017-02-27

    Collapsing glomerulopathy (CG) is a rare disease that can be associated with multiple other disorders. It usually leads to poor prognosis with a high percentage of patients progressing to end-stage renal disease. In this article, we illustrate a clinical case of CG associated with systemic lupus erythematosus that had a prompt response to mycophenolate and prednisone. The condition started after sudden cessation of the already established mycophenolate treatment regimen. The patient then presented with acute kidney injury due to kidney biopsy-proven CG. In that circumstance, we hypothesised that mycophenolate may play a role in prevention and development of CG.

  1. Renal vascular lesions in systemic lupus erythematosus.

    PubMed

    Katz, S M; Korn, S; Umlas, S L; DeHoratius, R J

    1990-01-01

    In the past, necrotizing vasculitis has been considered to be one of the dominant intrarenal vascular abnormalities in systemic lupus erythematosus (SLE). To test the validity of this statement, 70 consecutive renal biopsies from patients with SLE were reviewed. Light microscopy (LM) and immunofluorescence (IF) studies documented abnormalities, including thrombosis and nephrosclerosis, in 30 patients (43 percent), but no cellular infiltration of the vessel walls or other evidence of acute necrotizing vasculitis was seen. It is concluded that while intrarenal vasculopathy with thrombosis and nephrosclerosis is a common finding in SLE, our data and recently published studies suggest that acute necrotizing vasculitis occurs rarely, if at all, in SLE nephritis.

  2. Anticytokine therapies in systemic lupus erythematosus

    PubMed Central

    Cava, Antonio La

    2010-01-01

    The dysfunctional immune response that characterizes systemic lupus erythematosus (SLE) associates with an unbalanced production of soluble mediators that are crucial in promoting and sustaining chronic inflammation. The successful use of biologics in several autoimmune diseases has led to studies in SLE aimed at contrasting the proinflammatory responses that contribute to tissue and organ damage in the disease. Several approaches have been developed and tested as potential therapeutic agents in SLE in preclinical studies and in clinical trials. This article provides an overview on antibody-based approaches in SLE that, although preliminary, have the potential to expand the current therapeutic possibilities in the disease. PMID:20636010

  3. Review of treatment for discoid lupus erythematosus.

    PubMed

    Garza-Mayers, Anna Cristina; McClurkin, Michael; Smith, Gideon P

    2016-07-01

    Discoid lupus erythematosus (DLE) is a chronic cutaneous disease characterized by inflammatory plaques that, in the absence of prompt diagnosis and treatment, may lead to disfiguring scarring and skin atrophy. However, there is limited evidence for which treatments are most effective. Currently, no medications have been approved specifically for the treatment of DLE. Many of the drugs described in the literature were developed for use in other immune disorders. This review will summarize current therapeutic options for DLE and their supporting evidence with discussion of prevention, topical measures, physical modalities, and systemic therapies, including newer potential therapies.

  4. Lupus erythematosus: considerations about clinical, cutaneous and therapeutic aspects*

    PubMed Central

    Moura Filho, Jucélio Pereira; Peixoto, Raiza Luna; Martins, Lívia Gomes; de Melo, Sillas Duarte; de Carvalho, Ligiana Leite; Pereira, Ana Karine F. da Trindade C.; Freire, Eutilia Andrade Medeiros

    2014-01-01

    Systemic Lupus Erythematosus is a chronic inflammatory disease with multifactorial etiology. Although clinical manifestations are varied, the skin is an important target-organ, which contributes to the inclusion of skin lesions in 4 out of the 17 new criteria for the diagnosis of the disease, according to the Systemic Lupus International Collaborating Clinics. The cutaneous manifestations of lupus are pleomorphic. Depending on their clinical characteristics, they can be classified into Acute Cutaneous Lupus Erythematosus, Subacute Cutaneous Lupus Erythematosus, Chronic Cutaneous Lupus Erythematosus and Intermittent Cutaneous Lupus Erythematosus. Treatment is based on preventive measures, reversal of inflammation, prevention of damage to target organs and relief of adverse events due to pharmacological therapy. The most commonly used treatment options are topical, systemic and surgical treatment, as well as phototherapy. The correct handling of the cases depends on a careful evaluation of the morphology of the lesions and the patient's general status, always taking into consideration not only the benefits but also the side effects of each therapeutic proposal. PMID:24626656

  5. Do we still need renal biopsy in lupus nephritis?

    PubMed

    Haładyj, Ewa; Cervera, Ricard

    2016-01-01

    The natural course of systemic lupus erythematosus (SLE) is characterized by periods of disease activity and remissions. Prolonged disease activity results in cumulative organ damage. Lupus nephritis is one of the most common and devastating manifestations of SLE. In the era of changing therapy to less toxic regimens, some authors have stated that if mycophenolate mofetil can be used for the induction and maintenance treatment in all histological classes of lupus nephritis, renal biopsy can be omitted. This article aims to answer the question of what brings the bigger risk: renal biopsy or its abandonment.

  6. The Star Formation History of the Lupus Dark Clouds

    NASA Astrophysics Data System (ADS)

    Grocholski, A. J.; Hughes, J. D.

    1999-05-01

    In light of recent HIPPARCOS observations we have revised the distance to the Lupus dark cloud complex upwards. This, along with the adoption of newer pre-main sequence mass tracks and isochrones have led to a new mass function and age distribution. We use calculated masses and ages to discuss the progression of star formation through the Lupus clouds, with particular reference to Lupus 3, which is forming intermediate (3-5Mo) stars and a multitude of very low mass stars (<0.3 Mo).

  7. The systematic status of the Italian wolf Canis lupus

    USGS Publications Warehouse

    Nowak, R.M.; Federoff, N.E.

    2002-01-01

    In the past, the gray wolf Canis lupus Linnaeus, 1758, has been recognized in Italy as either the subspecies lupus or italicus. It has also been postulated that this population has undergone introgression from the domestic dog Canis familiaris. In order to clarify these issues, multistatistical analyses were made of 10 skull measurements of 34 full grown male wolves from the Italian Peninsula, 91 other male Eurasian wolves, and 20 domestic dogs. The analyses, together with other morphological evidence and prior genetic research, support recognition of the Italian wolf as a separate subspecies, Canis lupus italicus. The same evidence indicates that the subspecies has not been affected through hybridization with the domestic dog.

  8. Fli-1, a Functional Factor Performed in Autoimmune Lupus.

    PubMed

    Xu, Wang-Dong; Zhang, Min; Zhao, Yi; Liu, Yi

    2016-02-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease. The friend leukemia insertion site 1 (Fli-1) belongs to the Ets family of transcription factors. Recent findings suggested that expression of Fli-1 was abnormal in SLE patients and lupus mice. In addition, functional analysis indicated that Fli-1 plays a key role in the development of this complex autoimmune disorder. Here, we review the updated evidence indicating the roles of Fli-1 in autoimmune lupus. Hopefully, the information obtained may result in a better understanding of the pathogenesis of the systemic autoimmune disease.

  9. Systemic lupus erythematosus flare triggered by a spider bite.

    PubMed

    Martín Nares, Eduardo; López Iñiguez, Alvaro; Ontiveros Mercado, Heriberto

    2016-01-01

    Systemic lupus erythematosus is a chronic autoimmune disease with a relapsing and remitting course characterized by disease flares. Flares are a major cause of hospitalization, morbidity and mortality in patients with systemic lupus erythematosus. Some triggers for these exacerbations have been identified, including infections, vaccines, pregnancy, environmental factors such as weather, stress and drugs. We report a patient who presented with a lupus flare with predominantly mucocutaneous, serosal and cardiac involvement after being bitten by a spider and we present the possible mechanisms by which the venom elicited such a reaction. To the best of our knowledge, this is the first such case reported in the literature.

  10. Recent Advances in the Immunopathogenesis of Systemic Lupus Erythematosus

    PubMed Central

    Bardana, Emil J.; Pirofsky, Bernard

    1975-01-01

    Systemic lupus erythematosus (SLE) is a chronic multisystem inflammatory disease having definite etiologic associations with ethnic, genetic, viral and immunologic factors. Its pathologic hallmark, vasculitis, is currently felt to be the end result of an immune-complex mechanism. Several clinical and serologic variants of SLE are recognized including discoid lupus erythematosus (DLE), mixed connective tissue disease (MCTD) and drug-induced equivalents—such as procainamide-induced lupus (PIL). The distinguishing features of these variants as well as their prognosis and therapy are discussed in relation to recent developments in the immunopathogenesis of SLE. PMID:46657

  11. Lupus nephritis: induction therapy in severe lupus nephritis--should MMF be considered the drug of choice?

    PubMed

    Rovin, Brad H; Parikh, Samir V; Hebert, Lee A; Chan, Tak Mao; Mok, Chi Chiu; Ginzler, Ellen M; Hooi, Lai Seong; Brunetta, Paul; Maciuca, Romeo; Solomons, Neil

    2013-01-01

    Severe lupus nephritis is an aggressive disease that requires an aggressive approach to treatment. Recent randomized clinical trials showed that mycophenolate mofetil compared favorably with cyclophosphamide (traditional approach) for remission induction. Consequently, mycophenolate mofetil is now commonly recommended as first-line therapy. Nevertheless, the role of mycophenolate mofetil in treating severe lupus nephritis is unclear, because such patients were excluded from these trials. With this limitation as background, this work addresses the question of mycophenolate mofetil for induction therapy for severe lupus nephritis. We performed a systematic review of the outcomes of treating severe lupus nephritis with mycophenolate mofetil or cyclophosphamide. Because no studies directly addressed this question, these data were extracted from the published literature or obtained by personal communications from investigators. There is no universally accepted definition, and therefore, severe lupus nephritis was arbitrarily defined by renal histology, resistance to therapy, or level of kidney function at presentation. For each trial analyzed, we determined the partial and complete remission rates. Long-term outcomes were compared when available. The pooled results suggest that mycophenolate mofetil and cyclophosphamide are equally effective in inducing remission of severe lupus nephritis. However, relapse rates and risk of developing ESRD were higher for mycophenolate mofetil compared with cyclophosphamide. In conclusion, in the short term, mycophenolate mofetil and cyclophosphamide are about equal in inducing remission. However, long-term outcomes suggest better preservation of kidney function and fewer relapses with cyclophosphamide therapy. Therefore, mycophenolate mofetil should not yet be considered the induction drug of choice for severe lupus nephritis.

  12. Early history and iconography of lupus erythematosus.

    PubMed

    Fatovic-Ferencic, Stella; Holubar, Karl

    2004-01-01

    In analyzing the history of a certain disease, not only must the particular disease be investigated, but related pathological conditions that exist in a population at a given time must also be addressed. Also, the prevalence of other diseases should be explored, which may have a bearing on the problem under discussion. The history of medicine can help in this respect, revealing the circumstances or the environment when certain diseases (dis)appeared. Terminology must also be explored, and is the point with which we will begin. With regard to lupus, this again is the case (Latin for wolf; lykos ___ in Greek). Taboo and fantasy border semantics because in the naming of the wolf, the image of "tearing apart" or "pulling or ripping off" (a destructive phenomenon) comes into play. Even the Sanskrit word allows such a relation (v_ik, varkate, v_íkah [symbols: see text]). As a consequence, processes of various origin but characterized by ulceration or necrosis (neoplastic, infectious, traumatic, etc), were labeled lupus before the mid-19th century, and no specific pathogenesis was implied. This resulted in considerable confusion, as the books of Willan, Alibert, Cazenave, Schedeland, Hebra, and others prove. We see no purpose in delving further into the history of ulcerative lesions and what was understood early on to be their presumed cause, eg, back to Paracelsus and to the Old Testament ("shekhin" [see text] Hebrew, meaning "ulcer"); or, "cancer," another such descriptive term relating to destruction, taken from the Greek).

  13. Lupus vulgaris: unusual presentation on face.

    PubMed

    Pilani, A; Vora, R V

    2014-01-01

    Lupus vulgaris is a variant of cutaneous tuberculosis. As the disease has potential to mutilate when left untreated, leaving deforming scars and disfigurement, an early diagnosis is of paramount importance. Though the common type is plaque type, rarely mutilating and vegetative forms also are found. A 28 year old female, labourer presented with progressive annular plaque over right side of cheek extending upto right lower lid and ala of nose. There were two satellite plaques near the right side of giant lesion. On diascopy apple jelly nodule was seen. There was no regional lymhadenopathy. Histopathological examination showed many granulomas in upper dermis extending to deep dermis comprising of epitheloid cells with langhans' type of giant cells, lymphocytic infiltration & focal necrosis suggestive of lupus vulgaris. The consequences of failing to make an early diagnosis can be disastrous for the patients, as the progression of the disease can lead to necrosis, destruction of bones and cartilage leading to permanent deformity. Thus it is vital for clinicians to have a high index of suspicion of such atypical forms and take biopsy samples for histological and bacteriological studies.

  14. [Squamous cell carcinoma in lupus vulgaris].

    PubMed

    Kimmritz, Jens; Hermes, Barbara; Schewe, Christiane; Haas, Norbert

    2004-02-01

    Lupus vulgaris and carcinoma in lupo have become rare events that take place in the developed countries only under special circumstances. A 53-year-old woman developed such a carcinoma. She suffered from alcoholism, a well known risk factor for tuberculosis. The diagnosis of lupus vulgaris was confirmed by biopsy when an erythematous lesion on her arm that had been present for 25 years enlarged and subsequently ulcerated. Chemotherapy was discontinued because of lack of compliance and the ulcer grew markedly over the following 16 months. Therefore the entire lesion was excised. Histology showed a squamous cell carcinoma within the ulcer. Neither further systemic manifestations of tuberculosis nor metastases of the carcinoma were found. Under continuous combined antituberculous therapy, the patient remained free of symptoms. This case underlines the problems associated with a disease that has been nearly forgotten in the western countries. It also shows that alcoholism is a risk factor for tuberculosis, along with debilitating diseases such as lymphoma and AIDS as well as immunosuppressive therapy.

  15. Lupus nephritis and renal disease in pregnancy.

    PubMed

    Germain, S; Nelson-Piercy, C

    2006-01-01

    Management of pregnant women with renal disease involves awareness of, and allowance for, physiological changes including decreased serum creatinine and increased proteinuria. For women with systemic lupus erythematosus (SLE), pregnancy increases likelihood of flare. These can occur at any stage, and are more difficult to diagnose, as symptoms overlap those of normal pregnancy. Renal involvement is no more common in pregnancy. Worsening proteinuria may be lupus flare but differential includes pre-eclampsia. In women with chronic renal disease, pregnancy may accelerate decline in renal function and worsen hypertension and proteinuria, with increased risk of maternal (eg, pre-eclampsia) and fetal (eg, IUGR, IUD) complications, strongly correlating with degree of renal impairment peri-conception. Pregnancy success rate varies from 20% to 95% depending on base-line creatinine. Best outcome is obtained if disease was quiescent for >6 months pre-conception. Women on dialysis or with renal transplants can achieve successful pregnancy but have higher maternal and fetal complication rates. Acute on chronic renal failure can develop secondary to complications such as HELLP and AFLP. Management needs to be by a multidisciplinary team involving physicians and obstetricians, ideally beginning with pre-pregnancy counselling. Treatment of flares includes corticosteroids, hydroxychloroquine, azothioprine, NSAIDs and MME Blood pressure is controlled with methyldopa, nifedipine or hydralazine.

  16. Nature and nurture in systemic lupus erythematosus.

    PubMed

    Maddison, P J

    1999-01-01

    Nowhere across the spectrum of rheumatic and dermatological disease is the interaction of nature and nurture more relevant than in the connective tissue diseases such as SLE. While genetic and environmental factors are clearly involved in both the triggering of the disease and its expression, the interaction is complex with different combinations of factors contributing in different patients. For example, while genetic factors contribute substantially to susceptibility to lupus, this does not follow a simple Mendelian pattern of inheritance and mathematical models suggest that there may be varying contribution from at least four genes with differing inheritances. A variety of candidate genes and environmental factors have been highlighted in SLE but to dissect out the complexity of how these might interact requires the study of patient groups with a better defined clinical and serological phenotype. For example, studies of patients with subacute cutaneous lupus (SCLE) have shown associations with various genes in the MHC region (including HLA, complement and TNF) and suggest that the biological effect of inheriting an extended MHC region may be greater than its individual parts. One can now speculate on how interaction with an environmental factor such as UV light explains pathogenesis.

  17. Sensitivity to Change and Minimal Important Differences of the LupusQoL in Patients With Systemic Lupus Erythematosus

    PubMed Central

    McElhone, Kathleen; Abbott, Janice; Sutton, Chris; Mullen, Montana; Lanyon, Peter; Rahman, Anisur; Yee, Chee‐Seng; Akil, Mohammed; Bruce, Ian N.; Ahmad, Yasmeen; Gordon, Caroline

    2016-01-01

    Objective As a health‐related quality of life (HRQOL) measure, the LupusQoL is a reliable and valid measure for adults with systemic lupus erythematosus (SLE). This study evaluates the responsiveness and minimal important differences (MIDs) for the 8 LupusQoL domains. Methods Patients experiencing a flare were recruited from 9 UK centers. At each of the 10 monthly visits, HRQOL (LupusQoL, Short Form 36 health survey [SF‐36]), global rating of change (GRC), and disease activity using the British Isles Lupus Assessment Group 2004 index were assessed. The responsiveness of the LupusQoL and the SF‐36 was evaluated primarily when patients reported an improvement or deterioration on the GRC scale and additionally with changes in physician‐reported disease activity. MIDs were estimated as mean changes when minimal change was reported on the GRC scale. Results A total of 101 patients were recruited. For all LupusQoL domains, mean HRQOL worsened when patients reported deterioration and improved when patients reported an improvement in GRC; SF‐36 domains showed comparable responsiveness. Improvement in some domains of the LupusQoL/SF‐36 was observed with a decrease in disease activity, but when disease activity worsened, there was no significant change. LupusQoL MID estimates for deterioration ranged from −2.4 to −8.7, and for improvement from 3.5 to 7.3; for the SF‐36, the same MID estimates were −2.0 to −11.1 and 2.8 to 10.9, respectively. Conclusion All LupusQoL domains are sensitive to change with patient‐reported deterioration or improvement in health status. For disease activity, some LupusQoL domains showed responsiveness when there was improvement but none for deterioration. LupusQoL items were derived from SLE patients and provide the advantage of disease‐specific domains, important to the patients, not captured by the SF‐36. PMID:26816223

  18. The dissociation of arterial hypertension and lupus glomerulonephritis in systemic lupus erythematosus.

    PubMed

    Petrin, J; Rozman, B; Dolenc, P; Logar, D; Bozic, B; Vizjak, A; Ferluga, D; Jezersek, P

    1993-06-01

    In spite of several articles questioning the general opinion that arterial hypertension in patients with systemic lupus erythematosus (SLE) is only the consequence of lupus glomerulonephritis (LGN), this still remains the usual pathophysiologic explanation. The purpose of this study was to explore the correlations between hypertension and LGN and to assess the importance of hypertension control for the prognosis of patients. A retrospective analysis of 173 patients with SLE over a period of 14 years was performed. For most of the patients, data were available from regular follow-up visits over an average of 6 years. Our results show a dissociation of hypertension and LGN and an association of hypertension and renal dysfunction. Severe hypertensive renal vascular lesions correlated well with a decrease of renal function. Successful treatment of hypertension is therefore essential in order to prevent deterioration of renal function in patients with LGN.

  19. Murine lupus strains differentially model unique facets of human lupus serology

    PubMed Central

    Li, L; Nukala, S; Du, Y; Han, J; Liu, K; Hutcheson, J; Pathak, S; Li, Q; Mohan, C

    2012-01-01

    Systemic lupus erythematosus (SLE) is a polygenic autoimmune disease characterized by the production of anti-nuclear autoantibodies that lead to subsequent end organ damage. Previous array-based studies in patients with SLE have shown that high immunoglobulin (Ig)G anti-nuclear autoantibody reactivity was associated with severe renal lupus, whereas IgM polyreactivity was associated with less severe disease. To ascertain how different murine lupus strains recapitulate these different autoantibody profiles seen in patients, serum from New Zealand black (NZB)/NZ white (W) F1, Murphy Roths large (MRL)/lpr, NZ mixed (M)2410 and BXSB strains were compared using a comprehensive array-based screen. The array results were verified using enzyme-linked immunosorbent assays (ELISAs). Serum from MRL/lpr mice exhibited high levels of IgG anti-nuclear antibodies as well as anti-glomerular antibodies and variable levels of antibodies to myosin, Matrigel and thyroglobulin. Elevated anti-nuclear IgG antibodies were associated with severe nephritis in this strain. In contrast, NZM2410 mice exhibited lower IgG autoantibody levels with less severe nephritis but a significantly higher polyreactive IgM autoantibody profile. ELISA analysis confirmed these results. The NZB/NZW F1 and BXSB strains exhibited an intermediate serological profile. Hence, just as in patients with SLE, whereas strong IgG reactivity to nuclear antigens is associated with severe renal disease, a polyreactive IgM seroprofile is also less ominous in murine lupus. PMID:22471278

  20. Bullous Systemic Lupus Erythematosus and Lupus Nephritis in a Young Girl

    PubMed Central

    Momen, Tooba; Madihi, Yahya

    2016-01-01

    Bullous systemic lupus erythematosus (BSLE) is an autoimmune blistering disease occurring in patients with systemic lupus erythematosus (SLE). It is a rare disease, especially in children. A 14-year-old girl initially presented with fatigue, generalized vesiculobullous skin lesions, and ulcers over the hard palate and oral mucosa. Clinical investigations revealed hematuria and proteinuria, a high erythrocyte sedimentation rate and titer of antinuclear antibody, and anti-double-stranded DNA. Skin biopsy findings were suggestive of BSLE. A renal biopsy confirmed the features of class V lupus nephritis. Based on the clinical features and investigations, a diagnosis of BSLE with nephritis was made. She received methylprednisolone pulse therapy and hydroxychloroquine; however, it did not alleviate the vesiculobullous eruption, so treatment with dapsone started and resulted in the dramatic disappearance of the lesions. Interruption of dapsone due to hemolysis did not aggravate the bullous disease. During follow-up, she had multiple flare-ups of disease and nephritis without rebound of bullous lesions. BSLE is a rare presentation of SLE in children. Differentiating it from other skin bullous diseases and SLE with blister is important for the correct management. The unusual presentation of this disease may delay the diagnosis and therefore requires a high index of clinical suspicion. PMID:27974963

  1. Lupus in a patient with cystinosis: is it drug induced?

    PubMed

    Eroglu, F K; Besbas, N; Ozaltin, F; Topaloglu, R; Ozen, S

    2015-11-01

    A 9-year-old girl with a diagnosis of cystinosis since 2 years of age, on cysteamine therapy, presented with complaints of serositis and arthritis, and laboratory tests revealed high antinuclear antibody titers with hypocomplementemia. Kidney biopsy was not consistent with lupus nephritis. With prednisolone treatment her complaints resolved and creatinine level decreased, but on follow-up, serological features of systemic lupus erythematosus (SLE) continued. Six years after cessation of prednisolone, lupus features were reactivated, with positive antihistone antibodies and ANCA. Coincidence of cystinosis and SLE is very rare, and to the best of our knowledge this is the fourth case reported in the literature. Physicians should be aware that cystinosis patients may have some autoimmune manifestations with features of true or drug-induced lupus. In the light of this case, pathophysiology and treatment are discussed.

  2. Primary amoebic meningoencephalitis in a patient with systemic lupus erythematosus.

    PubMed

    Shrestha, Nabin K; Khanal, Basudha; Sharma, Sanjib K; Dhakal, Subodh S; Kanungo, Reba

    2003-01-01

    This report describes a case of primary amoebic meningoencephalitis in a patient with systemic lupus erythematosus. No specific exposure was identified. Treatment with intravenous amphotericin B was associated with marked clinical improvement, but subsequent fatal relapse while still on therapy.

  3. Prey escaping wolves, Canis lupus, despite close proximity

    USGS Publications Warehouse

    Nelson, M.E.; Mech, L.D.

    1993-01-01

    We describe attacks by wolf (Canis lupus) packs in Minnesota on a white-tailed deer (Odocoileus virginianus) and a moose (Alces alces) in which wolves were within contact distance of the prey but in which the prey escaped.

  4. Management of "refractory" skin disease in patients with lupus erythematosus.

    PubMed

    Callen, Jeffrey P

    2005-10-01

    Skin disease in patients with lupus erythematosus can be subdivided into two broad categories-those lesions that, when biopsied, demonstrate an interface dermatitis and those that do not demonstrate an interface dermatitis. The skin lesions that are represented by the interface dermatitis include discoid lupus erythematosus (DLE), subacute cutaneous lupus erythematosus (SCLE), and acute cutaneous lupus erythematosus. Many patients with these cutaneous lesions can be managed with "standard" therapies, including sunscreens, protective clothing and behavioral alteration, and topical corticosteroids with or without an oral antimalarial agent. These standard therapies are often not used appropriately, resulting in a situation in which the patient is felt to have refractory disease. This chapter discusses these therapies and defines what is meant by refractory disease and how the author approaches these patients.

  5. [Acute lupus pneumonitis--case report and literature review].

    PubMed

    Starczewska, Małgorzata H; Wawrzyńska, Liliana; Opoka, Lucyna; Małek, Grzegorz; Wieliczko, Monika; Amatuszkiewicz-Rowińska, Joanna; Szturmowicz, Monika

    2013-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune connective tissue disease that is characterized by its chronic course and the involvement of many organs and systems. The most common abnormality in the respiratory system of SLE patients is lupus pleuritis. Less common is parenchymal involvement, which may present as acute lupus pneumonitis (ALP) or chronic interstitial lung disease. Other possible pulmonary manifestations of SLE include pulmonary embolism, diffuse alveolar haemorrhage, acute reversible hypoxaemia, and shrinking lung syndrome. We present the case report of a young woman with previously diagnosed membranous glomerulonephritis with nephrotic syndrome and antiphospholipid syndrome, who was admitted with marked of shortness of breath. The diagnostic process, including imaging studies and laboratory tests, enabled us to confirm a diagnosis of ALP. After initiation of treatment with high doses of methyloprednisolone, nearly complete remission of pulmonary changes was observed. We also perform a literature review regarding acute lupus pneumonitis.

  6. For Parents of Children and Teens Living with Lupus

    MedlinePlus

    ... join us at Anthony's Coal Fired Pizza in Coral Gables for our Pizza with a Purpose Fundraiser! ... Oct. 29, 2014 12:30 pm | Broward Health Coral Springs Hospital, Classroom C West Broward Lupus Support ...

  7. Lupus vulgaris of external nose--a case report.

    PubMed

    Arunkumar, J S; Naveen, K N; Prasad, K C; Santhosh, S G; Hegde, J S

    2013-02-01

    Lupus vulgaris is the most common morphological variant of cutaneous tuberculosis accounting for approximately 59% of cases of cutaneous tuberculosis in India. We present a case of lupus vulgaris of external nose diagnosed early and treated with CAT-3 RNTCP regimen for six months without any nasal deformity except for a small scar over the dorsum of the nose. Patient followed up for one year after completion of the prescribed regimen, there being no recurrence of the lesion.

