Science.gov

Sample records for magna molecular fingerprints

  1. Molecular impact of juvenile hormone agonists on neonatal Daphnia magna.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Miyakawa, Hitoshi; Yatsu, Ryohei; Mizutani, Takeshi; Ogino, Yukiko; Miyagawa, Shinichi; Watanabe, Hajime; Nishide, Hiroyo; Uchiyama, Ikuo; Tatarazako, Norihisa; Iguchi, Taisen

    2014-05-01

    Daphnia magna has been used extensively to evaluate organism- and population-level responses to pollutants in acute toxicity and reproductive toxicity tests. We have previously reported that exposure to juvenile hormone (JH) agonists results in a reduction of reproductive function and production of male offspring in a cyclic parthenogenesis, D. magna. Recent advances in molecular techniques have provided tools to understand better the responses to pollutants in aquatic organisms, including D. magna. DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to JH agonists: methoprene (125, 250 and 500 ppb), fenoxycarb (0.5, 1 and 2 ppb) and epofenonane (50, 100 and 200 ppb). Exposure to these JH analogs resulted in chemical-specific patterns of gene expression. The heat map analyses based on hierarchical clustering revealed a similar pattern between treatments with a high dose of methoprene and with epofenonane. In contrast, treatment with low to middle doses of methoprene resulted in similar profiles to fenoxycarb treatments. Hemoglobin and JH epoxide hydrolase genes were clustered as JH-responsive genes. These data suggest that fenoxycarb has high activity as a JH agonist, methoprene shows high toxicity and epofenonane works through a different mechanism compared with other JH analogs, agreeing with data of previously reported toxicity tests. In conclusion, D. magna DNA microarray is useful for the classification of JH analogs and identification of JH-responsive genes.

  2. Molecular fingerprint similarity search in virtual screening.

    PubMed

    Cereto-Massagué, Adrià; Ojeda, María José; Valls, Cristina; Mulero, Miquel; Garcia-Vallvé, Santiago; Pujadas, Gerard

    2015-01-01

    Molecular fingerprints have been used for a long time now in drug discovery and virtual screening. Their ease of use (requiring little to no configuration) and the speed at which substructure and similarity searches can be performed with them - paired with a virtual screening performance similar to other more complex methods - is the reason for their popularity. However, there are many types of fingerprints, each representing a different aspect of the molecule, which can greatly affect search performance. This review focuses on commonly used fingerprint algorithms, their usage in virtual screening, and the software packages and online tools that provide these algorithms.

  3. Molecular graph convolutions: moving beyond fingerprints.

    PubMed

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-08-01

    Molecular "fingerprints" encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular graph convolutions, a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph-atoms, bonds, distances, etc.-which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement.

  4. Molecular graph convolutions: moving beyond fingerprints

    NASA Astrophysics Data System (ADS)

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-08-01

    Molecular "fingerprints" encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular graph convolutions, a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph—atoms, bonds, distances, etc.—which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement.

  5. Molecular graph convolutions: moving beyond fingerprints

    PubMed Central

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-01-01

    Molecular “fingerprints” encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular graph convolutions, a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph—atoms, bonds, distances, etc.—which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement. PMID:27558503

  6. Molecular crime scene investigation - dusting for fingerprints.

    PubMed

    Jürgen Bajorath

    2013-12-01

    In chemoinformatics and drug design, fingerprints (FPs) are defined as string representations of molecular structure and properties and are popular descriptors for similarity searching. FPs are generally characterized by the simplicity of their design and ease of use. Despite a long history in chemoinformatics, the potential and limitations of FP searching are often not well under- stood. Standard FPs can also be subjected to engineering techniques to tune them for specific search applications.

  7. Identification of molecular mechanisms used by Finegoldia magna to penetrate and colonize human skin.

    PubMed

    Murphy, Elizabeth C; Mörgelin, Matthias; Reinhardt, Dieter P; Olin, Anders I; Björck, Lars; Frick, Inga-Maria

    2014-10-01

    Finegoldia magna is a Gram-positive anaerobic commensal of the human skin microbiota, but also known to act as an opportunistic pathogen. Two primary virulence factors of F. magna are the subtilisin-like extracellular serine protease SufA and the adhesive protein FAF. This study examines the molecular mechanisms F. magna uses when colonizing or establishing an infection in the skin. FAF was found to be essential in the initial adherence of F. magna to human skin biopsies. In the upper layers of the epidermis FAF mediates adhesion through binding to galectin-7 - a keratinocyte cell marker. Once the bacteria moved deeper into the skin to the basement membrane layer, SufA was found to degrade collagen IV which forms the backbone structure of the basement membrane. It also degraded collagen V, whereby F. magna could reach deeper dermal tissue sites. In the dermis, FAF interacts with collagen V and fibrillin, which presumably helps the bacteria to establish infection in this area. The findings of this study paint a clear picture of how F. magna interacts with human skin and explain how it is such a successful opportunistic pathogen in chronic wounds and ulcers.

  8. Database fingerprint (DFP): an approach to represent molecular databases.

    PubMed

    Fernández-de Gortari, Eli; García-Jacas, César R; Martinez-Mayorga, Karina; Medina-Franco, José L

    2017-01-01

    Molecular fingerprints are widely used in several areas of chemoinformatics including diversity analysis and similarity searching. The fingerprint-based analysis of chemical libraries, in particular of large collections, usually requires the molecular representation of each compound in the library that may lead to issues of storage space and redundant calculations. In fact, information redundancy is inherent to the data, resulting on binary digit positions in the fingerprint without significant information. Herein is proposed a general approach to represent an entire compound library with a single binary fingerprint. The development of the database fingerprint (DFP) is illustrated first using a short fingerprint (MACCS keys) for 10 data sets of general interest in chemistry. The application of the DFP is further shown with PubChem fingerprints for the data sets used in the primary example but with a larger number of compounds, up to 25,000 molecules. The performance of DFP were studied through differential Shannon entropy, k-mean clustering, and DFP/Tanimoto similarity. The DFP is designed to capture key information of the compound collection and can be used to compare and assess the diversity of molecular libraries. This Preliminary Communication shows the potential of the novel fingerprint to conduct inter-library relationships. A major future goal is to apply the DFP for virtual screening and developing DFP for other data sets based on several different type of fingerprints.Graphical AbstractDatabase fingerprint captures the key information of molecular databases to perform chemical space characterization and virtual screening.

  9. Linking molecular and population stress responses in Daphnia magna exposed to cadmium.

    PubMed

    Connon, Richard; Hooper, Helen L; Sibly, Richard M; Lim, Fei-Ling; Heckmann, Lars-Henrik; Moore, David J; Watanabe, Hajime; Soetaert, Anneleen; Cook, Katie; Maund, Steve J; Hutchinson, Thomas H; Moggs, Jonathan; De Coen, Wim; Iguchi, Taisen; Callaghan, Amanda

    2008-03-15

    DNA microarrays can be used to measure environmental stress responses. If they are to be predictive of environmental impact, we need to determine if altered gene expression translates into negative impacts on individuals and populations. A large cDNA microarray (14000 spots) was created to measure molecular stress responses to cadmium in Daphnia magna,the mostwidely used aquatic indicator species, and relate responses to population growth rate (pgr). We used the array to detect differences in the transcription of genes in juvenile D. magna (24 h old) after 24 h exposure to a control and three cadmium concentrations (6, 20, and 37 microg Cd2+ L(-1)). Stress responses at the population level were estimated following a further 8 days exposure. Pgr was approximately linear negative with increasing cadmium concentration over this range. The microarray profile of gene expression in response to acute cadmium exposure begins to provide an overview of the molecular responses of D. magna, especially in relation to growth and development. Of the responding genes, 29% were involved with metabolism including carbohydrate, fat and peptide metabolism, and energy production, 31% were involved with transcription/translation, while 40% of responding genes were associated with cellular processes like growth and moulting, ion transport, and general stress responses (which included oxidative stress). Our production and application of a large Daphnia magna microarray has shown that measured gene responses can be logically linked to the impact of a toxicant such as cadmium on somatic growth and development, and consequently pgr.

  10. Fingerprinting Molecular Relaxation in Deformed Polymers

    NASA Astrophysics Data System (ADS)

    Wang, Zhe; Lam, Christopher N.; Chen, Wei-Ren; Wang, Weiyu; Liu, Jianning; Liu, Yun; Porcar, Lionel; Stanley, Christopher B.; Zhao, Zhichen; Hong, Kunlun; Wang, Yangyang

    2017-07-01

    The flow and deformation of macromolecules is ubiquitous in nature and industry, and an understanding of this phenomenon at both macroscopic and microscopic length scales is of fundamental and practical importance. Here, we present the formulation of a general mathematical framework, which could be used to extract, from scattering experiments, the molecular relaxation of deformed polymers. By combining and modestly extending several key conceptual ingredients in the literature, we show how the anisotropic single-chain structure factor can be decomposed by spherical harmonics and experimentally reconstructed from its cross sections on the scattering planes. The resulting wave-number-dependent expansion coefficients constitute a characteristic fingerprint of the macromolecular deformation, permitting detailed examinations of polymer dynamics at the microscopic level. We apply this approach to survey a long-standing problem in polymer physics regarding the molecular relaxation in entangled polymers after a large step deformation. The classical tube theory of Doi and Edwards predicts a fast chain retraction process immediately after the deformation, followed by a slow orientation relaxation through the reptation mechanism. This chain retraction hypothesis, which is the keystone of the tube theory for macromolecular flow and deformation, is critically examined by analyzing the fine features of the two-dimensional anisotropic spectra from small-angle neutron scattering by entangled polystyrenes. We show that the unique scattering patterns associated with the chain retraction mechanism are not experimentally observed. This result calls for a fundamental revision of the current theoretical picture for nonlinear rheological behavior of entangled polymeric liquids.

  11. Molecular characterization of Fascioloides magna (Trematoda: Fasciolidae) from south-western Poland based on mitochondrial markers.

    PubMed

    Králová-Hromadová, Ivica; Bazsalovicsová, Eva; Demiaszkiewicz, Aleksander W

    2015-09-01

    The giant liver fluke, Fascioloides magna, is a veterinary important liver parasite of free living and domestic ruminants. This originally North American parasite was introduced along with its cervid hosts to Europe where it has established three permanent natural foci - in northern Italy, central and southern parts of the Czech Republic and the Danube floodplain forests. The first record on fascioloidosis in Poland originated from the Lower Silesian Forest in south-western Poland and since then an occurrence of F. magna in this country has not been documented. Recently, the parasitological examination of red deer (Cervus elaphus elaphus) from the Lower Silesian Wilderness (south-western Poland) revealed the presence of F. magna eggs. In order to determine the genetic interrelationships of the Polish giant liver fluke individuals, they were molecularly analyzed by mitochondrial cytochrome c oxidase subunit I (cox1) and nicotinamide dehydrogenase subunit I (nad1) and compared with haplotypes of so far studied European populations of the parasite. The study revealed the genetic uniformity of F. magna specimens from Poland with part of individuals from the Czech natural focus. Note: Nucleotide sequence data reported in this paper are available in the GenBank, EMBL and DDBJ databases under the accession numbers KP635008-9.

  12. Molecular toxicity identification evaluation (mTIE) approach predicts chemical exposure in Daphnia magna.

    PubMed

    Antczak, Philipp; Jo, Hun Je; Woo, Seonock; Scanlan, Leona; Poynton, Helen; Loguinov, Alex; Chan, Sarah; Falciani, Francesco; Vulpe, Chris

    2013-10-15

    Daphnia magna is a bioindicator organism accepted by several international water quality regulatory agencies. Current approaches for assessment of water quality rely on acute and chronic toxicity that provide no insight into the cause of toxicity. Recently, molecular approaches, such as genome wide gene expression responses, are enabling an alternative mechanism based approach to toxicity assessment. While these genomic methods are providing important mechanistic insight into toxicity, statistically robust prediction systems that allow the identification of chemical contaminants from the molecular response to exposure are needed. Here we apply advanced machine learning approaches to develop predictive models of contaminant exposure using a D. magna gene expression data set for 36 chemical exposures. We demonstrate here that we can discriminate between chemicals belonging to different chemical classes including endocrine disruptors and inorganic and organic chemicals based on gene expression. We also show that predictive models based on indices of whole pathway transcriptional activity can achieve comparable results while facilitating biological interpretability.

  13. Proteomic analysis of Daphnia magna hints at molecular pathways involved in defensive plastic responses.

    PubMed

    Otte, Kathrin A; Fröhlich, Thomas; Arnold, Georg J; Laforsch, Christian

    2014-04-24

    Phenotypic plasticity in defensive traits occurs in many species when facing heterogeneous predator regimes. The waterflea Daphnia is well-known for showing a variety of these so called inducible defences. However, molecular mechanisms underlying this plasticity are poorly understood so far. We performed proteomic analysis on Daphnia magna exposed to chemical cues of the predator Triops cancriformis. D. magna develops an array of morphological changes in the presence of Triops including changes of carapace morphology and cuticle hardening. Using the 2D-DIGE technique, 1500 protein spots could be matched and quantified. We discovered 179 protein spots with altered intensity when comparing Triops exposed animals to a control group, and 69 spots were identified using nano-LC MS/MS. Kairomone exposure increased the intensity of spots containing muscle proteins, cuticle proteins and chitin-modifying enzymes as well as enzymes of carbohydrate and energy metabolism. The yolk precursor protein vitellogenin decreased in abundance in 41 of 43 spots. Identified proteins may be either directly involved in carapace stability or reflect changes in energy demand and allocation costs in animals exposed to predator kairomones. Our results present promising candidate proteins involved in the expression of inducible defences in Daphnia and enable further in depth analysis of this phenomenon.

  14. Proteomic analysis of Daphnia magna hints at molecular pathways involved in defensive plastic responses

    PubMed Central

    2014-01-01

    Background Phenotypic plasticity in defensive traits occurs in many species when facing heterogeneous predator regimes. The waterflea Daphnia is well-known for showing a variety of these so called inducible defences. However, molecular mechanisms underlying this plasticity are poorly understood so far. We performed proteomic analysis on Daphnia magna exposed to chemical cues of the predator Triops cancriformis. D. magna develops an array of morphological changes in the presence of Triops including changes of carapace morphology and cuticle hardening. Results Using the 2D-DIGE technique, 1500 protein spots could be matched and quantified. We discovered 179 protein spots with altered intensity when comparing Triops exposed animals to a control group, and 69 spots were identified using nano-LC MS/MS. Kairomone exposure increased the intensity of spots containing muscle proteins, cuticle proteins and chitin-modifying enzymes as well as enzymes of carbohydrate and energy metabolism. The yolk precursor protein vitellogenin decreased in abundance in 41 of 43 spots. Conclusion Identified proteins may be either directly involved in carapace stability or reflect changes in energy demand and allocation costs in animals exposed to predator kairomones. Our results present promising candidate proteins involved in the expression of inducible defences in Daphnia and enable further in depth analysis of this phenomenon. PMID:24762235

  15. Fingerprinting Electronic Molecular Complexes in Liquid

    NASA Astrophysics Data System (ADS)

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules.

  16. Fingerprinting Electronic Molecular Complexes in Liquid

    PubMed Central

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules. PMID:26743542

  17. Molecular Fingerprints to Identify Candida Species

    PubMed Central

    Spampinato, Claudia

    2013-01-01

    A wide range of molecular techniques have been developed for genotyping Candida species. Among them, multilocus sequence typing (MLST) and microsatellite length polymorphisms (MLP) analysis have recently emerged. MLST relies on DNA sequences of internal regions of various independent housekeeping genes, while MLP identifies microsatellite instability. Both methods generate unambiguous and highly reproducible data. Here, we review the results achieved by using these two techniques and also provide a brief overview of a new method based on high-resolution DNA melting (HRM). This method identifies sequence differences by subtle deviations in sample melting profiles in the presence of saturating fluorescent DNA binding dyes. PMID:23844370

  18. Systems biology meets stress ecology: linking molecular and organismal stress responses in Daphnia magna

    PubMed Central

    Heckmann, Lars-Henrik; Sibly, Richard M; Connon, Richard; Hooper, Helen L; Hutchinson, Thomas H; Maund, Steve J; Hill, Christopher J; Bouetard, Anthony; Callaghan, Amanda

    2008-01-01

    Background Ibuprofen and other nonsteroidal anti-inflammatory drugs have been designed to interrupt eicosanoid metabolism in mammals, but little is known of how they affect nontarget organisms. Here we report a systems biology study that simultaneously describes the transcriptomic and phenotypic stress responses of the model crustacean Daphnia magna after exposure to ibuprofen. Results Our findings reveal intriguing similarities in the mode of action of ibuprofen between vertebrates and invertebrates, and they suggest that ibuprofen has a targeted impact on reproduction at the molecular, organismal, and population level in daphnids. Microarray expression and temporal real-time quantitative PCR profiles of key genes suggest early ibuprofen interruption of crustacean eicosanoid metabolism, which appears to disrupt signal transduction affecting juvenile hormone metabolism and oogenesis. Conclusion Combining molecular and organismal stress responses provides a guide to possible chronic consequences of environmental stress for population health. This could improve current environmental risk assessment by providing an early indication of the need for higher tier testing. Our study demonstrates the advantages of a systems approach to stress ecology, in which Daphnia will probably play a major role. PMID:18291039

  19. Molecular mechanisms of tolerance to cyanobacterial protease inhibitors revealed by clonal differences in Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Kuster, Christian J; Von Elert, Eric

    2012-10-01

    Protease inhibitors of primary producers are a major food quality constraint for herbivores. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is mainly represented by Daphnia and cyanobacteria. Protease inhibitors have been found in many cyanobacterial blooms. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the daphnid's gut, that is, trypsins and chymotrypsins. In this study, we fed four different Daphnia magna genotypes with the trypsin-inhibitor-containing cyanobacterial strain Microcystis aeruginosa PCC 7806 Mut. Upon exposure to dietary trypsin inhibitors, all D. magna genotypes showed increased gene expression of digestive trypsins and chymotrypsins. Exposure to dietary trypsin inhibitors resulted in increased activity of chymotrypsins and reduced activity of trypsin. Strong intraspecific differences in tolerance of the four D. magna genotypes to the dietary trypsin inhibitors were found. The degree of tolerance depended on the D. magna genotype. The genotypes' tolerance was positively correlated with the residual trypsin activity and the different IC(50) values of the trypsins. On the genetic level, the different trypsin loci varied between the D. magna genotypes. The two tolerant Daphnia genotypes that both originate from the same lake, which frequently produces cyanobacterial blooms, clustered in a neighbour-joining phylogenetic tree based on the three trypsin loci. This suggests that the genetic variability of trypsin loci was an important cause for the observed intraspecific variability in tolerance to cyanobacterial trypsin inhibitors. Based on these findings, it is reasonable to assume that such genetic variability can also be found in natural populations and thus constitutes the basis for local adaptation of natural populations to dietary protease inhibitors.

  20. Phylogeny and molecular fingerprinting of green sulfur bacteria.

    PubMed

    Overmann, J; Tuschak, C

    1997-05-01

    The 16S rDNA sequences of nine strains of green sulfur bacteria (Chlorobiaceae) were determined and compared to the four known sequences of Chlorobiaceae and to sequences representative for all eubacterial phyla. The sequences of the Chlorobiaceae strains were consistent with the secondary structure model proposed earlier for Chlorobium vibrioforme strain 6030. Similarity values > 90.1% and Knuc values < 0.11 indicate a close phylogenetic relatedness among the green sulfur bacteria. As a group, these bacteria represent an isolated branch within the eubacterial radiation. In Chlorobiaceae, a similar morphology does not always reflect a close phylogenetic relatedness. While ternary fission is a morphological trait of phylogenetic significance, gas vesicle formation occurs also in distantly related species. Pigment composition is not an indicator of phylogenetic relatedness since very closely related species contain different bacteriochlorophylls and carotenoids. Two different molecular fingerprinting techniques for the rapid differentiation of Chlorobiaceae species were investigated. The 16S rDNA fragments of several species could not be separated by denaturing gradient gel electrophoresis. In contrast, all strains investigated during the present work gave distinct banding patterns when dispersed repetitive DNA sequences were used as targets in PCR. The latter technique is, therefore, well suited for the rapid screening of isolated pure cultures of green sulfur bacteria.

  1. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    PubMed

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  2. Molecular fingerprinting on the SIMD parallel processor Kestrel.

    PubMed

    Rice, E; Hughey, R

    2001-01-01

    In combinatorial library design and use, the conformation space of molecules can be represented using three-dimensional (3-D) pharmacophores. For large libraries of flexible molecules, the calculation of these 3-D pharmacophoric fingerprints can require examination of trillions of pharmacophores, presenting a significant practical challenge. Here we describe the mapping of this problem to the UCSC Kestrel parallel processor, a single-instruction multiple-data (SIMD) processor. Data parallelism is achieved by simultaneous processing of multiple conformations and by careful representation of the fingerprint structure in the array. The resulting application achieved a 35+ speedup over an SGI 2000 processor on the prototype Kestrel board.

  3. Linguini Models of Molecular Genetic Mapping and Fingerprinting.

    ERIC Educational Resources Information Center

    Thompson, James N., Jr.; Gray, Stanton B.; Hellack, Jenna J.

    1997-01-01

    Presents an exercise using linguini noodles to demonstrate an aspect of DNA fingerprinting. DNA maps that show genetic differences can be produced by digesting a certain piece of DNA with two or more restriction enzymes both individually and in combination. By rearranging and matching linguini fragments, students can recreate the original pattern…

  4. Linguini Models of Molecular Genetic Mapping and Fingerprinting.

    ERIC Educational Resources Information Center

    Thompson, James N., Jr.; Gray, Stanton B.; Hellack, Jenna J.

    1997-01-01

    Presents an exercise using linguini noodles to demonstrate an aspect of DNA fingerprinting. DNA maps that show genetic differences can be produced by digesting a certain piece of DNA with two or more restriction enzymes both individually and in combination. By rearranging and matching linguini fragments, students can recreate the original pattern…

  5. Comparison of molecular fingerprint methods on the basis of biological profile data.

    PubMed

    Steffen, Andreas; Kogej, Thierry; Tyrchan, Christian; Engkvist, Ola

    2009-02-01

    In this study we evaluated a set of molecular fingerprint methods with respect to their capability to reproduce similarities in the biological activity space. The evaluation presented in this paper is therefore different from many other fingerprint studies, in which the enrichment of active compounds binding to the same target as selected query structures was studied. Conversely, our data set was extracted from the BioPrint database, which contains uniformly derived biological activity profiles of mainly marketed drugs for a range of biological assays relevant for the pharmaceutical industry. We compared calculated molecular fingerprint similarity values between all compound pairs of the data set with the corresponding similarities in the biological activity space and additionally analyzed agreements of generated clusterings. A closer analysis of the compound pairs with a high biological activity similarity revealed that fingerprint methods such as CHEMGPS or TRUST4, which describe global features of a molecule such as physicochemical properties and pharmacophore patterns, might be better suited to describe similarity of biological activity profiles than purely structural fingerprint methods. It is therefore suggested that the usage of these fingerprint methods could increase the probability of finding molecules with a similar biological activity profile but yet a different chemical structure.

  6. Telopathes magna gen. nov., spec. nov. (Cnidaria: Anthozoa: Antipatharia: Schizopathidae) from deep waters off Atlantic Canada and the first molecular phylogeny of the deep-sea family Schizopathidae.

    PubMed

    Macisaac, K G; Best, M; Brugler, M R; Kenchington, E L R; Anstey, L J; Jordan, T

    2013-01-01

    A new genus and species of deep-sea antipatharian, Telopathes magna gen. nov., spec. nov., is described from the western North Atlantic off the coast of Canada. Five additional paratypes, consisting ofjuvenile to adult forms, are reported from the New England and Corner Rise Seamounts (NW Atlantic). Preliminary sequencing of a subsection of the nuclear ribosomal cistron confirmed the phylogenetic affinity of T. magna to the order Antipatharia, and in particular the family Schizopathidae. Subsequent sequencing of three mitochondrial DNA segments from nine of the 11 currently-recognized genera within the Schizopathidae revealed a well-supported phylogenetic relationship between T. magna and Stauropathes. This is the first study to use molecular techniques to elucidate the evolutionary relationships of the Schizopathidae, a family of black corals almost exclusively found in the deep sea (depths > 200 m). Telopathes is distinguished from other genera within the family Schizopathidae by its largely pinnulated stalk, sparse branching pattern to the second degree that is not restricted to a single plane, two anterolateral rows of long, simple primary pinnules, arranged alternately to sub-opposite, and colony with an adhesive base. This record of T. magna brings the total number of nominal species of Antipatharia reported to occur off eastern Canada to 12 and represents the third new genus added to the Schizopathidae since a critical review of the family by Dennis Opresko in 2002.

  7. De novo design of novel DNA-gyrase inhibitors based on 2D molecular fingerprints.

    PubMed

    Huang, Zhengui; Lin, Kejiang; You, Qidong

    2013-07-15

    As increasing drug-resistance poses an emerging threat to public health, the development of novel antibacterial agents is critical. We developed a workflow consisting of various methods for de novo design. In the workflow, 2D-QSAR model based on molecular fingerprints was constructed to extract the bioactive molecular fingerprints from a data set of DNA-gyrase inhibitors with new structure and mechanism. These fingerprints were converted into molecular fragments which were recombined to generate compound library. The new compound library was virtually screened by LigandFit and Gold docking, and the results were further investigated by pharmacophore validation and binding mode analysis. The workflow successfully achieved a potential DNA-gyrase inhibitor. It could be applied to design more novel potential DNA-gyrase inhibitors and provide theoretical basis for further optimization of the hit compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. PaDEL-descriptor: an open source software to calculate molecular descriptors and fingerprints.

    PubMed

    Yap, Chun Wei

    2011-05-01

    PaDEL-Descriptor is a software for calculating molecular descriptors and fingerprints. The software currently calculates 797 descriptors (663 1D, 2D descriptors, and 134 3D descriptors) and 10 types of fingerprints. These descriptors and fingerprints are calculated mainly using The Chemistry Development Kit. Some additional descriptors and fingerprints were added, which include atom type electrotopological state descriptors, McGowan volume, molecular linear free energy relation descriptors, ring counts, count of chemical substructures identified by Laggner, and binary fingerprints and count of chemical substructures identified by Klekota and Roth. PaDEL-Descriptor was developed using the Java language and consists of a library component and an interface component. The library component allows it to be easily integrated into quantitative structure activity relationship software to provide the descriptor calculation feature while the interface component allows it to be used as a standalone software. The software uses a Master/Worker pattern to take advantage of the multiple CPU cores that are present in most modern computers to speed up calculations of molecular descriptors. The software has several advantages over existing standalone molecular descriptor calculation software. It is free and open source, has both graphical user interface and command line interfaces, can work on all major platforms (Windows, Linux, MacOS), supports more than 90 different molecular file formats, and is multithreaded. PaDEL-Descriptor is a useful addition to the currently available molecular descriptor calculation software. The software can be downloaded at http://padel.nus.edu.sg/software/padeldescriptor. Copyright © 2010 Wiley Periodicals, Inc.

  9. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    USDA-ARS?s Scientific Manuscript database

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  10. Assessment of scaffold hopping efficiency by use of molecular interaction fingerprints.

    PubMed

    Venhorst, Jennifer; Núñez, Sara; Terpstra, Jan Willem; Kruse, Chris G

    2008-06-12

    A novel scoring algorithm based on molecular interaction fingerprints (IFPs) was comparatively evaluated in its scaffold hopping efficiency against four virtual screening standards (GlideXP, Gold, ROCS, and a Bayesian classifier). Decoy databases for the two targets under examination, adenosine deaminase and retinoid X receptor alpha, were obtained from the Directory of Useful Decoys and were further enriched with approximately 5% of active ligands. Structure and ligand-based methods were used to generate the ligand poses, and a Tanimoto metric was chosen for the calculation of the similarity interaction fingerprint between the reference ligand and the screening database. Database enrichments were found to strongly depend on the pose generator algorithm. In spite of these dependencies, enrichments using molecular IFPs were comparable to those obtained with GlideXP, Gold, ROCS, and the Bayesian classifier. More interestingly, the molecular IFP scoring algorithm outperformed these methods at scaffold hopping enrichment, regardless of the pose generator algorithm.

  11. Linear polyalkylamines as fingerprinting agents in capillary electrophoresis of low molecular weight heparins and glycosaminoglycans

    PubMed Central

    King, J. Timothy; Desai, Umesh R.

    2012-01-01

    Glycosaminoglycan (GAG) analysis represents a challenging frontier despite the advent of many high resolution technologies because of their unparalleled structural complexity. We previously developed a resolving agent aided capillary electrophoretic approach for fingerprinting low molecular weight heparins (LMWHs) to profile their microscopic differences and assess batch-to-batch variability. In this work, we study the application of this approach for fingerprinting other GAGs and analyze the basis for the fingerprints observed in CE. Whereas the resolving agents, linear polyalkylamines, could resolve the broad featureless electropherogram of LMWH into a large number of distinct, highly reproducible peaks, longer GAGs such as chondroitin sulfate, dermatan sulfate and heparin responded in a highly individualistic manner. Full-length heparin interacted with linear polyalkylamines very strongly followed by dermatan sulfate, while chondroitin sulfate remained essentially unaffected. Oversulfated chondroitin sulfate could be easily identified from full-length heparin. Scatchard analysis of the binding profile of enoxaparin with three linear polyalkylamines displayed a biphasic binding profile suggesting two distinctly different types of interactions. Some LMWH chains were found to interact with linear polyalkylamines with affinities as high as 10 nM, while others displayed nearly 5000-fold weaker affinities. These observations provide fundamental insight into the basis for fingerprinting of LMWHs by linear polyalkylamine-based resolving agents, which could be utilized in the design of advanced resolving agents for compositional profiling, direct sequencing and chemoinformatics studies. PMID:22002802

  12. [The problem of molecular-genetic identification of sweat and grease deposits in the human fingerprints].

    PubMed

    Faleeva, T G; Ivanov, I N; Mishin, E S; Vnukova, N V; Kornienko, I V

    2016-01-01

    The objective of the present experimental molecular-genetic study of DNA contained in of human fingerprints was to establish the relationship between the reference genetic profiles and the genotypes of the individuals leaving their fingerprints on a smooth metal object. The biological material for the purpose of the investigation was sampled at different time intervals. The were taken using a scotch tape and used to obtain the complete genetic profile immediately after the fingerprints had been left as well as within the next 24 hours and one week. It proved impossible to identify the complete genetic profile one month after the fingerprints had been left. The alleles not typical for reference samples were identified within one week after swabbing the material from the metal surface. The results of the sudy can be explained by the decrease of the concentration of the initial DNA-matrix in the samples due to its degradation in the course of time. It is concluded that the parallel genetic analysis is needed if reliable evidence of identity of the profiles of interest or its absence is to be obtained.

  13. Zika virus disrupts molecular fingerprinting of human neurospheres

    PubMed Central

    Garcez, Patricia P.; Nascimento, Juliana Minardi; de Vasconcelos, Janaina Mota; Madeiro da Costa, Rodrigo; Delvecchio, Rodrigo; Trindade, Pablo; Loiola, Erick Correia; Higa, Luiza M.; Cassoli, Juliana S.; Vitória, Gabriela; Sequeira, Patricia C.; Sochacki, Jaroslaw; Aguiar, Renato S.; Fuzii, Hellen Thais; de Filippis, Ana M. Bispo; da Silva Gonçalves Vianez Júnior, João Lídio; Tanuri, Amilcar; Martins-de-Souza, Daniel; Rehen, Stevens K.

    2017-01-01

    Zika virus (ZIKV) has been associated with microcephaly and other brain abnormalities; however, the molecular consequences of ZIKV to human brain development are still not fully understood. Here we describe alterations in human neurospheres derived from induced pluripotent stem (iPS) cells infected with the strain of Zika virus that is circulating in Brazil. Combining proteomics and mRNA transcriptional profiling, over 500 proteins and genes associated with the Brazilian ZIKV infection were found to be differentially expressed. These genes and proteins provide an interactome map, which indicates that ZIKV controls the expression of RNA processing bodies, miRNA biogenesis and splicing factors required for self-replication. It also suggests that impairments in the molecular pathways underpinning cell cycle and neuronal differentiation are caused by ZIKV. These results point to biological mechanisms implicated in brain malformations, which are important to further the understanding of ZIKV infection and can be exploited as therapeutic potential targets to mitigate it. PMID:28112162

  14. Metabolite identification and molecular fingerprint prediction through machine learning.

    PubMed

    Heinonen, Markus; Shen, Huibin; Zamboni, Nicola; Rousu, Juho

    2012-09-15

    Metabolite identification from tandem mass spectra is an important problem in metabolomics, underpinning subsequent metabolic modelling and network analysis. Yet, currently this task requires matching the observed spectrum against a database of reference spectra originating from similar equipment and closely matching operating parameters, a condition that is rarely satisfied in public repositories. Furthermore, the computational support for identification of molecules not present in reference databases is lacking. Recent efforts in assembling large public mass spectral databases such as MassBank have opened the door for the development of a new genre of metabolite identification methods. We introduce a novel framework for prediction of molecular characteristics and identification of metabolites from tandem mass spectra using machine learning with the support vector machine. Our approach is to first predict a large set of molecular properties of the unknown metabolite from salient tandem mass spectral signals, and in the second step to use the predicted properties for matching against large molecule databases, such as PubChem. We demonstrate that several molecular properties can be predicted to high accuracy and that they are useful in de novo metabolite identification, where the reference database does not contain any spectra of the same molecule. An Matlab/Python package of the FingerID tool is freely available on the web at http://www.sourceforge.net/p/fingerid. markus.heinonen@cs.helsinki.fi.

  15. The fingerprint of the human gastrointestinal tract microbiota: a hypothesis of molecular mapping.

    PubMed

    Tomasello, G; Mazzola, M; Jurjus, A; Cappello, F; Carini, F; Damiani, P; Gerges Geagea, A; Zeenny, M N; Leone, A

    2017-01-01

    The precise etiology of Inflammatory Bowel Disease (IDB) remains unclear and several factors are believed to play a role in its development and progression, including the composition of microbial communities resident in the gastrointestinal tract. Human intestinal microbiota are extensive with at least 15,000-36,000 bacterial species. However, thanks to the new development in sequencing and molecular taxonomic methodologies, our understanding of the microbiota population composition, dynamics, and ecology has greatly increased. Intestinal microbiota play a critical role in the maintenance of the host intestinal barrier homeostasis, while dysbiosis, which involves reduction in the microbiome diversity, can lead to progression of inflammatory disorders, such as IBD and colorectal cancer. It is hypothesized that fingerprinting characterization of the microbiota community composition is the first step in the study of this complex bacterial ecosystem and a crucial step in the targeted therapy. Molecular fingerprinting of human gastrointestinal tract microbiota could be performed by different techniques including the semi quantitation, 16SrRNA, the DNA- microarray as well as other relatively new methods which were developed to study many complex bacterial ecosystems. These techniques provide individual data and profiles, using fast and sensitive tools for the high taxonomic level fingerprint of the human intestinal microbiota and provide estimation of the relative presence of the microbial target groups within each individual. Such personalized information serves as a remarkable and unprecedented opportunity to improve targeted medical treatment and probably develop strategies to prevent disease.

  16. ¹⁹F NMR fingerprints: identification of neutral organic compounds in a molecular container.

    PubMed

    Zhao, Yanchuan; Markopoulos, Georgios; Swager, Timothy M

    2014-07-30

    Improved methods for quickly identifying neutral organic compounds and differentiation of analytes with similar chemical structures are widely needed. We report a new approach to effectively "fingerprint" neutral organic molecules by using (19)F NMR and molecular containers. The encapsulation of analytes induces characteristic up- or downfield shifts of (19)F resonances that can be used as multidimensional parameters to fingerprint each analyte. The strategy can be achieved either with an array of fluorinated receptors or by incorporating multiple nonequivalent fluorine atoms in a single receptor. Spatial proximity of the analyte to the (19)F is important to induce the most pronounced NMR shifts and is crucial in the differentiation of analytes with similar structures. This new scheme allows for the precise and simultaneous identification of multiple analytes in a complex mixture.

  17. Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

    PubMed

    McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

    2016-05-05

    One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. http://creativecommons.org/licenses/by-nc-nd/4.0/.

  18. Endoscopic Raman Spectroscopy for Molecular Fingerprinting of Gastric Cancer: Principle to Implementation

    PubMed Central

    2015-01-01

    Currently, positive endoscopic biopsy is the standard criterion for gastric cancer diagnosis but is invasive, often inconsistent, and delayed although early detection and early treatment is the most important policy. Raman spectroscopy is a spectroscopic technique based on inelastic scattering of monochromatic light. Raman spectrum represents molecular composition of the interrogated volume providing a direct molecular fingerprint. Several investigations revealed that Raman spectroscopy can differentiate normal, dysplastic, and adenocarcinoma gastric tissue with high sensitivity and specificity. Moreover, this technique can indentify malignant ulcer and showed the capability to analyze the carcinogenesis process. Automated on-line Raman spectral diagnostic system raised possibility to use Raman spectroscopy in clinical field. Raman spectroscopy can be applied in many fields such as guiding a target biopsy, optical biopsy in bleeding prone situation, and delineating the margin of the lesion. With wide field technology, Raman spectroscopy is expected to have specific role in our future clinical field. PMID:26106612

  19. Endoscopic Raman Spectroscopy for Molecular Fingerprinting of Gastric Cancer: Principle to Implementation.

    PubMed

    Kim, Hyung Hun

    2015-01-01

    Currently, positive endoscopic biopsy is the standard criterion for gastric cancer diagnosis but is invasive, often inconsistent, and delayed although early detection and early treatment is the most important policy. Raman spectroscopy is a spectroscopic technique based on inelastic scattering of monochromatic light. Raman spectrum represents molecular composition of the interrogated volume providing a direct molecular fingerprint. Several investigations revealed that Raman spectroscopy can differentiate normal, dysplastic, and adenocarcinoma gastric tissue with high sensitivity and specificity. Moreover, this technique can indentify malignant ulcer and showed the capability to analyze the carcinogenesis process. Automated on-line Raman spectral diagnostic system raised possibility to use Raman spectroscopy in clinical field. Raman spectroscopy can be applied in many fields such as guiding a target biopsy, optical biopsy in bleeding prone situation, and delineating the margin of the lesion. With wide field technology, Raman spectroscopy is expected to have specific role in our future clinical field.

  20. Molecular Fingerprinting Studies Do Not Support Intrahospital Transmission of Candida albicans among Candidemia Patients in Kuwait.

    PubMed

    Asadzadeh, Mohammad; Ahmad, Suhail; Al-Sweih, Noura; Khan, Ziauddin

    2017-01-01

    Candida albicans, a constituent of normal microbial flora of human mucosal surfaces, is a major cause of candidemia in immunocompromised individuals and hospitalized patients with other debilitating diseases. Molecular fingerprinting studies have suggested nosocomial transmission of C. albicans based on the presence of clusters or endemic genotypes in some hospitals. However, intrahospital strain transmission or a common source of infection has not been firmly established. We performed multilocus sequence typing (MLST) on 102 C. albicans bloodstream isolates (representing 92% of all culture-confirmed candidemia patients over a 31-month period at seven major hospitals) to identify patient-to-patient transmission or infection from a common source in Kuwait, a small country in the Middle East where consanguineous marriages are common. Repeat bloodstream isolates from six patients and nine surveillance cultures from other anatomic sites from six patients were also analyzed. Fifty-five isolates belonged to unique genotypes. Forty-seven isolates from 47 patients formed 16 clusters, with each cluster containing 2-9 isolates. Multiple isolates from the same patient from bloodstream or other anatomical sites yielded identical genotypes. We identified four cases of potential patient-to-patient transmission or infection from a common source based on association analysis between patients' clinical/epidemiological data and the corresponding MLST genotypes of eight C. albicans isolates. However, further fingerprinting by whole genome-based amplified fragment length polymorphism (AFLP) analysis yielded 8 different genotypes, ruling out intrahospital transmission of infection. The findings suggest that related strains of C. albicans exist in the community and fingerprinting by MLST alone may complicate hospital infection control measures during outbreak investigations.

  1. Molecular Fingerprinting Studies Do Not Support Intrahospital Transmission of Candida albicans among Candidemia Patients in Kuwait

    PubMed Central

    Asadzadeh, Mohammad; Ahmad, Suhail; Al-Sweih, Noura; Khan, Ziauddin

    2017-01-01

    Candida albicans, a constituent of normal microbial flora of human mucosal surfaces, is a major cause of candidemia in immunocompromised individuals and hospitalized patients with other debilitating diseases. Molecular fingerprinting studies have suggested nosocomial transmission of C. albicans based on the presence of clusters or endemic genotypes in some hospitals. However, intrahospital strain transmission or a common source of infection has not been firmly established. We performed multilocus sequence typing (MLST) on 102 C. albicans bloodstream isolates (representing 92% of all culture-confirmed candidemia patients over a 31-month period at seven major hospitals) to identify patient-to-patient transmission or infection from a common source in Kuwait, a small country in the Middle East where consanguineous marriages are common. Repeat bloodstream isolates from six patients and nine surveillance cultures from other anatomic sites from six patients were also analyzed. Fifty-five isolates belonged to unique genotypes. Forty-seven isolates from 47 patients formed 16 clusters, with each cluster containing 2–9 isolates. Multiple isolates from the same patient from bloodstream or other anatomical sites yielded identical genotypes. We identified four cases of potential patient-to-patient transmission or infection from a common source based on association analysis between patients' clinical/epidemiological data and the corresponding MLST genotypes of eight C. albicans isolates. However, further fingerprinting by whole genome-based amplified fragment length polymorphism (AFLP) analysis yielded 8 different genotypes, ruling out intrahospital transmission of infection. The findings suggest that related strains of C. albicans exist in the community and fingerprinting by MLST alone may complicate hospital infection control measures during outbreak investigations. PMID:28270801

  2. Molecular Dynamics Fingerprints (MDFP): Machine-Learning from MD Data to Predict Free-Energy Differences.

    PubMed

    Riniker, Sereina

    2017-04-03

    While the use of machine-learning (ML) techniques is well established in cheminformatics for the prediction of physicochemical properties and binding affinities, the training of ML models based on data from molecular dynamics (MD) simulations remains largely unexplored. Here, we present a fingerprint termed MDFP which is constructed from the distributions of properties such as potential-energy components, radius of gyration and solvent-accessible surface area extracted from MD simulations. The corresponding fingerprint elements are the first two statistical moments of the distributions and the median. By considering not only the average but also the spread of the distribution in the fingerprint, some degree of entropic information is encoded. Short MD simulations of the molecules in water (and in vacuum) are used to generate the MDFP. These are further combined with simple counts based on the 2D structure of the molecules into MDFP+. The resulting information-rich MDFP+ are used to train ML models for the prediction of solvation free energies in five different solvents (water, octanol, chloroform, hexadecane and cyclohexane) as well as partition coefficients in octanol/water, hexadecane/water and cyclohexane/water. The approach is easy to implement and computationally relatively inexpensive. Yet, it performs similarly well compared to more rigorous MD-based free-energy methods such as free-energy pertur- bation (FEP) as well as end-state methods such as linear interaction energy (LIE), the conductor-like screening model for realistic solvation (COSMO-RS) and the SMx family of solvation models.

  3. Quantitative Molecular Assay for Fingerprinting Microbial Communities of Wastewater and Estrogen-Degrading Consortia

    PubMed Central

    Yu, Chang-Ping; Ahuja, Rajiv; Sayler, Gary; Chu, Kung-Hui

    2005-01-01

    A quantitative fingerprinting method, called the real-time terminal restriction fragment length polymorphism (real-time-t-RFLP) assay, was developed for simultaneous determination of microbial diversity and abundance within a complex community. The real-time-t-RFLP assay was developed by incorporating the quantitative feature of real-time PCR and the fingerprinting feature of t-RFLP analysis. The assay was validated by using a model microbial community containing three pure strains, an Escherichia coli strain (gram negative), a Pseudomonas fluorescens strain (gram negative), and a Bacillus thuringiensis strain (gram positive). Subsequently, the real-time-t-RFLP assay was applied to and proven to be useful for environmental samples; the richness and abundance of species in microbial communities (expressed as the number of 16S rRNA gene copies of each ribotype per milliliter) of wastewater and estrogen-degrading consortia (enriched with 17α-estradiol, 17β-estradiol, or estrone) were successfully characterized. The results of this study strongly suggested that the real-time-t-RFLP assay can be a powerful molecular tool for gaining insight into microbial communities in various engineered systems and natural habitats. PMID:15746346

  4. Sequencing human mitochondrial hypervariable region II as a molecular fingerprint for environmental waters.

    PubMed

    Kapoor, Vikram; DeBry, Ronald W; Boccelli, Dominic L; Wendell, David

    2014-09-16

    To protect environmental water from human fecal contamination, authorities must be able to unambiguously identify the source of the contamination. Current identification methods focus on tracking fecal bacteria associated with the human gut, but many of these bacterial indicators also thrive in the environment and in other mammalian hosts. Mitochondrial DNA could solve this problem by serving as a human-specific marker for fecal contamination. Here we show that the human mitochondrial hypervariable region II can function as a molecular fingerprint for human contamination in an urban watershed impacted by combined sewer overflows. We present high-throughput sequencing analysis of hypervariable region II for spatial resolution of the contaminated sites and assessment of the population diversity of the impacting regions. We propose that human mitochondrial DNA from public waste streams may serve as a tool for identifying waste sources definitively, analyzing population diversity, and conducting other anthropological investigations.

  5. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    PubMed Central

    Burgess, Jacob A.J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-01-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface. PMID:26359203

  6. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope.

    PubMed

    Burgess, Jacob A J; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-09-11

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

  7. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    NASA Astrophysics Data System (ADS)

    Burgess, Jacob A. J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-09-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

  8. Highland cattle and Radix labiata, the hosts of Fascioloides magna

    PubMed Central

    2014-01-01

    Background Fascioloides magna is a pathogenic fluke introduced to Europe ca 140 years ago. As it is spreading over the continent, new intermediate and definitive hosts might be involved in transmission of the parasite. In Europe, several studies reported potential new intermediate snail hosts (Radix spp.) for F. magna, and also several cases of fascioloidosis of wild and domestic animals were published. However, the data based on molecular and histological analyses confirming these findings remained unreported. This study aims to refer to unique findings of F. magna in European snails and domestic animals (the first observation in the Czech Republic in the last 30 years) and demonstrate the use of molecular techniques in determination of F. magna. Results Two snails of R. labiata naturally infected with F. magna were found; mature cercariae and daughter rediae were observed. Maturity of cercariae was checked by histological methods, however, their ability to encyst was not confirmed. Co-infection of F. magna and Fasciola hepatica in the liver of two highland cattle bulls was proved. Adult fasciolid flukes producing eggs were found in the liver pseudocysts (F. magna) and the bile ducts (F. hepatica). Identification of intermediate hosts, intramolluscan stages, adult flukes and eggs was performed by sequencing the ITS2 region. Connection of F. magna pseudocysts with the gut (via the bile ducts) was not confirmed by means of histological and coprological examinations. Conclusions For the first time, Radix labiata was confirmed as the snail host for F. magna under natural conditions and, together with the finding of F. magna infection in cattle, we can expect further transmission of F. magna from wildlife to livestock in localities shared by these hosts. PMID:24517409

  9. Bayesian screening for active compounds in high-dimensional chemical spaces combining property descriptors and molecular fingerprints.

    PubMed

    Vogt, Martin; Bajorath, Jürgen

    2008-01-01

    Bayesian classifiers are increasingly being used to distinguish active from inactive compounds and search large databases for novel active molecules. We introduce an approach to directly combine the contributions of property descriptors and molecular fingerprints in the search for active compounds that is based on a Bayesian framework. Conventionally, property descriptors and fingerprints are used as alternative features for virtual screening methods. Following the approach introduced here, probability distributions of descriptor values and fingerprint bit settings are calculated for active and database molecules and the divergence between the resulting combined distributions is determined as a measure of biological activity. In test calculations on a large number of compound activity classes, this methodology was found to consistently perform better than similarity searching using fingerprints and multiple reference compounds or Bayesian screening calculations using probability distributions calculated only from property descriptors. These findings demonstrate that there is considerable synergy between different types of property descriptors and fingerprints in recognizing diverse structure-activity relationships, at least in the context of Bayesian modeling.

  10. Subtracted Diversity Array Identifies Novel Molecular Markers Including Retrotransposons for Fingerprinting Echinacea Species

    PubMed Central

    Olarte, Alexandra; Mantri, Nitin; Nugent, Gregory; Pang, Edwin C. K.

    2013-01-01

    Echinacea, native to the Canadian prairies and the prairie states of the United States, has a long tradition as a folk medicine for the Native Americans. Currently, Echinacea are among the top 10 selling herbal medicines in the U.S. and Europe, due to increasing popularity for the treatment of common cold and ability to stimulate the immune system. However, the genetic relationship within the species of this genus is unclear, making the authentication of the species used for the medicinal industry more difficult. We report the construction of a novel Subtracted Diversity Array (SDA) for Echinacea species and demonstrate the potential of this array for isolating highly polymorphic sequences. In order to selectively isolate Echinacea-specific sequences, a Suppression Subtractive Hybridization (SSH) was performed between a pool of twenty-four Echinacea genotypes and a pool of other angiosperms and non-angiosperms. A total of 283 subtracted genomic DNA (gDNA) fragments were amplified and arrayed. Twenty-seven Echinacea genotypes including four that were not used in the array construction could be successfully discriminated. Interestingly, unknown samples of E. paradoxa and E. purpurea could be unambiguously identified from the cluster analysis. Furthermore, this Echinacea-specific SDA was also able to isolate highly polymorphic retrotransposon sequences. Five out of the eleven most discriminatory features matched to known retrotransposons. This is the first time retrotransposon sequences have been used to fingerprint Echinacea, highlighting the potential of retrotransposons as based molecular markers useful for fingerprinting and studying diversity patterns in Echinacea. PMID:23940565

  11. Exploring the vibrational fingerprint of the electronic excitation energy via molecular dynamics

    SciTech Connect

    Deyne, Andy Van Yperen-De; Pauwels, Ewald; Ghysels, An; Waroquier, Michel; Van Speybroeck, Veronique; Hemelsoet, Karen; De Meyer, Thierry; De Clerck, Karen

    2014-04-07

    A Fourier-based method is presented to relate changes of the molecular structure during a molecular dynamics simulation with fluctuations in the electronic excitation energy. The method implies sampling of the ground state potential energy surface. Subsequently, the power spectrum of the velocities is compared with the power spectrum of the excitation energy computed using time-dependent density functional theory. Peaks in both spectra are compared, and motions exhibiting a linear or quadratic behavior can be distinguished. The quadratically active motions are mainly responsible for the changes in the excitation energy and hence cause shifts between the dynamic and static values of the spectral property. Moreover, information about the potential energy surface of various excited states can be obtained. The procedure is illustrated with three case studies. The first electronic excitation is explored in detail and dominant vibrational motions responsible for changes in the excitation energy are identified for ethylene, biphenyl, and hexamethylbenzene. The proposed method is also extended to other low-energy excitations. Finally, the vibrational fingerprint of the excitation energy of a more complex molecule, in particular the azo dye ethyl orange in a water environment, is analyzed.

  12. Exploring the vibrational fingerprint of the electronic excitation energy via molecular dynamics.

    PubMed

    Van Yperen-De Deyne, Andy; De Meyer, Thierry; Pauwels, Ewald; Ghysels, An; De Clerck, Karen; Waroquier, Michel; Van Speybroeck, Veronique; Hemelsoet, Karen

    2014-04-07

    A Fourier-based method is presented to relate changes of the molecular structure during a molecular dynamics simulation with fluctuations in the electronic excitation energy. The method implies sampling of the ground state potential energy surface. Subsequently, the power spectrum of the velocities is compared with the power spectrum of the excitation energy computed using time-dependent density functional theory. Peaks in both spectra are compared, and motions exhibiting a linear or quadratic behavior can be distinguished. The quadratically active motions are mainly responsible for the changes in the excitation energy and hence cause shifts between the dynamic and static values of the spectral property. Moreover, information about the potential energy surface of various excited states can be obtained. The procedure is illustrated with three case studies. The first electronic excitation is explored in detail and dominant vibrational motions responsible for changes in the excitation energy are identified for ethylene, biphenyl, and hexamethylbenzene. The proposed method is also extended to other low-energy excitations. Finally, the vibrational fingerprint of the excitation energy of a more complex molecule, in particular the azo dye ethyl orange in a water environment, is analyzed.

  13. Fingerprinting of poultry isolates of Enterococcus cecorum using three molecular typing methods.

    PubMed

    Wijetunge, Dona Saumya; Dunn, Patricia; Wallner-Pendleton, Eva; Lintner, Valerie; Lu, Huaguang; Kariyawasam, Subhashinie

    2012-11-01

    Enterococcus cecorum is an emerging challenge to the broiler industry. The organism has been implicated in septicemia, spondylitis, arthritis, and osteomyelitis in commercial broilers and broiler breeders, which lead to economic losses attributed to increased mortality and culling rates, decreased average processing weights, and increased feed conversion ratios. The current study evaluated the genetic variability of 30 clinical isolates of E. cecorum from outbreaks in Pennsylvania, using 3 molecular typing methods, namely, pulsed-field gel electrophoresis (PFGE), randomly amplified polymorphic DNA analysis, and enterobacterial repetitive intergenic consensus-PCR (polymerase chain reaction), in order to understand their genetic relatedness and to identify possible pathogenic clones. The study revealed the existence of genotypic polymorphism among E. cecorum associated with clinical disease. Of the 3 typing methods used, PFGE analysis demonstrated higher genetic variability of E. cecorum isolates compared to PCR-based methods. Also, each molecular typing method was evaluated in terms of typeability, discriminatory power, and reproducibility for application of these typing methods in fingerprinting of E. cecorum in future reference. Pulsed-field gel electrophoresis provided the most reliable results with greater discriminatory power and higher reproducibility compared to the 2 PCR-based methods.

  14. Multiple network alignment via multiMAGNA+.

    PubMed

    Vijayan, Vipin; Milenkovic, Tijana

    2017-08-21

    Network alignment (NA) aims to find a node mapping that identifies topologically or functionally similar network regions between molecular networks of different species. Analogous to genomic sequence alignment, NA can be used to transfer biological knowledge from well- to poorly-studied species between aligned network regions. Pairwise NA (PNA) finds similar regions between two networks while multiple NA (MNA) can align more than two networks. We focus on MNA. Existing MNA methods aim to maximize total similarity over all aligned nodes (node conservation). Then, they evaluate alignment quality by measuring the amount of conserved edges, but only after the alignment is constructed. Directly optimizing edge conservation during alignment construction in addition to node conservation may result in superior alignments. Thus, we present a novel MNA method called multiMAGNA++ that can achieve this. Indeed, multiMAGNA++ outperforms or is on par with existing MNA methods, while often completing faster than existing methods. That is, multiMAGNA++ scales well to larger network data and can be parallelized effectively. During method evaluation, we also introduce new MNA quality measures to allow for more fair MNA method comparison compared to the existing alignment quality measures. MultiMAGNA++ code is available on the method's web page at http://nd.edu/~cone/multiMAGNA++/.

  15. Molecular fingerprinting reflects different histotypes and brain region in low grade gliomas

    PubMed Central

    2013-01-01

    Background Paediatric low-grade gliomas (LGGs) encompass a heterogeneous set of tumours of different histologies, site of lesion, age and gender distribution, growth potential, morphological features, tendency to progression and clinical course. Among LGGs, Pilocytic astrocytomas (PAs) are the most common central nervous system (CNS) tumours in children. They are typically well-circumscribed, classified as grade I by the World Health Organization (WHO), but recurrence or progressive disease occurs in about 10-20% of cases. Despite radiological and neuropathological features deemed as classic are acknowledged, PA may present a bewildering variety of microscopic features. Indeed, tumours containing both neoplastic ganglion and astrocytic cells occur at a lower frequency. Methods Gene expression profiling on 40 primary LGGs including PAs and mixed glial-neuronal tumours comprising gangliogliomas (GG) and desmoplastic infantile gangliogliomas (DIG) using Affymetrix array platform was performed. A biologically validated machine learning workflow for the identification of microarray-based gene signatures was devised. The method is based on a sparsity inducing regularization algorithm l1l2 that selects relevant variables and takes into account their correlation. The most significant genetic signatures emerging from gene-chip analysis were confirmed and validated by qPCR. Results We identified an expression signature composed by a biologically validated list of 15 genes, able to distinguish infratentorial from supratentorial LGGs. In addition, a specific molecular fingerprinting distinguishes the supratentorial PAs from those originating in the posterior fossa. Lastly, within supratentorial tumours, we also identified a gene expression pattern composed by neurogenesis, cell motility and cell growth genes which dichotomize mixed glial-neuronal tumours versus PAs. Our results reinforce previous observations about aberrant activation of the mitogen-activated protein kinase

  16. Molecular typing of Cryptococcus neoformans by PCR fingerprinting, in comparison with serotyping and Fourier transform infrared-spectroscopy-based phenotyping.