  8. Central nervous system systemic lupus erythematosus mimicking progressive multifocal leucoencephalopathy.

    PubMed Central

    Kaye, B R; Neuwelt, C M; London, S S; DeArmond, S J

    1992-01-01

    The case is reported of a patient with central nervous system systemic lupus erythematosus (SLE) with features of progressive multifocal leucoencephalopathy (PML) seen clinically and by magnetic resonance imaging. A brain biopsy sample showed microinfarcts. The use of magnetic resonance imaging and IgG synthesis rates in evaluating central nervous system lupus, the co-occurrence of SLE and PML, and the differentiation of these entities by magnetic resonance imaging and by histology are considered. Images PMID:1444628

  9. [Squamous epithelial carcinoma as a complication of lupus vulgaris].

    PubMed

    Betti, R; Tolomio, E; Vergani, R; Crosti, C

    2002-02-01

    Lupus vulgaris represents a type of cutaneous tuberculosis that, if not correctly treated, presents a progressive chronic development whose long-term complications include cutaneous neoplasms. We report on a 55-year-old man presenting a 10-year-old ulcerated and bleeding lupus vulgaris lesion on the left cheek containing a squamous cell carcinoma. Reviewing the literature, we search for possible causes of delay in diagnosis that even now allowed therapy only after discovery of the tumoral complication.

  10. Advanced and Conventional Magnetic Resonance Imaging in Neuropsychiatric Lupus

    PubMed Central

    Sarbu, Nicolae; Bargalló, Núria; Cervera, Ricard

    2015-01-01

    Neuropsychiatric lupus is a major diagnostic challenge, and a main cause of morbidity and mortality in patients with systemic lupus erythematosus (SLE). Magnetic resonance imaging (MRI) is, by far, the main tool for assessing the brain in this disease. Conventional and advanced MRI techniques are used to help establishing the diagnosis, to rule out alternative diagnoses, and recently, to monitor the evolution of the disease. This review explores the neuroimaging findings in SLE, including the recent advances in new MRI methods. PMID:26236469

  11. Paediatric systemic lupus erythematosus: insights from translational research.

    PubMed

    Wright, Tracey B; Punaro, Marilynn

    2017-04-01

    Investigations in paediatric SLE contributed significantly to the discovery of the association of type I IFNs with lupus and underscored the potential application of this knowledge by informing the use of glucocorticoid therapy. Recent, promising research reveals biomarkers that may yield more focused clinical monitoring and assessment of response to treatment. This article reviews unique features of paediatric SLE and details important developments in paediatric lupus research.

  12. Phenotypic associations of genetic susceptibility loci in systemic lupus erythematosus

    PubMed Central

    Sanchez, Elena; Nadig, Ajay; Richardson, Bruce C; Freedman, Barry I; Kaufman, Kenneth M; Kelly, Jennifer A; Niewold, Timothy B; Kamen, Diane L; Gilkeson, Gary S; Ziegler, Julie T; Langefeld, Carl D; Alarcón, Graciela S; Edberg, Jeffrey C; Ramsey-Goldman, Rosalind; Petri, Michelle; Brown, Elizabeth E; Kimberly, Robert P; Reveille, John D; Vilá, Luis M; Merrill, Joan T; Anaya, Juan-Manuel; James, Judith A; Pons-Estel, Bernardo A; Martin, Javier; Park, So-Yeon; Bang, So-Young; Bae, Sang-Cheol; Moser, Kathy L; Vyse, Timothy J; Criswell, Lindsey A; Gaffney, Patrick M; Tsao, Betty P; Jacob, Chaim O; Harley, John B; Alarcón-Riquelme, Marta E; Sawalha, Amr H

    2011-01-01

    Objective Systemic lupus erythematosus is a clinically heterogeneous autoimmune disease. A number of genetic loci that increase lupus susceptibility have been established. This study examines if these genetic loci also contribute to the clinical heterogeneity in lupus. Materials and methods 4001 European-derived, 1547 Hispanic, 1590 African-American and 1191 Asian lupus patients were genotyped for 16 confirmed lupus susceptibility loci. Ancestry informative markers were genotyped to calculate and adjust for admixture. The association between the risk allele in each locus was determined and compared in patients with and without the various clinical manifestations included in the ACR criteria. Results Renal disorder was significantly correlated with the lupus risk allele in ITGAM (p=5.0×10−6, OR 1.25, 95% CI 1.12 to 1.35) and in TNFSF4 (p=0.0013, OR 1.14, 95% CI 1.07 to 1.25). Other significant findings include the association between risk alleles in FCGR2A and malar rash (p=0.0031, OR 1.11, 95% CI 1.17 to 1.33), ITGAM and discoid rash (p=0.0020, OR 1.20, 95% CI 1.06 to 1.33), STAT4 and protection from oral ulcers (p=0.0027, OR 0.89, 95% CI 0.83 to 0.96) and IL21 and haematological disorder (p=0.0027, OR 1.13, 95% CI 1.04 to 1.22). All these associations are significant with a false discovery rate of <0.05 and pass the significance threshold using Bonferroni correction for multiple testing. Conclusion Significant associations were found between lupus clinical manifestations and the FCGR2A, ITGAM, STAT4, TNSF4 and IL21 genes. The findings suggest that genetic profiling might be a useful tool to predict disease manifestations in lupus patients in the future. PMID:21719445

  13. Mood Disorders in Systemic Lupus Erythematosus

    PubMed Central

    Hanly, John G.; Su, Li; Urowitz, Murray B.; Romero-Diaz, Juanita; Gordon, Caroline; Bae, Sang-Cheol; Bernatsky, Sasha; Clarke, Ann E.; Wallace, Daniel J.; Merrill, Joan T.; Isenberg, David A.; Rahman, Anisur; Ginzler, Ellen M.; Petri, Michelle; Bruce, Ian N.; Dooley, M. A.; Fortin, Paul; Gladman, Dafna D.; Sanchez-Guerrero, Jorge; Steinsson, Kristjan; Ramsey-Goldman, Rosalind; Khamashta, Munther A.; Aranow, Cynthia; Alarcón, Graciela S.; Fessler, Barri J.; Manzi, Susan; Nived, Ola; Sturfelt, Gunnar K.; Zoma, Asad A.; van Vollenhoven, Ronald F.; Ramos-Casals, Manuel; Ruiz-Irastorza, Guillermo; Lim, S. Sam; Kalunian, Kenneth C.; Inanc, Murat; Kamen, Diane L.; Peschken, Christine A.; Jacobsen, Soren; Askanase, Anca; Theriault, Chris; Thompson, Kara; Farewell, Vernon

    2015-01-01

    Objective To determine the frequency, clinical and autoantibody associations and outcome of mood disorders in a multi-ethnic/racial, prospective, inception cohort of SLE patients. Methods Patients were assessed annually for mood disorders (4 types as per DSM-IV) and 18 other neuropsychiatric (NP) events. Global disease activity (SLEDAI-2K), SLICC/ACR damage index (SDI) and SF-36 subscale, mental (MCS) and physical (PCS) component summary scores were collected. Time to event, linear and ordinal regressions and multi-state models were used as appropriate. Results Of 1,827 SLE patients, 88.9% were female, 48.9% Caucasian, mean ± SD age 35.1±13.3 years, disease duration 5.6±4.8 months and follow-up 4.73±3.45 years. Over the study 863 (47.2%) patients had 1,627 NP events. Mood disorders occurred in 232/1827 (12.7%) patients and 98/256 (38.3%) events were attributed to SLE. The estimated cumulative incidence of any mood disorder after 10 years was 17.7% (95%CI=[15.1%,20.2%]). There was a greater risk of mood disorder in patients with concurrent NP events (p ≤ 0.01) and lower risk with Asian race/ethnicity (p=0.01) and immunosuppressive drugs (p=0.003). Mood disorders were associated with lower mental health subscale and MCS scores but not with SLEDAI-2K, SDI scores or lupus autoantibodies. Antidepressants were used in 168/232 (72.4%) patients with depression. 126/256 (49.2%) mood disorders resolved in 117/232 (50.4%) patients. Conclusion Mood disorders, the second most frequent NP event in SLE patients, have a negative impact on HRQoL and improve over time. The lack of association with global SLE disease activity, cumulative organ damage and lupus autoantibodies emphasize their multifactorial etiology and a role for non-lupus specific therapies. PMID:25778456

  14. Overview of lupus nephritis management guidelines and perspective from Asia.

    PubMed

    Mok, Chi Chiu; Yap, Desmond Y H; Navarra, Sandra V; Liu, Zhi-Hong; Zhao, Ming-Hui; Lu, Liangjing; Takeuchi, Tsutomu; Avihingsanon, Yingyos; Yu, Xue-Qing; Lapid, Elizabeth A; Lugue-Lizardo, Lenrore R; Sumethkul, Vasant; Shen, Nan; Chen, Shun-le; Chan, Tak Mao

    2013-12-01

    Lupus nephritis (LN) is a common and important manifestation of systemic lupus erythematosus (SLE). Evidence suggests higher rates of lupus renal involvement in Asian populations, and maybe more severe nephritis, compared with other racial or ethnic groups. The management of LN has evolved considerably over the past three decades, based on observations from clinical studies that investigated different immunosuppressive agents including corticosteroids, cyclophosphamide, azathioprine, mycophenolic acid, calcineurin inhibitors and novel biologic therapies. This is accompanied by improvements in both the short-term treatment response rate and long-term renal function preservation. Treatment guidelines for LN have recently been issued by rheumatology and nephrology communities in U.S.A. and Europe. In view of the racial difference in disease manifestation and response to therapy, and the substantial disease burden in Asia, a panel of 15 nephrologists and rheumatologists from different Asian regions with extensive experience in lupus nephritis - the Steering Group for the Asian Lupus Nephritis Network (ALNN) - met and discussed the management of lupus nephritis in Asian patients. The group has also reviewed and deliberated on the recently published recommendations from other parts of the world. This manuscript summarizes the discussions by the group and presents consensus views on the clinical management and treatment of adult Asian patients with LN, taking into account both the available evidence and expert opinion in areas where evidence remains to be sought.

  15. Sjögren's syndrome associated with systemic lupus erythematosus.

    PubMed

    Taşdemir, Mehmet; Hasan, Chiar; Ağbaş, Ayşe; Kasapçopur, Özgür; Canpolat, Nur; Sever, Lale; Çalışkan, Salim

    2016-09-01

    Systemic lupus erythematosus and Sjögren's syndrome are chronic auto- inflammatory disorders which can lead to serious organ damage. Although systemic lupus erythematosus and Sjögren's syndrome were previously considered two forms of the same disease because of presence of clinical coexistence of these two conditions, the view that they are two different conditions with mutual characteristics has become prominent in recent years. In this paper, we reported a 16 year-old girl who was followed up with a diagnosis of Sjögren's syndrome for six years and then was observed to have overlap of systemic lupus erythematosus. In the baseline, she did not have any clinical or serological evidence for systemic lupus erythematosus. After six year, massive proteinuria and serological findings developed and systemic lupus erythematosus nephritis was diagnosed by kidney biopsy. Currently, systemic lupus erythematosus and Sjögren's syndrome cannot be differentiated definetely. We need more valuable diagnostic and classification criteria to differentiate these two important conditions.

  16. The lupus impact tracker is responsive to changes in clinical activity measured by the systemic lupus erythematosus responder index.

    PubMed

    Devilliers, H; Bonithon-Kopp, C; Jolly, M

    2017-04-01

    Objective The lupus impact tracker (LIT) is a 10-item patient reported outcome tool to measure the impact of systemic lupus erythematosus or its treatment on patients' daily lives. Herein, we describe the responsiveness of the LIT and LupusQoL to changes in disease activity, using the systemic lupus erythematosus responder index (SRI). Methods A total of 325 adult systemic lupus erythematosus patients were enrolled in an observational, longitudinal, multicentre study, conducted across the USA and Canada. Data (demographics, LIT, LupusQoL, BILAG, SELENA-SLEDAI) were obtained three months apart. Modified SRI was defined as: a decrease in SELENA-SLEDAI (4 points); no new BILAG A, and no greater than one new BILAG B; and no increase in the physician global assessment. Standardised response mean and effect size for LIT and LupusQoL domains were calculated among SRI responders and non-responders. Wilcoxon's test was used to compare the LIT and LupusQoL variation by SRI responder status. Results Of the participants 90% were women, 53% were white, 33% were of African descendant and 17% were Hispanic. Mean (SD) age and SELENA-SLEDAI at baseline were 42.3 (16.2) years and 4.3 (3.8), respectively. Mean (SD) LIT score at baseline was 39.4 (22.9). LIT standardised response mean (effect size) among SRI responders and non-responders were -0.69 (-0.36) and -0.20 (-0.12), respectively ( P = 0.02). For LupusQoL, two domains were responsive to SRI: standardised response mean (effect size) for physical health and pain domains were 0.42 (0.23) and 0.65 (0.44), respectively. Conclusions LIT is moderately responsive to SRI in patients with systemic lupus erythematosus. Inclusion of this tool in clinical care and clinical trials may provide further insights into its responsiveness. This is the first systemic lupus erythematosus patient reported outcome tool to be evaluated against composite responder index (SRI) used in clinical trials.

  17. Lupus vulgaris in a young girl.

    PubMed

    Goyal, Tarang; Varshney, Anupam; Bakshi, S K

    2013-01-01

    With the estimated global burden of TB being 8.8 million incident cases and 1.1 million deaths from TB in HIV-negative cases and additional 0.35 million deaths in HIV-associated cases,1 the total number of cutaneous TB cases ( < 1-2 % of total cases) becomes significant. With the WHO setting up public-private mix partnerships and a millenium development goal of a 50% reduction in the total number of incident cases, the case detection and reporting of unusual cutaneous TB cases becomes very important. We present a case of lupus vulgaris in a young girl with rapid progression of a large plaque with hypertrophic features in the periphery. The case is unusual due to its rapid progression, unusual site and extensive giant form which have never been reported previously.

  18. Atherosclerosis risk factors in systemic lupus erythematosus.

    PubMed

    Agarwal, Surabhi; Elliott, Jennifer R; Manzi, Susan

    2009-08-01

    Cardiovascular disease (CVD) has emerged as a leading cause of morbidity and mortality in patients with systemic lupus erythematosus (SLE). Growing evidence suggests that inflammation plays a key role in the pathogenesis of atherosclerosis from initial endothelial dysfunction to rupture of atheromatous plaques. The increased frequency of atherosclerosis in SLE is likely due to a complex interplay among traditional risk factors, disease-related factors such as medications and disease activity, and inflammatory and immunogenic factors. Identification of these novel risk factors will lead to a better understanding of CVD pathogenesis and may also provide targets for potential treatment strategies. When caring for SLE patients, clinicians should be aware of the increased CVD risk and treat the known modifiable risk factors in addition to controlling disease activity and inflammation.

  19. Atypical systemic lupus erythematosus or Castleman's disease.

    PubMed

    Van de Voorde, K; De Raeve, H; De Block, C E; Van Regenmortel, N; Van Offel, J F; De Clerck, L S; Stevens, W J

    2004-01-01

    Collagen vascular diseases and malignancies have common systemic and immune features. We report a case of a 21 year old female patient with constitutional symptoms, polyserositis, spontaneous rupture of the spleen, leukocytoclastic vasculitis and acute renal failure. The tentative diagnosis of SLE was made because she developed a positive antinuclear factor (1/640), with anti-SSA antibodies and a positive lupus anticoagulans. Two months later a cervical lymphadenopathy occurred while recieving treatment with prednisolone. A lymph node biopsy revealed morphologic features of a SLE, similar to those observed in multicentric Castleman's disease (MCD). MCD is a distinct type of a lymphoproliferative disorder of unknown etiology. The difficulties in differential diagnosis of these two diseases are discussed.

  20. Cerebral blood flow variations in CNS lupus

    SciTech Connect

    Kushner, M.J.; Tobin, M.; Fazekas, F.; Chawluk, J.; Jamieson, D.; Freundlich, B.; Grenell, S.; Freemen, L.; Reivich, M. )

    1990-01-01

    We studied the patterns of cerebral blood flow (CBF), over time, in patients with systemic lupus erythematosus and varying neurologic manifestations including headache, stroke, psychosis, and encephalopathy. For 20 paired xenon-133 CBF measurements, CBF was normal during CNS remissions, regardless of the symptoms. CBF was significantly depressed during CNS exacerbations. The magnitude of change in CBF varied with the neurologic syndrome. CBF was least affected in patients with nonspecific symptoms such as headache or malaise, whereas patients with encephalopathy or psychosis exhibited the greatest reductions in CBF. In 1 patient with affective psychosis, without clinical or CT evidence of cerebral ischemia, serial SPECT studies showed resolution of multifocal cerebral perfusion defects which paralleled clinical recovery.

  1. [Laboratory evaluation of lupus anticoagulant in Israel].

    PubMed

    Sarig, Galit; Garach-Jehoshua, Osnat; Deutch, Varda; Winder, Asher; Hyam, Esti; Katz, Ben Zion; Lahav, Judith; Cassel, Aliza; Zivelin, Ariella; Souroujon, Moshe; Shimron, Orit

    2010-05-01

    Lupus anticoagulants (LAC) are antibodies which are detected by a prolongation of phospholipid-dependent coagulation assays, and are associated with thrombotic events and pregnancy complications in patients with the antiphospholipid syndrome. The antiphospholipid syndrome is defined by arterial or venous thrombosis and/or pregnancy morbidity and by laboratory diagnosis of antiphospholipid antibodies. The laboratory diagnosis is based on LAC and/or anticardiolipin and/or anti-beta2-glycoprotein I antibodies present in plasma, on two or more occasions at least 12 weeks apart. ALthough the presence of LAC correlates best with thrombosis, the Laboratory testing of LAC is not well standardized. In this article, the Laboratory evaluation of LAC will be explained, including the different tests that are recommended by the Israeli Sub-committee of Thrombosis and Hemostasis Laboratories, the possibility to evaluate LAC in patients treated with antithrombotic therapy, and how to report and interpret the results.

  2. Neuropsychiatric Systemic Lupus Erythematosus: A Diagnostic Conundrum

    PubMed Central

    Joseph, Vivek; Anil, Rahul; Aristy, Sary

    2016-01-01

    A 70-year-old man presented with complaints of rapid cognitive decline and new onset leukopenia. The patient had a 17-year history of refractory seizures. Detailed review of symptoms and investigations revealed the patient met American College of Rheumatology (ACR) diagnostic criteria for systemic lupus erythematosus (SLE). The patient had high titer ANA with a strongly positive dsDNA. Immunosuppressive therapy with hydroxychloroquine and mycophenolate mofetil led to significant improvement in cognition and seizures. Neuropsychiatric SLE should be considered a potential differential diagnosis for patients presenting with seizures or cognitive decline. Moreover, neuropsychiatric manifestations especially seizures are an early event in the disease course of SLE. Hence, we believe that early diagnosis of SLE by neuropsychiatric manifestations will not only lead to better control of CNS symptoms but early immunosuppressive therapy could control the progression of the underlying autoimmune disease. PMID:27635183

  3. Ocular manifestations in systemic lupus erythematosus.

    PubMed

    Silpa-archa, Sukhum; Lee, Joan J; Foster, C Stephen

    2016-01-01

    Systemic lupus erythematosus (SLE) can involve many parts of the eye, including the eyelid, ocular adnexa, sclera, cornea, uvea, retina and optic nerve. Ocular manifestations of SLE are common and may lead to permanent blindness from the underlying disease or therapeutic side effects. Keratoconjunctivitis sicca is the most common manifestation. However, vision loss may result from involvement of the retina, choroid and optic nerve. Ocular symptoms are correlated to systemic disease activity and can present as an initial manifestation of SLE. The established treatment includes prompt systemic corticosteroids, steroid-sparing immunosuppressive drugs and biological agents. Local ocular therapies are options with promising efficacy. The early recognition of disease and treatment provides reduction of visual morbidity and mortality.

  4. Systemic lupus erythematosus--2005 annus mirabilis?

    PubMed

    Isenberg, David; Rahman, Anisur

    2006-03-01

    We are about to enter a new era in the treatment of patients with systemic lupus erythematosus (SLE). For the past 40 years hydroxychloroquine sulfate and corticosteroids, together with varying combinations of immunosuppressive drugs, have been the main treatments for SLE. Although effective for many patients, some patients fail to respond to these drugs and even more suffer from major side effects due to the generalized nature of the immunosuppression. In this article we review the remarkable confluence of new therapies ranging from newer immunosuppressive drugs with fewer side effects, such as mycophenolate mofetil, to the more targeted approaches offered by biological agents. These agents have been designed to block molecules such as CD20, CD22 and interleukin-10 that are thought to have an integral part in the development of SLE. This wolf might not yet be about to become extinct but its survival is increasingly under threat!

  5. New therapies for systemic lupus erythematosus

    PubMed Central

    Goldblatt, F; Isenberg, D A

    2005-01-01

    In the past 40 years, prognosis for patients with systemic lupus erythematosus (SLE) has improved, with 10-year survival now approximately 90%. This is due probably to a combination of earlier disease diagnosis and diagnosis of milder disease, due in part to availability of multiple serological tests for SLE, use of steroids and other immunosuppressive agents, and availability of renal dialysis and transplantation. Despite this, however, the potential for significant morbidity and mortality remains in the group of patients with partially responsive or treatment resistant disease. More recently, advancements in the understanding of molecular mechanisms involved in the pathogenesis of SLE have translated to the development of novel therapies, offering possible alternatives to this patient cohort. Discussion of these pharmacological options and ongoing research forms the basis of this review. PMID:15807843

  6. Novel treatments for systemic lupus erythematosus.

    PubMed

    Gayed, Mary; Gordon, Caroline

    2010-11-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease that is associated with the production of autoantibodies, and with considerable morbidity and mortality. There has been much interest in developing more specific therapies for this disease, which is currently managed with immunosuppressive drugs, predominantly corticosteroids, azathioprine, methotrexate and cyclophosphamide, in combination with hydroxychloroquine. Mycophenolate mofetil has been demonstrated to be as efficacious as cyclophosphamide in patients with lupus nephritis, and is being used increasingly in the clinic despite not being licensed for this indication. Novel methods of reducing autoantibody formation in SLE include the use of mAbs that modulate and/or deplete B-cells (anti-CD22 and anti-CD20 antibodies, respectively), or that interfere with the stimulatory effects of the soluble factor B-lymphocyte stimulator (anti-BLys antibodies). Alternative approaches include the use of atacicept (Merck Serono), a transmembrane activator and calcium modulator ligand interactor (TACI)-Ig fusion protein, which inhibits B-cell stimulation by binding to BLys and a profileration-inducing ligand (APRIL), or toleragens such as abetimus. Blocking costimulatory molecule interactions, such as the CD40-CD40 ligand interaction with mAbs and the CD28-B7 interaction with a soluble cytotoxic T-lymphocyte antigen 4 (CTLA-4)-IgG1 construct (abatacept), has also been attempted as a therapeutic strategy for SLE. The most promising strategy for a new drug for SLE is belimumab (Human Genome Sciences/GlaxoSmithKline), an anti-BLys antibody, as two phase III clinical trials with this drug recently met their primary endpoints. In this review, these novel approaches to the treatment of SLE, including the potential of targeting cytokine pathways involved in autoimmunity, are discussed.

  7. Interferon-gamma and cortisol levels in cerebrospinal fluid and its relationship to the etiology of aseptic meningoencephalitis.

    PubMed

    Holub, M; Beran, O; Lacinová, Z; Cinek, O; Chalupa, P

    2006-01-01

    The aim of the study was to analyze the concentrations of Th1/Th2 cytokines and cortisol in the cerebrospinal fluid (CSF) from patients with aseptic meningoencephalitis (AM). The study enrolled 37 patients with AM and 11 control subjects. CSF concentrations of IL-2, IL-4, IL-5, IL-10, IFN-gamma, and TNF-alpha were analyzed using cytokine bead array and flow cytometry; CSF cortisol concentrations were measured by a RIA method. Cortisol was detected in 37 CSF samples (100%) from patients with AM, and it was significantly elevated in comparison to control subjects. IFN-gamma was detected in 32 CSF samples (86.5%) and IL-10 was detectable in 9 CSF samples (24.3%). The CSF cortisol levels correlated negatively with the duration of AM. The intrathecal concentration of IFN-gamma correlated positively with CSF numbers of leukocytes and lymphocytes, and negatively with the duration of AM. The etiology of AM influenced the CSF cortisol concentration, which was significantly higher in patients with tick-borne encephalitis when compared to persons with AM of unknown origin and control subjects. The results indicate that the prevailing intrathecal immune reaction during AM is shifted to a Th1-like response, whereas anti-inflammatory response in the brain is executed by the effect of cortisol.

  8. Case report of early aseptic loosening of total hip arthroplasty in monostotic paget disease, a diagnostic challenge.

    PubMed

    Crego-Vita, Diana; Aedo-Martín, Daniel; Sánchez-Pérez, Coral

    2016-01-01

    Paget's disease of bone is a localised chronic osteopathy which produces bone deformities, bone hypervascularity, structural weakness and altered joint biomechanics. Although radiological diagnosis of Paget's disease of bone is usually straightforward, monostotic cases may potentially raise specific problems which require invasive and expensive procedures such as bone biopsies. The pelvis and upper femur are frequently affected, resulting in disabling hip disease that may require total hip arthroplasty. We report a case of Paget disease of bone in an 84-year-old woman, which was initially identified as avascular necrosis of the hip, reason for which she underwent total hip arthroplasty. During follow up, the patient complained about hip pain and in a few months she was not able to walk because of an early loosening with bone destruction. Radiological and laboratory exams were carried out with normal results except for alkaline phosphatase (AP). After treatment with biphosphonates hip pain relieved but hip reconstruction was not possible. In this paper we present an early aseptic loosening of hip arthroplasty due to monostotic Paget's disease of bone, a rare ethiology of loosening which poses particular diagnostic difficulties prompting an excessive use of excisional biopsies.

  9. Aseptic non-touch technique and catheter-related bloodstream infection in children receiving parenteral nutrition at home

    PubMed Central

    Evans, Victoria; Hughes, Anna; Hill, Susan

    2015-01-01

    Objectives Parenteral nutrition (PN) at home is an acceptable form of delivering long-term PN for children with intestinal failure. Catheter-related bloodstream infection (CRBSI) is one of the serious complications of long-term PN and can lead to increasing morbidity and mortality. Using aseptic non-touch technique (ANTT) was proven to decrease the incidence of CRBSI in hospital patients. In this study we aimed to review the incidence of CRBSI in children receiving PN at home in our institution using the ANTT and a simplified training programme for parents and carers. Methods We retrospectively collected clinical and microbiological data on all children with intestinal failure (IF) who were on treatment with PN at home under our specialist IF rehabilitation service between November 2012 and November 2013. Results Thirty-five children were included, 16 of whom did not have any infection recorded during the study period. The overall CRBSI rate was 1.3 infections per 1000 line-days, with Staphylococcus being the commonest organism. Twenty-one children did not require catheter change and the overall catheter changes were 1.8 per 1000 line-days. Conclusion In this article, we report a low incidence of CRBSI in a single institution by using the principle of ANTT for accessing central venous catheters combined with a simplified, nurse-led, two-week standardised training programme for parents of children going home on PN. PMID:26279849

  10. Pyrolysis of aseptic packages (tetrapak) in a laboratory screw type reactor and secondary thermal/catalytic tar decomposition.

    PubMed

    Haydary, J; Susa, D; Dudáš, J

    2013-05-01

    Pyrolysis of aseptic packages (tetrapak cartons) in a laboratory apparatus using a flow screw type reactor and a secondary catalytic reactor for tar cracking was studied. The pyrolysis experiments were realized at temperatures ranging from 650 °C to 850 °C aimed at maximizing of the amount of the gas product and reducing its tar content. Distribution of tetrapak into the product yields at different conditions was obtained. The presence of H2, CO, CH4, CO2 and light hydrocarbons, HCx, in the gas product was observed. The Aluminum foil was easily separated from the solid product. The rest part of char was characterized by proximate and elemental analysis and calorimetric measurements. The total organic carbon in the tar product was estimated by elemental analysis of tars. Two types of catalysts (dolomite and red clay marked AFRC) were used for catalytic thermal tar decomposition. Three series of experiments (without catalyst in a secondary cracking reactor, with dolomite and with AFRC) at temperatures of 650, 700, 750, 800 and 850 °C were carried out. Both types of catalysts have significantly affected the content of tars and other components in pyrolytic gases. The effect of catalyst on the tetrapack distribution into the product yield on the composition of gas and on the total organic carbon in the tar product is presented in this work.

  11. Broad-range 16S rRNA PCR with cerebrospinal fluid may be unreliable for management of postoperative aseptic meningitis.

    PubMed

    Zarrouk, Virginie; Leflon-Guibout, Véronique; Robineaux, Sébastien; Kalamarides, Michel; Nicolas-Chanoine, Marie-Hélène; Sterkers, Olivier; Fantin, Bruno

    2010-09-01

    We previously demonstrated that discontinuing presumptive antibiotic treatment in cases of negative conventional cultures is safe and effective for patients with postoperative aseptic meningitis (PAM). Here, we prospectively investigated 32 patients with postoperative meningitis. All 26 patients with PAM diagnosed on the basis of conventional cultures demonstrated negative 16S rRNA PCR results. Our results suggest that the PCR technique does not change PAM management.

  12. Idiopathic Facial Aseptic Granuloma in a 13-Year-Old Boy Dramatically Improved with Oral Doxycycline and Topical Metronidazole: Evidence for a Link with Childhood Rosacea

    PubMed Central

    Orion, Camille; Sfecci, Alicia; Tisseau, Laurent; Darrieux, Laure; Safa, Gilles

    2016-01-01

    Idiopathic facial aseptic granuloma (IFAG) is a rare, benign pediatric dermatological lesion that occurs in children between 8 months and 13 years of age. The pathogenesis of IFAG is still unclear but it is likely to be associated with granulomatous rosacea in childhood. Here we describe a case of IFAG in a 13-year-old boy who showed a dramatic response to oral doxycycline and topical metronidazole, which supports the hypothesis that IFAG may belong to the spectrum of rosacea. PMID:27920676

  13. Postextraction hemorrhage in a young male patient with systemic lupus erythematosus.

    PubMed

    Schwartz, S; Esseltine, D W

    1984-03-01

    A case of a 13-year-old boy with prolonged bleeding after tooth extraction is reported. This was the first manifestation of systemic lupus erythematosus found to be associated with circulating anticoagulants, including the "lupus anticoagulant," and possible hypoprothrombinemia.

  14. Feasibility of aseptic processing of a low-acid multiphase food product (salsa con queso) using a continuous flow microwave system.

    PubMed

    Kumar, P; Coronel, P; Simunovic, J; Sandeep, K P

    2007-04-01

    Aseptic processing of a low-acid multiphase food product using a continuous flow microwave heating system can combine the advantages of an aseptic process along with those of microwave heating. Dielectric properties of 2 different brands of 1 such product (salsa con queso) were measured under continuous flow conditions at a temperature range of 20 to 130 degrees C. At 915 MHz, the dielectric constant ranged from 58.7 at 20 degrees C to 41.3 at 130 degrees C with dielectric loss factor ranging from 41.0 at 20 degrees C to 145.5 at 130 degrees C. The loss tangent at 915 MHz ranged from 0.61 at 20 degrees C to 3.52 at 130 degrees C. The temperature profiles at the outlet during processing of salsa con queso in a 5-kW microwave unit showed a narrow temperature distribution between the center and the wall of the tube. The study showed the feasibility of aseptic processing of salsa con queso using a continuous flow microwave system.

  15. Strontium-doped calcium polyphosphate/ultrahigh molecular weight polyethylene composites: A new class of artificial joint components with enhanced biological efficacy to aseptic loosening.

    PubMed

    Gu, Zhipeng; Huang, Bingxue; Li, Yiwen; Tian, Meng; Li, Li; Yu, Xixun

    2016-04-01

    To enhance implant stability and prolong the service life of artificial joint component, a new approach was proposed to improve the wear resistance of artificial joint component and endow artificial joint component with the biological efficacy of resistance to aseptic loosening. Strontium calcium polyphosphate (SCPP) were interfused in ultrahigh molecular weight polyethylene (UHMWPE) by a combination of liquid nitrogen ball-milling and flat-panel curing process to prepare the SCPP/UHMWPE composites. The micro-structure, mechanical characterization, tribological characterization and bioactivities of various SCPP/UHMWPE composites were investigated. The results suggested that this method could statistically improve the wear resistance of UHMWPE resulting from a good SCPP particle dispersion. Moreover, it is also observed that the SCPP/UHMWPE composites-wear particles could promote the production of OPG by osteoblasts and decrease the production of RANKL by osteoblasts, and then increase the OPG/RANKL ratio. This indicated that the SCPP/UHMWPE composites had potential efficacy to prevent and treat aseptic loosening. Above all, the SCPP/UHMWPE composites with a suitable SCPP content would be the promising materials for fabricating artificial joint component with ability to resist aseptic loosening.

  16. [Papular mucinosis associated with lupus erythematosus. A case presentation and review of the literature].

    PubMed

    Revier, J; Kienzler, J L; Blanc, D; Coulon, G; Saint-Hillier, Y; Laurent, R

    1982-01-01

    A 36-year-old woman presented with a widespread papulonodular eruption followed by cutaneous and systemic manifestations of lupus erythematosus. Both conditions, papular mucinosis and lupus erythematosus were investigated by histopathology, immunofluorescence and electron microscopy. Referring to seven other cases reported in the literature, the possible relationship between lupus erythematosus and cutaneous mucinosis is discussed. It seemed that the cutaneous deposits of mucine were secondary to lupus erythematosus and not a simultaneous occurrence of the two diseases.

  17. Lipofilling: A New Therapeutic Option for the Treatment of Lupus Panniculitis-Induced Atrophy

    PubMed Central

    Polivka, Laura; Revol, Marc; Battistella, Maxime; Bachelez, Hervé

    2016-01-01

    Lupus panniculitis is a rare manifestation of cutaneous lupus erythematosus, which may lead to major aesthetic sequelae with a severe impact on patients’ quality of life. We report 2 cases supporting the short- and long-term efficacy and safety of lipofilling in the treatment of lupus panniculitis-induced atrophy. These observations pave the way for prospective, larger-scale studies in patients with scarring lupus panniculitis, provided that the autoimmune pathogenic process is in complete, stable remission. PMID:27920685

  18. Ethnicity and mortality from systemic lupus erythematosus in the US

    PubMed Central

    Krishnan, E; Hubert, H B

    2006-01-01

    Objective To study ethnic differences in mortality from systemic lupus erythematosus (lupus) in two large, population‐based datasets. Methods We analysed the national death data (1979–98) from the National Center for Health Statistics (Hyattsville, Maryland, USA) and hospitalisation data (1993–2002) from the Nationwide Inpatient Sample (NIS), the largest hospitalisation database in the US. Results The overall, unadjusted, lupus mortality in the National Center for Health Statistics data was 4.6 per million, whereas the proportion of in‐hospital mortality from the NIS was 2.9%. African‐Americans had disproportionately higher mortality risk than Caucasians (all‐cause mortality relative risk adjusted for age = 1.24 (women), 1.36 (men); lupus mortality relative risk = 3.91 (women), 2.40 (men)). Excess risk was found among in‐hospital deaths (odds ratio adjusted for age = 1.4 (women), 1.3 (men)). Lupus death rates increased overall from 1979 to 98 (p<0.001). The proportional increase was greatest among African‐Americans. Among Caucasian men, death rates declined significantly (p<0.001), but rates did not change substantially for African‐American men. The African‐American:Caucasian mortality ratio rose with time among men, but there was little change among women. In analyses of the NIS data adjusted for age, the in‐hospital mortality risk decreased with time among Caucasian women (p<0.001). Conclusions African‐Americans with lupus have 2–3‐fold higher lupus mortality risk than Caucasians. The magnitude of the risk disparity is disproportionately higher than the disparity in all‐cause mortality. A lupus‐specific biological factor, as opposed to socioeconomic and access‐to‐care factors, may be responsible for this phenomenon. PMID:16627544

  19. Evaluating fatigue in lupus-prone mice: preliminary assessments.

    PubMed

    Meeks, Allison; Larson, Susan J

    2012-01-01

    Fatigue is a debilitating condition suffered by many as the result of chronic disease, yet relatively little is known about its biological basis or how to effectively manage its effects. This study sought to evaluate chronic fatigue by using lupus-prone mice and testing them at three different time periods. Lupus-prone mice were chosen because fatigue affects over half of patients with Systemic Lupus Erythematosus. Eleven MLR⁺/(+) (genetic controls) and twelve MLR/MpJ-Fas/J (MRL/lpr; lupus-prone) mice were tested three times: once at 12, 16 and 20 weeks of age. All mice were subjected to a variety of behavioral tests including: forced swim, post-swim grooming, running wheel, and sucrose consumption; five of the MLR⁺/(+) and five of the MLR/lpr mice were also tested on a fixed ratio-25 operant conditioning task. MRL/lpr mice showed more peripheral symptoms of lupus than controls, particularly lymphadenopathy and proteinuria. Lupus mice spent more time floating during the forced swim test and traveled less distance in the running wheel at each testing period. There were no differences between groups in post-swim grooming or in number of reinforcers earned in the operant conditioning task indicating the behavioral changes were not likely due simply to muscle weakness or motivation. Correlations between performance in the running wheel, forced swim test and sucrose consumption were conducted and distance traveled in the running wheel was consistently negatively correlated with time spent floating. Based on these data, we conclude that the lupus-prone mice were experiencing chronic fatigue and that running wheel activity and floating during a forced swim test can be used to evaluate fatigue, although these data cannot rule out the possibility that both fatigue and a depressive-like state were mediating these effects.

  20. Psoriasis in systemic lupus erythematosus: a single-center experience.

    PubMed

    Tselios, Konstantinos; Yap, Kristy Su-Ying; Pakchotanon, Rattapol; Polachek, Ari; Su, Jiandong; Urowitz, Murray B; Gladman, Dafna D

    2017-04-01

    The coexistence of psoriasis with systemic lupus erythematosus (SLE) has been reported in limited case series, raising hypotheses about shared pathogenetic mechanisms. Nevertheless, important differences regarding treatment do exist. The aim of the present study was to determine the prevalence and characteristics of psoriasis in a defined cohort of lupus patients. Patients with psoriasis were retrieved from the University of Toronto Lupus Clinic from its inception in 1970 up to 2015. Charts were hand-searched to collect information concerning demographic, clinical, and therapeutic variables. Patients were matched with non-psoriasis lupus patients to identify the impact of supervening psoriasis on lupus activity, damage accrual, and venous thromboembolic (VTEs) and cardiovascular events (CVEs). Psoriasis was diagnosed in 63 patients (49 females, 14 males) for a prevalence of 3.46% (63/1823). The male-to-female ratio was significantly higher in non-psoriasis patients (0.286 vs. 0.138, p = 0.017). Plaque psoriasis was the most prominent type (55/63, 87.3%) whereas three patients had pustular disease; one had psoriatic arthritis. Nine patients (14.3%) were administered systemic treatment with methotrexate (n = 5), azathioprine (n = 1), ustekinumab (n = 3), and etanercept (n = 1). Psoriasis was definitely deteriorated by hydroxychloroquine in one patient. There was no significant impact of psoriasis on disease activity, damage accrual, VTEs, and CVEs. The prevalence of psoriasis was twice as high as that of the general Canadian population in this lupus cohort. Plaque psoriasis was the most prominent subtype, and topical treatment was adequate in the majority of patients. Supervening psoriasis had no significant impact on lupus activity and damage accrual.

  1. Novel approaches to therapy for systemic lupus erythematosus: update 2005.

    PubMed

    Zandman-Goddard, Gisele; Orbach, Hedi; Shoenfeld, Yehuda

    2005-07-01

    This review covers the major advances in the therapeutic potentials related to systemic lupus erythematosus published in Medline between 2000 and February 2005. Controlled, open and Phase I-III trials were included. Anecdotal reports were excluded. Several trials have defined the role of cyclophosphamide, methotrexate, antimalarials, hormonal treatment and mycophenolate mofetil (Cellcept) in the management of systemic lupus erythematosus. The aims of novel biologics for systemic lupus erythematosus are to target the autoimmune disease at different points: B-cell depletion (rituximab [Rituxan], anti-BLys antibodies [Lymphostat-B]), inhibition of T-B interaction (rituximab), blockade of cytokines (anti-interleukin-10 antibodies), manipulation of idiotypes (intravenous immunoglobulin), tolerance induction to DNA and immunoglobulin-peptides and peptide therapy (abetimus sodium [Riquent]). Low-dose intravenous cyclophosphamide (Euro-Lupus protocol) is as effective as the conventional National Institutes of Health protocol and is also associated with less toxicity. Stem cell transplantation for severe disease induces remission in most patients, however, the relapse rate in a third of patients and the associated morbity and mortality restricts its use to selected patients with life-threatening disease. Intravenous immunoglobulin, although utilized in open trials, is effective and safe for various manifestations of systemic lupus erythematosus. Major advances have been associated with mycophenolate mofetil and rituximab. Mycophenolate mofetil is effective for induction and maintenance therapy of lupus proliferative glomerulonephritis and is associated with fewer adverse events than monthly intravenous cyclophosphamide. Rituximab is a promising agent, and although its utilization is presently limited, it appears to be effective for lupus patients with severe disease.

  2. Abdominal manifestations in childhood‐onset systemic lupus erythematosus

    PubMed Central

    Richer, O; Ulinski, T; Lemelle, I; Ranchin, B; Loirat, C; Piette, J C; Pillet, P; Quartier, P; Salomon, R; Bader‐Meunier, B

    2007-01-01

    Background Childhood‐onset lupus erythematosus is a rare disorder of unknown origin. Objectives To describe the frequency of gastrointestinal manifestations at presentation of systemic lupus erythematosus SLE and at follow‐up, and discuss the specific causes of these manifestations. Methods Medical records of 201 patients with childhood‐onset SLE followed up in French paediatric nephrological, haematological and rheumatological centres were reviewed and abstracted for gastrointestinal manifestations. Results Gastrointestinal involvement was recorded in 39 (19%) children. The median (range) age at the time of initial gastrointestinal manifestations was 11.3 (4.5–16) years. Gastrointestinal symptoms were present at or occurred within 1 month after diagnosis in 32% patients. Abdominal pain was the most frequent symptom, present in 34 (87%) patients. It was mostly related to lupus involvement, especially ascites (n = 14) and pancreatitis (n = 12), more rarely to treatment‐induced events (n = 1) or infection (n = 1) and never to events unrelated to SLE. Three children with surgical abdomen underwent a laparotomy before SLE was diagnosed, with a final diagnosis of lupus peritonitis and lupus acalculous cholecystitis. C reactive protein values were <40 mg/l in all but two patients who had surgical abdomen. Abdominal ultrasonography and computed tomography scans were abnormal in 58% and 83% of the evaluated patients, respectively. Corticosteroids, associated with intravenous cyclophospamide in eight patients, led to complete remission of gastrointestinal involvement in 30 of 31 treated patients. Conclusion Gastrointestinal involvement is common in children with SLE, and is mainly due to primary lupus involvement. Corticoidsteroid treatment should be promptly considered in children with lupus presenting with abdominal pain after infectious disease; side effects of treatment and intestinal perforation have been excluded. PMID:16818463

  3. What Black Women Should Know about Lupus: Ideas for Community Programs.

    ERIC Educational Resources Information Center

    National Inst. of Arthritis and Musculoskeletal and Skin Diseases (NIH), Bethesda, MD.

    Lupus is a serious health problem that mainly affects young women between the ages of 15 and 44. Although people of all races may get lupus, black women have three times higher rates of incidence, prevalence, and mortality than white women. With early detection and proper treatment, most people with lupus can lead a normal life. This kit is…

  4. Delayed diagnosis in a case of lupus vulgaris with unusual localization.

    PubMed

    Ceylan, Can; Gerceker, Bengu; Ozdemir, Fezal; Kazandi, Alican

    2004-01-01

    Lupus vulgaris is the most common form of cutaneous tuberculosis, and the usual sites of involvement are the head and neck. We present a forty-six-year-old woman with lupus vulgaris on the external surface of the left leg and foot, an unusual site. Based on histopathological and clinical features, this case was diagnosed as lupus vulgaris with unusual localization.

  5. 75 FR 35493 - Guidance for Industry on Systemic Lupus Erythematosus-Developing Medical Products for Treatment...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-22

    ... Systemic Lupus Erythematosus--Developing Medical Products for Treatment; Availability AGENCY: Food and Drug... availability of a guidance for industry entitled ``Systemic Lupus Erythematosus--Developing Medical Products..., therapeutic biological products, and medical devices for the treatment of systemic lupus erythematosus...

  6. Probable systemic lupus erythematosus with cell-bound complement activation products (CB-CAPS).

    PubMed

    Lamichhane, D; Weinstein, A

    2016-08-01

    Complement activation is a key feature of systemic lupus erythematosus (SLE). Detection of cell-bound complement activation products (CB-CAPS) occurs more frequently than serum hypocomplementemia in definite lupus. We describe a patient with normocomplementemic probable SLE who did not fulfill ACR classification criteria for lupus, but the diagnosis was supported by the presence of CB-CAPS.

  7. Validation of the Lupus Nephritis Clinical Indices in Childhood-Onset Systemic Lupus Erythematosus

    PubMed Central

    Mina, Rina; Abulaban, Khalid; Klein-Gitelman, Marisa; Eberhard, Anne; Ardoin, Stacy; Singer, Nora; Onel, Karen; Tucker, Lori; O’Neil, Kathleen; Wright, Tracey; Brooks, Elizabeth; Rouster-Stevens, Kelly; Jung, Lawrence; Imundo, Lisa; Rovin, Brad; Witte, David; Ying, Jun; Brunner, Hermine I.

    2015-01-01

    Objective To validate clinical indices of lupus nephritis (LN) activity and damage when used in children against the criterion standard of kidney biopsy findings. Methods In 83 children requiring kidney biopsy the SLE Disease Activity Index Renal Domain (SLEDAI-R); British Isles Lupus Assessment Group index Renal Domain (BILAG-R), Systemic Lupus International Collaborating Clinics Renal Activity (SLICC-RAS) and Damage Index Renal Domain (SDI-R) were measured. Fixed effect and logistic models were done to predict International Society of Nephrology/Renal Pathology Society (ISN/RPS) class; low/moderate vs. high LN-activity [NIH Activity Index (NIH-AI) score: ≤ 10 vs. > 10; Tubulointerstitial Activity Index (TIAI) score: ≤ 5 vs. > 5) or the absence vs. presence of LN chronicity [NIH Chronicity Index (NIH-CI) score: 0 vs. ≥ 1]. Results There were 10, 50 and 23 patients with class I/II, III/IV and V, respectively. Scores of the clinical indices did not differentiate among patients by ISN/RPS class. The SLEDAI-R and SLICC-RAS but not the BILAG-R differed with LN-activity status defined by NIH-AI scores, while only the SLEDAI-R scores differed between LN-activity status based on TIAI scores. The sensitivity and specificity of the SDI-R to capture LN chronicity was 23.5% and 91.7%, respectively. Despite designed to measure LN-activity, SLICC-RAS and SLEDAI-R scores significantly differed with LN chronicity status. Conclusion Current clinical indices of LN fail to discriminate ISN/RPS Class in children. Despite its shortcomings, the SLEDAI-R appears to best for measuring LN activity in a clinical setting. The SDI-R is a poor correlate of LN chronicity. PMID:26213987

  8. [A case report of childhood systemic lupus erythematosus complicated with lupus cystitis].

    PubMed

    Kurosawa, Rumiko; Miyamae, Takako; Imagawa, Tomoyuki; Katakura, Shigeki; Mori, Masaaki; Aihara, Yuhkoh; Yokota, Shumpei

    2006-06-01

    The patient was a 13-year-old girl. In August 2000, she presented with a fever, together with diarrhea, vomiting, arthralgia, nasal bleeding and malaise, and was examined by another physician. Because her platelet count was low, and there were positive reactions for anti-nuclear antibodies, anti-DNA antibodies and platelet-associated IgG, idiopathic thrombopenic purpura, and systemic lupus erythematosus (SLE) was suspected. From January 2001, when she caught measles, she reported abdominal pain, and urinalysis indicated urinary protein and occult blood, and the left kidney was found hydronephrotic. At the same time left ureter stenosis and dilatation were demonstrated. Symptoms were disappeared by hydration and treatment with NSAIDs, but 2 months later fever and erythematous patches seen on both cheeks led to the proper diagnosis of SLE, and she was admitted to our hospital. Intravenous pyelography revealed hydronephrosis on left kidney, constriction and dilatation of the left ureter, and intracystic endoscopy showed erythema at the orifice of the left ureter. The pathological examination indicated the presence of vasculitis, and finally lupus cystitis was diagnosed. Intravenous cyclophosphamide (IVCY)-pulse therapy was introduced to a total of 8 times over the period of a year, and maintenance therapy with predonisolone and azathioprin was also used. After completion of the IVCY-pulse therapy, the hydronephrosis and constriction of the ureter were disappeared. No side effects of IVCY-pulses were observed, and the patient is now in remission. We reported a case of childhood SLE complicated with lupus cystitis and successfully treated by IVCY-pulse therapy and maintenance predonisolone and azathioprin.

  9. Derivation and Validation of Systemic Lupus International Collaborating Clinics Classification Criteria for Systemic Lupus Erythematosus

    PubMed Central

    Petri, Michelle; Orbai, Ana-Maria; Alarcón, Graciela S.; Gordon, Caroline; Merrill, Joan T.; Fortin, Paul R.; Bruce, Ian N.; Isenberg, David; Wallace, Daniel J.; Nived, Ola; Sturfelt, Gunnar; Ramsey-Goldman, Rosalind; Bae, Sang-Cheol; Hanly, John G.; Sanchez-Guerrero, Jorge; Clarke, Ann; Aranow, Cynthia; Manzi, Susan; Urowitz, Murray; Gladman, Dafna; Kalunian, Kenneth; Costner, Melissa; Werth, Victoria P.; Zoma, Asad; Bernatsky, Sasha; Ruiz-Irastorza, Guillermo; Khamashta, Munther A.; Jacobsen, Soren; Buyon, Jill P.; Maddison, Peter; Dooley, Mary Anne; van Vollenhoven, Ronald F.; Ginzler, Ellen; Stoll, Thomas; Peschken, Christine; Jorizzo, Joseph L.; Callen, Jeffrey P.; Lim, S. Sam; Fessler, Barri J.; Inanc, Murat; Kamen, Diane L.; Rahman, Anisur; Steinsson, Kristjan; Franks, Andrew G.; Sigler, Lisa; Hameed, Suhail; Fang, Hong; Pham, Ngoc; Brey, Robin; Weisman, Michael H.; McGwin, Gerald; Magder, Laurence S.

    2012-01-01

    Objective The Systemic Lupus Collaborating Clinics (SLICC) revised and validated the American College of Rheumatology (ACR) SLE classification criteria in order to improve clinical relevance, meet stringent methodology requirements and incorporate new knowledge in SLE immunology. Methods The classification criteria were derived from a set of 702 expert-rated patient scenarios. Recursive partitioning was used to derive an initial rule that was simplified and refined based on SLICC physician consensus. SLICC validated the classification criteria in a new validation sample of 690 SLE patients and controls. Results Seventeen criteria were identified. The SLICC criteria for SLE classification requires: 1) Fulfillment of at least four criteria, with at least one clinical criterion AND one immunologic criterion OR 2) Lupus nephritis as the sole clinical criterion in the presence of ANA or anti-dsDNA antibodies. In the derivation set, the SLICC classification criteria resulted in fewer misclassifications than the current ACR classification criteria (49 versus 70, p=0.0082), had greater sensitivity (94% versus 86%, p<0.0001) and equal specificity (92% versus 93%, p=0.39). In the validation set, the SLICC Classification criteria resulted in fewer misclassifications (62 versus 74, p=0.24), had greater sensitivity (97% versus 83%, p<0.0001) but less specificity (84% versus 96%, p<0.0001). Conclusions The new SLICC classification criteria performed well on a large set of patient scenarios rated by experts. They require that at least one clinical criterion and one immunologic criterion be present for a classification of SLE. Biopsy confirmed nephritis compatible with lupus (in the presence of SLE autoantibodies) is sufficient for classification. PMID:22553077

  10. Satisfaction with control of systemic lupus erythematosus and lupus nephritis: physician and patient perspectives

    PubMed Central

    Mozaffarian, Neelufar; Lobosco, Steve; Lu, Peng; Roughley, Adam; Alperovich, Gabriela

    2016-01-01

    Purpose Patient satisfaction with disease control of systemic lupus erythematosus (SLE) is an important component of medical management. This analysis evaluated patient and physician satisfaction with disease control of SLE, factors associated with satisfaction/dissatisfaction, and the degree of physician–patient concordance of these parameters. Patients and methods Data were extracted from the US Adelphi Real World Lupus Disease Specific Programme®, a cross-sectional survey of 50 rheumatologists, 25 nephrologists, and their patients with non-nephritis SLE (NNSLE) or lupus nephritis (LN). Results Physicians reported moderate or severe disease activity in 25.0% of patients with NNSLE and in 50.5% of patients with LN, and were satisfied with disease control in 78.6% (132/168) and 73.8% (152/206) of patients, respectively. For patients, 75.8% (75/99) with NNSLE were satisfied with their current treatment, compared with 65.5% (74/113) with LN. Physician–patient agreement (70.7%) on the level of satisfaction was “slight” (kappa =0.1445) for NNSLE; patients were more frequently dissatisfied than physicians with regard to joint tenderness, fatigue, anxiety, pain on movement, malar rash, and photosensitivity. Physician–patient agreement (71.4%) on the level of satisfaction was “fair” (kappa =0.3695) for LN; patients expressed greater dissatisfaction than physicians for headache, photosensitivity, and anxiety, whereas physicians were more dissatisfied with regard to joint swelling, kidney function, and blood pressure control. In general, patients with NNSLE or LN who were dissatisfied (or whose physicians were dissatisfied) were more likely to have joint swelling, joint stiffness, malar rash, hair loss, depression, and fatigue, have moderate or severe disease, or to be currently experiencing disease flare. Conclusion These data highlight the patient and physician dissatisfaction with real-world disease control of SLE. PMID:27784995

  11. Successful treatment of massive ascites due to lupus peritonitis with hydroxychloroquine in old- onset lupus erythematosus.