    PubMed

    Lemmer, K; Naumann, D; Raddatz, B; Tintelnot, K

    2004-04-01

    Molecular typing by PCR fingerprinting using the single primer (GACA)4 was performed with 110 isolates of Cryptococcus neoformans. Seventy clinical isolates of C. neoformans var. neoformans from Germany (n = 52) and Africa (n = 18) were included. Of these, serotype A (C. neoformans var. grubii) accounted for 47 isolates, serotype D for 12 and serotype AD for 11. Fourier transform infrared (FT-IR) spectroscopy was evaluated for its discriminatory power in phenotyping. Molecular types, defined by different PCR fingerprinting patterns, were compared to serotypes, and both sets of results were compared with the results of analysis by FT-IR spectroscopy. PCR fingerprinting revealed genotypic diversity within each serotype; it showed three different genotypes (designated VNA1-VNA3) within serotype A, two within serotype D (VND1 and VND2), and three within serotype AD (VNAD1-VNAD3). The nomenclature of molecular types within C. n. var. neoformans, as seen in publications to date, is not uniform. In this study, the name assigned to each genotype was based on the 98.6% concordance of genotypes with serotypes, a correspondence that facilitates interlaboratory comparison. This nomenclature is tentatively recommended as a standard. FT-IR spectroscopy combined with hierarchical cluster analysis successfully distinguished C n. var. neoformans from C. n. var. gattii. For C. n. var. neoformans, FT-IR confirmed three distinct genotypes within serotype A and was able to distinguish isolates derived from particular patients as well as isolates differing at the sub-genotype level. Within C. n. var. gattii, the serotypes B and C did not correlate with the four genotypes VGI-VGIV. However, these serotypes could clearly be separated by FT-IR spectroscopy. The molecular profiles were reproducible, and were more stable and more discriminating than serotyping. In connection with a standardized nomenclature, PCR fingerprinting can be a beneficial tool for global epidemiological studies. FT

  17. Fourier series of atomic radial distribution functions: A molecular fingerprint for machine learning models of quantum chemical properties

    SciTech Connect

    von Lilienfeld, O. Anatole; Ramakrishnan, Raghunathan; Rupp, Matthias; Knoll, Aaron

    2015-08-15

    We introduce a fingerprint representation of molecules based on a Fourier series of atomic radial distribution functions. This fingerprint is unique (except for chirality), continuous, and differentiable with respect to atomic coordinates and nuclear charges. It is invariant with respect to translation, rotation, and nuclear permutation, and requires no preconceived knowledge about chemical bonding, topology, or electronic orbitals. As such, it meets many important criteria for a good molecular representation, suggesting its usefulness for machine learning models of molecular properties trained across chemical compound space. To assess the performance of this new descriptor, we have trained machine learning models of molecular enthalpies of atomization for training sets with up to 10 k organic molecules, drawn at random from a published set of 134 k organic molecules with an average atomization enthalpy of over 1770 kcal/mol. We validate the descriptor on all remaining molecules of the 134 k set. For a training set of 10 k molecules, the fingerprint descriptor achieves a mean absolute error of 8.0 kcal/mol. This is slightly worse than the performance attained using the Coulomb matrix, another popular alternative, reaching 6.2 kcal/mol for the same training and test sets. (c) 2015 Wiley Periodicals, Inc.

  18. Molecular fingerprinting with the resolved modes of a femtosecond laser frequency comb.

    PubMed

    Diddams, Scott A; Hollberg, Leo; Mbele, Vela

    2007-02-08

    The control of the broadband frequency comb emitted from a mode-locked femtosecond laser has permitted a wide range of scientific and technological advances--ranging from the counting of optical cycles for next-generation atomic clocks to measurements of phase-sensitive high-field processes. A unique advantage of the stabilized frequency comb is that it provides, in a single laser beam, about a million optical modes with very narrow linewidths and absolute frequency positions known to better than one part in 10(15) (ref. 5). One important application of this vast array of highly coherent optical fields is precision spectroscopy, in which a large number of modes can be used to map internal atomic energy structure and dynamics. However, an efficient means of simultaneously identifying, addressing and measuring the amplitude or relative phase of individual modes has not existed. Here we use a high-resolution disperser to separate the individual modes of a stabilized frequency comb into a two-dimensional array in the image plane of the spectrometer. We illustrate the power of this technique for high-resolution spectral fingerprinting of molecular iodine vapour, acquiring in a few milliseconds absorption images covering over 6 THz of bandwidth with high frequency resolution. Our technique for direct and parallel accessing of stabilized frequency comb modes could find application in high-bandwidth spread-spectrum communications with increased security, high-resolution coherent quantum control, and arbitrary optical waveform synthesis with control at the optical radian level.

  19. Investigating molecular structures: Rapidly examining molecular fingerprints through fast passage broadband fourier transform microwave spectroscopy

    NASA Astrophysics Data System (ADS)

    Grubbs, Garry Smith Smitty, II

    Microwave spectroscopy is a gas phase technique typically geared toward measuring the rotational transitions of molecules. The information contained in this type of spectroscopy pertains to a molecules structure, both geometric and electronic, which give insight into a molecule's chemistry. Typically this type of spectroscopy is high resolution, but narrowband ≤1 MHz in frequency. This is achieved by tuning a cavity, exciting a molecule with electromagnetic radiation in the microwave region, turning the electromagnetic radiation off, and measuring a signal from the molecular relaxation in the form of a free induction decay (FID). The FID is then Fourier transformed to give a frequency of the transition. "Fast passage" is defined as a sweeping of frequencies through a transition at a time much shorter (≤10 mus) than the molecular relaxation (≈100 mus). Recent advancements in technology have allowed for the creation of these fast frequency sweeps, known as "chirps", which allow for broadband capabilities. This work presents the design, construction, and implementation of one such novel, high-resolution microwave spectrometer with broadband capabilities. The manuscript also provides the theory, technique, and motivations behind building of such an instrument. In this manuscript it is demonstrated that, although a gas phase technique, solids, liquids, and transient species may be studied with the spectrometer with high sensitivity, making it a viable option for many molecules wanting to be rotationally studied. The spectrometer has a relative correct intensity feature that, when coupled with theory, may ease the difficulty in transition assignment and facilitate dynamic chemical studies of the experiment. Molecules studied on this spectrometer have, in turn, been analyzed and assigned using common rotational spectroscopic analysis. Detailed theory on the analysis of these molecules has been provided. Structural parameters such as rotational constants and

  20. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  1. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  2. Molecular Fingerprint Comparison of Closely Related Rose Varieties based on UHPLC-HRMS Analysis and Chemometrics.

    PubMed

    Riffault-Valois, Ludivine; Blanchot, Lucille; Colas, Cyril; Destandau, Emilie; Pasquier, Laure; André, Patrice; Elfakir, Claire

    2017-01-01

    The "Jardin de Granville" modern rose variety not only combines the morphological properties of its two parental cultivars, but also possesses better agronomic characteristics (abundant blooms, strong growth and vitality, high resistance to common rose diseases). In addition, it shows remarkable biological properties such as a high ability to decrease inflammatory and oxidative stress on skin cells. That is why Parfums Christian Dior selected this rose variety to be an active ingredient in luxury cosmetics. To identify the characteristic molecular signature of "Jardin de Granville" compared with its parents "Annapurna" and "John Clare", by the mean of a non-targeted metabolomic comparison. Wood, flower and leaf hydro-alcoholic extracts were analysed by UHPLC-ESI-HRMS. The fingerprints were then submitted to unsupervised multivariate analyses involving principal component analysis (PCA) and hierarchical ascendant classification (HAC). Analysis of variance (ANOVA) was finally performed to highlight the significant differences in each group of organs. The extracts were composed of phenolic compounds such as hydrolysable and condensed tannins and flavonol derivatives. Three groups of extracts were clustered as a function of the variety. The compounds overexpressed in "Jardin de Granville" variety were highlighted thanks to ANOVA test. Flower was the most discriminative organ with 15 overexpressed molecules. Auto MS/MS analyses led to their tentative identifications. The non-targeted metabolomic approach revealed the importance of tannins to discriminate close rose varieties. The overexpressed hydrolysable tannins characteristic of "Jardin de Granville" can be responsible for the antioxidant and anti-inflammatory properties of the rose cosmetic ingredients. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  3. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    PubMed

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL, matK, trnH-psbA, trnLC-trnLD, their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus, Conophallus and Amorphophallus. In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK, trnH-psbA, trnLC-trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL.

  4. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering.

    PubMed

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3'-diethylthiatricarbocyanine iodide] and DTDC [3,3'-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist.

  5. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering

    PubMed Central

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3′-diethylthiatricarbocyanine iodide] and DTDC [3,3′-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist. PMID:26730189

  6. Fingerprint-imprinted polymer: rational selection of peptide epitope templates for the determination of proteins by molecularly imprinted polymers.

    PubMed

    Bossi, Alessandra M; Sharma, Piyush S; Montana, Luca; Zoccatelli, Gianni; Laub, Orgad; Levi, Raphael

    2012-05-01

    The pool of peptides composing a protein allows for its distinctive identification in a process named fingerprint (FP) analysis. Here, the FP concept is used to develop a method for the rational preparation of molecularly imprinted polymers (MIPs) for protein recognition. The fingerprint imprinting (FIP) is based on the following: (1) the in silico cleavage of the protein sequence of interest with specific agents; (2) the screening of all the peptide sequences generated against the UniProtKB database in order to allow for the rational selection of distinctive and unique peptides (named as epitopes) of the target protein; (3) the selected epitopes are synthesized and used as templates for the molecular imprinting process. To prove the principle, NT-proBNP, a marker of the risk of cardiovascular events, was chosen as an example. The in silico analysis of the NT-proBNP sequence allowed us to individuate the peptide candidates, which were next used as templates for the preparation of NT-pro-BNP-specific FIPs and tested for their ability to bind the NT-proBNP peptides in complex samples. Results indicated an imprinting factor, IF, of ~10, a binding capacity of 0.5-2 mg/g, and the ability to rebind 40% of the template in a complex sample, composed of the whole digests of NT-proBNP.

  7. Binding mode of triazole derivatives as aromatase inhibitors based on docking, protein ligand interaction fingerprinting, and molecular dynamics simulation studies

    PubMed Central

    Mojaddami, Ayyub; Sakhteman, Amirhossein; Fereidoonnezhad, Masood; Faghih, Zeinab; Najdian, Atena; Khabnadideh, Soghra; Sadeghpour, Hossein; Rezaei, Zahra

    2017-01-01

    Aromatase inhibitors (AIs) as effective candidates have been used in the treatment of hormone-dependent breast cancer. In this study, we have proposed 300 structures as potential AIs and filtered them by Lipinski's rule of five using DrugLito software. Subsequently, they were subjected to docking simulation studies to select the top 20 compounds based on their Gibbs free energy changes and also to perform more studies on the protein-ligand interaction fingerprint by AuposSOM software. In this stage, anastrozole and letrozole were used as positive control to compare their interaction fingerprint patterns with our proposed structures. Finally, based on the binding energy values, one active structure (ligand 15) was selected for molecular dynamic simulation in order to get information for the binding mode of these ligands within the enzyme cavity. The triazole of ligand 15 pointed to HEM group in aromatase active site and coordinated to Fe of HEM through its N4 atom. In addition, two π-cation interactions was also observed, one interaction between triazole and porphyrin of HEM group, and the other was 4-chloro phenyl moiety of this ligand with Arg115 residue. PMID:28255310

  8. Spatio-temporal variability of the molecular fingerprint of soil dissolved organic matter in a headwater agricultural catchment

    NASA Astrophysics Data System (ADS)

    Jeanneau, Laurent; Pierson-Wickmann, Anne-Catherine; Jaffrezic, Anne; Lambert, Thibault; Gruau, Gérard

    2013-04-01

    Dissolved organic matter (DOM) is implied in (i) ecosystem services such as the support of biodiversity, (ii) the alteration of the drinkable water quality by formation of trihalomethane and (iii) the transfer of micropollutants from soils to rivers. Moreover, since DOM connects soils and oceans that are interacting with the atmosphere, understanding its biogeochemistry will help in investigating the carbon cycle and in creating strategies to mitigate climate change. DOM in headwater stream ecosystems is mainly inherited from allochtonous inputs with different reservoirs being mobilized during storm and interstorm events at the scale of an hydrological year. Those changes in DOM reservoirs, if accompanied by composition and reactivity changes, may impact DOM ecosystem services and drinking water production processes. Elucidating the compositional changes due to changes in the source of DOM in rivers has thus become a important axis of DOM research. The aim of this study is to test the ability of the molecular tools of the organic geochemistry and more specifically the combination of thermochemiolysis and gas chromatography - mass spectrometry (THM-GC-MS) to (i) link the variability of the river DOM composition to different DOM reservoirs in catchment soils and (ii) provide hypothesis on the nature and the mechanisms of formation (microbial growth, litter decomposition) of those reservoirs. This analytical method seems particularly adapted since it allows the differentiation between vegetal and microbial inputs and the determination of the extent of the biodegradation process of biomolecules such as lignin. To test this method, the molecular fingerprint of soil DOM has been investigated in the wetland area of a small (500 ha) agricultural catchment (the so-called Kervidy-Naizin catchment) located in Brittany, western France. The soil DOM was sampled fortnightly at three depths using zero-tension lysimeters during the hydrological year 2010-2011. The samples were

  9. Morphological and molecular observations on the status of Crassicauda magna, a parasite of the subcutaneous tissues of the pygmy sperm whale, with a re-evaluation of the systematic relationships of the genus Crassicauda.

    PubMed

    Jabbar, Abdul; Beveridge, Ian; Bryant, Malcolm S

    2015-03-01

    Members of the genus Crassicauda (Nematoda: Spirurida) are parasites of the body tissues of whales and dolphins. Owing to the large size of worms and difficulties in the recovery of entire nematodes from the tissues of hosts, limited information is available on morphological descriptions of both male and female worms. Furthermore, there are currently no available sequence data for this genus to assist with such identifications. This paper describes for the first time features of the anterior extremity and the male tail of Crassicauda magna, suggesting that Crassicauda duguyi may be a synonym of this species. In addition, molecular data are presented for the genus for the first time suggesting that the genus belongs within the superfamily Acuarioidea rather than within the Habronematoidea, in which it is currently placed.

  10. New target prediction and visualization tools incorporating open source molecular fingerprints for TB Mobile 2.0.

    PubMed

    Clark, Alex M; Sarker, Malabika; Ekins, Sean

    2014-01-01

    We recently developed a freely available mobile app (TB Mobile) for both iOS and Android platforms that displays Mycobacterium tuberculosis (Mtb) active molecule structures and their targets with links to associated data. The app was developed to make target information available to as large an audience as possible. We now report a major update of the iOS version of the app. This includes enhancements that use an implementation of ECFP_6 fingerprints that we have made open source. Using these fingerprints, the user can propose compounds with possible anti-TB activity, and view the compounds within a cluster landscape. Proposed compounds can also be compared to existing target data, using a näive Bayesian scoring system to rank probable targets. We have curated an additional 60 new compounds and their targets for Mtb and added these to the original set of 745 compounds. We have also curated 20 further compounds (many without targets in TB Mobile) to evaluate this version of the app with 805 compounds and associated targets. TB Mobile can now manage a small collection of compounds that can be imported from external sources, or exported by various means such as email or app-to-app inter-process communication. This means that TB Mobile can be used as a node within a growing ecosystem of mobile apps for cheminformatics. It can also cluster compounds and use internal algorithms to help identify potential targets based on molecular similarity. TB Mobile represents a valuable dataset, data-visualization aid and target prediction tool.

  11. New target prediction and visualization tools incorporating open source molecular fingerprints for TB Mobile 2.0

    PubMed Central

    2014-01-01

    Background We recently developed a freely available mobile app (TB Mobile) for both iOS and Android platforms that displays Mycobacterium tuberculosis (Mtb) active molecule structures and their targets with links to associated data. The app was developed to make target information available to as large an audience as possible. Results We now report a major update of the iOS version of the app. This includes enhancements that use an implementation of ECFP_6 fingerprints that we have made open source. Using these fingerprints, the user can propose compounds with possible anti-TB activity, and view the compounds within a cluster landscape. Proposed compounds can also be compared to existing target data, using a näive Bayesian scoring system to rank probable targets. We have curated an additional 60 new compounds and their targets for Mtb and added these to the original set of 745 compounds. We have also curated 20 further compounds (many without targets in TB Mobile) to evaluate this version of the app with 805 compounds and associated targets. Conclusions TB Mobile can now manage a small collection of compounds that can be imported from external sources, or exported by various means such as email or app-to-app inter-process communication. This means that TB Mobile can be used as a node within a growing ecosystem of mobile apps for cheminformatics. It can also cluster compounds and use internal algorithms to help identify potential targets based on molecular similarity. TB Mobile represents a valuable dataset, data-visualization aid and target prediction tool. PMID:25302078

  12. Molecular Fingerprinting of Cyanobacteria from River Biofilms as a Water Quality Monitoring Tool

    PubMed Central

    Loza, Virginia; Perona, Elvira

    2013-01-01

    Benthic cyanobacterial communities from Guadarrama River (Spain) biofilms were examined using temperature gradient gel electrophoresis (TGGE), comparing the results with microscopic analyses of field-fixed samples and the genetic characterization of cultured isolates from the river. Changes in the structure and composition of cyanobacterial communities and their possible association with eutrophication in the river downstream were studied by examining complex TGGE patterns, band extraction, and subsequent sequencing of 16S rRNA gene fragments. Band profiles differed among sampling sites depending on differences in water quality. The results showed that TGGE band richness decreased in a downstream direction, and there was a clear clustering of phylotypes on the basis of their origins from different locations according to their ecological requirements. Multivariate analyses (cluster analysis and canonical correspondence analysis) corroborated these differences. Results were consistent with those obtained from microscopic observations of field-fixed samples. According to the phylogenetic analysis, morphotypes observed in natural samples were the most common phylotypes in the TGGE sequences. These phylotypes were closely related to Chamaesiphon, Aphanocapsa, Pleurocapsa, Cyanobium, Pseudanabaena, Phormidium, and Leptolyngbya. Differences in the populations in response to environmental variables, principally nutrient concentrations (dissolved inorganic nitrogen and soluble reactive phosphorus), were found. Some phylotypes were associated with low nutrient concentrations and high levels of dissolved oxygen, while other phylotypes were associated with eutrophic-hypertrophic conditions. These results support the view that once a community has been characterized and its genetic fingerprint obtained, this technique could be used for the purpose of monitoring rivers. PMID:23263954

  13. Molecular variation of Trypanosoma brucei subspecies as revealed by AFLP fingerprinting.

    PubMed

    Agbo, E E C; Majiwa, P A O; Claassen, H J H M; te Pas, M F W

    2002-04-01

    Genetic analysis of Trypanosoma spp. depends on the detection of variation between strains. We have used the amplified fragment length polymorphism (AFLP) technique to develop a convenient and reliable method for genetic characterization of Trypanosome (sub)species. AFLP accesses multiple independent sites within the genome and would allow a better definition of the relatedness of different Trypanosome (sub)species. Nine isolates (3 from each T. brucei subspecies) were tested with 40 AFLP primer combinations to identify the most appropriate pairs of restriction endonucleases and selective primers. Primers based on the recognition sequences of EcoRI and BglII were chosen and used to analyse 31 T. brucei isolates. Similarity levels calculated with the Pearson correlation coefficient ranged from 15 to 98%, and clusters were determined using the unweighted pair-group method using arithmetic averages (UPGMA). At the intraspecific level, AFLP fingerprints were grouped by numerical analysis in 2 main clusters, allowing a clear separation of T. b. gambiense (cluster I) from T. b. brucei and T. b. rhodesiense isolates (cluster II). Interspecies evaluation of this customized approach produced heterogeneous AFLP patterns, with unique genetic markers, except for T. evansi and T. equiperdum, which showed identical patterns and clustered together.

  14. Fingerprint Recognition

    DTIC Science & Technology

    2006-06-01

    their central lines. The rule- based algorithm developed for character recognition by Ahmed and Ward (2002) can be applied to a fingerprint image...REFERENCES Ahmed, M., & Ward, R. (2002). A rotation invariant rule- based thinning algorithm for character recognition . IEEE Transactions on Pattern...various steps present in a fingerprint recognition system. The study develops a working algorithm to extract fingerprint minutiae from an input

  15. A systematic prediction of drug-target interactions using molecular fingerprints and protein sequences.

    PubMed

    Huang, Yu-An; You, Zhu-Hong; Chen, Xing

    2016-11-21

    Drug-Target Interactions (DTI) play a crucial role in discovering new drug candidates and finding new proteins to target for drug development. Although the number of detected DTI obtained by high-throughput techniques has been increasing, the number of known DTI is still limited. On the other hand, the experimental methods for detecting the interactions among drugs and proteins are costly and inefficient. Therefore, computational approaches for predicting DTI are drawing increasing attention in recent years. In this paper, we report a novel computational model for predicting the DTI using extremely randomized trees model and protein amino acids information. More specifically, the protein sequence is represented as a Pseudo Substitution Matrix Representation (Pseudo-SMR) descriptor in which the influence of biological evolutionary information is retained. For the representation of drug molecules, a novel fingerprint feature vector is utilized to describe its substructure information. Then the DTI pair is characterized by concatenating the two vector spaces of protein sequence and drug substructure. Finally, the proposed method is explored for predicting the DTI on four benchmark datasets: Enzyme, Ion Channel, GPCRs and Nuclear Receptor. The experimental results demonstrate that this method achieves promising prediction accuracies of 89.85%, 87.87%, 82.99% and 81.67%, respectively. For further evaluation, we compared the performance of Extremely Randomized Trees model with that of the state-of-the-art Support Vector Machine classifier. And we also compared the proposed model with existing computational models, and confirmed 15 potential drug-target interactions by looking for existing databases. The experiment results show that the proposed method is feasible and promising for predicting drug-target interactions for new drug candidate screening based on sizeable features.

  16. Molecular Typing of Borrelia burgdorferi Sensu Lato by Randomly Amplified Polymorphic DNA Fingerprinting Analysis

    PubMed Central

    Wang, Guiqing; van Dam, Alje P.; Spanjaard, Lodewijk; Dankert, Jacob

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA (RAPD) fingerprinting with four arbitrary primers. The RAPD patterns were reproducible up to the 95% similarity level as shown in duplicate experiments. In these experiments the purified DNAs prepared on different days, from different colonies, and after various passages were used as templates. With an intergroup difference of 55%, the 136 strains could be divided into seven genetic clusters. Six clusters comprised and corresponded to the established species B. burgdorferi sensu stricto (n = 23), Borrelia garinii (n = 39), Borrelia afzelii (n = 59), Borrelia japonica (n = 1), Borrelia valaisiana (n = 12), and genomic group DN127 (n = 1). One strain from a patient with erythema migrans (EM) did not belong to any of the species or genomic groups known up to now. The RAPD types of B. burgdorferi sensu stricto, B. garinii, and B. afzelii isolates, which may give rise to human Lyme borreliosis (LB), were associated with their geographic origins. A high degree of genetic diversity was observed among the 39 B. garinii strains, and six subgroups could be recognized. One of these comprised eight isolates from patients with disseminated LB only and no tick isolates. B. afzelii strains from patients with EM or acrodermatitis chronica atrophicans were not clustered in particular branches. Our study showed that RAPD analysis is a powerful tool for discriminating different Borrelia species as well as Borrelia isolates within species. PMID:9508310

  17. First certified reference materials for molecular fingerprinting of two approved probiotic Bacillus strains.

    PubMed

    De Baets, L; Van Iwaarden, P; Meeus, N; Schimmel, H; Philipp, W; Emons, H

    2009-01-31

    At present probiotic bacteria are widely used in human and animal nutrition because they beneficially influence the balance of the intestinal flora of the host. Positive effects related to probiotics are various and include enhancement of digestion, strengthening of the immune system and stimulation of vitamin production. Moreover, implementation of probiotics is intended to reduce the use of antibiotics and improve animal growth and feed conversion. To protect human and animal health and to improve consumer confidence, a strict legislation on the use of probiotics exists within the European Union (EU). Official controls by national authorities are performed to ensure verification of compliance with feed and food law. Apart from the risk of using unauthorized strains, mislabelling is a known problem, partly because of the use of phenotyping or genotyping methods with a lack of discriminative power. In addition to official controls, private controls by food and feed producing companies are important in the frame of protection of patented strains and industrial property rights. To support these applications, IRMM has developed certified reference materials (CRMs) consisting of genomic DNA inserts of B. subtilis DSM 5749 and B. licheniformis DSM 5750, two strains that received EU approval. In this study we investigated the use of these CRMs, IRMM-311 and IRMM-312, for the detection and unambiguous discrimination of Bacillus strains by pulsed-field gel electrophoresis (PFGE). Identical fingerprints were obtained for the CRMs and control strains isolated from the feed additive Bioplus 2B. On the other hand a distinction could be made from other not approved B. licheniformis and B. subtilis strains. The reference materials discussed in this study are the first CRMs based on a whole bacterial genome and suitable for PFGE. They offer perspectives for applications in other domains such as analysis of foodborne pathogens in outbreaks or routine analysis.

  18. Reversed-phase ion-pair ultra-high-performance-liquid chromatography-mass spectrometry for fingerprinting low-molecular-weight heparins.

    PubMed

    Langeslay, Derek J; Urso, Elena; Gardini, Cristina; Naggi, Annamaria; Torri, Giangiacomo; Larive, Cynthia K

    2013-05-31

    Heparin is a complex mixture of sulfated linear carbohydrate polymers. It is widely used as an antithrombotic drug, though it has been shown to have a myriad of additional biological activities. Heparin is often partially depolymerized in order to decrease the average molecular weight, as it has been shown that low molecular weight heparins (LMWH) possess more desirable pharmacokinetic and pharmacodynamic properties than unfractionated heparin (UFH). Due to the prevalence of LMWHs in the market and the emerging availability of generic LMWH products, it is important that analytical methods be developed to ensure the drug quality. This work explores the use of tributylamine (TrBA), dibutylamine (DBA), and pentylamine (PTA) as ion-pairing reagents in conjunction with acetonitrile and methanol modified mobile phases for reversed-phase ion-pairing ultraperformance liquid chromatography coupled to mass spectrometry (RPIP-UPLC-MS) for fingerprint analysis of LMWH preparations. RPIP-UPLC-MS fingerprints are presented and compared for tinzaparinand enoxaparin.

  19. Denaturing gradient electrophoresis (DGE) and single-strand conformation polymorphism (SSCP) molecular fingerprintings revisited by simulation and used as a tool to measure microbial diversity.

    PubMed

    Loisel, Patrice; Harmand, Jérôme; Zemb, Olivier; Latrille, Eric; Lobry, Claude; Delgenès, Jean-Philippe; Godon, Jean-Jacques

    2006-04-01

    The exact extent of microbial diversity remains unknowable. Nevertheless, fingerprinting patterns [denaturing gradient electrophoresis (DGE), single-strand conformation polymorphism (SSCP)] provide an image of a microbial ecosystem and contain diversity data. We generated numerical simulation fingerprinting patterns based on three types of distribution (uniform, geometric and lognormal) with a range of units from 10 to 500,000. First, simulated patterns containing a diversity of around 1000 units or more gave patterns similar to those obtained in experiments. Second, the number of bands or peaks saturated quickly to about 35 and were unrelated to the degree of diversity. Finally, assuming lognormal distribution, we used an estimator of diversity on in silico and experimental fingerprinting patterns. Results on in silico patterns corresponded to the simulation inputs. Diversity results in experimental patterns were in the same range as those obtained from the same DNA sample in molecular inventories. Thus, fingerprinting patterns contain extractable data about diversity although not on the basis of a number of bands or peaks, as is generally assumed to be the case.

  20. Whole genome sequencing of Mycobacterium bovis to obtain molecular fingerprints in human and cattle isolates from Baja California, Mexico.

    PubMed

    Sandoval-Azuara, Sarai Estrella; Muñiz-Salazar, Raquel; Perea-Jacobo, Ricardo; Robbe-Austerman, Suelee; Perera-Ortiz, Alejandro; López-Valencia, Gilberto; Bravo, Doris M; Sanchez-Flores, Alejandro; Miranda-Guzmán, Daniela; Flores-López, Carlos Alberto; Zenteno-Cuevas, Roberto; Laniado-Laborín, Rafael; de la Cruz, Fabiola Lafarga; Stuber, Tod P

    2017-10-01

    To determine genetic diversity by comparing the whole genome sequences of cattle and human Mycobacterium bovis isolates from Baja California. A whole genome sequencing strategy was used to obtain the molecular fingerprints of 172 isolates of M. bovis obtained from Baja California, Mexico; 155 isolates were from cattle and 17 isolates were from humans. Spoligotypes were characterized in silico and single nucleotide polymorphism (SNP) differences between the isolates were evaluated. A total of 12 M. bovis spoligotype patterns were identified in cattle and humans. Two predominant spoligotypes patterns were seen in both cattle and humans: SB0145 and SB1040. The SB0145 spoligotype represented 59% of cattle isolates (n=91) and 65% of human isolates (n=11), while the SB1040 spoligotype represented 30% of cattle isolates (n=47) and 30% of human isolates (n=5). When evaluating SNP differences, the human isolates were intimately intertwined with the cattle isolates. All isolates from humans had spoligotype patterns that matched those observed in the cattle isolates, and all human isolates shared common ancestors with cattle in Baja California based on SNP analysis. This suggests that most human tuberculosis caused by M. bovis in Baja California is derived from M. bovis circulating in Baja California cattle. These results reinforce the importance of bovine tuberculosis surveillance and control in this region. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

    PubMed

    Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

    2015-01-01

    In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.

  2. Molecular fingerprinting of principal neurons in the rodent hippocampus: A neuroinformatics approach.

    PubMed

    Hamilton, D J; White, C M; Rees, C L; Wheeler, D W; Ascoli, G A

    2017-09-10

    Neurons are often classified by their morphological and molecular properties. The online knowledge base Hippocampome.org primarily defines neuron types from the rodent hippocampal formation based on their main neurotransmitter (glutamate or GABA) and the spatial distributions of their axons and dendrites. For each neuron type, this open-access resource reports any and all published information regarding the presence or absence of known molecular markers, including calcium-binding proteins, neuropeptides, receptors, channels, transcription factors, and other molecules of biomedical relevance. The resulting chemical profile is relatively sparse: even for the best studied neuron types, the expression or lack thereof of fewer than 70 molecules has been firmly established to date. The mouse genome-wide in situ hybridization mapping of the Allen Brain Atlas provides a wealth of data that, when appropriately analyzed, can substantially augment the molecular marker knowledge in Hippocampome.org. Here we focus on the principal cell layers of dentate gyrus (DG), CA3, CA2, and CA1, which together contain approximately 90% of hippocampal neurons. These four anatomical parcels are densely packed with somata of mostly excitatory projection neurons. Thus, gene expression data for those layers can be justifiably linked to the respective principal neuron types: granule cells in DG and pyramidal cells in CA3, CA2, and CA1. In order to enable consistent interpretation across genes and regions, we screened the whole-genome dataset against known molecular markers of those neuron types. The resulting threshold values allow over 6000 very-high confidence (>99.5%) expressed/not-expressed assignments, expanding the biochemical information content of Hippocampome.org more than five-fold. Many of these newly identified molecular markers are potential pharmacological targets for major neurological and psychiatric conditions. Furthermore, our approach yields reasonable expression

  3. Fingerprinting Of Materials

    NASA Technical Reports Server (NTRS)

    Workman, Gary L.

    1994-01-01

    Collection of three reports surveys emerging technology of chemical fingerprinting, which can be defined, loosely, as systematic application of modern methods of analysis to determine elemental or molecular compositions of materials, measure relative amounts of constituents of materials, and/or measure other relevant properties of materials.

  4. Atom pair 2D-fingerprints perceive 3D-molecular shape and pharmacophores for very fast virtual screening of ZINC and GDB-17.

    PubMed

    Awale, Mahendra; Reymond, Jean-Louis

    2014-07-28

    Three-dimensional (3D) molecular shape and pharmacophores are important determinants of the biological activity of organic molecules; however, a precise computation of 3D-shape is generally too slow for virtual screening of very large databases. A reinvestigation of the concept of atom pairs initially reported by Carhart et al. and extended by Schneider et al. showed that a simple atom pair fingerprint (APfp) counting atom pairs at increasing topological distances in 2D-structures without atom property assignment correlates with various representations of molecular shape extracted from the 3D-structures. A related 55-dimensional atom pair fingerprint extended with atom properties (Xfp) provided an efficient pharmacophore fingerprint with good performance for ligand-based virtual screening such as the recovery of active compounds from decoys in DUD, and overlap with the ROCS 3D-pharmacophore scoring function. The APfp and Xfp data were organized for web-based extremely fast nearest-neighbor searching in ZINC (13.5 M compounds) and GDB-17 (50 M random subset) freely accessible at www.gdb.unibe.ch .

  5. Myogenesis in the sea urchin embryo: the molecular fingerprint of the myoblast precursors.

    PubMed

    Andrikou, Carmen; Iovene, Edmondo; Rizzo, Francesca; Oliveri, Paola; Arnone, Maria Ina

    2013-12-02

    In sea urchin larvae the circumesophageal fibers form a prominent muscle system of mesodermal origin. Although the morphology and later development of this muscle system has been well-described, little is known about the molecular signature of these cells or their precise origin in the early embryo. As an invertebrate deuterostome that is more closely related to the vertebrates than other commonly used model systems in myogenesis, the sea urchin fills an important phylogenetic gap and provides a unique perspective on the evolution of muscle cell development. Here, we present a comprehensive description of the development of the sea urchin larval circumesophageal muscle lineage beginning with its mesodermal origin using high-resolution localization of the expression of several myogenic transcriptional regulators and differentiation genes. A few myoblasts are bilaterally distributed at the oral vegetal side of the tip of the archenteron and first appear at the late gastrula stage. The expression of the differentiation genes Myosin Heavy Chain, Tropomyosin I and II, as well as the regulatory genes MyoD2, FoxF, FoxC, FoxL1, Myocardin, Twist, and Tbx6 uniquely identify these cells. Interestingly, evolutionarily conserved myogenic factors such as Mef2, MyoR and Six1/2 are not expressed in sea urchin myoblasts but are found in other mesodermal domains of the tip of the archenteron. The regulatory states of these domains were characterized in detail. Moreover, using a combinatorial analysis of gene expression we followed the development of the FoxF/FoxC positive cells from the onset of expression to the end of gastrulation. Our data allowed us to build a complete map of the Non-Skeletogenic Mesoderm at the very early gastrula stage, in which specific molecular signatures identify the precursors of different cell types. Among them, a small group of cells within the FoxY domain, which also express FoxC and SoxE, have been identified as plausible myoblast precursors. Together

  6. Myogenesis in the sea urchin embryo: the molecular fingerprint of the myoblast precursors

    PubMed Central

    2013-01-01

    Background In sea urchin larvae the circumesophageal fibers form a prominent muscle system of mesodermal origin. Although the morphology and later development of this muscle system has been well-described, little is known about the molecular signature of these cells or their precise origin in the early embryo. As an invertebrate deuterostome that is more closely related to the vertebrates than other commonly used model systems in myogenesis, the sea urchin fills an important phylogenetic gap and provides a unique perspective on the evolution of muscle cell development. Results Here, we present a comprehensive description of the development of the sea urchin larval circumesophageal muscle lineage beginning with its mesodermal origin using high-resolution localization of the expression of several myogenic transcriptional regulators and differentiation genes. A few myoblasts are bilaterally distributed at the oral vegetal side of the tip of the archenteron and first appear at the late gastrula stage. The expression of the differentiation genes Myosin Heavy Chain, Tropomyosin I and II, as well as the regulatory genes MyoD2, FoxF, FoxC, FoxL1, Myocardin, Twist, and Tbx6 uniquely identify these cells. Interestingly, evolutionarily conserved myogenic factors such as Mef2, MyoR and Six1/2 are not expressed in sea urchin myoblasts but are found in other mesodermal domains of the tip of the archenteron. The regulatory states of these domains were characterized in detail. Moreover, using a combinatorial analysis of gene expression we followed the development of the FoxF/FoxC positive cells from the onset of expression to the end of gastrulation. Our data allowed us to build a complete map of the Non-Skeletogenic Mesoderm at the very early gastrula stage, in which specific molecular signatures identify the precursors of different cell types. Among them, a small group of cells within the FoxY domain, which also express FoxC and SoxE, have been identified as plausible myoblast

  7. Molecular Heterogeneity in Primary Breast Carcinomas and Axillary Lymph Node Metastases Assessed by Genomic Fingerprinting Analysis

    PubMed Central

    Ellsworth, Rachel E; Toro, Allyson L; Blackburn, Heather L; Decewicz, Alisha; Deyarmin, Brenda; Mamula, Kimberly A; Costantino, Nicholas S; Hooke, Jeffrey A; Shriver, Craig D; Ellsworth, Darrell L

    2015-01-01

    Molecular heterogeneity within primary breast carcinomas and among axillary lymph node (LN) metastases may impact diagnosis and confound treatment. In this study, we used short tandem repeated sequences to assess genomic heterogeneity and to determine hereditary relationships among primary tumor areas and regional metastases from 30 breast cancer patients. We found that primary carcinomas were genetically heterogeneous and sampling multiple areas was necessary to adequately assess genomic variability. LN metastases appeared to originate at different time periods during disease progression from different sites of the primary tumor and the extent of genomic divergence among regional metastases was associated with a less favorable patient outcome (P = 0.009). In conclusion, metastasis is a complex process influenced by primary tumor heterogeneity and variability in the timing of dissemination. Genomic variation in primary breast tumors and regional metastases may negatively impact clinical diagnostics and contribute to therapeutic resistance. PMID:26279627

  8. Rotation commensurate echo of asymmetric molecules—Molecular fingerprints in the time domain

    SciTech Connect

    Chesnokov, E. N.; Kubarev, V. V.; Koshlyakov, P. V.

    2014-12-29

    Using the pulses of terahertz free electron laser and ultra-fast Schottky diode detectors, we observed the coherent transients within a free induction decay of gaseous nitrogen dioxide NO{sub 2}. The laser excited different sub-bands of rotation spectra of NO{sub 2} containing about 50–70 lines. The free induction signal continued more than 30 ns and consisted of many echo-like bursts duration about 0.2 ns. Unlike the similar effect observed previously for linear and symmetric top molecules, the sequence of echo bursts is not periodic. The values for delay of individual echo are stable, and the set of these delays can be considered as a “molecular fingerprint” in the time domain.

  9. Complete Mitochondrial Genome of Anoplocephala magna Solidifying the Species

    PubMed Central

    Guo, Aijiang

    2016-01-01

    The 2 species of the genus Anoplocephala (Anoplocephalidae), A. perfoliata and A. magna, are among the most important equine cestode parasites. However, there is little information about their differences at the molecular level. The present study revealed that the mitochondrial (mt) genome of A. magna was 13,759 bp in size and 700 bp shorter than that of A. perfoliata. The 2 species includes 2 rRNA, 22 tRNA, and 12 protein-coding genes each. The size of each of the 36 genes was the same as that of A. perfoliata, except for cox1, rrnL, trnC, trnS2(UCN), trnG, trnH, trnQ, and trnP. In the full mitochondrial genome, the sequence similarity was 87.1%. The divergence in the nucleotide and amino acid sequences of individual protein-coding genes ranged from 11.1% to 16% and 6.8% to 16.4%, respectively. The 2 noncoding regions of the mt genome of A. magna were 199 bp and 271 bp in length, while the equivalent regions in A. perfoliata were 875 bp and 276 bp, respectively. The results of this study support the proposal that A. magna and A. perfoliata are separate species, consistent with previous morphological analyses. PMID:27417096

  10. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    PubMed

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  11. The culturome of the human nose habitats reveals individual bacterial fingerprint patterns.

    PubMed

    Kaspar, Ursula; Kriegeskorte, André; Schubert, Tanja; Peters, Georg; Rudack, Claudia; Pieper, Dietmar H; Wos-Oxley, Melissa; Becker, Karsten

    2016-07-01

    The complex anatomy of the human nose might offer distinct microbial niches. Microbiota composition may affect nose inflammatory diseases and Staphylococcus aureus carriage. Considering different nasal cavity locations, microbial colonization was analysed across individuals exhibiting chronic nasal inflammatory diseases (n = 18) and those without local inflammation signs (n = 16). Samples were collected systematically during surgery and examined by an extensive culture-based approach and, for a subset, by 16S rRNA gene community profiling. Cultivation yielded 141 taxa with members of Staphylococcus, Corynebacterium and Propionibacterium as most common isolates comprising the nasal core culturome together with Finegoldia magna. Staphylococcus aureus was most frequently found in association with Staphylococcus epidermidis and Propionibacterium acnes, and the posterior vestibules were redefined as S. aureus' principle habitat. Culturome analysis revealed host-specific bacterial 'fingerprints' irrespective of host-driven factors or intranasal sites. Comparisons between cultivable and molecular fingerprints demonstrated that only a small fraction of phylotypes (6.2%) was correlated. While the total number of different phylotypes was higher in the molecular dataset, the total number of identifications down to the species level was higher in the culturomic approach. To determine host-specific microbiomes, the advantages of molecular approaches should be combined with the resolution and reliability of species identification by culturomic analyses.

  12. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD

    PubMed Central

    Sunil Kumar, K.N.; Maruthi, K.R.; Alfarhan, A.H.; Rajakrishnan, R.; Thomas, J.

    2015-01-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard’s coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  13. Combining molecular fingerprints with multidimensional scaling analyses to identify the source of spilled oil from highly similar suspected oils.

    PubMed

    Zhou, Peiyu; Chen, Changshu; Ye, Jianjun; Shen, Wenjie; Xiong, Xiaofei; Hu, Ping; Fang, Hongda; Huang, Chuguang; Sun, Yongge

    2015-04-15

    Oil fingerprints have been a powerful tool widely used for determining the source of spilled oil. In most cases, this tool works well. However, it is usually difficult to identify the source if the oil spill accident occurs during offshore petroleum exploration due to the highly similar physiochemical characteristics of suspected oils from the same drilling platform. In this report, a case study from the waters of the South China Sea is presented, and multidimensional scaling analysis (MDS) is introduced to demonstrate how oil fingerprints can be combined with mathematical methods to identify the source of spilled oil from highly similar suspected sources. The results suggest that the MDS calculation based on oil fingerprints and subsequently integrated with specific biomarkers in spilled oils is the most effective method with a great potential for determining the source in terms of highly similar suspected oils. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Molecular fingerprint-region spectroscopy from 5 to 12 μm using an orientation-patterned gallium phosphide optical parametric oscillator

    NASA Astrophysics Data System (ADS)

    Maidment, Luke; Schunemann, Peter G.; Reid, Derryck T.

    2016-09-01

    We report a femtosecond optical parametric oscillator (OPO) based on the new semiconductor gain material orientation patterned gallium phosphide (OP-GaP), which enables the production of high-repetition-rate femtosecond pulses spanning 5-12 \\mu m with average powers in the few to tens of milliwatts range. This is the first example of a broadband OPO operating across the molecular fingerprint region, and we demonstrate its potential by conducting broadband Fourier-transform spectroscopy using water vapor and a polystyrene reference standard.

  15. Molecular fingerprint-region spectroscopy from 5 to 12  μm using an orientation-patterned gallium phosphide optical parametric oscillator.

    PubMed

    Maidment, Luke; Schunemann, Peter G; Reid, Derryck T

    2016-09-15

    We report a femtosecond optical parametric oscillator (OPO) based on the new semiconductor gain material orientation-patterned gallium phosphide (OP-GaP), which enables the production of high-repetition-rate femtosecond pulses spanning 5-12 μm with average powers in the few to tens of milliwatts range. This is the first example of a broadband OPO operating across the molecular fingerprint region, and we demonstrate its potential by conducting broadband Fourier-transform spectroscopy using water vapor and a polystyrene reference standard.

  16. Fingerprint detection

    DOEpatents

    Saunders, George C.

    1992-01-01

    A method for detection and visualization of latent fingerprints is provided and includes contacting a substrate containing a latent print thereon with a colloidal metal composition for time sufficient to allow reaction of said colloidal metal composition with said latent print, and preserving or recording the observable print. Further, the method for detection and visualization of latent fingerprints can include contacting the metal composition-latent print reaction product with a secondary metal-containing solution for time sufficient to allow precipitation of said secondary metal thereby enhancing the visibility of the latent print, and preserving or recording the observable print.

  17. Rapid determination of Escherichia coli O157:H7 lineage types and molecular subtypes by using comparative genomic fingerprinting.

    PubMed

    Laing, Chad; Pegg, Crystal; Yawney, Davis; Ziebell, Kim; Steele, Marina; Johnson, Roger; Thomas, James E; Taboada, Eduardo N; Zhang, Yongxiang; Gannon, Victor P J

    2008-11-01

    In this study, variably absent or present (VAP) regions discovered through comparative genomics experiments were targeted for the development of a rapid, PCR-based method to subtype and fingerprint Escherichia coli O157:H7. Forty-four VAP loci were analyzed for discriminatory power among 79 E. coli O157:H7 strains of 13 phage types (PT). Twenty-three loci were found to maximize resolution among strains, generating 54 separate fingerprints, each of which contained strains of unique PT. Strains from the three previously identified major E. coli O157:H7 lineages, LSPA6-LI, LSPA6-LI/II, and LSPA6-LII, formed distinct branches on a dendrogram obtained by hierarchical clustering of comparative genomic fingerprinting (CGF) data. By contrast, pulsed-field gel electrophoresis (PFGE) typing generated 52 XbaI digestion profiles that were not unique to PT and did not cluster according to O157:H7 lineage. Our analysis identified a subpopulation comprised of 25 strains from a closed herd of cattle, all of which were of PT87 and formed a cluster distinct from all other E. coli O157:H7 strains examined. CGF found five related but unique fingerprints among the highly clonal herd strains, with two dominant subtypes characterized by a shift from the presence of locus fprn33 to its absence. CGF had equal resolution to PFGE typing but with greater specificity, generating fingerprints that were unique among phenotypically related E. coli O157:H7 lineages and PT. As a comparative genomics typing method that is amenable for use in high-throughput platforms, CGF may be a valuable tool in outbreak investigations and strain characterization.

  18. Peptide mass fingerprinting.

    PubMed

    Thiede, Bernd; Höhenwarter, Wolfgang; Krah, Alexander; Mattow, Jens; Schmid, Monika; Schmidt, Frank; Jungblut, Peter R

    2005-03-01

    Peptide mass fingerprinting by MALDI-MS and sequencing by tandem mass spectrometry have evolved into the major methods for identification of proteins following separation by two-dimensional gel electrophoresis, SDS-PAGE or liquid chromatography. One main technological goal of proteome analyses beside high sensitivity and automation was the comprehensive analysis of proteins. Therefore, the protein species level with the essential information on co- and post-translational modifications must be achieved. The power of peptide mass fingerprinting for protein identification was described here, as exemplified by the identification of protein species with high molecular masses (spectrin alpha and beta), low molecular masses (elongation factor EF-TU fragments), splice variants (alpha A crystallin), aggregates with disulfide bridges (alkylhydroperoxide reductase), and phosphorylated proteins (heat shock protein 27). Helpful tools for these analyses were the use of the minimal protein identifier concept and the software program MS-Screener to remove mass peaks assignable to contaminants and neighbor spots.

  19. Molecular characterization and fingerprinting of vanadyl porphyrin and non-porphyrin compounds in the asphaltenes of heavy crude petroleums using HPLC-GFAA analysis

    SciTech Connect

    Wines, B.K.; Vermeulen, T.; Fish, R.H.

    1983-08-01

    High performance liquid chromatography coupled with graphite furnace atomic absorption (HPLC-GFAA) analysis were used to study the precipitated asphaltene fraction of four heavy crude petroleums. Prudhoe Bay and Wilmington crude oils from Alaska and California, respectively, have low vanadium and asphaltene concentrations. Boscan and Cerro Negro are Venezuelan crudes with high levels of vanadium and asphaltenes. The emphasis of this study is the molecular characterization of classes of vanadyl compounds, with special emphasis placed on differentiating the locations of non-porphyrin and porphyrin compounds in the HPLC-GFAA analyses of the asphaltenes and their solvent extracts. Steric exclusion chromatography (SEC) columns were used to determine the molecular weight distribution of vanadium in the asphaltenes and extracts. Fingerprints obtained from SEC-HPLC-GFAA analysis of asphaltenes or normal and reverse phase HPLC-GFAA analysis of polar extracts provided information on the composition of the asphaltines. 122 references, 27 figures, 7 tables.

  20. Alanine polypeptide structural fingerprints at room temperature: what can be gained from non-harmonic Car-Parrinello molecular dynamics simulations.

    PubMed

    Gaigeot, M-P

    2008-12-25

    Structural infrared fingerprints of neutral gas phase alanine peptides of increasing size and complexity (dipeptide, octapeptide, and beta-strand peptide) are characterized through DFT-based Car-Parrinello molecular dynamics simulations. Harmonic and nonharmonic vibrational signatures are calculated from the time correlation of the dipole moment of the gas phase peptide in a direct way (without any approximation) respectively from low temperature (20 K) and room temperature (300 K) molecular dynamics. Our main purpose is to answer the two following questions: (i) Is the direct inclusion of temperature for the calculation of infrared spectra mandatory for the comprehension of the vibrational signatures experimentally recorded at room temperature? (ii) To what extent is the amide I, II, and III domain sensitive enough to the local structure of the peptides, to provide vibrational signatures that can be definitely used to assess the peptide conformation at 300 K?

  1. [Study on action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis based on techniques of gene expression profile and molecular fingerprint].

    PubMed

    Zhou, Wei; Song, Xiang-gang; Chen, Chao; Wang, Shu-mei; Liang, Sheng-wang

    2015-08-01

    Action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis were discussed based on gene expression profile and molecular fingerprint in this paper. First, gene expression profiles of atherosclerotic carotid artery tissues and histologically normal tissues in human body were collected, and were screened using significance analysis of microarray (SAM) to screen out differential gene expressions; then differential genes were analyzed by Gene Ontology (GO) analysis and KEGG pathway analysis; to avoid some genes with non-outstanding differential expression but biologically importance, Gene Set Enrichment Analysis (GSEA) were performed, and 7 chemical ingredients with higher negative enrichment score were obtained by Cmap method, implying that they could reversely regulate the gene expression profiles of pathological tissues; and last, based on the hypotheses that similar structures have similar activities, 336 ingredients of compound Danshen dripping pills were compared with 7 drug molecules in 2D molecular fingerprints method. The results showed that 147 differential genes including 60 up-regulated genes and 87 down regulated genes were screened out by SAM. And in GO analysis, Biological Process ( BP) is mainly concerned with biological adhesion, response to wounding and inflammatory response; Cellular Component (CC) is mainly concerned with extracellular region, extracellular space and plasma membrane; while Molecular Function (MF) is mainly concerned with antigen binding, metalloendopeptidase activity and peptide binding. KEGG pathway analysis is mainly concerned with JAK-STAT, RIG-I like receptor and PPAR signaling pathway. There were 10 compounds, such as hexadecane, with Tanimoto coefficients greater than 0.85, which implied that they may be the active ingredients (AIs) of compound Danshen dripping pills in treatment of carotid atherosclerosis (CAs). The present method can be applied to the research on material

  2. Genetic homogeneity of Fascioloides magna in Austria.

    PubMed

    Husch, Christian; Sattmann, Helmut; Hörweg, Christoph; Ursprung, Josef; Walochnik, Julia

    2017-08-30

    The large American liver fluke, Fascioloides magna, is an economically relevant parasite of both domestic and wild ungulates. F. magna was repeatedly introduced into Europe, for the first time already in the 19th century. In Austria, a stable population of F. magna has established in the Danube floodplain forests southeast of Vienna. The aim of this study was to determine the genetic diversity of F. magna in Austria. A total of 26 individuals from various regions within the known area of distribution were investigated for their cytochrome oxidase subunit 1 (cox1) and nicotinamide dehydrogenase subunit 1 (nad1) gene haplotypes. Interestingly, all 26 individuals revealed one and the same haplotype, namely concatenated haplotype Ha5. This indicates a homogenous population of F. magna in Austria and may argue for a single introduction. Alternatively, genetic homogeneity might also be explained by a bottleneck effect and/or genetic drift. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Mid-infrared supercontinuum covering the 1.4-13.3 μm molecular fingerprint region using ultra-high NA chalcogenide step-index fibre

    NASA Astrophysics Data System (ADS)

    Petersen, Christian Rosenberg; Møller, Uffe; Kubat, Irnis; Zhou, Binbin; Dupont, Sune; Ramsay, Jacob; Benson, Trevor; Sujecki, Slawomir; Abdel-Moneim, Nabil; Tang, Zhuoqi; Furniss, David; Seddon, Angela; Bang, Ole

    2014-11-01

    The mid-infrared spectral region is of great technical and scientific interest because most molecules display fundamental vibrational absorptions in this region, leaving distinctive spectral fingerprints. To date, the limitations of mid-infrared light sources such as thermal emitters, low-power laser diodes, quantum cascade lasers and synchrotron radiation have precluded mid-infrared applications where the spatial coherence, broad bandwidth, high brightness and portability of a supercontinuum laser are all required. Here, we demonstrate experimentally that launching intense ultra-short pulses with a central wavelength of either 4.5 μm or 6.3 μm into short pieces of ultra-high numerical-aperture step-index chalcogenide glass optical fibre generates a mid-infrared supercontinuum spanning 1.5 μm to 11.7 μm and 1.4 μm to 13.3 μm, respectively. This is the first experimental demonstration to truly reveal the potential of fibres to emit across the mid-infrared molecularfingerprint region’, which is of key importance for applications such as early cancer diagnostics, gas sensing and food quality control.

  4. Comparison of two highly discriminatory molecular fingerprinting assays for analysis of multiple Aspergillus fumigatus isolates from patients with invasive aspergillosis.

    PubMed

    de Valk, Hanneke A; Meis, Jacques F G M; de Pauw, Ben E; Donnelly, Peter J; Klaassen, Corné H W

    2007-05-01

    Two highly discriminatory fingerprinting assays, short tandem repeat typing and amplified fragment length polymorphism (AFLP), were compared to determine the genetic relatedness between 55 isolates of Aspergillus fumigatus obtained from 15 different patients suffering from proven invasive aspergillosis. Both techniques showed that interpatient isolates belonged to different genotypes and that intrapatient isolates from deep sites were all of the same genotype. By contrast, multiple genotypes were found among isolates originating from respiratory samples. Both techniques have specific advantages and disadvantages. AFLP is more universally applicable, but short tandem repeat analysis offers better discriminatory power and should be the preferred method for standardizing typing of clinical isolates of Aspergillus fumigatus.

  5. Theranostic Profiling for Actionable Aberrations in Advanced High Risk Osteosarcoma with Aggressive Biology Reveals High Molecular Diversity: The Human Fingerprint Hypothesis.

    PubMed

    Egas-Bejar, Daniela; Anderson, Pete M; Agarwal, Rishi; Corrales-Medina, Fernando; Devarajan, Eswaran; Huh, Winston W; Brown, Robert E; Subbiah, Vivek

    2014-03-12

    The survival of patients with advanced osteosarcoma is poor with limited therapeutic options. There is an urgent need for new targeted therapies based on biomarkers. Recently, theranostic molecular profiling services for cancer patients by CLIA-certified commercial companies as well as in-house profiling in academic medical centers have expanded exponentially. We evaluated molecular profiles of patients with advanced osteosarcoma whose tumor tissue had been analyzed by one of the following methods: 1. 182-gene next-generation exome sequencing (Foundation Medicine, Boston, MA), 2. Immunohistochemistry (IHC)/PCR-based panel (CARIS Target Now, Irving, Tx), 3.Comparative genome hybridization (Oncopath, San Antonio, TX). 4. Single-gene PCR assays, PTEN IHC (MDACC CLIA), 5. UT Houston morphoproteomics (Houston, TX). The most common actionable aberrations occur in the PI3K/PTEN/mTOR pathway. No patterns in genomic alterations beyond the above are readily identifiable, and suggest both high molecular diversity in osteosarcoma and the need for more analyses to define distinct subgroups of osteosarcoma defined by genomic alterations. Based on our preliminary observations we hypothesize that the biology of aggressive and the metastatic phenotype osteosarcoma at the molecular level is similar to human fingerprints, in that no two tumors are identical. Further large scale analyses of osteosarcoma samples are warranted to test this hypothesis.

  6. Efficiency of rep-PCR fingerprinting as a useful technique for molecular typing of plant pathogenic fungal species: Botryosphaeriaceae species as a case study.

    PubMed

    Abdollahzadeh, Jafar; Zolfaghari, Sajedeh

    2014-12-01

    Progress in molecular biology and the advent of rapid and accurate molecular techniques have contributed to precise and rapid detection and differentiation of microbial pathogens. Identification of the Botryosphaeriaceae species based on morphology has been problematic over time. In this study, we used rep-PCR technique as a molecular tool for typing and differentiation of the Botryosphaeriaceae species, well-known and cosmopolitan fungal pathogens on woody plants. Three primer sets BOX, ERIC and REP were used to differentiate 27 species belong to eight genera. The majority of them were examined in terms of typing and differentiation using molecular methods for the first time. All the primer sets were able to generate species-specific DNA fingerprints from all the tested strains, with two exceptions in the genera Diplodia and Spencermartinsia. Despite the deficiency of each primer sets to separate a few species, cluster analysis of combined data sets indicated the ability of rep-PCR technique to separate 26 out of 27 examined species in highly supported clusters corresponded to the species recognized based on DNA sequence data. Our findings revealed the efficiency of rep-PCR for detection and differentiation of the Botryosphaeriaceae species, especially cryptic species with the same ITS sequences and similar morphology.

  7. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  8. Fingerprint Recognition with Identical Twin Fingerprints

    PubMed Central

    Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  9. Defining the Baseline and Oxidant Perturbed Lipidomic Profiles of Daphnia magna.

    PubMed

    Taylor, Nadine S; White, Thomas A; Viant, Mark R

    2017-03-15

    Recent technological advancement has enabled the emergence of lipidomics as an important tool for assessing molecular stress, one which has yet to be assessed fully as an approach in an environmental toxicological context. Here we have applied a high-resolution, non-targeted, nanoelectrospray ionisation (nESI) direct infusion mass spectrometry (DIMS) technique to assess the effects of oxidative stress to Daphnia magna both in vitro (air exposure of daphniid extracts) and in vivo (Cu(2+) exposure). Multivariate and univariate statistical analyses were used to distinguish any perturbations including oxidation to the D. magna baseline lipidome. This approach enabled the putative annotation of the baseline lipidome of D. magna with 65% of the lipid species discovered previously not reported. In vitro exposure of lipid extracts to air, primarily to test the methodology, revealed a significant perturbation to this baseline lipidome with detectable oxidation of peaks, in most cases attributed to single oxygen addition. Exposure of D. magna to Cu(2+) in vivo also caused a significant perturbation to the lipidome at an environmentally relevant concentration of 20 µg/L. This nESI DIMS approach has successfully identified perturbations and oxidative modifications to the D. magna lipidome in a high-throughput manner, highlighting its suitability for environmental lipidomic studies.

  10. Defining the Baseline and Oxidant Perturbed Lipidomic Profiles of Daphnia magna

    PubMed Central

    Taylor, Nadine S.; White, Thomas A.; Viant, Mark R.

    2017-01-01

    Recent technological advancement has enabled the emergence of lipidomics as an important tool for assessing molecular stress, one which has yet to be assessed fully as an approach in an environmental toxicological context. Here we have applied a high-resolution, non-targeted, nanoelectrospray ionisation (nESI) direct infusion mass spectrometry (DIMS) technique to assess the effects of oxidative stress to Daphnia magna both in vitro (air exposure of daphniid extracts) and in vivo (Cu2+ exposure). Multivariate and univariate statistical analyses were used to distinguish any perturbations including oxidation to the D. magna baseline lipidome. This approach enabled the putative annotation of the baseline lipidome of D. magna with 65% of the lipid species discovered previously not reported. In vitro exposure of lipid extracts to air, primarily to test the methodology, revealed a significant perturbation to this baseline lipidome with detectable oxidation of peaks, in most cases attributed to single oxygen addition. Exposure of D. magna to Cu2+ in vivo also caused a significant perturbation to the lipidome at an environmentally relevant concentration of 20 µg/L. This nESI DIMS approach has successfully identified perturbations and oxidative modifications to the D. magna lipidome in a high-throughput manner, highlighting its suitability for environmental lipidomic studies. PMID:28294984

  11. Aerogel Fingerprint Media

    SciTech Connect

    Miller, Fred S.; Andresen, Brian D.

    1999-09-21

    A fingerprint medium which is made of an aerogel having a predetermined density. The fingerprint medium may have a midrange density for forming plates or may be crushed forming a powder. The fingerprint medium may further include at least one of a metal and metal oxide to enhance characteristics desirable in a fingerprint medium.

  12. Behavioral response of Daphnia magna to silver salt and nanoparticle exposure

    EPA Science Inventory

    Endpoints in the investigation of the toxicity of metallic nanoparticles have varied from genetic and molecular through whole organism responses such as death and reproduction. The work presented here is an effort to quantify behavioral responses of Daphnia magna to exposure to s...

  13. Behavioral response of Daphnia magna to silver salt and nanoparticle exposure

    EPA Science Inventory

    Endpoints in the investigation of the toxicity of metallic nanoparticles have varied from genetic and molecular through whole organism responses such as death and reproduction. The work presented here is an effort to quantify behavioral responses of Daphnia magna to exposure to s...

  14. First evidence for toxic defense based on the multixenobiotic resistance (MXR) mechanism in Daphnia magna.

    PubMed

    Campos, Bruno; Altenburger, Rolf; Gómez, Cristian; Lacorte, Silvia; Piña, Benjamin; Barata, Carlos; Luckenbach, Till

    2014-03-01

    The water flea Daphnia magna is widely used as test species in ecotoxicological bioassays. So far, there is no information available to which extent ATP binding cassette (ABC) transporter based multixenobiotic resistance (MXR) counteracts adverse chemical effects in this species. This, however, would be important for assessing to which extent the bio-active potential of a compound determined with this species depends on this cellular defense. We here present molecular, functional and toxicological studies that provide first evidence for ABC transporter-based MXR in D. magna. We cloned putatively MXR-related partial abcb1, abcc1/3, abcc4 and abcc5 coding sequences; respective transcripts were constitutively expressed in different D. magna life stages. MXR associated efflux activity was monitored in D. magna using the fluorescent substrate dyes rhodamine 123, rhodamine B and calcein-AM combined with inhibitors of human ABCB1 and/or ABCC transporter activities reversin 205, MK571 and cyclosporin A. With inhibitors present, efflux of dye substrates was reduced in D. magna in a concentration-dependent mode, as indicated by elevated accumulation of the dyes in D. magna tissues. In animals pre-exposed to mercury, pentachlorophenol or dacthal applied as inducers of ABC transporter expression, levels of some ABC transporter transcripts were increased in some cases showing that these genes can be chemically induced. Likewise, pre-exposure of animals to these chemicals decreased dye accumulation in tissue, indicating enhanced MXR transporter activity, likely associated with higher transporter protein levels. Toxicity assays with toxic transporter substrates mitoxantrone and chlorambucil that were applied singly and in combination with inhibitors were performed to study the tolerance role of Abcb1 and Abcc efflux transporters in D. magna. Joint toxicities of about half of the binary combinations of test compounds applied (substrate/inhibitor, substrate/substrate, inhibitor

  15. Comparison of 16S rDNA analysis and rep-PCR genomic fingerprinting for molecular identification of Yersinia pseudotuberculosis.

    PubMed

    Kim, Wonyong; Song, Mi-Ok; Song, Wonkeun; Kim, Ki-Jung; Chung, Sang-In; Choi, Chul-Soon; Park, Yong-Ha

    2003-01-01

    16S rDNA sequence analysis and repetitive element sequence-based PCR (rep-PCR) genomic fingerprinting were evaluated on 11 type strains of the genus Yersinia and 17 recognized serotype strains of Y. pseudotuberculosis to investigate their genetic relatedness and to establish the value of techniques for the identification of Y. pseudotuberculosis. A phylogenetic tree constructed from 16S rDNA sequences showed that the type strains of Yersinia species formed distinct clusters with the exception of Y. pestis and Y. pseudotuberculosis. Moreover, Y. pestis NCTC 5923T was found to be closely related to Y. pseudotuberculosis serotypes 1b, 3, and 7. Dendrograms generated from REP-PCR, and ERIC-PCR data revealed that members of the genus Yersinia differed from each other with the degree of similarity 62% and 58%, respectively. However, the BOX-PCR results showed that Y. pestis 5923T clustered with the Y. pseudotuberculosis group with a degree of similarity 74%. According to these findings, 16S rDNA sequence analysis was unable to reliably discriminate Y. pseudotuberculosis from Y. pestis. However, REP-PCR and especially ERIC-PCR provided an effective means of differentiating between members of the taxa.

  16. Toward personalized hemodialysis by low molecular weight amino-containing compounds: future perspective of patient metabolic fingerprint

    PubMed Central

    Sirolli, Vittorio; Rossi, Claudia; Di Castelnuovo, Augusto; Felaco, Paolo; Amoroso, Luigi; Zucchelli, Mirco; Ciavardelli, Domenico; Di Ilio, Carmine; Sacchetta, Paolo; Bernardini, Sergio; Arduini, Arduino; Bonomini, Mario; Urbani, Andrea

    2012-01-01

    Background L-carnitine deficiency is commonly observed in chronic hemodialysis patients, and this depletion may cause clinical symptoms like muscle weakness, anaemia, and hypotension. Materials and methods We pursued a targeted metabonomics investigation in 28 hemodialysis patients (13 non diabetics and 15 diabetics) and in 10 age-matched healthy controls, on plasma levels of all carnitine esters and of several amino acids. Samples were taken before and after the first hemodialysis treatment of the week. Multiplexed data were collected in LCMRM (Multiple Reaction Monitoring) and analysed by unsupervised multivariate analysis. Results In diabetic uremic patients, we observed lower values of propionylcarnitine than in other groups, while acylcarnitine concentration was higher in uremics compared to controls. The hemodialysis session induced a decline in free, short-chain, medium-chain and dicarboxylic acylcarnitines, whereas the long chain acylcarnitines remained unaffected. Plasma levels of amino acid proline, ornithine, citrulline and serine were significantly elevated in uremic patients before dialysis compared to controls. For most tested plasma amino acids, a significant reduction after hemodialysis session was found. Discussion Our study is the first that investigated on possible modifications of the system of carnitine in diabetic patients in hemodialysis not only in relation to the condition of deficiency but also compared to lipid and glucose homeostasis alteration typical of diabetics. We proposed the application of targeted metabolic fingerprint in the management of the hemodialysis patients. PMID:22890273

  17. Phenotypic and molecular fingerprinting of fast growing rhizobia of field-grown pigeonpea from the eastern edge of the Brazilian Pantanal.

    PubMed

    Costa, F M; Schiavo, J A; Brasil, M S; Leite, J; Xavier, G R; Fernandes, P I

    2014-01-21

    The aim of this study was to evaluate the diversity of rhizobial isolates obtained from root nodules of pigeonpea plants grown at the eastern edge of the Brazilian Pantanal. The bacterial isolates were isolated from root nodules from field-growing pigeonpea grown in two rural settlements of the Aquidauana municipality. The bacterial isolates were characterized phenotypically by means of cultural characterization, intrinsic antibiotic resistance (IAR), salt and high incubation temperature tolerance, and amylolytic and cellulolytic activities. The molecular characterization of the bacterial isolates was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and Box-polymerase chain reaction (PCR) techniques. In addition, the symbiotic performance of selected rhizobial isolates was evaluated in a greenhouse experiment using sterile substrate. The phenotypic characterization revealed that the bacterial strains obtained from pigeonpea root nodules presented characteristics that are uncommon among rhizobial isolates, indicating the presence of new species nodulating the pigeonpea plants in the Brazilian Pantanal. The molecular fingerprinting of these bacterial isolates also showed a highly diverse collection, with both techniques revealing less than 25% similarity among bacterial isolates. The evaluation of symbiotic performance also indicated the presence of microorganisms with high potential to increase the growth and nitrogen content at the shoots of pigeonpea plants. The results obtained in this study indicate the presence of a highly diversified rhizobial community nodulating the pigeonpea at the eastern edge of the Brazilian Pantanal.

  18. Advanced Fingerprint Analysis Project Fingerprint Constituents

    SciTech Connect

    GM Mong; CE Petersen; TRW Clauss

    1999-10-29

    The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

  19. Fingerprint comparison. I: Similarity of fingerprints.

    PubMed

    Lin, C H; Liu, J H; Osterburg, J W; Nicol, J D

    1982-04-01

    Fingerprints from 61 pairs of male monozygotic twins (MZ), 47 pairs of female MZ, 40 pairs of same-sex male dizygotic twins (DZ), 44 pairs of same-sex female DZ, 4 pairs of opposite-sex DZ, and 28 brothers and 31 sisters of those twins are used for the study of fingerprint similarities. Similarities of fingerprint pattern, ridge count, and minutiae are evaluated for two population groups genetically related to each other in different degrees. It is concluded that fingerprint similarities, including pattern, ridge count, and possibly minutiae, between MZ individuals are significantly higher than those between other population groups, including DZ twins.

  20. “Self” and “Non-Self” in the Control of Phytoalexin Biosynthesis: Plant Phospholipases A2 with Alkaloid-Specific Molecular Fingerprints

    PubMed Central

    Heinze, Michael; Brandt, Wolfgang; Marillonnet, Sylvestre; Roos, Werner

    2015-01-01

    The overproduction of specialized metabolites requires plants to manage the inherent burdens, including the risk of self-intoxication. We present a control mechanism that stops the expression of phytoalexin biosynthetic enzymes by blocking the antecedent signal transduction cascade. Cultured cells of Eschscholzia californica (Papaveraceae) and Catharanthus roseus (Apocynaceae) overproduce benzophenanthridine alkaloids and monoterpenoid indole alkaloids, respectively, in response to microbial elicitors. In both plants, an elicitor-responsive phospholipase A2 (PLA2) at the plasma membrane generates signal molecules that initiate the induction of biosynthetic enzymes. The final alkaloids produced in the respective plant inhibit the respective PLA, a negative feedback that prevents continuous overexpression. The selective inhibition by alkaloids from the class produced in the “self” plant could be transferred to leaves of Nicotiana benthamiana via recombinant expression of PLA2. The 3D homology model of each PLA2 displays a binding pocket that specifically accommodates alkaloids of the class produced by the same plant, but not of the other class; for example, C. roseus PLA2 only accommodates C. roseus alkaloids. The interaction energies of docked alkaloids correlate with their selective inhibition of PLA2 activity. The existence in two evolutionary distant plants of phospholipases A2 that discriminate “self-made” from “foreign” alkaloids reveals molecular fingerprints left in signal enzymes during the evolution of species-specific, cytotoxic phytoalexins. PMID:25670767

  1. Fluorescence fingerprints and Cu2+-complexing ability of individual molecular size fractions in soil- and waste-borne DOM.

    PubMed

    Knoth de Zarruk, K; Scholer, G; Dudal, Y

    2007-09-01

    Land spreading of organic materials introduces large amounts of dissolved organic matter (DOM) into the soil. DOM has the ability to form stable complexes with heavy metals and can facilitate their transport towards the groundwater. The effects on soil processes are difficult to assess, because different DOM components might react differently towards metal ions. The objective of this study was to investigate the fluorescence signature and the Cu2+-binding capacity of individual molecular size fractions of DOM from various sources. DOM extracted from leaf compost, chicken manure, sugar cane vinasse and a fulvic hypercalcaric cambisol was fractionated by the means of dialysis into four molecular size classes: MW<500, 50012000-14000 Da. Vinasse and leaf compost contained around 80% and 70%, respectively, of the total organic carbon in the fractions with low molecular weight (MW<3500 Da); in chicken manure and soil these fractions accounted for 40% and 50% only. Fluorescence was highest in the fraction MW>12000 Da for leaf compost, chicken manure and soil. The opposite result was obtained for vinasse, where the fractions with low molecular weight showed highest fluorescence intensities, distinguishing it from all other samples. Vinasse showed the greatest ability to bind Cu2+ with a resulting complex concentration of 6.31mgl(-1) while in contact with an excess of Cu2+. Leaf compost, soil and chicken manure followed with 2.69, 1.12, and 0.85mgl(-1), respectively. Within vinasse, the fraction MW<500 Da was able to form the most DOM-Cu complexes, indicating the importance of low molecular weight fractions in metal binding.

  2. Identification of pili on the surface of Finegoldia magna--a gram-positive anaerobic cocci.

    PubMed

    Murphy, Elizabeth C; Janulczyk, Robert; Karlsson, Christofer; Mörgelin, Matthias; Frick, Inga-Maria

    2014-06-01

    Pili have only been discovered in the major Gram-positive pathogens in the past decade and they have been found to play an important role in colonisation and virulence. Pili have been shown to have many important functions including attachment to host tissues, mediating bacterial aggregation, biofilm formation and binding to proteins in the extracellular matrix. In this study, sortase-dependent pili have been found to be expressed on the surface of Finegoldia magna ALB8. F. magna is a Gram-positive anaerobic coccus that, primarily, is a commensal of the skin and mucous membranes, but has also been isolated from various clinical infection sites and is associated with soft-tissue abscesses, wound infections and bone and prosthetic joint infections. In this study, F. magna ALB8 was found to harbour three sortases at the pilus locus, two of which bear high similarity to class C sortases in Streptococcus pneumoniae. Two putative sortase-dependent pili proteins were found in the locus, with one being identified as the major pilus subunit, Fmp1 (F. magna pilus subunit 1), due to its high similarity to other major pilus proteins in prominent Gram-positive pathogens. The presence of sortase-dependent pili was confirmed experimentally through recombinant production of Fmp1 and production of antiserum. The Fmp1 antiserum was used in Western blot to show the presence of a high molecular weight protein ladder, characteristic of the presence of pili, in trypsin released cell wall surface proteins from F. magna. The presence of sortase-dependent pili was visually confirmed by transmission electron microscopy, which showed the binding of gold labelled anti-Fmp1 to individual pilus proteins along the pilus. Furthermore, pili could also be found to bind and interact with keratinocytes in the epidermal layer of human skin, suggesting an adhesive role for pili on F. magna. Our work represents the first description of pilus structures in F. magna. This discovery further

  3. Development of 3D-QSAR Model for Acetylcholinesterase Inhibitors Using a Combination of Fingerprint, Molecular Docking, and Structure-Based Pharmacophore Approaches.

    PubMed

    Lee, Sehan; Barron, Mace G

    2015-11-01

    Acetylcholinesterase (AChE), a serine hydrolase vital for regulating the neurotransmitter acetylcholine in animals, has been used as a target for drugs and pesticides. With the increasing availability of AChE crystal structures, with or without ligands bound, structure-based approaches have been successfully applied to AChE inhibitors (AChEIs). The major limitation of these approaches has been the small applicability domain due to the lack of structural diversity in the training set. In this study, we developed a 3 dimensional quantitative structure-activity relationship (3D-QSAR) for inhibitory activity of 89 reversible and irreversible AChEIs including drugs and insecticides. A 3D-fingerprint descriptor encoding protein-ligand interactions was developed using molecular docking and structure-based pharmacophore to rationalize the structural requirements responsible for the activity of these compounds. The obtained 3D-QSAR model exhibited high correlation value (R(2) = 0.93) and low mean absolute error (MAE = 0.32 log units) for the training set (n = 63). The model was predictive across a range of structures as shown by the leave-one-out cross-validated correlation coefficient (Q(2) = 0.89) and external validation results (n = 26, R(2) = 0.89, and MAE = 0.38 log units). The model revealed that the compounds with high inhibition potency had proper conformation in the active site gorge and interacted with key amino acid residues, in particular Trp84 and Phe330 at the catalytic anionic site, Trp279 at the peripheral anionic site, and Gly118, Gly119, and Ala201 at the oxyanion hole. The resulting universal 3D-QSAR model provides insight into the multiple molecular interactions determining AChEI potency that may guide future chemical design and regulation of toxic AChEIs.

  4. Comparison of multilocus sequence typing and Ca3 fingerprinting for molecular subtyping epidemiologically-related clinical isolates of Candida albicans.

    PubMed

    Chowdhary, Anuradha; Lee-Yang, Wendy; Lasker, Brent A; Brandt, Mary E; Warnock, David W; Arthington-Skaggs, Beth A

    2006-08-01

    Southern hybridization with the complex probe Ca3 is a well established tool for molecular subtyping of Candida albicans. Multilocus sequence typing (MLST) is a DNA sequence-based subtyping method recently applied to C. albicans and shown to have a high degree of intraspecies discriminatory power. However, its utility for studying the molecular epidemiology of sequential isolates from recurrent disease has not been established. We compared Ca3 Southern hybridization and MLST using seven housekeeping genes (CaAAT1a, CaACC1, CaADP1, CaPMI, CaSYA1, CaVPS13, CaZWF1b) for their ability to discriminate among 37 C. albicans isolates from recurrent cases of oropharyngeal candidiasis (OPC) in ten HIV-positive patients from India and the US. Among the 37 isolates, MLST identified 23 distinct genotypes (index of diversity = 97%); Ca3 Southern hybridization identified 21 distinct genotypes (index of diversity = 95%). Both methods clustered isolates into seven genetically-related groups and, with one exception, isolates that were indistinguishable by MLST were indistinguishable or highly related by Ca3 Southern hybridization. These results demonstrate that MLST performs equally well or better compared to Ca3 Southern hybridization for defining genetic-relatedness of sequential C. albicans isolates from recurrent cases of OPC in HIV-positive patients.

  5. Conversion of the pathogenic fungus Colletotrichum magna to a nonpathogenic, endophytic mutualist by gene disruption

    USGS Publications Warehouse

    Redman, R.S.; Ranson, J.C.; Rodriguez, R.J.

    1999-01-01

    Hygromycin-resistant transformants of the cucurbit pathogen Colletotrichum magna (teleomorph: Glomerella magna) were generated by restriction enzyme-mediated integration (REMI) transformation. A rapid pathogenicity assay involving watermelon (Citrullus lanatus) seedlings was developed and 14,400 REMI transformants were screened and assessed for their ability to cause disease, colonize plant tissues, and confer disease resistance against wild-type C. magna. A total of 176 nonpathogenic REMI mutants capable of colonizing cucurbit plants were isolated and assigned to three groups based on their ability to confer disease resistance: phenotype A, 80 to 100% disease protection; phenotype B, 10 to 65% disease protection; and phenotype C, 0 to 4% disease protection. Molecular and genetic analyses of one REMI mutant (R1) indicated that the nonpathogenic phenotype A resulted from a single-site integration. R1 showed a 1:1 segregation of hygromycin resistance and nonpathogenicity and all hygromycin-resistant progeny were nonpathogenic. The integrated vector and 5.5 kb of flanking fungal genomic DNA were isolated from R1 and designated pGMR1. To verify that pGMR1 contained pathogenicity gene sequences, a wild-type isolate of C. magna was transformed with pGMR1 to induce gene disruptions by homologous integration. Approximately 47% of the pGMR1 transformants expressed phenotype A, indicating homologous integration and gene disruption.

  6. Molecular fingerprinting of Salmonella typhimurium by IS200-typing as a tool for epidemiological and evolutionary studies.

    PubMed

    Soria, G; Barbé, J; Gibert, I

    1994-01-01

    The aim of this work was to develop and evaluate a molecular typing strategy for Salmonella based on hybridization of chromosomal DNA with two different probes derived from insertion sequence IS200. Probe IS200-TT was specifically constructed for this study as a trimer of a 112 pb TaqI-TaqI fragment of IS200. Among several restriction enzymes evaluated, two were selected: EcoRI, which cuts the insertion sequence in two pieces, each one complementary to one of the probes used, and PstI, a restriction enzyme with no recognition site into IS200. With several combinations of these restrictions enzymes and probes, 43 Salmonella typhimurium strains were analyzed for copy number and location of IS200, as well as reproducibility and stability of the patterns. IS200 types have been shown to be stable, both in strains isolated from different patients implicated in the same salmonellosis outbreak and in strains isolated from the same patient at different times or from different specimens. The discriminatory power of the method has been 0.91 to 0.94. As a comparison, S. typhimurium strains were also ribotyped. Discriminatory power of the ribotypes oscillated between 0.44 and 0.55, depending on the enzyme used, and achieved a 0.78 value when the information obtained with two restriction enzymes was combined. Moreover, IS200 typing was able to differentiate among a group of S. typhimurium strains which were identical by ribotype and enzymatic electrophoretic mobility. These results enable us to conclude that, for the stability, reproducibility and discriminatory power of the patterns generated, IS200 probes can be a very useful tool in the molecular typing of S. typhimurium.

  7. MAGNA: Maximizing Accuracy in Global Network Alignment.

    PubMed

    Saraph, Vikram; Milenković, Tijana

    2014-10-15

    Biological network alignment aims to identify similar regions between networks of different species. Existing methods compute node similarities to rapidly identify from possible alignments the high-scoring alignments with respect to the overall node similarity. But, the accuracy of the alignments is then evaluated with some other measure that is different than the node similarity used to construct the alignments. Typically, one measures the amount of conserved edges. Thus, the existing methods align similar nodes between networks hoping to conserve many edges (after the alignment is constructed!). Instead, we introduce MAGNA to directly 'optimize' edge conservation while the alignment is constructed, without decreasing the quality of node mapping. MAGNA uses a genetic algorithm and our novel function for 'crossover' of two 'parent' alignments into a superior 'child' alignment to simulate a 'population' of alignments that 'evolves' over time; the 'fittest' alignments survive and proceed to the next 'generation', until the alignment accuracy cannot be optimized further. While we optimize our new and superior measure of the amount of conserved edges, MAGNA can optimize any alignment accuracy measure, including a combined measure of both node and edge conservation. In systematic evaluations against state-of-the-art methods (IsoRank, MI-GRAAL and GHOST), on both synthetic networks and real-world biological data, MAGNA outperforms all of the existing methods, in terms of both node and edge conservation as well as both topological and biological alignment accuracy. Software: http://nd.edu/∼cone/MAGNA CONTACT: : tmilenko@nd.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Molecular fingerprinting of complex grass allergoids: size assessments reveal new insights in epitope repertoires and functional capacities.

    PubMed

    Starchenka, S; Bell, A J; Mwange, J; Skinner, M A; Heath, M D

    2017-01-01

    Subcutaneous allergen immunotherapy (SCIT) is a well-documented treatment for allergic disease which involves injections of native allergen or modified (allergoid) extracts. The use of allergoid vaccines is a growing sector of the allergy immunotherapy market, associated with shorter-course therapy. The aim of this study was the structural and immunological characterisation of group 1 (Lol p 1) IgG-binding epitopes within a complex mix grass allergoid formulation containing rye grass. HP-SEC was used to resolve a mix grass allergoid preparation of high molecular weight into several distinct fractions with defined molecular weight and elution profiles. Allergen verification of the HP-SEC allergoid fractions was confirmed by mass spectrometry analysis. IgE and IgG immunoreactivity of the allergoid preparations was explored and Lol p 1 specific IgG-binding epitopes mapped by SPOT synthesis technology (PepSpot™) with structural analysis based on a Lol p 1 homology model. Grass specific IgE reactivity of the mix grass modified extract (allergoid) was diminished in comparison with the mix grass native extract. A difference in IgG profiles was observed between an intact mix grass allergoid preparation and HP-SEC allergoid fractions, which indicated enhancement of accessible reactive IgG epitopes across size distribution profiles of the mix grass allergoid formulation. Detailed analysis of the epitope specificity showed retention of six Lol p 1 IgG-binding epitopes in the mix grass modified extract. The structural and immunological changes which take place following the grass allergen modification process was further unravelled revealing distinct IgG immunological profiles. All epitopes were mapped on the solvent exposed area of Lol p 1 homology model accessible for IgG binding. One of the epitopes was identified as an 'immunodominant' Lol p 1 IgG-binding epitope (62-IFKDGRGCGSCFEIK-76) and classified as a novel epitope. The results from this study support the concept

  9. Reflection on Molecular Approaches Influencing State-of-the-Art Bioremediation Design: Culturing to Microbial Community Fingerprinting to Omics

    PubMed Central

    Czaplicki, Lauren M.; Gunsch, Claudia K.

    2017-01-01

    Bioremediation is generally viewed as a cost effective and sustainable technology because it relies on microbes to transform pollutants into benign compounds. Advances in molecular biological analyses allow unprecedented microbial detection and are increasingly incorporated into bioremediation. Throughout history, state-of-the-art techniques have informed bioremediation strategies. However, the insights those techniques provided were not as in depth as those provided by recently developed omics tools. Advances in next generation sequencing (NGS) have now placed metagenomics and metatranscriptomics within reach of environmental engineers. As NGS costs decrease, metagenomics and metatranscriptomics have become increasingly feasible options to rapidly scan sites for specific degradative functions and identify microorganisms important in pollutant degradation. These omic techniques are capable of revolutionizing biological treatment in environmental engineering by allowing highly sensitive characterization of previously uncultured microorganisms. Omics enables the discovery of novel microorganisms for use in bioaugmentation and supports systematic optimization of biostimulation strategies. This review describes the omics journey from roots in biology and medicine to its current status in environmental engineering including potential future directions in commercial application. PMID:28348455

  10. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    PubMed

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  11. Quantitative structure-activity relationship modeling of the toxicity of organothiophosphate pesticides to Daphnia magna and Cyprinus carpio.

    PubMed

    Zvinavashe, Elton; Du, Tingting; Griff, Tamas; van den Berg, Hans H J; Soffers, Ans E M F; Vervoort, Jacques; Murk, Albertinka J; Rietjens, Ivonne M C M

    2009-06-01

    Within the REACH regulatory framework in the EU, quantitative structure-activity relationships (QSAR) models are expected to help reduce the number of animals used for experimental testing. The objective of this study was to develop QSAR models to describe the acute toxicity of organothiophosphate pesticides to aquatic organisms. Literature data sets for acute toxicity data of organothiophosphates to fish and one data set from experiments with 15 organothiophosphates on Daphniamagna performed in the present study were used to establish QSARs based on quantum mechanically derived molecular descriptors. The logarithm of the octanol/water partition coefficient, logK(ow,) the energy of the lowest unoccupied molecular orbital, E(lumo), and the energy of the highest occupied molecular orbital, E(homo) were used as descriptors. Additionally, it was investigated if toxicity data for the invertebrate D. magna could be used to build a QSAR model to predict toxicity to fish. Suitable QSAR models (0.80magna). Toxicity data for D. magna correlated well (r(2)=0.94) with toxicity data for C. carpio. This implies that by performing toxicity tests with D. magna, one can use our interspecies QSAR model to predict the acute toxicity of organothiophosphates to fish. The three QSAR models were validated either both internally and externally (D. magna) or internally only (carp and D. magna to carp). For each QSAR model, an applicability domain was defined based on the chemical structures and the ranges of the descriptor values of the training set compounds. From the 100196 European Inventory of Existing Commercial Chemical Substances (EINECS), 83 compounds were identified that fit the selection criteria for the QSAR models. For these compounds, using our QSAR models, one can obtain an indication of their toxicity without the need for additional experimental

  12. Latent fingerprint matching.

    PubMed

    Jain, Anil K; Feng, Jianjiang

    2011-01-01

    Latent fingerprint identification is of critical importance to law enforcement agencies in identifying suspects: Latent fingerprints are inadvertent impressions left by fingers on surfaces of objects. While tremendous progress has been made in plain and rolled fingerprint matching, latent fingerprint matching continues to be a difficult problem. Poor quality of ridge impressions, small finger area, and large nonlinear distortion are the main difficulties in latent fingerprint matching compared to plain or rolled fingerprint matching. We propose a system for matching latent fingerprints found at crime scenes to rolled fingerprints enrolled in law enforcement databases. In addition to minutiae, we also use extended features, including singularity, ridge quality map, ridge flow map, ridge wavelength map, and skeleton. We tested our system by matching 258 latents in the NIST SD27 database against a background database of 29,257 rolled fingerprints obtained by combining the NIST SD4, SD14, and SD27 databases. The minutiae-based baseline rank-1 identification rate of 34.9 percent was improved to 74 percent when extended features were used. In order to evaluate the relative importance of each extended feature, these features were incrementally used in the order of their cost in marking by latent experts. The experimental results indicate that singularity, ridge quality map, and ridge flow map are the most effective features in improving the matching accuracy.

  13. How fingerprints came into use for personal identification.

    PubMed

    Caplan, R M

    1990-07-01

    The use of fingerprints for personal identification became widespread early in this century. How the fingerprints slowly became standardized involves many persons, including Nathaniel Grew, Johannes Purkinje, William Herschel, Henry Faulds, Charles Darwin, Francis Galton, Mark Twain, Juan Vucetich, Edward Henry, and J. Edgar Hoover. Although fingerprints have been noted and used since antiquity, a 25-year burst of activity that secured adoption of their use for identification began in about 1880. New modifications and applications have continued to the present. The history of fingerprints offers an excellent example of how society adopts innovations. This story also includes a bitter struggle for appropriate credit for various crucial steps in developing and adopting this important tool. More recent technical advances, including computers and molecular biology, now supplement the ease and usefulness of fingerprints, although the word fingerprinting continues in use by metaphoric extension.

  14. iCDI-PseFpt: identify the channel-drug interaction in cellular networking with PseAAC and molecular fingerprints.

    PubMed

    Xiao, Xuan; Min, Jian-Liang; Wang, Pu; Chou, Kuo-Chen

    2013-11-21

    Many crucial functions in life, such as heartbeat, sensory transduction and central nervous system response, are controlled by cell signalings via various ion channels. Therefore, ion channels have become an excellent drug target, and study of ion channel-drug interaction networks is an important topic for drug development. However, it is both time-consuming and costly to determine whether a drug and a protein ion channel are interacting with each other in a cellular network by means of experimental techniques. Although some computational methods were developed in this regard based on the knowledge of the 3D (three-dimensional) structure of protein, unfortunately their usage is quite limited because the 3D structures for most protein ion channels are still unknown. With the avalanche of protein sequences generated in the post-genomic age, it is highly desirable to develop the sequence-based computational method to address this problem. To take up the challenge, we developed a new predictor called iCDI-PseFpt, in which the protein ion-channel sample is formulated by the PseAAC (pseudo amino acid composition) generated with the gray model theory, the drug compound by the 2D molecular fingerprint, and the operation engine is the fuzzy K-nearest neighbor algorithm. The overall success rate achieved by iCDI-PseFpt via the jackknife cross-validation was 87.27%, which is remarkably higher than that by any of the existing predictors in this area. As a user-friendly web-server, iCDI-PseFpt is freely accessible to the public at the website http://www.jci-bioinfo.cn/iCDI-PseFpt/. Furthermore, for the convenience of most experimental scientists, a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated math equations presented in the paper just for its integrity. It has not escaped our notice that the current approach can also be used to study other drug-target interaction networks. © 2013 Elsevier Ltd

  15. Rapid Molecular Fingerprinting of Pathogens

    DTIC Science & Technology

    2006-08-31

    establishing appropriate biotinylation conditions and the availability of sufficient quantities of purified virus for library screening . Additionally...the level of peptide display on the cell surface was found to be lower than desired for optimal library screening . This problem was corrected by...remaining virus sample with the green fluroescent probe Alexa 488. However, Alexa labeling resulted in insufficient fluorescent signals for library

  16. Physics and fingerprints

    NASA Astrophysics Data System (ADS)

    Voss-de Haan, Patrick

    2006-08-01

    This article discusses a variety of aspects in the detection and development of fingerprints and the physics involved in it. It gives an introduction to some basic issues like composition and properties of fingerprint deposits and a rudimentary framework of dactyloscopy; it covers various techniques for the visualization of latent fingerprints; and it concludes with a view of current research topics. The techniques range from very common procedures, such as powdering and cyanoacrylate fuming, to more demanding methods, for example luminescence and vacuum metal deposition, to fairly unusual approaches like autoradiography. The emphasis is placed on the physical rather than the forensic aspects of these topics while trying to give the physicist—who is not dealing with fingerprinting and forensic science on a daily basis—a feeling for the problems and solutions in the visualization of latent fingerprints.

  17. Comparing Bacterial DNA Microarray Fingerprints

    SciTech Connect

    Willse, Alan R.; Chandler, Darrell P.; White, Amanda M.; Protic, Miroslava; Daly, Don S.; Wunschel, Sharon C.

    2005-08-15

    Detecting subtle genetic differences between microorganisms is an important problem in molecular epidemiology and microbial forensics. In a typical investigation, gel electrophoresis is used to compare randomly amplified DNA fragments between microbial strains, where the patterns of DNA fragment sizes are proxies for a microbe's genotype. The limited genomic sample captured on a gel is often insufficient to discriminate nearly identical strains. This paper examines the application of microarray technology to DNA fingerprinting as a high-resolution alternative to gel-based methods. The so-called universal microarray, which uses short oligonucleotide probes that do not target specific genes or species, is intended to be applicable to all microorganisms because it does not require prior knowledge of genomic sequence. In principle, closely related strains can be distinguished if the number of probes on the microarray is sufficiently large, i.e., if the genome is sufficiently sampled. In practice, we confront noisy data, imperfectly matched hybridizations, and a high-dimensional inference problem. We describe the statistical problems of microarray fingerprinting, outline similarities with and differences from more conventional microarray applications, and illustrate the statistical fingerprinting problem for 10 closely related strains from three Bacillus species, and 3 strains from non-Bacillus species.

  18. Teaching Magna Carta in American History: Land, Law, and Legacy

    ERIC Educational Resources Information Center

    Saxe, David W.

    2010-01-01

    Magna Carta, that great cornerstone of American liberty, has been in the news lately. Put up for sale by three-time U.S. Presidential candidate Ross Perot in December 2007, the 1297 version of Magna Carta displayed in the National Archives was sold to financier David Rubenstein for $21.3 million. While its sale demonstrates the cash value of the…

  19. A DAPHNIA MAGNA SHORT-TERM SURVIVAL AND GROWTH TEST

    EPA Science Inventory

    With the change in acceptable test temperatures for invertebrate toxicity tests from <20oC to 25oC, it is now possible to use Daphnia magna for short-term chronic testing. When cultured at 25oC the dry weight of <24 hr old D. magna ranges from 7 to 15 g depending upon nutrition,...

  20. Use of Daphnia Magna to Assess Potentially Contaminated Buildings.

    DTIC Science & Technology

    1992-06-01

    Random concrete core samples taken from a loading dock were used in determining the toxicity of concrete to Daphnia magna . The cores were ground to...powder and analyzed for volatiles and chemical agents before being subjected to aquatic toxicology studies using Daphnia magna . Particle size, pH, and

  1. A DAPHNIA MAGNA SHORT-TERM SURVIVAL AND GROWTH TEST

    EPA Science Inventory

    With the change in acceptable test temperatures for invertebrate toxicity tests from <20oC to 25oC, it is now possible to use Daphnia magna for short-term chronic testing. When cultured at 25oC the dry weight of <24 hr old D. magna ranges from 7 to 15 g depending upon nutrition,...

  2. Advanced fingerprint verification software

    NASA Astrophysics Data System (ADS)

    Baradarani, A.; Taylor, J. R. B.; Severin, F.; Maev, R. Gr.

    2016-05-01

    We have developed a fingerprint software package that can be used in a wide range of applications from law enforcement to public and private security systems, and to personal devices such as laptops, vehicles, and door- locks. The software and processing units are a unique implementation of new and sophisticated algorithms that compete with the current best systems in the world. Development of the software package has been in line with the third generation of our ultrasonic fingerprinting machine1. Solid and robust performance is achieved in the presence of misplaced and low quality fingerprints.

  3. Longitudinal study of fingerprint recognition.

    PubMed

    Yoon, Soweon; Jain, Anil K

    2015-07-14

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject's age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis.

  4. Longitudinal study of fingerprint recognition

    PubMed Central

    Yoon, Soweon; Jain, Anil K.

    2015-01-01

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject’s age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis. PMID:26124106

  5. Altered fingerprints: analysis and detection.

    PubMed

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K

    2012-03-01

    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem.

  6. Expertise in fingerprint identification.

    PubMed

    Thompson, Matthew B; Tangen, Jason M; McCarthy, Duncan J

    2013-11-01

    Although fingerprint experts have presented evidence in criminal courts for more than a century, there have been few scientific investigations of the human capacity to discriminate these patterns. A recent latent print matching experiment shows that qualified, court-practicing fingerprint experts are exceedingly accurate (and more conservative) compared with novices, but they do make errors. Here, a rationale for the design of this experiment is provided. We argue that fidelity, generalizability, and control must be balanced to answer important research questions; that the proficiency and competence of fingerprint examiners are best determined when experiments include highly similar print pairs, in a signal detection paradigm, where the ground truth is known; and that inferring from this experiment the statement "The error rate of fingerprint identification is 0.68%" would be unjustified. In closing, the ramifications of these findings for the future psychological study of forensic expertise and the implications for expert testimony and public policy are considered.

  7. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  8. Online fingerprint verification.

    PubMed

    Upendra, K; Singh, S; Kumar, V; Verma, H K

    2007-01-01

    As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications.

  9. Fingerprinting of music scores

    NASA Astrophysics Data System (ADS)

    Irons, Jonathan; Schmucker, Martin

    2004-06-01

    Publishers of sheet music are generally reluctant in distributing their content via the Internet. Although online sheet music distribution's advantages are numerous the potential risk of Intellectual Property Rights (IPR) infringement, e.g. illegal online distributions, disables any innovation propensity. While active protection techniques only deter external risk factors, additional technology is necessary to adequately treat further risk factors. For several media types including music scores watermarking technology has been developed, which ebeds information in data by suitable data modifications. Furthermore, fingerprinting or perceptual hasing methods have been developed and are being applied especially for audio. These methods allow the identification of content without prior modifications. In this article we motivate the development of watermarking and fingerprinting technologies for sheet music. Outgoing from potential limitations of watermarking methods we explain why fingerprinting methods are important for sheet music and address potential applications. Finally we introduce a condept for fingerprinting of sheet music.

  10. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  11. Toxicity of the cyanobacterium Cylindrospermopsis raciborskii to Daphnia magna.

    PubMed

    Nogueira, Isabel C G; Saker, Martin L; Pflugmacher, Stephan; Wiegand, Claudia; Vasconcelos, Vítor M

    2004-10-01

    The effect of two strains of Cylindrospermopsis raciborskii on the survivorship, somatic growth, and detoxification processes of juvenile Daphnia magna were investigated. Both strains of C. raciborskii (and also Ankistrodesmus falcatus, used as the control) were given to newborn D. magna at equivalent biovolumes. The survival curves for D. magna subjected to the two C. raciborskii treatments differed from those of the starved and fed treatments. After 48 h of exposure, the percentage of D. magna surviving after exposure to Cylin-A (a cylindrospermopsin-producing strain isolated from Australia) and Cylin-P (a non-cylindrospermopsin-producing strain isolated from Portugal) was 10.00% and 93.33%, respectively. The strain that produces cylindrospermopsin caused the greatest toxic effect in juvenile D. magna. Statistically significant differences in D. magna body size between the four treatments (Cylin-A, Cylin-P, A. falcatus, and starved) were detected after 48 h of exposure. The juvenile D. magna that received the two C. raciborskii treatments showed an increase in size (relative to their size at T(0)) of 2.54% and 38.14%, respectively. These values were statistically significantly different than those of the A. falcatus-fed control (55.54%) and the starved control (11.47%). In both C. raciborskii treatments there was a tendency for increased GST enzyme activities after 24 h of exposure. Cylindrospermopsin was detected (HPLC-MS/MS) in D. magna tissues after 24 and 48 h (0.025 and 0.02 ng animal(-)1, respectively). The results of this study indicate that C. raciborskii can affect the fitness and growth potential of juvenile D. magna. Copyright 2004 Wiley Periodicals, Inc.

  12. Small scale mass culture of Daphnia magna Straus

    SciTech Connect

    Rees, J.T.; Oldfather, J.M.

    1980-02-01

    Daphnia magna Straus 1820 was raised on a defined medium in 4-liter flasks with controlled light intensity, temperature, and algal food species. Adult D. magna tolerated high levels of ammonia (up to 108 ..mu..M) at high pH (> 10), although at these levels parthenogenic reproduction may be inhibited. Scenedesmus quadricauda and Ankistrodesmus sp. were satisfactory food sources, and by utilizing Ankistrodesmus densities greater than one animal per ml were achieved. Maintaining the pH at about 7 to 8 seems to be important for successful D. magna culture.

  13. Ligand-, structure- and pharmacophore-based molecular fingerprints: a case study on adenosine A1, A2A, A2B, and A3 receptor antagonists

    NASA Astrophysics Data System (ADS)

    Sirci, Francesco; Goracci, Laura; Rodríguez, David; van Muijlwijk-Koezen, Jacqueline; Gutiérrez-de-Terán, Hugo; Mannhold, Raimund

    2012-11-01

    FLAP fingerprints are applied in the ligand-, structure- and pharmacophore-based mode in a case study on antagonists of all four adenosine receptor (AR) subtypes. Structurally diverse antagonist collections with respect to the different ARs were constructed by including binding data to human species only. FLAP models well discriminate "active" (=highly potent) from "inactive" (=weakly potent) AR antagonists, as indicated by enrichment curves, numbers of false positives, and AUC values. For all FLAP modes, model predictivity slightly decreases as follows: A2BR > A2AR > A3R > A1R antagonists. General performance of FLAP modes in this study is: ligand- > structure- > pharmacophore- based mode. We also compared the FLAP performance with other common ligand- and structure-based fingerprints. Concerning the ligand-based mode, FLAP model performance is superior to ECFP4 and ROCS for all AR subtypes. Although focusing on the early first part of the A2A, A2B and A3 enrichment curves, ECFP4 and ROCS still retain a satisfactory retrieval of actives. FLAP is also superior when comparing the structure-based mode with PLANTS and GOLD. In this study we applied for the first time the novel FLAPPharm tool for pharmacophore generation. Pharmacophore hypotheses, generated with this tool, convincingly match with formerly published data. Finally, we could demonstrate the capability of FLAP models to uncover selectivity aspects although single AR subtype models were not trained for this purpose.

  14. Perspective automated inkless fingerprinting imaging software for fingerprint research.

    PubMed

    Nanakorn, Somsong; Poosankam, Pongsakorn; Mongconthawornchai, Paiboon

    2008-01-01

    Fingerprint collection using ink-and-paper image is a conventional method i.e. an ink-print, transparent-adhesive tape techniques which are slower and cumbersome. This is a pilot research for software development aimed at imaging an automated, inkless fingerprint using a fingerprint sensor, a development kit of the IT WORKS Company Limited, PC camera, and printer The development of software was performed to connect with the fingerprint sensor for collection of fingerprint images and recorded into a hard disk. It was also developed to connect with the PC camera for recording a face image of persons' fingerprints or identification card images. These images had been appropriately arranged in a PDF file prior to printing. This software is able to scan ten fingerprints and store high-quality electronics fingertip images with rapid, large, and clear images without dirt of ink or carbon. This fingerprint technology is helpful in a potential application in public health and clinical medicine research.

  15. Mathematical correction for fingerprint similarity measures to improve chemical retrieval.

    PubMed

    Swamidass, S Joshua; Baldi, Pierre

    2007-01-01

    In many modern chemoinformatics systems, molecules are represented by long binary fingerprint vectors recording the presence or absence of particular features or substructures, such as labeled paths or trees, in the molecular graphs. These long fingerprints are often compressed to much shorter fingerprints using a simple modulo operation. As the length of the fingerprints decreases, their typical density and overlap tend to increase, and so does any similarity measure based on overlap, such as the widely used Tanimoto similarity. Here we show that this correlation between shorter fingerprints and higher similarity can be thought of as a systematic error introduced by the fingerprint folding algorithm and that this systematic error can be corrected mathematically. More precisely, given two molecules and their compressed fingerprints of a given length, we show how a better estimate of their uncompressed overlap, hence of their similarity, can be derived to correct for this bias. We show how the correction can be implemented not only for the Tanimoto measure but also for all other commonly used measures. Experiments on various data sets and fingerprint sizes demonstrate how, with a negligible computational overhead, the correction noticeably improves the sensitivity and specificity of chemical retrieval.

  16. Effects of acid precipitation on Daphnia magna

    SciTech Connect

    Parent, S.; Cheetham, R.D.

    1980-08-01

    Pollutants derived from fossil fuel combustion and precipitated from the atmosphere have substantially increased in the past decades. These materials, precipitated in such industrialized areas as southeastern Canada, have caused considerable alterations in aquatic ecosystems. Precipitation over most of the eastern United States is presently 10 to 500 times more acidic than is natural. Most affected aquatic ecosystems contain oligotrophic waters in regions of thin poorly buffered soils. Zooplankton are an important link in food chains of aquatic ecosystems and their disappearance or decline could drastically affect trophic relationships. Declines in zooplankton density in response to acid precipitation have been reported and short term survival of Daphnia pulex between pH 4.3 and 10.4; however, its potential for reproduction was limited to a fairly narrow range. Anderson (1944) noted the advantages of using daphnia as test organisms, and concluded that Daphnia magna was representative of other abundant zooplankton in sensitivity to toxic substances.

  17. An Introduction to DNA Fingerprinting.

    ERIC Educational Resources Information Center

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  18. An Introduction to DNA Fingerprinting.

    ERIC Educational Resources Information Center

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  19. Fingerprinting with Wow

    NASA Astrophysics Data System (ADS)

    Yu, Eugene; Craver, Scott

    2006-02-01

    Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

  20. Evolutionary Fingerprinting of Genes

    PubMed Central

    Kosakovsky Pond, Sergei L.; Scheffler, Konrad; Gravenor, Michael B.; Poon, Art F.Y.; Frost, Simon D.W.

    2010-01-01

    Over time, natural selection molds every gene into a unique mosaic of sites evolving rapidly or resisting change—an “evolutionary fingerprint” of the gene. Aspects of this evolutionary fingerprint, such as the site-specific ratio of nonsynonymous to synonymous substitution rates (dN/dS), are commonly used to identify genetic features of potential biological interest; however, no framework exists for comparing evolutionary fingerprints between genes. We hypothesize that protein-coding genes with similar protein structure and/or function tend to have similar evolutionary fingerprints and that comparing evolutionary fingerprints can be useful for discovering similarities between genes in a way that is analogous to, but independent of, discovery of similarity via sequence-based comparison tools such as Blast. To test this hypothesis, we develop a novel model of coding sequence evolution that uses a general bivariate discrete parameterization of the evolutionary rates. We show that this approach provides a better fit to the data using a smaller number of parameters than existing models. Next, we use the model to represent evolutionary fingerprints as probability distributions and present a methodology for comparing these distributions in a way that is robust against variations in data set size and divergence. Finally, using sequences of three rapidly evolving RNA viruses (HIV-1, hepatitis C virus, and influenza A virus), we demonstrate that genes within the same functional group tend to have similar evolutionary fingerprints. Our framework provides a sound statistical foundation for efficient inference and comparison of evolutionary rate patterns in arbitrary collections of gene alignments, clustering homologous and nonhomologous genes, and investigation of biological and functional correlates of evolutionary rates. PMID:19864470

  1. Metabolite fingerprinting in transgenic lettuce.

    PubMed

    Garratt, Lee C; Linforth, Robert; Taylor, Andrew J; Lowe, Kenneth C; Power, J Brian; Davey, Michael R

    2005-03-01

    Metabolite fingerprinting has been achieved using direct atmospheric pressure chemical ionization-mass spectrometry (APCI-MS) and linked gas chromatography (GC-APCI/EI-MS) for transgenic lettuce (Lactuca sativa L. cv. Evola) plants expressing an IPT gene under the control of the senescence-specific SAG12 promoter from Arabidopsis thaliana (P(SAG12)-IPT). Mature heads of transgenic lettuce and their azygous controls were maintained under defined conditions to assess their shelf life. Transgenic lettuce plants exhibited delayed senescence and significant increases (up to a maximum of threefold) in the concentrations of three volatile organic compounds (VOCs), corresponding to molecular masses of 45, 47 and 63, when compared with heads from azygous plants. These VOCs were identified as acetaldehyde (45), ethanol (47) and dimethyl sulphide (63). The increase in dimethyl sulphide was paralleled by an accumulation of reactive oxygen species (ROS) in the heads of transgenic plants. These results demonstrate the applicability of metabolic fingerprinting techniques to elucidate the underlying pleiotropic responses of plants to transgene expression.

  2. Multixenobiotic resistance efflux activity in Daphnia magna and Lumbriculus variegatus.

    PubMed

    Vehniäinen, Eeva-Riikka; Kukkonen, Jussi V K

    2015-04-01

    Multixenobiotic resistance is a phenomenon in which ATP-binding cassette (ABC) family proteins transfer harmful compounds out of cells. Daphnia magna and Lumbriculus variegatus are model species in aquatic ecotoxicology, but the presence and activity of ABC proteins have not been well described in these species. The aim of this work was to study the presence, activity, and inhibition of ABC transport proteins in D. magna and L. variegatus. The presence of abcb1 and abcc transcripts in 8-9-day-old D. magna was investigated by qRT-PCR. The activity of MXR in D. magna and L. variegatus was explored by influx of the fluorescent ABC protein substrates rhodamine B and calcein-AM, with and without the model inhibitors verapamil (unspecific ABC inhibitor), reversin 205 (ABCB1 inhibitor) and MK571 (ABCC inhibitor). Juvenile D. magna possessed all examined abcb and abcc transcripts, but only reversin 205 inhibited MXR activity. The MXR activity in L. variegatus was inhibited by MK571, and to a lesser extent by verapamil, whereas reversin 205 seemed to stimulate the transport activity. Whereas calcein-AM worked better as an MXR substrate in D. magna, rhodamine B was a better substrate for L. variegatus MXR activity measurements. This is the first report on MXR activity in the order Lumbriculida, subclass Oligochaeta, and class Clitellata.

  3. Predicting the Metabolic Sites by Flavin-Containing Monooxygenase on Drug Molecules Using SVM Classification on Computed Quantum Mechanics and Circular Fingerprints Molecular Descriptors

    PubMed Central

    Fu, Chien-wei; Lin, Thy-Hou

    2017-01-01

    As an important enzyme in Phase I drug metabolism, the flavin-containing monooxygenase (FMO) also metabolizes some xenobiotics with soft nucleophiles. The site of metabolism (SOM) on a molecule is the site where the metabolic reaction is exerted by an enzyme. Accurate prediction of SOMs on drug molecules will assist the search for drug leads during the optimization process. Here, some quantum mechanics features such as the condensed Fukui function and attributes from circular fingerprints (called Molprint2D) are computed and classified using the support vector machine (SVM) for predicting some potential SOMs on a series of drugs that can be metabolized by FMO enzymes. The condensed Fukui function fA− representing the nucleophilicity of central atom A and the attributes from circular fingerprints accounting the influence of neighbors on the central atom. The total number of FMO substrates and non-substrates collected in the study is 85 and they are equally divided into the training and test sets with each carrying roughly the same number of potential SOMs. However, only N-oxidation and S-oxidation features were considered in the prediction since the available C-oxidation data was scarce. In the training process, the LibSVM package of WEKA package and the option of 10-fold cross validation are employed. The prediction performance on the test set evaluated by accuracy, Matthews correlation coefficient and area under ROC curve computed are 0.829, 0.659, and 0.877 respectively. This work reveals that the SVM model built can accurately predict the potential SOMs for drug molecules that are metabolizable by the FMO enzymes. PMID:28072829

  4. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    PubMed

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  5. Predicting the Metabolic Sites by Flavin-Containing Monooxygenase on Drug Molecules Using SVM Classification on Computed Quantum Mechanics and Circular Fingerprints Molecular Descriptors.

    PubMed

    Fu, Chien-Wei; Lin, Thy-Hou

    2017-01-01

    As an important enzyme in Phase I drug metabolism, the flavin-containing monooxygenase (FMO) also metabolizes some xenobiotics with soft nucleophiles. The site of metabolism (SOM) on a molecule is the site where the metabolic reaction is exerted by an enzyme. Accurate prediction of SOMs on drug molecules will assist the search for drug leads during the optimization process. Here, some quantum mechanics features such as the condensed Fukui function and attributes from circular fingerprints (called Molprint2D) are computed and classified using the support vector machine (SVM) for predicting some potential SOMs on a series of drugs that can be metabolized by FMO enzymes. The condensed Fukui function fA- representing the nucleophilicity of central atom A and the attributes from circular fingerprints accounting the influence of neighbors on the central atom. The total number of FMO substrates and non-substrates collected in the study is 85 and they are equally divided into the training and test sets with each carrying roughly the same number of potential SOMs. However, only N-oxidation and S-oxidation features were considered in the prediction since the available C-oxidation data was scarce. In the training process, the LibSVM package of WEKA package and the option of 10-fold cross validation are employed. The prediction performance on the test set evaluated by accuracy, Matthews correlation coefficient and area under ROC curve computed are 0.829, 0.659, and 0.877 respectively. This work reveals that the SVM model built can accurately predict the potential SOMs for drug molecules that are metabolizable by the FMO enzymes.

  6. Sequence analysis of ribosomal and mitochondrial genes of the giant liver fluke Fascioloides magna (Trematoda: Fasciolidae): intraspecific variation and differentiation from Fasciola hepatica.

    PubMed

    Králová-Hromadová, Ivica; Spakulová, Marta; Horácková, Eva; Turceková, Ludmila; Novobilský, Adam; Beck, Relja; Koudela, Bretislav; Marinculić, Albert; Rajský, Dusan; Pybus, Margo

    2008-02-01

    Complete sequences of ribosomal and mitochondrial genes of the giant liver fluke Fascioloides magna are presented. In particular, small subunit (18S) and internal transcribed spacers (ITS1 and ITS2) of the ribosomal gene (rDNA), as well as cytochrome c oxidase subunit I (cox1) and nicotinamide dehydrogenase subunit I (nad1) of the mitochondrial DNA (mtDNA), were analyzed. The 18S and ITS sequences were compared with previously published sequences of the liver fluke Fasciola hepatica. Fixed interspecific genetic differences were determined that allow molecular differentiation of F. magna and F. hepatica using either the PCR-RFLP method or PCR amplification of species-specific DNA regions. Additionally, intraspecific sequence polymorphism of the complete cox1 and nad1 mitochondrial genes in geographically distinct F. magna populations was determined. Based on the sequence divergences, short (< 500 bp) variable regions suitable for broader biogeographical studies of giant liver fluke were designed.

  7. Historeceptomic Fingerprints for Drug-Like Compounds

    PubMed Central

    Shmelkov, Evgeny; Grigoryan, Arsen; Swetnam, James; Xin, Junyang; Tivon, Doreen; Shmelkov, Sergey V.; Cardozo, Timothy

    2015-01-01

    Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology). The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300,000 experimentally determined bioactivity values from the ChEMBL database and 4.2 billion molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics) scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic, in vivo picture of the mechanism of any drug's action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at drugable.org for access through a user-friendly web site. PMID:26733872

  8. Historeceptomic Fingerprints for Drug-Like Compounds.

    PubMed

    Shmelkov, Evgeny; Grigoryan, Arsen; Swetnam, James; Xin, Junyang; Tivon, Doreen; Shmelkov, Sergey V; Cardozo, Timothy

    2015-01-01

    Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology). The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300,000 experimentally determined bioactivity values from the ChEMBL database and 4.2 billion molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics) scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic, in vivo picture of the mechanism of any drug's action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at drugable.org for access through a user-friendly web site.

  9. Bioaccumulation and uptake routes of perfluoroalkyl acids in Daphnia magna.

    PubMed

    Dai, Zhineng; Xia, Xinghui; Guo, Jia; Jiang, Xiaoman

    2013-02-01

    Perfluoroalkyl acids (PFAs), one kind of emerging contaminants, have attracted great attentions in recent years. However, the study about their bioaccumulation mechanism remains scarce. In this research, the bioaccumulation of six kinds of PFAs in water flea Daphnia magna was studied. The uptake rates of PFAs in D. magna ranged from 178 to 1338 L kg(-1) d(-1), and they increased with increasing perfluoroalkyl chain length; the elimination rates ranged from 0.98 to 2.82 d(-1). The bioaccumulation factors (BAFs) of PFAs ranged from 91 to 380 L kg(-1) in wet weight after 25 d exposure; they increased with increasing perfluoroalkyl chain length and had a significant positive correlation with the n-octanol/water partition coefficients (logK(ow)) of PFAs (p<0.05). This indicated that the hydrophobicity of PFAs plays an important role in their bioaccumulation. The BAFs almost kept constant when the PFA concentrations in aqueous phase increased from 1 to 10 μg L(-1). Scenedesmus subspicatus, as the food of D. magna, did not significantly affect the bioaccumulation of PFAs by D. magna. Furthermore, the body burden of PFAs in the dead D. magna was 1.08-2.52 times higher than that in the living ones, inferring that the body surface sorption is a main uptake route of PFAs in D. magna. This study suggested that the bioaccumulation of PFAs in D. magna is mainly controlled by their partition between organisms and water; further research should be conducted to study the intrinsic mechanisms, especially the roles of protein and lipid in organisms.