    PubMed

    Hammami, Sonia; Bdioui, Fethia; Ouaz, Afef; Loghmari, Hichem; Mahjoub, Sylvia; Saffar, Hamouda

    2014-01-01

    Systemic lupus erythematous (SLE) is an auto-immune disease with multiple organ involvements that occurs mainly in young women. Literature data suggest that serositis is more frequent in late-onset SLE. However, peritoneal serositis with massive ascites is an extremely rare manifestation. We report a case of old-onset lupus peritonitis treated successfully by Hydroxychloroquine. A 77-year-old Tunisian woman was hospitalized because of massive painful ascites. Her family history did not include any autoimmune disease. She was explored 4 years prior to admission for exudative pleuritis of the right lung without any established diagnosis. Physical examination showed only massive ascites. Laboratory investigations showed leucopenia: 3100/mm3, lymphopenia: 840/mm3 and trace protein (0.03 g/24 h). Ascitic fluid contained 170 cells mm(3) (67% lymphocytes), 46 g/L protein, but no malignant cells. The main etiologies of exudative ascites were excluded. She had markedly elevated anti-nuclear antibody (ANA) titer of 1/1600 and a significantly elevated titer of antibody to double-stranded DNA (83 IU/mL) with hypo-complementemia (C3 levl was at 67 mg/dL). Antibody against the Smith antigen was also positive. Relying on these findings, the patient was diagnosed with SLE and treated with Hydroxychloroquine 200 mg daily in combination with diuretics. One month later, there was no detectable ascitic fluid and no pleural effusions. Five months later she remained free from symptoms while continuing to take chloroquine. This case was characterized by old age of onset of SLE, the extremely rare initial presentation with lupus peritonitis and massive painful ascites with dramatic response to only hydroxychloroquine treatment.

  12. Systemic lupus erythematosus and thrombotic thrombocytopenia purpura: a refractory case without lupus activity.

    PubMed

    Garcia Boyero, Raimundo; Mas Esteve, Eva; Mas Esteve, Maria; Millá Perseguer, M Magdalena; Marco Buades, Josefa; Beltran Fabregat, Juan; Cañigral Ferrando, Guillermo; Belmonte Serrano, Miguel Angel

    2013-01-01

    The association between systemic lupus erythematosus (SLE) and thrombotic thrombocytopenic purpura (TTP) has been infrequently reported. Usually, patients with TTP have more SLE activity and frequent renal involvement. Here we present a case of TTP associated to low-activity SLE. The absence of renal and major organ involvement increased the difficulty in making the initial diagnosis. ADAMTS13 activity in plasma in this patient was very low, as seen in other similar cases. The evolution of the patient was poor, needing plasma exchanges and immunosuppressive therapy, including the use of rituximab.

  13. The rate of and risk factors for frequent hospitalization in systemic lupus erythematosus: results from the Korean lupus network registry.

    PubMed

    Lee, J W; Park, D J; Kang, J H; Choi, S E; Yim, Y R; Kim, J E; Lee, K E; Wen, L; Kim, T J; Park, Y W; Sung, Y K; Lee, S S

    2016-11-01

    Objectives The survival rate of patients with systemic lupus erythematosus has improved in the last few decades, but the rate of hospitalization and health care costs for these patients remain higher than in the general population. Thus, we evaluated the rate of hospitalization and associated risk factors in an inception cohort of Korean patients with lupus. Methods Of the 507 patients with systemic lupus erythematosus enrolled in the KORean lupus NETwork, we investigated an inception cohort consisting of 196 patients with systemic lupus erythematosus presenting within 6 months of diagnosis based on the American College of Rheumatology classification criteria. We evaluated the causes of hospitalization, demographic characteristics, and laboratory and clinical data at the time of systemic lupus erythematosus diagnosis of hospitalized patients and during a follow-up period. We calculated the hospitalization rate as the number of total hospitalizations divided by the disease duration, and defined "frequent hospitalization" as hospitalization more than once per year. Results Of the 196 patients, 117 (59.6%) were admitted to hospital a total of 257 times during the 8-year follow-up period. Moreover, 22 (11.2%) patients were hospitalized frequently. The most common reasons for hospitalization included disease flares, infection, and pregnancy-related morbidity. In the univariate regression analysis, malar rash, arthritis, pericarditis, renal involvement, fever, systemic lupus erythematosus disease activity index > 12, hemoglobin level < 10 mg/dl, albumin level < 3.5 mg/dl, and anti-Sjögren's syndrome A positivity were associated with frequent hospitalization. Finally, multivariate analysis showed that arthritis, pericarditis, and anti-Sjögren's syndrome A antibody positivity at the time of diagnosis were risk factors for frequent hospitalization. Conclusions Our results showed that frequent hospitalization occurred in 11.2% of hospitalized patients and

  14. The features of skin inflammation induced by lupus serum.

    PubMed

    Liu, Lena; Xu, Guangqion; Dou, Hui; Deng, Guo-Min

    2016-04-01

    We recently developed a model of lupus serum-induced skin inflammation, which was used to study the pathogenesis of skin injury in systemic lupus erythematosus (SLE). We further characterized the features of lupus serum-induced skin inflammation. This skin inflammation was evident within 3h and lasted for at least two weeks. The skin inflammation was characterized by an influx of monocytic, CD11b+cells and by a scarcity of T and B lymphocytes. Depletion of IgG from the serum abrogated the skin inflammatory response. The skin inflammation was related to lupus patients' skin history but not to SLE disease activity and type of autoantibody. The expression of TNFR1, NF-kB and MCP-1 was increased locally in skin lesions. The TLR9 ligand and lupus serum act synergistically to trigger skin inflammation. These findings suggest that this novel model is valuable for the study of the pathogenesis and therapy of skin injury in SLE.

  15. [Lupus vulgaris manifestation as a destructive nose and facial tumor].

    PubMed

    Haller, D; Reisser, C

    2009-04-01

    Lupus vulgaris is the most frequent manifestation of cutaneous tuberculosis, but in Europe it is limited to isolated cases. Mainly immunocompetent individuals are affected by this result of an endogenous reinfection on a lymphogenous-less frequently hematogenous-pathway. Lupus vulgaris has been observed to develop in more than 50% of all patients who already suffer from other manifestations of tuberculosis. The development of a squamous cell carcinoma in the lupus vulgaris is a rare complication; therefore, lupus vulgaris is deemed a facultative precancerosis.A 68-year-old female Serbo-Croatian patient presented with an extensive ulcerative nose and facial tumor. Her anamnesis included a squamous cell carcinoma of the nose that had been excised alio loco 3 years before. Further examinations revealed enlarged cervical lymphoma on both sides, and pulmonary metastases were also suspected. The tumor biopsy revealed a necrotic, granulomatous inflammation. No acid-fast rods were seen on Ziehl-Neelsen stain. The tuberculous origin of this ulcerative skin tumor-the lupus vulgaris-as an endogenous reinfection of pulmonary tuberculosis manifestation was confirmed by the detection of Mycobacterium tuberculosis DNA in polymerase chain reaction and the growth of Mycobacterium tuberculosis colonies in the bacterial culture (skin biopsy and bronchial secretion). The skin tumor as well as the pulmonary manifestation were successfully treated with combined tuberculostatic therapy and showed a dramatic response within 3 months.

  16. Prolactin has a pathogenic role in systemic lupus erythematosus.

    PubMed

    Jara, Luis J; Medina, Gabriela; Saavedra, Miguel A; Vera-Lastra, Olga; Torres-Aguilar, Honorio; Navarro, Carmen; Vazquez Del Mercado, Monica; Espinoza, Luis R

    2017-01-28

    Prolactin, a 23-kDa peptide hormone, is produced by the anterior pituitary gland and extrapituitary sites including the immune cells. Prolactin (PRL) participates in innate and adaptive immune response. PRL stimulates the immune cells by binding to receptor (PRL-R). Binding of PRL to its receptor activates the Janus kinase-signal transducer (JAK-STAT). Activation of these cascades results in endpoints such as immunoestimulator and immunosupressor action. Prolactin belongs to the network of immune-neuroendocrine interaction. Hyperprolactinemia has been found in patients with systemic lupus erythematosus (SLE), and new evidence has confirmed a significant correlation between serum PRL levels and disease activity. PRL participates in activation of SLE during pregnancy and in pathogenesis of lupus nephritis, neuropsychiatric, serosal, hematologic, articular, and cutaneous involvement. Hyperprolactinemia was associated with increase IgG concentrations, anti-DNA antibodies, immune complex, glomerulonephritis, and accelerated mortality in murine lupus. Bromocriptine, a dopamine analog that suppresses PRL secretion, was associated with decreased lupus activity, prolonged lifespan, and restoration of immune competence in experimental model. In clinical trials, bromocriptine and derivative drugs showed beneficial therapeutic effect in treating human lupus, including pregnancy. Taken together, clinical and experimental results leave little doubt that PRL indeed contributes to the pathogenesis and clinical expression of SLE.

  17. Seizure disorders in Systemic Lupus Erythematosus

    PubMed Central

    Hanly, John G.; Urowitz, Murray B.; Su, Li; Gordon, Caroline; Bae, Sang-Cheol; Sanchez-Guerrero, Jorge; Romero-Diaz, Juanita; Wallace, Daniel J; Clarke, Ann E.; Ginzler, E.M.; Merrill, Joan T.; Isenberg, David A.; Rahman, Anisur; Petri, M.; Fortin, Paul R.; Gladman, D. D.; Bruce, Ian N.; Steinsson, Kristjan; Dooley, M.A.; Khamashta, Munther A.; Alarcón, Graciela S.; Fessler, Barri J.; Ramsey-Goldman, Rosalind; Manzi, Susan; Zoma, Asad A.; Sturfelt, Gunnar K.; Nived, Ola; Aranow, Cynthia; Mackay, Meggan; Ramos-Casals, Manuel; van Vollenhoven, R.F.; Kalunian, Kenneth C.; Ruiz-Irastorza, Guillermo; Lim, Sam; Kamen, Diane L.; Peschken, Christine A.; Inanc, Murat; Theriault, Chris; Thompson, Kara; Farewell, Vernon

    2015-01-01

    Objective To describe the frequency, attribution, outcome and predictors of seizures in SLE Methods The Systemic Lupus International Collaborating Clinics (SLICC) performed a prospective inception cohort study. Demographic variables, global SLE disease activity (SLEDAI-2K), cumulative organ damage (SLICC/ACR Damage Index (SDI)) and neuropsychiatric events were recorded at enrollment and annually. Lupus anticoagulant, anticardiolipin, anti-β2 glycoprotein-I, anti-ribosomal P and anti-NR2 glutamate receptor antibodies were measured at enrollment. Physician outcomes of seizures were recorded. Patient outcomes were derived from the SF-36 mental (MCS) and physical (PCS) component summary scores. Statistical analyses included Cox and linear regressions. Results The cohort was 89.4% female with a mean follow up of 3.5±2.9 years. 75/1631 (4.6%) had ≥1 seizure, the majority around the time of SLE diagnosis. Multivariate analysis indicated a higher risk of seizures with African race/ethnicity (HR(CI):1.97 (1.07–3.63); p=0.03) and lower education status (1.97 (1.21–3.19); p<0.01). Higher damage scores (without NP variables) were associated with an increased risk of subsequent seizures (SDI=1:3.93 (1.46–10.55)); SDI=2 or 3:1.57 (0.32–7.65); SDI≥4:7.86 (0.89–69.06); p=0.03). There was an association with disease activity but not with autoantibodies. Seizures attributed to SLE frequently resolved (59/78(76%)) in the absence of anti-seizure drugs. There was no significant impact on the MCS or PCS scores. Anti-malarial drugs in absence of immunosuppressive agents were associated with reduced seizure risk (0.07(0.01–0.66); p=0.03). Conclusion Seizures occurred close to SLE diagnosis, in patients with African race/ethnicity, lower educational status and cumulative organ damage. Most seizures resolved without a negative impact on health-related quality of life. Anti-malarial drugs were associated with a protective effect. PMID:22492779

  18. Combination gene therapy targeting on interleukin-1β and RANKL for wear debris-induced aseptic loosening.

    PubMed

    Wang, H; Jia, T-H; Zacharias, N; Gong, W; Du, H-X; Wooley, P H; Yang, S-Y

    2013-02-01

    This study investigated the efficacy of a combination gene therapy to repress interleukin-1 (IL-1) and receptor activator of nuclear factor NF-kappa B ligand (RANKL) for the treatment of particulate debris-induced aseptic loosening, and tried to explore the molecular mechanism of the exogenous gene modifications on osteoclastogenesis. RAW cells activated by titanium particles were transduced with DFG-IL-1Ra (retroviral vector encoding IL-1 receptor antagonist) and AAV-OPG (adeno-associated viral vectors-osteoprotegerin) individually or in combination for 4 weeks. Pro-inflammatory cytokines in culture media were determined by enzyme-linked immunosorbent assay, and gene expressions of RANK, IL-1β, c-Fos, TRAF6, JNK1 and CPK were examined using real-time PCR. An established knee-implant-failure mouse model was employed to evaluate the efficacy of the in vivo double-gene therapy. The surgical implantation of a titanium alloy pin into the proximal tibia was followed by monthly challenge with titanium debris. Peri-implant gene transfers of IL-1Ra and OPG (respectively or in combination) were given 3 weeks after surgery. The combination of OPG and IL-1Ra gene transfer exhibited strong synergetic effects in blockage of inflammation and osteoclastogenesis at 8 weeks after gene modification. The combination therapy reversed peri-implant bone resorption and restored implant stability when compared with either single gene transduction. Real-time PCR data indicated that the action of IL-1Ra gene therapy may be mediated via the JNK1 pathway, while the reduction of osteoclastogenesis by OPG gene modification may be regulated by c-Fos expression. In addition, both gene modifications resulted in significant diminishment of TRAF6 expression.

  19. Ethnic differences in the epidemiology of cutaneous lupus erythematosus in New Zealand.

    PubMed

    Jarrett, P; Thornley, S; Scragg, R

    2016-11-01

    Background The prevalence and variation by ethnicity of cutaneous lupus in New Zealand is not known. Therefore, a cross-sectional study to determine the prevalence and variation by ethnicity of cutaneous lupus in the ethnically diverse community of South Auckland, New Zealand, was undertaken. Methods Multiple sources were examined to determine the prevalence of acute cutaneous lupus erythematosus, subacute cutaneous erythematosus and discoid lupus erythematosus. Ethnicities examined were European, Māori/Pacific and Indian/Asian. Capture-recapture was used to determine the overall population prevalence of cutaneous lupus. Results A total of 145 cases of cutaneous lupus were identified. There were 22 men and 123 women, with an average age (standard deviation), respectively, of 46.4 (±21.5) and 43.1 (±14.8) years. There were 53 cases of acute cutaneous lupus erythematosus, 19 cases of subacute cutaneous erythematosus and 66 cases of discoid lupus erythematosus. The age and sex adjusted relative risk (95% confidence interval; CI) of Māori/Pacific compared to the European population was 2.47 (95% CI 1.67-3.67) for all types of cutaneous lupus, 1.60 (95% CI 0.84-3.18) for acute cutaneous lupus erythematosus, 0.09 (95% CI 0.01-1.1) for subacute cutaneous erythematosus and 5.96 (95% CI 3.06-11.6) for discoid lupus erythematosus. The overall prevalence of cutaneous lupus was 30.1 (95% CI 25.5-35.4) per 100,000. However, capture-recapture estimated the unadjusted prevalence of cutaneous lupus to be 86.0 (95% CI 78.1-94.7) per 100,000. Conclusion Māori and Pacific people in Auckland, New Zealand, have a greater relative risk of all types of cutaneous lupus compared to the European population and a particularly high risk of discoid lupus erythematosus.

  20. Acute lupus pneumonitis followed by intestinal pseudo-obstruction in systemic lupus erythematosus: A case report

    PubMed Central

    JI, CAIHONG; YU, XING; WANG, YONG; SHI, LUFENG

    2016-01-01

    Intestinal pseudo-obstruction (IpsO) and acute lupus pneumonitis (ALP) are uncommon severe complications of systemic lupus erythematosus (SLE). The present study reports the case of a 26-year-old female who presented with abdominal pain, nausea and vomiting as initial symptoms. Computed tomography (CT) scanning revealed the jejunal wall was thickened and streaky, mimicking the presentation of intestinal obstruction. Following emergency surgery, the patient's general condition was aggravated, with evident limb erythematous rashes. A series of laboratory examinations revealed SLE, and combined with patient's medical history IpsO was diagnosed, with a disease Activity Index score of 10. During the therapeutic period, high fever, dyspnea and oxygen saturation (SaO2) reductions were detected, and CT scans indicated lung infiltration, excluding other causes through a comprehensive infectious work-up and a bronchoalveolar lavage examination. ALP was confirmed and treated with high-dose methylprednisolone and gamma globulin supplement. The patient responded well and was discharged in 2 weeks. In the one-year tapering period and after stopping corticosteroids, the patient recovered well with no relapse detected. In conclusion, the manifestation of IpsO in SLE is rare and represents a challenge for the surgeon to establish the correct diagnosis and avoid inappropriate surgical intervention. ALP may be the consequence of emergency surgery, and immediate high-dose glucocorticoid therapy is recommended. PMID:27347044

  1. [A case of systemic lupus erythematosus presenting with jaundice and lupus pneumonia].

    PubMed

    Kawai, Takako; Tominaga, Sizuo; Okouchi, Akiko; Kudo, Makoto; Katoh, Kiyoshi; Shoda, Masataka; Fujino, Masayuki A

    2005-02-01

    A 27-year-old Japanese woman was referred to our hospital for acute hepatitis in April 2002. She had been suffering from low grade fever and fatigue for a week. She also presented with dyspnea. On admission, ALT and AST were 857 U/l and 473 U/l respectively. Urine protein was 2 g/day. Chest radiograph showed bilateral infiltrative shadow and pleural effusion. She developed jaundice and her level of total bilirubin was increased to 9.6 mg/dl on May 9. Antibodies to hepatitis viruses were not detected. Testing for antimitochondrial antibodies, antismooth muscle antibodies, and antiribosomal P antibodies showed all negative. However, antinuclear antibodies were positive at titer 1:160 and anti-double stranded DNA antibodies were 130 U/ml. A diagnosis of systemic lupus erythematosus was made and oral administration of 60 mg/day prednisolon was started on May 10. Serum levels of ALT, AST and bilirubin were reduced to within normal range and pulmonary lesions were also improved. We conclude that this is a rare case of systemic lupus erythematosus presenting with acute hepatitis and jaundice.

  2. Complement-fixing properties of antinuclear antibodies distinguish drug-induced lupus from systemic lupus erythematosus.

    PubMed

    Rubin, R L; Teodorescu, M; Beutner, E H; Plunkett, R W

    2004-01-01

    The immunofluorescence antinuclear antibody (ANA) test has been widely used to monitor autoimmune disease, but its value for diagnostic purposes is compromised by low specificity and high prevalence in disease-free individuals. The capacity of autoantibodies to fix serum complement proteins when bound to antigen is an important effector function because this property is associated with acute and chronic inflammatory processes. The current study evaluates the complement-fixing properties of antinuclear antibodies (CANA) in three well-defined and clinically-related patient groups: systemic lupus erythematosus (SLE), drug-induced lupus (DIL) and drug-induced autoimmunity (DIA). Of 20 patients diagnosed with SLE, 90% displayed complement-fixing ANA while this feature was present in only two of 18 patients with DIL and no patients with DIA without associated disease even though the mean ANA titres were similar among these patient groups. CANA was significantly correlated with anti-Sm activity. Because SLE but not DIL or DIA can be a life-threatening disease associated with complement consumption in vivo, these results demonstrate that measurement of CANA is a diagnostically useful tool and may have immunopathologic implications.

  3. Dickkopf-1 Is a Biomarker for Systemic Lupus Erythematosus and Active Lupus Nephritis

    PubMed Central

    Xue, Jing; Yang, Jiali; Yang, Lijuan; Zhou, Shaolan; Ji, Chen; Wang, Xuemei; Yu, Nan

    2017-01-01

    An early diagnosis of lupus nephritis (LN) has an important clinical implication in guiding treatments of systemic lupus erythematosus (SLE) in clinical settings. In this study, the concentrations of Wnt-3A, Frizzled-8 (FZD-8), and Dickkopf-1 (DKK-1) of Wnt signaling, as well as their diagnostic values for accessing LN, were evaluated by ELISA in sera and urine of 111 SLE patients (31 with LN and 80 without LN) and 70 healthy cohorts. Significantly more abundances of DKK-1 protein were determined in both of sera and urine of SLE patients compared to healthy cohorts (p < 0.0001); in particular the serum DKK-1 concentration was even higher in LN-SLE patients relative to non-LN SLE subjects (p < 0.0001). Intriguingly, concentrations of above examined proteins in SLE patients showed no correlation between serum and urine. Moreover, a combination of DKK-1 with anti-dsDNA and/or levels of complement C3 and C4 could not increase the specificity and/or sensitivity for identification of patients with LN diseases, but both ROC curve and multiple-factor nonconditional logistic regression analysis showed that serum DKK-1 was considered better positive biomarker for identification of LN in SLE patients. These results imply that serum and/or urine DKK-1 may be a valuable and independent biomarker for identification of SLE patients with LN. PMID:28373995

  4. Metabolic Disturbances Associated with Systemic Lupus Erythematosus

    PubMed Central

    Wu, Tianfu; Xie, Chun; Han, Jie; Ye, Yujin; Weiel, Jim; Li, Quan; Blanco, Irene; Ahn, Chul; Olsen, Nancy; Putterman, Chaim; Saxena, Ramesh; Mohan, Chandra

    2012-01-01

    The metabolic disturbances that underlie systemic lupus erythematosus are currently unknown. A metabolomic study was executed, comparing the sera of 20 SLE patients against that of healthy controls, using LC/MS and GC/MS platforms. Validation of key differences was performed using an independent cohort of 38 SLE patients and orthogonal assays. SLE sera showed evidence of profoundly dampened glycolysis, Krebs cycle, fatty acid β oxidation and amino acid metabolism, alluding to reduced energy biogenesis from all sources. Whereas long-chain fatty acids, including the n3 and n6 essential fatty acids, were significantly reduced, medium chain fatty acids and serum free fatty acids were elevated. The SLE metabolome exhibited profound lipid peroxidation, reflective of oxidative damage. Deficiencies were noted in the cellular anti-oxidant, glutathione, and all methyl group donors, including cysteine, methionine, and choline, as well as phosphocholines. The best discriminators of SLE included elevated lipid peroxidation products, MDA, gamma-glutamyl peptides, GGT, leukotriene B4 and 5-HETE. Importantly, similar elevations were not observed in another chronic inflammatory autoimmune disease, rheumatoid arthritis. To sum, comprehensive profiling of the SLE metabolome reveals evidence of heightened oxidative stress, inflammation, reduced energy generation, altered lipid profiles and a pro-thrombotic state. Resetting the SLE metabolome, either by targeting selected molecules or by supplementing the diet with essential fatty acids, vitamins and methyl group donors offers novel opportunities for disease modulation in this disabling systemic autoimmune ailment. PMID:22723834

  5. Hydroxychloroquine: a multifaceted treatment in lupus.

    PubMed

    Costedoat-Chalumeau, Nathalie; Dunogué, Bertrand; Morel, Nathalie; Le Guern, Véronique; Guettrot-Imbert, Gaëlle

    2014-06-01

    The efficacy of antimalarials, especially hydroxychloroquine (HCQ), in preventing systemic lupus erythematosus (SLE) flares is well demonstrated. However, many studies show that the percentage of SLE patients treated with HCQ remains low. By blocking the toll-like receptor 7 and 9 in plasmacytoid dendritic cells, HCQ inhibits interferon-alpha production which plays a crucial role in SLE pathogenesis. In addition to reducing damage accrual in SLE patients, HCQ appears to protect against the occurrence of diabetes, thrombotic events, and dyslipidemia. As a consequence, some studies have suggested that HCQ, which is inexpensive, has a protective effect on survival in SLE patients. Thanks to the pharmacokinetic properties of HCQ (long half-life) and to the availability of its blood assay, very low or undetectable blood HCQ concentrations are a valuable marker of non-adherence to treatment, thus adding a new benefit to HCQ prescriptions. The main side effect of HCQ is retinal toxicity. This complication is very rare, but may be potentially severe, thus requiring regular screening. Retinal toxicity remains the only absolute contra-indication of HCQ in adult SLE patients. Other contra-indications are few and rare. During pregnancy and breast-feeding, HCQ continuation is not only allowed but recommended. In conclusion, the risk/benefit ratio of HCQ is excellent. Many now believe that all SLE patients should be offered this treatment.

  6. Macrophage subpopulations in systemic lupus erythematosus.

    PubMed

    Orme, Jacob; Mohan, Chandra

    2012-02-01

    Systemic lupus erythematosus (SLE) is a heterogeneous group of autoimmune disorders defined by a consensus of clinical and laboratory criteria. Much of the pathophysiology and therapy of SLE has focused on autoimmune B and T cells of the adaptive immune system. Recently, the role of macrophages, part of the innate immune system, in SLE pathogenesis has gained attention. The field of immunology in general has recently changed in the way that it approaches macrophages. Rather than viewing them as a single, concrete whole, it has become clear that different subpopulations of macrophages contribute to various immune and non-immune processes. Such a nomenclature may provide an ideal framework from which to study macrophage pathogenesis in SLE. Studies suggest that M1 subtype macrophages play an important inflammatory role in SLE pathogenesis. Further, apparently reduced populations of M2a and M2c subtype macrophages may contribute to the lack of anti-inflammatory activity apparent in the disease. M2b subtype macrophages may actually have a role in causing disease directly. Regulatory macrophages have yet to be explored thoroughly in SLE, though the presence of a few of their markers may mean that they are active in suppressing SLE-related inflammation.