  10. DNA-based molecular fingerprinting of eukaryotic protists and cyanobacteria contributing to sinking particle flux at the Bermuda Atlantic time-series study

    NASA Astrophysics Data System (ADS)

    Amacher, Jessica; Neuer, Susanne; Lomas, Michael

    2013-09-01

    We used denaturing gradient gel electrophoresis (DGGE) to examine the protist and cyanobacterial communities in the euphotic zone (0-120 m) and in corresponding 150 m particle interceptor traps at the Bermuda Atlantic Time-series Study (BATS) in a two-year monthly time-series from May 2008 to April 2010. Dinoflagellates were the most commonly detected taxa in both water column and trap samples throughout the time series. Diatom sequences were found only eight times in the water column, and only four times in trap material. Small-sized eukaryotic taxa, including the prasinophyte genera Ostreococcus, Micromonas, and Bathycoccus, were present in trap samples, as were the cyanobacteria Prochlorococcus and Synechococcus. Synechococcus was usually overrepresented in trap material, whereas Prochlorococcus was underrepresented compared to the water column. Both seasonal and temporal variability affected patterns of ribosomal DNA found in sediment traps. The two years of this study were quite different hydrographically, with higher storm activity and the passing of a cyclonic eddy causing unusually deep mixing in winter 2010. This was reflected in the DGGE fingerprints of the water column, which showed greater phylotype richness of eukaryotes and a lesser richness of cyanobacteria in winter of 2010 compared with the winter of 2009. Increases in eukaryotic richness could be traced to increased diversity of prasinophytes and prymnesiophytes. The decrease in cyanobacterial richness was in turn reflected in the trap composition, but the increase in eukaryotes was not, indicating a disproportionate contribution of certain taxa to sinking particle flux.

  11. Complete Genome Sequence of Finegoldia magna, an Anaerobic Opportunistic Pathogen

    PubMed Central

    Goto, Takatsugu; Yamashita, Atsushi; Hirakawa, Hideki; Matsutani, Minenosuke; Todo, Kozo; Ohshima, Kenshiro; Toh, Hidehiro; Miyamoto, Kazuaki; Kuhara, Satoru; Hattori, Masahira; Shimizu, Tohru; Akimoto, Shigeru

    2008-01-01

    Finegoldia magna (formerly Peptostreptococcus magnus), a member of the Gram-positive anaerobic cocci (GPAC), is a commensal bacterium colonizing human skin and mucous membranes. Moreover, it is also recognized as an opportunistic pathogen responsible for various infectious diseases. Here, we report the complete genome sequence of F. magna ATCC 29328. The genome consists of a 1 797 577 bp circular chromosome and an 189 163 bp plasmid (pPEP1). The metabolic maps constructed based on the genome information confirmed that most F. magna strains cannot ferment most sugars, except fructose, and have various aminopeptidase activities. Three homologs of albumin-binding protein, a known virulence factor useful for antiphagocytosis, are encoded on the chromosome, and one albumin-binding protein homolog is encoded on the plasmid. A unique feature of the genome is that F. magna encodes many sortase genes, of which substrates may be involved in bacterial pathogenesis, such as antiphagocytosis and adherence to the host cell. The plasmid pPEP1 encodes seven sortase and seven substrate genes, whereas the chromosome encodes four sortase and 19 substrate genes. These plasmid-encoded sortases may play important roles in the pathogenesis of F. magna by enriching the variety of cell wall anchored surface proteins. PMID:18263572

  12. Evaluation of Daphnia Magna Neonate Viability under Low Temperature Exposure Conditions

    DTIC Science & Technology

    2007-01-25

    code) Evaluation of Daphnia magna Neonate Viability under Low Temperature Exposure Conditions Prepared For: United States Army...LIST OF ATTACHMENTS ATTACHMENT I DAPHNIA MAGNA 21-DAY REPRODUCTION TEST DATA – FIRST SERIES (JULY 28, 2006 - AUGUST 18, 2006...I ATTACHMENT II DAPHNIA MAGNA 21-DAY REPRODUCTION TEST DATA – SECOND SERIES (SEPTEMBER 19, 2006 - OCTOBER 21, 2006) ....II

  13. Sucralose Induces Biochemical Responses in Daphnia magna

    PubMed Central

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena

    2014-01-01

    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001–5 mg L−1). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology. PMID:24699280

  14. Sucralose induces biochemical responses in Daphnia magna.

    PubMed

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena

    2014-01-01

    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001-5 mg L(-1)). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology.

  15. Development of a Daphnia magna DNA microarray for evaluating the toxicity of environmental chemicals.

    PubMed

    Watanabe, Hajime; Takahashi, Eri; Nakamura, Yuko; Oda, Shigeto; Tatarazako, Norihisa; Iguchi, Taisen

    2007-04-01

    Toxic chemical contaminants have a variety of detrimental effects on various species, and the impact of pollutants on ecosystems has become an urgent issue. However, the majority of studies regarding the effects of chemical contaminants have focused on vertebrates. Among aquatic organisms, Daphnia magna has been used extensively to evaluate organism- and population-level responses of invertebrates to pollutants in acute toxicity or reproductive toxicity tests. Although these types of tests can provide information concerning hazardous concentrations of chemicals, they provide no information about their mode of action. Recent advances in molecular genetic techniques have provided tools to better understand the responses of aquatic organisms to pollutants. In the present study, we adapted some of the techniques of molecular genetics to develop new tools, which form the basis for an ecotoxicogenomic assessment of D. magna. Based on a Daphnia expressed sequence tag database, we developed an oligonucleotide-based DNA microarray with high reproducibility. The DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to several different chemicals: Copper sulfate, hydrogen peroxide, pentachlorophenol, or beta-naphthoflavone. Exposure to these chemicals resulted in characteristic patterns of gene expression that were chemical-specific, indicating that the Daphnia DNA microarray can be used for classification of toxic chemicals and for development of a mechanistic understanding of chemical toxicity on a common freshwater organism.

  16. Application of DNA fingerprinting in medicolegal practice.

    PubMed

    Raina, Anupuma; Dogra, T D

    2002-12-01

    Fingerprinting is thought to establish the identify of an individual in forensic cases. The technique is extensively used for forensic purposes. Deoxyribonucleic acid (DNA) is the vehicle of generational transference of heritable unit. While arching markers for genetic disease professor Alec Jeffreys discovered that certain regions of DNA showed variations in the number of tandem repeats known as variable number of tandem repeats (VNTRs). Thus DNA fingerprint was named by observing the number of repeated sequences which differ from individual to individual. The structure of DNA is quite flexible, within the nucleus of each cell resides an identical copy of the individual's genetic material, DNA. The coding regions of the genomic DNA are known as genes. The DNA fingerprinting in forensic science has generated considerable excitement in the criminal justice community. DNA fingerprinting can be applied to identify an individual in criminal and civil cases. Polymerase chain reaction has revolutionised molecular biology it has an ability to amplify (usually fewer than 3000 bp) a particular sequence of DNA into million of copies in a very short period. Consequently only a very tiny amount of an organism's DNA needs to be available originally. This property of polymerase chain reaction has enabled to analyse many forensic samples particularly which are degraded. Microsatellite DNA or commonly as short tandem repeats are scattered throughout the human genome and occur on an average of every 10,000 nucleotides. Microsatellite markers are considered to be the most powerful genetic markers. Collection, preservation and handling are the integral part of DNA fingerprinting analysis. There are various methods to isolate DNA from different biological materials but presently most of the laboratories prefer using FTA paper. The age of humans can be estimated by using DNA based on telomere shortening.

  17. Distribution of Virulence Factors and Molecular Fingerprinting of Aeromonas Species Isolates from Water and Clinical Samples: Suggestive Evidence of Water-to-Human Transmission ▿ †

    PubMed Central

    Khajanchi, Bijay K.; Fadl, Amin A.; Borchardt, Mark A.; Berg, Richard L.; Horneman, Amy J.; Stemper, Mary E.; Joseph, Sam W.; Moyer, Nelson P.; Sha, Jian; Chopra, Ashok K.

    2010-01-01

    A total of 227 isolates of Aeromonas obtained from different geographical locations in the United States and different parts of the world, including 28 reference strains, were analyzed to determine the presence of various virulence factors. These isolates were also fingerprinted using biochemical identification and pulse-field gel electrophoresis (PFGE). Of these 227 isolates, 199 that were collected from water and clinical samples belonged to three major groups or complexes, namely, the A. hydrophila group, the A. caviae-A. media group, and the A. veronii-A. sobria group, based on biochemical profiles, and they had various pulsotypes. When virulence factor activities were examined, Aeromonas isolates obtained from clinical sources had higher cytotoxic activities than isolates obtained from water sources for all three Aeromonas species groups. Likewise, the production of quorum-sensing signaling molecules, such as N-acyl homoserine lactone, was greater in clinical isolates than in isolates from water for the A. caviae-A. media and A. hydrophila groups. Based on colony blot DNA hybridization, the heat-labile cytotonic enterotoxin gene and the DNA adenosine methyltransferase gene were more prevalent in clinical isolates than in water isolates for all three Aeromonas groups. Using colony blot DNA hybridization and PFGE, we obtained three sets of water and clinical isolates that had the same virulence signature and had indistinguishable PFGE patterns. In addition, all of these isolates belonged to the A. caviae-A. media group. The findings of the present study provide the first suggestive evidence of successful colonization and infection by particular strains of certain Aeromonas species after transmission from water to humans. PMID:20154106

  18. Fingerprinting of Materials

    NASA Technical Reports Server (NTRS)

    Workman, Gary L

    1992-01-01

    Recent issues emerging in our fiscal and ecological environments have promulgated that federal agencies shall promote activities which respond to the improvement of both. In response to these developments, the National Aeronautics and Space Administration (NASA) has undertaken an innovative approach to improve the control of materials used in all NASA manufacturing activities. In concert with this goal, NASA is requiring that its contractors and their sub-contractors perform a more intensive consolidation of technologies that can provide an accounting of materials, which includes in-coming materials, materials in process, end-products and waste materials. The purpose of this handbook is to provide guidelines to NASA and its contractor personnel for the planning and implementation of chemical fingerprinting programs and to illustrate the chemical and statistical fundamentals needed for successful use of chemical fingerprinting.

  19. Quantifying the fingerprint descriptor dependence of structure-activity relationship information on a large scale.

    PubMed

    Dimova, Dilyana; Stumpfe, Dagmar; Bajorath, Jürgen

    2013-09-23

    It is well-known that different molecular representations, e.g., graphs, numerical descriptors, fingerprints, or 3D models, change the numerical results of molecular similarity calculations. Because the assessment of structure-activity relationships (SARs) requires similarity and potency comparisons of active compounds, this representation dependence inevitably also affects SAR analysis. But to what extent? How exactly does SAR information change when alternative fingerprints are used as descriptors? What is the proportion of active compounds with substantial changes in SAR information induced by different fingerprints? To provide answers to these questions, we have quantified changes in SAR information across many different compound classes using six different fingerprints. SAR profiling was carried out on 128 target-based data sets comprising more than 60,000 compounds with high-confidence activity annotations. A numerical measure of SAR discontinuity was applied to assess SAR information on a per compound basis. For ~70% of all test compounds, changes in SAR characteristics were detected when different fingerprints were used as molecular representations. Moreover, the SAR phenotype of ~30% of the compounds changed, and distinct fingerprint-dependent local SAR environments were detected. The fingerprints we compared were found to generate SAR models that were essentially not comparable. Atom environment and pharmacophore fingerprints produced the largest differences in compound-associated SAR information. Taken together, the results of our systematic analysis reveal larger fingerprint-dependent changes in compound-associated SAR information than would have been anticipated.

  20. Fingerprints in the Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1

    This graph, or spectrum, shows the light from a dusty, distant galaxy located 11 billion light-years away. The galaxy is invisible to optical telescopes, but NASA's Spitzer Space Telescope was able to capture the light from it and dozens of other similar galaxies using heat-seeking infrared eyes.

    Spectra are created when an instrument called a spectrograph spreads light out into its basic parts, like a prism turning sunlight into a rainbow. They contain the signatures, or 'fingerprints,' of molecules that contribute to an object's light.

    In this case, the galaxy's spectrum reveals the fingerprint for silicate dust (large dip at right), a planetary building block like sand, only smaller. This particular fingerprint is important because it helped astronomers determine how far away the galaxy lies, or more specifically, how much the galaxy's light had stretched, or 'redshifted,' during its journey to Spitzer's eyes. Because the universe is expanding, a galaxy's light will shift toward reddish wavelengths as it moves away from us. This galaxy was found to have a redshift of 1.95, which means that its light took about 11 billion years to get here.

    The presence of the silicate fingerprint is also significant because it implies that galaxies were ripe for planetary formation 11 billion years ago - back to a time when the universe was 3 billion years old. The universe is currently believed to be 13.5 billion years old. This is the furthest back in time that silicate dust has been detected around a galaxy.

    These data were taken by Spitzer's infrared spectrograph in July, 2004.

  1. Fingerprints in the Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1

    This graph, or spectrum, shows the light from a dusty, distant galaxy located 11 billion light-years away. The galaxy is invisible to optical telescopes, but NASA's Spitzer Space Telescope was able to capture the light from it and dozens of other similar galaxies using heat-seeking infrared eyes.

    Spectra are created when an instrument called a spectrograph spreads light out into its basic parts, like a prism turning sunlight into a rainbow. They contain the signatures, or 'fingerprints,' of molecules that contribute to an object's light.

    In this case, the galaxy's spectrum reveals the fingerprint for silicate dust (large dip at right), a planetary building block like sand, only smaller. This particular fingerprint is important because it helped astronomers determine how far away the galaxy lies, or more specifically, how much the galaxy's light had stretched, or 'redshifted,' during its journey to Spitzer's eyes. Because the universe is expanding, a galaxy's light will shift toward reddish wavelengths as it moves away from us. This galaxy was found to have a redshift of 1.95, which means that its light took about 11 billion years to get here.

    The presence of the silicate fingerprint is also significant because it implies that galaxies were ripe for planetary formation 11 billion years ago - back to a time when the universe was 3 billion years old. The universe is currently believed to be 13.5 billion years old. This is the furthest back in time that silicate dust has been detected around a galaxy.

    These data were taken by Spitzer's infrared spectrograph in July, 2004.

  2. Filtered circular fingerprints improve either prediction or runtime performance while retaining interpretability.

    PubMed

    Gütlein, Martin; Kramer, Stefan

    2016-01-01

    Even though circular fingerprints have been first introduced more than 50 years ago, they are still widely used for building highly predictive, state-of-the-art (Q)SAR models. Historically, these structural fragments were designed to search large molecular databases. Hence, to derive a compact representation, circular fingerprint fragments are often folded to comparatively short bit-strings. However, folding fingerprints introduces bit collisions, and therefore adds noise to the encoded structural information and removes its interpretability. Both representations, folded as well as unprocessed fingerprints, are often used for (Q)SAR modeling. We show that it can be preferable to build (Q)SAR models with circular fingerprint fragments that have been filtered by supervised feature selection, instead of applying folded or all fragments. Compared to folded fingerprints, filtered fingerprints significantly increase predictive performance and remain unambiguous and interpretable. Compared to unprocessed fingerprints, filtered fingerprints reduce the computational effort and are a more compact and less redundant feature representation. Depending on the selected learning algorithm filtering yields about equally predictive (Q)SAR models. We demonstrate the suitability of filtered fingerprints for (Q)SAR modeling by presenting our freely available web service Collision-free Filtered Circular Fingerprints that provides rationales for predictions by highlighting important structural features in the query compound (see http://coffer.informatik.uni-mainz.de). Circular fingerprints are potent structural features that yield highly predictive models and encode interpretable structural information. However, to not lose interpretability, circular fingerprints should not be folded when building prediction models. Our experiments show that filtering is a suitable option to reduce the high computational effort when working with all fingerprint fragments. Additionally, our experiments

  3. Medical-biological aspects of radiation effects in Daphnia magna

    NASA Astrophysics Data System (ADS)

    Sarapultseva, E.; Uskalova, D.; Savina, N.; Ustenko, K.

    2017-01-01

    We have shown that γ-irradiation at doses of 100 and 1000 mGy significantly compromised fecundity and reproductive success of the directly exposed D. magna. These effects were also observed among the non-exposed first-generation progeny of irradiated parents, thus implying the manifestation of transgenerational effects in Daphnia. We have also shown that compromised viability of irradiated D. magna can be attributed cytotoxic effects of irradiation. It would therefore appear that the compromised viability may be attributed to the cytotoxic effects resulted from epigenetic changes affecting some metabolic pathways involved in detoxification of free-radicals. Additionally we have analyzed more distant progeny of irradiated at doses of 10, 100 and 1000 mGy Daphnia. Our data demonstrated that multicellular crustacean D. magna represent a very useful experimental model for analyse of long-term effects of ionising radiation at the organismal level.

  4. Fossa navicularis magna detection on cone-beam computed tomography

    PubMed Central

    Mupparapu, Mel

    2016-01-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed. PMID:27051639

  5. Antineoplastic agents. 553. The Texas grasshopper Brachystola magna.

    PubMed

    Pettit, George R; Meng, Yanhui; Herald, Delbert L; Knight, John C; Day, John F

    2005-08-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2), and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis), and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1-3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed.

  6. Antineoplastic Agents 553. The Texas Grasshopper Brachystola magna1

    PubMed Central

    Pettit, George R.; Meng, Yanhui; Herald, Delbert L.; Knight, John C.; Day, John F.

    2011-01-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) -guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2) and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis (a.k.a. Pancratium littorale Jacq) and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study a crystal of pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1–3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed. PMID:16124772

  7. SMALL SCALE MASS CULTURE OF DAPHNIA MAGNA STRAUS

    SciTech Connect

    Rees, John T.; Oldfather, Joan M.

    1980-03-01

    Daphnia magna Straus 1820 was reared on a defined medium in 4-liter flasks under controlled conditions of light, temperature and species of algal food. Adult D. magna were found to be tolerant to high levels of ammonia, up to 108 {micro}M, at high pH (>10), although parthenogenic reproduction may be inhibited at these high levels. Scenedesmus quadricauda and Ankistrodesmus sp. were found to be satisfactory food sources. Densities of greater than one animal per ml in culture were attained utilizing Ankistrodesmus sp. as a food source at a pH of 7.7. Maintenance of pH at around 7-8 appears to be important to successful D. magna culture.

  8. Probing with and into fingerprints.

    PubMed

    Dahiya, Ravinder S; Gori, Monica

    2010-07-01

    A recent report by Scheibert et al. highlights the role of fingerprints in enhancing tactile sensitivity. By scanning a surface with a biometric force sensor they demonstrate the dominance of the frequencies that fall within the optimal sensitivity range of Pacinian afferents. The sensor, in this study, has a soft cover patterned with parallel ridges-mimicking the fingerprints. However, the skin structure is quite complex. Elasticity of the skin varies with depth and the ridge like pattern is comprised of not just papillary ridges or fingerprints. Besides fingerprints there exist intermediate ridges, positioned exactly under the papillary ridges, and limiting ridges at dermis-epidermis junction. These structures are usually considered as single unit. If so, it is important to revisit and see if the role of fingerprints remains the same, should the sensor cover have both fingerprints and intermediate ridges.

  9. Petroleum fingerprinting with organic markers

    USGS Publications Warehouse

    Hostettler, Frances D.; Lorenson, T.D.; Bekins, Barbara A.

    2013-01-01

    Petroleum fingerprinting is an invaluable tool in forensic geochemistry. This article summarizes applications of fingerprinting in several oil spills and natural oil seepages that we have studied during the last 25 years. It shows how each unique chemical fingerprint can be used to correlate or differentiate oils. Fingerprints can provide information about processes in the environment that impact oils such as weathering and microbial degradation. They can be used to evaluate organic matter that contributed to oils, and classify oils with regard to the geological framework of their source, such as evaluating geological facies, age, lithology, and depositional environment.

  10. Fingerprinting of Materials: Technical Supplement

    NASA Technical Reports Server (NTRS)

    Workman, Gary L.

    1992-01-01

    This supplement to the Guidelines for Maintaining a Chemical Fingerprinting Program has been developed to assist NASA personnel, contractors, and sub-contractors in defining the technical aspects and basic concepts which can be used in chemical fingerprinting programs. This material is not meant to be totally inclusive to all chemical fingerprinting programs, but merely to present current concepts. Each program will be tailored to meet the needs of the individual organizations using chemical fingerprinting to improve their quality and reliability in the production of aerospace systems.

  11. Chronic toxicity of 14 phthalate esters to Daphnia magna and rainbow trout (Oncorhynchus mykiss)

    SciTech Connect

    Rhodes, J.E.; Adams, W.J.; Biddinger, G.R.; Robillard, K.A.; Gorsuch, J.W.

    1995-11-01

    Chronic toxicity studies were performed with commercial phthalate esters and Daphnia magna (14 phthalates) and rainbow trout (Oncorhynchus mykiss) (six phthalates). For the lower-molecular-weight phthalate esters--dimethyl phthalate (DMP), diethyl phthalate (DEP), di-n-butyl phthalate (DBP), and butylbenzyl phthalate (BBP)--the results of the studies indicated a general trend in which toxicity for both species increased as water solubility decreased. The geometric mean maximum acceptable toxicant concentration(GM-MATC) for D. magna ranged from 0.63 to 34.8 mg/L. For the higher-molecular-weight phthalate esters--dihexyl phthalate (DHP), butyl 2-ethylhexyl phthalate (BOP), di-(n-hexyl, n-octyl, n-decyl) phthalate (610P), di-(2-ethylhexyl) phthalate (DEHP), diisooctyl phthalate (DIOP), diisononyl phthalate (DINP), di-(heptyl, nonyl, undecyl) phthalate (711P), diisodecyl phthalate (DIDP), diundecyl phthalate (DUP), and ditridecyl phthalate (DTDP)--the GM-MATC values ranged from 0.042 to 0.15 mg/L. Survival was equally sensitive and sometimes more sensitive than reproduction. The observed toxicity to daphnids with most of the higher-molecular-weight phthalate esters appeared to be due to surface entrapment or a mode of toxicity that is not due to exposure to dissolved aqueous-phase chemical. Early life-stage toxicity studies with rainbow trout indicated that survival (DMP) and growth (DBP) were affected at 24 and 0.19 mg/L, respectively. This pattern of observed toxicity with the lower-molecular-weight phthalate esters and not the higher-molecular-weight phthalate esters is consistent with previously reported acute toxicity studies for several aquatic species.

  12. Multigenerational effects of carbendazim in Daphnia magna.

    PubMed

    Silva, Ana Rita R; Cardoso, Diogo N; Cruz, Andreia; Pestana, João L T; Mendo, Sónia; Soares, Amadeu M V M; Loureiro, Susana

    2017-02-01

    Carbendazim is a fungicide largely used in agriculture as a plant protection product. As a result of agricultural runoffs, drainage, and leaching, it reaches surface waters at concentrations possibly hazardous to aquatic communities. Because of potential and continuous release of carbendazim to aquatic systems, long-term exposure to aquatic organisms should be addressed. To fill the knowledge gap, the present study evaluated the responses of multiple generations of Daphnia magna (clone K6) to an environmentally relevant concentration of carbendazim (5 μg/L). Twelve successive generations were evaluated, and the effects in these offspring were compared with those from a control population. Neonates' fitness was assessed through immobilization, reproduction, and feeding activity tests, along with the comet assay for in vivo DNA damage evaluation. Recovery from long-term exposure was also assessed. In the F5 generation, the results revealed that when daphnids were re-exposed to carbendazim, DNA damage was higher in daphnids continuously exposed to carbendazim than those from clean medium. After daphnids were moved to a clean medium, a low recovery potential was observed for DNA damage. Daphnids exposed continuously for 6 generations (F6) to carbendazim displayed an increase in feeding rates when re-exposed to carbendazim compared with F6 daphnids reared in clean medium. Continuous exposure of daphnids to carbendazim induced a significant increase in DNA damage from the F0 to the F12 generation. Deleterious effects of the multigenerational exposure to carbendazim were more prominent at a subcellular level (DNA damage) compared with the individual level. Environ Toxicol Chem 2017;36:383-394. © 2016 SETAC.

  13. Self Organizing Map-Based Classification of Cathepsin k and S Inhibitors with Different Selectivity Profiles Using Different Structural Molecular Fingerprints: Design and Application for Discovery of Novel Hits.

    PubMed

    Ihmaid, Saleh K; Ahmed, Hany E A; Zayed, Mohamed F; Abadleh, Mohammed M

    2016-01-30

    The main step in a successful drug discovery pipeline is the identification of small potent compounds that selectively bind to the target of interest with high affinity. However, there is still a shortage of efficient and accurate computational methods with powerful capability to study and hence predict compound selectivity properties. In this work, we propose an affordable machine learning method to perform compound selectivity classification and prediction. For this purpose, we have collected compounds with reported activity and built a selectivity database formed of 153 cathepsin K and S inhibitors that are considered of medicinal interest. This database has three compound sets, two K/S and S/K selective ones and one non-selective KS one. We have subjected this database to the selectivity classification tool 'Emergent Self-Organizing Maps' for exploring its capability to differentiate selective cathepsin inhibitors for one target over the other. The method exhibited good clustering performance for selective ligands with high accuracy (up to 100 %). Among the possibilites, BAPs and MACCS molecular structural fingerprints were used for such a classification. The results exhibited the ability of the method for structure-selectivity relationship interpretation and selectivity markers were identified for the design of further novel inhibitors with high activity and target selectivity.

  14. Comparison of semi-automated commercial rep-PCR fingerprinting, spoligotyping, 12-locus MIRU-VNTR typing and single nucleotide polymorphism analysis of the embB gene as molecular typing tools for Mycobacterium bovis.

    PubMed

    Armas, Federica; Camperio, Cristina; Coltella, Luana; Selvaggini, Serena; Boniotti, Maria Beatrice; Pacciarini, Maria Lodovica; Di Marco Lo Presti, Vincenzo; Marianelli, Cinzia

    2017-08-04

    Highly discriminatory genotyping strategies are essential in molecular epidemiological studies of tuberculosis. In this study we evaluated, for the first time, the efficacy of the repetitive sequence-based PCR (rep-PCR) DiversiLab Mycobacterium typing kit over spoligotyping, 12-locus mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) typing and embB single nucleotide polymorphism (SNP) analysis for Mycobacterium bovis typing. A total of 49 M. bovis animal isolates were used. DNA was extracted and genomic DNA was amplified using the DiversiLab Mycobacterium typing kit. The amplified fragments were separated and detected using a microfluidics chip with Agilent 2100. The resulting rep-PCR-based DNA fingerprints were uploaded to and analysed using web-based DiversiLab software through Pearson's correlation coefficient. Rep-PCR DiversiLab grouped M. bovis isolates into ten different clusters. Most isolates sharing identical spoligotype, MIRU-VNTR profile or embB gene polymorphism were grouped into different rep-PCR clusters. Rep-PCR DiversiLab displayed greater discriminatory power than spoligotyping and embB SNP analysis but a lower resolution power than the 12-locus MIRU-VNTR analysis. MIRU-VNTR confirmed that it is superior to the other PCR-based methods tested here. In combination with spoligotyping and 12-locus MIRU-VNTR analysis, rep-PCR improved the discriminatory power for M. bovis typing.

  15. Parasitism drives host genome evolution: Insights from the Pasteuria ramosa-Daphnia magna system.

    PubMed

    Bourgeois, Yann; Roulin, Anne C; Müller, Kristina; Ebert, Dieter

    2017-02-23

    Because parasitism is thought to play a major role in shaping host genomes, it has been predicted that genomic regions associated with resistance to parasites should stand out in genome scans, revealing signals of selection above the genomic background. To test whether parasitism is indeed such a major factor in host evolution and to better understand host-parasite interaction at the molecular level, we studied genome-wide polymorphisms in 97 genotypes of the planktonic crustacean Daphnia magna originating from three localities across Europe. Daphnia magna is known to coevolve with the bacterial pathogen Pasteuria ramosa for which host genotypes (clonal lines) are either resistant or susceptible. Using association mapping, we identified two genomic regions involved in resistance to P. ramosa, one of which was already known from a previous QTL analysis. We then performed a naïve genome scan to test for signatures of positive selection and found that the two regions identified with the association mapping further stood out as outliers. Several other regions with evidence for selection were also found, but no link between these regions and phenotypic variation could be established. Our results are consistent with the hypothesis that parasitism is driving host genome evolution.

  16. A Deep Exploration of the Transcriptome and “Excretory/Secretory” Proteome of Adult Fascioloides magna*

    PubMed Central

    Cantacessi, Cinzia; Mulvenna, Jason; Young, Neil D.; Kasny, Martin; Horak, Petr; Aziz, Ammar; Hofmann, Andreas; Loukas, Alex; Gasser, Robin B.

    2012-01-01

    Parasitic liver flukes of the family Fasciolidae are responsible for major socioeconomic losses worldwide. However, at present, knowledge of the fundamental molecular biology of these organisms is scant. Here, we characterize, for the first time, the transcriptome and secreted proteome of the adult stage of the “giant liver fluke,” Fascioloides magna, using Illumina sequencing technology and one-dimensional SDS-PAGE and OFFGEL protein electrophoresis, respectively. A total of ∼54,000,000 reads were generated and assembled into ∼39,000 contiguous sequences (contigs); ∼20,000 peptides were predicted and classified based on homology searches, protein motifs, gene ontology, and biological pathway mapping. From the predicted proteome, 48.1% of proteins could be assigned to 384 biological pathway terms, including “spliceosome,” “RNA transport,” and “endocytosis.” Putative proteins involved in amino acid degradation were most abundant. Of the 835 secreted proteins predicted from the transcriptome of F. magna, 80 were identified in the excretory/secretory products from this parasite. Highly represented were antioxidant proteins, followed by peptidases (particularly cathepsins) and proteins involved in carbohydrate metabolism. The integration of transcriptomic and proteomic datasets generated herein sets the scene for future studies aimed at exploring the potential role(s) that molecules might play at the host–parasite interface and for establishing novel strategies for the treatment or control of parasitic fluke infections. PMID:22899770

  17. Hereditary nodular heterotopia accompanied by mega cisterna magna.

    PubMed

    Oda, T; Nagai, Y; Fujimoto, S; Sobajima, H; Kobayashi, M; Togari, H; Wada, Y

    1993-08-15

    This is the first report of hereditary nodular heterotopia accompanied by mega cisterna magna. Magnetic resonance imaging documented multiple bilateral subependymal nodules, which were isointense to gray matter. This disease entity is considered a dominant trait, since the mother and two daughters, half-sisters, were affected.

  18. Magna Carta: Teaching Medieval Topics for Historical Significance

    ERIC Educational Resources Information Center

    Metzger, Scott Alan

    2010-01-01

    The Middle Ages are an immensely important era in the Western experience. Unfortunately, medieval studies are often marginalized or trivialized in school curriculum. With the approach of the 800th anniversary of Magna Carta, the famous charter of rights from medieval England, one has a timely and useful example for considering what a focus on…

  19. Magna Carta at 800: Ten Key Questions Answered

    ERIC Educational Resources Information Center

    Kaplan, Howard

    2014-01-01

    2015 marks the 800th anniversary of Magna Carta. For Americans, this iconic document is a formative element of our own legal and political heritage. This "Lessons on the Law" column offers an overview of the "Great Charter," why it is significant, and what students and teachers should know about it. The article also highlights…

  20. Magna Carta: Teaching Medieval Topics for Historical Significance

    ERIC Educational Resources Information Center

    Metzger, Scott Alan

    2010-01-01

    The Middle Ages are an immensely important era in the Western experience. Unfortunately, medieval studies are often marginalized or trivialized in school curriculum. With the approach of the 800th anniversary of Magna Carta, the famous charter of rights from medieval England, one has a timely and useful example for considering what a focus on…

  1. Postoperative Mediastinitis Due to Finegoldia magna with Negative Blood Cultures▿

    PubMed Central

    Kernéis, Solen; Matta, Matta; Hoï, Annie Buu; Podglajen, Isabelle; Gutmann, Laurent; Novara, Ana; Latremouille, Christian; Mainardi, Jean-Luc

    2009-01-01

    We report a case of Finegoldia magna (formerly known as Peptostreptococcus magnus) mediastinitis following coronary artery bypass in a 50-year-old patient. Even if staphylococci remain the main causative organism of postoperative mediastinitis, the responsibility of anaerobic bacteria must be considered in cases of fever and sternal drainage with negative blood cultures. PMID:19812272

  2. The heart of Daphnia magna: effects of four cardioactive drugs.

    PubMed

    Villegas-Navarro, Arturo; Rosas-L, Esperanza; Reyes, José L

    2003-10-01

    We used Daphnia magna bioassays to determine the LC(50) and the effects on the heart of the cardioactive drugs ouabain, verapamil, metaproterenol and metoprolol. Distinctions were made between the pharmacological and toxicological effects of these drugs and the adequacy of physicochemical characteristics of its habitat (reconstituted water). Video microscopy and digital image processing were used to study the pharmacological effects on the heart. D. magna exhibited the expected sensitivity to the reference toxicant sodium dodecyl sulfate with a LC(50) of 15.6+/-4.5 mg/l. All drugs were toxic with 48 h-LC(50) of 2.03 mg/l ouabain, 7.04 mg/l verapamil, 32.45 mg/l metaproterenol and 76.21 mg/l metoprolol. Ouabain was the most toxic and caused a positive concentration-dependent inotropic effect. Verapamil caused positive chronotropic and inotropic effects, while metaproterenol showed positive concentration-dependent chronotropic effects at high concentrations (10(-3) and 10(-4) M). Metoprolol induced a positive chronotropic effect at low concentrations (10(-8), 10(-7), 10(-6) M) and a negative chronotropic effect at high concentration (10(-4) M). Ouabain, metaproterenol and metoprolol in D. magna caused similar effects to those produced in mammals. In contrast, verapamil caused opposite effects. The results suggest the presence of Na(+), K(+)-ATPase receptors to verapamil and of non-specific adrenergic receptors in heart of D. magna.

  3. Wavelet Features Based Fingerprint Verification

    NASA Astrophysics Data System (ADS)

    Bagadi, Shweta U.; Thalange, Asha V.; Jain, Giridhar P.

    2010-11-01

    In this work; we present a automatic fingerprint identification system based on Level 3 features. Systems based only on minutiae features do not perform well for poor quality images. In practice, we often encounter extremely dry, wet fingerprint images with cuts, warts, etc. Due to such fingerprints, minutiae based systems show poor performance for real time authentication applications. To alleviate the problem of poor quality fingerprints, and to improve overall performance of the system, this paper proposes fingerprint verification based on wavelet statistical features & co-occurrence matrix features. The features include mean, standard deviation, energy, entropy, contrast, local homogeneity, cluster shade, cluster prominence, Information measure of correlation. In this method, matching can be done between the input image and the stored template without exhaustive search using the extracted feature. The wavelet transform based approach is better than the existing minutiae based method and it takes less response time and hence suitable for on-line verification, with high accuracy.

  4. One-qubit fingerprinting schemes

    SciTech Connect

    Beaudrap, J. Niel de

    2004-02-01

    Fingerprinting is a technique in communication complexity in which two parties (Alice and Bob) with large data sets send short messages to a third party (a referee), who attempts to compute some function of the larger data sets. For the equality function, the referee attempts to determine whether Alice's data and Bob's data are the same. In this paper, we consider the extreme scenario of performing fingerprinting where Alice and Bob both send either one bit (classically) or one qubit (in the quantum regime) messages to the referee for the equality problem. Restrictive bounds are demonstrated for the error probability of one-bit fingerprinting schemes, and show that it is easy to construct one-qubit fingerprinting schemes which can outperform any one-bit fingerprinting scheme. The author hopes that this analysis will provide results useful for performing physical experiments, which may help to advance implementations for more general quantum communication protocols.

  5. Acute toxicity of benzophenone-type UV filters for Photobacterium phosphoreum and Daphnia magna: QSAR analysis, interspecies relationship and integrated assessment.

    PubMed

    Liu, Hui; Sun, Ping; Liu, Hongxia; Yang, Shaogui; Wang, Liansheng; Wang, Zunyao

    2015-09-01

    The hazardous potential of benzophenone (BP)-type UV filters is becoming an issue of great concern due to the wide application of these compounds in many personal care products. In the present study, the toxicities of BPs to Photobacterium phosphoreum and Daphnia magna were determined. Next, density functional theory (DFT) and comparative molecular field analysis (CoMFA) descriptors were used to obtain more detailed insight into the structure - activity relationships and to preliminarily discuss the toxicity mechanism. Additionally, the sensitivities of the two organisms to BPs and the interspecies toxicity relationship were compared. Moreover, an approach for providing a global index of the environmental risk of BPs to aquatic organisms is proposed. The results demonstrated that the mechanism underlying the toxicity of BPs to P. phosphoreum is primarily related to their electronic properties, and the mechanism of toxicity to D. magna is hydrophobicity. Additionally, D. magna was more sensitive than P. phosphoreum to most of the BPs, with the exceptions of the polyhydric BPs. Moreover, comparisons with published data revealed a high interspecies correlation coefficient among the experimental toxicity values for D. magna and Dugesia japonica. Furthermore, hydrophobicity was also found to be the most important descriptor of integrated toxicity. This investigation will provide insight into the toxicity mechanisms and useful information for assessing the potential ecological risk of BP-type UV filters.

  6. Fingerprints of Life?

    NASA Astrophysics Data System (ADS)

    Pittman, Cheryl

    Pioneered by NASA-JSC scientists, Marilyn Lindstorm and Jaclyn Allen, the partnering of teachers with scientists has ventured into the realms of the extreme... extreme life, that is. In 1998, two years after the announcement that possible evidence of life had been discovered within a Martian rock, teachers from region served by JSC were brought together with the Mars Meteorite research team. The goal was to familiarize the teachers with research being done in the search for evidence of extra-terrestrial life and Earth analogues. The teachers would then design curriculum to translate the research into a format that could be utilized in the classroom. "Fingerprints of Life", a work-in-progress, is a CD-rom /web-based curriculum derived from that collaboration. Modeling the actual science being done, the CD contains laboratory and classroom activities utilizing Astrobiology as the 'hook' to teach basic science skills of observation, description, communication of ideas and laboratory techniques. In addition, electron microscopy images and video clips give background information for the uninitiated. From "Wold Trap", which is based upon an actual experiment designed for the Mars Viking missions, to "Creature Feature", which deals with observation and communication, the labs and activities are appropriate for multiple grade levels. Designed to be user-friendly and tested in the classroom, "Fingerprints" uses materials that can be purchased inexpensively at the grocery store, or recycled from other sources.

  7. Fascioloides magna--epizootiology in a deer farm in Germany.

    PubMed

    Plötz, Cornelia; Rehbein, Steffen; Bamler, Helmut; Reindl, Hubert; Pfister, Kurt; Scheuerle, Miriam C

    2015-01-01

    After initial observations of suspicious cases in 2009, the occurrence of Fascioloides (F.) magna in deer of a deer farm located in northeastern Bavaria, Germany, at the border to the Czech Republic was confirmed in autumn 2011. In March 2012, the deer were treated for fascioloidosis with triclabendazole. To monitor the epizootiology of fascioloidosis in the farm, 80-100 faecal samples were examined for Fascioloides eggs at monthly intervals from June 2012 to June 2013 inclusive. In addition, livers of 27 red deer and one sika deer collected during winter 2012/2013 were examined for gross lesions suspicious for F. magna infection and 21 of the 28 livers were dissected for F. magna recovery. Fascioloides eggs were recorded in 63 (4.9%) of 1280 faecal samples (range 0.4 to 355 eggs per gram). Both, number of Fascioloides-egg positive samples and egg counts were low during the first eight months of the study but increased notably since February 2013. While Fascioloides egg-positive faecal samples were obtained from red deer (46/948,4.9%) and fallow deer (17/166, 10.2%), no Fascioloides eggs were demonstrated in the 166 samples obtained from sika deer. Livers of five red deer and the sika deer showed gross lesions characteristic for fascioloidosis, and F. magna were recovered from three of the five affected red deer livers (range, five to seven flukes). Results of this study confirm that F. magna is endemic in the deer farm, and measures should be implemented to minimize the transmission of the parasite.

  8. Vulnerabilities of fingerprint reader to fake fingerprints attacks.

    PubMed

    Espinoza, Marcela; Champod, Christophe; Margot, Pierre

    2011-01-30

    The purpose of this research is to assess the vulnerabilities of a high resolution fingerprint sensor when confronted with fake fingerprints. The study has not been focused on the decision outcome of the biometric device, but essentially on the scores obtained following the comparison between a query (genuine or fake) and a template using an AFIS system. To do this, fake fingerprints of 12 subjects have been produced with and without their cooperation. These fake fingerprints have been used alongside with real fingers. The study led to three major observations: First, genuine fingerprints produced scores higher than fake fingers (translating a closer proximity) and this tendency is observed considering each subject separately. Second, scores are however not sufficient as a single measure to differentiate these samples (fake from genuine) given the variation due to the donors themselves. That explains why fingerprint readers without vitality detection can be fooled. Third, production methods and subjects greatly influence the scores obtained for fake fingerprints. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  9. Molecular characterization and fingerprinting of vanadyl porphyrin and non-porphyrin compounds in heavy crude petroleums using HPLC-GFAA analysis

    SciTech Connect

    Komlenic, J.J.; Vermeulen, T.; Fish, R.H.

    1982-12-01

    Element-specific high performance liquid chromatography-graphite furnace atomic absorption (HPLC-GFAA) analysis was used to classify vanadyl porphyrin and nonporphyrin compounds present in Boscan, Cerro Negro, Wilmington, and Prudhoe Bay heavy crude oils, containing 1100, 550, 49, and 19 ppM V. The crude oils and pyridine extraction products have been analyzed using the HPLC-GFAA technique with steric exclusion chromatography (SEC) and polar amino-cyano (PAC) columns to yield molecular weight and polarity distributions. 50% of the V present, in the form of low molecular weight vanadyl compounds, is extracted, primarily from the asphaltene fraction of each oil. HPLC-GFAA reveal two classes of extracted vanadyl nonporphyrin compounds. One class, present in Cerro Negro, Wilmington, and Prudhoe Bay pyrdine extract, consists of relatively nonpolar compound(s) with maximum uv-Vis absorbance at 300 nm. The other class, present in Boscan and Cerro Negro crude oils, consists of a more polar nonporphyrin compound(s) with maximum absorbance of 265 nm. The two Venezuelan, high sulfur crude oils contain proportionally greater percentages of vanadyl porphyrin compounds, while the two North American, low sulfur crude oils contain predominantly vanadyl nonporphyrin and nickel porphyrin compounds. A correlation relating V concentration and sulfur and asphaltene content has been observed, while correlations involving V content and depth of burial or age of deposit were not apparent. 21 figures, 5 tables.

  10. Vibrational fingerprints of the Mn4CaO5 cluster in Photosystem II by mixed quantum-classical molecular dynamics.

    PubMed

    Bovi, Daniele; Capone, Matteo; Narzi, Daniele; Guidoni, Leonardo

    2016-10-01

    A detailed knowledge of the structures of the catalytic steps along the Kok-Joliot cycle of Photosystem II may help to understand the strategies adopted by this unique enzyme to achieve water oxidation. Vibrational spectroscopy has probed in the last decades the intermediate states of the catalytic cycle, although the interpretation of the data turned out to be often problematic. In the present work we use QM/MM molecular dynamics on the S2 state to obtain the vibrational density of states at room temperature. To help the interpretation of the computational and experimental data we propose a decomposition of the Mn4CaO5 moiety into five separate parts, composed by "diamond" motifs involving four atoms. The spectral signatures arising from this analysis can be easily interpreted to assign experimentally known bands to specific molecular motions. In particular, we focused in the low frequency region of the vibrational spectrum of the S2 state. We can therefore identify the observed bands around 600-620cm(-1) as characteristic for the stretching vibrations involving Mn1-O1-Mn2 or Mn3-O5 moieties. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Effect of deltamethrin (pyrethroid insecticide) on two clones of Daphnia magna (Crustacea, Cladocera): a proteomic investigation.

    PubMed

    Toumi, Héla; Boumaiza, Moncef; Immel, Françoise; Sohm, Bénédicte; Felten, Vincent; Férard, Jean-François

    2014-03-01

    Deltamethrin is a class II pyrethroid insecticide commonly used in agriculture. It is hazardous to freshwater ecosystems, especially for the cladoceran Daphnia magna (Straus 1820). The results of our previous studies based on acute and chronic ecotoxicity experiments revealed differences in the sensitivity between two different clones. In this work, to investigate deltamethrin toxicity mechanisms in two clones of D. magna, we used a proteomic approach in order to analyze changes in protein expression profiles after 48 h of exposure. We detected 1339 spots; then applying statistical criteria (ANOVA p<0.001 and minimum fold change 1.5), only 128 spots were significantly different in the normalized volume. Among the preselected proteins there were 88 up-regulated and 40 down-regulated proteins. Results showed differences in sensitivities after deltamethrin exposure between the clones. Moreover, using the 2-DIGE method, proteomic investigation for deltamethrin exposure proved to be a reliable and powerful approach to investigate effects of deltamethrin as part of research for new metabolic and cellular biomarkers. After identification by mass spectrometry, there were 39 proteins recognized and identified, in which 21 and 18 were up- and down-regulated, respectively, in deltamethrin-exposed clone A compared to three other conditions (controls of each clone and deltamethrin-exposed clone 2). Up- and down-regulated proteins belonged to 12 biological processes (i.e. metabolic processes, apoptosis and stimulus response) and 5 molecular functions (i.e. catalytic activity, binding, structural molecular activity, antioxidant and receptor activities). Identification of these deregulated proteins opens a new way in discovering new molecular targets and putative biomarkers in daphnids exposed to deltamethrin.

  12. GenomeFingerprinter: the genome fingerprint and the universal genome fingerprint analysis for systematic comparative genomics.

    PubMed

    Ai, Yuncan; Ai, Hannan; Meng, Fanmei; Zhao, Lei

    2013-01-01

    No attention has been paid on comparing a set of genome sequences crossing genetic components and biological categories with far divergence over large size range. We define it as the systematic comparative genomics and aim to develop the methodology. First, we create a method, GenomeFingerprinter, to unambiguously produce a set of three-dimensional coordinates from a sequence, followed by one three-dimensional plot and six two-dimensional trajectory projections, to illustrate the genome fingerprint of a given genome sequence. Second, we develop a set of concepts and tools, and thereby establish a method called the universal genome fingerprint analysis (UGFA). Particularly, we define the total genetic component configuration (TGCC) (including chromosome, plasmid, and phage) for describing a strain as a systematic unit, the universal genome fingerprint map (UGFM) of TGCC for differentiating strains as a universal system, and the systematic comparative genomics (SCG) for comparing a set of genomes crossing genetic components and biological categories. Third, we construct a method of quantitative analysis to compare two genomes by using the outcome dataset of genome fingerprint analysis. Specifically, we define the geometric center and its geometric mean for a given genome fingerprint map, followed by the Euclidean distance, the differentiate rate, and the weighted differentiate rate to quantitatively describe the difference between two genomes of comparison. Moreover, we demonstrate the applications through case studies on various genome sequences, giving tremendous insights into the critical issues in microbial genomics and taxonomy. We have created a method, GenomeFingerprinter, for rapidly computing, geometrically visualizing, intuitively comparing a set of genomes at genome fingerprint level, and hence established a method called the universal genome fingerprint analysis, as well as developed a method of quantitative analysis of the outcome dataset. These have set

  13. GenomeFingerprinter: The Genome Fingerprint and the Universal Genome Fingerprint Analysis for Systematic Comparative Genomics

    PubMed Central

    Ai, Yuncan; Ai, Hannan; Meng, Fanmei; Zhao, Lei

    2013-01-01

    Background No attention has been paid on comparing a set of genome sequences crossing genetic components and biological categories with far divergence over large size range. We define it as the systematic comparative genomics and aim to develop the methodology. Results First, we create a method, GenomeFingerprinter, to unambiguously produce a set of three-dimensional coordinates from a sequence, followed by one three-dimensional plot and six two-dimensional trajectory projections, to illustrate the genome fingerprint of a given genome sequence. Second, we develop a set of concepts and tools, and thereby establish a method called the universal genome fingerprint analysis (UGFA). Particularly, we define the total genetic component configuration (TGCC) (including chromosome, plasmid, and phage) for describing a strain as a systematic unit, the universal genome fingerprint map (UGFM) of TGCC for differentiating strains as a universal system, and the systematic comparative genomics (SCG) for comparing a set of genomes crossing genetic components and biological categories. Third, we construct a method of quantitative analysis to compare two genomes by using the outcome dataset of genome fingerprint analysis. Specifically, we define the geometric center and its geometric mean for a given genome fingerprint map, followed by the Euclidean distance, the differentiate rate, and the weighted differentiate rate to quantitatively describe the difference between two genomes of comparison. Moreover, we demonstrate the applications through case studies on various genome sequences, giving tremendous insights into the critical issues in microbial genomics and taxonomy. Conclusions We have created a method, GenomeFingerprinter, for rapidly computing, geometrically visualizing, intuitively comparing a set of genomes at genome fingerprint level, and hence established a method called the universal genome fingerprint analysis, as well as developed a method of quantitative analysis of the

  14. Sensitive multiplex spectroscopy in the molecular fingerprint 2.4 μm region with a Cr2+:ZnSe femtosecond laser

    PubMed Central

    Sorokin, E.; Sorokina, I. T.; Mandon, J.; Guelachvili, G.; Picqué, N.

    2010-01-01

    An ultrashort-pulse Cr2+:ZnSe laser is a novel broadband source for sensitive high resolution molecular spectroscopy. A 130-fs pulse allows covering of up to 380 cm−1 spectral domain around 2.4 μm which is analyzed simultaneously with a 0.12 cm−1 (3.6 GHz) resolution by a Fourier-transform spectrometer. Recorded in 13 s, from 70-cm length absorption around 4150 cm−1, acetylene and ammonia spectra exhibit a 3800 signal-to-noise ratio and a 2.4·10−7 cm−1·Hz−1/2 noise equivalent absorption coefficient at one second averaging per spectral element, suggesting a 0.2 ppbv detection level for HF molecule. With the widely practiced classical tungsten lamp source instead of the laser, identical spectra would have taken more than one hour. PMID:19550944

  15. Video-based fingerprint verification.

    PubMed

    Qin, Wei; Yin, Yilong; Liu, Lili

    2013-09-04

    Conventional fingerprint verification systems use only static information. In this paper, fingerprint videos, which contain dynamic information, are utilized for verification. Fingerprint videos are acquired by the same capture device that acquires conventional fingerprint images, and the user experience of providing a fingerprint video is the same as that of providing a single impression. After preprocessing and aligning processes, "inside similarity" and "outside similarity" are defined and calculated to take advantage of both dynamic and static information contained in fingerprint videos. Match scores between two matching fingerprint videos are then calculated by combining the two kinds of similarity. Experimental results show that the proposed video-based method leads to a relative reduction of 60 percent in the equal error rate (EER) in comparison to the conventional single impression-based method. We also analyze the time complexity of our method when different combinations of strategies are used. Our method still outperforms the conventional method, even if both methods have the same time complexity. Finally, experimental results demonstrate that the proposed video-based method can lead to better accuracy than the multiple impressions fusion method, and the proposed method has a much lower false acceptance rate (FAR) when the false rejection rate (FRR) is quite low.

  16. Video-Based Fingerprint Verification

    PubMed Central

    Qin, Wei; Yin, Yilong; Liu, Lili

    2013-01-01

    Conventional fingerprint verification systems use only static information. In this paper, fingerprint videos, which contain dynamic information, are utilized for verification. Fingerprint videos are acquired by the same capture device that acquires conventional fingerprint images, and the user experience of providing a fingerprint video is the same as that of providing a single impression. After preprocessing and aligning processes, “inside similarity” and “outside similarity” are defined and calculated to take advantage of both dynamic and static information contained in fingerprint videos. Match scores between two matching fingerprint videos are then calculated by combining the two kinds of similarity. Experimental results show that the proposed video-based method leads to a relative reduction of 60 percent in the equal error rate (EER) in comparison to the conventional single impression-based method. We also analyze the time complexity of our method when different combinations of strategies are used. Our method still outperforms the conventional method, even if both methods have the same time complexity. Finally, experimental results demonstrate that the proposed video-based method can lead to better accuracy than the multiple impressions fusion method, and the proposed method has a much lower false acceptance rate (FAR) when the false rejection rate (FRR) is quite low. PMID:24008283

  17. Fluorescence fingerprints of Eisenia fetida and Eisenia andrei.

    PubMed

    Albani, J R; Demuynck, S; Grumiaux, F; Leprêtre, A

    2003-12-01

    We describe a fluorescent method that allows to differentiate the worms Eisenia fetida and Eisenia andrei. In fact, the coelomic fluid of E. andrei displays specific fluorescence absent in that of E. fetida. The two species do not metabolize the same types of molecules and thus can be differentiated at the molecular level. Each species has specific fluorescence fingerprints.

  18. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    PubMed

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  19. Influence of skin diseases on fingerprint recognition.

    PubMed

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described.

  20. Influence of Skin Diseases on Fingerprint Recognition

    PubMed Central

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  1. Fingerprinting dark energy

    SciTech Connect

    Sapone, Domenico; Kunz, Martin

    2009-10-15

    Dark energy perturbations are normally either neglected or else included in a purely numerical way, obscuring their dependence on underlying parameters like the equation of state or the sound speed. However, while many different explanations for the dark energy can have the same equation of state, they usually differ in their perturbations so that these provide a fingerprint for distinguishing between different models with the same equation of state. In this paper we derive simple yet accurate approximations that are able to characterize a specific class of models (encompassing most scalar-field models) which is often generically called 'dark energy'. We then use the approximate solutions to look at the impact of the dark energy perturbations on the dark matter power spectrum and on the integrated Sachs-Wolfe effect in the cosmic microwave background radiation.

  2. Prediction of the Clinical Outcome in Invasive Candidiasis Patients Based on Molecular Fingerprints of Five Anti-Candida Antibodies in Serum*

    PubMed Central

    Pitarch, Aida; Nombela, César; Gil, Concha

    2011-01-01

    Better prognostic predictors for invasive candidiasis (IC) are needed to tailor and individualize therapeutic decision-making and minimize its high morbidity and mortality. We investigated whether molecular profiling of IgG-antibody response to the whole soluble Candida proteome could reveal a prognostic signature that may serve to devise a clinical-outcome prediction model for IC and contribute to known IC prognostic factors. By serological proteome analysis and data-mining procedures, serum 31-IgG antibody-reactivity patterns were examined in 45 IC patients randomly split into training and test sets. Within the training cohort, unsupervised two-way hierarchical clustering and principal-component analyses segregated IC patients into two antibody-reactivity subgroups with distinct prognoses that were unbiased by traditional IC prognostic factors and other patients-related variables. Supervised discriminant analysis with leave-one-out cross-validation identified a five-IgG antibody-reactivity signature as the most simplified and accurate IC clinical-outcome predictor, from which an IC prognosis score (ICPS) was derived. Its robustness was confirmed in the test set. Multivariate logistic-regression and receiver-operating-characteristic curve analyses demonstrated that the ICPS was able to accurately discriminate IC patients at high risk for death from those at low risk and outperformed conventional IC prognostic factors. Further validation of the five-IgG antibody-reactivity signature on a multiplexed immunoassay supported the serological proteome analysis results. The five IgG antibodies incorporated in the ICPS made biologic sense and were associated either with good-prognosis and protective patterns (those to Met6p, Hsp90p, and Pgk1p, putative Candida virulence factors and antiapoptotic mediators) or with poor-prognosis and risk patterns (those to Ssb1p and Gap1p/Tdh3p, potential Candida proapoptotic mediators). We conclude that the ICPS, with additional

  3. Identification and molecular epidemiology of dermatophyte isolates by repetitive-sequence-PCR-based DNA fingerprinting using the DiversiLab system in Turkey.

    PubMed

    Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize

    2017-05-01

    Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.

  4. Molecular Fingerprinting by PCR-Denaturing Gradient Gel Electrophoresis Reveals Differences in the Levels of Microbial Diversity for Musty-Earthy Tainted Corks ▿

    PubMed Central

    Prat, Chantal; Ruiz-Rueda, Olaya; Trias, Rosalia; Anticó, Enriqueta; Capone, Dimitra; Sefton, Mark; Bañeras, Lluís

    2009-01-01

    The microbial community structure of cork with marked musty-earthy aromas was analyzed using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Cork stoppers and discs were used for DNA extraction and were analyzed by using selective primers for bacteria and fungi. Stoppers clearly differed from discs harboring a different fungal community. Moreover, musty-earthy samples of both types were shown to have a specific microbiota. The fungi Penicillium glabrum and Neurospora spp. were present in all samples and were assumed to make only a small contribution to off-odor development. In contrast, Penicillium islandicum and Penicillium variabile were found almost exclusively in 2,4,6-trichloroanisole (TCA) tainted discs. Conversely, Rhodotorula minuta and Rhodotorula sloofiae were most common in cork stoppers, where only small amounts of TCA were detected. Alpha- and gammaproteobacteria were the most commonly found bacteria in either control or tainted cork stoppers. Specific Pseudomonas and Actinobacteria were detected in stoppers with low amounts of TCA and 2-methoxy-3,5-dimethylpyrazine. These results are discussed in terms of biological degradation of taint compounds by specific microorganisms. Reliable and straightforward microbial identification methods based on a molecular approach provided useful data to determine and evaluate the risk of taint formation in cork. PMID:19201983

  5. Molecular fingerprinting by PCR-denaturing gradient gel electrophoresis reveals differences in the levels of microbial diversity for musty-earthy tainted corks.

    PubMed

    Prat, Chantal; Ruiz-Rueda, Olaya; Trias, Rosalia; Anticó, Enriqueta; Capone, Dimitra; Sefton, Mark; Bañeras, Lluís

    2009-04-01

    The microbial community structure of cork with marked musty-earthy aromas was analyzed using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Cork stoppers and discs were used for DNA extraction and were analyzed by using selective primers for bacteria and fungi. Stoppers clearly differed from discs harboring a different fungal community. Moreover, musty-earthy samples of both types were shown to have a specific microbiota. The fungi Penicillium glabrum and Neurospora spp. were present in all samples and were assumed to make only a small contribution to off-odor development. In contrast, Penicillium islandicum and Penicillium variabile were found almost exclusively in 2,4,6-trichloroanisole (TCA) tainted discs. Conversely, Rhodotorula minuta and Rhodotorula sloofiae were most common in cork stoppers, where only small amounts of TCA were detected. Alpha- and gammaproteobacteria were the most commonly found bacteria in either control or tainted cork stoppers. Specific Pseudomonas and Actinobacteria were detected in stoppers with low amounts of TCA and 2-methoxy-3,5-dimethylpyrazine. These results are discussed in terms of biological degradation of taint compounds by specific microorganisms. Reliable and straightforward microbial identification methods based on a molecular approach provided useful data to determine and evaluate the risk of taint formation in cork.

  6. Accumulation of dieldrin in an alga (Scenedesmus obliquus), Daphnia magna, and the guppy (Poecilia reticulata)

    USGS Publications Warehouse

    Reinert, Robert E.

    1972-01-01

    Scenedesmus obliquus, Daphnia magna, and Poecilia reticulata accumulated dieldrin directly from water; average concentration factors (concentration in organism, dry weight, divided by concentration in water) were 1282 for the alga, 13,954 for D. magna, and 49,307 (estimated) for the guppy. The amount accumulated by each species at equilibrium (after about 1.5, 3-4, and 18 days, respectively) was directly proportional to the concentration of dieldrin in the water. Daphnia magna and guppies accumulated more dieldrin from water than from food that had been exposed to similar concentrations in water. When guppies were fed equal daily rations of D. magna containing different concentrations of insecticide, the amounts of dieldrin accumulated by the fish were directly proportional to the concentration in D. magna; when two lots of guppies were fed different quantities of D. magna (10 and 20 organisms per day) containing identical concentrations of dieldrin, however, the amounts accumulated did not differ substantially.

  7. Characterization of the antithrombotic fingerprint of the branded and copies of the low-molecular-weight enoxaparin using thrombin generation assay.

    PubMed

    Gerotziafas, Grigoris T; Rouseau, Aurèlie; Mbemba, Elisabeth; Khartechi, Amir; Van Dreden, Patrick; Walenga, Janine; Fareed, Jawed; Elalamy, Ismail

    2015-11-01

    The patent protection of low-molecular-weight heparins (LMWHs) expired, so the definition of criteria for the biological similarity between LMWH copies and the original product is a real need. The present in vitro study compared copies and branded enoxaparin using the specific anti-Xa activity and the calibrated automated thrombogram assay. Samples of platelet-poor plasma (PPP) and platelet-rich plasma (PRP) from 15 healthy volunteers were spiked with branded enoxaparin (Lovenox) or its copies (Cutenox, Dilutol, Enoxa, Fibrinox, Loparin, Lupenox, Novex, Noxprin, and Versa). The specific anti-Xa activity was measured in PPP, and thrombin generation was assessed in PPP and PRP in the presence of tissue factor or pancreatic cancer cells BXPC3. The anti-Xa activity of enoxaparin copies ranged from 0.072 to 0.088 IU/μg, being lower as compared to the branded enoxaparin (0.095 anti-Xa IU/μg). The potency of each copy to inhibit thrombin generation varied in the 3 experimental systems. The presence of platelets or pancreatic cancer cells BXPC3 in human plasma induced significant modifications in the inhibitory efficiency of enoxaparin copies on thrombin generation, which distinguished them from the branded product. Enoxaparin copies showed significant variability regarding their inhibitory potency on thrombin generation. Platelets and cancer cells significantly increased the variability of the antithrombotic efficiency of the copies as compared to the branded enoxaparin. The present study underlines the need for the elaboration of additional functional criteria to evaluate the global antithrombotic capacity of enoxaparin copies in order to evaluate their potential sameness with the branded drug. © The Author(s) 2015.

  8. Interclonal proteomic responses to predator exposure in Daphnia magna may depend on predator composition of habitats.

    PubMed

    Otte, Kathrin A; Schrank, Isabella; Fröhlich, Thomas; Arnold, Georg J; Laforsch, Christian

    2015-08-01

    Phenotypic plasticity, the ability of one genotype to express different phenotypes in response to changing environmental conditions, is one of the most common phenomena characterizing the living world and is not only relevant for the ecology but also for the evolution of species. Daphnia, the water flea, is a textbook example for predator-induced phenotypic plastic defences; however, the analysis of molecular mechanisms underlying these inducible defences is still in its early stages. We exposed Daphnia magna to chemical cues of the predator Triops cancriformis to identify key processes underlying plastic defensive trait formation. To get a more comprehensive idea of this phenomenon, we studied four genotypes with five biological replicates each, originating from habitats characterized by different predator composition, ranging from predator-free habitats to habitats containing T. cancriformis. We analysed the morphologies as well as proteomes of predator-exposed and control animals. Three genotypes showed morphological changes when the predator was present. Using a high-throughput proteomics approach, we found 294 proteins which were significantly altered in their abundance after predator exposure in a general or genotype-dependent manner. Proteins connected to genotype-dependent responses were related to the cuticle, protein synthesis and calcium binding, whereas the yolk protein vitellogenin increased in abundance in all genotypes, indicating their involvement in a more general response. Furthermore, genotype-dependent responses at the proteome level were most distinct for the only genotype that shares its habitat with Triops. Altogether, our study provides new insights concerning genotype-dependent and general molecular processes involved in predator-induced phenotypic plasticity in D. magna. © 2015 John Wiley & Sons Ltd.

  9. Fingerprint Changes in Coeliac Disease

    PubMed Central

    David, T. J.; Ajdukiewicz, A. B.; Read, A. E.

    1970-01-01

    Study of the fingerprints of 73 patients with coeliac disease, taken carefully, showed changes varying between moderate epidermal ridge atrophy and actual loss of fingerprint patterns. Of the patients 63 had these abnormalities, compared with 3 out of 485 controls. A high degree of correlation existed between ridge atrophy and changes in the clinical state of patients with coeliac disease. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6 PMID:5488703

  10. Effects of symbiotic bacteria on chemical sensitivity of Daphnia magna.

    PubMed

    Manakul, Patcharaporn; Peerakietkhajorn, Saranya; Matsuura, Tomoaki; Kato, Yasuhiko; Watanabe, Hajime

    2017-07-01

    The crustacean zooplankton Daphnia magna has been widely used for chemical toxicity tests. Although abiotic factors have been well documented in ecotoxicological test protocols, biotic factors that may affect the sensitivity to chemical compounds remain limited. Recently, we identified symbiotic bacteria that are critical for the growth and reproduction of D. magna. The presence of symbiotic bacteria on Daphnia raised the question as to whether these bacteria have a positive or negative effect on toxicity tests. In order to evaluate the effects of symbiotic bacteria on toxicity tests, bacteria-free Daphnia were prepared, and their chemical sensitivities were compared with that of Daphnia with symbiotic bacteria based on an acute immobilization test. The Daphnia with symbiotic bacteria showed higher chemical resistance to nonylphenol, fenoxycarb, and pentachlorophenol than bacteria-free Daphnia. These results suggested potential roles of symbiotic bacteria in the chemical resistance of its host Daphnia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Chronic toxicity of biphenyl to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Bartlett, E.A.; Murphy, P.G.; Milazzo, D.P. )

    1989-09-01

    The US Environmental Protection Agency (EPA) issued a final test rule (1985) for biphenyl on the authority of Section 4(a) of the Toxic Substances Control Act (TSCA). Contained within this rule was the requirement for generating chronic daphnid toxicity data for biphenyl. Biphenyl is used primarily to produce dye carriers, heat-transfer fluids and alkylated biphenyls. The acute toxicity of biphenyl to Daphnia magna has been reported. The 48-hr LC50 values were 4.7 and 2.1 mg/L, respectively. To date, the chronic toxicity of biphenyl to fish and aquatic invertebrates has not been investigated. The objective of this study was to determine the chronic toxicity of biphenyl to D. magna. The daphnid chronic toxicity test is designed to estimate the maximum acceptable toxicant concentration (MATC). The MATC is defined as the concentration falling between the highest concentration showing no effect and the next higher concentration showing a toxic effect when compared to the controls.

  12. Applications of Synchrotron Infrared Microspectroscopy to the Study of Fingerprints

    NASA Astrophysics Data System (ADS)

    Wilkinson, Tommy J.; Perry, Dale L.; Martin, Michael C.; McKinney, Wayne R.

    2001-03-01

    Synchrotron infrared microspectroscopy has been used to study chemical markers and profiles of human fingerprints in the mid-infrared region (4000-400 cm-1). Band intensities and band intensity ratios for functional groups of chemical molecules that are inherent to the fingerprint's chemical system are discussed in the context of molecular species. These species can be identified by comparison to infrared spectra that have been reported previously for identified chemical components. Mapping of chemical heterogeneities using spectral markers is presented and discussed. Changes in the chemistry of the fingerprint will be discussed in the context of the aging process which is reflected in the changes in the infrared spectra. agraph This work was supported by the Center for Science and Engineering Education (CSEE) at Lawrence Berkeley National Laboratory, and the Director, Office of Basic Energy Sciences, Materials Science Division, of the U. S. Department of Energy under Contract No. DE-AC03-76SF00098.

  13. Fingerprints selection for topological localization

    NASA Astrophysics Data System (ADS)

    Popov, Vladimir

    2017-07-01

    Problems of visual navigation are extensively studied in contemporary robotics. In particular, we can mention different problems of visual landmarks selection, the problem of selection of a minimal set of visual landmarks, selection of partially distinguishable guards, the problem of placement of visual landmarks. In this paper, we consider one-dimensional color panoramas. Such panoramas can be used for creating fingerprints. Fingerprints give us unique identifiers for visually distinct locations by recovering statistically significant features. Fingerprints can be used as visual landmarks for the solution of various problems of mobile robot navigation. In this paper, we consider a method for automatic generation of fingerprints. In particular, we consider the bounded Post correspondence problem and applications of the problem to consensus fingerprints and topological localization. We propose an efficient approach to solve the bounded Post correspondence problem. In particular, we use an explicit reduction from the decision version of the problem to the satisfiability problem. We present the results of computational experiments for different satisfiability algorithms. In robotic experiments, we consider the average accuracy of reaching of the target point for different lengths of routes and types of fingerprints.

  14. Chapelieria magna, a new species of Rubiaceae from eastern Madagascar

    PubMed Central

    Kainulainen, Kent; Razafimandimbison, Sylvain G.

    2015-01-01

    Abstract A new species of Chapelieria was discovered during a recent field trip to the Masoala National Park in eastern Madagascar, and is described here as Chapelieria magna Kainul., sp. nov. This species is readily distinguishable from previously described species of the genus by its quadrangular shoots, triangular-calyptrate stipules, sessile leaves, pubescent styles, and ridged fruits. It also differs in the larger number of ovules and the much larger size of leaves and fruits. PMID:25698895

  15. Acute toxicity and QSAR of chlorophenols on Daphnia magna

    SciTech Connect

    Devillers, J.; Chambon, P.

    1986-10-01

    Chlorophenols which are released into natural waters from various industrial processes and from agricultural uses have been recognized as a group of chemical substances potentially hazardous to the aquatic environment. Therefore it is important to estimate their toxic impact on biota. Thus, the scope of this research was to obtain acute toxicity data for seventeen chlorophenols towards Daphnia magna and to explore the possibilities of deriving QSAR's (quantitative structure-activity relationship) from the above values.

  16. A multi-fingerprint browser for the ZINC database

    PubMed Central

    Awale, Mahendra; Reymond, Jean-Louis

    2014-01-01

    To confirm the activity of an initial small molecule ‘hit compound’ from an activity screening, one needs to probe the structure–activity relationships by testing close analogs. The multi-fingerprint browser presented here (http://dcb-reymond23.unibe.ch:8080/MCSS/) enables one to rapidly identify such close analogs among commercially available compounds in the ZINC database (>13 million molecules). The browser retrieves nearest neighbors of any query molecule in multi-dimensional chemical spaces defined by four different fingerprints, each of which represents relevant structural and pharmacophoric features in a different way: sFP (substructure fingerprint), ECFP4 (extended connectivity fingerprint), MQNs (molecular quantum numbers) and SMIfp (SMILES fingerprint). Distances are calculated using the city-block distance, a similarity measure that performs as well as Tanimoto similarity but is much faster to compute. The list of up to 1000 nearest neighbors of any query molecule is retrieved by the browser and can be then clustered using the K-means clustering algorithm to produce a focused list of analogs with likely similar bioactivity to be considered for experimental evaluation. PMID:24782520

  17. Spectral fingerprinting of soil organic matter composition

    NASA Astrophysics Data System (ADS)

    Cecillon, L.; Certini, G.; Lange, H.; Forte, C.; Strand, L. T.

    2009-04-01

    The determination of soil organic matter (SOM) composition relies on a variety of chemical and physical methods, most of them time consuming and expensive. Hitherto, such methodological limitations have hampered the use of detailed SOM composition in process-based models of SOM dynamics, which usually include only three poorly defined carbon pools. Here we show a novel approach merging both near and mid infrared spectroscopy into a single fingerprint for an expeditious prediction of the molecular composition of organic materials in soil, as inferred from a molecular mixing model (MMM) based on 13C nuclear magnetic resonance (NMR), which describes SOM as a mixture of common biologically derived polymers. Infrared and solid-state 13C NMR spectroscopic measurements were performed on a set of mineral and organic soil samples presenting a wide range of organic carbon content (2 to 500 g kg-1), collected in a boreal heathland (Storgama, Norway). The implementation of the MMM using 13C NMR spectra allowed the calculation of five main biochemical components (carbohydrate, protein, lignin, lipids and black carbon) for each sample. Partial least squares regression models were developed for the five biopolymers using outer product analysis of near and mid infrared spectra (Infrared-OPA). All models reached ratios of performance to deviation (RPD) above 2 and specific infrared wavenumbers associated to each biochemical component were identified. Our results demonstrate that Infrared-OPA provides a robust and cost-effective fingerprint of SOM composition that could be useful for the routine assessment of soil carbon pools.

  18. CRISPR/Cas-mediated targeted mutagenesis in Daphnia magna.

    PubMed

    Nakanishi, Takashi; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2014-01-01

    The water flea Daphnia magna has been used as an animal model in ecology, evolution, and environmental sciences. Thanks to the recent progress in Daphnia genomics, genetic information such as the draft genome sequence and expressed sequence tags (ESTs) is now available. To investigate the relationship between phenotypes and the available genetic information about Daphnia, some gene manipulation methods have been developed. However, a technique to induce targeted mutagenesis into Daphnia genome remains elusive. To overcome this problem, we focused on an emerging genome editing technique mediated by the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system to introduce genomic mutations. In this study, we targeted a functionally conserved regulator of eye development, the eyeless gene in D. magna. When we injected Cas9 mRNAs and eyeless-targeting guide RNAs into eggs, 18-47% of the survived juveniles exhibited abnormal eye morphology. After maturation, up to 8.2% of the adults produced progenies with deformed eyes, which carried mutations in the eyeless loci. These results showed that CRISPR/Cas system could introduce heritable mutations into the endogenous eyeless gene in D. magna. This is the first report of a targeted gene knockout technique in Daphnia and will be useful in uncovering Daphnia gene functions.

  19. Increasing toxicity of enrofloxacin over four generations of Daphnia magna.

    PubMed

    Dalla Bona, Mirco; Lizzi, Francesca; Borgato, Arianna; De Liguoro, Marco

    2016-10-01

    The effects of both continuous and alternate exposure to 2mgL(-1) of enrofloxacin (EFX) on survival, growth and reproduction were evaluated over four generations of Daphnia magna. Mortality increased, reaching 100% in most groups by the end of the third generation. Growth inhibition was detected in only one group of the fourth generation. Reproduction inhibition was >50% in all groups and, in second and third generations, groups transferred to pure medium showed a greater inhibition of reproduction than those exposed to EFX. To verify whether the effects observed in these groups could be explained by the perinatal exposure to the antibacterial, a reproduction test with daphnids obtained from in vitro exposed D. magna embryos was also carried out. Perinatal exposure to EFX seemed to act as an 'all-or-nothing' toxicity effect as 31.4% of embryos died, but the surviving daphnids did not show any inhibition of reproduction activity. However, the embryonic mortality may at least partially justify the inhibition of reproduction observed in exposed groups along the multigenerational test. Concluding, the multigenerational test with D. magna did show disruption to a population that cannot be evidenced by the official tests. The increasing deterioration across generations might be inferred as the consequence of heritable alterations. Whilst the concentration tested was higher than those usually detected in the natural environment, the increasing toxicity of EFX across generations and the possible additive toxicity of fluoroquinolone mixtures, prevent harm to crustacean populations by effects in the real context from being completely ruled out.

  20. Acute and chronic toxicity of veterinary antibiotics to Daphnia magna.

    PubMed

    Wollenberger, L; Halling-Sørensen, B; Kusk, K O

    2000-04-01

    The acute and chronic toxicity of nine antibiotics used both therapeutically and as growth promoters in intensive farming was investigated on the freshwater crustacean Daphnia magna. The effect of the antibiotics metronidazole (M), olaquindox (OL), oxolinic acid (OA), oxytetracycline (OTC), streptomycin (ST), sulfadiazine (SU), tetracycline (TC), tiamulin (TI) and tylosin (TY) was tested in accordance to the ISO (1989) and OECD (1996) standard procedures. The acute toxicities (48-h EC50 value, mg/l) in decreasing order were OA (4.6), TI (40), SU (221), ST (487), TY (680) and OTC (approximately 1000). NOECs were 340 mg/l for TC and 1000 mg/l for M and OL. Toxic effect on reproduction occurred generally at concentrations, which were one order of magnitude below the acute toxic levels. The chronic toxicity (EC50 values, mg/l) in the D. magna reproduction test in decreasing order were TI (5.4), SU (13.7), TC (44.8) and OTC (46.2). The NOECs (mg/l) obtained in the reproduction test with OA, ST, TY and M were 0.38 for OA, 32 for ST, 45 for TY and 250 for M. The observed toxicity of OA to D. magna indicates that this substance, which is a commonly used feed additive in fish farms, has a potential to cause adverse effects on the aquatic environment.

  1. 'Fingerprinting' of HLA-DQA by polymerase chain reaction and heteroduplex analysis.

    PubMed

    Martinelli, G; Trabetti, E; Farabegoli, P; Buzzi, M; Zaccaria, A; Testoni, N; Amabile, M; Casartelli, A; de Vivo, A; Pignatti, P F; Tura, S

    1996-04-01

    We have developed a rapid, non-radioisotopic PCR fingerprinting technique for analysis of the HLA-Class II DQA gene second exon polymorphism, and have applied it to DNA samples from 210 healthy individuals. The technique is based on the formation of specific patterns (fingerprints) of homoduplexes or heteroduplexes between in vitro amplified DNA sequences. After electrophoresis on non-denaturing polyacrylamide gels and ethidium bromide fluorescence or silver staining, different HLA-DQA types give allele-specific banding patterns. HLA DQA typing is done by visual comparison between the sample's fingerprint patterns and appropriate controls. Similar fingerprints can be resolved by mixing the sample with a standard DNA in an amplified 'DNA crossmatch'. This application of PCR fingerprinting is useful to confirm the HLA-DQA serological typing and to improve the molecular characterization of this polymorphic region.

  2. Toxicity Determination of Explosive Contaminated Soil Leachates to Daphnia magna Using an Adapted Toxicity Characteristic Leaching Procedure

    DTIC Science & Technology

    1993-06-01

    An adapted toxicity characteristic leaching procedure was used to determine toxicity of soils to Daphnia magna . Soil samples were collected from U.S...vol/vol). Contaminated boils, Munition residues, Daphnia magna , EC50 Toxicity.

  3. Generating cancelable fingerprint templates.

    PubMed

    Ratha, Nalini K; Chikkerur, Sharat; Connell, Jonathan H; Bolle, Ruud M

    2007-04-01

    Biometrics-based authentication systems offer obvious usability advantages over traditional password and token-based authentication schemes. However, biometrics raises several privacy concerns. A biometric is permanently associated with a user and cannot be changed. Hence, if a biometric identifier is compromised, it is lost forever and possibly for every application where the biometric is used. Moreover, if the same biometric is used in multiple applications, a user can potentially be tracked from one application to the next by cross-matching biometric databases. In this paper, we demonstrate several methods to generate multiple cancelable identifiers from fingerprint images to overcome these problems. In essence, a user can be given as many biometric identifiers as needed by issuing a new transformation "key." The identifiers can be cancelled and replaced when compromised. We empirically compare the performance of several algorithms such as Cartesian, polar, and surface folding transformations of the minutiae positions. It is demonstrated through multiple experiments that we can achieve revocability and prevent cross-matching of biometric databases. It is also shown that the transforms are noninvertible by demonstrating that it is computationally as hard to recover the original biometric identifier from a transformed version as by randomly guessing. Based on these empirical results and a theoretical analysis we conclude that feature-level cancelable biometric construction is practicable in large biometric deployments.

  4. Phototoxic effects of titanium dioxide nanoparticles on Daphnia magna

    NASA Astrophysics Data System (ADS)

    Mansfield, Charles M.

    Titanium dioxide nanoparticles (TiO2-NP) are one of the most abundantly utilized nanomaterials in the world. Studies have demonstrated the mechanism of acute toxicity in TiO2-NP to be the production of reactive oxygen species (ROS) leading to oxidative stress and mortality in exposed organisms. It has also been demonstrated that the anatase crystalline conformation is capable of catalyzing the cleavage of water molecules to further increase the concentration of ROS in the presence of ultraviolet radiation. This photoenhanced toxicity significantly lowers the toxicity threshold of TiO2-NP to environmentally relevant concentrations (ppb). The goal of this study was to determine whether dietary uptake and accumulation of TiO2-NP in the aquatic filter feeder Daphnia magna resulted in photoenhanced toxicity. D. magna and S. caprincornatum were exposed to aqueous solutions of 20ppm and 200ppm TiO2-NP for 24hrs and then transferred to clean moderately hard water. Samples were taken at various time points, dried, and TiO 2 quantified using ICP-MS. Toxicity assays were run on D. magna using three TiO2-NP (20ppm, 200ppm) exposure protocols and two ultraviolet radiation treatments. The first exposure group was exposed to aqueous solutions of TiO2-NP for the duration of the test. The second exposure group was exposed to TiO2-NP for an hour and then transferred to clean water. The third exposure group was fed S. capricornatum that had been allowed to adsorb TiO2-NP. All samples were then placed in an outdoor UV exposure system and exposed to either full spectrum sunlight (with UV) or filtered sunlight (no UV). Here we show that TiO2 uptake peaked at one hour of exposure likely due to sedimentation of the particles out of suspension, thus decreasing bioavailability for the duration of the test. Interestingly, when D. magna were moved to clean water, aqueous concentrations of TiO2 increase as a result of depuration from the gut tract. Data also suggests these excreted particles

  5. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis

    PubMed Central

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F.; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  6. A Tree Based Method for the Rapid Screening of Chemical Fingerprints

    NASA Astrophysics Data System (ADS)

    Kristensen, Thomas G.; Nielsen, Jesper; Pedersen, Christian N. S.

    The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules with fingerprints similar to a query fingerprint. In this paper, we present a method which efficiently finds all fingerprints in a database with Tanimoto coefficient to the query fingerprint above a user defined threshold. The method is based on two novel data structures for rapid screening of large databases: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds. We have implemented our method and tested it on a large data set from the industry. Our experiments show that our method yields a three-fold speed-up over previous methods.

  7. Fake fingerprint detection based on image analysis

    NASA Astrophysics Data System (ADS)

    Jin, Sang-il; Bae, You-suk; Maeng, Hyun-ju; Lee, Hyun-suk

    2010-01-01

    Fingerprint recognition systems have become prevalent in various security applications. However, recent studies have shown that it is not difficult to deceive the system with fake fingerprints made of silicon or gelatin. The fake fingerprints have almost the same ridge-valley patterns as ones of genuine fingerprints so that conventional systems are unable to detect fake fingerprints without a particular detection method. Many previous works against fake fingers required extra sensors; thus, they lacked practicality. This paper proposes a practical and effective method that detects fake fingerprints, using only an image sensor. Two criteria are introduced to differentiate genuine and fake fingerprints: the histogram distance and Fourier spectrum distance. In the proposed method, after identifying an input fingerprint of a user, the system computes two distances between the input and the reference that comes from the registered fingerprints of the user. Depending on the two distances, the system classifies the input as a genuine fingerprint or a fake. In the experiment, 2,400 fingerprint images including 1,600 fakes were tested, and the proposed method has shown a high recognition rate of 95%. The fake fingerprints were all accepted by a commercial system; thus, the use of these fake fingerprints qualifies the experiment.

  8. Comparing structural fingerprints using a literature-based similarity benchmark.

    PubMed

    O'Boyle, Noel M; Sayle, Roger A

    2016-01-01

    The concept of molecular similarity is one of the central ideas in cheminformatics, despite the fact that it is ill-defined and rather difficult to assess objectively. Here we propose a practical definition of molecular similarity in the context of drug discovery: molecules A and B are similar if a medicinal chemist would be likely to synthesise and test them around the same time as part of the same medicinal chemistry program. The attraction of such a definition is that it matches one of the key uses of similarity measures in early-stage drug discovery. If we make the assumption that molecules in the same compound activity table in a medicinal chemistry paper were considered similar by the authors of the paper, we can create a dataset of similar molecules from the medicinal chemistry literature. Furthermore, molecules with decreasing levels of similarity to a reference can be found by either ordering molecules in an activity table by their activity, or by considering activity tables in different papers which have at least one molecule in common. Using this procedure with activity data from ChEMBL, we have created two benchmark datasets for structural similarity that can be used to guide the development of improved measures. Compared to similar results from a virtual screen, these benchmarks are an order of magnitude more sensitive to differences between fingerprints both because of their size and because they avoid loss of statistical power due to the use of mean scores or ranks. We measure the performance of 28 different fingerprints on the benchmark sets and compare the results to those from the Riniker and Landrum (J Cheminf 5:26, 2013. doi:10.1186/1758-2946-5-26) ligand-based virtual screening benchmark. Extended-connectivity fingerprints of diameter 4 and 6 are among the best performing fingerprints when ranking diverse structures by similarity, as is the topological torsion fingerprint. However, when ranking very close analogues, the atom pair fingerprint

  9. Electronic fingerprinting of the dead.

    PubMed

    Rutty, G N; Stringer, K; Turk, E E

    2008-01-01

    To date, a number of methods exist for the capture of fingerprints from cadavers that can then be used in isolation as a primary method for the identification of the dead. We report the use of a handheld, mobile wireless unit used in conjunction with a personal digital assistant (PDA) device for the capture of fingerprints from the dead. We also consider a handheld single-digit fingerprint scanner that utilises a USB laptop connection for the electronic capture of cadaveric fingerprints. Both are single-operator units that, if ridge detail is preserved, can collect a 10-set of finger pad prints in approximately 45 and 90 s, respectively. We present our observations on the restrictions as to when such devices can be used with cadavers. We do, however, illustrate that the images are of sufficient quality to allow positive identification from finger pad prints of the dead. With the development of mobile, handheld, biometric, PDA-based units for the police, we hypothesize that, under certain circumstances, devices such as these could be used for the accelerated acquisition of fingerprint identification data with the potential for rapid near-patient identification in the future.

  10. Video fingerprinting for live events

    NASA Astrophysics Data System (ADS)

    Celik, Mehmet; Haitsma, Jaap; Barvinko, Pavlo; Langelaar, Gerhard; Maas, Martijn

    2009-02-01

    Multimedia fingerprinting (robust hashing) as a content identification technology is emerging as an effective tool for preventing unauthorized distribution of commercial content through user generated content (UGC) sites. Research in the field has mainly considered content types with slow distribution cycles, e.g. feature films, for which reference fingerprint ingestion and database indexing can be performed offline. As a result, research focus has been on improving the robustness and search speed. Live events, such as live sports broadcasts, impose new challenges on a fingerprinting system. For instance, highlights from a soccer match are often available-and viewed-on UGC sites well before the end of the match. In this scenario, the fingerprinting system should be able to ingest and index live content online and offer continuous search capability, where new material is identifiable within minutes of broadcast. In this paper, we concentrate on algorithmic and architectural challenges we faced when developing a video fingerprinting solution for live events. In particular, we discuss how to effectively utilize fast sorting algorithms and a master-slave architecture for fast and continuous ingestion of live broadcasts.

  11. Environmental Effects of Dredging. Use of Daphnia Magna to Predict Consequences of Bioaccumulation.

    DTIC Science & Technology

    1987-03-01

    and biological effects in the freshwater crustacean, Daphnia magna (commonly known as the water flea). Procedures presented here for a 28-day Daphnia ... magna toxicity test could be used in screening for water-column toxicity resulting from open-water disposal of a specific dredged material. As a part

  12. Fingerprint fake detection by optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

    2013-03-01

    The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

  13. Secure Fingerprint Identification of High Accuracy

    DTIC Science & Technology

    2014-01-01

    work on secure face recognition ([12], [29] and others), DNA matching ([35], [6], and others), iris code comparisons ([9], [7]), fingerprint ...1 Secure Fingerprint Identification of High Accuracy Marina Blanton and Siddharth Saraph Department of Computer Science and Engineering University of...In this work, we treat the problem of privacy- preserving matching of two fingerprints , which can be used for secure fingerprint authentication and

  14. Understanding the chemistry of the development of latent fingerprints by superglue fuming.

    PubMed

    Wargacki, Stephen P; Lewis, Linda A; Dadmun, Mark D

    2007-09-01

    Cyanoacrylate fuming is a widely used forensic tool for the development of latent fingerprints, however the mechanistic details of the reaction between the fingerprint residue and the cyanoacrylate vapor are not well understood. Here the polymerization of ethyl-cyanoacrylate vapor by sodium lactate or alanine solutions, two of the major components in fingerprint residue, has been examined by monitoring the time dependence of the mass uptake and resultant polymer molecular weight characteristics. This data provides insight into the molecular level actions in the efficient development of latent fingerprints by superglue fuming. The results show that the carboxylate moiety is the primary initiator of the polymerization process and that a basic environment inhibits chain termination while an acidic environment promotes it. The results also indicate that water cannot be the primary initiator in this forensic technique.

  15. Interspecific Differences between D. pulex and D. magna in Tolerance to Cyanobacteria with Protease Inhibitors

    PubMed Central

    Kuster, Christian J.; Von Elert, Eric

    2013-01-01

    It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids’ tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC− contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC−, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease inhibitors. PMID:23650523

  16. The effect of fullerenes and functionalized fullerenes on Daphnia magna phototaxis and swimming behavior.

    PubMed

    Brausch, Kathryn A; Anderson, Todd A; Smith, Philip N; Maul, Jonathan D

    2011-04-01

    The effects of carbon fullerenes (C(60) ) on the environment is a growing concern as the use of nanotechnology continues to increase. Previous studies have reported alteration in Daphnia magna behavior, including increased hopping frequency, heart rate, and appendage movement in response to tetrahydrofuran-solubilized C(60) and increased hopping rate and appendage movement in response to tetrahydrofuran-solubilized C(60) HxC(70) Hx exposure. The objective of the current study was to evaluate effects of water-stirred C(60) and sonicated carboxylic acid functionalized fullerenes (fC(60) ) on D. magna behavior. Behavioral endpoints are important because changes in behavior can influence predator avoidance behaviors, alter predation risk, and potentially lead to population-level effects in D. magna. To evaluate the potential effect of fullerenes on phototactic behavior, D. magna were exposed to 545.4 µg/L C(60) and 545.6 µg/L fC(60) , and vertical position was monitored. Daphnia magna were also exposed to 545.4 µg/L C(60) , 545.6 µg/L fC(60) , and 829.3 µg/L fC(60) , and swimming movements were recorded. Fullerenes altered the vertical migration response of D. magna to the addition of food, but D. magna vertical position response to predator cues was similar for fullerenes and controls. In addition, D. magna reduced swimming speed when exposed to C(60) , but other components of D. magna swimming behavior were not affected. This research supports previous findings and suggests that C(60) may influence D. magna behavior and highlights the need for further research on sublethal behavioral modifications in aquatic organisms in response to nanomaterials. Copyright © 2011 SETAC.

  17. Optical Wavelet Transform for Fingerprint Identification

    DTIC Science & Technology

    1993-12-15

    requirements of digitized fingerprints. This research implements an optical wavelet transform of a fingerprint image, as the first step in an optical... wavelet transform is implemented with continuous shift using an optical correlation between binarized fingerprints written on a Magneto-Optic Spatial

  18. Group-Oriented Fingerprinting for Multimedia Forensics

    NASA Astrophysics Data System (ADS)

    Wang, Z. Jane; Wu, Min; Trappe, Wade; Liu, K. J. Ray

    2004-12-01

    Digital fingerprinting of multimedia data involves embedding information in the content signal and offers protection to the digital rights of the content by allowing illegitimate usage of the content to be identified by authorized parties. One potential threat to fingerprinting is collusion, whereby a group of adversaries combine their individual copies in an attempt to remove the underlying fingerprints. Former studies indicate that collusion attacks based on a few dozen independent copies can confound a fingerprinting system that employs orthogonal modulation. However, in practice an adversary is more likely to collude with some users than with other users due to geographic or social circumstances. To take advantage of prior knowledge of the collusion pattern, we propose a two-tier group-oriented fingerprinting scheme where users likely to collude with each other are assigned correlated fingerprints. Additionally, we extend our construction to represent the natural social and geographic hierarchical relationships between users by developing a more flexible tree-structure-based fingerprinting system. We also propose a multistage colluder identification scheme by taking advantage of the hierarchial nature of the fingerprints. We evaluate the performance of the proposed fingerprinting scheme by studying the collusion resistance of a fingerprinting system employing Gaussian-distributed fingerprints. Our results show that the group-oriented fingerprinting system provides the superior collusion resistance over a system employing orthogonal modulation when knowledge of the potential collusion pattern is available.

  19. Forensic Chemistry: The Revelation of Latent Fingerprints

    ERIC Educational Resources Information Center

    Friesen, J. Brent

    2015-01-01

    The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

  20. Entropy based fingerprint for local crystalline order.

    PubMed

    Piaggi, Pablo M; Parrinello, Michele

    2017-09-21

    We introduce a new fingerprint that allows distinguishing between liquid-like and solid-like atomic environments. This fingerprint is based on an approximate expression for the entropy projected on individual atoms. When combined with local enthalpy, this fingerprint acquires an even finer resolution and it is capable of discriminating between different crystal structures.

  1. Entropy based fingerprint for local crystalline order

    NASA Astrophysics Data System (ADS)

    Piaggi, Pablo M.; Parrinello, Michele

    2017-09-01

    We introduce a new fingerprint that allows distinguishing between liquid-like and solid-like atomic environments. This fingerprint is based on an approximate expression for the entropy projected on individual atoms. When combined with local enthalpy, this fingerprint acquires an even finer resolution and it is capable of discriminating between different crystal structures.

  2. Forensic Chemistry: The Revelation of Latent Fingerprints

    ERIC Educational Resources Information Center

    Friesen, J. Brent

    2015-01-01

    The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

  3. Detection and Rectification of Distorted Fingerprints.

    PubMed

    Si, Xuanbin; Feng, Jianjiang; Zhou, Jie; Luo, Yuxuan

    2015-03-01

    Elastic distortion of fingerprints is one of the major causes for false non-match. While this problem affects all fingerprint recognition applications, it is especially dangerous in negative recognition applications, such as watchlist and deduplication applications. In such applications, malicious users may purposely distort their fingerprints to evade identification. In this paper, we proposed novel algorithms to detect and rectify skin distortion based on a single fingerprint image. Distortion detection is viewed as a two-class classification problem, for which the registered ridge orientation map and period map of a fingerprint are used as the feature vector and a SVM classifier is trained to perform the classification task. Distortion rectification (or equivalently distortion field estimation) is viewed as a regression problem, where the input is a distorted fingerprint and the output is the distortion field. To solve this problem, a database (called reference database) of various distorted reference fingerprints and corresponding distortion fields is built in the offline stage, and then in the online stage, the nearest neighbor of the input fingerprint is found in the reference database and the corresponding distortion field is used to transform the input fingerprint into a normal one. Promising results have been obtained on three databases containing many distorted fingerprints, namely FVC2004 DB1, Tsinghua Distorted Fingerprint database, and the NIST SD27 latent fingerprint database.

  4. Fingerprints in the Dust

    NASA Technical Reports Server (NTRS)

    2001-01-01

    These MISR nadir-camera images of eastern China compare a somewhat hazy summer view from July 9, 2000 (left) with a spectacularly dusty spring view from April 7, 2001 (middle). The left-hand and middle images are from Terra orbits 2967 and 6928, respectively, and extend from central Manchuria near the top to portions of North and South Korea at the bottom. They are approximately 380 kilometers in width.

    Asia's desert areas are prone to soil erosion, as underground water tables are lowered by prolonged drought and by industrial and agricultural water use. Heavy winds blowing eastward across the arid and sparsely vegetated surfaces of Mongolia and western China pick up large quantities of yellow dust. Airborne dust clouds from the April 2001 storm blew across the Pacific Ocean and were carried as far as North America. The minerals transported in this manner are believed to provide nutrients for both oceanic and land ecosystems.

    According to the Xinhua News Agency in China, nearly one million tons of Gobi Desert dust blow into Beijing each year. During a similar dust outbreak last year, the Associated Press reported that the visibility in Beijing had been reduced the point where buildings were barely visible across city streets, and airline schedules were significantly disrupted. The dust has also been implicated in adverse health effects such as respiratory discomfort and eye irritation.

    The image on the right is a higher resolution MISR nadir-camera view of a portion of the April 7, 2001 dust cloud. It covers an area roughly 250 kilometers wide by 470 kilometers high. When viewed at full magnification, a number of atmospheric wave features, like the ridges and valleys of a fingerprint, are apparent. These are probably induced by surface topography, which can disturb the wind flow. A few small cumulus clouds are also visible, and are casting shadows on the thick lower dust layer.

    Analyses of images such as these constitute one phase of MISR

  5. Fingerprints in the Dust

    NASA Technical Reports Server (NTRS)

    2001-01-01

    These MISR nadir-camera images of eastern China compare a somewhat hazy summer view from July 9, 2000 (left) with a spectacularly dusty spring view from April 7, 2001 (middle). The left-hand and middle images are from Terra orbits 2967 and 6928, respectively, and extend from central Manchuria near the top to portions of North and South Korea at the bottom. They are approximately 380 kilometers in width.

    Asia's desert areas are prone to soil erosion, as underground water tables are lowered by prolonged drought and by industrial and agricultural water use. Heavy winds blowing eastward across the arid and sparsely vegetated surfaces of Mongolia and western China pick up large quantities of yellow dust. Airborne dust clouds from the April 2001 storm blew across the Pacific Ocean and were carried as far as North America. The minerals transported in this manner are believed to provide nutrients for both oceanic and land ecosystems.

    According to the Xinhua News Agency in China, nearly one million tons of Gobi Desert dust blow into Beijing each year. During a similar dust outbreak last year, the Associated Press reported that the visibility in Beijing had been reduced the point where buildings were barely visible across city streets, and airline schedules were significantly disrupted. The dust has also been implicated in adverse health effects such as respiratory discomfort and eye irritation.

    The image on the right is a higher resolution MISR nadir-camera view of a portion of the April 7, 2001 dust cloud. It covers an area roughly 250 kilometers wide by 470 kilometers high. When viewed at full magnification, a number of atmospheric wave features, like the ridges and valleys of a fingerprint, are apparent. These are probably induced by surface topography, which can disturb the wind flow. A few small cumulus clouds are also visible, and are casting shadows on the thick lower dust layer.

    Analyses of images such as these constitute one phase of MISR

  6. Comet Assay on Daphnia magna in eco-genotoxicity testing.

    PubMed

    Pellegri, Valerio; Gorbi, Gessica; Buschini, Annamaria

    2014-10-01

    Detection of potentially hazardous compounds in water bodies is a priority in environmental risk assessment. For the evaluation and monitoring of water quality, a series of methodologies may be applied. Among them, the worldwide used toxicity tests with organisms of the genus Daphnia is one of the most powerful. In recent years, some attempts were made to utilize Daphnia magna in genotoxicity testing as many of the new environmental contaminants are described as DNA-damaging agents in aquatic organisms. The aim of this research was to develop a highly standardized protocol of the Comet Assay adapted for D. magna, especially regarding the isolation of cells derived from the same tissue (haemolymph) from newborn organisms exposed in vivo. Several methods for haemolymph extraction and different Comet Assay parameters were compared. Electrophoretic conditions were adapted in order to obtain minimum DNA migration in cells derived from untreated organisms and, at the same time, maximum sensitivity in specimens treated with known genotoxicants (CdCl2 and H2O2). Additional tests were performed to investigate if life-history traits of the cladoceran (such as the age of adult organisms that provide newborns, the clutch size of origin, the number of generations reared in standard conditions) and the water composition as well, might influence the response of the assay. This study confirms the potential application of the Comet Assay in D. magna for assessing genotoxic loads in aqueous solution. The newly developed protocol could integrate the acute toxicity bioassay, thus expanding the possibility of using this model species in freshwater monitoring (waters, sediment and soil elutriates) and is in line with the spirit of the EU Water Framework Directive in reducing the number of bioassays that involve medium-sized species.

  7. Protective effects of ectoine on heat-stressed Daphnia magna.

    PubMed

    Adam, Bownik; Zofia, Stępniewska; Tadeusz, Skowroński

    2014-12-01

    Ectoine (ECT) is an amino acid produced and accumulated by halophilic bacteria in stressful conditions in order to prevent the loss of water from the cell. There is a lack of knowledge on the effects of ECT in heat-stressed aquatic animals. The purpose of our study was to determine the influence of ECT on Daphnia magna subjected to heat stress with two temperature gradients: 1 and 0.1 °C/min in the range of 23-42 °C. Time to immobilisation, survival during recovery, swimming performance, heart rate, thoracic limb movement and the levels of heat shock protein 70 kDa 1A (HSP70 1A), catalase (CAT) and nitric oxide species (NOx) were determined in ECT-exposed and unexposed daphnids; we showed protective effects of ECT on Daphnia magna subjected to heat stress. Time to immobilisation of daphnids exposed to ECT was longer when compared to the unexposed animals. Also, survival rate during the recovery of daphnids previously treated with ECT was higher. ECT significantly attenuated a rapid increase of mean swimming velocity which was elevated in the unexposed daphnids. Moreover, we observed elevation of thoracic limb movement and modulation of heart rate in ECT-exposed animals. HSP70 1A and CAT levels were reduced in the presence of ECT. On the other hand, NOx level was slightly elevated in both ECT-treated and unexposed daphnids, however slightly higher NOx level was found in ECT-treated animals. We conclude that the exposure to ectoine has thermoprotective effects on Daphnia magna, however their mechanisms are not associated with the induction of HSP70 1A.

  8. Acute toxicity of 50 metals to Daphnia magna.

    PubMed

    Okamoto, Akira; Yamamuro, Masumi; Tatarazako, Norihisa

    2015-07-01

    Metals are essential for human life and physiological functions but may sometimes cause disorders. Therefore, we conducted acute toxicity testing of 50 metals in Daphnia magna: EC50s of seven elements (Be, Cu, Ag, Cd, Os, Au and Hg) were < 100 µg l(-1) ; EC50s of 13 elements (Al, Sc, Cr, Co, Ni, Zn, Se, Rb, Y, Rh, Pt, Tl and Pb) were between 100 and 1000 µg l(-1) ; EC50s of 14 elements (Li, V, Mn, Fe, Ge, As, In, Sn, Sb, Te, Cs, Ba, W and Ir) were between 1,001 and 100,000 µg l(-1) ; EC50s of six elements (Na, Mg, K, Ca, Sr and Mo) were > 100,000 µg l(-1) ; and. 7 elements (Ti, Zr, Bi, Nb, Hf, Re and Ta) did not show EC50 at the upper limit of respective aqueous solubility, and EC50s were not obtained. Ga, Ru and Pd adhered to the body of D. magna and physically retarded the movement of D. magna. These metals formed hydroxides after adjusting the pH. Therefore, here, we distinguished this physical effect from the physiological toxic effect. The acute toxicity results of 40 elements obtained in this study were not correlated with electronegativity. Similarly, the acute toxicity results of metals including the rare metals were also not correlated with first ionization energy, atomic weight, atomic number, covalent radius, atomic radius or ionic radius. Copyright © 2014 John Wiley & Sons, Ltd.

  9. Statistical validation of structured population models for Daphnia magna.

    PubMed

    Adoteye, Kaska; Banks, H T; Cross, Karissa; Eytcheson, Stephanie; Flores, Kevin B; LeBlanc, Gerald A; Nguyen, Timothy; Ross, Chelsea; Smith, Emmaline; Stemkovski, Michael; Stokely, Sarah

    2015-08-01

    In this study we use statistical validation techniques to verify density-dependent mechanisms hypothesized for populations of Daphnia magna. We develop structured population models that exemplify specific mechanisms and use multi-scale experimental data in order to test their importance. We show that fecundity and survival rates are affected by both time-varying density-independent factors, such as age, and density-dependent factors, such as competition. We perform uncertainty analysis and show that our parameters are estimated with a high degree of confidence. Furthermore, we perform a sensitivity analysis to understand how changes in fecundity and survival rates affect population size and age-structure.

  10. Effects of metal salt mixtures on Daphnia magna reproduction

    SciTech Connect

    Biesinger, K.E.; Christensen, G.M.; Fiandt, J.T.

    1986-02-01

    Three binary metal experiments were conducted using a complete block design; testing the chlorides of Cd, Hg, and Zn individually and in combinations of Cd-Hg, Cd-Zn, and Zn-Hg on Daphnia magna reproduction. These mixtures were tested at one-half, once, and twice the 16% reproductive impairment concentration previously determined for individual metals. The Cd-Hg, Cd-Zn, and Zn-Hg mixtures all showed significant reductions in reproduction at concentrations where the metal salts alone caused no significant effect.

  11. Evolving transcriptomic fingerprint based on genome‐wide data as prognostic tools in prostate cancer

    PubMed Central

    Schliekelman, Mark; Shin, Heesun; Erho, Nicholas; Davicioni, Elai

    2015-01-01

    Background Information Prostate cancer (PCa) is a common disease but only a small subset of patients are at risk of developing metastasis and lethal disease, and identifying which patients will progress is challenging because of the heterogeneity underlying tumour progression. Understanding this heterogeneity at the molecular level and the resulting clinical impact is a critical step necessary for risk stratification. Defining genomic fingerprint elucidates molecular variation and may improve PCa risk stratification, providing more accurate prognostic information of tumour aggressiveness (or lethality) for prognostic biomarker development. Therefore, we explored transcriptomic differences between patients with indolent disease outcome and patients who developed metastasis post‐radical prostatectomy using genome‐wide expression data in the post radical prostatectomy clinical space before metastatic spread. Results Based on differential expression analysis, patients with adverse pathological findings who are at higher risk of developing metastasis have a distinct transcriptomic fingerprint that can be detected on surgically removed prostate specimens several years before metastasis detection. Nearly half of the transcriptomic fingerprint features were non‐coding RNA highlighting their pivotal role in PCa progression. Protein‐coding RNA features in the fingerprint are involved in multiple pathways including cell cycle, chromosome structure maintenance and cytoskeleton organisation. The metastatic transcriptomic fingerprint was determined in independent cohorts verifying the association between the fingerprint and metastatic patients. Further, the fingerprint was confirmed in metastasis lesions demonstrating that the fingerprint represents early metastatic transcriptomic changes, suggesting its utility as a prognostic tool to predict metastasis and provide clinical value in the early radical prostatectomy setting. Conclusions Here, we show that transcriptomic

  12. On the spatial distribution of fingerprint singularities.

    PubMed

    Cappelli, Raffaele; Maltoni, Davide

    2009-04-01

    Fingerprint singularities play an important role in several fingerprint recognition and classification systems. Although some general relationships and constraints about the location of singularities in the different fingerprint classes are well known, to the best of our knowledge no statistical models have been developed until now. This paper studies the spatial distributions of singularity locations in nature and derives, from a representative dataset of labelled samples, the probability density functions of the four main fingerprint classes. The results obtained can be directly exploited to improve the accuracy of many techniques relying on the position of singularities, as confirmed by the results of two experiments on fingerprint classification and synthesis.

  13. Determination of mRNA expression of DMRT93B, vitellogenin, and cuticle 12 in Daphnia magna and their biomarker potential for endocrine disruption.

    PubMed

    Kim, Jungkon; Kim, Younghee; Lee, Sangwoo; Kwak, Kyunghee; Chung, Wook-Jin; Choi, Kyungho

    2011-11-01

    We explored the use of molecular genetic biomarkers for endocrine disruption in Daphnia magna after the exposure to fenoxycarb (FOC), a model juvenile hormone analog. For this purpose, the mRNA expression patterns of DMRT93B (DMRT, sex determination), cuticle 12 (CUT, molting), and vitellogenin (VTG, embryo development) were determined in D. magna. Furthermore, these results were compared with developmental abnormality and reproduction performance. The fold changes of CUT and VTG mRNA expression showed significant dose-response relationship with FOC exposure. Relative mRNA expressions of DMRT and CUT showed notable changes at as low as 1 ng/l FOC. After chronic exposure FOC significantly delayed the first day of reproduction and decreased the number of young and growth rate even at 10 ng/l FOC. A concentration-dependant trend in reproduction effect was also observed. Developmental abnormality such as poorly developed second antennae and curved or unextended shell spines were observed. These results suggest that the three mRNAs, i.e., DMRT, CUT, and VTG can be used as biomarkers of endocrine disrupting effects in D. magna.

  14. Enhancing contrast of fingerprints on plastic tape.

    PubMed

    Steele, Charles A; Ball, Mikki S

    2003-11-01

    Many of the currently available fingerprinting methods have limited ability to visualize fingerprints on plastic tape without expensive equipment or significant handling of the sample. This is especially true for visualizing fingerprints on black electrical tape. This study sought a hands-off method to produce easy visualization of fingerprints on different types of plastic tape, including black electrical tape, without the need for expensive equipment. The methods selected were to sublime disperse dyes into the tape, both with and without the fuming of cyanoacrylate, everywhere except for where the fingerprint was applied. The resulting color contrasts provided enough differentiation to visualize fingerprints on plastic tape under ambient light. Sequential fuming with cyanoacrylate followed by disperse dyes provided the best visualizations on all tapes, and cyanoacrylate followed by disperse yellow 211 clearly visualized fingerprints on black electrical tape.

  15. MAGNA++: Maximizing Accuracy in Global Network Alignment via both node and edge conservation.

    PubMed

    Vijayan, V; Saraph, V; Milenković, T

    2015-07-15

    Network alignment aims to find conserved regions between different networks. Existing methods aim to maximize total similarity over all aligned nodes (i.e. node conservation). Then, they evaluate alignment quality by measuring the amount of conserved edges, but only after the alignment is constructed. Thus, we recently introduced MAGNA (Maximizing Accuracy in Global Network Alignment) to directly maximize edge conservation while producing alignments and showed its superiority over the existing methods. Here, we extend the original MAGNA with several important algorithmic advances into a new MAGNA++ framework. MAGNA++ introduces several novelties: (i) it simultaneously maximizes any one of three different measures of edge conservation (including our recent superior [Formula: see text] measure) and any desired node conservation measure, which further improves alignment quality compared with maximizing only node conservation or only edge conservation; (ii) it speeds up the original MAGNA algorithm by parallelizing it to automatically use all available resources, as well as by reimplementing the edge conservation measures more efficiently; (iii) it provides a friendly graphical user interface for easy use by domain (e.g. biological) scientists; and (iv) at the same time, MAGNA++ offers source code for easy extensibility by computational scientists. http://www.nd.edu/∼cone/MAGNA++/ © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. [Acute toxicity of different type pesticide surfactants to Daphnia magna].

    PubMed

    Li, Xiu-huan; Li, Hua; Chen, Cheng-yu; Li, Jian-tao; Liu, Feng

    2013-08-01

    By using the standard test methods in Experimental Guideline for Environmental Safety Evaluation of Chemical Pesticide to aquatic organisms, a comparative study was conducted on the acute toxicity of 39 nonionic, 6 anionic, and 3 cationic surfactants to Daphnia magna. The acute toxicity of three cationic surfactants 1427, 1227 and C8-10 to D. magna belonged to virulent level, and the toxicity of 1427 was the highest, with the EC50 value being 0.97 x 10(-2) mg x L(-1). The acute toxicity of nonionic surfactants polyoxyethylene ether castor oil EL, Tween, and Span emulsifiers belonged to low level, but the toxicity of alkylphenol polyoxyethylene ether and fatty alcohol polyoxyethylene ether surfactants was relatively high, of which, AEO-7 and AEO-5 displayed high toxicity, with the EC50 value being 0.82 and 0.97 mg x L(-1), respectively. In these surfactants, the more liposolubility, the higher the toxicity was. Most of the anionic surfactants were medium in toxicity, but the acute toxicity of NNO belonged to high toxicity, with the EC50 value being 0.17 mg x L(-1).

  17. Biotransformation and bioconcentration of pyrene in Daphnia magna.

    PubMed

    Akkanen, Jarkko; Kukkonen, Jussi V K

    2003-06-19

    Water fleas (Daphnia magna) were exposed to [14C]pyrene in the presence and absence of piperonyl butoxide (PBO), a general cytochrome P450 (CYP) inhibitor, in organic carbon-free artificial freshwater (AFW, DOC<0.2 mg l(-1)) and in natural lake water (DOC=19.9 mg l(-1)) for 24 h. The bioconcentration of total radioactivity after 24 h exposure was 50% lower in the natural lake water, indicating decreased bioavailability of pyrene by the dissolved organic matter. However, the proportions of parent compound were only ca. 12 and 19% of the total body burden in daphnids exposed in AFW and natural lake water, respectively. Therefore, the tissue concentration of the parent pyrene was not significantly different in the daphnids exposed in the two different waters. Due to extensive biotransformation the bioconcentration factor (BCF) of parent pyrene was only 16 and 23% of the BCF calculated on the basis of total radioactivity in the daphnids in AFW and natural lake water, respectively. The proportion of parent pyrene was significantly higher (over 60%) in the daphnids exposed simultaneously to PBO, which indicates the involvement of CYP monooxygenases in the biotransformation. Furthermore, increasing PBO concentration decreased the accumulation of total radioactivity in AFW but not in the natural lake water. The data demonstrate capability and importance of CYP monooxygenases in biotransformation of polycyclic aromatic hydrocarbons in D. magna.

  18. Aquatic acute toxicity assessments of molybdenum (+VI) to Daphnia magna.

    PubMed

    Wang, Chi-Wei; Liang, Chenju; Yeh, Hui-Ju

    2016-03-01

    Generally, molybdenum (Mo) metals in the environment are very rare, but wastewater discharges from industrial processes may contain high concentrations of Mo, which has the potential to contaminate water or soil if not handled properly. In this study, the impact of three common compounds of hexavalent Mo (sodium molybdate (Na2MoO4‧2H2O), ammonium molybdate ((NH4)6Mo7O24‧4H2O) and molybdenum trioxide (MoO3)) in an aquatic system were assessed based on 48-h exposure acute toxicity to Daphnia magna (D. magna). The LC50 toxicities for associated conjugate ions including Na(+), Cl(-), SO4(2-), and NH4(+) were determined. Furthermore, the LC50 values for the three forms of hexavalent Mo were determined, and the acute toxicities of the Mo forms were found to follow the order: (NH4)6Mo7O24‧4H2O > MoO3 > Na2MoO4‧2H2O in solution. (NH4)6Mo7O24‧4H2O exhibited the lowest LC50 of 43.3 mg L(-1) (corresponding to 23.5 mg Mo L(-1)) among the three molybdenum salts. The research confirmed that the toxicity of molybdenum in the aquatic system is highly dependent on the form of molybdenum salts used, and is also associated with the influence of the background water quality.

  19. Acute toxicities of six manufactured nanomaterial suspensions to Daphnia magna

    NASA Astrophysics Data System (ADS)

    Zhu, Xiaoshan; Zhu, Lin; Chen, Yongsheng; Tian, Shengyan

    2009-01-01

    The rapid growth of nanotechnology is stimulating research on the potential environmental impacts of manufactured nanomaterials (MNMs). This paper summarizes a comprehensive study on the 48-h acute toxicity of water suspensions of six MNMs (i.e., ZnO, TiO2, Al2O3, C60, SWCNTs, and MWCNTs) to Daphnia magna, using immobilization and mortality as toxicological endpoints. The results show that the acute toxicities of all MNMs tested are dose dependent. The EC50 values for immobilization ranged from 0.622 mg/L (ZnO NPs) to 114.357 mg/L (Al2O3 NPs), while the LC50 values for mortality ranged from 1.511 mg/L (ZnO NPs) to 162.392 mg/L (Al2O3 NPs). In these tests, TiO2, Al2O3, and carbon-based nanomaterials were more toxic than their bulk counterparts. Moreover, D. magna were found to ingest nanomaterials from the test solutions through feeding behaviors, which indicates that the potential ecotoxicities and environmental health effects of these MNMs cannot be neglected.