  7. Unmet medical needs in systemic lupus erythematosus

    PubMed Central

    2012-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease of diverse manifestations, with onset usually in young women in the third to fourth decade of life. The chronic nature of this relapsing remitting disease leads to organ damage accrual over time. Mortality and morbidity are increased in patients with SLE compared with the general population. Therapeutic advances over the last few decades have led to significant improvements in patient outcomes. Five-year survival has improved to over 90% from a low of 50% in the 1950s. However, multiple aspects of the management of SLE patients are still far from optimal. Early diagnosis remains a challenge; diagnostic delays leading to delay in definitive treatment are common. Monitoring treatment remains problematic due to the paucity of sensitive biomarkers. Current treatment regimens rely heavily on corticosteroids, even though corticosteroids are well known to cause organ damage. Treatment of refractory disease manifestations such as nephritis, recalcitrant cutaneous lesions and neurological involvement require new approaches with greater efficacy. Cognitive dysfunction is common in SLE patients, but early recognition and adequate treatment are yet to be established. Premature accelerated atherosclerosis remains a leading cause of morbidity and mortality. Fatigue is one of the most disabling symptoms, and contributes to the poor quality of life in patients with SLE. Ongoing research in SLE faces many challenges, including enrollment of homogeneous patient populations, use of reliable outcome measures and a standard control arm. The current review will highlight some of the outstanding unmet challenges in the management of this complex disease. PMID:23281889

  8. Intestinal Dysbiosis Associated with Systemic Lupus Erythematosus

    PubMed Central

    Hevia, Arancha; Milani, Christian; López, Patricia; Cuervo, Adriana; Arboleya, Silvia; Duranti, Sabrina; Turroni, Francesca; González, Sonia; Suárez, Ana; Gueimonde, Miguel; Ventura, Marco

    2014-01-01

    ABSTRACT Systemic lupus erythematosus (SLE) is the prototypical systemic autoimmune disease in humans and is characterized by the presence of hyperactive immune cells and aberrant antibody responses to nuclear and cytoplasmic antigens, including characteristic anti–double-stranded DNA antibodies. We performed a cross-sectional study in order to determine if an SLE-associated gut dysbiosis exists in patients without active disease. A group of 20 SLE patients in remission, for which there was strict inclusion and exclusion criteria, was recruited, and we used an optimized Ion Torrent 16S rRNA gene-based analysis protocol to decipher the fecal microbial profiles of these patients and compare them with those of 20 age- and sex-matched healthy control subjects. We found diversity to be comparable based on Shannon’s index. However, we saw a significantly lower Firmicutes/Bacteroidetes ratio in SLE individuals (median ratio, 1.97) than in healthy subjects (median ratio, 4.86; P < 0.002). A lower Firmicutes/Bacteroidetes ratio in SLE individuals was corroborated by quantitative PCR analysis. Notably, a decrease of some Firmicutes families was also detected. This dysbiosis is reflected, based on in silico functional inference, in an overrepresentation of oxidative phosphorylation and glycan utilization pathways in SLE patient microbiota. PMID:25271284

  9. How Finsen's light cured lupus vulgaris.

    PubMed

    Møller, Kirsten Iversen; Kongshoj, Brian; Philipsen, Peter Alshede; Thomsen, Vibeke Ostergaard; Wulf, Hans Christian

    2005-06-01

    In 1903, Niels Ryberg Finsen was awarded the Nobel Prize for his invention of light therapy for skin tuberculosis (lupus vulgaris). The mechanism of action has not been shown; thus, we wanted to elucidate the mechanism of Finsen's light therapy. We measured radiation that could be transmitted through his lens systems and absorption of the stain solution filters in the lamps, and related the obtained results to the possible biological effects on Mycobacterium tuberculosis. Judged from transmission characteristics all tested lens systems were glass lenses (absorbing wavelength < 340 nm). The tested filters likewise absorbed wavelengths < 340 nm. The methylene blue solution used to absorb heat, blocked out wavelengths below 340 nm and between 550 and 700 nm. Furthermore, fluorescence of M. tuberculosis indicated the presence of porphyrins and HPLC analysis of sonicated M. marinum showed that coproporphyrin III was present, which highly justified that porphyrins were present in M. tuberculosis. Production of singlet oxygen through radiation of porphyrins with light of e.g. 400 nm seems to be a most plausible explanation why Finsen's therapy worked in spite of the lack of shortwave ultraviolet radiation, which Finsen believed was the most effective radiation for treating skin tuberculosis.

  10. Juvenile systemic lupus erythematosus in Nigeria.

    PubMed

    Adelowo, O O; Olaosebikan, B H; Animashaun, B A; Akintayo, R O

    2017-03-01

    Juvenile systemic lupus erythematosus (JSLE) is a complex multisystemic autoimmune disorder of unknown cause. It accounts for about one in five cases of SLE. The tendency for SLE to run a fulminant course when it starts in childhood has made JSLE a potentially more severe disease than adult SLE. Reports of JSLE from sub-Saharan Africa are scanty in spite of the increasing reports of adult SLE. We conducted a 4-year retrospective study of JSLE cases seen at the Lagos State University Teaching Hospital between January 2010 and December 2014. Out of the 12 patients studied, eight were girls and four were boys. All patients had positive antinuclear antibody and extractable nuclear antibody tests. Anti-dsDNA antibody was positive in 10 patients. Eight patients had renal disease while four patients had neuropsychiatric manifestations. Haematological abnormalities and constitutional symptoms were present in all patients. Patients were treated with pulse methylprednisolone, oral prednisolone, hydroxychloroquine and azathioprine. Three patients also received rituximab. In conclusion, JSLE exists in Nigeria and exhibits clinical and immunological characteristics similar to its pattern in other parts of the world. It is, however, diagnosed late and is possibly being underdiagnosed as there is no paediatric rheumatologist in the country.

  11. Biotherapies in systemic lupus erythematosus: New targets.

    PubMed

    Lazaro, Estibaliz; Scherlinger, Marc; Truchetet, Marie-Elise; Chiche, Laurent; Schaeverbeke, Thierry; Blanco, Patrick; Richez, Christophe

    2016-09-20

    Systemic lupus erythematosus (SLE) is an autoimmune disease with a polymorphic presentation. The variability in the clinical expression and severity of SLE makes new treatments both essential and challenging to develop. Several biotherapies targeting different pathophysiological pathways have been developed over the past 15 years. The results of Phase II trials were encouraging but rarely borne out by Phase III trials. Recent data, which are discussed in detail in this review, allowed belimumab - a monoclonal antibody against BLyS (B-lymphocyte stimulator) - to become the first biotherapy approved for use in SLE. Other molecules targeting B cells include the two anti-BLyS antibodies tabalumab and blisibimod; atacicept, which targets both BLyS and APRIL (a proliferation-inducing ligand); and the monoclonal antibody to CD22 epratuzumab. The rekindling of interest in the B-cell pathway has also driven new clinical research into rituximab, a monoclonal antibody targeting CD20 with evaluations of new strategies. A new and promising approach is the use of inhibitors of the type 1 interferon (IFN) pathway, of which the most promising is anifrolumab, a monoclonal antibody targeting the type 1 IFN receptor. In this review, we discuss study findings and their clinical relevance, present the most promising targets, and analyze possible explanations to negative results, such as inappropriate patient selection and treatment response criteria or the erratic use of high-dose glucocorticoid therapy.

  12. Myocardial perfusion abnormalities in asymptomatic patients with systemic lupus erythematosus

    SciTech Connect

    Hosenpud, J.D.; Montanaro, A.; Hart, M.V.; Haines, J.E.; Specht, H.D.; Bennett, R.M.; Kloster, F.E.

    1984-08-01

    Accelerated coronary artery disease and myocardial infarction in young patients with systemic lupus erythematosus is well documented; however, the prevalence of coronary involvement is unknown. Accordingly, 26 patients with systemic lupus were selected irrespective of previous cardiac history to undergo exercise thallium-201 cardiac scintigraphy. Segmental perfusion abnormalities were present in 10 of the 26 studies (38.5 percent). Five patients had reversible defects suggesting ischemia, four patients had persistent defects consistent with scar, and one patient had both reversible and persistent defects in two areas. There was no correlation between positive thallium results and duration of disease, amount of corticosteroid treatment, major organ system involvement or age. Only a history of pericarditis appeared to be associated with positive thallium-201 results (p less than 0.05). It is concluded that segmental myocardial perfusion abnormalities are common in patients with systemic lupus erythematosus. Whether this reflects large-vessel coronary disease or small-vessel abnormalities remains to be determined.

  13. Lupus arthropathy: a case series of patients with rhupus.

    PubMed

    Fernández, Andrés; Quintana, Gerardo; Rondón, Federico; Restrepo, José Félix; Sánchez, Alvaro; Matteson, Eric L; Iglesias, Antonio

    2006-03-01

    Among the clinical manifestations of systemic lupus erythematosus (SLE) is an arthropathy, which is usually nonerosive. In many cases the joint involvement is mild. A subset of patients have deforming, nonerosive Jaccoud's arthropathy, and a minority have an arthropathy with clinical findings similar to rheumatoid arthritis (RA) that has been called "rhupus." We report our series of eight patients (seven female, one male) with rhupus arthropathy. Patients were between the ages of 17 and 38 years (average: 30.3 years) at disease onset. All had deforming or Jaccoud's arthropathy, and three had erosive disease. The arthritis was typically the first disease manifestation. Other symptoms of lupus including vasculitis and glomerulonephritis appeared after an average of 2.8 years. All had positive antinuclear antibody and rheumatoid factor. Rhupus arthritis is not a combination of RA and SLE, but should be regarded as a variant of the arthropathy of lupus.

  14. The Soul of Lupus with ALMA (SOLA) Project Overview

    NASA Astrophysics Data System (ADS)

    Saito, M.; de Gregorio, I.; Team SOLA

    2015-12-01

    The SOLA (Soul of Lupus with ALMA) project is conducting comprehensive studies of the Lupus Molecular Clouds and their star formation processes. Our goal is to exploit ALMA and other facilities over a wide wavelength range to establish a prototypical low-mass star forming scenario based on the Lupus region. We focus mainly on 10-104 au scale physics, kinematics, density, and temperature, together with detailed modelling of radiative transfer. Our unique source catalog so far contains more than 700 sources at various evolutionary stages and we have obtained complementary data with Mopra, APEX, etc. In the poster, we will report the latest status of SOLA and the expected outcome in observing runs in the near future, including ALMA Cycle 3.

  15. Lupus vulgaris in a pediatric patient: a clinicohistopathological diagnosis.

    PubMed

    Afsar, F Sule; Afsar, Ilhan; Diniz, Gulden; Asilsoy, Suna; Sorguc, Yelda

    2008-04-01

    Lupus vulgaris is the most common form of cutaneous tuberculosis which usually occurs in patients previously sensitized to Mycobacterium tuberculosis. We present a case of a 10-year-old boy who was diagnosed as lupus vulgaris clinically and histopathologically. He had well demarcated, irregularly bordered, pink, infiltrated plaques on his left cheek showing apple-jelly appearance on diascopy. The histopathological examination showed tuberculoid granulomas with Langhans type giant cells. The Mantoux reactivity was in normal limits, and no acid-fast bacilli was found in the lesion, either by direct stained smears or by culture. The lesions showed marked improvement on anti-tuberculosis treatment. We want to emphasize that histopathological examination has diagnostic value in lupus vulgaris in correlation with clinical appearance, when direct analysis or culture is negative.

  16. Acute macular neuroretinopathy associated with systemic lupus erythematosus.

    PubMed

    Lee, D H; Lee, S C; Kim, M

    2016-04-01

    Acute macular neuroretinopathy (AMN) is a rare disorder that presents with abrupt visual change with wedge-shaped or flower-like lesions pointing towards the fovea. Ischemic insults to the retinal capillary plexus may be important for development of this disease. While many case reports have been published on AMN, none have described AMN in association with systemic lupus erythematosus (SLE). Here, we report a case of AMN associated with newly-diagnosed SLE. We speculate that in patients with lupus flares, immune complex-mediated vascular injury and microvascular thrombosis may disrupt the deep retinal capillary network, causing ischemic damages to the outer retina and leading to the development of AMN. AMN can develop in patients with lupus flares, and must be considered as an SLE-associated ophthalmologic complication. To the best of our knowledge, this is the first case report of AMN associated with SLE.

  17. [Down syndrome and heart block secondary to neonatal lupus].

    PubMed

    Illana-Bravo, Carla Lucila; Méndez-Martínez, Socorro; Juan-Martínez, María Enriqueta

    2017-01-01

    In Down syndrome, so far, has not been reported it's association with congenital heart block, this entity is rare and occurred in only 1% of mothers who have systemic lupus erythematosus, the presence of anti-Ro antibodies cross the placenta presenting neonatal lupus with skin lesions and congenital heart block, bradycardia, which is why we describe the following case. This is a new male end product of asymptomatic young mother, but serological birth with stigmata of Down syndrome, birth presents congenital bradycardia rare manifestation abnormalities, but common in children of mothers with lupus are initiated study protocol, realizing you including laboratory tests and immunological studies cabinet as electrocardiogram and echocardiogram, which gave tone to take the mother immunological studies, being positive antiRo. We concluded that the risk of heart block in a patient with Down syndrome is the same as for the general population.

  18. Total lymphoid irradiation in refractory systemic lupus erythematosus

    SciTech Connect

    Ben-Chetrit, E.; Gross, D.J.; Braverman, A.; Weshler, Z.; Fuks, Z.; Slavin, S.; Eliakim, M.

    1986-07-01

    In two patients with systemic lupus erythematosus, conventional therapy was considered to have failed because of persistent disease activity and unacceptable side effects. Both were treated with total lymphoid irradiation without clinical benefit, despite adequate immunosuppression as documented by markedly reduced numbers of circulating T lymphocytes and T-lymphocyte-dependent proliferative responses in vitro. The first patient developed herpes zoster, gram-negative septicemia, neurologic symptoms, and deterioration of lupus nephritis. The second patient developed massive bronchopneumonia, necrotic cutaneous lesions, and progressive nephritis and died 2 weeks after completion of radiotherapy. These observations, although limited to two patients, indicate that total lymphoid irradiation in patients with severe systemic lupus erythematosus should be regarded as strictly experimental.

  19. Bilateral acute lupus pneumonitis in a case of rhupus syndrome.

    PubMed

    Sarkar, Supriya; Saha, Kaushik

    2012-07-01

    Rhupus syndrome, the overlap of rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE), is an extremely uncommon condition. Organ damages found due to SLE are usually mild in rhupus. Lupus pneumonitis in rhupus syndrome has not been reported worldwide. We are reporting a 23-year-old female with bilateral symmetric erosive arthritis, oral ulcer, alopecia, polyserositis, anemia, leucopenia, positive RA-factor, anti nuclear antibody (ANA) and anti ds-DNA. She presented with acute onset dyspnea, high fever, chest pain, tachycardia, tachypnea, hypoxia and respiratory alkalosis. High resolution computed tomography (HRCT)-thorax showed bilateral, basal consolidation with air bronchogram. Repeated sputum and single broncho alveolar lavage (BAL) fluid examination revealed no organism or Hemosiderin-laden macrophage. The diagnosis of rhupus was confirmed by combined manifestations of RA and SLE, and the diagnosis of acute lupus pneumonitis was established by clinico-radiological picture and by excluding other possibilities.

  20. Rapidly progressive lupus nephritis and concomitant thrombotic microangiopathy.

    PubMed

    Gharbi, Chems; Bourry, Edward; Rouvier, Philippe; Hacini, Sabria; Letaief, Ahmed; Baumelou, Alain; Izzedine, Hassane

    2010-10-01

    Although uncommon, thrombotic microangiopathy (TMA) is one of the most serious complications in patients with systemic lupus erythematosus. A 30-year-old black woman admitted to our hospital because of fever, fatigue, 'dark' urine and rapidly progressive renal failure was found to have systemic lupus erythematous and atypical hemolytic uremic syndrome. Kidney biopsy showed WHO class IV lupus nephritis with crescents and TMA. Hemodialysis was initiated for worsening renal failure. The patient was treated with corticosteroids, monthly pulse intravenous Cyclophosphamide, plasmapheresis and Rituximab on a weekly basis for 4 weeks. The patient's blood pressure was aggressively controlled using antihypertensive agents. Despite this extensive therapy, she remained dialysis dependent although hematological parameters returned to normal values.

  1. Radiologic findings in late-onset systemic lupus erythematosus

    SciTech Connect

    Braunstein, E.M.; Weissman, B.N.; Sosman, J.L.; Schur, P.H.

    1983-03-01

    Systemic lupus erythematosus in the elderly has a different clinical and serologic course from that in young patients. Radiographic findings in patients in whom the diagnosis was made after age 50 were compared with findings in younger patients to see if the radiologic patterns are also different. The only significant radiographic difference between the two groups was that the older group had a greater incidence of soft-tissue swelling of the hands and wrists (p < 0.001). There was no significant difference in osteopenia, erosion, soft-tissue calcification, alignment abnormalities, or intrathoracic findings. Of 24 patients over age 50, two developed lymphoma and another developed multiple myeloma. The data agree with clinical observations that there is a higher incidence of arthritis in late-onset lupus, but clinical findings of increased incidence of pleuropericardial disease are not confirmed radiographically. The coincidence of hematologic malignancy with late-onset lupus in this series is noteworthy.

  2. Lenalidomide for refractory cutaneous manifestations of pediatric systemic lupus erythematosus.

    PubMed

    Wu, E Y; Schanberg, L E; Wershba, E C; Rabinovich, C E

    2017-05-01

    Objective Cutaneous manifestations of pediatric systemic lupus erythematosus cause significant morbidity. Lenalidomide, a thalidomide analogue, has shown promise treating cutaneous lupus erythematosus in adults. Our objective was to evaluate lenalidomide's efficacy and safety in treating refractory cutaneous manifestations of pediatric systemic lupus erythematosus. Methods We performed a retrospective chart review of 10 adolescents who received lenalidomide for recalcitrant cutaneous lupus erythematosus. Information was gathered at drug initiation and 6-month follow-up. The Wilcoxon matched-pairs signed-rank test was used to assess change in quantitative parameters of disease activity. Results Nine subjects were girls and six were African-American. Indications for lenalidomide treatment included alopecia, nasal and oral ulcers, extensive malar rash, discoid lesions, bullous lesions, panniculitis, cutaneous vasculitis, and Raynaud's phenomenon with digital ulcerations. Within 6 months, all patients demonstrated complete or near resolution based on physician report. Prednisone dose decreased from a mean 23.5 mg (SD± 13.3) to 12.25 mg (SD± 9.2) ( P= 0.008). Sedimentation rate decreased from a mean 29 mm/hour (SD± 31.5) to 17 mm/hour (SD± 18.1) ( P= 0.004). Lenalidomide was well tolerated. Conclusion Lenalidomide is an effective and safe treatment for a spectrum of dermatological conditions in pediatric systemic lupus erythematosus. Its use may allow a reduction in prednisone dose and decreased disfigurement. Prospective study is needed to clarify lenalidomide's role in treating cutaneous manifestations of systemic lupus erythematosus.

  3. Successful modulation of murine lupus nephritis with tuftsin-phosphorylcholine.

    PubMed

    Bashi, Tomer; Blank, Miri; Ben-Ami Shor, Dana; Fridkin, Mati; Versini, Mathilde; Gendelman, Omer; Volkov, Alexander; Barshak, Iris; Shoenfeld, Yehuda

    2015-05-01

    In areas where helminths infections are common, autoimmune diseases are rare. Treatment with helminths and ova from helminths, improved clinical findings of inflammatory bowel disease, multiple-sclerosis and rheumatoid-arthritis. The immunomodulatory functions of some helminths were attributed to the phosphorylcholine (PC) moiety. We aimed to decipher the tolerogenic potential of Tuftsin-PC (TPC) compound in mice genetically prone to develop lupus. Lupus prone NZBXW/F1 mice received subcutaneously TPC (5 μg/1 ml), 3 times a week starting at 14 weeks age. Autoantibodies were tested by ELISA, T-regulatory-cells by FACS, cytokines profile by RT-PCR and cytokines protein levels by DuoSet ELISA. Glomerulonephritis was addressed by detection of proteinuria, and immunoglobulin complex deposition in the mesangium of the kidneys of the mice by immunofluorescence. Our results show that TPC attenuated the development of glomerulonephritis in lupus prone mice, in particular, it ameliorated proteinuria (p < 0.02), and reduced immunoglobulin deposition in the kidney mesangium. TPC also enhanced the expression of TGFβ and IL-10 (p < 0.001), and inhibited the production of IFNγ and IL-17 (p < 0.03). TPC Significantly enhanced the expansion of CD4+CD25+FOXP3+ T-regulatory cells (Tregs) phenotype in the treated mice. These data indicate that TPC hampered lupus development in genetically lupus prone mice which was exemplified by moderate glomerulonephritis, attenuation of pro-inflammatory cytokines and enhancement of anti-inflammatory cytokines expression, as well as Tregs expansion. Our results propose harnessing novel natural therapy for lupus patients.

  4. Malignant hypertension in antiphospholipid syndrome without overt lupus nephritis.

    PubMed

    Cacoub, P; Wechsler, B; Piette, J C; Beaufils, H; Herreman, G; Bletry, O; Godeau, P

    1993-01-01

    The antiphospholipid syndrome is usually defined by the association of a clinical manifestation (recurrent venous and/or arterial thrombosis, recurrent spontaneous miscarriages) and a biological abnormality (anticardiolipin antibody, lupus anticoagulant). We retrospectively analyzed the records of 5 patients (4 females, 1 male, aged 30 +/- 12 years) with antiphospholipid syndrome, primary (n = 1) or secondary to systemic lupus erythematosus (n = 4), who developed malignant systemic hypertension with renal insufficiency, in the absence of lupus nephritis. Before the episode of malignant hypertension, all patients had normal systemic blood pressure and renal function. During malignant hypertension the systolic pressure was 206 +/- 39 mmHg and the diastolic pressure 130 +/- 25 mmHg, peak serum creatinine was 204 +/- 95 mumol/l, daily proteinuria was 1.1 +/- 0.8 gr, and complement serum levels were normal in all patients. Renal angiography found normal proximal renal arteries. Renal biopsy showed ischaemic glomeruli without proliferative lesions (n = 5), focal intimal fibrosis either isolated (n = 3) or associated with thrombosis (n = 2) of the intrarenal vessels, and the absence of vasculitis. Immunofluorescence study did not reveal typical lupus deposits. Patients were treated with antihypertensive agents, increasing doses of prednisone (n = 3), and anticoagulant (n = 2) or anti-aggregant therapy (n = 1). After a mean follow-up of 6.8 +/- 5.2 years, 4 patients were still alive with normal blood pressure and renal function, whereas 1 patient died of a probable catastrophic antiphospholipid syndrome. Patients with antiphospholipid syndrome, primary or secondary to systemic lupus erythematosus, may develop malignant hypertension with renal insufficiency and intrarenal vascular lesions, in the absence of lupus nephritis.

  5. Coincident systemic lupus erythematosus and psoriasis vulgaris: a case report.

    PubMed

    Wang, Y; Da, G; Yu, Y; Han, J; Li, H

    2015-12-01

    Psoriasis vulgaris is an autoimmune chronic inflammatory skin disease, but its association with other typical autoimmune disease such as systemic lupus erythematosus has only occasionally been reported. We presented a 25-year-old female who developed systemic lupus erythematosus associated with psoriasis vulgaris. Her conditions were in good control after she got administration of prednisolone (5 mg/day) and Tripterygium Wilfordii Hook (20 mg/day). It is necessary to integrate past history and physical examination to diagnose coincident SLE and psoriasis, and combined treatment with prednisolone and Tripterygium Wilfordii Hook proves effective.

  6. METABOLIC REGULATION OF ORGANELLE HOMEOSTASIS IN LUPUS T CELLS

    PubMed Central

    Caza, Tiffany N; Talaber, Gergely; Perl, Andras

    2012-01-01

    Abnormal T-cell signaling and activation is a characteristic feature in systemic lupus erythematosus (SLE). Lupus T cells are shifted towards an over-activated state, important signaling pathways are rewired, and signaling molecules are replaced. Disturbances in metabolic and organelle homeostasis, importantly within the mitochondrial, endosomal, and autophagosomal compartments, underlie the changes in signal transduction. Mitochondrial hyperpolarization, enhanced endosomal recycling, and dysregulated autophagy are hallmarks of pathologic organelle homeostasis in SLE. This review is focused on the metabolic checkpoints of endosomal traffic that control immunological synapse formation and mitophagy and may thus serve as targets for treatment in SLE. PMID:22836085

  7. Kikuchi–Fujimoto disease and systemic lupus erythematosus

    PubMed Central

    Baenas, Diego F; Diehl, Fernando A; Haye Salinas, María J; Riva, Verónica; Diller, Ana; Lemos, Pablo A

    2016-01-01

    Kikuchi–Fujimoto disease, or histiocytic necrotizing lymphadenitis, is an infrequent idiopathic disorder. It has been associated with autoimmune disorders, of which systemic lupus erythematosus is the most outstanding. The basis of its diagnosis relies on the histological examination of lymph nodes, which typically reveals necrosis surrounded by histiocytes with crescentic nucleus, immunoblasts and plasma cells, and absence of neutrophils. We report the case of a 27-year-old Argentinian female patient without any relevant past medical history to demonstrate the correlation between Kikuchi–Fujimoto disease and systemic lupus erythematosus. PMID:27418858

  8. Chemokines and Chemokine Receptors in the Development of Lupus Nephritis

    PubMed Central

    2016-01-01

    Lupus nephritis (LN) is a major cause of morbidity and mortality in the patients with systemic lupus erythematosus (SLE), an autoimmune disease with damage to multiple organs. Leukocyte recruitment into the inflamed kidney is a critical step to promote LN progression, and the chemokine/chemokine receptor system is necessary for leukocyte recruitment. In this review, we summarize recent studies on the roles of chemokines and chemokine receptors in the development of LN and discuss the potential and hurdles of developing novel, chemokine-based drugs to treat LN. PMID:27403037

  9. [Management of pregnancy in patients with systemic lupus erythematosus].

    PubMed

    Ugarte, A; Villar, I; Ruiz-Irastorza, G

    2012-11-01

    Patients with systemic lupus erythematosus are exposed to a remarkably high number of maternal-fetal complications during pregnancy. Knowledge regarding the reciprocal influence between lupus and pregnancy is the starting point to assure that these patients are correctly monitored. It is also important to carry out comprehensive preconception evaluation to individually evaluate the risk of each patient. The immunological profile, history of nephritis, presence of chronic damage and disease activity are the basic data that will determine the specific individual risk profile. Finally, correct drug management must be assured during this period, based on the safety profile of the different treatments during pregnancy and lactation.

  10. Practice and Educational Gaps in Lupus, Dermatomyositis, and Morphea.

    PubMed

    Fett, Nicole M; Fiorentino, David; Werth, Victoria P

    2016-07-01

    Patients with skin-predominant lupus erythematosus, dermatomyositis, and morphea should be evaluated, treated, and followed by dermatologists who can take primary responsibility for their care. Many academic centers have specialized centers with dermatologists who care for these patients. Patients with skin-predominant lupus erythematosus should be followed regularly with laboratory tests to detect significant systemic disease. Antibody tests can help determine the risks for individual patients. Patients with morphea rarely progress to systemic disease, but therapies can be helpful in treating and preventing progression of disease.

  11. Streptococcus pneumoniae necrotizing fasciitis in systemic lupus erythematosus.

    PubMed

    Sánchez, A; Robaina, R; Pérez, G; Cairoli, E

    2016-04-01

    Necrotizing fasciitis is a rapidly progressive destructive soft tissue infection with high mortality. Streptococcus pneumoniae as etiologic agent of necrotizing fasciitis is extremely unusual. The increased susceptibility to Streptococcus pneumoniae infection in patients with systemic lupus erythematosus is probably a multifactorial phenomenon. We report a case of a patient, a 36-year-old Caucasian female with 8-year history of systemic lupus erythematosus who presented a fatal Streptococcus pneumoniae necrotizing fasciitis. The role of computed tomography and the high performance of blood cultures for isolation of the causative microorganism are emphasized. Once diagnosis is suspected, empiric antibiotic treatment must be prescribed and prompt surgical exploration is mandatory.