  20. Fingerprint reconstruction: from minutiae to phase.

    PubMed

    Feng, Jianjiang; Jain, Anil K

    2011-02-01

    Fingerprint matching systems generally use four types of representation schemes: grayscale image, phase image, skeleton image, and minutiae, among which minutiae-based representation is the most widely adopted one. The compactness of minutiae representation has created an impression that the minutiae template does not contain sufficient information to allow the reconstruction of the original grayscale fingerprint image. This belief has now been shown to be false; several algorithms have been proposed that can reconstruct fingerprint images from minutiae templates. These techniques try to either reconstruct the skeleton image, which is then converted into the grayscale image, or reconstruct the grayscale image directly from the minutiae template. However, they have a common drawback: Many spurious minutiae not included in the original minutiae template are generated in the reconstructed image. Moreover, some of these reconstruction techniques can only generate a partial fingerprint. In this paper, a novel fingerprint reconstruction algorithm is proposed to reconstruct the phase image, which is then converted into the grayscale image. The proposed reconstruction algorithm not only gives the whole fingerprint, but the reconstructed fingerprint contains very few spurious minutiae. Specifically, a fingerprint image is represented as a phase image which consists of the continuous phase and the spiral phase (which corresponds to minutiae). An algorithm is proposed to reconstruct the continuous phase from minutiae. The proposed reconstruction algorithm has been evaluated with respect to the success rates of type-I attack (match the reconstructed fingerprint against the original fingerprint) and type-II attack (match the reconstructed fingerprint against different impressions of the original fingerprint) using a commercial fingerprint recognition system. Given the reconstructed image from our algorithm, we show that both types of attacks can be successfully launched against

  1. Network fingerprint: a knowledge-based characterization of biomedical networks

    PubMed Central

    Cui, Xiuliang; He, Haochen; He, Fuchu; Wang, Shengqi; Li, Fei; Bo, Xiaochen

    2015-01-01

    It can be difficult for biomedical researchers to understand complex molecular networks due to their unfamiliarity with the mathematical concepts employed. To represent molecular networks with clear meanings and familiar forms for biomedical researchers, we introduce a knowledge-based computational framework to decipher biomedical networks by making systematic comparisons to well-studied “basic networks”. A biomedical network is characterized as a spectrum-like vector called “network fingerprint”, which contains similarities to basic networks. This knowledge-based multidimensional characterization provides a more intuitive way to decipher molecular networks, especially for large-scale network comparisons and clustering analyses. As an example, we extracted network fingerprints of 44 disease networks in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The comparisons among the network fingerprints of disease networks revealed informative disease-disease and disease-signaling pathway associations, illustrating that the network fingerprinting framework will lead to new approaches for better understanding of biomedical networks. PMID:26307246

  2. Identification of chemical-specific protein profiles in Daphnia magna using neural networks

    SciTech Connect

    Iamonte, T.; Broadt, T.; Bradley, B.

    1995-12-31

    One dimensional gel electrophoresis was performed on whole-animal homogenates of 10 Daphnia magna exposed for 48 hours to one toxic and one non-toxic concentration of 2,4-dinitrophenol and sodium pentachlorophenate, two uncouplers of oxidative phosphorylation; malathion, an organophosphate; and permethrine, a pyrethroid, along with culture water and solvent controls, as appropriate. Ten randomized complete block exposures were conducted to minimize among-cohort variability. The 10-animal samples were gel electrophoresed, visualized using neutral silver staining and digitized with a Molecular Dynamics personal laser densitometer equipped with ImageQuant software. Densitometric data were used in a commercial neural network software package to construct a learning set, or database, of the protein profiles induced by the known chemical treatments. Novel data sets were then presented to the neural network program for assignment to treatment categories. Although no differences in protein profile between controls and chemical treatments and among chemical treatments could be detected visually in one dimensional gels, the neural network was able to correctly assign each sample to the appropriate learned treatment category about 70 percent of the time. Key proteins used by the neural network software to learn the protein profile of each chemical were identified by molecular weight and assigned a relative importance for identification of that chemical.

  3. Open-source platform to benchmark fingerprints for ligand-based virtual screening

    PubMed Central

    2013-01-01

    Similarity-search methods using molecular fingerprints are an important tool for ligand-based virtual screening. A huge variety of fingerprints exist and their performance, usually assessed in retrospective benchmarking studies using data sets with known actives and known or assumed inactives, depends largely on the validation data sets used and the similarity measure used. Comparing new methods to existing ones in any systematic way is rather difficult due to the lack of standard data sets and evaluation procedures. Here, we present a standard platform for the benchmarking of 2D fingerprints. The open-source platform contains all source code, structural data for the actives and inactives used (drawn from three publicly available collections of data sets), and lists of randomly selected query molecules to be used for statistically valid comparisons of methods. This allows the exact reproduction and comparison of results for future studies. The results for 12 standard fingerprints together with two simple baseline fingerprints assessed by seven evaluation methods are shown together with the correlations between methods. High correlations were found between the 12 fingerprints and a careful statistical analysis showed that only the two baseline fingerprints were different from the others in a statistically significant way. High correlations were also found between six of the seven evaluation methods, indicating that despite their seeming differences, many of these methods are similar to each other. PMID:23721588

  4. Open-source platform to benchmark fingerprints for ligand-based virtual screening.

    PubMed

    Riniker, Sereina; Landrum, Gregory A

    2013-05-30

    : Similarity-search methods using molecular fingerprints are an important tool for ligand-based virtual screening. A huge variety of fingerprints exist and their performance, usually assessed in retrospective benchmarking studies using data sets with known actives and known or assumed inactives, depends largely on the validation data sets used and the similarity measure used. Comparing new methods to existing ones in any systematic way is rather difficult due to the lack of standard data sets and evaluation procedures. Here, we present a standard platform for the benchmarking of 2D fingerprints. The open-source platform contains all source code, structural data for the actives and inactives used (drawn from three publicly available collections of data sets), and lists of randomly selected query molecules to be used for statistically valid comparisons of methods. This allows the exact reproduction and comparison of results for future studies. The results for 12 standard fingerprints together with two simple baseline fingerprints assessed by seven evaluation methods are shown together with the correlations between methods. High correlations were found between the 12 fingerprints and a careful statistical analysis showed that only the two baseline fingerprints were different from the others in a statistically significant way. High correlations were also found between six of the seven evaluation methods, indicating that despite their seeming differences, many of these methods are similar to each other.

  5. Chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Milazzo, D.P.

    1988-01-01

    Data generated from daphnid chronic toxicity tests are used by various regulatory agencies for the development of water quality criteria. Two chemicals which are lacking reported chronic data are aniline and 2,4-dichlorophenol. The acute toxicity of 2,4-dichlorophenol to Daphnia magna has been reported; the toxicity of aniline to D. magna also has been reported. Chronic data for these chemicals are lacking for invertebrates. The objective of this study was to estimate the chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus, using a standard 21-day static renewal procedure.

  6. DNA decontamination of fingerprint brushes.

    PubMed

    Szkuta, Bianca; Oorschot, Roland A H van; Ballantyne, Kaye N

    2017-08-01

    Genetic profiling of DNA collected from fingerprints that have been exposed to various enhancement techniques is routine in many forensic laboratories. As a result of direct contact with fingermark residues during treatment, there is concern around the DNA contamination risk of dusting fingermarks with fingerprint brushes. Previous studies have demonstrated the potential for cross-contamination between evidentiary items through various mechanisms, highlighting the risk of using the same fingerprint brush to powder multiple surfaces within and between crime-scenes. Experiments were performed to assess the contamination risk of reused fingerprint brushes through the transfer of dried saliva and skin deposits from and to glass surfaces with new unused squirrel hair and fiberglass brushes. Additional new unused brushes and brushes previously used in casework were also tested for their ability to contaminate samples. In addition, the ability to eradicate DNA from used squirrel hair and fiberglass fingerprint brushes was assessed using a 1% sodium hypochlorite solution and a 5% solution of a commercially available alternative, Virkon. DNA profiling results from surfaces contacted by treated and untreated brushes were compared to determine the effectiveness of the devised cleaning protocol. Brush durability was also assessed over multiple wash/rinse/dry cycles with both agents. Varying amounts of DNA-containing material were collected and transferred by squirrel hair and fiberglass brushes, with detectability on the secondary surface dependent on the biological nature of the material being transferred. The impact of DNA contamination from dirty fingerprint brushes was most apparent in simulations involving the transfer of dried saliva and brushes previously used in casework, while minimal transfer of touch DNA was observed. Alarmingly, large quantities of DNA were found to reside on new unused squirrel hair brushes, while no DNA was detected on new unused fiberglass

  7. Investigation of PDE5/PDE6 and PDE5/PDE11 selective potent tadalafil-like PDE5 inhibitors using combination of molecular modeling approaches, molecular fingerprint-based virtual screening protocols and structure-based pharmacophore development.

    PubMed

    Kayık, Gülru; Tüzün, Nurcan Ş; Durdagi, Serdar

    2017-12-01

    The essential biological function of phosphodiesterase (PDE) type enzymes is to regulate the cytoplasmic levels of intracellular second messengers, 3',5'-cyclic guanosine monophosphate (cGMP) and/or 3',5'-cyclic adenosine monophosphate (cAMP). PDE targets have 11 isoenzymes. Of these enzymes, PDE5 has attracted a special attention over the years after its recognition as being the target enzyme in treating erectile dysfunction. Due to the amino acid sequence and the secondary structural similarity of PDE6 and PDE11 with the catalytic domain of PDE5, first-generation PDE5 inhibitors (i.e. sildenafil and vardenafil) are also competitive inhibitors of PDE6 and PDE11. Since the major challenge of designing novel PDE5 inhibitors is to decrease their cross-reactivity with PDE6 and PDE11, in this study, we attempt to identify potent tadalafil-like PDE5 inhibitors that have PDE5/PDE6 and PDE5/PDE11 selectivity. For this aim, the similarity-based virtual screening protocol is applied for the "clean drug-like subset of ZINC database" that contains more than 20 million small compounds. Moreover, molecular dynamics (MD) simulations of selected hits complexed with PDE5 and off-targets were performed in order to get insights for structural and dynamical behaviors of the selected molecules as selective PDE5 inhibitors. Since tadalafil blocks hERG1 K channels in concentration dependent manner, the cardiotoxicity prediction of the hit molecules was also tested. Results of this study can be useful for designing of novel, safe and selective PDE5 inhibitors.

  8. Orientation field estimation for latent fingerprint enhancement.

    PubMed

    Feng, Jianjiang; Zhou, Jie; Jain, Anil K

    2013-04-01

    Identifying latent fingerprints is of vital importance for law enforcement agencies to apprehend criminals and terrorists. Compared to live-scan and inked fingerprints, the image quality of latent fingerprints is much lower, with complex image background, unclear ridge structure, and even overlapping patterns. A robust orientation field estimation algorithm is indispensable for enhancing and recognizing poor quality latents. However, conventional orientation field estimation algorithms, which can satisfactorily process most live-scan and inked fingerprints, do not provide acceptable results for most latents. We believe that a major limitation of conventional algorithms is that they do not utilize prior knowledge of the ridge structure in fingerprints. Inspired by spelling correction techniques in natural language processing, we propose a novel fingerprint orientation field estimation algorithm based on prior knowledge of fingerprint structure. We represent prior knowledge of fingerprints using a dictionary of reference orientation patches. which is constructed using a set of true orientation fields, and the compatibility constraint between neighboring orientation patches. Orientation field estimation for latents is posed as an energy minimization problem, which is solved by loopy belief propagation. Experimental results on the challenging NIST SD27 latent fingerprint database and an overlapped latent fingerprint database demonstrate the advantages of the proposed orientation field estimation algorithm over conventional algorithms.

  9. Fingerprint verification prediction model in hand dermatitis.

    PubMed

    Lee, Chew K; Chang, Choong C; Johor, Asmah; Othman, Puwira; Baba, Roshidah

    2015-07-01

    Hand dermatitis associated fingerprint changes is a significant problem and affects fingerprint verification processes. This study was done to develop a clinically useful prediction model for fingerprint verification in patients with hand dermatitis. A case-control study involving 100 patients with hand dermatitis. All patients verified their thumbprints against their identity card. Registered fingerprints were randomized into a model derivation and model validation group. Predictive model was derived using multiple logistic regression. Validation was done using the goodness-of-fit test. The fingerprint verification prediction model consists of a major criterion (fingerprint dystrophy area of ≥ 25%) and two minor criteria (long horizontal lines and long vertical lines). The presence of the major criterion predicts it will almost always fail verification, while presence of both minor criteria and presence of one minor criterion predict high and low risk of fingerprint verification failure, respectively. When none of the criteria are met, the fingerprint almost always passes the verification. The area under the receiver operating characteristic curve was 0.937, and the goodness-of-fit test showed agreement between the observed and expected number (P = 0.26). The derived fingerprint verification failure prediction model is validated and highly discriminatory in predicting risk of fingerprint verification in patients with hand dermatitis. © 2014 The International Society of Dermatology.

  10. Optical wavelet transform for fingerprint identification

    NASA Astrophysics Data System (ADS)

    MacDonald, Robert P.; Rogers, Steven K.; Burns, Thomas J.; Fielding, Kenneth H.; Warhola, Gregory T.; Ruck, Dennis W.

    1994-03-01

    The Federal Bureau of Investigation (FBI) has recently sanctioned a wavelet fingerprint image compression algorithm developed for reducing storage requirements of digitized fingerprints. This research implements an optical wavelet transform of a fingerprint image, as the first step in an optical fingerprint identification process. Wavelet filters are created from computer- generated holograms of biorthogonal wavelets, the same wavelets implemented in the FBI algorithm. Using a detour phase holographic technique, a complex binary filter mask is created with both symmetry and linear phase. The wavelet transform is implemented with continuous shift using an optical correlation between binarized fingerprints written on a Magneto-Optic Spatial Light Modulator and the biorthogonal wavelet filters. A telescopic lens combination scales the transformed fingerprint onto the filters, providing a means of adjusting the biorthogonal wavelet filter dilation continuously. The wavelet transformed fingerprint is then applied to an optical fingerprint identification process. Comparison between normal fingerprints and wavelet transformed fingerprints shows improvement in the optical identification process, in terms of rotational invariance.

  11. Neurogenesis in the water flea Daphnia magna (Crustacea, Branchiopoda) suggests different mechanisms of neuroblast formation in insects and crustaceans.

    PubMed

    Ungerer, Petra; Eriksson, Bo Joakim; Stollewerk, Angelika

    2011-09-01

    Within euarthropods, the morphological and molecular mechanisms of early nervous system development have been analysed in insects and several representatives of chelicerates and myriapods, while data on crustaceans are fragmentary. Neural stem cells (neuroblasts) generate the nervous system in insects and in higher crustaceans (malacostracans); in the remaining euarthropod groups, the chelicerates (e.g. spiders) and myriapods (e.g. millipedes), neuroblasts are missing. In the latter taxa, groups of neural precursors segregate from the neuroectoderm and directly differentiate into neurons and glial cells. In all euarthropod groups, achaete-scute homologues are required for neuroblast/neural precursor group formation. In the insects Drosophila melanogaster and Tribolium castaneum achaete-scute homologues are initially expressed in clusters of cells (proneural clusters) in the neuroepithelium but expression becomes restricted to the future neuroblast. Subsequently genes such as snail and prospero are expressed in the neuroblasts which are required for asymmetric division and differentiation. In contrast to insects, malacostracan neuroblasts do not segregate into the embryo but remain in the outer neuroepithelium, similar to vertebrate neural stem cells. It has been suggested that neuroblasts are present in another crustacean group, the branchiopods, and that they also remain in the neuroepithelium. This raises the questions how the molecular mechanisms of neuroblast selection have been modified during crustacean and insect evolution and if the segregation or the maintenance of neuroblasts in the neuroepithelium represents the ancestral state. Here we take advantage of the recently published Daphnia pulex (branchiopod) genome and identify genes in Daphnia magna that are known to be required for the selection and asymmetric division of neuroblasts in the fruit fly D. melanogaster. We unambiguously identify neuroblasts in D. magna by molecular marker gene expression and

  12. Evidence of transmission of tuberculosis by DNA fingerprinting.

    PubMed Central

    Godfrey-Faussett, P.; Mortimer, P. R.; Jenkins, P. A.; Stoker, N. G.

    1992-01-01

    OBJECTIVE--To determine whether a subject who had died of tuberculous meningitis had been infected by a neighbour. DESIGN--Retrospective comparison of isolates of Mycobacterium tuberculosis from the two cases and from 10 controls by DNA fingerprinting. SETTING--Public Health Service Reference Laboratory for Mycobacteria and bacterial molecular genetics unit of the London School of Hygiene and Tropical Medicine. SUBJECTS--Deceased and neighbour; 10 controls from the same city, from whom isolates had been collected over three months before the subject's death. MAIN OUTCOME MEASURES--Identity and similarity values (SAB) between fingerprint patterns from different isolates obtained by hybridisation of restriction fragments produced by PvuII with a probe from the insertion element IS6110/986, present in multiple copies throughout the genome of M tuberculosis. RESULTS--Isolates from the two cases under investigation had identical fingerprints whereas those from the controls were all distinct. Two clusters of isolates with a similarity coefficient > 0.25 were identified: in one, four out of five patients were born in the midlands (the birth place of the fifth was not known) and in the other all three patients were born in the Indian subcontinent. CONCLUSIONS--The data are consistent with, but do not prove, transmission of tuberculosis from the neighbour to the deceased. Geographical separation of the pools of infection may have led to the evolution of distinct clusters of fingerprint patterns. DNA fingerprinting of M tuberculosis is a powerful new tool for study of the epidemiology and pathogenesis of tuberculosis. Images FIG 1 PMID:1392824

  13. A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

    PubMed Central

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  14. A support vector machine approach for truncated fingerprint image detection from sweeping fingerprint sensors.

    PubMed

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-03-31

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates.

  15. Stereoselective virtual screening of the ZINC database using atom pair 3D-fingerprints.

    PubMed

    Awale, Mahendra; Jin, Xian; Reymond, Jean-Louis

    2015-01-01

    Tools to explore large compound databases in search for analogs of query molecules provide a strategically important support in drug discovery to help identify available analogs of any given reference or hit compound by ligand based virtual screening (LBVS). We recently showed that large databases can be formatted for very fast searching with various 2D-fingerprints using the city-block distance as similarity measure, in particular a 2D-atom pair fingerprint (APfp) and the related category extended atom pair fingerprint (Xfp) which efficiently encode molecular shape and pharmacophores, but do not perceive stereochemistry. Here we investigated related 3D-atom pair fingerprints to enable rapid stereoselective searches in the ZINC database (23.2 million 3D structures). Molecular fingerprints counting atom pairs at increasing through-space distance intervals were designed using either all atoms (16-bit 3DAPfp) or different atom categories (80-bit 3DXfp). These 3D-fingerprints retrieved molecular shape and pharmacophore analogs (defined by OpenEye ROCS scoring functions) of 110,000 compounds from the Cambridge Structural Database with equal or better accuracy than the 2D-fingerprints APfp and Xfp, and showed comparable performance in recovering actives from decoys in the DUD database. LBVS by 3DXfp or 3DAPfp similarity was stereoselective and gave very different analogs when starting from different diastereomers of the same chiral drug. Results were also different from LBVS with the parent 2D-fingerprints Xfp or APfp. 3D- and 2D-fingerprints also gave very different results in LBVS of folded molecules where through-space distances between atom pairs are much shorter than topological distances. 3DAPfp and 3DXfp are suitable for stereoselective searches for shape and pharmacophore analogs of query molecules in large databases. Web-browsers for searching ZINC by 3DAPfp and 3DXfp similarity are accessible at www.gdb.unibe.ch and should provide useful assistance to drug

  16. Data requirements for the reliable use of atomic pair distribution functions in amorphous pharmaceutical fingerprinting.

    PubMed

    Dykhne, Timur; Taylor, Ryan; Florence, Alastair; Billinge, Simon J L

    2011-05-01

    To determine the optimal measurement strategy for fingerprinting condensed phases of pharmaceutical systems using atomic pair distribution functions (PDFs) obtained from data collected using several types of x-ray diffraction instruments. PDFs of crystalline and amorphous-phase molecular systems derived from data accessible to copper-, molybdenum-, and silver-anode laboratory sources were compared to one another and synchrotron data using qualitative and quantitative methods. We find that reliable fingerprinting is still possible using silver and molybdenum laboratory sources, but data from copper anode laboratory sources are unreliable for fingerprinting, yielding ambiguous and potentially incorrect results. The ambiguities make data measured using low energy x-rays unsuitable for fingerprinting active pharmaceutical ingredients and small molecule systems, and, in general, copper anode diffractometers are undesirable for this purpose; however, laboratory x-ray sources with either Mo or Ag anodes are well suited for this application.

  17. Graphene Nanopres for DNA Fingerprinting

    NASA Astrophysics Data System (ADS)

    Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

    2013-03-01

    The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

  18. The dichotomous oxyregulatory behaviour of the planktonic crustacean Daphnia magna.

    PubMed

    Pirow, R; Buchen, I

    2004-02-01

    The dual function of appendage movement (food acquisition, ventilation) proved to be the key to explaining the peculiar oxyregulatory repertoire of the planktonic filter feeder Daphnia magna. Short-term hypoxic exposure experiments with normoxia-acclimated animals under varying food concentrations revealed a dichotomous response pattern with a compensatory tachycardia under food-free conditions and a ventilatory compensation prevailing under food-rich conditions. Food-free, normoxic conditions resulted in maximum appendage beating rates (fA) and half-maximum heart rates (fH), which restricted the scope for oxyregulation to the circulatory system. Food-rich conditions (10(5) algal cells ml(-1)), on the contrary, had a depressing effect on fA whereas fH increased to 83% of the maximum. In this physiological state, D. magna was able to respond to progressive hypoxia with a compensatory increase in ventilation. A conceptual and mathematical model was developed to analyse the efficiency of ventilatory and circulatory adjustments in improving oxygen transport to tissue. Model predictions showed that an increase in perfusion rate was most effective under both food-free and food-rich conditions in reducing the critical ambient oxygen tension (PO2crit) at which oxygen supply to the tissue started to become impeded. By contrast, a hypothetical increase in ventilation rate had almost no effect on PO2crit under food-free conditions, indicating that appendage movement is driven by nutritive rather than respiratory requirements. However, the model predicted a moderate reduction of PO2crit by hyperventilation under food-rich conditions. Since the regulatory scope for an adjustment in fH was found to be limited in D. magna under these conditions, the increase in ventilation rate is the means of choice for a fed animal to cope with short-term, moderate reductions in ambient oxygen availability. Under long-term and more severe hypoxic conditions, however, the increase in the

  19. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    PubMed Central

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-01-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm−1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light–matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon–phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications. PMID:27460765

  20. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    NASA Astrophysics Data System (ADS)

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-07-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm-1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light-matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon-phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications.

  1. [Genetic fingerprints and computerised databases].

    PubMed

    Sabatier, Myriam

    2003-01-01

    The computerised databases of genetic fingerprints are laboratory tools and by extension law enforcement tools, for which the European Union has defined the applications. As these genetic profiles give no information on specific hereditary characteristics, these bases have been established in order to respect the rights and fundamental liberties of each individual. Compatible at the international level, nobody contests today their rewards in the fight against crime.

  2. FROG - Fingerprinting Genomic Variation Ontology.

    PubMed

    Abinaya, E; Narang, Pankaj; Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: "FingeRprinting Ontology of Genomic variations" is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog.

  3. Developmental outcome of children with enlargement of the cisterna magna identified in utero.

    PubMed

    Dror, Raheli; Malinger, Gustavo; Ben-Sira, Liat; Lev, Dorit; Pick, Chaim G; Lerman-Sagie, Tally

    2009-12-01

    An enlarged cisterna magna can be identified during routine ultrasound screening in the second half of pregnancy. It is important to be able to give an accurate prognosis. We evaluated the developmental outcome of these children. A total of 29 fetuses with a large cisterna magna identified in utero were compared to 35 children with a normal fetal ultrasound. The children were evaluated by the Gesell Developmental Schedules and the Peabody Developmental Motor Scale. The study group showed a significantly worse performance in the Gesell test. However, the overall performance for both groups was within normal limits. Four children in the study group had a borderline developmental quotient. Both groups performed similarly in the Peabody test. Walking age was significantly delayed in the study group. Children with an enlarged cisterna magna may be at risk for mild developmental delay. In cases of nonisolated enlargement of the cisterna magna, the outcome may be guarded.

  4. Ecotoxicological evaluation of selected pharmaceuticals to Vibrio fischeri and Daphnia magna before and after photooxidation process.

    PubMed

    Czech, Bożena; Jośko, Izabela; Oleszczuk, Patryk

    2014-06-01

    The aim of the research was the determination of the toxicity of photocatalytically treated water contaminated by different pharmaceuticals: chloramphenicol (CPL), diclofenac (DCF) or metoprolol (MT). Daphtoxkit F™ with Dapnia magna and Microtox(®) with Vibrio fischeri were used to evaluate the toxicity of the water before and after treatment. D. magna showed higher sensitivity to the presence of pharmaceuticals than V. fischeri. Generally, both tested organisms revealed the greatest sensitivity to the presence of CPL. The application of photocatalytic oxidation has resulted in decreased toxicity. It may confirm the reduction of high toxic parent compounds to less toxic metabolites. The toxicity was reduced in the range from 30% to 100% depending on pharmaceutical tested. The highest reduction of toxicity to V. fischeri and D. magna was observed to MT and CPL respectively. Depending on bioassay the toxicity decrease as follows: CPL>DCF>MT for D. magna and CPL>MT>DCF for V. fischeri.

  5. A novel approach for fingerprinting mummified hands.

    PubMed

    Fields, Roy; Molina, D Kimberley

    2008-07-01

    Fingerprinting has long been used as a method for identifying bodies and, since first discovered, many advances have been made in both fingerprint acquisition and interpretation. However, in the field of forensic pathology, the attainment of fingerprints from mummified bodies has remained difficult. The most common technique historically used to obtain fingerprints in these cases usually employs the amputation of the fingers combined with soaking and/or injecting the fingers with various solutions in order to enhance the fingerprints. A novel approach to fingerprinting mummified fingers is presented which involves removal and rehydration of the fingerpads (including the epidermal, dermal, and adipose tissues) followed by inking and rolling, using a gloved finger for support. The technique presented produces a superior quality of print without amputation of the finger, yielding excellent results and assisting in obtaining positive identification.

  6. A Computational Discriminability Analysis on Twin Fingerprints

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Srihari, Sargur N.

    Sharing similar genetic traits makes the investigation of twins an important study in forensics and biometrics. Fingerprints are one of the most commonly found types of forensic evidence. The similarity between twins’ prints is critical establish to the reliability of fingerprint identification. We present a quantitative analysis of the discriminability of twin fingerprints on a new data set (227 pairs of identical twins and fraternal twins) recently collected from a twin population using both level 1 and level 2 features. Although the patterns of minutiae among twins are more similar than in the general population, the similarity of fingerprints of twins is significantly different from that between genuine prints of the same finger. Twins fingerprints are discriminable with a 1.5%~1.7% higher EER than non-twins. And identical twins can be distinguished by examine fingerprint with a slightly higher error rate than fraternal twins.

  7. Self-assembled dynamic 3D fingerprints in liquid-crystal coatings towards controllable friction and adhesion.

    PubMed

    Liu, Danqing; Broer, Dirk J

    2014-04-25

    Chiral-nematic polymer network coatings form a "fingerprint" texture through self-assembly. For this purpose the molecular helix of the coating is oriented parallel to the substrate. The coating has a flat surface but when actuated by light in the presence of a copolymerized azobenzene compound, 3D fingerprint structures appear in the coating. The helix forms protrusions at the positions where the molecules are aligned parallel to the surface and withdraws at the positions where the orientation is perpendicular. This process proceeds rapidly and is reversible, that is, the fingerprint-shaped protrusions disappear when the light is switched off. The texture in the on-state resembles that of a human fingerprint and is used to manipulate the gripping friction of a robotic finger. The friction coefficient drops by a factor of four to five when the fingerprint switched on because of reduced surface contacts.

  8. Acute toxicity of cyanogen chloride to Daphnia magna

    SciTech Connect

    Kononen, D.W.

    1988-09-01

    The destruction of cyanide in waste waters by chlorination has been shown to result in the formation of the extremely toxic compound, cyanogen chloride. Industrial cyanide-containing waste waters may be treated by a batch chlorination process under highly alkaline conditions prior to being discharged into a receiving water systems. Alternatively, if the concentration of cyanide is relatively low, and such waste waters may be diverted to municipal waste treatment facilities where they may be subjected to a process of chlorination which may not be sufficient for the complete oxidative destruction of the available cyanide. Although a large body of literature exists concerning the toxicity of HCN and metallic cyanide compounds to aquatic organisms, there is a comparative scarcity of information concerning cyanogen chloride toxicity. This study was designed to determine the acute toxicity of CNCl to Daphnia magna neonates under static bioassay conditions.

  9. An objective fingerprint quality-grading system.

    PubMed

    Pulsifer, Drew P; Muhlberger, Sarah A; Williams, Stephanie F; Shaler, Robert C; Lakhtakia, Akhlesh

    2013-09-10

    The grading of fingerprint quality by fingerprint examiners as currently practised is a subjective process. Therefore, an objective system was devised to remove the subjectivity. The devised grading system is quantitative and uses three separate, easily available, software packages to ultimately identify the portions of a fingerprint that correspond to low-, medium-, and high-quality definitive minutiae as defined on the Universal Latent Workstation of the US Federal Bureau of Investigation. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Automated FingerPrint Background removal: FPB.

    PubMed

    Scalabrin, Simone; Morgante, Michele; Policriti, Alberto

    2009-04-30

    The construction of a whole-genome physical map has been an essential component of numerous genome projects initiated since the inception of the Human Genome Project. Its usefulness has been proved for whole-genome shotgun projects as a post-assembly validation and recently it has also been used in the assembly step to constrain on BACs positions. Fingerprinting is usually the method of choice for construction of physical maps. A clone fingerprint is composed of true peaks representing real fragments and background peaks, mainly composed of E. coli genomic DNA, partial digestions, star activity by-products, and machine background. High-throughput fingerprinting leads to the production of thousands of BAC clone fingerprints per day. That is why background peaks removal has become an important issue and needs to be automatized, especially in capillary electrophoresis based fingerprints. At the moment, the only tools available for such a task are GenoProfiler and its descendant FPMiner. The large variation in the quality of fingerprints that is usually present in large fingerprinting projects represents a major difficulty in the correct removal of background peaks that has only been partially addressed by the methods so far adopted that all require a long manual optimization of parameters. Thus, we implemented a new data-independent tool, FPB (FingerPrint Background removal), suitable for large scale projects as well as mapping of few clones. FPB is freely available at http://www.appliedgenomics.org/tools.php. FPB was used to remove the background from all fingerprints of three grapevine physical map projects. The first project consists of about 50,000 fingerprints, the second one consists of about 70,000 fingerprints, and the third one consists of about 45,000 fingerprints. In all cases a successful assembly was built.

  11. Design and Analysis of Chronic Aquatic Tests of Toxicity with Daphnia magna.

    DTIC Science & Technology

    1981-12-01

    A.. .A...A... * A.... ct. * . .2 .A - - ’-..- .. .I. • o .~ AD __ DESIGN AND ANALYSIS OF CHRONIC AQUATIC TESTS OF TOXICITY WITH DAPHNIA MAGNA...1981 OF TOXICITY WITH DAPHNIA MACNA S. PERFORMING ORG. REPORT NUMBER p G-7673 7. AUTHOR(e) 6. CONTRACT OR GRANT NUMBER(&) Paul I. Feder DAMDl7-80-C...SUPPLEMENTARY NOTES 19. KEY WORDS (Continue on reveree aide It neceeary and Identify by block number) Daphnia Magna confidence intervals outlier detection 5

  12. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    SciTech Connect

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  13. Genes mirror geography in Daphnia magna.

    PubMed

    Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

    2015-09-01

    Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history. © 2015 John Wiley & Sons Ltd.

  14. Toxicity of new generation flame retardants to Daphnia magna.

    PubMed

    Waaijers, Susanne L; Hartmann, Julia; Soeter, A Marieke; Helmus, Rick; Kools, Stefan A E; de Voogt, Pim; Admiraal, Wim; Parsons, John R; Kraak, Michiel H S

    2013-10-01

    There is a tendency to substitute frequently used, but relatively hazardous brominated flame retardants (BFRs) with halogen-free flame retardants (HFFRs). Consequently, information on the persistence, bioaccumulation and toxicity (PBT) of these HFFRs is urgently needed, but large data gaps and inconsistencies exist. Therefore, in the present study the toxicity of a wide range of HFFRs to the water flea Daphnia magna was investigated. Our results revealed that four HFFRs were showing no effect at their Sw (saturated water concentration) and three had a low toxicity (EC50>10 mg L(-1)), suggesting that these compounds are not hazardous. Antimony trioxide had a moderate toxicity (EC50=3.01 mg L(-1), 95% CL: 2.76-3.25) and triphenyl phosphate and the brominated reference compound tetra bromobisphenol A were highly toxic to D. magna (EC50=0.55 mg L(-1), 95% CL: 0.53-0.55 and EC50=0.60 mg L(-1), 95% CL: 0.24-0.97 respectively). Aluminum trihydroxide and bisphenol A bis(diphenyl phosphate) caused limited mortality at Sw (26 and 25% respectively) and have a low solubility (<10 mg L(-1)). Hence, increased toxicity of these compounds may be observed when for instance decreasing pH could increase solubility. By testing all compounds under identical conditions we provided missing insights in the environmental hazards of new generation flame retardants and propose as best candidates for BFR replacements: APP, ALPI, DOPO, MHO, MPP, ZHS and ZS. © 2013 Elsevier B.V. All rights reserved.

  15. On relative distortion in fingerprint comparison.

    PubMed

    Kalka, Nathan D; Hicklin, R Austin

    2014-11-01

    When fingerprints are deposited, non-uniform pressure in conjunction with the inherent elasticity of friction ridge skin often causes linear and non-linear distortions in the ridge and valley structure. The effects of these distortions must be considered during analysis of fingerprint images. Even when individual prints are not notably distorted, relative distortion between two prints can have a serious impact on comparison. In this paper we discuss several metrics for quantifying and visualizing linear and non-linear fingerprint deformations, and software tools to assist examiners in accounting for distortion in fingerprint comparisons.

  16. The connecting link! Lip prints and fingerprints

    PubMed Central

    Negi, Amita; Negi, Anurag

    2016-01-01

    Background: Lip prints and fingerprints are considered to be unique to each individual. The study of fingerprints and lip prints is very popular in personal identification of the deceased and in criminal investigations. Aims: This study was done to find the predominant lip and fingerprint patterns in males and females in the North Indian population and also to find any correlation between lip print and fingerprint patterns within a gender. Materials and Methods: Two hundred students (100 males, 100 females) were included in the study. Lip prints were recorded for each individual using a dark-colored lipstick and the right thumb impression was recorded using an ink pad. The lip prints and fingerprints were analyzed using a magnifying glass. The Chi-square test was used for statistical analysis. Results: The branched pattern in males and the vertical pattern in females were the predominant lip print patterns. The predominant fingerprint pattern in both males and females was found to be the loop pattern, followed by the whorl pattern and then the arch pattern. No statistically significant correlation was found between lip prints and fingeprints. However, the arch type of fingerprint was found to be associated with different lip print patterns in males and females. Conclusion: Lip prints and fingerprints can be used for personal identification in a forensic scenario. Further correlative studies between lip prints and fingerprints could be useful in forensic science for gender identification. PMID:28123281

  17. Fingerprint imaging of dry finger using photoacoustics.

    PubMed

    Choi, Won Young; Park, Kwan Kyu

    2017-03-01

    Fingerprint imaging has been widely used in biometric identification systems. This work presents a photoacoustic (PA) fingerprint imaging system that provides acoustic resolution using a pulsed laser and focused ultrasound transducer operating as a receiver. This PA system can measure dry fingers with a wide-range laser field based on the differences in the ultrasound coupling between the fingertip areas contacting and not contacting a solid plate. To demonstrate and validate the image accuracy of the PA system, PA fingerprint images were compared to images captured using a pulse-echo ultrasound system and an ink-pressed fingerprint scan.

  18. Aqueous and dietary bioaccumulation of antibiotic tetracycline in D. magna and its multigenerational transfer.

    PubMed

    Kim, Hyun Young; Jeon, Junho; Hollender, Juliane; Yu, Seungho; Kim, Sang Don

    2014-08-30

    The potential bioaccumulation and distribution of antibiotics in non-target organisms have been inadequately studied in spite of their widespread occurrence in aquatic systems. We investigated the ability of tetracycline to bioaccumulate through aqueous and dietary routes in an aquatic organism, the freshwater crustacean Daphnia magna. D. magna was exposed to algal food (Pseudokirchneriella subcapitata) contaminated with tetracycline for dietary uptake. Tetracycline was transferred to D. magna more through aqueous uptake than through dietary uptake. The uptake rate constant of tetracycline for D. magna was kin,water=0.33±0.045 via the aqueous route and kin,food=0.16±0.012 via the dietary route for 1.0mgL(-1) tetracycline. Bioconcentration factors of 4.40±0.91Lkg(-1) and 3.66±0.50Lkg(-1) for 0.1 and 1.0mgL(-1) tetracycline were found for D. magna. The biomagnification factor of 0.19±0.04 indicates that magnification of tetracycline through the food web will not occur. The change in the internal concentration of the target compound was also studied for multigenerational (F1-F4) exposure. The internal concentration in D. magna showed a decreasing trend with increasing generations except for the parent generation. The bioaccumulation tendency showed a biphasic change in multigenerational exposure. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Toxaphene detoxification and acclimation in Daphnia magna: do cytochrome P-450 enzymes play a role?

    PubMed

    Kashian, Donna R

    2004-01-01

    Toxaphene is a persistent environmental contaminant that has been shown to alter male production in Daphnia magna and to induce P-450 activity in mammals. Cytochrome P-450-mediated metabolism may lead to xenobiotic detoxification resulting in acclimation. To determine if D. magna acclimate to toxaphene via P-450 pathways, chronic and acute toxicity tests were conducted with D. magna exposed to toxaphene in the presence and absence of piperonyl butoxide (PBO), an inhibitor of cytochrome P-450 enzymes. Toxaphene exposure increased male production in acute but not chronic assays, indicating that D. magna may acclimate to chronic toxaphene exposure. Upon co-administration of toxaphene and PBO in chronic tests, D. magna exhibited a decline in growth rate, fecundity and survival. The observed toxaphene acclimation in chronic tests, along with its increased toxicity in the presence of a P-450 suppressor, suggests that P-450 enzymes may contribute to detoxification and subsequent acclimation of D. magna to chronic toxaphene exposure. Additional chronic toxicity tests indicated that toxaphene acclimation occurs between 7 and 12 days following initial exposure, at which time sex determination is no longer affected. Thus, sublethal toxaphene toxicity effects such as reproductive impairments may be detectable with acute but not chronic tests, potentially due to the upregulation of P-450 isozymes.

  20. Effects of vertebrate hormones on development and sex determination in Daphnia magna.

    PubMed

    Kashian, Donna R; Dodson, Stanley I

    2004-05-01

    Daphnia (Crustacea) are extensively used as model organisms in ecotoxicology; however, little is known regarding their endocrine system. This study examines Daphnia vulnerability to vertebrate hormones. Twelve natural or synthetic vertebrate hormones were screened for activity on developmental and reproductive processes in Daphnia magna. Natural hormones tested included: beta-estradiol, gonadotropin, hydrocortisone, insulin, melatonin, progesterone, somatostatin, testosterone, and thyroxine at concentrations ranging from 1 to 100 microg/L. Synthetic hormones tested included diethylstilbestrol (estrogenic), R-1881 (androgen), and ICI-182,780 (antiestrogen); all hormones were screened with a 6-d assay. Additionally, progesterone, insulin, testosterone, and thyroxine were screened for 25 d. Diethylstilbestrol decreased D. magna growth rate while thyroxine increased it. Short-term testosterone exposure reduced D. magna fecundity; however, long-term exposure did not, potentially indicating testosterone hydroxylation with long-term exposure. Hormones commonly considered sex-hormones (estrogens and androgens) in vertebrates do not appear to control sexual differentiation in D. magna; however, several vertebrate hormones do affect reproduction and development in D. magna making D. magna a potentially useful tool in monitoring for the presence of these hormones or compounds that mimic them.

  1. SufA--a novel subtilisin-like serine proteinase of Finegoldia magna.

    PubMed

    Karlsson, Christofer; Andersson, Marie-Louise; Collin, Mattias; Schmidtchen, Artur; Björck, Lars; Frick, Inga-Maria

    2007-12-01

    Finegoldia magna is an anaerobic Gram-positive bacterium and commensal, which is also associated with clinically important conditions such as skin and soft tissue infections. This study describes a novel subtilisin-like extracellular serine proteinase of F. magna, denoted SufA (subtilase of Finegoldia magna), which is believed to be the first subtilase described among Gram-positive anaerobic cocci. SufA is associated with the bacterial cell surface, but is also released in substantial amounts during bacterial growth. Papain was used to release SufA from the surface of F. magna and the enzyme was purified by ion-exchange chromatography and gel filtration. A protein band on SDS-PAGE corresponding to the dominating proteolytic activity on gelatin zymography was analysed by MS/MS. Based on the peptide sequences obtained, the sufA gene was sequenced. The gene comprises 3466 bp corresponding to a preprotein of 127 kDa. Like other members of the subtilase family, SufA contains the catalytic triad of aspartic acid, histidine and serine with surrounding conserved residues. A SufA homologue was identified in 33 of 34 investigated isolates of F. magna, as revealed by PCR and immunoprinting. The enzyme forms dimers, which are more proteolytically active than the monomeric protein. SufA was found to efficiently cleave and inactivate the antibacterial peptide LL-37 and the CXC chemokine MIG/CXCL9, indicating that the enzyme promotes F. magna survival and colonization.

  2. Effects of Microcystis aeruginosa on life history of water flea Daphnia magna

    NASA Astrophysics Data System (ADS)

    Liu, Liping; Li, Kang; Chen, Taoying; Dai, Xilin; Jiang, Min; Diana, James S.

    2011-07-01

    Cyanobacterial blooms in eutrophic freshwater systems are a worldwide problem, creating adverse effects for many aquatic organisms by producing toxic microcystins and deteriorating water quality. In this study, microcystins (MCs) in Microcystis aeruginosa, and Daphnia magna exposed to M. aeruginosa, were analyzed by HPLC-MS, and the effects of M. aeruginosa on D. magna were investigated. When D. magna was exposed to M. aeruginosa for more than 2 h, Microcystin-LR (MC-LR) was detected. When exposed to 1.5 × 106, 3 × 106, 0.75 × 107, and 1.5 × 107 cell/mL of M. aeruginosa for 96 h, average survival of D. magna for treatments were 23.33%, 33.33%, 13.33%, 16.67%, respectively, which were significantly lower than the average 100% survival in the control group ( P < 0.05). The adverse effects of M. aeruginosa on body length, time for the first brood, brood numbers, gross fecundity, lifespan, and population growth of D. magna were density-dependent. These results suggest that the occurrence of M. aeruginosa blooms could strongly inhibit the population growth of D. magna through depression of survival, individual growth and gross fecundity. In the most serious situations, M. aeruginosa blooms could undermine the food web by eliminating filter-feeding zooplankton, which would destroy the ecological balance of aquaculture water bodies.

  3. Experimental models of microcystin accumulation in Daphnia magna grazing on Planktothrix rubescens: implications for water management.

    PubMed

    Shams, Shiva; Cerasino, Leonardo; Salmaso, Nico; Dietrich, Daniel R

    2014-03-01

    In this study, we investigated the kinetic aspects of the microcystin (MC) transfer from Planktothrix rubescens to Daphnia magna by carrying out exposure experiments in small simple mesocosms. We hypothesized that higher fractions of toxic cyanobacteria in the diet of grazers would shift the balance towards a greater than linear, i.e. non-linear accumulation of MC in D. magna. This hypothesis was tested by exposing D. magna to varying initial densities of MC-producing P. rubescens. The evolving models of MC accumulation differed largely as a result of the duration of exposure and initial MC concentrations used. Within the first 24h of exposure, MC accumulation in D. magna was linear, irrespective of the initial densities of toxic P. rubescens and thus MC concentrations. After 48 h of exposure, MC accumulation in D. magna showed an exponential pattern, possibly due to a delayed digestion of P. rubescens and/or decreased MC detoxification capabilities when compared with higher ambient concentrations of MC. After 72 h toxin concentrations in Daphnia drop in all experiments as a consequence of the reduced cyanobacterial cells in the medium and the detoxification of MC within Daphnia. The results obtained suggest that in lakes with higher MC content and longer cyanobacterial bloom period MC accumulation in D. magna should be more pronounced than in mesotrophic lakes with lower MC content. The latter interpretation, however, should be verified investigating accumulation of MC both in larger mesocosms and in situ, in lakes of different trophic status.

  4. Evolutionary variation in neural gene expression in the developing sense organs of the crustacean Daphnia magna.

    PubMed

    Klann, Marleen; Stollewerk, Angelika

    2017-04-01

    Arthropods have numerous sense organs, which are adapted to their habitat. While some sense organs are similar in structure and function in all arthropod groups, structural differences in functionally related sense organs have been described, as well as the absence of particular sense organ subtypes in individual arthropod groups. Here we address the question of how the diverse structures of arthropod sense organs have evolved by analysing the underlying molecular developmental processes in a crustacean, an arthropod group that has been neglected so far. We have investigated the development of four types of chemo- and mechanosensory sense organs in the branchiopod Daphnia magna (Cladocera) that either cannot be found in arthropods other than crustaceans or represent adaptations to an aquatic environment. The formation of the sensory organ precursors shows greater similarity to the arthropod taxa Chelicerata and Myriapoda than to the more closely related insects. All analysed sense organ types co-express the proneural genes ASH and atonal regardless of their structure and function. In contrast, in Drosophila melanogaster, ASH and atonal expression does not overlap and the genes confer different sense organ subtype identities. We performed experimental co-expression studies in D. melanogaster and found that the combinatorial expression of ato and ASH can change the external structure of sense organs. Our results indicate a central role for ASH and Atonal family members in the emergence of structural variations in arthropod sense organs.

  5. Systems Biology Approach Reveals a Calcium-Dependent Mechanism for Basal Toxicity in Daphnia magna.

    PubMed

    Antczak, Philipp; White, Thomas A; Giri, Anirudha; Michelangeli, Francesco; Viant, Mark R; Cronin, Mark T D; Vulpe, Chris; Falciani, Francesco

    2015-09-15

    The expanding diversity and ever increasing amounts of man-made chemicals discharged to the environment pose largely unknown hazards to ecosystem and human health. The concept of adverse outcome pathways (AOPs) emerged as a comprehensive framework for risk assessment. However, the limited mechanistic information available for most chemicals and a lack of biological pathway annotation in many species represent significant challenges to effective implementation of this approach. Here, a systems level, multistep modeling strategy demonstrates how to integrate information on chemical structure with mechanistic insight from genomic studies, and phenotypic effects to define a putative adverse outcome pathway. Results indicated that transcriptional changes indicative of intracellular calcium mobilization were significantly overrepresented in Daphnia magna (DM) exposed to sublethal doses of presumed narcotic chemicals with log Kow ≥ 1.8. Treatment of DM with a calcium ATPase pump inhibitor substantially recapitulated the common transcriptional changes. We hypothesize that calcium mobilization is a potential key molecular initiating event in DM basal (narcosis) toxicity. Heart beat rate analysis and metabolome analysis indicated sublethal effects consistent with perturbations of calcium preceding overt acute toxicity. Together, the results indicate that altered calcium homeostasis may be a key early event in basal toxicity or narcosis induced by lipophilic compounds.

  6. Cloning and characterization of the ecdysone receptor and ultraspiracle protein from the water flea Daphnia magna.

    PubMed

    Kato, Yasuhiko; Kobayashi, Kaoru; Oda, Shigeto; Tatarazako, Norihisa; Watanabe, Hajime; Iguchi, Taisen

    2007-04-01

    cDNAs encoding the ecdysone receptor (EcR) and ultra spiracle (USP) protein were cloned from the water flea Daphnia magna (Crustacea: Cladocera). The deduced EcR and USP amino acid sequences showed a high degree of homology to those of other crustaceans as well as insects. We isolated three isoforms of EcR that differ in the A/B domain. Quantitative PCR analysis indicated differing temporal expression patterns of the EcR isoforms during the molting period and demonstrated that the expression of one subtype correlated well with the timing of molt. Using cDNAs encoding EcR and USP, we constructed a Daphnia EcR/USP reporter based on a two-hybrid system. The gene fusions encoded the EcR ligand-binding domain (LBD) fused to the Gal4 DNA-binding domain, and the USP-LBD fused to the Vp16 activation domain. These chimeric genes were transfected with a luciferase reporter gene. Dose-dependent activation of the reporter gene could be observed when transfectants were exposed to Ec and other chemicals known to have Ec-like activities. This two-hybrid system may represent a useful reporter system for further examination of hormonal and chemical effects on Daphnia at the molecular level.

  7. Microorganism Identification Based On MALDI-TOF-MS Fingerprints

    NASA Astrophysics Data System (ADS)

    Elssner, Thomas; Kostrzewa, Markus; Maier, Thomas; Kruppa, Gary

    Advances in MALDI-TOF mass spectrometry have enabled the ­development of a rapid, accurate and specific method for the identification of bacteria directly from colonies picked from culture plates, which we have named the MALDI Biotyper. The picked colonies are placed on a target plate, a drop of matrix solution is added, and a pattern of protein molecular weights and intensities, "the protein fingerprint" of the bacteria, is produced by the MALDI-TOF mass spectrometer. The obtained protein mass fingerprint representing a molecular signature of the microorganism is then matched against a database containing a library of previously measured protein mass fingerprints, and scores for the match to every library entry are produced. An ID is obtained if a score is returned over a pre-set threshold. The sensitivity of the techniques is such that only approximately 104 bacterial cells are needed, meaning that an overnight culture is sufficient, and the results are obtained in minutes after culture. The improvement in time to result over biochemical methods, and the capability to perform a non-targeted identification of bacteria and spores, potentially makes this method suitable for use in the detect-to-treat timeframe in a bioterrorism event. In the case of white-powder samples, the infectious spore is present in sufficient quantity in the powder so that the MALDI Biotyper result can be obtained directly from the white powder, without the need for culture. While spores produce very different patterns from the vegetative colonies of the corresponding bacteria, this problem is overcome by simply including protein fingerprints of the spores in the library. Results on spores can be returned within minutes, making the method suitable for use in the "detect-to-protect" timeframe.

  8. jCompoundMapper: An open source Java library and command-line tool for chemical fingerprints.

    PubMed

    Hinselmann, Georg; Rosenbaum, Lars; Jahn, Andreas; Fechner, Nikolas; Zell, Andreas

    2011-01-10

    The decomposition of a chemical graph is a convenient approach to encode information of the corresponding organic compound. While several commercial toolkits exist to encode molecules as so-called fingerprints, only a few open source implementations are available. The aim of this work is to introduce a library for exactly defined molecular decompositions, with a strong focus on the application of these features in machine learning and data mining. It provides several options such as search depth, distance cut-offs, atom- and pharmacophore typing. Furthermore, it provides the functionality to combine, to compare, or to export the fingerprints into several formats. We provide a Java 1.6 library for the decomposition of chemical graphs based on the open source Chemistry Development Kit toolkit. We reimplemented popular fingerprinting algorithms such as depth-first search fingerprints, extended connectivity fingerprints, autocorrelation fingerprints (e.g. CATS2D), radial fingerprints (e.g. Molprint2D), geometrical Molprint, atom pairs, and pharmacophore fingerprints. We also implemented custom fingerprints such as the all-shortest path fingerprint that only includes the subset of shortest paths from the full set of paths of the depth-first search fingerprint. As an application of jCompoundMapper, we provide a command-line executable binary. We measured the conversion speed and number of features for each encoding and described the composition of the features in detail. The quality of the encodings was tested using the default parametrizations in combination with a support vector machine on the Sutherland QSAR data sets. Additionally, we benchmarked the fingerprint encodings on the large-scale Ames toxicity benchmark using a large-scale linear support vector machine. The results were promising and could often compete with literature results. On the large Ames benchmark, for example, we obtained an AUC ROC performance of 0.87 with a reimplementation of the extended

  9. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    PubMed

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

  10. DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

    PubMed Central

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

  11. Proteomic analysis in Daphnia magna exposed to As(III), As(V) and Cd heavy metals and their binary mixtures for screening potential biomarkers.

    PubMed

    Le, Thai-Hoang; Lim, Eun-Suk; Hong, Nam-Hui; Lee, Sung-Kyu; Shim, Yon Sik; Hwang, Jin Rae; Kim, Yang-Hoon; Min, Jiho

    2013-11-01

    In this study, the effects of three widespread heavy metals, As(III), As(V) and Cd, and their binary mixtures on the proteomic profile in D. magna were examined to screen novel protein biomarkers using the two-dimensional gel electrophoresis method (2DE). Ten 20d daphnia were exposed to the LC20 concentrations for each of a total of 8 treatments, including the control, As(III), As(V), Cd, [As(III)+As(V)], [As(III)+Cd], [As(V)+Cd], and [As(III), As(V), Cd], for 24h before protein isolation. Three replicates were performed for each treatment. These protein samples were employed for 2DE experiments with a pH gradient gel strip from pH 3 to pH 10. The protein spots were detected by a silver staining process and their intensities were analyzed by Progenesis software to discover the differentially expressed proteins (DEPs) in response to each heavy metal. A total of 117 differentially expressed proteins (DEPs) were found in daphnia responding to the 8 treatments and mapped onto a 2D proteome map, which provides some information of the molecular weight (MW) and pI value for each protein. All of these DEPs are considered as potential candidates for protein biomarkers in D. magna for detecting heavy metals in the aquatic ecosystem. Comparing the proteomic results among these treatments suggested that exposing D. magna to binary mixtures of heavy metals may result in some complex interactive molecular responses within them, rather than just the simple sum of the proteomic profiles of the individual chemicals, (As(III), As(V), and Cd).

  12. Blind camera fingerprinting and image clustering.

    PubMed

    Bloy, Greg J

    2008-03-01

    Previous studies have shown how to "fingerprint" a digital camera given a set of images known to come from the camera. A clustering technique is proposed to construct such fingerprints from a mixed set of images, enabling identification of each image's source camera without any prior knowledge of source.

  13. DNA Fingerprinting in a Forensic Teaching Experiment

    ERIC Educational Resources Information Center

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  14. Tools for quality control of fingerprint databases

    NASA Astrophysics Data System (ADS)

    Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

    2010-04-01

    Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

  15. Chemical Fingerprinting Program for RSRM Critical Materials

    NASA Technical Reports Server (NTRS)

    McClennen, William H.; Fife, Dennis J.; Killpack, Michael O.; Golde, Rick P.; Cash, Steve (Technical Monitor)

    2002-01-01

    This viewgraph presentation provides information on the chemical fingerprinting of RSRM (Reusable Sold Rocket Motor) components. A chemical fingerprint can be used to identify a material, to differentiate it from similar looking materials, or lead to its source. It can also identify unexpected changes to a vendor or supplier's material, and monitor aging.

  16. DNA Fingerprinting in a Forensic Teaching Experiment

    ERIC Educational Resources Information Center

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  17. Fingerprint Compression Based on Sparse Representation.

    PubMed

    Shao, Guangqi; Wu, Yanping; A, Yong; Liu, Xiao; Guo, Tiande

    2014-02-01

    A new fingerprint compression algorithm based on sparse representation is introduced. Obtaining an overcomplete dictionary from a set of fingerprint patches allows us to represent them as a sparse linear combination of dictionary atoms. In the algorithm, we first construct a dictionary for predefined fingerprint image patches. For a new given fingerprint images, represent its patches according to the dictionary by computing l(0)-minimization and then quantize and encode the representation. In this paper, we consider the effect of various factors on compression results. Three groups of fingerprint images are tested. The experiments demonstrate that our algorithm is efficient compared with several competing compression techniques (JPEG, JPEG 2000, and WSQ), especially at high compression ratios. The experiments also illustrate that the proposed algorithm is robust to extract minutiae.

  18. Integrated fingerprinting in secure digital cinema projection

    NASA Astrophysics Data System (ADS)

    Delannay, Damien; Delaigle, Jean-Francois; Macq, Benoit M. M.; Quisquater, Jean-Jacques; Mas Ribes, Joan M.; Boucqueau, Jean M.; Nivart, Jean-Francois

    2001-12-01

    This paper describes the functional model of a combined conditional access and fingerprinting copyright (-or projectionright) protection system in a digital cinema framework. In the cinema industry, a large part of early movie piracy comes from copies made in the theater itself with a camera. The evolution towards digital cinema broadcast enables watermark based fingerprinting protection systems. Besides an appropriate fingerprinting technology, a number of well defined security/cryptographic tools are integrated in order to guaranty the integrity of the whole system. The requirements are two-fold: On one side, we must ensure that the media content is only accessible at exhibition time (under specific authorization obtained after an ad-hoc film rental agreement) and contains the related exhibition fingerprint. At the other end, we must prove our ability to retrieve the fingerprint information from an illegal copy of the media.