  12. HMGB1: a smoking gun in lupus nephritis?

    PubMed Central

    2012-01-01

    High-mobility group box 1 protein (HMGB1) is a prototypic alarmin that is released from activated and dying cells. Because of its proinflammatory activities, HMGB1 could mediate key events in the pathogenesis of systemic lupus erythematosus, a possibility supported by elevations of HMGB1 in patient blood and increased expression in renal biopsies. The biology of HMGB1 is complicated, however, and its activity is dependent on redox state as well as binding to other molecules such as cytokines. Defining more precisely the role of HMGB1 in lupus will require treatment studies to block the activity of this alarmin in animal models and ultimately patients. PMID:22423653

  13. Infection in systemic lupus erythematosus: friend or foe?

    PubMed Central

    Francis, Lisa; Perl, Andras

    2010-01-01

    Infectious agents have long been implicated in the pathogenesis of systemic lupus erythematosus. Common viruses, such as the Epstein-Barr virus, transfusion transmitted virus, parvovirus and cytomegalovirus, have an increased prevalence in patients with systemic lupus erythematosus. They may contribute to disease pathogenesis through triggering autoimmunity via structural or functional molecular mimicry, encoding proteins that induce cross-reactive immune responses to self antigens or modulate antigen processing, activation, or apoptosis of B and T cells, macrophages or dendritic cells. Alternatively, some infectious agents, such as malaria, Toxoplasma gondii and Helicobacter pylori, may have a protective effect. Vaccinations may play dual roles by protecting against friend and foe alike. PMID:20209114

  14. A highlight from the LUPUS 2014 meeting: eight great ideas

    PubMed Central

    Buyon, Jill P; Cohen, Phillip; Merrill, Joan T; Gilkeson, Gary; Kaplan, Mariana; James, Judith; McCune, W Joseph; Bernatsky, Sasha; Elkon, Keith

    2015-01-01

    This review describes eight ‘great ideas’ regarding bench-to-bedside considerations in systemic lupus erythematosus (SLE) presented at the second international LUPUS meeting in Quebec, September 2014. The topics included: correcting the impaired clearance of apoptotic fragments; optimisation of clinical trial design: the PERFECT (Pre Evaluation Reducing Frighteningly Elevated Coverable Targets) study; lipidomics and metabolomics in SLE; importance of the inflammasome; identification and treatment of asymptomatic autoimmunity: prevention of SLE; combining low doses of hydroxychloroquine and quinacrine for long-term maintenance therapy of SLE; reducing emergency room visits and the critical relevance of the autoantigen. PMID:26167290

  15. Syphilitic aseptic meningitis

    MedlinePlus

    ... or syphilitic meningitis, is a complication of untreated syphilis . It involves inflammation of the tissues covering the ... This condition is a life-threatening complication of syphilis infection. Syphilis is a sexually transmitted infection. Syphilitic ...

  16. Added value of experts' knowledge to improve a quantitative microbial exposure assessment model--Application to aseptic-UHT food products.

    PubMed

    Pujol, Laure; Johnson, Nicholas Brian; Magras, Catherine; Albert, Isabelle; Membré, Jeanne-Marie

    2015-10-15

    In a previous study, a quantitative microbial exposure assessment (QMEA) model applied to an aseptic-UHT food process was developed [Pujol, L., Albert, I., Magras, C., Johnson, N. B., Membré, J. M. Probabilistic exposure assessment model to estimate aseptic UHT product failure rate. 2015 International Journal of Food Microbiology. 192, 124-141]. It quantified Sterility Failure Rate (SFR) associated with Bacillus cereus and Geobacillus stearothermophilus per process module (nine modules in total from raw material reception to end-product storage). Previously, the probabilistic model inputs were set by experts (using knowledge and in-house data). However, only the variability dimension was taken into account. The model was then improved using expert elicitation knowledge in two ways. First, the model was refined by adding the uncertainty dimension to the probabilistic inputs, enabling to set a second order Monte Carlo analysis. The eight following inputs, and their impact on SFR, are presented in detail in this present study: D-value for each bacteria of interest (B. cereus and G. stearothermophilus) associated with the inactivation model for the UHT treatment step, i.e., two inputs; log reduction (decimal reduction) number associated with the inactivation model for the packaging sterilization step for each bacterium and each part of the packaging (product container and sealing component), i.e., four inputs; and bacterial spore air load of the aseptic tank and the filler cabinet rooms, i.e., two inputs. Second, the model was improved by leveraging expert knowledge to develop further the existing model. The proportion of bacteria in the product which settled on surface of pipes (between the UHT treatment and the aseptic tank on one hand, and between the aseptic tank and the filler cabinet on the other hand) leading to a possible biofilm formation for each bacterium, was better characterized. It was modeled as a function of the hygienic design level of the aseptic

  17. Optimizing and developing a continuous separation system for the wet process separation of aluminum and polyethylene in aseptic composite packaging waste.

    PubMed

    Yan, Dahai; Peng, Zheng; Liu, Yuqiang; Li, Li; Huang, Qifei; Xie, Minghui; Wang, Qi

    2015-01-01

    The consumption of milk in China is increasing as living standards rapidly improve, and huge amounts of aseptic composite milk packaging waste are being generated. Aseptic composite packaging is composed of paper, polyethylene, and aluminum. It is difficult to separate the polyethylene and aluminum, so most of the waste is currently sent to landfill or incinerated with other municipal solid waste, meaning that enormous amounts of resources are wasted. A wet process technique for separating the aluminum and polyethylene from the composite materials after the paper had been removed from the original packaging waste was studied. The separation efficiency achieved using different separation reagents was compared, different separation mechanisms were explored, and the impacts of a range of parameters, such as the reagent concentration, temperature, and liquid-solid ratio, on the separation time and aluminum loss ratio were studied. Methanoic acid was found to be the optimal separation reagent, and the suitable conditions were a reagent concentration of 2-4 mol/L, a temperature of 60-80°C, and a liquid-solid ratio of 30 L/kg. These conditions allowed aluminum and polyethylene to be separated in less than 30 min, with an aluminum loss ratio of less than 3%. A mass balance was produced for the aluminum-polyethylene separation system, and control technique was developed to keep the ion concentrations in the reaction system stable. This allowed a continuous industrial-scale process for separating aluminum and polyethylene to be developed, and a demonstration facility with a capacity of 50t/d was built. The demonstration facility gave polyethylene and aluminum recovery rates of more than 98% and more than 72%, respectively. Separating 1t of aluminum-polyethylene composite packaging material gave a profit of 1769 Yuan, meaning that an effective method for recycling aseptic composite packaging waste was achieved.

  18. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66)

    PubMed Central

    1971-01-01

    Report of Decompression Sickness Panel, Medical Research Council (1971). Brit. J. industr. Med., 28, 1-21. Decompression sickness and aseptic necrosis of bone: Investigations carried out during and after the construction of the Tyne Road Tunnel (1962-66). This paper describes investigations into the health of compressed air workers during and after the construction of a road tunnel under the River Tyne. Altogether 641 men were exposed to the compressed air environment over a period of approximately 31 months. The maximum working pressure was 42 psig (289·6 kN/m2), and the overall decompression sickness rate for work at pressures of 18 psig (124·1 kN/m2) and above was 2%. Radiological examination of the chest was carried out on 183 men to detect lung cysts but only one was found. Thus lung cysts were not shown to be a common factor in the causation of decompression sickness but the possibility of small sub-radiological collections of trapped air being involved was not excluded. Radiological examinations of the shoulders, hips and knee joints were carried out on 171 men. There was evidence of aseptic necrosis in one or more bones of 44 men (26%). Fifteen of the men with definite lesions of aseptic necrosis of bone and 7 of the men with suspected lesions had never worked in compressed air before this contract. The remaining 14 men with definite lesions and the 8 with suspected lesions had worked elsewhere in compressed air prior to this contract, but a definite lesion in one of these men and a suspected lesion in another can almost certainly be attributed to their work in compressed air on this contract. Images PMID:5543625

  19. Heart involvement in systemic lupus erythematosus, anti-phospholipid syndrome and neonatal lupus.

    PubMed

    Tincani, A; Rebaioli, C B; Taglietti, M; Shoenfeld, Y

    2006-10-01

    Cardiac involvement is one of the main complications substantially contributing to the morbidity and mortality of patients suffering from systemic autoimmune diseases. All the anatomical heart structures can be affected, and multiple pathogenic mechanisms have been reported. Non-organ-specific autoantibodies have been implicated in immune complex formation and deposition as the initial triggers for inflammatory processes responsible for Libman-Sacks verrucous endocarditis, myocarditis and pericarditis. Anti-phospholipid antibodies have been associated with thrombotic events in coronary arteries, heart valve involvement and intra-myocardial vasculopathy in the context of primary and secondary anti-phospholipid syndrome. Antibodies-SSA/Ro and anti-SSB/La antigens play a major pathogenic role in affecting the heart conduction tissue leading to the electrocardiographic abnormalities of the neonatal lupus syndrome and have been closely associated with endocardial fibroelastosis.

  20. Toward the Development of a Lupus Interactive Navigator to Facilitate Patients and Their Health Care Providers in the Management of Lupus: Results of Web-Based Surveys

    PubMed Central

    Neville, Carolyn; DaCosta, Deborah; Rochon, Murray; Eng, Davy

    2014-01-01

    Background Systemic lupus erythematosus is an inflammatory autoimmune disease associated with high morbidity and unacceptable mortality. Information and management tools are needed to help persons with lupus cope with their illness and facilitate health care providers in the delivery of care. Objective The objective of the study was to assess the needs and find solutions to support persons with lupus and their health care providers. Methods Web-based surveys were distributed across Canada to persons with lupus and their relatives (n=3119), rheumatologists (n=517), and arthritis health professionals (AHPs) (n=226) by Lupus Canada, the Canadian Rheumatology Association, and the Arthritis Health Professions Association, respectively. Results The survey sample comprised 665 (21.3%) persons with lupus, 98 (19.0%) rheumatologists, and 74 (32.7%) AHPs. Among the participants with lupus, 92.4% were female, the average age was 46.8 (SD 12.7) years, 79.2% were Caucasian, and 58.8% were employed. All Canadian provinces and territories were represented. The majority (43.3%) of respondents were from Ontario. Mean disease duration was 10.2 (SD 9.5) years, and 41.9% rated their global assessment as fair or poor. There was high agreement between lupus participants and health care providers regarding disease-specific information topics. All groups rated topics related to lupus, fatigue, medications, and stress as most important. Ratings differed among lupus participants and their health care providers regarding perceived helpfulness of some of the patient tools, such as the option to view test results. Needs differed for persons with lupus based on age, sex, depression, stress, and disease activity. Differences in health care provider needs were based on amount of experience in treating lupus. Conclusions Information and support tools needed for persons with lupus and their health care providers were identified. These results will help guide us in the development of a Web

  1. Lupus anticoagulant in systemic lupus erythematosus: a clinical and renal pathological study.

    PubMed

    Farrugia, E; Torres, V E; Gastineau, D; Michet, C J; Holley, K E

    1992-11-01

    Circulating lupus anticoagulant (LA) is associated with thrombosis in large and small vessels. To determine how often the presence of LA is associated with thrombosis within the renal microcirculation, 33 patients with systemic lupus erythematosus (SLE), renal dysfunction, and LA were identified over a 25-year period (LA group) and 32 patients with renal SLE but with normal gross coagulation screen were matched for age, sex, and biopsy timing (C group). Prevalences of serositis, neuropsychiatric illness, leukopenia, thrombocytopenia, hemolysis, anti-DS-DNA elevation, and complement reduction were similar. Arthritis was less and biologic false-positive (BFP) syphilis serology more common in LA. More LA patients had thrombotic events (LA 39% v C 13%; P = 0.014); bleeding episodes, including postbiopsy, were similar. At biopsy, hypertension (LA 55%, C 41%), serum creatinine (mean +/- SD: LA 186 +/- 168 mumol/L [2.1 +/- 1.9 mg/dL] v C 150 +/- 168 mumol/L [1.7 +/- 1.9 mg/dL]) and proteinuria (LA 2.6 +/- 3.1 g/24 h v C 3.1 +/- 2.7) were similar. Lesions by World Health Organization (WHO) class, activity, and chronicity indices, as well as immunofluorescence (IF) and electron microscopy (EM) findings, were not significantly different. Occlusive glomerular, arteriolar, and arterial fibrin thrombi, along with varying degrees of renal thrombotic microangiopathy, were seen in five of 33 patients with LA, but zero of 32 C patients (P = 0.053); three of these five patients died soon after biopsy. Overall, mortality was not different between LA and C. We conclude that the majority of patients with SLE, renal dysfunction, and LA exhibit renal morphologic findings indistinguishable from patients without LA. However, a significant minority of LA patients have thrombotic microangiopathy in their biopsy, which is accompanied by a worse prognosis.

  2. [A case of systemic lupus erythematosus complicated with psoriasis vulgaris].

    PubMed

    Shidara, Kumi; Soejima, Makoto; Shiseki, Mariko; Ohta, Syuji; Nishinarita, Makoto

    2003-12-01

    A 49-years-old female admitted to our hospital because of skin eruptions on the extremities in 1985. She had suffered from polyarthralgia, skin eruptions since 1983. Physical examinations revealed discoid lesion, central nervous system involvement, and polyarthritis. Laboratory tests revealed leukopenia, thrombocytopenia, and hypocomplementemia. Antinuclear antibody, ant-DNA antibody, LE test were positive. From these findings, she was diagnosed as systemic lupus erythematosus (SLE). She developed lupus peritonitis in 1990 and 1994, which was successfully treated by steroid pulse therapy. Since then, the activity of SLE was in good control under administration of prednisolone 10 mg/day. Chilblain lupus was seen from 1993, Raynaud's phenomenon from 1996, and she further developed subcutaneous induration on her chest, back and upper extremities in 1999. Skin biopsy findings were compatible with lupus panniculitis. In 2002, erythematous patches with scales were observed on her right hand and left knee, and these skin lesions were histologically diagnosed as psoriasis vulgaris. An autoimmune response similar to SLE is speculated in psoriasis. We describe a rare case of SLE with various skin lesions including psoriasis vulgaris.

  3. The Lupus Transit Survey for Hot Jupiters: Results and Lessons

    NASA Astrophysics Data System (ADS)

    Bayliss, Daniel D. R.; Weldrake, David T. F.; Sackett, Penny D.; Tingley, Brandon W.; Lewis, Karen M.

    2009-05-01

    We present the results of a deep, wide-field transit survey targeting "Hot Jupiter" planets in the Lupus region of the Galactic plane conducted over 53 nights concentrated in two epochs separated by a year. Using the Australian National University 40-inch telescope at Siding Spring Observatory (SSO), the survey covered a 0.66 deg2 region close to the Galactic plane (b = 11°) and monitored a total of 110,372 stars (15.0 <= V <= 22.0). Using difference imaging photometry, 16,134 light curves with a photometric precision of σ < 0.025 mag were obtained. These light curves were searched for transits, and four candidates were detected that displayed low-amplitude variability consistent with a transiting giant planet. Further investigations, including spectral typing and radial velocity measurements for some candidates, revealed that of the four, one is a true planetary companion (Lupus-TR-3), two are blended systems (Lupus-TR-1 and 4), and one is a binary (Lupus-TR-2). The results of this successful survey are instructive for optimizing the observational strategy and follow-up procedure for deep searches for transiting planets, including an upcoming survey using the SkyMapper telescope at SSO.

  4. Moraxella lacunata Septic Arthritis in a Patient with Lupus Nephritis▿

    PubMed Central

    Woodbury, Anna; Jorgensen, James; Owens, Aaron; Henao-Martinez, Andres

    2009-01-01

    Moraxella lacunata is a rare, usually commensal gram-negative rod most commonly associated with eye infections. We report a unique case of noniatrogenic M. lacunata bacteremia and septic knee arthritis in a patient with class III-IV lupus nephritis and speculate on the association between invasive Moraxella infection and renal impairment. PMID:19794049

  5. Tofacitinib ameliorates murine lupus and its associated vascular dysfunction

    PubMed Central

    Furumoto, Yasuko; Smith, Carolyne K.; Blanco, Luz; Zhao, Wenpu; Brooks, Stephen R.; Thacker, Seth G; Abdalrahman, Zarzour; Sciumè, Giuseppe; Tsai, Wanxia L.; Trier, Anna M.; Nunez, Leti; Mast, Laurel; Hoffmann, Victoria; Remaley, Alan T.; O'Shea, John J.

    2016-01-01

    Objectives Dysregulation of innate and adaptive immune responses contributes to the pathogenesis of systemic lupus erythematosus (SLE) and its associated premature vascular damage. To date, no drug targets both systemic inflammatory disease and the cardiovascular complications of SLE. Tofacitinib is a Janus kinase (JAK) inhibitor that blocks signaling downstream of multiple cytokines implicated in lupus pathogenesis. While clinical trials have shown that tofacitinib exhibits significant clinical efficacy in various autoimmune diseases, its role in SLE and on its associated vascular pathology remains to be characterized. Methods MRL/lpr lupus-prone mice received tofacitinib or vehicle by gavage for 6 weeks (therapeutic arm) or 8 weeks (preventive arm). Nephritis, skin inflammation, serum autoantibody levels and cytokines, mononuclear cell phenotype and gene expression, neutrophil extracellular trap (NET) release, endothelium-dependent vasorelaxation and endothelial differentiation were compared in treated and untreated mice. Results Treatment with tofacitinib led to significant improvement in measures of disease activity including nephritis, skin inflammation, and autoantibody production. In addition, tofacitinib treatment reduced serum levels of pro-inflammatory cytokines and interferon responses in splenocytes and kidney tissue. Tofacitinib also modulated NET formation and significantly increased endothelium-dependent vasorelaxation and endothelial differentiation. The drug was effective as both preventive and therapeutic strategies. Conclusions Tofacitinib modulates the innate and adaptive immune responses, ameliorates murine lupus and improves vascular function. These results indicate that JAK inhibitors have the potential to be beneficial in SLE and its associated vascular damage. PMID:27429362

  6. Chorea in systemic lupus erythematosus: association with antiphospholipid antibodies.

    PubMed Central

    Khamashta, M A; Gil, A; Anciones, B; Lavilla, P; Valencia, M E; Pintado, V; Vázquez, J J

    1988-01-01

    Chorea is a rare manifestation of systemic lupus erythematosus (SLE). In this report the clinical features of two cases of chorea associated with SLE are presented. Of special interest were the raised titres of antiphospholipid antibodies in both cases. The possible pathogenic role of these antibodies is briefly discussed. PMID:3415367

  7. Long daily movements of wolves (Canis lupus) during pup raising

    USGS Publications Warehouse

    Mech, L. David; Cluff, H. Dean

    2009-01-01

    Wolves, Canis lupus, on Ellesmere Island traveled a daily round-trip distance of 40.2 km from their den to a landfill during July 2008, plus an undetermined distance hunting after leaving the landfill. Although long travels by Wolves are well known, this appears to be the first documentation of long daily movements by Wolves rearing pups.

  8. The lupus band test in oral mucosa, conjunctiva and skin.

    PubMed

    Burge, S M; Frith, P A; Millard, P R; Wojnarowska, F

    1989-12-01

    The prevalence and clinical significance of subepithelial immunoglobulin and complement deposition (the lupus band) were examined in the uninvolved sun-protected skin of the forearm, the uninvolved sun-protected lip mucosa and sun-protected bulbar conjunctival mucosa in systemic lupus erythematosus (SLE) and chronic cutaneous lupus erythematosus (CCLE). In SLE, linear deposition of an immunoreactant at the BMZ was detected in 32% (6/19) of skin biopsies; 21% (4/19) of lip mucosal biopsies and 42% (5/12) of conjunctival biopsies. There was no significant difference in the sensitivity of the test at different sites in SLE and no correlation between a positive test in skin, lip or conjunctiva and clinical mucosal involvement. In CCLE, linear deposition of an immunoreactant at the BMZ was found in 3% (1/32) of skin biopsies; 3% (1/29) of lip mucosal biopsies and 50% (10/20) of conjunctiva and clinical mucosal involvement. In the conjunctiva, IgG was present in all but one of the biopsies and was the only immunoreactant in 90% (9/10) of positive CCLE biopsies and 60% (3/5) of positive SLE biopsies. In lupus erythematosus immunoreactants may be deposited in the basement membrane zone beneath non-keratinizing mucosal surfaces of the lip and the eye as well as the skin. In CCLE, the test may be positive in conjunctiva when skin and lip are negative.

  9. Lupus enteritis during pregnancy: A case-based review.

    PubMed

    Nagakawa, Asuka; Arata, Naoko; Mito, Asako; Kaneshige, Terumi; Kitami, Masahiro; Sago, Haruhiko; Murashima, Atsuko

    2015-05-26

    Although the symptoms of systemic lupus erythematosus (SLE) worsen during pregnancy, few previous studies have reported lupus enteritis in pregnant women with SLE. A 29-year-old pregnant Japanese woman presented with acute abdomen. Six years before pain onset, she developed pure red cell aplasia and tested positive for anti-Ro (SS-A) and anti-La (SS-B) antibodies. Anti-DNA antibodies were detected two and a half years later. The patient remained asymptomatic until she developed acute abdomen. A mild increase in anti-DNA antibody levels and a mild decrease in complement levels were observed, and abdominal ultrasound and magnetic resonance imaging revealed the presence of large-volume ascites and edematous thickening of the small intestinal wall. These findings established the diagnosis of lupus enteritis. Her condition improved after treatment with prednisolone 50 mg/day, and she delivered a female infant weighing approximately 1810 g at 37 weeks of gestation. Our study suggests that lupus enteritis should be suspected in female patients with autoimmune disease who develop acute abdomen during pregnancy, and that magnetic resonance imaging is useful in its diagnosis.

  10. Lupus Nephritis: Animal Modeling of a Complex Disease Syndrome Pathology

    PubMed Central

    McGaha, Tracy L; Madaio, Michael P.

    2014-01-01

    Nephritis as a result of autoimmunity is a common morbidity associated with Systemic Lupus Erythematosus (SLE). There is substantial clinical and industry interest in medicinal intervention in the SLE nephritic process; however, clinical trials to specifically treat lupus nephritis have not resulted in complete and sustained remission in all patients. Multiple mouse models have been used to investigate the pathologic interactions between autoimmune reactivity and SLE pathology. While several models bear a remarkable similarity to SLE-driven nephritis, there are limitations for each that can make the task of choosing the appropriate model for a particular aspect of SLE pathology challenging. This is not surprising given the variable and diverse nature of human disease. In many respects, features among murine strains mimic some (but never all) of the autoimmune and pathologic features of lupus patients. Although the diversity often limits universal conclusions relevant to pathogenesis, they provide insights into the complex process that result in phenotypic manifestations of nephritis. Thus nephritis represents a microcosm of systemic disease, with variable lesions and clinical features. In this review, we discuss some of the most commonly used models of lupus nephritis (LN) and immune-mediated glomerular damage examining their relative strengths and weaknesses, which may provide insight in the human condition. PMID:25722732

  11. Lupus vulgaris over a tattoo mark--inoculation tuberculosis.

    PubMed

    Ghorpade, A

    2003-09-01

    Lupus vulgaris developing after tattooing and remaining exclusively confined to it, in a 40-year-old-lady is reported. The tattooing was done one year earlier by a roadside tattoo artist. Diagnosis was suggested by the clinical features and confirmed by histopathology.

  12. Lupus vulgaris in a child following BCG immunization.

    PubMed

    Kokcam, I; Kose, A; Yekeler, H; Doymaz, M Z

    2001-11-01

    A three year old girl presented with lupus vulgaris of the upper arm, which appeared 1 month after BCG immunization. The diagnosis was confirmed by polymerase chain reaction after histology and culture were negative for mycobacteria. Complete healing followed 6 months of oral isoniazid.

  13. Antibody induction of lupus-like neuropsychiatric manifestations.

    PubMed

    Lawrence, David A; Bolivar, Valerie J; Hudson, Chad A; Mondal, Tapan K; Pabello, Nina G

    2007-01-01

    Although systemic lupus erythematosus (SLE) is usually evaluated with regard to autoimmune reactivity toward the kidney, there are multiple psychiatric abnormalities associated with this autoimmune disease. Lupus-prone male NZM88 mice, derived from NZB/NZW F1 mice, develop early neuropsychiatric manifestations without any signs of nephritis. In addition to the usual repertoire of antibody specificities, including autoantibodies to dsDNA and renal antigens, mice of this inbred strain express autoantibodies to numerous brain antigens. Here, we show that autoantibodies to brain antigens, assessed by Western analysis, are as individually varied as are the diverse neuropsychiatric manifestations observed in SLE patients. Additionally, a monoclonal antibody derived from the spleen of an untreated NZM88 male when injected into healthy BALB/cByJ, but not C57BL/6J, mice induced behaviors similar to those of lupus-prone NZM88 mice. This monoclonal antibody, which is specific to dynamin-1, binds preferentially in BALB/cByJ cortex and induces substantial expression of cytokines mainly in the hypothalamus. Thus, an antibody to just one brain antigen can induce multiple behavioral changes, and multiple autoantibodies to different brain antigens exist in lupus-prone mice; however, susceptibility to the induction of neurobehavioral deficits is dependent on host genetics.

  14. Tinea corporis masquerading as subacute cutaneous lupus erythematosus.

    PubMed

    Modi, Gunjan M; Maender, Jennifer L; Coleman, Neil; Hsu, Sylvia

    2008-04-15

    Few papers discuss the potential challenge of differentiating dermatophytosis from subacute cutaneous lupus erythematosus. This masquerade, most often manifest on the face, is of both clinical and therapeutic importance. We report a patient whose extensive tinea corporis very closely mimicked SCLE. The threshold for biopsy should be low in cases that exhibit atypical features for either of these entities.

  15. Automated Detection of Lupus White Matter Lesions in MRI

    PubMed Central

    Roura, Eloy; Sarbu, Nicolae; Oliver, Arnau; Valverde, Sergi; González-Villà, Sandra; Cervera, Ricard; Bargalló, Núria; Lladó, Xavier

    2016-01-01

    Brain magnetic resonance imaging provides detailed information which can be used to detect and segment white matter lesions (WML). In this work we propose an approach to automatically segment WML in Lupus patients by using T1w and fluid-attenuated inversion recovery (FLAIR) images. Lupus WML appear as small focal abnormal tissue observed as hyperintensities in the FLAIR images. The quantification of these WML is a key factor for the stratification of lupus patients and therefore both lesion detection and segmentation play an important role. In our approach, the T1w image is first used to classify the three main tissues of the brain, white matter (WM), gray matter (GM), and cerebrospinal fluid (CSF), while the FLAIR image is then used to detect focal WML as outliers of its GM intensity distribution. A set of post-processing steps based on lesion size, tissue neighborhood, and location are used to refine the lesion candidates. The proposal is evaluated on 20 patients, presenting qualitative, and quantitative results in terms of precision and sensitivity of lesion detection [True Positive Rate (62%) and Positive Prediction Value (80%), respectively] as well as segmentation accuracy [Dice Similarity Coefficient (72%)]. Obtained results illustrate the validity of the approach to automatically detect and segment lupus lesions. Besides, our approach is publicly available as a SPM8/12 toolbox extension with a simple parameter configuration. PMID:27570507

  16. Is chronic periodontitis premature in systemic lupus erythematosus patients?

    PubMed

    Calderaro, Débora Cerqueira; Ferreira, Gilda Aparecida; Corrêa, Jôice Dias; Mendonça, Santuza Maria Souza; Silva, Tarcília Aparecida; Costa, Fernando Oliveira; Lúcio Teixeira, Antônio

    2017-03-01

    The aim of this study was to compare the frequency and severity of chronic periodontitis (CP) in systemic lupus erythematosus (SLE) patients with individuals without rheumatic diseases. Seventy-five patients with SLE were compared to 75 individuals without rheumatic diseases (control group) matched for age, educational level, and income. The activity of SLE was assessed with the Systemic Lupus Erythematosus Disease Activity Index 2000. Systemic Lupus International Collaborating Clinics/American College of Rheumatology Damage Index for Systemic Lupus Erythematosus evaluated SLE-related damage. Dental evaluation included measuring plaque index and parameters of periodontal disease (probing depth, clinical attachment level, and bleeding on probing). Fifty-one (68 %) SLE patients and 42 (56 %) control individuals had CP (p = 0.13). Periodontal status was similar in both groups. Considering only individuals with CP, SLE patients were younger than controls (40.7 ± 9.8 versus 46.14 ± 12.5 years of age, p = 0.02). CP was not associated with activity or therapeutics in SLE patients. Severity of periodontal parameters was similar in SLE patients and control subjects; however, CP occurred earlier in SLE patients.

  17. Early Prediction of Lupus Nephritis Using Advanced Proteomics

    DTIC Science & Technology

    2010-06-01

    mechanisms of inflammatory lupus nephritis from non inflammatory nephropathies with similar urinary findings. 1.2: Validation of NGAL as a biomarker...Membranous Class V lesions. Kidney biopsies are the choice for diagnosis of LN, but are impractical to accurately assess the course of LN in clinical

  18. Normalization of CD4+ T Cell Metabolism Reverses Lupus

    PubMed Central

    Yin, Yiming; Choi, Seung-Chul; Xu, Zhiwei; Perry, Daniel J.; Seay, Howard; Croker, Byron P.; Sobel, Eric S.; Brusko, Todd M.; Morel, Laurence

    2015-01-01

    Systemic Lupus Erythematosus (SLE) is an autoimmune disease in which autoreactive CD4+ T cells play an essential role. CD4+ T cells rely on glycolysis for inflammatory effector functions, but recent studies have shown that mitochondrial metabolism supports their chronic activation. How these processes contribute to lupus is unclear. Here, we show that both glycolysis and mitochondrial oxidative metabolism are elevated in CD4+ T cells from lupus-prone B6.Sle1.Sle2.Sle3 (TC) mice as compared to non-autoimmune controls. In vitro, both the mitochondrial metabolism inhibitor metformin and the glucose metabolism inhibitor 2-Deoxy-D-glucose (2DG) reduced IFNγ production, although at different stages of activation. Metformin also restored the defective IL-2 production by TC CD4+ T cells. In vivo, treatment of TC mice and other lupus models with a combination of metformin and 2DG normalized T cell metabolism and reversed disease biomarkers. Further, CD4+ T cells from SLE patients also exhibited enhanced glycolysis and mitochondrial metabolism that correlated with their activation status, and their excessive IFNγ production was significantly reduced by metformin in vitro. These results suggest that normalization of T cell metabolism through the dual inhibition of glycolysis and mitochondrial metabolism is a promising therapeutic venue for SLE. PMID:25673763

  19. BCMA deficiency exacerbates lymphoproliferation and autoimmunity in murine lupus1

    PubMed Central

    Jiang, Chao; Loo, William M.; Greenley, Erin J.; Tung, Kenneth S.; Erickson, Loren D.

    2011-01-01

    Systemic lupus erythematosus (SLE) and its preclinical lupus-prone mouse models are autoimmune disorders involving the production of pathogenic autoantibodies. Genetic predisposition to SLE results in B cell hyperactivity, survival of self-reactive B cells, and differentiation to autoantibody-secreting plasma cells (PC). These corrupt B cell responses are, in part, controlled by excess levels of the cytokine B cell activation factor from the TNF family (BAFF) that normally maintains B cell homeostasis and self-tolerance through limited production. B cell maturation antigen (BCMA) is a receptor for BAFF that, under nonautoimmune conditions, is important for sustaining enduring antibody protection by mediating survival of long-lived PCs, but is not required for B cell maturation and homeostasis. Through analysis of two different lupus-prone mouse models deficient in BCMA, we identify BCMA as an important factor in regulating peripheral B cell expansion, differentiation, and survival. We demonstrate that a BCMA deficiency combined with the lpr mutation or the murine lupus susceptibility locus Nba2 cause dramatic B cell and PC lymphoproliferation, accelerated autoantibody production, and early lethality. This study unexpectedly reveals that BCMA works to control B cell homeostasis and self-tolerance in systemic autoimmunity. PMID:21536804

  20. Parasites alter the pathological phenotype of lupus nephritis.

    PubMed

    Miyake, Katsuhisa; Adachi, Keishi; Watanabe, Maho; Sasatomi, Yoshie; Ogahara, Satoru; Abe, Yasuhiro; Ito, Kenji; Dan Justin, Yombo K; Saito, Takao; Nakashima, Hitoshi; Hamano, Shinjiro

    2014-12-01

    Lupus nephritis is one of the most serious complications of systemic lupus erythematosus and manifests with considerable phenotypic and histological heterogeneity. In particular, diffuse proliferative lupus nephritis (DPLN) and membranous lupus nephritis (MLN) represent morphologic forms that are polar opposites. DPLN is associated with autoimmune responses dominated by Th1 immune response associated with high levels of interferon (IFN)-γ. In contrast, a Th2 cytokine response is associated with the pathogenesis of MLN. MRL/lpr mice develop human LN-like immune complex-associated nephritis and provide a suitable histological model for human DPLN. Infection with Schistosoma mansoni skewed a Th2-type immune response induction and IL-10 in MRL/lpr mice, drastically changing the pathophysiology of glomerulonephritis from DPLN to MLN accompanied by increased IgG1 and IgE in the sera. T cells in 32-week-old MRL/lpr mice infected with S. mansoni expressed significantly more IL-4 and IL-10 than T cells of uninfected mice; T cells with IFN-γ were comparable between infected and uninfected MR/lpr mice. Thus, the helminthic infection modified the cytokine microenvironment and altered the pathological phenotype of autoimmune nephritis.

  1. Parasites alter the pathological phenotype of lupus nephritis

    PubMed Central

    Miyake, Katsuhisa; Adachi, Keishi; Watanabe, Maho; Sasatomi, Yoshie; Ogahara, Satoru; Abe, Yasuhiro; Ito, Kenji; Dan Justin, Yombo K.; Saito, Takao

    2014-01-01

    lpr Lupus nephritis is one of the most serious complications of systemic lupus erythematosus and manifests with considerable phenotypic and histological heterogeneity. In particular, diffuse proliferative lupus nephritis (DPLN) and membranous lupus nephritis (MLN) represent morphologic forms that are polar opposites. DPLN is associated with autoimmune responses dominated by Th1 immune response associated with high levels of interferon (IFN)-γ. In contrast, a Th2 cytokine response is associated with the pathogenesis of MLN. MRL/lpr mice develop human LN-like immune complex-associated nephritis and provide a suitable histological model for human DPLN. Infection with Schistosoma mansoni skewed a Th2-type immune response induction and IL-10 in MRL/lpr mice, drastically changing the pathophysiology of glomerulonephritis from DPLN to MLN accompanied by increased IgG1 and IgE in the sera. T cells in 32-week-old MRL/lpr mice infected with S. mansoni expressed significantly more IL-4 and IL-10 than T cells of uninfected mice; T cells with IFN-γ were comparable between infected and uninfected MR/lpr mice. Thus, the helminthic infection modified the cytokine microenvironment and altered the pathological phenotype of autoimmune nephritis. PMID:24957876

  2. Current and emerging treatment options in the management of lupus

    PubMed Central

    Jordan, Natasha; D’Cruz, David

    2016-01-01

    Systemic lupus erythematosus (SLE) is a complex autoimmune disease with variable clinical manifestations. While the clearest guidelines for the treatment of SLE exist in the context of lupus nephritis, patients with other lupus manifestations such as neuropsychiatric, hematologic, musculoskeletal, and severe cutaneous lupus frequently require immunosuppression and/or biologic therapy. Conventional immunosuppressive agents such as mycophenolate mofetil, azathioprine, and cyclophosphamide are widely used in the management of SLE with current more rationalized treatment regimens optimizing the use of these agents while minimizing potential toxicity. The advent of biologic therapies has advanced the treatment of SLE particularly in patients with refractory disease. The CD20 monoclonal antibody rituximab and the anti-BLyS agent belimumab are now widely in use in clinical practice. Several other biologic agents are in ongoing clinical trials. While immunosuppressive and biologic agents are the foundation of inflammatory disease control in SLE, the importance of managing comorbidities such as cardiovascular risk factors, bone health, and minimizing susceptibility to infection should not be neglected. PMID:27529058

  3. Current and emerging treatment options in the management of lupus.

    PubMed

    Jordan, Natasha; D'Cruz, David

    2016-01-01

    Systemic lupus erythematosus (SLE) is a complex autoimmune disease with variable clinical manifestations. While the clearest guidelines for the treatment of SLE exist in the context of lupus nephritis, patients with other lupus manifestations such as neuropsychiatric, hematologic, musculoskeletal, and severe cutaneous lupus frequently require immunosuppression and/or biologic therapy. Conventional immunosuppressive agents such as mycophenolate mofetil, azathioprine, and cyclophosphamide are widely used in the management of SLE with current more rationalized treatment regimens optimizing the use of these agents while minimizing potential toxicity. The advent of biologic therapies has advanced the treatment of SLE particularly in patients with refractory disease. The CD20 monoclonal antibody rituximab and the anti-BLyS agent belimumab are now widely in use in clinical practice. Several other biologic agents are in ongoing clinical trials. While immunosuppressive and biologic agents are the foundation of inflammatory disease control in SLE, the importance of managing comorbidities such as cardiovascular risk factors, bone health, and minimizing susceptibility to infection should not be neglected.

  4. DEPRESSION--A FELLOW TRAVELER WITH SYSTEMIC LUPUS ERYTHEMATOSUS.

    PubMed

    Cojocaru, Doina-Clementina; Costin, Melania; Bădeanu, Lucia Elena; Negru, R D; Aursulesei, Viviana

    2015-01-01

    Systemic lupus erythematosus (SLE) is a chronic multisystem inflammatory disorder that occurs primarily in women of childbearing age, immunologic abnormalities being a prominent feature of the disease. Psychiatric disorders frequently coexist, depression being the most common mood disorder in neuropsychiatric lupus. This literature review was performed through searching MEDLINE database for full-text English-language articles--original research, systematic review and updates published in the last five years (2010-2015), using the keywords "depression and systemic lupus erythematosus". The main outcomes identified were prevalence and predictors of depression in various cultural and ethnic groups, depression-related clinical issues (suicidal ideation, cognitive impairment, altered body image, sleep and sexual disturbances, influence of SLE treatment), and influence on quality of life. A multidisciplinary approach that takes into account the polymorphism and individual variability of the SLE clinical manifestations helps to improve early detection of depression, which is responsible for the increased risk of comorbidities, suicidal attempts, decreased treatment adherence, and impaired quality of life. Physicians across all specialties involved in the care for lupus patients should be aware of the major prevalence of this condition, while helping patients to cope with their disabling disease.

  5. THE LUPUS TRANSIT SURVEY FOR HOT JUPITERS: RESULTS AND LESSONS

    SciTech Connect

    Bayliss, Daniel D. R.; Sackett, Penny D.; Weldrake, David T. F.; Tingley, Brandon W. E-mail: penny.sackett@anu.edu.au E-mail: btingley@iac.es

    2009-05-15

    We present the results of a deep, wide-field transit survey targeting 'Hot Jupiter' planets in the Lupus region of the Galactic plane conducted over 53 nights concentrated in two epochs separated by a year. Using the Australian National University 40-inch telescope at Siding Spring Observatory (SSO), the survey covered a 0.66 deg{sup 2} region close to the Galactic plane (b = 11{sup 0}) and monitored a total of 110,372 stars (15.0 {<=} V {<=} 22.0). Using difference imaging photometry, 16,134 light curves with a photometric precision of {sigma} < 0.025 mag were obtained. These light curves were searched for transits, and four candidates were detected that displayed low-amplitude variability consistent with a transiting giant planet. Further investigations, including spectral typing and radial velocity measurements for some candidates, revealed that of the four, one is a true planetary companion (Lupus-TR-3), two are blended systems (Lupus-TR-1 and 4), and one is a binary (Lupus-TR-2). The results of this successful survey are instructive for optimizing the observational strategy and follow-up procedure for deep searches for transiting planets, including an upcoming survey using the SkyMapper telescope at SSO.

  6. An example of endurance in an old wolf, Canis lupus

    USGS Publications Warehouse

    Mech, L.D.

    1997-01-01

    An 11 to 13-year-old Arctic Wolf (Canis lupus arctos) was observed chasing a young Arctic Hare (Lepus arcticus) for 6 to 7 minutes and catching it. This provides an example of the degree of endurance of which an old wolf is capable.

  7. Impact of previous lupus nephritis on maternal and fetal outcomes during pregnancy.

    PubMed

    Saavedra, Miguel A; Cruz-Reyes, Claudia; Vera-Lastra, Olga; Romero, Griselda T; Cruz-Cruz, Polita; Arias-Flores, Rafael; Jara, Luis J

    2012-05-01

    Previous reports suggest that renal involvement before pregnancy or active renal disease during pregnancy may be associated with poor fetal and maternal outcomes in systemic lupus erythematosus (SLE) women. We report our experience of fetal and maternal complications in pregnant lupus women with and without previous lupus nephritis. We analyzed the clinical records of pregnant SLE patients attended in a tertiary reference center during a 5-year period. Patients were allocated into two groups according to the presence or absence of previous lupus nephritis. Women were evaluated monthly during pregnancy and at least 1 month postpartum. Maternal and fetal outcomes of pregnancy were abstracted. We included 95 pregnancies in 92 patients. Compared with pregnant women without lupus nephritis (n = 60), pregnancies with previous lupus nephritis (n = 35) were associated with a higher risk of maternal complications (88.5% vs. 43.3%, p = 0.00001), higher rate of lupus flares (54.2% vs. 25%, p = 0.004), and renal flares (45.7% vs. 6.6%, p = 0.00001), but most of which in most instances were reversible. On the other hand, fetal outcome was similar in both groups. Multivariate analysis showed that previous lupus nephritis and active lupus at conception were predictors of adverse maternal outcome. Pregnancies in women with previous lupus nephritis had a higher rate of maternal complications in comparison with those without. However, fetal prognosis was similar in both groups.

  8. Detection and quantification of lupus anticoagulants in plasma from heparin treated patients, using addition of polybrene

    PubMed Central

    Jacobsen, Eva M; Trettenes, Elin J; Wisløff, Finn; Abildgaard, Ulrich

    2006-01-01

    Background Lupus anticoagulants prolong clotting times in phospholipid-dependent coagulation tests. Lupus Ratio assays are integrated tests for lupus anticoagulants that may be based on APTT, RVVT or dPT clotting times. If a patient is being treated with unfractionated heparin, however, the heparin prolong clotting times and the diagnosis of lupus anticoagulant is invalidated. Commercial assays may have heparin neutralising agents added to their reagents. However, the type and efficacy of the heparin neutralisation is often not documented. We wanted to test the influence and efficacy of heparin neutralisers in the Lupus Ratio assay. Methods Several heparin neutralisers were tested, and polybrene was chosen for further testing. Unfractionated heparin and/or polybrene were added to normal plasma and to plasma from patients with or without lupus anticoagulant and clotting times compared before and after the additions. Lupus anticoagulant-positive patients were given 5000 IU i.v. of unfractionated heparin and plasma was collected just before and five minutes after the injection. Lupus Ratios were calculated after polybrene was added to the postinjection samples. Results The Lupus Ratio became slightly lower when polybrene was added to plasma without heparin. Plasma heparinised in vitro and plasma from patients that had received heparin, both had Lupus Ratios nearly identical to the Lupus Ratios calculated before any additions. Conclusion By addition of polybrene to a final concentration of 7.9 μg/ml in test plasma, Lupus Ratio may be determined in lupus anticoagulant-negative as well as positive plasmas irrespective of the presence of heparin 0.0 – 1.3 U/ml. PMID:16436199

  9. Protein Kinase Cβ Is Required for Lupus Development in Sle Mice

    PubMed Central

    Oleksyn, David; Pulvino, Mary; Zhao, Jiyong; Misra, Ravi; Vosoughi, Aram; Jenks, Scott; Tipton, Christopher; Lund, Frances; Schwartz, George; Goldman, Bruce; Mohan, Chandra; Mehta, Kamal; Mehta, Madhu; Leitgets, Michael; Sanz, Ignacio; Chen, Luojing

    2013-01-01

    Objective To evaluate the requirement for protein kinase Cβ (PKCβ) in the development of lupus in mice, and to explore the potential of targeting PKCβ as a therapeutic strategy in lupus. Methods Congenic mice bearing the disease loci Sle1 or Sle1 and Sle3, which represent different stages of severity in the development of lupus, were crossed with PKCβ-deficient mice. The effect of PKCβ deficiency in lupus development was analyzed. In addition, the effects of the PKCβ-specific inhibitor enzastaurin on the survival of B cells from mice with lupus and human 9G4-positive B cells as well as the in vivo effect of enzastaurin treatment on the development of lupus in Sle mice were investigated. Results In Sle mice, PKCβ deficiency abrogated lupus-associated phenotypes, including high autoantibody levels, proteinuria, and histologic features of lupus nephritis. Significant decreases in spleen size and in the peritoneal B-1 cell population, reduced numbers of activated CD4 T cells, and normalized CD4:CD8 ratios were observed. PKCβ deficiency induced an anergic B cell phenotype and preferentially inhibited autoreactive plasma cells and autoantibodies in mice with lupus. Inhibition of PKCβ enhanced apoptosis of both B cells from Sle mice and human autoreactive B cells (9G4 positive). Treatment of Sle mice with the PKCβ-specific inhibitor enzastaurin prevented the development of lupus. Conclusion This study identifies PKCβ as a central mediator of lupus pathogenesis, suggesting that PKCβ represents a promising therapeutic target for the treatment of systemic lupus erythematosus. Moreover, the results indicate the feasibility of using a PKCβ inhibitor for the treatment of lupus. PMID:23280626

  10. Correlation between the Modified Systemic Lupus Erythematosus Disease Activity Index 2000 and the European Consensus Lupus Activity Measurement in juvenile systemic lupus erythematosus.

    PubMed

    Sato, J O; Corrente, J E; Saad-Magalhães, C

    2016-11-01

    Objective The objective of this study was to assess Modified Systemic Lupus Erythematosus Disease Activity Index 2000 (SLEDAI-2K) and European Consensus Lupus Activity Measurement (ECLAM) disease activity correlation in addition to their respective correlation to Pediatric Systemic Lupus International Collaborative Clinics/American College of Rheumatology (SLICC/ACR) Damage Index (Ped-SDI), in juvenile systemic lupus erythematosus (JSLE). Methods The activity indices were scored retrospectively and summarized by adjusted means during follow-up. The Ped-SDI was scored during the last visit for those with more than six months follow-up. Pearson correlation between the Modified SLEDAI-2K and ECLAM, as well as Spearman correlations between the Modified SLEDAI-2K, ECLAM, and Ped-SDI were calculated. The receiver operating characteristic (ROC) curve was calculated for both activity indices discriminating damage measured by Ped-SDI. Results Thirty-seven patients with mean age at diagnosis 11 ± 2.9 years and mean follow-up time 3.2 ± 2.4 years were studied. The Modified SLEDAI-2K and ECLAM adjusted means were highly correlated ( r = 0.78, p < 0.001). Similarly, Spearman correlation between the activity indices was also high ( rs > 0.7, p < 0.001), but Modified SLEDAI-2K and ECLAM correlation with Ped-SDI was only moderate. ROC analysis discriminant performance for both activity indices resulted in area under curve (AUC) of 0.74 and 0.73 for Modified SLEDAI-2K and ECLAM, respectively. Conclusion The high correlation found between the Modified SLEDAI-2K and ECLAM adjusted means indicated that both tools can be equally useful for longitudinal estimates of JSLE activity.

  11. Echocardiographic findings in asymptomatic systemic lupus erythematosus patients.

    PubMed

    Mohammed, Abdel GaffarA; Alghamdi, Abdulaziz A; ALjahlan, Mohammad A; Al-Homood, Ibrahim A

    2017-03-01

    The aim of this study is to use transthoracic echocardiographic (TTE) imaging methods to identify cardiac dysfunction in asymptomatic systemic lupus erythematosus (SLE) patients and to determine the association between echocardiographic findings and serology. This is a prospective cross-sectional study where 50 patients with confirmed diagnoses of SLE were recruited from rheumatology outpatient clinics. Clinical and serological evaluation to confirm the diagnosis of lupus was done in all patients. Fifty SLE patients, 46 (92%) females and 4 (8%) males, were recruited. Anti-double-stranded DNA (Anti-dsDNA), anticardiolipin, lupus anticoagulant, and anti-β2-glycoproteins were positive in 52.1, 32.6, 13.3, and 15.6%, respectively. Transthoracic echocardiogram revealed mitral regurgitation in 16 patients (32%), pericardial effusion in16 patients (32%), aortic regurgitation in five patients (10%), and tricuspid regurgitation in 10 patients (20%). Eleven patients had left ventricular hypertrophy (22%), and eight patients had ventricular systolic dysfunction (16%). Only four patients had ventricular diastolic dysfunction (8%). A significant association between mitral and tricuspid valve regurgitation and positive anti-dsDNA (p < 0.018, p < 0.006, respectively) was found. Positive anticardiolipin antibodies, lupus anticoagulant, and anti-β 2 glycoprotein antibodies were also associated with mitral valve regurgitation (p values 0.044, 0.006, and 0.023), respectively. Active disease assessed by Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) was found to be associated with increased risk of mitral valvular leaflet thickening (p value 0.028). Performing regular transthoracic echocardiogram in asymptomatic SLE patients is important for early detection and appropriate treatment of cardiac lesions. Clinically quiescent but serologically active disease and presence of antiphospholipid antibodies were associated with structural heart abnormalities.

  12. Blisters and Loss of Epidermis in Patients With Lupus Erythematosus

    PubMed Central

    Merklen-Djafri, Carine; Bessis, Didier; Frances, Camille; Poulalhon, Nicolas; Debarbieux, Sébastien; Cordel, Nadège; Lipsker, Dan

    2015-01-01

    Abstract The nosology of bullous lesions or equivalents (vesicles, erosions, and crusts) in patients with lupus erythematosus (LE) is rarely addressed. The primary aim of this study was to draw up a precise phenotypic inventory of such skin lesions; the secondary objective was to assess a potential relationship between the different types of loss of epidermis and extracutaneous lupus manifestations. We conducted a retrospective multicenter study including 22 patients with definite LE and bullous lesions or equivalents. All biopsies were reviewed. Patients were recruited in the dermatology departments of 6 centers. Patients were included if they met the diagnosis of systemic LE according to American College of Rheumatology and/or Systemic Lupus International Collaborating Clinics criteria or diagnosis of cutaneous LE based on classic clinical criteria and/or histological ascertainment of LE. Patients were recruited through clinician's memory and photographic collections. Three clinico-pathological patterns could be individualized. First, toxic epidermal necrolysis (TEN)-like, sheet-like, skin detachment; sun-exposure, mild mucosal involvement, and dermal mucin deposition allow differential diagnosis with classical Lyell syndrome. Second, vesiculo-bullae and/or crusting occurring on typical lesions of subacute cutaneous lupus erythematosus or chronic cutaneous lupus erythematosus. Third, tense vesicles and/or blisters with an underlying neutrophilic dermatosis and a usual response to dapsone. A careful analysis of 22 LE patients with epidermal detachment reveals 2 main pathomechanisms: a classic LE interface dermatitis, which can be hyperacute and lead to TEN-like skin detachment; and a neutrophilic dermatosis, with tense vesicles and/or blisters, including classic bullous LE. PMID:26579826

  13. Malarial infection of female BWF1 lupus mice alters the redox state in kidney and liver tissues and confers protection against lupus nephritis.

    PubMed

    Al-Quraishy, Saleh; Abdel-Maksoud, Mostafa A; El-Amir, Azza; Abdel-Ghaffar, Fathy A; Badr, Gamal

    2013-01-01

    Systemic lupus erythematosus (SLE) is a prototypic autoimmune disease characterized by an imbalanced redox state and increased apoptosis. Tropical infections, particularly malaria, may confer protection against SLE. Oxidative stress is a hallmark of SLE. We have measured changes in the levels of nitric oxide (NO), hydrogen peroxide (H2O2), malondialdehyde (MDA), and reduced glutathione (GSH) in both kidney and liver tissues of female BWF1 lupus mice, an experimental model of SLE, after infection with either live or gamma-irradiated malaria. We observed a decrease in NO, H2O2, and MDA levels in kidney tissues after infection of lupus mice with live malaria. Similarly, the levels of NO and H2O2 were significantly decreased in the liver tissues of lupus mice after infection with live malaria. Conversely, GSH levels were obviously increased in both kidney and liver tissues after infection of lupus mice with either live or gamma-irradiated malaria. Liver and kidney functions were significantly altered after infection of lupus mice with live malaria. We further investigated the ultrastructural changes and detected the number of apoptotic cells in kidney and liver tissues in situ by electron microscopy and TUNEL assays. Our data reveal that infection of lupus mice with malaria confers protection against lupus nephritis.

  14. Proximal femoral reconstruction after aseptic loosening following proximal femoral replacement for Ewing sarcoma: a case report with one-year follow-up.

    PubMed

    Schoof, Benjamin; Jakobs, Oliver; Gehrke, Thorsten; Gebauer, Matthias

    2014-01-01

    We report the case of a 30-year-old patient initially treated for a proximal femoral Ewing's sarcoma when 12 years old. Index treatment comprised tumour resection and total hip arthroplasty. Two years later revision for aseptic loosening was performed. Subsequently, six further surgical revisons were performed for varying causes. At the age of 23 years the proximal femur was resected and a proximal femoral endoprosthesis implanted.Eighteen years after initial diagnosis the patient presented with recurrent aseptc loosening. Both the proximal femur and acetabulum were reconstructed. For acetabular reconstruction a structural allograft and a tantalum cup were utilised. Reconstruction of the femur utilsed extensive wire mesh and circlage wiring with impaction bone allograft into which a femoral stem was implanted.At one-year follow-up the patient was pain free, had no evidence of infection with satisfactory radiographs and no evidence of implant loosening. This is the first case reporting an extended proximal femoral reconstruction with a wire mesh in combination with impaction bone grafting in an aseptic loosened proximal femoral replacement following Ewing's Sarcoma.

  15. Risk analysis of aseptic meningitis after measles-mumps-rubella vaccination in Korean children by using a case-crossover design.

    PubMed

    Ki, Moran; Park, Taesung; Yi, Sung Gon; Oh, Jin Kyoung; Choi, BoYoul

    2003-01-15

    Epidemiologic study of a vaccine's adverse events is not easy; so many countries have no reliable data. Vaccines containing the Urabe or Hoshino strain have been withdrawn from use in several countries. However, the data are not strong enough to form the basis of a recommendation not to use specific strains. The authors used a case-crossover design to estimate the relative risk of aseptic meningitis in children after receiving the measles-mumps-rubella vaccine in Korea. Study subjects were hospitalized children aged 8-36 months who had aseptic meningitis in 1998. Cases were confirmed by hospital chart reviews using previously defined criteria. Through a telephone survey, the authors obtained vaccination date and place information from parents' vaccination records. Study results showed that no significant risk was associated with the Jeryl Lynn or Rubini strain of the vaccine (relative risk = 0.6, 95% confidence interval (CI): 0.18, 1.97). For the Urabe or Hoshino strain, the relative risk was 5.5 (95% CI: 2.6, 11.8); the risk increased in the third week after vaccination (relative risk = 15.6, 95% CI: 5.9, 41.2) and was elevated until the sixth week. The case-crossover design was useful in confirming the risk of acute adverse events after receiving vaccines.