  19. Experimental infection of liver flukes, Fasciola hepatica and Fascioloides magna, in Bison (Bison bison).

    PubMed

    Foreyt, William J; Drew, M L

    2010-01-01

    This experimental study was conducted to evaluate the susceptibility of American bison (Bison bison) to liver flukes, Fascioloides magna and Fasciola hepatica. Six bison were each experimentally inoculated with 600 metacercariae of Fascioloides magna, and three were later treated with triclabendazole suspension at 40 mg/kg of body weight. Four additional bison were each experimentally inoculated with 600 metacercariae of Fasciola hepatica. Five control bison were placebo controls. Two controls and all inoculated bison were euthanized 10 mo (Fascioloides magna) and 7 mo (Fasciola hepatica) after inoculation. None of the control bison or the bison inoculated with Fascioloides magna had flukes or lesions characteristic of fluke infection at necropsy. All four bison inoculated with Fasciola hepatica had characteristic liver fluke lesions at necropsy, and three of four bison contained four, 103, and 111 adult flukes, respectively. Fluke eggs were detected in feces of all Fasciola hepatica-inoculated bison during the experiment, but not from the Fascioloides magna-infected bison or control bison. Clinical signs of infection were not observed during the experiment, but hemoglobin and packed cell volumes were lower in the Fasciola hepatica bison when compared to controls, and eosinophil levels were increased. Triclabendazole at 40 mg/kg of body weight appeared to be safe in bison because no toxic reactions were observed. Results from this study indicated bison are susceptible to infection with Fasciola hepatica and are efficient definitive hosts. Because no Fascioloides magna were recovered, bison may have a decreased susceptibility or innate resistance to Fascioloides magna infection, which may account for a lack of reported infections in this host.

  20. Toxicity of three strobilurins (kresoxim-methyl, pyraclostrobin, and trifloxystrobin) on Daphnia magna.

    PubMed

    Cui, Feng; Chai, Tingting; Liu, Xiaoxu; Wang, Chengju

    2017-01-01

    Strobilurins constitute a new class of fungicides that is the most widely used in the world. The present study was conducted to investigate the aquatic toxicity of 3 common strobilurin fungicides (kresoxim-methyl, pyraclostrobin, and trifloxystrobin) to Daphnia magna. The neonate acute immobilization test showed that the 48-h 50% effective concentration (EC50) values of kresoxim-methyl, pyraclostrobin, and trifloxystrobin were 443.3 µg/L, 20.9 µg/L, and 23.0 µg/L, respectively. In addition, the 3 strobilurins significantly induced activity of the important detoxification enzyme glutathione S-transferase (GST) in D. magna, and there was a significant positive relationship between GST activity and immobility of D. magna after acute exposure. The 3 strobilurins showed higher toxicity to D. magna embryos, and the 48-h EC50 were 157.3 µg/L, 3.9 µg/L, and 1.7 µg/L for kresoxim-methyl, pyraclostrobin, and trifloxystrobin, respectively. The 21-d chronic test revealed that the strobilurins could also significantly affect the reproduction, development, and growth of D. magna at sublethal concentrations. The lowest-observed-effect concentrations of kresoxim-methyl, pyraclostrobin, and trifloxystrobin for reproduction were 20 µg/L, 0.15 µg/L, and 0.2 µg/L, respectively, which were close to environmental concentrations. The findings indicate that strobilurin fungicides are very toxic to D. magna and they are sufficient to cause harm to D. magna at environmentally relevant concentrations. Environ Toxicol Chem 2017;36:182-189. © 2016 SETAC.

  1. DNA fingerprints come to court

    SciTech Connect

    Not Available

    1988-04-15

    DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person.

  2. FROG - Fingerprinting Genomic Variation Ontology

    PubMed Central

    Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: “FingeRprinting Ontology of Genomic variations” is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog. PMID:26244889

  3. Slowflow fingerprints of urban hydrology

    NASA Astrophysics Data System (ADS)

    Schwartz, Stuart S.; Smith, Brennan

    2014-07-01

    Urban streamflow is commonly characterized by increased peak discharges and runoff volumes. Slowflow integrates altered storage and transit times affecting urban recharge and drainage, resulting in a highly variable indeterminate urban slowflow response. This study introduces the use of multiple baseflow metrics to characterize and interpret the dominant processes driving urban slowflow response. Slowflow characteristics derived from USGS streamflow records are used to quantify the patterns of hydrologic alteration across the rural-to-urban landuse gradient in the Piedmont watersheds of the Baltimore Ecosystem Study (BES), an NSF Urban Long Term Ecological Research (LTER) site in the Baltimore Metropolitan area. We interpret multimetric slowflow response from a top-down perspective, learning from data, in order to draw dominant process inferences from observed slowflow. When characterized by a single slowflow metric such as the baseflow index, urban slowflow response can exhibit equifinality and is not reliably predicted a priori. Multimetric analysis quantifies distinct differences in urban slowflow response, framing testable hypotheses and refined experimental designs to elucidate the dominant processes driving urban slowflow. Multimetric fingerprinting offers a consistent framework for interpreting urban slowflow response, constrained by the equifinality of single slowflow metrics and the inherent limitations on process inferences that can be drawn from gauged streamflow alone. Heterogeneity of observed slowflow belies the simple paradigm of a single consistent type of urban slowflow response. In contrast, we suggest a conceptual typology of urban slowflow response, framing a conceptual mixing model of dominant process endpoints that shape the slowflow fingerprints of urban hydrology.

  4. Molecular tools used in agriculture

    USDA-ARS?s Scientific Manuscript database

    A summary of molecular tools used for research in agriculture were presented. Examples of DNA sequencing, library preparation, use of fingerprinting for pathogens and plant crops, high throughput sequencing, whole-genome amplification, reporter genes, and other methods....

  5. Encoding protein-ligand interaction patterns in fingerprints and graphs.

    PubMed

    Desaphy, Jérémy; Raimbaud, Eric; Ducrot, Pierre; Rognan, Didier

    2013-03-25

    We herewith present a novel and universal method to convert protein-ligand coordinates into a simple fingerprint of 210 integers registering the corresponding molecular interaction pattern. Each interaction (hydrophobic, aromatic, hydrogen bond, ionic bond, metal complexation) is detected on the fly and physically described by a pseudoatom centered either on the interacting ligand atom, the interacting protein atom, or the geometric center of both interacting atoms. Counting all possible triplets of interaction pseudoatoms within six distance ranges, and pruning the full integer vector to keep the most frequent triplets enables the definition of a simple (210 integers) and coordinate frame-invariant interaction pattern descriptor (TIFP) that can be applied to compare any pair of protein-ligand complexes. TIFP fingerprints have been calculated for ca. 10,000 druggable protein-ligand complexes therefore enabling a wide comparison of relationships between interaction pattern similarity and ligand or binding site pairwise similarity. We notably show that interaction pattern similarity strongly depends on binding site similarity. In addition to the TIFP fingerprint which registers intermolecular interactions between a ligand and its target protein, we developed two tools (Ishape, Grim) to align protein-ligand complexes from their interaction patterns. Ishape is based on the overlap of interaction pseudoatoms using a smooth Gaussian function, whereas Grim utilizes a standard clique detection algorithm to match interaction pattern graphs. Both tools are complementary and enable protein-ligand complex alignments capitalizing on both global and local pattern similarities. The new fingerprint and companion alignment tools have been successfully used in three scenarios: (i) interaction-biased alignment of protein-ligand complexes, (ii) postprocessing docking poses according to known interaction patterns for a particular target, and (iii) virtual screening for bioisosteric

  6. Impact of dispersant on early life stages of the water flea Daphnia magna and the eastern oyster Crassostrea virginica.

    PubMed

    Salehi, Maryam; Rodriguez, Rachel; Boettcher, Anne; Powers, Sean; Geitner, Nick; Ladner, David A; Rikard, Scott; Whelton, Andrew J

    2017-06-27

    In response to the 2010 Deepwater Horizon oil spill, over 1 million gallons of dispersant were applied in Gulf of Mexico offshore waters; Corexit 9500 was the most applied dispersant. The impact on organisms in nearshore and freshwaters has received little scrutiny. Acute 48 h toxicity of Corexit 9500 and a new hyperbranched polyethylenimine (HPEI) dispersant-like compound were evaluated for the freshwater indicator organism, Daphnia magna and for larval and early spat stages of the Eastern oyster, Crassostrea virginica. For D. magna, Corexit 9500 demonstrated toxicity (EC50 of 0.14 [0.13, 0.15] ppm) similar to the 10-kDa HPEI (EC50 of 0.16 [0.12, 0.19] ppm). HPEI toxicity increased as a function of molecular weight (1.2 to 750 kDa). The 10 kDa size HPEI was further investigated because it dispersed crude oil with equal effectiveness as Corexit. For Corexit, 100% oyster mortality was detected for the ≤0.2-mm size classes and mortality >50% for the 0.3- and 0.7-mm size classes at the two greatest concentrations (25 and 50 ppm). HPEI (10 kDa) exhibited low mortality rates (<30%) for all concentrations for all oyster size classes except the 0.1-mm class. Although mortality rates for this size class were up to 60%, mortality was still less than the mortality caused by Corexit 9500. The low toxicity of HPEI polymers for C. virginica in comparison with Corexit 9500 suggests that HPEI polymers warrant further study. Copyright © 2017 John Wiley & Sons, Ltd.

  7. FAF and SufA: proteins of Finegoldia magna that modulate the antibacterial activity of histones.

    PubMed

    Murphy, Elizabeth C; Mohanty, Tirthankar; Frick, Inga-Maria

    2014-01-01

    Many bacterial pathogens have developed methods to overcome the defences of the host innate immune system. One such defence is the release of antimicrobial peptides (AMPs). Histones have been found to function as AMPs, in addition to their main biological function of packaging and organising DNA into nucleosomes. In this study, the Gram-positive anaerobic coccus Finegoldia magna was found to bind histones by Western blot and immunoprecipitation analysis. F. magna, which is normally a commensal of the skin and mucous membranes, is also known to act as an opportunistic pathogen and has been isolated from various clinical infection sites. It was found to bind to histones extracted from human skin epidermis through its surface and extracellular adhesion protein FAF. Through FAF binding, F. magna was protected from histone bactericidal activity. Furthermore, the histones were found to be degraded by SufA, a subtilisin-like extracellular serine protease of F. magna. Hence, the results of the present study will give more insight into how F. magna persists both as a commensal organism at the basement membrane of the skin and as an opportunistic pathogen during infection.

  8. Oil sands process-affected water impairs feeding by Daphnia magna.

    PubMed

    Lari, Ebrahim; Steinkey, Dylan; Morandi, Garrett; Rasmussen, Joseph B; Giesy, John P; Pyle, Greg G

    2017-05-01

    Growth in extraction of bitumen from oil sands has raised concerns about influences of this industry on surrounding environments. Water clearance rate (a surrogate of feeding rate by Daphnia magna) in water containing D. magna exposed to oil sands process-affected water (OSPW) and its principal components, dissolved component (DC) and suspended particulate matter (SPM), was reduced to 72, 29, and 59% of controls, respectively. This study also examined several possible mechanisms for the observed changes algal cell density (i.e., feeding rate). There was no change in the digestive enzymes trypsin or amylase when D. magna were exposed to DC or SPM; however, exposure to total OSPW reduced trypsin activity. Mandible rolling or post-abdominal rejections, which are indicators of feeding and palatability of food, were not affected by any exposures to OSPW. Beating of thoracic limbs, which provides water flow toward the feeding groove, was reduced by exposure to SPM or total OSPW. Peristaltic activity was reduced by exposure to DC, which then might result in reduced digestion time in D. magna exposed to DC, SPM or whole OSPW. All treatments caused an increase in numbers of intact algae cells in the hindgut and excreted material. These results suggest that both DC and SPM affect feeding of D. magna by impairing actions of the digestive system, but most probably not by reducing rates of ingestion.

  9. Chronic toxicity of chlordane to Daphnia magna and Ceriodaphnia dubia: a comparative study.

    PubMed

    Manar, Rachid; Vasseur, Paule; Bessi, Hlima

    2012-02-01

    Chronic toxicity of chlordane, an organochlorine insecticide, was assessed on Ceriodaphnia dubia under standardized conditions of testing. Results were compared to Daphnia magna to determine the sensitivity of the two freshwater cladoceran species to this persistent organic pollutant (POP) and to explore the possibility of using the 7-day C. dubia test as an alternative to the 21-day D. magna test in chronic toxicity assessment of POPs. The NOEC-7d value of chlordane on reproduction of C. dubia (2.9 μg/L) was much higher than the NOEC-21d value of D. magna (0.18 μg/L), attesting that the 7-day test on C. dubia was less sensitive than the 21-day reproduction test on D. magna to chlordane. However, extending the period of exposure of C. dubia to chlordane from 7 to 14 days led to a NOEC-14d value similar to the NOEC-21d value in D. magna (0.18 μg/L). This study highlights the usefulness of prolonging the exposure time of the reproduction test in C. dubia from 7 to 14 days to increase the performances of the reproduction test on C. dubia for assessing chronic toxicity of POPs.

  10. Tertiary treatment for wastewater reuse based on the Daphnia magna filtration - comparison with conventional tertiary treatments.

    PubMed

    Serra, Teresa; Colomer, Jordi; Pau, Conxi; Marín, Maribel; Sala, Lluís

    2014-01-01

    Tertiary treatments are required to permit safe reuse of wastewater. The performance of a new biological tertiary treatment based on the filtration by a population of Daphnia magna was studied and compared with the performance of other conventional tertiary treatments such as coagulation-flocculation, settling tank, disc filtration, sand filtering and ultraviolet (UV) light. The analysis was based on the efficiency in the particle removal and Escherichia coli inactivation. The Daphnia magna treatment reduced the concentration of particles with diameters below 30 μm by 35%, depending on abiotic parameters such as water temperature and the hydraulic retention time (HRT). The Daphnia magna filtration increased with water temperature for water temperatures >20 °C, while it remained constant for water temperatures <20 °C. Lower HRTs induced the growth of the Daphnia magna population, maintaining the same water quality. Furthermore, the Daphnia magna treatment inactivated E. coli in 1.2 log units. This inactivation was six times larger than that obtained by the conventional macrofiltration systems analyzed, although lower than the inactivation attained by UV light, which ranged between 1.5 and 4 log units.

  11. The Daphnia magna role to predict the cadmium toxicity of sediment: Bioaccumlation and biomarker response.

    PubMed

    Li, Xiaomin; Peng, Weihua; Jiang, Yanyan; Duan, Yong; Ren, Jinqian; Liu, Yingying; Fan, Wenhong

    2017-04-01

    To evaluate Daphnia magna role to predict the Cd toxicity in contaminated sediment, the Cd accumulation, metallothionein (MT), and mortality of D. magna exposed to overlying water system or water-sediment coexistence system were measured. The mortality, Cd accumulation, and MT in D. magna increased with the increasing Cd content in sediment. The Cd accumulation and MT in D. magna exposed to the coexistence system were significantly higher than those exposed to the overlying water system because of the ingestion of Cd-containing sediments by D. magna. However, the mortality did not significantly differ in the two systems, suggesting that mortality was less sensitive than accumulation and MT. The Cd accumulation/MT index can explain why the two systems had the similar mortality but different Cd accumulation and MT. Not all the percentage composition of nonresidual fractions (e.g., exchangeable, carbonate bound, and organic bound phases) significantly correlated with the difference values of Cd accumulation and MT, as well as Cd accumulation/MT. However, these indexes increased with the percentage composition of the nonresidual fractions, indicating that the distribution of Cd chemical fractions is crucial for its bioavailability and biotoxicity.

  12. DNA fingerprinting of jute germplasm by RAPD.

    PubMed

    Hossain, Mohammad Belayat; Haque, Samiul; Khan, Haseena

    2002-07-31

    The genotype characteristic of cultivars was investigated, along with varieties of both of the jute species, Corchorus olitorius and Corchorus capsularis, in the germplasm collection at the Bangladesh Jute Research Institute (BJRI). DNA fingerprinting was generated for 9 different varieties and 12 accessions of jute cultivars by using random amplified polymorphic DNA (RAPD). A total of 29 arbitrary oligonucleotide primers were screened. Seven primers gave polymorphism within the varieties, and 6 primers detected polymorphism within the accessions that were tested. A dendrogram was engendered from these data, and this gave a distinct clustering of the cultivated species of jute. Therefore, we generated RAPD markers, which are species-specific. These primers can distinguish between C. olitorius and C. capsularis. From the dendrogram that we generated between the various members of these two species, we found the existing genetic classification that agrees with our molecular marking data. A different dendrogram showed that jute accessions could be clustered into three groups. These data will be invaluable in the conservation and utilization of the genetic pool in the germplasm collection.

  13. DNA fingerprinting in zoology: past, present, future.

    PubMed

    Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

    2014-02-03

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

  14. Galectin fingerprinting in naso-sinusal diseases.

    PubMed

    Duray, Anaëlle; De Maesschalck, Thibault; Decaestecker, Christine; Remmelink, Myriam; Chantrain, Gilbert; Neiveyans, Jennifer; Horoi, Mihaela; Leroy, Xavier; Gabius, Hans-Joachim; Saussez, Sven

    2014-07-01

    Galectins, a family of endogenous lectins, are multifunctional effectors that act at various sites and can be used in immunohistochemical localization studies of diseased states. Since they form a potentially cooperative and antagonistic network, we tested the hypothesis that histopathological fingerprinting of galectins could refine the molecular understanding of naso-sinusal pathologies. Using non-cross-reactive antibodies against galectin-1, -3, -4, -7, -8 and -9, we characterized the galectin profiles in chronic rhinosinusitis, nasal polyposis, inverted papillomas and squamous cell carcinomas. The expression, signal location and quantitative parameters describing the percentage of positive cells and labeling intensity were assessed for various cases. We discovered that inverted papillomas showed a distinct galectin immunohistochemical profile. Indeed, epithelial overexpression of galectin-3 (p=0.0002), galectin-4 (p<10-6), galectin-7 (p<10-6) and galectin-9 (p<10-6) was observed in inverted papillomas compared to non-malignant diseases. Regarding carcinomas, we observed increased expression of galectin-9 (p<10-6) in epithelial cells compared to non-tumor pathologies. Our results suggest that galectin-3, -4, -7 and -9 could be involved in the biology of inverted papillomas. In addition, we observed that the expression of galectin in naso-sinusal diseases seems to be affected by tumor progression and not inflammatory or allergic phenomena.

  15. Maternal food quantity affects offspring feeding rate in Daphnia magna.

    PubMed

    Garbutt, Jennie S; Little, Tom J

    2014-07-01

    Maternal effects have wide-ranging effects on life-history traits. Here, using the crustacean Daphnia magna, we document a new effect: maternal food quantity affects offspring feeding rate, with low quantities of food triggering mothers to produce slow-feeding offspring. Such a change in the rate of resource acquisition has broad implications for population growth or dynamics and for interactions with, for instance, predators and parasites. This maternal effect can also explain the previously puzzling situation that the offspring of well-fed mothers, despite being smaller, grow and reproduce better than the offspring of food-starved mothers. As an additional source of variation in resource acquisition, this maternal effect may also influence relationships between life-history traits, i.e. trade-offs, and thus constraints on adaptation. Maternal nutrition has long-lasting effects on health and particularly diet-related traits in humans; finding an effect of maternal nutrition on offspring feeding rate in Daphnia highlights the utility of this organism as a powerful experimental model for exploring the relationship between maternal diet and offspring fitness. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  16. Toxicity of cerium and thorium on Daphnia magna.

    PubMed

    Ma, Yuhui; Wang, Jingkun; Peng, Can; Ding, Yayun; He, Xiao; Zhang, Peng; Li, Na; Lan, Tu; Wang, Dongqi; Zhang, Zhaohui; Sun, Fuhong; Liao, Haiqing; Zhang, Zhiyong

    2016-12-01

    Cerium (Ce) and thorium (Th) are always thought to be chemically similar and have comparable toxic properties on living organisms. In the present study, the acute and chronic toxicity of these two elements to freshwater crustacean Daphnia magna were investigated in the modified reconstituted water (6mg/L KCl, 123mg/L MgSO4·7H2O, and 294mg/L CaCl2·2H2O in Milli-Q water, pH 7.8). It seemed that Ce and Th had comparable acute toxicity on Daphnia: 24/48h EC50 for Th and Ce were 7.3/4.7μM and 16.4/10.7μM, respectively. However, Ce was present as soluble ions while all of Th was present as particulate ThO2 in the exposure medium. Considering their different chemical forms and bioavailability, the toxic mechanisms of Ce(3+) and ThO2 on Daphnia would be totally different. To our knowledge, this is the first time to investigate the aquatic toxicity of thorium and cerium based on their actual chemical speciation in the exposure medium. The results also suggest that more attention should be paid on the detrimental effect of Th in the form of particulate ThO2.

  17. Silver nanoparticle-specific mitotoxicity in Daphnia magna.

    PubMed

    Stensberg, Matthew C; Madangopal, Rajtarun; Yale, Gowri; Wei, Qingshan; Ochoa-Acuña, Hugo; Wei, Alexander; McLamore, Eric S; Rickus, Jenna; Porterfield, D Marshall; Sepúlveda, Maria S

    2014-12-01

    Silver nanoparticles (Ag NPs) are gaining popularity as bactericidal agents in commercial products; however, the mechanisms of toxicity (MOT) of Ag NPs to other organisms are not fully understood. It is the goal of this research to determine differences in MOT induced by ionic Ag(+) and Ag NPs in Daphnia magna, by incorporating a battery of traditional and novel methods. Daphnia embryos were exposed to sublethal concentrations of AgNO3 and Ag NPs (130-650 ng/L), with uptake of the latter confirmed by confocal reflectance microscopy. Mitochondrial function was non-invasively monitored by measuring proton flux using self-referencing microsensors. Proton flux measurements revealed that while both forms of silver significantly affected proton efflux, the change induced by Ag NPs was greater than that of Ag(+). This could be correlated with the effects of Ag NPs on mitochondrial dysfunction, as determined by confocal fluorescence microscopy and JC-1, an indicator of mitochondrial permeability. However, Ag(+) was more efficient than Ag NPs at displacing Na(+) within embryonic Daphnia, based on inductively coupled plasma-mass spectroscopy (ICP-MS) analysis. The abnormalities in mitochondrial activity for Ag NP-exposed organisms suggest a nanoparticle-specific MOT, distinct from that induced by Ag ions. We propose that the MOT of each form of silver are complementary, and can act in synergy to produce a greater toxic response overall.

  18. Ecotoxicity and QSAR studies of glycerol ethers in Daphnia magna.

    PubMed

    Perales, Eduardo; García, Jose Ignacio; Pires, Elisabet; Aldea, Luis; Lomba, Laura; Giner, Beatriz

    2017-09-01

    Glycerol is currently considered a raw, renewable material, which can be used to synthesize new glycerol derivatives that may be used as green solvents. However, these compounds must be environmentally evaluated before their use. The acute ecotoxicity of a series of mono-, di-, and trialkyl ethers synthesized from glycerol for the crustacean Daphnia magna has been studied. The EC50 values of these ethers after 24 h of exposure were determined according to the OECD 202 protocol. Their possible structural-toxicity relationships according to different alkyl substituents have been discussed after applying different QSAR models (with the DARC-PELCO approach and topological parameters). The results of the immobilization test show that most of the glycerol derivatives studied exhibit relatively low ecotoxicity. There is a correlation between the lipophilicity and the increase of the toxic effect in the crustacean biomodel. Furthermore, the length and the number of the alkyl substituents and ecotoxicity are highly related. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Ecotoxicity of pp'DDE to Daphnia magna.

    PubMed

    Bettinetti, Roberta; Croce, Valeria; Noè, Francesca; Ponti, Benedetta; Quadroni, Silvia; Galassi, Silvana

    2013-10-01

    pp'-Dichlorodiphenyl-dichloroethylene (pp'DDE), a metabolite of pp'-dichlorodiphenyl-trichloroethane poses a risk for many ecosystems in spite of the banning of the parent compound because of its persistence and bioaccumulability. Nevertheless, the knowledge of acute and chronic toxicity on aquatic organisms is still very poor. In the present study, Daphnia magna was exposed to varying concentrations of pp'DDE in water and through diet to determine both acute toxicity and potential for effects on reproduction and survivability. The 48 h IC50 was 5.08 μg L(-1) (3.76-7.01 μg L(-1)). As pp'DDE concentration in water was not stable and the amount assumed by food cannot be established with certainty, the results of chronic toxicity tests were expressed as the concentration in the organism which caused a negative effect. Grazing activity was affected with a pp'DDE concentration in the organism of 24 ng mg(-1) d.w., while the lowest observed effect concentration for fecundity reduction was 109 ng mg(-1) d.w.

  20. Mixture toxicity of flubendazole and fenbendazole to Daphnia magna.

    PubMed

    Puckowski, Alan; Stolte, Stefan; Wagil, Marta; Markiewicz, Marta; Łukaszewicz, Paulina; Stepnowski, Piotr; Białk-Bielińska, Anna

    2017-02-03

    Nowadays, residual amounts of many pharmaceuticals can be found in various environmental compartments including surface and ground waters, soils and sediments as well as biota. Even though they undergo degradability, their environmental discharge is relatively continuous, thus they may be regarded as quasi-persistent contaminants, and are also frequently regarded as emerging organic pollutants. Benzimidazoles, especially flubendazole (FLU) and fenbendazole (FEN), represent two anthelmintic drugs belonging to this group. Although their presence in environmental matrices has been reported, there is relatively little data concerning their (eco)toxicological impact. Furthermore, no data is available on their mixture toxicity. FLU and FEN have been found to have a strong impact on an environmentally important non-target organism - Daphnia magna. Moreover, these compounds are usually present in the environment as a part of pharmaceutical mixtures. Therefore, there is a need to evaluate their mixture toxicity, which was the main aim of this study. Single substance toxicity tests were carried out in parallel with mixture studies of FLU and FEN, with the application of two well established concepts of Concentration Addition (CA) and Independent Action (IA). As a result, both models (CA and IA) were found to underestimate the toxicity of mixtures, however CA yielded more accurate predictions.

  1. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  2. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  3. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  4. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  5. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints and...

  6. Fingerprint Minutiae from Latent and Matching Tenprint Images

    National Institute of Standards and Technology Data Gateway

    NIST Fingerprint Minutiae from Latent and Matching Tenprint Images (PC database for purchase)   NIST Special Database 27 contains latent fingerprints from crime scenes and their matching rolled fingerprint mates. This database can be used to develop and test new fingerprint algorithms, test commercial and research AFIS systems, train latent examiners, and promote the ANSI/NIST file format standard.

  7. DNA fingerprinting. The future of forensic dentistry--a review.

    PubMed

    Diwaker, N R; Rajeshwari; Rao, B

    2001-01-01

    Forensic dental identification is at technological cross roads. The incidence of dental restorations, the mainstay of radiographic dental investigations, have declined. Whereas molecular biology laboratory procedures are rapidly increasing in efficiency and availability. With new typing techniques forensic scientists can characterize individuals at the fundamental level of their DNA, and variations between individuals at this level can be used to discriminated between them. The anatomical location of teeth and the extent to which teeth may suffer environmental changes and still provide useful DNA material has propelled forensic odontology. The techniques of DNS fingerprinting, the role of teeth as a source of DNA material and its feasibility is discussed in relatively simple terms.

  8. Fingerprints of polycyclic aromatic hydrocarbons (PAHs) in infrared absorption spectroscopy.

    PubMed

    Tommasini, Matteo; Lucotti, Andrea; Alfè, Michela; Ciajolo, Anna; Zerbi, Giuseppe

    2016-01-05

    We have analyzed a set of 51 PAHs whose structures have been hypothesized from mass spectrometry data collected on samples extracted from carbon particles of combustion origin. We have obtained relationships between infrared absorption signals in the fingerprint region (mid-IR) and the chemical structures of PAHs, thus proving the potential of IR spectroscopy for the characterization of the molecular structure of aromatic combustion products. The results obtained here for the spectroscopic characterization of PAHs can be also of interest in Materials Science and Astrophysics.

  9. Detection of a novel arginine vasopression defect by dideoxy fingerprinting

    SciTech Connect

    Krishnamani, M.R.S.; Phillips, J.A. III; Copeland, K.C. Univ. of Vermont College of Medicine, Burlington, VT )

    1993-09-01

    Autosomal dominant neurohypophyseal diabetes insipidus is a familial form of diabetes insipidus. This disorder is associated with variable levels of arginine vasopressin (AVP) and diabetes insipidus of varying severity, which responds to exogenous AVP. To determine the molecular basis of autosomal dominant neurohypophyseal diabetes insipidus, the AVP genes of members of a large kindred were analyzed. A new method, called dideoxy fingerprinting, was used to detect an AVP mutation that was characterized by DNA sequencing. The novel defect found changes the last codon of the AVP signal peptide from alanine to threonine, which should perturb cleavage of mature AVP from its precursor protein and inhibit its secretion or action. 18 refs., 3 figs.

  10. Case study of 3D fingerprints applications.

    PubMed

    Liu, Feng; Liang, Jinrong; Shen, Linlin; Yang, Meng; Zhang, David; Lai, Zhihui

    2017-01-01

    Human fingers are 3D objects. More information will be provided if three dimensional (3D) fingerprints are available compared with two dimensional (2D) fingerprints. Thus, this paper firstly collected 3D finger point cloud data by Structured-light Illumination method. Additional features from 3D fingerprint images are then studied and extracted. The applications of these features are finally discussed. A series of experiments are conducted to demonstrate the helpfulness of 3D information to fingerprint recognition. Results show that a quick alignment can be easily implemented under the guidance of 3D finger shape feature even though this feature does not work for fingerprint recognition directly. The newly defined distinctive 3D shape ridge feature can be used for personal authentication with Equal Error Rate (EER) of ~8.3%. Also, it is helpful to remove false core point. Furthermore, a promising of EER ~1.3% is realized by combining this feature with 2D features for fingerprint recognition which indicates the prospect of 3D fingerprint recognition.

  11. Prediction of acute toxicity of emerging contaminants on the water flea Daphnia magna by Ant Colony Optimization-Support Vector Machine QSTR models.

    PubMed

    Aalizadeh, Reza; von der Ohe, Peter C; Thomaidis, Nikolaos S

    2017-03-22

    According to the European REACH Directive, the acute toxicity towards Daphnia magna should be assessed for any industrial chemical with a market volume of more than 1 t/a. Therefore, it is highly recommended to determine the toxicity at a certain confidence level, either experimentally or by applying reliable prediction models. To this end, a large dataset was compiled, with the experimental acute toxicity values (pLC50) of 1353 compounds in Daphnia magna after 48 h of exposure. A novel quantitative structure-toxicity relationship (QSTR) model was developed, using Ant Colony Optimization (ACO) to select the most relevant set of molecular descriptors, and Support Vector Machine (SVM) to correlate the selected descriptors with the toxicity data. The proposed model showed high performance (QLOO(2) = 0.695, Rfitting(2) = 0.920 and Rtest(2) = 0.831) with low root mean square errors of 0.498 and 0.707 for the training and test set, respectively. It was found that, in addition to hydrophobicity, polarizability and summation of solute-hydrogen bond basicity affected toxicity positively, while minimum atom-type E-state of -OH influenced toxicity values in Daphnia magna inversely. The applicability domain of the proposed model was carefully studied, considering the effect of chemical structure and prediction error in terms of leverage values and standardized residuals. In addition, a new method was proposed to define the chemical space failure for a compound with unknown toxicity to avoid using these prediction results. The resulting ACO-SVM model was successfully applied on an additional evaluation set and the prediction results were found to be very accurate for those compounds that fall inside the defined applicability domain. In fact, compounds commonly found to be difficult to predict, such as quaternary ammonium compounds or organotin compounds were outside the applicability domain, while five representative homologues of LAS (non-ionic surfactants) were, on average

  12. Mated Fingerprint Card Pairs 2 (MFCP2)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs 2 (MFCP2) (Web, free access)   NIST Special Database 14 is being distributed for use in development and testing of automated fingerprint classification and matching systems on a set of images which approximate a natural horizontal distribution of the National Crime Information Center (NCIC) fingerprint classes. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  13. Errors in spectral fingerprints and their effects on climate fingerprinting accuracy in the solar spectrum

    NASA Astrophysics Data System (ADS)

    Jin, Zhonghai; Sun, Moguo

    2017-02-01

    Using the Earth's reflected solar spectrum for climate change fingerprinting is an emerging research area. The spectral fingerprinting approach directly retrieves the changes in climate variables from the mean spectral data averaged across large space and time scales. To investigate this fingerprinting concept, we use ten years of satellite data to simulate the monthly and annual mean reflected solar spectra and the associated spectral fingerprints for different regions over the ocean. The interannual variations in the spectral data are derived and attributed to the interannual variations in the relevant climate variables. The fingerprinting retrieved changes in climate variables are then compared with the actual underlying variable changes from the observational data to evaluate the fingerprinting retrieval accuracy. Two important errors related to the fingerprinting approach, the nonlinearity error and the averaging error in the mean fingerprints, and their impact on the retrieval accuracy, are investigated. It is found that the averaging error increases but the nonlinearity error decreases as the region size increases. The averaging error has minimal effect on the fingerprinting retrieval accuracy in small regions but has more of an impact in large regions. In comparison, the effect of nonlinearity error on the retrieval accuracy decreases as the region size increases. It is also found that the fingerprinting retrieval accuracy is more sensitive to the nonlinearity error than to the averaging error. In addition, we compare the fingerprinting accuracy between using the monthly mean data and the annual mean data. The results show that on average higher retrieval accuracy is achieved when the annual mean data are used for the fingerprinting retrieval.

  14. Toxicity of aqueous C70-gallic acid suspension in Daphnia magna.

    PubMed

    Seda, Brandon C; Ke, Pu-Chun; Mount, Andrew S; Klaine, Stephen J

    2012-01-01

    The present study assessed the toxic effects of stable aqueous colloidal suspensions of gallic-acid-stabilized C(70) fullerene on Daphnia magna. The suspensions were stabilized through noncovalent surface modification with gallic acid. In addition to whole-organism responses, changes in antioxidative processes in D. magna were quantified. Acute toxicity was observed with 96LC50 for C(70) -gallic acid of 0.4 ± 0.1 mg/L C(70) . Daphnia magna fecundity was significantly reduced in 21-d bioassays at C(70) -gallic aqcid concentrations below quantifiable limits. Antioxidant enzyme activities of glutathione peroxidase and superoxide dismutase as well as lipid peroxidation suggested that exposed organisms experienced oxidative stress. Microscopic techniques used to determine cellular toxicity via apoptosis proved unsuccessful.

  15. Joint toxicity of cadmium and SDBS on Daphnia magna and Danio rerio.

    PubMed

    Zhang, Ying; Ma, Jing; Shi, Liu; Cao, Di; Quan, Xie

    2016-12-01

    Information on joint toxicity is limited. To clarify the joint toxicity and the interactions among toxicants on different aquatic organisms, we investigated the acute toxicity of cadmium and sodium dodecyl benzene sulfonate, two chemicals with high concerns in Chinese waters, on the immobilization of Daphnia magna (D. magna) and the swimming behavior of Danio rerio (D. rerio). Our results illustrated that cadmium and sodium dodecyl benzene sulfonate expressed a synergistic effect on the immobilization of D. magna; and an antagonistic effect on the swimming speed D. rerio, but a synergistic effect on its vertical position in the water column. Based on the observed data, we found the independent action model was more appropriate than the concentration addition model in the prediction of their joint toxicity. Our results gave an example of the joint toxicity investigation, and aided to comprehensive the toxicity action mode of chemical mixtures.

  16. [Final thermal preference in parthenogenetic females of Daphnia magna Straus (Crustacea: Cladocera) acclimated to various temperatures].

    PubMed

    Verbitskiĭ, V B; Verbitskaia, T I

    2011-01-01

    The final thermal preference (FTP) range in parthenogenetic females of cladoceran Daphnia magna was assessed by "acute" and "chronic" methods. The first method included 4-month acclimation to different temperatures in the range of 14.2 +/- 0.7 to 27.1 +/- 0.3 degrees C; the "chronic" method was characterized by long-term acclimation to +20 degrees C. Two ranges of FTP were found for D. magna, 13.3-15.4 degrees C and 20.2-26.2 degrees C. The thermal preference ofdaphnids and the temperature of acclimation were correspondingly linearly. The range of FTP was independent of the season. The food-searching activity of D. magna rose in April, when the FTP range increased, and the FTP was less pronounced.

  17. [Studying intermediatory regulation of heart rhythm using Daphnia magna as the alternative test object].

    PubMed

    Podosinovikova, N P; Beliaev, V A; Dolgo-Saburov, V B

    2009-01-01

    A functional test using Daphnia magna Straus hydrobionts is proposed for studying the role of intermediatory relationships in the heart rate (HR) regulation. It is established that the M-cholinomimetic carbamylcholine increases for two hours and decreases after 24 hours the HR in D. magna. Caffeine (a nonselective antagonist of adenosine receptors) potentiates the action of carbamylcholine during the first hour and then ceases to influence the drug effect. Caffeine normalizes the HR rate D magna, which was decreased by the cholinolytic atropine and the beta-adrenolytic atenolol. The possibilities of using the proposed test for the investigation of intermediatory relationships in the HR regulation, rapid analysis of the cardiothropic action of xenobiotics, and the primary screening of drugs for the pharmacological correction of HR disturbances are discussed.

  18. Annotation of the Daphnia magna nuclear receptors: comparison to Daphnia pulex.

    PubMed

    Litoff, Elizabeth J; Garriott, Travis E; Ginjupalli, Gautam K; Butler, LaToya; Gay, Claudy; Scott, Kiandra; Baldwin, William S

    2014-11-15

    Most nuclear receptors (NRs) are ligand-dependent transcription factors crucial in homeostatic physiological responses or environmental responses. We annotated the Daphnia magna NRs and compared them to Daphnia pulex and other species, primarily through phylogenetic analysis. Daphnia species contain 26 NRs spanning all seven gene subfamilies. Thirteen of the 26 receptors found in Daphnia species phylogenetically segregate into the NR1 subfamily, primarily involved in energy metabolism and resource allocation. Some of the Daphnia NRs, such as RXR, HR96, and E75 show strong conservation between D. magna and D. pulex. Other receptors, such as EcRb, THRL-11 and RARL-10 have diverged considerably and therefore may show different functions in the two species. Curiously, there is an inverse association between the number of NR splice variants and conservation of the LBD. Overall, D. pulex and D. magna possess the same NRs; however not all of the NRs demonstrate high conservation indicating the potential for a divergence of function.

  19. Correlation between heavy metal acute toxicity values in Daphnia magna and fish

    SciTech Connect

    Khangarot, B.S.; Ray, P.K.

    1987-04-01

    In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species have been of recent interest as test models due to the need for developing nonmammalian tests system. The cladoceran Daphnia magna bioassays have several practical advantages. D. magna has been used as a useful test species and its sensitivity to environmental pollutants have been recognized as a general representative of other freshwater zooplankton species. The objectives of this study were to determine the acute toxicity of various heavy metals to Daphnia magna for 48 h of exposure and to compare these values with the existing LC50 values for rainbow trout (Salmo gairdneri); which is commonly used as a test animal in aquatic bioassay studies.

  20. A comparison of the toxicity of 30 reference chemicals to Daphnia magna and Daphnia pulex

    SciTech Connect

    Lilius, H.; Haestbacka, T.; Isomaa, B.

    1995-12-01

    To determine whether significant differences exist in the sensitivity of different Daphnia species to toxicants, the acute toxicity of the first 30 MEIC (multicenter evaluation of in vitro cytotoxicity) reference chemicals was determined in two species of Daphnia: D. magna and D. pulex. Correlation and regression analysis of the EC50 data for immobilization showed a very good concordance (r = 0.97, slope = 1.02). A comparison between the EC50 data obtained for D. magna by two laboratories independently for the 50 MEIC chemicals also showed a good concordance (r = 0.93, slope = 0.91). In both comparisons the regression line did not differ significantly from the regression line for a 1:1 regression. The authors conclude that their study, including a set of reference chemicals, indicates that is no difference in the overall sensitivity of the two Daphnia species and the two clones of D. magna.

  1. In vivo biodegradation of colloidal quantum dots by a freshwater invertebrate, Daphnia magna.

    PubMed

    Kwon, Dongwook; Kim, Min Jung; Park, Chansik; Park, Jaehong; Choi, Kyungho; Yoon, Tae Hyun

    2012-06-15

    Impacts of planktonic invertebrate, Daphnia magna, on the speciation of colloidal quantum dots (QD) were investigated using fluorescence spectromicroscopic technique. Well-dispersed (GA/TOPO)QD were prepared by forming a supramolecular assembly of hydrophobic (TOPO)QD with biomacromolecules (i.e., Gum Arabic, GA). Biological degradation of this nanomaterial was monitored by fluorescence spectromicroscopic methods. Our study confirmed the major uptake pathway of manufactured nanomaterials and in vivo biodegradation processes in a well-known toxicity test organism, D. magna. In addition, we also found that D. magna can induce significant deterioration of aquatic media by releasing fragments of partially degraded QD colloids. These biological processes may significantly change the predicted toxicities of nanomaterials in aquatic environments. Thus, we propose that the impacts of aquatic living organisms on the environmental fate of manufactured nanomaterials (MNs) should be carefully taken into account when assessing the risk of MNs to the environment and human health.

  2. Development of Quantitative Structure-Activity Relationship Models for Predicting Chronic Toxicity of Substituted Benzenes to Daphnia Magna.

    PubMed

    Fan, Deling; Liu, Jining; Wang, Lei; Yang, Xianhai; Zhang, Shenghu; Zhang, Yan; Shi, Lili

    2016-05-01

    The chronic toxicity of anthropogenic molecules such as substituted benzenes to Daphnia magna is a basic eco-toxicity parameter employed to assess their environmental risk. As the experimental methods are laborious, costly, and time-consuming, development in silico models for predicting the chronic toxicity is vitally important. In this study, on the basis of five molecular descriptors and 48 compounds, a quantitative structure-property relationship model that can predict the chronic toxicity of substituted benzenes were developed by employing multiple linear regressions. The correlation coefficient (R (2)) and root-mean square error (RMSE) for the training set were 0.836 and 0.390, respectively. The developed model was validated by employing 10 compounds tested in our lab. The R EXT (2) and RMSE EXT for the validation set were 0.736 and 0.490, respectively. To further characterizing the toxicity mechanism of anthropogenic molecules to Daphnia, comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) models were developed.

  3. The detection of drugs of abuse in fingerprints using Raman spectroscopy I: latent fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-02-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in latent fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were studied in both sweat-rich and sebum-rich latent fingerprints. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in latent fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in sweat-rich latent fingerprints were of a similar quality to spectra that obtained from the substances under normal sampling conditions. Interfering Raman bands arising from latent fingerprint material were present in the spectra obtained from the substances in sebum-rich fingerprints. These bands did not prevent identification of the substances and could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in latent fingerprints was visually locating the substance in the fingerprint in order to obtain a Raman spectrum.

  4. Phototoxicity and chronic toxicity of methyl paraben and 1,2-hexanediol in Daphnia magna.

    PubMed

    Lee, Jiyun; Park, Nayeon; Kho, Younglim; Lee, Kiyoung; Ji, Kyunghee

    2017-01-01

    Parabens are used as antimicrobial preservatives in consumer products. Exposure to methylparaben (MP) has been associated with adverse health outcomes, therefore, an alternative compound, 1,2-hexanediol (1,2-H), has been applied for cosmetics. In the present study, the phototoxicity of MP and 1,2-H, as well as the toxic effect caused by chronic exposure, were investigated using Daphnia magna. The 48 h acute toxicity tests with D. magna were conducted under indoor or ultraviolet (UV) light irradiation conditions, i.e., exposure to 4 h/d sunlight. Changes in the transcription of genes related to oxidative stress were determined in D. magna juveniles, to investigate the underlying mechanism of phototoxicity. The 21 d chronic toxicity tests of MP and 1,2-H were performed under indoor light irradiation. Exposure to MP under environmental level of UV light was more detrimental to D. magna. Transcripts of catalase and glutathione-S-transferase genes in D. magna was significantly increased by co-exposure to MP and UV light. After 21 d of chronic exposure to MP and 1,2-H, the reproduction no-observed effect concentrations for D. magna were 1 and >10 mg/L, respectively. The present study showed that exposure to UV could magnify the toxicity of MP on daphnids. Although acute and chronic toxicities of 1,2-H were generally lower than those of MP, its effects on other aquatic organisms should not be ignored. Further studies are needed to identify other mechanisms of MP phototoxicity.

  5. A Study on the D. magna and V. fischeri Toxicity Relationship of Industrial Wastewater from Korea

    NASA Astrophysics Data System (ADS)

    Pyo, S.; Lee, S.; Chun Sang, H.; Park, T. J.; Kim, M. S.

    2015-12-01

    It is well known that high concentration of TDS (total dissolved solid) in industrial effluent gives rise to the toxicity to the Daphnia magna toxicity test. D. magna is vulnerable to relatively low TDS concentration showing the 24-hr EC50 of Salinity 0.6% (as the sea salt concentration). Recently, standard mandatory toxicity testing using Daphnia magna has been used to monitor industrial effluent toxicity according to Korea standard method (Acute Toxicity Test Method of the Daphnia magna Straus (Cladocera, Crustacea), ES 04704. 1a) under regulation. Since only one acute toxicity testing is applied in the present, we are trying to introduce microbial battery for more complete toxicity assessment. In this study, the acute toxicities between daphnids and microbes were compared. The results of D. magna and Vibrio fischeri toxicity test from 165 industrial wastewater effluents showed high positive correlation. In addition, the possibility of predicting daphnia toxicity from the bacterial toxicity data amounts to 92.6% if we consider salinity effect (>5ppt) together. From this study, we found that the V. fischeri toxicity test is a powerful battery tool to assess the industrial wastewater toxicity. Here, we suggest that luminescent bacteria toxicity test be useful not only for complete toxicity assessment which can't be obtained by daphnia toxicity testing only but also for the reduction cost, time, and labor in the Korean society. Keywords : D. magna, V. fischeri, Industrial waste water, battery test Acknowledgement This research was supported by a grant (15IFIP-B089908-02) from Plant Research Program funded by Ministry of Land, Infrastructure and Transport of Korean government

  6. Exploring methods for compositional and particle size analysis of noble metal nanoparticles in Daphnia magna.

    PubMed

    Krystek, Petra; Brandsma, Sicco; Leonards, Pim; de Boer, Jacob

    2016-01-15

    The identification and quantification of the bioaccumulation of noble metal engineered nanoparticles (ENPs) by aquatic organisms is of great relevance to understand the exposure and potential toxicity mechanisms of nanoscale materials. Four analytical scenarios were investigated in relation to various sized and composed noble metal (gold (Au), platinum (Pt) and silver (Ag)) ENPs during acute, short-term exposure of Daphnia (D.) magna. Next to the total elemental quantification of absorbed ENPs by D. magna, especially information on the size and particle distribution of ENPs in D. magna is of relevance. Dissolution of the exposed biological material prior to measurement by asymmetric flow field flow fractionation coupled to inductively coupled plasma mass spectrometry (AF4-ICPMS) is challenging because the ENPs must stay stable regarding to particle size and composition. Next to dissolution of exposed D. magna by tetra methyl ammonium hydroxide (TMAH), a new enzymatic dissolution approach was explored by using trypsin. The presence of various sized and composed ENPs has been confirmed by AF4-ICPMS but the chosen dissolution medium was crucial for the results. TMAH and trypsin led to comparable results for medium-sized (50nm) noble metals ENPs in exposed D. magna. But it was also shown that the dissolution of biological materials with smaller (<5nm) ENPs led to different results in particle size and elemental concentration depending on the selected dissolution medium. A significant uptake of Au and Pt ENPs by D. magna or adsorption to particles occurred because only 1-5% of the exposed ENPs remained in the exposure medium.

  7. Development of an NMR microprobe procedure for high-throughput environmental metabolomics of Daphnia magna.

    PubMed

    Nagato, Edward G; Lankadurai, Brian P; Soong, Ronald; Simpson, André J; Simpson, Myrna J

    2015-09-01

    Nuclear magnetic resonance (NMR) is the primary platform used in high-throughput environmental metabolomics studies because its non-selectivity is well suited for non-targeted approaches. However, standard NMR probes may limit the use of NMR-based metabolomics for tiny organisms because of the sample volumes required for routine metabolic profiling. Because of this, keystone ecological species, such as the water flea Daphnia magna, are not commonly studied because of the analytical challenges associated with NMR-based approaches. Here, the use of a 1.7-mm NMR microprobe in analyzing tissue extracts from D. magna is tested. Three different extraction procedures (D2O-based buffer, Bligh and Dyer, and acetonitrile : methanol : water) were compared in terms of the yields and breadth of polar metabolites. The D2O buffer extraction yielded the most metabolites and resulted in the best reproducibility. Varying amounts of D. magna dry mass were extracted to optimize metabolite isolation from D. magna tissues. A ratio of 1-1.5-mg dry mass to 40 µl of extraction solvent provided excellent signal-to-noise and spectral resolution using (1)H NMR. The metabolite profile of a single daphnid was also investigated (approximately 0.2 mg). However, the signal-to-noise of the (1)H NMR was considerably lower, and while feasible for select applications would likely not be appropriate for high-throughput NMR-based metabolomics. Two-dimensional NMR experiments on D. magna extracts were also performed using the 1.7-mm NMR probe to confirm (1)H NMR metabolite assignments. This study provides an NMR-based analytical framework for future metabolomics studies that use D. magna in ecological and ecotoxicity studies.

  8. Effect of the lipid regulator Gemfibrozil in the Cladocera Daphnia magna at different temperatures.

    PubMed

    Salesa, Beatriz; Ferrando, María D; Villarroel, María J; Sancho, Encarna

    2017-02-23

    In the present study, an ecotoxicological approach to the evaluation of Gemfibrozil (GEM) as an emerging organic pollutant was done. In order to assess its toxicity, tests were conducted using the cladocera Daphnia magna. Experiments were carried out at 22°C and 28°C. EC50, feeding behavior, and chronic toxicity tests (21 days) were evaluated in D. magna exposed to GEM as well as cholesterol levels at 21-day chronic exposure. D. magna GEM EC50 values (24 h) in our experimental conditions were 148.75 and 116.24 mg L(-1) at 22°C and 28°C, respectively. Test concentrations of 0.1, 0.5, 1.0, 5.0 and 7.5 mg L(-1) were selected for subacute and chronic experiments. Subacute short-term test (feeding study) was assessed after exposure to the toxicant. Filtration and ingestion rates of D. magna exposed animals did not show any significant difference (P > 0.05) with respect to control daphniids neither at 22°C nor at 28°C. Therefore, GEM test concentrations used in the present study did not reduce feeding behavior in D. magna. Temperature increased from 22°C to 28°C, which resulted in a decrease of the daphniids reproductive parameters such as brood size and number of young per female. Other parameters as longevity were not affected. The GEM concentrations used in the chronic test with D. magna did not affect daphniids longevity but some reproductive parameters as number of young per female or brood size were affected. Finally, a significant decreased in cholesterol levels was found in those animals exposed to the highest toxicant concentrations. More studies must be done to determine the possible implications of GEM in aquatic fauna and to derive its possible effects on the environment.

  9. Lossless Compression of Chemical Fingerprints Using Integer Entropy Codes Improves Storage and Retrieval

    PubMed Central

    Baldi, Pierre; Benz, Ryan W.

    2008-01-01

    Many modern chemoinformatics systems for small molecules rely on large fingerprint vector representations, where the components of the vector record the presence or number of occurrences in the molecular graphs of particular combinatorial features, such as labeled paths or labeled trees. These large fingerprint vectors are often compressed to much shorter fingerprint vectors using a lossy compression scheme based on a simple modulo procedure. Here we combine statistical models of fingerprints with integer entropy codes, such as Golomb and Elias codes, to encode the indices or the run-lengths of the fingerprints. After reordering the fingerprint components by decreasing frequency order, the indices are monotone increasing and the run-lenghts are quasi-monotone increasing, and both exhibit power-law distribution trends. We take advantage of these statistical properties to derive new efficient, lossless, compression algorithms for monotone integer sequences: Monotone Value (MOV) Coding and Monotone Length (MOL) Coding. In contrast with lossy systems that use 1,024 or more bits of storage per molecule, we can achieve lossless compression of long chemical fingerprints based on circular substructures in slightly over 300 bits per molecule, close to the Shannon entropy limit, using a MOL Elias Gamma code for run-lengths. The improvement in storage comes at a modest computational cost. Furthermore, because the compression is lossless, uncompressed similarity (e.g. Tanimoto) between molecules can be computed exactly from their compressed representations, leading to significant improvements in retrival performance, as shown on six benchmark datasets of drug-like molecules. PMID:17967006

  10. Chemical characterization of components in fingerprints

    SciTech Connect

    Jarboe, S.G.; Asano, K.G.; Buchanan, M.V.; Bohanan, A.

    1997-12-31

    Investigations into the chemical composition of fingerprints were initiated after it was observed that the latent fingerprints of children disappear more rapidly from surfaces than those of adults. Initial work included the use of GUMS for the identification of compounds present in fingerprints. The relative concentrations of fatty acids and alkyl esters in children and adults appear to contribute to the higher rate of disappearance of prints from the younger subjects. The presence of alkyl esters is linked to sebaceous excretions originating from the face, which increase markedly after puberty. This work has been expanded to include characterization of other classes of components, including amino acids and triacylglycerols. This research is part of an ongoing project to identify various components of fingerprints and explore possible clinical and forensic applications. Through large sampling pools, trends that can indicate personal characteristics (i.e., gender, age), habits (smoking, drug use), and health-related issues (diabetes) are being investigated.

  11. Dual Resolution Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Dual Resolution Images from Paired Fingerprint Cards (Web, free access)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  12. Defining the Crystallographic Fingerprint of Extraterrestrial Treasures

    NASA Astrophysics Data System (ADS)

    Forman, L. V.; Bland, P. A.; Timms, N. E.; Daly, L.; Benedix, G. K.; Trimby, P. W.

    2016-08-01

    An approach to determine the crystallographic fingerprint of chondritic matrix grains, which is complimentary to the geochemical signature commonly identified to constrain some aspects of the petrogenesis of a sample.

  13. Forensic Identification of Gender from Fingerprints.

    PubMed

    Huynh, Crystal; Brunelle, Erica; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2015-11-17

    In the past century, forensic investigators have universally accepted fingerprinting as a reliable identification method, which relies mainly on pictorial comparisons. Despite developments to software systems in order to increase the probability and speed of identification, there has been limited success in the efforts that have been made to move away from the discipline's absolute dependence on the existence of a prerecorded matching fingerprint. Here, we have revealed that an information-rich latent fingerprint has not been used to its full potential. In our approach, the content present in the sweat left behind-namely the amino acids-can be used to determine physical such as gender of the originator. As a result, we were able to focus on the biochemical content in the fingerprint using a biocatalytic assay, coupled with a specially designed extraction protocol, for determining gender rather than focusing solely on the physical image.

  14. Free ionic nickel accumulation and localization in the freshwater zooplankter, Daphnia magna

    SciTech Connect

    Hall, T.M.

    1982-01-01

    The processes which lead to the accumulation of free ionic nickel (radioactive) from solution by Daphnia magna were studied and incorporated into a model which describes accummulation at different concentrations. Adsorption proved to be a relatively small component of nickel accummulation. The accummulation rate eventually approached zero, which represented an equilibrium between uptake and loss of nickel. However, elimination experiments did reveal a pool of relatively static nickel. The appearance and distribution of nickel within five body parts (body fluid, carapace, gut, filtering appendages, and eggs) of D. magna supported the accummulation data and added to the understanding of the pathways of nickel through the organism.

  15. Reproducibility of a life-cycle toxicity test with Daphnia magna

    SciTech Connect

    Parkhurst, B.R.; Forte, J.L.; Wright, G.P.

    1981-01-01

    Standardized chronic life-cycle toxicity testing procedures for aquatic species are described. The reproducibility of chronic toxicity and points using the static-renewal method with Daphnia magna are investigated. The objectives were to determine if the lowest rejected concentrations tested (LRCTs) obtained for six different toxicity criteria in static-renewal tests with acridine were reproducible over time and to determine the relative sensitivity and variability of the toxicity criteria. Two of the six toxicity criteria, numbers of young per brood and the young produced per female, were found to be reliable and sensitive for estimating the LRCT for acridine to D. magna. (RJC)

  16. Petroleum fingerprinting: Dating a gasoline release

    SciTech Connect

    Johnson, M.D.; Morrison, R.D.

    1996-09-01

    Dating a gasoline releases is particularly important in situations involving a contaminated gasoline service station. Often the station begins under the control of a major oil company, and as it ages and deteriorates it may be operated by a series of smaller operators. When facing a claim for contamination, often operators blame former operators. Fingerprinting is one of several successful methods used to date petroleum releases on contaminated sites. The topics covered in this article are inventory reconciliation; reverse groundwater modeling; hydrocarbon fingerprinting.

  17. On the statistics of the "genetic fingerprint".

    PubMed

    Ritter, H

    1991-01-01

    In analogy to the polygene determined morphological features, the DNA-fingerprint is also not suitable for statistical processing. Statements about the individuality are merely speculative. Frequencies of genes cannot be found, since it is impossible to determine which combinations of bands belong to one gene locus. Hence the DNA fingerprint enables the recognition of exclusions from paternity; it does not, however, allow a statistical analysis, no matter which method be employed.

  18. Fingerprinting ordered diffractions in multiply diffracted waves

    NASA Astrophysics Data System (ADS)

    Meles, Giovanni Angelo; Curtis, Andrew

    2014-09-01

    We show how to `fingerprint' individual diffractors inside an acoustic medium using interrogative wave energy from arrays of sources and receivers. For any recorded multiply diffracted wave observed between any source and any receiver, the set of such fingerprints is sufficient information to identify all diffractors involved in the corresponding diffraction path, and the sequential order in which diffractors are encountered. The method herein thus decomposes complex, multiply diffracted wavefields into constituent, single-diffraction interactions.