  16. News on two jets in Lupus 3

    NASA Astrophysics Data System (ADS)

    Comerón, F.; Fernández, M.

    2011-04-01

    Context. Jets from solar-type and low-mass stars are typical manifestations of stellar youth. Shocks along these jets produce visible, generally fast-moving Herbig-Haro objects whose proper motions are easily measured in nearby star-forming regions using images taken just a few years apart. Herbig-Haro objects have now been observed in association with objects close to the substellar boundary. Aims: We present second-epoch observations of the central area of the Lupus 3 star-forming region that include two of its most interesting Herbig-Haro systems. One is HH 228, produced by the classical T Tauri star Th 28 (=Sz 102), whereas the other is HH 600, which has its origin in the very low-mass star Par-Lup3-4. Methods: Narrow-band imaging through filters centered on the Hα and the [SII] lines was obtained with the FORS2 instrument at the Very Large Telescope (VLT) in mid-2010. The images obtained were compared to others obtained in early 2003, leading to the discovery of HH 600. Results: New Herbig-Haro objects are found at large distances from Th 28 and to be associated with it, representing an extension of the HH 228 jet to a projected distance of 0.32 pc from Th 28. The farthest Herbig-Haro object is HH 989, whose possible relationship with Th 28 had been already suggested in a previous study but is now kinematically confirmed. We find other likely Herbig-Haro objects whose proper motions are less indicative of a connection with Th 28, but which may be caused by oblique shocks near the outer walls of its jet. For the HH 600 jet, the knot discovered by ourselves in 2003 to the southeast of Par-Lup3-4 is found to have clearly moved and faded. Using high resolution spectroscopy obtained in 2003 and the proper motion that we can measure now, we determine a spatial velocity of 170 ± 30 km s-1. The northwestern jet is found to have grown in prominence in the intervening years. The possible relationship of other Herbig-Haro objects in the region with Th 28, Par-Lup3

  17. Cardiovascular Events in Systemic Lupus Erythematosus

    PubMed Central

    Fernández-Nebro, Antonio; Rúa-Figueroa, Íñigo; López-Longo, Francisco J.; Galindo-Izquierdo, María; Calvo-Alén, Jaime; Olivé-Marqués, Alejandro; Ordóñez-Cañizares, Carmen; Martín-Martínez, María A.; Blanco, Ricardo; Melero-González, Rafael; Ibáñez-Rúan, Jesús; Bernal-Vidal, José Antonio; Tomero-Muriel, Eva; Uriarte-Isacelaya, Esther; Horcada-Rubio, Loreto; Freire-González, Mercedes; Narváez, Javier; Boteanu, Alina L.; Santos-Soler, Gregorio; Andreu, José L.; Pego-Reigosa, José M.

    2015-01-01

    Abstract This article estimates the frequency of cardiovascular (CV) events that occurred after diagnosis in a large Spanish cohort of patients with systemic lupus erythematosus (SLE) and investigates the main risk factors for atherosclerosis. RELESSER is a nationwide multicenter, hospital-based registry of SLE patients. This is a cross-sectional study. Demographic and clinical variables, the presence of traditional risk factors, and CV events were collected. A CV event was defined as a myocardial infarction, angina, stroke, and/or peripheral artery disease. Multiple logistic regression analysis was performed to investigate the possible risk factors for atherosclerosis. From 2011 to 2012, 3658 SLE patients were enrolled. Of these, 374 (10.9%) patients suffered at least a CV event. In 269 (7.4%) patients, the CV events occurred after SLE diagnosis (86.2% women, median [interquartile range] age 54.9 years [43.2–66.1], and SLE duration of 212.0 months [120.8–289.0]). Strokes (5.7%) were the most frequent CV event, followed by ischemic heart disease (3.8%) and peripheral artery disease (2.2%). Multivariate analysis identified age (odds ratio [95% confidence interval], 1.03 [1.02–1.04]), hypertension (1.71 [1.20–2.44]), smoking (1.48 [1.06–2.07]), diabetes (2.2 [1.32–3.74]), dyslipidemia (2.18 [1.54–3.09]), neurolupus (2.42 [1.56–3.75]), valvulopathy (2.44 [1.34–4.26]), serositis (1.54 [1.09–2.18]), antiphospholipid antibodies (1.57 [1.13–2.17]), low complement (1.81 [1.12–2.93]), and azathioprine (1.47 [1.04–2.07]) as risk factors for CV events. We have confirmed that SLE patients suffer a high prevalence of premature CV disease. Both traditional and nontraditional risk factors contribute to this higher prevalence. Although it needs to be verified with future studies, our study also shows—for the first time—an association between diabetes and CV events in SLE patients. PMID:26200625

  18. Dilute Russell's viper venom and activated partial thromboplastin time in lupus anticoagulant diagnosis: is mixing essential?

    PubMed

    Chandrashekar, Vani

    2016-06-01

    Dilute Russell's viper venom (DRVV) testing and activated partial thromboplastin time (APTT) have been effectively used in combination for lupus anticoagulant testing. The purpose of our study was to evaluate the role of mixing in activated partial thromboplastin and dilute Russell's viper venom testing for evaluation of lupus anticoagulants. Citrated blood from patients who were not on oral anticoagulant therapy was studied. Mixing study with 1 : 1 normal plasma for elevated APTT and also few samples with elevated screen time was carried out. Elevated APTT was seen in only 48.1% of patients with lupus anticoagulant. Correction of APTT was seen in 27.8% of lupus anticoagulant-positive patients. DRVV test on mixing resulted in 83.8% false-negative values. Integrated DRVV test could be a standalone test for testing lupus anticoagulant. Mixing study may be restricted for patients on oral anticoagulants or patients with strong lupus anticoagulant.

  19. Clinical significance of the mixing test in laboratory diagnoses of lupus anticoagulant: the fate of the mixing test in integrated lupus anticoagulant test systems.

    PubMed

    Hong, Sung Kuk; Hwang, Sang Mee; Kim, Ji-Eun; Kim, Hyun Kyung

    2012-12-01

    The mixing test is used to determine the presence of inhibitors in laboratory diagnoses of lupus anticoagulant. Updated international guidelines state that an integrated lupus anticoagulant test system does not require the mixing test; an appraisal of the mixing tests in integrated lupus anticoagulant test systems is, therefore, required. We investigated the clinical relevance of mixing tests by using the best cutoff value of the mixing test through thrombotic risk analysis. A retrospective analysis was performed on 525 specimens with positive screening tests by using two integrated lupus anticoagulant tests: diluted Russell's Viper venom (dRVVT) and silica clotting time. The diagnostic performance of two interpretation formulas (percentage correction, Rosner index) was assessed, and the thrombotic risk of a subgroup based on the mixing results was investigated. Finally, the thrombotic risk of lupus anticoagulant positivity based on the integrated lupus anticoagulant test system procedures was assessed for the appraisal of mixing test exclusion in integrated lupus anticoagulant test systems. The best cutoff values of mixing test interpretation methods based on dRVVT were as follows: 60.1% for percentage correction and 15.7 for Rosner index. There was no substantial difference in the thrombotic risk between percentage correction and the Rosner index. The mixing-positive group showed a higher lupus anticoagulant titer and higher thrombotic risk than the mixing-negative group. However, even the mixing-negative group carried a significant risk of thrombosis. Finally, lupus anticoagulant positivity determined by the updated two-step procedure (screening and confirmation tests) showed higher thrombotic risk than that determined by the traditional three-step procedure (screening, mixing, and confirmation tests). Although a positive mixing result can predict a high risk of thrombosis, negative mixing results are also associated with a substantial thrombotic risk. The

  20. Studying the Role for CD4+ T Cell Subsets in Human Lupus

    DTIC Science & Technology

    2013-07-01

    subsets in human lupus PRINCIPAL INVESTIGATOR: Insoo Kang, M.D. CONTRACTING...SUBTITLE 5a. CONTRACT NUMBER Studying the role for CD4+ T cell subsets in human lupus 5b. GRANT NUMBER W81XWH-10-1-0150 5c. PROGRAM ELEMENT NUMBER...Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT We have investigated whether and how autoimmune complex (AIC) in SLE ( lupus ) can

  1. Complement Depletion Protects Lupus-prone Mice from Ischemia-reperfusion-initiated Organ Injury

    DTIC Science & Technology

    2012-10-25

    ischemia-reperfusion injury; intestine; complement; systemic lupus erythematosus MESENTERIC ISCHEMIA-REPERFUSION (IR) injury is encountered after...also affect the disease process in patients with autoimmune diseases such as systemic lupus erythematosus (SLE) (1, 36, 47). SLE is characterized by...Bove A, Delgado G, Cervera R, Ingelmo M, Font J. Vasculitis in systemic lupus erythematosus : prevalence and clinical characteristics in 670 patients

  2. Genome-Wide Association Study in African-Americans With Systemic Lupus Erythematosus

    DTIC Science & Technology

    2011-09-01

    Americans with Systemic Lupus Erythematosus PRINCIPAL INVESTIGATOR: John Harley, M.D., Ph.D... Systemic Lupus Erythematosus 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER John Harley, M.D., Ph.D. 5e. TASK...SUPPLEMENTARY NOTES 14. ABSTRACT Systemic lupus erythematosus is a potentially deadly systemic autoimmune disease that disproportionately afflicts women

  3. Frontal Fibrosing Alopecia Coexisting with Lupus Erythematosus: Poor Response to Hydroxychloroquine.

    PubMed

    Contin, Letícia Arsie; Martins da Costa Marques, Elisa Raquel; Noriega, Leandro

    2017-01-01

    Lupus erythematosus, especially the discoid form, and lichen planopilaris may be associated and can occur in different topographies (coexistence) or in the same lesion (lupus eythematosus/lichen planus overlap syndrome). Frontal fibrosing alopecia is considered a variant form of lichen planopilaris and is characterized by frontotemporal hairline and eyebrow involvement. Of the association with lupus erythematosus we have only a few descriptions. Hydroxychloroquine and chloroquine diphosphate are antimalarial drugs described as viable treatment options for both diseases, due to an antilymphocytic effect. The association between frontal fibrosing alopecia and lupus erythematosus (discoid or systemic) is reported in this article, showing a progressive alopecia in the frontotemporal hairline despite treatment with hydroxychloroquine.

  4. Lupus anticoagulant-hypoprothrombinemia syndrome and catastrophic antiphospholipid syndrome in a patient with antidomain I antibodies.

    PubMed

    Galland, Joris; Mohamed, Shirine; Revuz, Sabine; de Maistre, Emmanuel; de Laat, Bas; Marie, Pierre-Yves; Zuily, Stéphane; Lévy, Bruno; Regnault, Véronique; Wahl, Denis

    2016-07-01

    Lupus anticoagulant-hypoprothrombinemia syndrome is a rare condition characterized by the association of acquired factor II deficiency and lupus anticoagulant. Contrary to classical antiphospholipid syndrome, it may cause severe life-threatening bleeding (89% of published cases). We report a patient, positive for antidomain I antibodies, with initially primary lupus anticoagulant-hypoprothrombinemia syndrome without previous clinical manifestation or underlying systemic disease. Five years later, he experienced the first systemic lupus erythematous flare. Within a few days, catastrophic antiphospholipid syndrome was diagnosed with heart, liver and kidney involvement. The patient recovered under pulse steroids, intravenous heparin and intravenous immunoglobulins.

  5. Therapeutic interventions of tissue specific autoimmune onset in systemic lupus erythematosus.

    PubMed

    Dasgupta, Subhajit; Dasgupta, Shaoni

    2016-06-10

    Systemic lupus erythematosus (lupus) is a female predominant autoimmune disease. The auto reactive B cells and T helper cells together are known to develop self-reactive immune responses in different tissues like kidney, bone, cardiovascular and central nervous system. Progression of disease is associated with deposition of immune complex which initiates tissue damage. The therapy for lupus still includes corticosteroids to reduce allergic manifestations and inflammatory immune responses. Recent observations suggested that, mycophenolate mofetil and cyclophosphamide treatment in combination with corticosteroids have benefit in lupus therapy. The prospect of B cell depletion by CD20 targeted monoclonal antibody Rituximab has been demonstrated in lupus patients. The CD52 specific monoclonal antibody Alemtuzumab is another proposition for lupus therapy. The drug Belimumab inhibits B cell activation by altering BAFF/APRIL signal cascade. Recent discovery of the CD22 targeted Epratuzumab also shows therapeutic prospect. The researches on new generation drugs for autoimmune lupus include search for inhibitors of CD40-CD40Ligand interactions, CD86 activation, selective modulation of complement cascades. The choice of inhibitors of transcription factor NF-κBp65 and selective modulators for estrogen receptor alpha are proposed areas of lupus drug discovery research. Keeping a close eye on the mechanisms of disease onset, a comprehensive view is provided on recent therapy of systemic lupus erythematosus.

  6. Disseminated lupus vulgaris and papulonecrotic tuberculid: case report.

    PubMed

    Senol, M; Ozcan, A; Aydin, A; Karincaoglu, Y; Sasmaz, S; Sener, S

    2000-01-01

    The incidence of tuberculosis and extrapulmonary forms of this disease is increasing all over the world. Lupus vulgaris is the most prevalent form of cutaneous tuberculosis in Europe and the Middle East. Papulonecrotic tuberculid, the most common form of hyperergic response to mycobacteria or their fragments, is uncommon in children. We report lupus vulgaris with papulonecrotic tuberculid in a 12-year-old girl who had a 3-year history of slowly growing plaques on her trunk, extremities, and the tip of her nose and papuloulcerative lesions over her entire body. A skin biopsy specimen showed minimally caseating granulomatous inflammation. Staining for acid-fast bacilli was negative in both plaques and papules. Polymerase chain reaction identified Mycobacterium tuberculosis DNA in the patient's sputum, gastric fluid, and plaques and was negative in the papules. She was started on antituberculous therapy with four drugs and her lesions responded rapidly.

  7. [The main stages in the history of systemic lupus erythematosus].

    PubMed

    Rampudda, M; Marson, P; Pasero, G

    2009-01-01

    Systemic lupus erythematosus can be considered the most characteristic and important among the connective tissue diseases. In this short review the main stages of its history are sketched, from the introduction of the term "lupus", traditionally attributed to Roger Frugardi, in 1230 (but in fact already documented in the 10th century) to the actual knowledge of its clinical and laboratory aspects. Initially considered exclusively of dermatological interest, the first to describe a systemic form with visceral involvement were Moriz Kohn Kaposi and William Osler. Significant contribution was also given by serological diagnosis, and in particular, by the identification of specific markers of disease, such as anti-native DNA and anti-Sm antibodies, allowing early diagnosis and the establishment of an adequate therapy.

  8. Case of lupus vulgaris diagnosed 50 years after onset.

    PubMed

    Uttawichai, Pattanawadee; Igarashi, Tsukasa; Kawana, Seiji

    2009-02-01

    Cutaneous tuberculosis is an infrequent form of extrapulmonary tuberculosis, but is a symptom that can lead to diagnosis of tuberculosis. We describe a case of lupus vulgaris in a 79-year-old woman who had a 50-year history of a slowly growing plaque on her right cheek. She visited many hospitals without resolution and the plaque gradually enlarged. Recently, she was misdiagnosed with eczema and prescribed topical steroids that had no effect, and she subsequently visited our outpatient clinic. A diagnosis of lupus vulgaris was made based on histopathology, culture and polymerase chain reaction, and isoniazid, rifampicin and ethambutol were administered as antituberculosis treatment. Although the incidence of cutaneous tuberculosis has decreased significantly in developed countries, knowledge and awareness of the disease are still of importance for proper diagnosis and treatment.

  9. Cardiac tamponade as initial presentation in systemic lupus erythematosus.

    PubMed

    Jawaid, Ambreen; Almas, Aysha

    2014-05-01

    Systemic Lupus Erythematosus (SLE) is one of the many diseases known as 'the great imitators' because it can have diverse presentations and so is misunderstood for other illnesses. This case illustrates a 19 years old girl with SLE who presented as cardiac tamponade which is a rare feature of lupus pericarditis requiring medical and surgical treatment. Even after pericardiocentesis and steroid therapy there was a re-accumulation of the pericardial fluid resulting in cardiac tamponade which led to pericardial window formation. This case draws attention to the need to consider the diagnosis of tamponade in patients with connective tissue disease and dyspnea or hemodynamic compromise. It also outlines the treatment options available so that surgical referral, if needed, can be done timely for this rare but life threatening manifestation of SLE.

  10. Annular lupus vulgaris: an unusual case undiagnosed for five years.

    PubMed

    Gönül, Müzeyyen; Kiliç, Arzu; Külcü Cakmak, Seray; Gül, Ulker; Koçak, Oğuzhan; Demiriz, Murat

    2007-01-01

    Tuberculosis is still a serious problem in both developing and developed countries. It is often confused with various cutaneous disorders both clinically and histopathologically.A 46-year-old woman attended our clinic with progressive, asymptomatic, annular skin lesions on her right upper extremity for 5 years. She had received many different therapies for these lesions at other institutions previously but these medications were not effective and the lesions deteriorated. On dermatological examination, well-demarcated, irregular bordered, violaceous colored, elevated and crusted annular lesions on her right hand dorsum and forearm were observed. She was diagnosed as having lupus vulgaris clinically and histopathologically. Antituberculosis therapy was administered and regression of the lesions started in the second week of medication.We report a case of long-standing, undiagnosed and uncommon, annular form of lupus vulgaris. We want to stress that clinical and histopathological findings are still important for the diagnosis of cutaneous tuberculosis.

  11. Ulcerative lupus vulgaris of face: an uncommon presentation in India.

    PubMed

    Padmavathy, L; Rao, L Lakshmana; Ethirajan, N; Krishnaswami, B

    2007-01-01

    Tuberculosis affects the population world wide, more among those living in developing countries. The incidence of tuberculosis registered an upward trend even in developed countries, with the advent of HIV infection. Cutaneous tuberculosis accounts for about 1% of cases of extra-pulmonary tuberculosis. Cutaneous tuberculosis presents with various lesions ranging from ulcerative to proliferative or hyperkeratotic lesions. The lesions may sometimes be associated with marked destruction of the tissues resulting in marked disfigurement, especially when it involves face as seen in cases of Lupus Vulgaris. A case of Lupus Vulgaris in a young woman with extensive ulceration of face which responded to ATT resulting in scarring of the face is reported for its rarity amongst Indian population as against western population.

  12. Vaccine-preventable infections in Systemic Lupus Erythematosus

    PubMed Central

    Murdaca, Giuseppe; Orsi, Andrea; Spanò, Francesca; Faccio, Valeria; Puppo, Francesco; Durando, Paolo; Icardi, Giancarlo; Ansaldi, Filippo

    2016-01-01

    Systemic Lupus Erythematosus (SLE) is characterized by abnormal autoantibody production and clearance. Infections are among the most important causes of morbidity and mortality in SLE patients; they have an increased frequency of severe bacterial and viral infections possibly due to inherited genetic and immunologic defects and to immunosuppressive therapies. In addition, infectious agents can switch on lupus disease expression and activity. Among the strategies to reduce the risk of infection, vaccination can be considered the most reliable option. Most vaccines are effective and safe in SLE patients, although in certain cases immunogenicity may be sub-optimal and vaccination can trigger a flare. Although these issues are currently unresolved, the risk benefit balance is in favor for vaccination to reduce the risk of infection in SLE patients. In the present review we discuss the preventive strategies currently recommended to reduce bacterial and viral infections in SLE. PMID:26750996

  13. Presence of hepatitis-associated antigen in systemic lupus erythematosus

    PubMed Central

    Alarcón-Segovia, D.; Fishbein, Eugenia; Díaz-Jouanen, E.

    1972-01-01

    Presence of hepatitis-associated antigen (HAA) was investigated in 504 sera from 116 patients with SLE and was found in 41% of them. HAA was present in at least one serum in 75% of the patients but there were variations in presence and titres in the same patient at different times. Except for a tendency of HAA to appear or rise in titre with lupusi nactivation following corticosteroid or immunosuppresive therapy, there was no correlation between its presence and disease activity, specific organ involvement, antinuclear antibodies or immunoglobulin levels. All but one of twelve lupus patients with recurrent bacterial infections had HAA at high titres. HAA appeared in the serum of a patient upon development of IgA deficiency. HAA antigenaemia in systemic lupus erythematosus seems a consequence rather than a cause of the immunological derangement in this disease. PMID:4538860

  14. Cavitary pulmonary lesions in systemic lupus erythematosus: an unusual manifestation.

    PubMed

    Dalili, Amir Reza; Lotfi, Reza; Mousavi, Seyedeh Maryam

    2014-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease of unknown pathogenesis. The frequency of SLE with cavitary lesion manifestation is very rare and is thought to be due to infection or pulmonary embolism. A 19-year-old female diagnosed with SLE complicated by lupus nephritis and cavitary pulmonary lesion is presented in this case report. Other diseases that can lead to such lesions were ruled out in the patient. The patient improved briefly after the initiation of immunosuppressive therapy, but was unresponsive to supportive treatment due to pneumothorax. Pneumothorax is caused by cavitary lesions and possibly bronchopleural fistulas - these later caused respiratory distress and death. The patient did not show any improvement in the lesions after the initiation of immunosuppressive therapy. This case report suggests that the differential diagnosis of cavitary lung lesions should include SLE.

  15. Cavitary pulmonary lesions in systemic lupus erythematosus: an unusual manifestation

    PubMed Central

    Dalili, Amir Reza; Lotfi, Reza; Mousavi, Seyedeh Maryam

    2014-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disease of unknown pathogenesis. The frequency of SLE with cavitary lesion manifestation is very rare and is thought to be due to infection or pulmonary embolism. A 19-year-old female diagnosed with SLE complicated by lupus nephritis and cavitary pulmonary lesion is presented in this case report. Other diseases that can lead to such lesions were ruled out in the patient. The patient improved briefly after the initiation of immunosuppressive therapy, but was unresponsive to supportive treatment due to pneumothorax. Pneumothorax is caused by cavitary lesions and possibly bronchopleural fistulas – these later caused respiratory distress and death. The patient did not show any improvement in the lesions after the initiation of immunosuppressive therapy. This case report suggests that the differential diagnosis of cavitary lung lesions should include SLE. PMID:25763160

  16. Complete heart block associated with lupus in a dog.

    PubMed

    Malik, R; Zunino, P; Hunt, G B

    2003-07-01

    A 5-year-old Poodle-cross was initially presented for exercise intolerance and difficulty in chewing and yawning. Some months later it acutely developed lethargy referable to complete heart block. Further investigations before and after permanent pacemaker implantation demonstrated Coombs-positive immune-mediated haemolytic anaemia, presumptive masticatory myositis and hypoadrenocorticism, suggesting the possibility of multisystem auto-immune disease. A diagnosis of systemic lupus erythematosus (SLE) was made based on these findings and a positive anti-nuclear antibody titre. It was thought that immune-mediated destruction of cardiac conduction tissues was responsible for the development of atrioventricular conduction block. Glucocorticoid deficiency was corrected using cortisone replacement therapy. SLE was controlled successfully for 10 months using azathioprine monotherapy until signs, subsequently shown to be due to subacute bacterial endocarditis, resulted in the death of the patient. Lupus should be considered as a potential underlying aetiology in dogs that develop heart block.

  17. Shrinking lung syndrome complicating pediatric systemic lupus erythematosus.

    PubMed

    Burns, Natalie S; Stevens, Anne M; Iyer, Ramesh S

    2014-10-01

    Systemic lupus erythematosis (SLE) can affect the lungs and pleura, usually manifesting with pleural effusions or diffuse parenchymal disease. A rare manifestation of SLE is shrinking lung syndrome, a severe restrictive respiratory disorder. While pleuropulmonary complications of pediatric SLE are common, shrinking lung syndrome is exceedingly rare in children. We present a case of a 13-year-old girl previously diagnosed with lupus, who developed severe dyspnea on exertion and restrictive pulmonary physiology. Her chest radiographs on presentation demonstrated low lung volumes, and CT showed neither pleural nor parenchymal disease. Fluoroscopy demonstrated poor diaphragmatic excursion. While shrinking lung syndrome is described and studied in adults, there is only sparse reference to shrinking lung syndrome in children.

  18. Echolalia as a novel manifestation of neuropsychiatric systemic lupus erythematosus.

    PubMed

    Zapor, M; Murphy, F T; Enzenauer, R

    2001-01-01

    "That tongue of yours, by which I have been tricked, shall have its power curtailed and enjoy the briefest use of speech." With these words, Hera, of Greek mythology, deprived the nymph Echo of spontaneous speech, constraining her instead to merely repeating the words of others. Echolalia, which derives from the word "echo," is disordered speech in which an individual persistently repeats what is heard. Echolalia has been described in patients with a number of neuropsychiatric illnesses including autism and Tourette's syndrome. Neuropsychiatric systemic lupus erythematosus (NPSLE) is a heterogeneous disease with protean manifestations that may occur in approximately 25% to 50% of patients with systemic lupus erythematosus (SLE). Although the most common manifestations include cognitive dysfunction (50%) and seizures (20%), NPSLE may also present as peripheral neuropathy (15%), psychosis (10%), or other central nervous system abnormalities. We report the case of a 57-year-old woman with SLE and echolalia.

  19. Thrombotic and hemorrhagic complications in children with the lupus anticoagulant.

    PubMed

    Bernstein, M L; Salusinsky-Sternbach, M; Bellefleur, M; Esseltine, D W

    1984-12-01

    Endogenous circulating anticoagulants are unusual in children without a congenital factor deficiency. In particular, the lupus anticoagulant has only rarely been reported in children. Despite its functioning in vitro to prolong the partial thromboplastin time, patients more frequently have problems with thrombosis than bleeding, unless there is a coexistent prothrombin deficiency or thrombocytopenia. We report the cases of three children with the lupus anticoagulant. Two children had associated thromboses. One had a thrombosis of the iliofemoral system and the other had a partial Budd-Chiari syndrome, a thrombosis of the deep calf veins and ureteric obstruction. The third child had a concomitant prothrombin deficiency and bleeding after tooth extraction. Associated findings in these patients included a positive antinuclear antibody test in two, a positive anti-DNA antibody test in two, a false-positive VDRL test in two, and an antiphospholipid antibody test in two.

  20. Neonatal lupus with atypical cardiac and cutaneous manifestation

    PubMed Central

    Morais, Sofia; Santos, Isabel Cristina; Pereira, Dolores Faria; Mimoso, Gabriela

    2013-01-01

    Neonatal lupus erythematosus is a rare, passively acquired autoimmune disease, caused by maternal autoantibodies. The most common manifestations are skin rash and congenital heart block. Cutaneous manifestations may be present at birth, but often develop within a few weeks after delivery. Congenital heart block may present as bradycardia in utero or during physical examination at birth. Approximately 40–60% of mothers are asymptomatic when the infants are diagnosed. We present a case of a child, born with erythematosus lesions in the face, scalp, trunk, limbs and nodules/papules on the palmar and plantar surfaces. He also had hepatosplenomegaly and thrombocytopenia. Echocardiography showed hyperechoic lesions on the anterior papilar muscle of the left ventricle and on the lateral cusp of the tricuspid valve. The mother had unexplained fever and vasculitic lesions in her hands and feet. Antinuclear antibodies, anti-SSa/Ro and anti-SSb/La were positive in the mother and child, making the diagnosis of neonatal lupus. PMID:23839605