  19. Comparative toxicity of leachates from 52 textiles to Daphnia magna.

    PubMed

    Dave, Göran; Aspegren, Pia

    2010-10-01

    The environmental aspects of textiles are very complex and include production, processing, transport, usage, and recycling. Textiles are made from a variety of materials and can contain a large number of chemicals. Chemicals are used during production of fibres, for preservation and colouring and they are released during normal wear and during washing. The aim of this study was to investigate the release to water of toxic chemicals from various textiles. Altogether 52 samples of textiles made from cotton (21), linen (4), cotton and linen (7), cellulose (3), synthetic fibres (7), cotton and synthetic fibres (8) and wool (2). Seven were eco-labelled. All textiles were cut into squares and placed into Petri dishes with 50 ml ISO test medium in a concentration series (4-256 cm(2)/50 ml) and tested for acute toxicity to Daphnia magna. Estimated EC50s were converted into weight/volume, and 48-h EC50s ranged between <1 and >182 g/L. It was not possible to detect any difference between fibre type and toxicity (ANOVA), but a significantly higher toxicity was found for printed versus unprinted cotton and cotton/linen textiles, while the opposite was found for synthetic textiles. Eco-labelled products were evenly distributed on a toxicity scale, which means that eco-labelling in its present form does not necessarily protect users or the environment from exposure to toxic chemicals. Therefore, the results from the present study suggest that bioassays and toxicity tests should become an integrated part of textile environmental quality control programs.

  20. Miniaturising acute toxicity and feeding rate measurements in Daphnia magna.

    PubMed

    Grintzalis, Konstantinos; Dai, Wenkui; Panagiotidis, Konstantinos; Belavgeni, Alexia; Viant, Mark R

    2017-05-01

    Phenotypic markers of animal health form an essential component of regulatory toxicology. Immobilisation of neonate water fleas - Daphnia magna - as a surrogate measure of their mortality following exposure to a chemical for 24-48h forms the basis of the internationally utilised OECD acute toxicity test 202. A second important marker of animal physiology and health is feeding rate, which in Daphnia is determined by measuring the algae feeding rate. Given the widespread use of OECD test 202 for acute toxicity as well as the quantification of feeding rate in toxicological studies of daphniids, significant benefits could result from miniaturising this assay. In particular, miniaturisation would use fewer animals, less media and chemicals, less laboratory space and make the tests more compatible with automation, and therefore could result in considerable time savings. Furthermore, miniaturising phenotypic markers to the ultimate level of a single animal per well would facilitate multiple measurements of other phenotypic markers, such as behavioural responses, which could be integrated at the individual level. In this study we used a wide range of exposure vessels to evaluate the impacts of systematically varying total media volume, surface to volume ratio and animal density for the acute toxicity testing of cadmium. We demonstrate that Daphnia acute toxicity tests using single animals within 24- or 48-well plates produce equivalent results as for traditional test configurations, for different chemicals. Considering algae feeding rates by Daphnia, we studied the impacts of varying algae concentration, total volume and animal density. After having demonstrated that multiwell plates can again yield equivalent test results as traditional experimental setups, we used miniaturised test vessels to show the impact of metals on the feeding activity on daphniids for both neonates and adult animals. Overall we confirm the feasibility of a multiwell approach for Daphnia toxicity

  1. Acute toxicity of the herbicide bromoxynil to Daphnia magna

    USGS Publications Warehouse

    Buhl, Kevin J.; Hamilton, Steven J.; Schmulbach, James C.

    1993-01-01

    The acute toxicities of technical-grade bromoxynil octanoate (BO) and two commercial formulations, Buctril® and Bronate®, to < 24-h-old neonate Daphnia magna (Straus) were determined in soft, hard, and oligosaline water. In addition, effects of life stage, feeding, aging the herbicide, and exposure duration on BO toxicity to daphnids were investigated. Regardless of formulation, life stage, and water quality, BO was found to be extremely to highly toxic to daphnids in standard tests; 48-h EC50 values ranged from 41 to 161 m̈g/L. Bromoxynil octanoate was the most toxic to neonates in soft water and the least toxic in hard water. The acute toxicities of the three bromoxynil herbicides to a given age group of daphnids were similar within the same water type. Overall, neonates and 7-d-old adults were more sensitive than 14- or 15-d-old adults to each herbicide. Feeding daphnids during the toxicity test significantly decreased BO toxicity compared to not feeding them. Aging BO (as Buctril) in hard water decreased its toxicity, and the rate of deactivation was rapid, with an estimated half-life of biological activity of 13 h. Daphnids immobilized by exposures to toxic BO concentrations for ≤ 6 h recovered their mobility, whereas exposures of 18 and 24 h to BO produced toxic effects in daphnids similar to those exposed for 48 h. These results indicated that standard continuous exposure tests may not adequately predict the acute toxicity of BO to freshwater animals in the field.

  2. Uncovering Cryptic Asexuality in Daphnia magna by RAD Sequencing.

    PubMed

    Svendsen, Nils; Reisser, Celine M O; Dukić, Marinela; Thuillier, Virginie; Ségard, Adeline; Liautard-Haag, Cathy; Fasel, Dominique; Hürlimann, Evelin; Lenormand, Thomas; Galimov, Yan; Haag, Christoph R

    2015-11-01

    The breeding systems of many organisms are cryptic and difficult to investigate with observational data, yet they have profound effects on a species' ecology, evolution, and genome organization. Genomic approaches offer a novel, indirect way to investigate breeding systems, specifically by studying the transmission of genetic information from parents to offspring. Here we exemplify this method through an assessment of self-fertilization vs. automictic parthenogenesis in Daphnia magna. Self-fertilization reduces heterozygosity by 50% compared to the parents, but under automixis, whereby two haploid products from a single meiosis fuse, the expected heterozygosity reduction depends on whether the two meiotic products are separated during meiosis I or II (i.e., central vs. terminal fusion). Reviewing the existing literature and incorporating recombination interference, we derive an interchromosomal and an intrachromosomal prediction of how to distinguish various forms of automixis from self-fertilization using offspring heterozygosity data. We then test these predictions using RAD-sequencing data on presumed automictic diapause offspring of so-called nonmale producing strains and compare them with "self-fertilized" offspring produced by within-clone mating. The results unequivocally show that these offspring were produced by automixis, mostly, but not exclusively, through terminal fusion. However, the results also show that this conclusion was only possible owing to genome-wide heterozygosity data, with phenotypic data as well as data from microsatellite markers yielding inconclusive or even misleading results. Our study thus demonstrates how to use the power of genomic approaches for elucidating breeding systems, and it provides the first demonstration of automictic parthenogenesis in Daphnia.

  3. Gas Chromatography/Atmospheric Pressure Chemical Ionization Tandem Mass Spectrometry for Fingerprinting the Macondo Oil Spill.

    PubMed

    Lobodin, Vladislav V; Maksimova, Ekaterina V; Rodgers, Ryan P

    2016-07-05

    We report the first application of a new mass spectrometry technique (gas chromatography combined to atmospheric pressure chemical ionization tandem mass spectrometry, GC/APCI-MS/MS) for fingerprinting a crude oil and environmental samples from the largest accidental marine oil spill in history (the Macondo oil spill, the Gulf of Mexico, 2010). The fingerprinting of the oil spill is based on a trace analysis of petroleum biomarkers (steranes, diasteranes, and pentacyclic triterpanes) naturally occurring in crude oil. GC/APCI enables soft ionization of petroleum compounds that form abundant molecular ions without (or little) fragmentation. The ability to operate the instrument simultaneously in several tandem mass spectrometry (MS/MS) modes (e.g., full scan, product ion scan, reaction monitoring) significantly improves structural information content and sensitivity of analysis. For fingerprinting the oil spill, we constructed diagrams and conducted correlation studies that measure the similarity between environmental samples and enable us to differentiate the Macondo oil spill from other sources.

  4. Fingerprinting using extrolite profiles and physiological data shows sub-specific groupings of Penicillium crustosum strains.

    PubMed

    Sonjak, Silva; Frisvad, Jens Christian; Gunde-Cimerman, Nina

    2009-08-01

    Fingerprinting of Penicillium crustosum strains was performed using different phenotypic characteristics. Seven strains of this extremely homogenous species were selected; of these, five originated from geographical locations characterized by low temperatures, and one from a location with a low water activity. Principal component analysis (PCA) was performed using micromorphological data, temperature- and water-dependent growth rates, and extrolite profiles obtained by HPLC analysis. The micromorphological data were less informative, while the growth-rate data were informative only if the strains investigated already showed slight adaptations to the selected external parameter. In contrast, PCA analyses of the extrolite data showed groupings of the strains according to their origins and known physiological differences. These groupings are in full agreement with the clustering obtained by previous amplified fragment length polymorphism (AFLP) study. We thus demonstrate here for the first time that combined qualitative and quantitative extrolite profiles can be used as a tool for phenotypic fingerprinting, to complement, or replace, molecular fingerprinting techniques.

  5. Fingerprint composition and aging: A literature review.

    PubMed

    Cadd, Samuel; Islam, Meez; Manson, Peter; Bleay, Stephen

    2015-07-01

    Fingerprints have a key role in criminal investigations and are the most commonly used form of evidence worldwide. Significant gaps remain however, in the understanding of fingerprint chemistry, including enhancement reaction mechanisms and the effect of environmental variables and time on composition. Determining the age of a fingerprint is also a relatively unexplored area. A successful method, with reliable and quantitative estimates, would have numerous advantages. Previous unreliable methods have predominantly focused on enhancement success based on physical and chemical changes. This review explores variations in composition due to donor characteristics and environmental variables, and identifies gaps for further research. We also present a qualitative and quantitative summary of the effect of time on composition. Kinetics are presented where known, with summary schematics for reaction mechanisms. Previous studies exploring methods for determining the age of a fingerprint are also discussed, including their advantages and disadvantages. Lastly we propose a potentially more accurate and reliable methodology for determining fingerprint age based on quantitative kinetic changes to the composition of a fingerprint over time.

  6. Quantifying the limits of fingerprint variability.

    PubMed

    Fagert, Michael; Morris, Keith

    2015-09-01

    The comparison and identification of fingerprints are made difficult by fingerprint variability arising from distortion. This study seeks to quantify both the limits of fingerprint variability when subject to heavy distortion, and the variability observed in repeated inked planar impressions. A total of 30 fingers were studied: 10 right slant loops, 10 plain whorls, and 10 plain arches. Fingers were video recorded performing several distortion movements under heavy deposition pressure: left, right, up, and down translation of the finger, clockwise and counter-clockwise torque of the finger, and planar impressions. Fingerprint templates, containing 'true' minutiae locations, were created for each finger using 10 repeated inked planar impressions. A minimal amount of variability, 0.18mm globally, was observed for minutiae in repeated inked planar impressions. When subject to heavy distortion minutiae can be displaced by upwards of 3mm and their orientation altered by as much as 30° in relation to their template positions. Minutiae displacements of 1mm and 10° changes in orientation are readily observed. The results of this study will allow fingerprint examiners to identify and understand the degree of variability that can be reasonably expected throughout the various regions of fingerprints.

  7. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  8. [HPLC fingerprints in seed of Celosia argentea].

    PubMed

    Wang, Ying; Guo, Mei-Li; Wang, Xiao-Kang; Yin, Jun

    2008-01-01

    For preferable authentication and regulation of material quality of Celosia argentea, HPLC fingerprints of different habitats were studied. Analysis was carried out on a Hypersil ODS2 column (4.6 mm x 250 mm, 5 microm) with acetonitrile-0.1% glacial acetic acid as the mobile phase, and eluates were detected by an evaporative light scattering detector (ELSD). The similarity evaluation system for chromatographic fingerprint of traditional Chinese medicine ( Version 2004 A) was applied to analyses the similarity of the fingerprint of diverse habitats. The similarity results were verified by SPSS. The chromatographic profiles of the samples from different regions were very similar. HPLC fingerprints of Semen C. argentea 12 common peaks and each peak in the fingerprint was well separated under the chromatographic condition above. The different habitats of C. argentea can be grouped to two types: the middle region and the south region. The chemical constituents of C. argentea vary with different habitats so selection of material habitat is very important for quality control of C. argentea. The fingerprint with high individuality and specificity could be applied in the identification and quality control of the material of C. argentea.

  9. New approach to automated fingerprint matching

    NASA Astrophysics Data System (ADS)

    Tico, Marius; Kuosmanen, Pauli

    2001-04-01

    Fingerprint verification is one of the most widespread techniques of personal identification. This paper describes the design of am minutiae-based fingerprint verification system including image preprocessing, feature extraction and fingerprint matching. Image preprocessing comprises the extraction of the region of interest, ridge segmentation, and ridge thinning. The features extracted from a fingerprint include fingerprint minutiae, i.e. ridge endings, and ridge bifurcations, as well as other related characteristics meant to improve the matching performances. The list of attributes of each minutia is extended with a feature vector, that resembles information extracted from the neighborhood region of the minutia. A measure of similarity between two minutiae can be expressed in terms of the distance between their corresponding feature vectors. We investigate two matching techniques based on the new approach of similar minutiae detection. A database containing 168 fingerprint images is used for experiments. The results reveal that the proposed system can achieve a good verification accuracy on this database. In addition, the proposed system meets the time requirements of practical acceptability as long as the average time for a verification is below 1.2 sec on a Sun ULTRA 1 workstation.

  10. Linguistically informed digital fingerprints for text

    NASA Astrophysics Data System (ADS)

    Uzuner, Özlem

    2006-02-01

    Digital fingerprinting, watermarking, and tracking technologies have gained importance in the recent years in response to growing problems such as digital copyright infringement. While fingerprints and watermarks can be generated in many different ways, use of natural language processing for these purposes has so far been limited. Measuring similarity of literary works for automatic copyright infringement detection requires identifying and comparing creative expression of content in documents. In this paper, we present a linguistic approach to automatically fingerprinting novels based on their expression of content. We use natural language processing techniques to generate "expression fingerprints". These fingerprints consist of both syntactic and semantic elements of language, i.e., syntactic and semantic elements of expression. Our experiments indicate that syntactic and semantic elements of expression enable accurate identification of novels and their paraphrases, providing a significant improvement over techniques used in text classification literature for automatic copy recognition. We show that these elements of expression can be used to fingerprint, label, or watermark works; they represent features that are essential to the character of works and that remain fairly consistent in the works even when works are paraphrased. These features can be directly extracted from the contents of the works on demand and can be used to recognize works that would not be correctly identified either in the absence of pre-existing labels or by verbatim-copy detectors.

  11. Privacy protection schemes for fingerprint recognition systems

    NASA Astrophysics Data System (ADS)

    Marasco, Emanuela; Cukic, Bojan

    2015-05-01

    The deployment of fingerprint recognition systems has always raised concerns related to personal privacy. A fingerprint is permanently associated with an individual and, generally, it cannot be reset if compromised in one application. Given that fingerprints are not a secret, potential misuses besides personal recognition represent privacy threats and may lead to public distrust. Privacy mechanisms control access to personal information and limit the likelihood of intrusions. In this paper, image- and feature-level schemes for privacy protection in fingerprint recognition systems are reviewed. Storing only key features of a biometric signature can reduce the likelihood of biometric data being used for unintended purposes. In biometric cryptosystems and biometric-based key release, the biometric component verifies the identity of the user, while the cryptographic key protects the communication channel. Transformation-based approaches only a transformed version of the original biometric signature is stored. Different applications can use different transforms. Matching is performed in the transformed domain which enable the preservation of low error rates. Since such templates do not reveal information about individuals, they are referred to as cancelable templates. A compromised template can be re-issued using a different transform. At image-level, de-identification schemes can remove identifiers disclosed for objectives unrelated to the original purpose, while permitting other authorized uses of personal information. Fingerprint images can be de-identified by, for example, mixing fingerprints or removing gender signature. In both cases, degradation of matching performance is minimized.

  12. Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

    PubMed

    Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

    2008-01-01

    Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

  13. [Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

    PubMed

    Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

    2010-04-01

    Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

  14. Chemical Visualization of Sweat Pores in Fingerprints Using GO-Enhanced TOF-SIMS.

    PubMed

    Cai, Lesi; Xia, Meng-Chan; Wang, Zhaoying; Zhao, Ya-Bin; Li, Zhanping; Zhang, Sichun; Zhang, Xinrong

    2017-08-15

    Time-of-flight secondary ion mass spectrometry (TOF-SIMS) has been used in imaging of small molecules (<500 Da) in fingerprints, such as gunshot residues and illicit drugs. However, identifying and mapping relatively high mass molecules are quite difficult owing to insufficient ion yield of their molecular ions. In this report, graphene oxide (GO)-enhanced TOF-SIMS was used to detect and image relatively high mass molecules such as poison, alkaloids (>600 Da) and controlled drugs, and antibiotics (>700 Da) in fingerprints. Detail features of fingerprints such as the number and distribution of sweat pores in a ridge and even the delicate morphology of one pore were clearly revealed in SIMS images of relatively high mass molecules. The detail features combining with identified chemical composition were sufficient to establish a human identity and link the suspect to a crime scene. The wide detectable mass range and high spatial resolution make GO-enhanced TOF-SIMS a promising tool in accurate and fast analysis of fingerprints, especially in fragmental fingerprint analysis.

  15. Toward Surface-Enhanced Raman Imaging of Latent Fingerprints

    SciTech Connect

    Connatser, Raynella M; Prokes, Sharka M.; Glembocki, Orest; Schuler, Rebecca A.; Gardner, Charles W.; Lewis Sr, Samuel Arthur; Lewis, Linda A

    2010-01-01

    Exposure to light or heat, or simply a dearth of fingerprint material, renders some latent fingerprints undetectable using conventional methods. We begin to address such elusive fingerprints using detection targeting photo- and thermally stable fingerprint constituents: surface-enhanced Raman spectroscopy (SERS). SERS can give descriptive vibrational spectra of amino acids, among other robust fingerprint constituents, and good sensitivity can be attained by improving metal-dielectric nanoparticle substrates. With SERS chemical imaging, vibrational bands intensities recreate a visual of fingerprint topography. The impact of nanoparticle synthesis route, dispersal methodology-deposition solvent, and laser wavelength are discussed, as are data from enhanced vibrational spectra of fingerprint components. SERS and Raman chemical images of fingerprints and realistic contaminants are shown. To our knowledge, this represents the first SERS imaging of fingerprints. In conclusion, this work progresses toward the ultimate goal of vibrationally detecting latent prints that would otherwise remain undetected using traditional development methods.

  16. An effective one-dimensional anisotropic fingerprint enhancement algorithm

    NASA Astrophysics Data System (ADS)

    Ye, Zhendong; Xie, Mei

    2011-12-01

    Fingerprint identification is one of the most important biometric technologies. The performance of the minutiae extraction and the speed of the fingerprint verification system rely heavily on the quality of the input fingerprint images, so the enhancement of the low fingerprint is a critical and difficult step in a fingerprint verification system. In this paper we proposed an effective algorithm for fingerprint enhancement. Firstly we use normalization algorithm to reduce the variations in gray level values along ridges and valleys. Then we utilize the structure tensor approach to estimate each pixel of the fingerprint orientations. At last we propose a novel algorithm which combines the advantages of onedimensional Gabor filtering method and anisotropic method to enhance the fingerprint in recoverable region. The proposed algorithm has been evaluated on the database of Fingerprint Verification Competition 2004, and the results show that our algorithm performs within less time.

  17. An effective one-dimensional anisotropic fingerprint enhancement algorithm

    NASA Astrophysics Data System (ADS)

    Ye, Zhendong; Xie, Mei

    2012-01-01

    Fingerprint identification is one of the most important biometric technologies. The performance of the minutiae extraction and the speed of the fingerprint verification system rely heavily on the quality of the input fingerprint images, so the enhancement of the low fingerprint is a critical and difficult step in a fingerprint verification system. In this paper we proposed an effective algorithm for fingerprint enhancement. Firstly we use normalization algorithm to reduce the variations in gray level values along ridges and valleys. Then we utilize the structure tensor approach to estimate each pixel of the fingerprint orientations. At last we propose a novel algorithm which combines the advantages of onedimensional Gabor filtering method and anisotropic method to enhance the fingerprint in recoverable region. The proposed algorithm has been evaluated on the database of Fingerprint Verification Competition 2004, and the results show that our algorithm performs within less time.

  18. Toward surface-enhanced Raman imaging of latent fingerprints.

    PubMed

    Connatser, R Maggie; Prokes, Sharka M; Glembocki, Orest J; Schuler, Rebecca L; Gardner, Charles W; Lewis, Samuel A; Lewis, Linda A

    2010-11-01

    Exposure to light or heat, or simply a dearth of fingerprint material, renders some latent fingerprints undetectable using conventional methods. We begin to address such elusive fingerprints using detection targeting photo- and thermally stable fingerprint constituents: surface-enhanced Raman spectroscopy (SERS). SERS can give descriptive vibrational spectra of amino acids, among other robust fingerprint constituents, and good sensitivity can be attained by improving metal-dielectric nanoparticle substrates. With SERS chemical imaging, vibrational bands' intensities recreate a visual of fingerprint topography. The impact of nanoparticle synthesis route, dispersal methodology-deposition solvent, and laser wavelength are discussed, as are data from enhanced vibrational spectra of fingerprint components. SERS and Raman chemical images of fingerprints and realistic contaminants are shown. To our knowledge, this represents the first SERS imaging of fingerprints. In conclusion, this work progresses toward the ultimate goal of vibrationally detecting latent prints that would otherwise remain undetected using traditional development methods.

  19. Iodometric and Molecular Detection of ESBL Production Among Clinical Isolates of E. coli Fingerprinted by ERIC-PCR: The First Egyptian Report Declares the Emergence of E. coli O25b-ST131clone Harboring blaGES.

    PubMed

    El-Badawy, Mohamed F; Tawakol, Wael M; Maghrabi, Ibrahim A; Mansy, Moselhy S; Shohayeb, Mohamed M; Ashour, Mohammed S

    2017-01-18

    The extensive use of β-lactam antibiotics has led to emergence and spread of extended-spectrum β-lactamases (ESBLs). This study was conducted to investigate the prevalence of 7 different ESBL genes (blaTEM, blaSHV, blaCTX-M, blaVEB, blaPER, blaGES, and blaOXA-10) and O25b-ST131 high-risk clone among 61 clinical isolates of Escherichia coli. Also, one broad-spectrum β-lactamase (blaOXA-1) was investigated. This study was also constructed to evaluate iodometric overlay method in detection of ESBL production. Phenotypic identification of E. coli isolates using API 20E revealed 18 distinct biotypes. DNA fingerprinting using enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) differentiated all isolates into 2 main phylogenetic groups with 60 distinct genetic profiles. Elevated values of minimal inhibitory concentration (MIC)50 and MIC90 for third- and fourth-generation cephalosporins were observed. Phenotypic tests revealed that 85.24% of isolates were ESBL producers. The incidence rates of blaTEM, blaSHV, blaCTX-M, blaGES, blaOXA-1, and blaOXA-10 among E. coli ESBL producer phenotype were 69.23%, 25%, 96.15%, 3.85%, 11.54%, and 48%, respectively. On the other hand, blaVEB and blaPER were not detected. Sequencing of blaTEM and blaSHV revealed that blaTEM-214 and blaSHV-11 were the most prevalent variants. Group characterization of blaCTX-M revealed that blaCTX-M-1 was the most prevalent group of blaCTX-M family. It was found that 30.77% of E. coli ESBL producers belonged to O25b-ST131 clone harboring blaCTX-M-15. This study concluded that iodometric overlay method was 100% sensitive in detection of ESBL production. To our knowledge, this is the first Egyptian study that declares the emergence of E. coli O25b-ST131 harboring blaGES.

  20. The detection of drugs of abuse in fingerprints using Raman spectroscopy II: cyanoacrylate-fumed fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-07-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in cyanoacrylate-fumed fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. These fingerprints were enhanced by cyanoacrylate fuming, a process in which a layer of white cyanoacrylate polymer is deposited on the fingerprint material, enabling visual detection. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were used. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in cyanoacrylate-fumed fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in cyanoacrylate-fumed fingerprints were of a similar quality to spectra obtained from the substances under normal sampling conditions, however, interfering Raman bands arising from the cyanoacrylate polymer were present in the spectra. In most cases the only interfering band was the CN stretching mode of the polymer, and there were no cases where the interfering bands prevented identification of the substances. If necessary, the interfering bands could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in cyanoacrylate-fumed fingerprints was visually locating the substance in the fingerprint beneath the polymer layer in order to obtain a Raman spectrum.

  1. The effect of lead from sediment bioturbation by Lumbriculus variegatus on Daphnia magna in the water column.

    PubMed

    Blankson, Emmanuel R; Klerks, Paul L

    2016-12-01

    The present study investigated the bioavailability and potential toxicity to Daphnia magna of lead released to the water column due to bioturbation by Lumbriculus variegatus. Experiments used microcosms with Pb-spiked sediment, with or without worms in the sediment, and with D. magna present in the water column. The daphniids were allowed free movement or were restricted to flow-through containers, in order to assess the influence of their direct contact with the contaminated sediment. A control group consisted of D. magna in clean moderately hard reconstituted water. At the end of the 12-day experiment, D. magna survival, reproduction, biomass, and Pb-bioaccumulation were determined. Water column turbidity and Pb levels were quantified to assess their influence on the Pb toxicity and bioaccumulation. The bioturbation by L. variegatus increased Pb levels and turbidity in the water column. While this resulted in an increased Pb bioaccumulation by the D. magna, the water column Pb levels and the Pb bioaccumulation were insufficient to bring about toxic effects for the survival, reproduction, and biomass of the daphniids. Contact of D. magna with the sediment resulted in an increase in their Pb bioaccumulation, with water turbidity and Pb data, suggesting that these crustaceans also acted as bioturbators. The increase in Pb bioaccumulation in D. magna as a consequence of bioturbation by L. variegatus demonstrates the potential for bioturbation to enhance contaminant toxicity to organisms in the water column, though this potential appeared relatively low in the case of lead.

  2. Social media fingerprints of unemployment.

    PubMed

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets.

  3. Social Media Fingerprints of Unemployment

    PubMed Central

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

  4. Iron-Tolerant Cyanobacteria: Ecophysiology and Fingerprinting

    NASA Technical Reports Server (NTRS)

    Brown, I. I.; Mummey, D.; Lindsey, J.; McKay, D. S.

    2006-01-01

    Although the iron-dependent physiology of marine and freshwater cyanobacterial strains has been the focus of extensive study, very few studies dedicated to the physiology and diversity of cyanobacteria inhabiting iron-depositing hot springs have been conducted. One of the few studies that have been conducted [B. Pierson, 1999] found that cyanobacterial members of iron depositing bacterial mat communities might increase the rate of iron oxidation in situ and that ferrous iron concentrations up to 1 mM significantly stimulated light dependent consumption of bicarbonate, suggesting a specific role for elevated iron in photosynthesis of cyanobacteria inhabiting iron-depositing hot springs. Our recent studies pertaining to the diversity and physiology of cyanobacteria populating iron-depositing hot springs in Great Yellowstone area (Western USA) indicated a number of different isolates exhibiting elevated tolerance to Fe(3+) (up to 1 mM). Moreover, stimulation of growth was observed with increased Fe(3+) (0.02-0.4 mM). Molecular fingerprinting of unialgal isolates revealed a new cyanobacterial genus and species Chroogloeocystis siderophila, an unicellular cyanobacterium with significant EPS sheath harboring colloidal Fe(3+) from iron enriched media. Our preliminary data suggest that some filamentous species of iron-tolerant cyanobacteria are capable of exocytosis of iron precipitated in cytoplasm. Prior to 2.4 Ga global oceans were likely significantly enriched in soluble iron [Lindsay et al, 2003], conditions which are not conducive to growth of most contemporary oxygenic cyanobacteria. Thus, iron-tolerant CB may have played important physiological and evolutionary roles in Earths history.

  5. Monte Carlo-based quantitative structure-activity relationship models for toxicity of organic chemicals to Daphnia magna.

    PubMed

    Toropova, Alla P; Toropov, Andrey A; Veselinović, Aleksandar M; Veselinović, Jovana B; Leszczynska, Danuta; Leszczynski, Jerzy

    2016-11-01

    Quantitative structure-activity relationships (QSARs) for toxicity of a large set of 758 organic compounds to Daphnia magna were built up. The simplified molecular input-line entry system (SMILES) was used to represent the molecular structure. The Correlation and Logic (CORAL) software was utilized as a tool to develop the QSAR models. These models are built up using the Monte Carlo method and according to the principle "QSAR is a random event" if one checks a group of random distributions in the visible training set and the invisible validation set. Three distributions of the data into the visible training, calibration, and invisible validation sets are examined. The predictive potentials (i.e., statistical characteristics for the invisible validation set of the best model) are as follows: n = 87, r(2)  = 0.8377, root mean square error = 0.564. The mechanistic interpretations and the domain of applicability of built models are suggested and discussed. Environ Toxicol Chem 2016;35:2691-2697. © 2016 SETAC. © 2016 SETAC.

  6. Influences of size-fractionated humic acids on arsenite and arsenate complexation and toxicity to Daphnia magna.

    PubMed

    Ren, Jinqian; Fan, Wenhong; Wang, Xiangrui; Ma, Qingquan; Li, Xiaomin; Xu, Zhizhen; Wei, Chaoyang

    2017-01-01

    The intrinsic physicochemical properties of dissolved organic matter (DOM) may affect the mobility and toxicity of arsenic in aquatic environments. In the present study, the humic acid (HA) was ultra-filtered into five fractions according to molecular weight, and their physicochemical properties were characterized. Complexation of HA fractions with arsenite and arsenate was first determined by differential pulse polarography (DPP). The influences of HA fractions on arsenic toxicity were then examined using Daphnia magna as a model organism. As(V) had a higher affinity with HA than As(III), and their complexation was dependent on the total acidity and fluorescence characteristics of DOM. We demonstrated that the acidity and fluorescence also better explained the As toxicity to daphnids than UV absorbance and hydraulic diameter. Arsenic speciation determined by DPP significantly affected the toxicity of arsenite and arsenate. The results extended the free-ion activity model application to the case of arsenic. The present study clearly indicated that DOM with different molecular weights has distinct physicochemical properties, and could influence the speciation and toxicity of As to different extent. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Exploring the role of quantum chemical descriptors in modeling acute toxicity of diverse chemicals to Daphnia magna.

    PubMed

    Reenu; Vikas

    2015-09-01

    Various quantum-mechanically computed molecular and thermodynamic descriptors along with physico-chemical, electrostatic and topological descriptors are compared while developing quantitative structure-activity relationships (QSARs) for the acute toxicity of 252 diverse organic chemicals towards Daphnia magna. QSAR models based on the quantum-chemical descriptors, computed with routinely employed advanced semi-empirical and ab-initio methods, along with the electron-correlation contribution (CORR) of the descriptors, are analyzed for the external predictivity of the acute toxicity. The models with reliable internal stability and external predictivity are found to be based on the HOMO energy along with the physico-chemical, electrostatic and topological descriptors. Besides this, the total energy and electron-correlation energy are also observed as highly reliable descriptors, suggesting that the intra-molecular interactions between the electrons play an important role in the origin of the acute toxicity, which is in fact an unexplored phenomenon. The models based on quantum-chemical descriptors such as chemical hardness, absolute electronegativity, standard Gibbs free energy and enthalpy are also observed to be reliable. A comparison of the robust models based on the quantum-chemical descriptors computed with various quantum-mechanical methods suggests that the advanced semi-empirical methods such as PM7 can be more reliable than the ab-initio methods which are computationally more expensive. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Dental DNA fingerprinting in identification of human remains.

    PubMed

    Girish, Kl; Rahman, Farzan S; Tippu, Shoaib R

    2010-07-01

    The recent advances in molecular biology have revolutionized all aspects of dentistry. DNA, the language of life yields information beyond our imagination, both in health or disease. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. It is being increasingly used in analyzing various scenarios related to forensic science. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. DNA is an excellent means for identification of unidentified human remains. As dental pulp is surrounded by dentin and enamel, which forms dental armor, it offers the best source of DNA for reliable genetic type in forensic science. This paper summarizes the recent literature on use of this technique in identification of unidentified human remains.

  9. Dental DNA fingerprinting in identification of human remains

    PubMed Central

    Girish, KL; Rahman, Farzan S; Tippu, Shoaib R

    2010-01-01

    The recent advances in molecular biology have revolutionized all aspects of dentistry. DNA, the language of life yields information beyond our imagination, both in health or disease. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. It is being increasingly used in analyzing various scenarios related to forensic science. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. DNA is an excellent means for identification of unidentified human remains. As dental pulp is surrounded by dentin and enamel, which forms dental armor, it offers the best source of DNA for reliable genetic type in forensic science. This paper summarizes the recent literature on use of this technique in identification of unidentified human remains. PMID:21731342

  10. Virulence arsenal of the most pathogenic species among the Gram-positive anaerobic cocci, Finegoldia magna.

    PubMed

    Boyanova, Lyudmila; Markovska, Rumyana; Mitov, Ivan

    2016-12-01

    This review focuses on the virulence arsenal of the most pathogenic species among Gram positive anaerobic cocci, Finegoldia magna according to recently published data from 2012 to 2016. Virulence factors like sortase dependent pili and F. magna adhesion factor (FAF) facilitate the start of the infection. Albumin binding protein (PAB) enhances F. magna survival. FAF, subtilisin-like extracellular serine protease (SufA) and superantigen protein L protect the bacteria from factors of innate defense system. SufA, capsule and tissue-destroying enzymes provide a deep penetration or spread of the infections and the protein L is associated with infection severity. Biofilm production results in infection chronification and complicated treatment as well as to persistence of multi-species biofilms. Resistance rates to quinolones (13.0->70%) and clindamycin (0-40.0%) are important, and resistance to penicillins (<4%), chloramphenicol (7.0%) and metronidazole (<7%) has been reported. F. magna should not be overlooked when present in monoinfections or mixed infections in humans.

  11. Daphnia magna transcriptome by RNA-Seq across 12 environmental stressors

    PubMed Central

    Orsini, Luisa; Gilbert, Donald; Podicheti, Ram; Jansen, Mieke; Brown, James B.; Solari, Omid Shams; Spanier, Katina I.; Colbourne, John K.; Rush, Douglas; Decaestecker, Ellen; Asselman, Jana; De Schamphelaere, Karel A.C.; Ebert, Dieter; Haag, Christoph R.; Kvist, Jouni; Laforsch, Christian; Petrusek, Adam; Beckerman, Andrew P.; Little, Tom J.; Chaturvedi, Anurag; Pfrender, Michael E.; De Meester, Luc; Frilander, Mikko J.

    2016-01-01

    The full exploration of gene-environment interactions requires model organisms with well-characterized ecological interactions in their natural environment, manipulability in the laboratory and genomic tools. The waterflea Daphnia magna is an established ecological and toxicological model species, central to the food webs of freshwater lentic habitats and sentinel for water quality. Its tractability and cyclic parthenogenetic life-cycle are ideal to investigate links between genes and the environment. Capitalizing on this unique model system, the STRESSFLEA consortium generated a comprehensive RNA-Seq data set by exposing two inbred genotypes of D. magna and a recombinant cross of these genotypes to a range of environmental perturbations. Gene models were constructed from the transcriptome data and mapped onto the draft genome of D. magna using EvidentialGene. The transcriptome data generated here, together with the available draft genome sequence of D. magna and a high-density genetic map will be a key asset for future investigations in environmental genomics. PMID:27164179

  12. Three-Dimensional Analysis of the Swimming Behavior of Daphnia magna Exposed to Nanosized Titanium Dioxide

    PubMed Central

    Noss, Christian; Dabrunz, André; Rosenfeldt, Ricki R.; Lorke, Andreas; Schulz, Ralf

    2013-01-01

    Due to their surface characteristics, nanosized titanium dioxide particles (nTiO2) tend to adhere to biological surfaces and we thus hypothesize that they may alter the swimming performance and behavior of motile aquatic organisms. However, no suitable approaches to address these impairments in swimming behavior as a result of nanoparticle exposure are available. Water fleas Daphnia magna exposed to 5 and 20 mg/L nTiO2 (61 nm; polydispersity index: 0.157 in 17.46 mg/L stock suspension) for 96 h showed a significantly (p<0.05) reduced growth rate compared to a 1-mg/L treatment and the control. Using three-dimensional video observations of swimming trajectories, we observed a treatment-dependent swarming of D. magna in the center of the test vessels during the initial phase of the exposure period. Ensemble mean swimming velocities increased with increasing body length of D. magna, but were significantly reduced in comparison to the control in all treatments after 96 h of exposure. Spectral analysis of swimming velocities revealed that high-frequency variance, which we consider as a measure of swimming activity, was significantly reduced in the 5- and 20-mg/L treatments. The results highlight the potential of detailed swimming analysis of D. magna for the evaluation of sub-lethal mechanical stress mechanisms resulting from biological surface coating and thus for evaluating the effects of nanoparticles in the aquatic environment. PMID:24260519

  13. EFFECTIVE CONCENTRATIONS OF 6 CONTAMINANTS TO LEMMA MINOR, PIMEPHALES PROMELA, DAPHNIA MAGNA, AND CERIODAPHNIA DUBIA

    EPA Science Inventory

    The research presented here resulted in EC50 and LOEC values for the contaminants copper, cadmium, diazinon, atrazine, and cyanide to the species Lemna Minor, Pimephales promelas, Daphnia magna, and Ceriodaphnia dubia. Observed values were used as benchmarks for assessing the se...

  14. Development and validation of a Daphnia magna four-day survival and growth test method

    EPA Science Inventory

    Zooplankton are an important part of the aquatic ecology of all lakes and streams. As a result, numerous methods have been developed to assess the quality of waterbodies using various zooplankton species. Included in these is the freshwater species Daphnia magna. Current test me...

  15. The Role of Secure Knowledge in Enabling Year 7 to Write Essays on Magna Carta

    ERIC Educational Resources Information Center

    King, Mark

    2015-01-01

    Setting out to teach Magna Carta to the full attainment range in Year 7, Mark King decided to choose a question that reflected real scholarly debates and also to ensure that pupils held enough knowledge in long-term memory to be able to think about that question meaningfully. As he gradually prepared his pupils to produce their own causation…

  16. Coxa magna quantification using MRI in Legg-Calve-Perthes disease.

    PubMed

    Sales de Gauzy, Jérôme; Briot, Jérôme; Swider, Pascal

    2009-01-01

    The idiopathic avascular necrosis of the femoral epiphysis characterizes the Legg-Calve-Perthes disease in pediatric osteoarticular pathologies. The coxa magna, more frequently observed, corresponds to an enlargement and deformation of the femoral head. The volume extension induces a subluxation of the hip, which is a bad prognosis for the healthy function of the joint. The aim of the study was to quantify the coxa magna in Legg-Calve-Perthes disease using magnetic resonance imaging. Twenty-five patients with unilateral Legg-Calve-Perthes disease were included in the clinical protocol and the volume properties of cartilaginous epiphyseal head were quantified using custom-made image processing software. Difference in cartilage volume between healthy hips and pathological ones were significant. Excepting one patient, we observed a statistically significant volume increase for the pathological hip, the mean value being +13%. Our results confirmed the effective three-dimensional properties of the coxa magna, which is clearly associated to a negative prognosis for the future of the joint. To our knowledge, the volume quantification of coxa magna has not been established before. The non-radiant MRI associated to three-dimensional investigation could potentially improve the clinical follow up of children to adapt the non-invasive treatment and to plan the surgery if necessary.

  17. SALINITY TOLERANCE OF DAPHNIA MAGNA AND POTENTIAL USE FOR ESTUARINE SEDIMENT TOXICITY TESTS

    EPA Science Inventory

    Daphnia magna Straus, a common organism used for freshwater sediment toxicity tests, was evaluated to determine its tolerance to salinity and suitability for tests with estuarine water and sediments. Daphnids were exposed for 2 to 21 days to salinity in a variety of water-only te...

  18. The Role of Secure Knowledge in Enabling Year 7 to Write Essays on Magna Carta

    ERIC Educational Resources Information Center

    King, Mark

    2015-01-01

    Setting out to teach Magna Carta to the full attainment range in Year 7, Mark King decided to choose a question that reflected real scholarly debates and also to ensure that pupils held enough knowledge in long-term memory to be able to think about that question meaningfully. As he gradually prepared his pupils to produce their own causation…

  19. EFFECTIVE CONCENTRATIONS OF 6 CONTAMINANTS TO LEMMA MINOR, PIMEPHALES PROMELA, DAPHNIA MAGNA, AND CERIODAPHNIA DUBIA

    EPA Science Inventory

    The research presented here resulted in EC50 and LOEC values for the contaminants copper, cadmium, diazinon, atrazine, and cyanide to the species Lemna Minor, Pimephales promelas, Daphnia magna, and Ceriodaphnia dubia. Observed values were used as benchmarks for assessing the se...

  20. Basilar impression associated with impacted cisterna magna, spastic paraparesis and distress of balance: case report.

    PubMed

    Gonçalves da Silva, José Alberto; de Almeida Holanda, Maurus Marques; do Desterro Leiros, Maria; Melo, Luiz Ricardo Santiago; de Araújo, Antônio Fernandes; de Almeida, Everardo Bandeira

    2006-09-01

    We report on a 48 years-old man with basilar impression without syringohydromyelia, in which the cisterna magna was impacted by the cerebellar tonsils. Six months after posterior fossa decompression there was the disappearance of nuchal rigidity, vertigo, spastic paraparesis and improvement of balance. Nevertheless hyperreflexia and diminished pallesthesia of the lower limbs persisted.

  1. Genetic variation in the cellular response of Daphnia magna (Crustacea: Cladocera) to its bacterial parasite

    PubMed Central

    Auld, Stuart K. J. R.; Scholefield, Jennifer A.; Little, Tom J.

    2010-01-01

    Linking measures of immune function with infection, and ultimately, host and parasite fitness is a major goal in the field of ecological immunology. In this study, we tested for the presence and timing of a cellular immune response in the crustacean Daphnia magna following exposure to its sterilizing endoparasite Pasteuria ramosa. We found that D. magna possesses two cell types circulating in the haemolymph: a spherical one, which we call a granulocyte and an irregular-shaped amoeboid cell first described by Metchnikoff over 125 years ago. Daphnia magna mounts a strong cellular response (of the amoeboid cells) just a few hours after parasite exposure. We further tested for, and found, considerable genetic variation for the magnitude of this cellular response. These data fostered a heuristic model of resistance in this naturally coevolving host–parasite interaction. Specifically, the strongest cellular responses were found in the most susceptible hosts, indicating resistance is not always borne from a response that destroys invading parasites, but rather stems from mechanisms that prevent their initial entry. Thus, D. magna may have a two-stage defence—a genetically determined barrier to parasite establishment and a cellular response once establishment has begun. PMID:20534618

  2. Acute toxicity assessment of camphor in biopesticides by using Daphnia magna and Danio rerio.

    PubMed

    Yim, Eun-Chae; Kim, Hyeon-Joe; Kim, Seong-Jun

    2014-01-01

    An ecofriendly alternative to chemical pesticides is bio-pesticides, which are derived from natural sources. The interest in bio-pesticides is based on the disadvantages associated with chemical pesticides. We conducted acute toxicity assessments of camphor, a major component of bio-pesticides, by using Daphnia magna (D. magna) as well as assessed the morphological abnormalities that occurred in Danio rerio (D. rerio) embryos. The median effective concentration of camphor on D. magna after 48 hours was 395.0 μM, and the median lethal concentration on D. rerio embryos after 96 hours was 838.6 μM. The no observed effect concentration and predicted no effect concentration of camphor on D. magna, which was more sensitive than D. rerio, were calculated as 55.2 μM and 3.95 μM, respectively. Morphological abnormalities in D. rerio embryos exposed to camphor increased over time. Coagulation, delayed hatching, yolk sac edema, pericardial edema, and pigmentation of embryos mainly appeared between 24 and 48 hours. Further, symptoms of scoliosis and head edema occurred after 72 hours. In addition, bent tails, ocular defects and collapsed symptoms of fertilized embryonic tissue were observed after 96 hours. The camphor toxicity results suggest that continuous observations on the ecosystem are necessary to monitor toxicity in areas where biological pesticides containing camphor are sprayed.

  3. Acute toxicity assessment of camphor in biopesticides by using Daphnia magna and Danio rerio

    PubMed Central

    Yim, Eun-Chae; Kim, Hyeon-Joe; Kim, Seong-Jun

    2014-01-01

    Objectives An ecofriendly alternative to chemical pesticides is bio-pesticides, which are derived from natural sources. The interest in bio-pesticides is based on the disadvantages associated with chemical pesticides. Methods We conducted acute toxicity assessments of camphor, a major component of bio-pesticides, by using Daphnia magna (D. magna) as well as assessed the morphological abnormalities that occurred in Danio rerio (D. rerio) embryos. Results The median effective concentration of camphor on D. magna after 48 hours was 395.0 μM, and the median lethal concentration on D. rerio embryos after 96 hours was 838.6 μM. The no observed effect concentration and predicted no effect concentration of camphor on D. magna, which was more sensitive than D. rerio, were calculated as 55.2 μM and 3.95 μM, respectively. Morphological abnormalities in D. rerio embryos exposed to camphor increased over time. Coagulation, delayed hatching, yolk sac edema, pericardial edema, and pigmentation of embryos mainly appeared between 24 and 48 hours. Further, symptoms of scoliosis and head edema occurred after 72 hours. In addition, bent tails, ocular defects and collapsed symptoms of fertilized embryonic tissue were observed after 96 hours. Conclusions The camphor toxicity results suggest that continuous observations on the ecosystem are necessary to monitor toxicity in areas where biological pesticides containing camphor are sprayed. PMID:25234414

  4. Production of male neonates in Daphnia magna (Cladocera, Crustacea) exposed to juvenile hormones and their analogs.

    PubMed

    Oda, Shigeto; Tatarazako, Norihisa; Watanabe, Hajime; Morita, Masatoshi; Iguchi, Taisen

    2005-12-01

    We exposed the water flea Daphnia magna (Cladocera, Crustacea) to either juvenile hormone I (JH I), juvenile hormone II (JH II), or the juvenile hormone-mimicking insecticides kinoprene, hydroprene, epofenonane, or fenoxycarb. By 21-day reproduction tests, we investigated the effects on the number of neonates born per female and the offspring sex ratio. All six chemicals induced D. magna to produce male neonates; the male sex ratio of the offspring increased as the chemical concentration increased. EC50 values for production of male neonates were estimated as 400 (JH I), 410 (JH II), 190 (kinoprene), 2.9 (hydroprene), 64 (epofenonane), and 0.92 (fenoxycarb) microg/l. The number of neonates produced was reduced with all chemicals at the concentrations investigated. At the EC50 for male production, five of the six chemicals reduced the reproductive rate to less than 50%; the exception was epofenonane, which caused only a slight reduction in reproductive rate. These results were similar to those obtained for five juvenoids studied previously, one of which was studied here again. There are now 10 chemical substances--all juvenile hormones or their analogs-that are known to induce D. magna to produce male neonates. This suggests that juvenile hormone is involved in initiating male production followed by sexual reproduction in D. magna, and probably in most cladocerans that exhibit cyclic parthenogenesis.

  5. Quantification of differentially expressed genes in Daphnia magna exposed to rubber wastewater.

    PubMed

    Jo, Hun-Je; Jung, Jinho

    2008-09-01

    In this study, differentially expressed genes (DEGs) were investigated in Daphnia magna exposed to rubber wastewater using an annealing control primer (ACP)-based polymerase chain reaction (PCR) and real-time PCR. Among three identified DEGs, two genes (DEG1 and DEG2) were up-regulated, and DEG1 expression was well-correlated to a logarithm of rubber wastewater concentration (r2=0.971, p<0.0001). In addition, DEG1 expression in D. magna exposed to rubber wastewater was strongly correlated with that of D. magna exposed to Zn (r2=0.9513, p<0.05), suggesting that the induction of DEG1 was caused by Zn, which is the dominant toxicant in rubber wastewater. In addition, DEG1 expression was more sensitive to toxicants than immobility, which is the conventional endpoint in toxicity tests using D. magna. The lowest observed effect concentrations (LOEC) determined using immobility tests were 2.5% for rubber wastewater and 1.6mgl(-1) for Zn. In contrast, a significant increase in DEG1 expression was observed at exposure concentrations of as low as 0.6% rubber wastewater and 0.2mgl(-1) Zn. These results indicate that DEG1 is a sensitive and quantitative biomarker of water and wastewater containing Zn.

  6. Ecotoxicological effect of ketamine: Evidence of acute, chronic and photolysis toxicity to Daphnia magna.

    PubMed

    Li, Shih-Wei; Wang, Yu-Hsiang; Lin, Angela Yu-Chen

    2017-09-01

    Ketamine has been increasingly used in medicine and has the potential for abuse or illicit use around the world. Ketamine cannot be removed by conventional wastewater treatment plants. Although ketamine and its metabolite norketamine have been detected to a significant degree in effluents and aquatic environments, their ecotoxicity effects in aquatic organisms remain undefined. In this study, we investigated the acute toxicity of ketamine and its metabolite, along with the chronic reproductive toxicity of ketamine (5-100μg/L) to Daphnia magna. Multiple environmental scenarios were also evaluated, including drug mixtures and sunlight irradiation toxicity. Ketamine and norketamine caused acute toxicity to D. magna, with half lethal concentration (LC50) values of 30.93 and 25.35mg/L, respectively, after 48h of exposure. Irradiated solutions of ketamine (20mg/L) significantly increased the mortality of D. magna; pre-irradiation durations up to 2h rapidly increased the death rate to 100%. A new photolysis byproduct (M.W. 241) of norketamine that accumulates during irradiation was identified for the first time. The relevant environmental concentration of ketamine produced significant reproductive toxicity effects in D. magna, as revealed by the reduction of the number of total live offspring by 33.6-49.8% (p < 0.05). The toxicity results indicate that the environmental hazardous risks of the relevant ketamine concentration cannot be ignored and warrant further examination. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Development and validation of a Daphnia magna four-day survival and growth test method

    EPA Science Inventory

    Zooplankton are an important part of the aquatic ecology of all lakes and streams. As a result, numerous methods have been developed to assess the quality of waterbodies using various zooplankton species. Included in these is the freshwater species Daphnia magna. Current test me...

  8. Three-dimensional analysis of the swimming behavior of Daphnia magna exposed to nanosized titanium dioxide.

    PubMed

    Noss, Christian; Dabrunz, André; Rosenfeldt, Ricki R; Lorke, Andreas; Schulz, Ralf

    2013-01-01

    Due to their surface characteristics, nanosized titanium dioxide particles (nTiO2) tend to adhere to biological surfaces and we thus hypothesize that they may alter the swimming performance and behavior of motile aquatic organisms. However, no suitable approaches to address these impairments in swimming behavior as a result of nanoparticle exposure are available. Water fleas Daphnia magna exposed to 5 and 20 mg/L nTiO2 (61 nm; polydispersity index: 0.157 in 17.46 mg/L stock suspension) for 96 h showed a significantly (p<0.05) reduced growth rate compared to a 1-mg/L treatment and the control. Using three-dimensional video observations of swimming trajectories, we observed a treatment-dependent swarming of D. magna in the center of the test vessels during the initial phase of the exposure period. Ensemble mean swimming velocities increased with increasing body length of D. magna, but were significantly reduced in comparison to the control in all treatments after 96 h of exposure. Spectral analysis of swimming velocities revealed that high-frequency variance, which we consider as a measure of swimming activity, was significantly reduced in the 5- and 20-mg/L treatments. The results highlight the potential of detailed swimming analysis of D. magna for the evaluation of sub-lethal mechanical stress mechanisms resulting from biological surface coating and thus for evaluating the effects of nanoparticles in the aquatic environment.

  9. Activity of closantel against experimentally induced Fascioloides magna infection in sheep.

    PubMed

    Stromberg, B E; Schlotthauer, J C; Seibert, B P; Conboy, G A; Newcomb, K M

    1985-12-01

    The efficacy of closantel against experimentally induced Fascioloides magna infection in sheep was studied. In each of 3 experiments, closantel was administered 8 weeks after the sheep were given (oral inoculation) 100 metacercariae of F magna. In the 1st experiment, closantel was given orally to 5 groups of 6 sheep each at dosages of 0 (nontreated control), 5, 7.5, 10, and 15 mg/kg of body weight. In the 2nd and 3rd experiments, groups of 10 or 12 sheep were treated to confirm the efficacy of the previously determined optimal dosage of 15 mg/kg. An additional group of sheep (n = 10) was used in the 3rd experiment to evaluate the efficacy of closantel given IM at a dosage of 7.5 mg/kg. Closantel given orally at a dosage level of 15 mg/kg was highly effective (94.6% to 97.7%) in reducing F magna burdens. Also, pathologic scores associated with the F magna infection were reduced by 81.3% to 92.6% in sheep given this dosage of closantel. Efficacy of the IM administered dosage of 7.5 mg of drug/kg was equivalent to that of the 15 mg/kg oral dosage. Other than mild, transient lameness of the limbs which were injected with the drug (group 10), side effects were not observed.

  10. Metabolism of drugs and other xenobiotics in giant liver fluke (Fascioloides magna).

    PubMed

    Prchal, Lukáš; Vokřál, Ivan; Kašný, Martin; Rejšková, Lenka; Zajíčková, Markéta; Lamka, Jiří; Skálová, Lenka; Lecová, Lenka; Szotáková, Barbora

    2016-01-01

    1. Giant liver fluke Fascioloides magna is a dangerous parasite, which infects herbivores. It was imported to Europe from North America and started to spread. Benzimidazoles like albendazole, mebendazole, triclabendazole and salicylanilides closantel and rafoxanide are the most used anthelmintics to control fascioloidosis. However their effect might be altered via drug-metabolizing enzymes of this parasite. 2. The aim of our study was to determine the activities of drug-metabolizing enzymes in F. magna and the metabolism of above mentioned anthelmintics. 3. Activities of several oxidative, reductive and conjugative enzymes towards various model xenobiotic substrates were found in F. magna subcellular fractions. 4. Subcellular fractions from F. magna oxidized albendazole to its sulphoxide metabolite and reduced mebendazole to hydroxyl-mebendazole. Under ex vivo conditions, only very-low concentrations of these compounds were detected using high-performance liquid chromatography/mass spectrometry. 5. The results indicate that the giant liver fluke possesses the active xenobiotic-metabolizing system. The overexpression of this system may play an important role in parasite resistance against these anthelmintics.

  11. [Lifetime of hydrobionts Daphnia magna in a noncontact-activated water].

    PubMed

    Iksanova, T I; Stekhin, A A; Iakovleva, G V; Kamentskaia, D B

    2015-01-01

    The article is devoted to the study of the influence of non-contact activated water on the lifetime and replicative function of aquatic organisms Daphnia magna, belonging to a highly organized animal organisms. There was established the proportional relationship between the concentration of hydrogen peroxide (in the anion-radical form) and the duration of aquatic lifetime of hydrobionts. In a non contact activated water media with values of redox -potential (Eh)~130mV (against Eh = 213mV--in the control) the lifetime of hydrobionts Daphnia magna is shown to increase in average up to 9 days and reaches 34 days (as 25 days in the control). Replicative junction activated in the aquatic environment does not change, but there was noted a delay in the time of dropping by 7 days in average. Noted regularities in the change in the lifetime of aquatic organisms Daphnia magna in aquatic activated environments are interpreted on the basis of the dependence of the proliferative activity of cells on the concentration of hydrogen peroxide in water. The obtained data on lifetime of Daphnia magna in activated electron-donor environments can serve as proof of the hygienic safety and biological activity of physically-activated (non-contact) drinking water.

  12. Growth of Daphnia magna exposed to mixtures of chemicals with diverse modes of action

    SciTech Connect

    Deneer, J.W.; Seinen, W.; Hermens, J.L.

    1988-02-01

    Concentrations causing inhibition of growth of Daphnia magna after 16 days of exposure were determined for nine chemicals that presumably act through different modes of action. The joint toxic effect of a mixture of these chemicals is found to be nonadditive.

  13. Impact of imidacloprid on Daphnia magna under different food quality regimes.

    PubMed

    Ieromina, Oleksandra; Peijnenburg, Willie J G M; de Snoo, Geert; Müller, Jutta; Knepper, Thomas P; Vijver, Martina G

    2014-03-01

    Aquatic ecosystems are characterized by fluctuating conditions that have direct effects on aquatic communities but also indirect influences such as changing the toxicity of chemicals. Because the effect of food quality on pesticide toxicity has rarely been studied, in the present study Daphnia magna juveniles supplied with 4 different food quality levels were exposed to a range of imidacloprid concentrations for 21 d. Food quality was expressed as carbon:phosphorus ratios of algae Pseudokirchneriella subcapitata (C:P 35, C:P 240, C:P 400, and C:P 1300). Survival, growth rates, and reproduction of D. magna were monitored, and the combined effects of imidacloprid exposure and the phosphorus content of algae were analyzed. A stronger effect on survival was observed at the P-deficient diet (C:P 1300), confirmed by lower 10% effect concentration (EC10) values at days 7, 9, 15, and 21 compared with diets with higher phosphorus contents. Similarly, the growth rate was reduced when D. magna were supplied with algae of low phosphorus content at imidacloprid exposure conditions. The highest reproductive output was observed for D. magna fed the optimal phosphorus diet (C:P 240), both at control and exposed conditions. Poor food quality increased the sensitivity of nontarget species to pesticide exposure, potentially leading to an underestimation of adverse effects on aquatic communities in the field.

  14. Bioaccumulation and oxidative stress in Daphnia magna exposed to arsenite and arsenate.

    PubMed

    Fan, Wenhong; Ren, Jinqian; Li, Xiaomin; Wei, Chaoyang; Xue, Feng; Zhang, Nan

    2015-11-01

    Arsenic pollution and its toxicity to aquatic organisms have attracted worldwide attention. The bioavailability and toxicity of arsenic are highly related to its speciation. The present study investigated the differences in bioaccumulation and oxidative stress responses in an aquatic organism, Daphnia magna, induced by 2 inorganic arsenic species (As(III) and As(V)). The bioaccumulation of arsenic, Na(+) /K(+) -adenosine triphosphatase (ATPase) activity, reactive oxygen species (ROS) content, total superoxide dismutase (SOD) activity, total antioxidative capability, and malondialdehyde content in D. magna were determined after exposure to 500 µg/L of arsenite and arsenate for 48 h. The results showed that the oxidative stress and antioxidative process in D. magna exposed to arsenite and arsenate could be divided into 3 phases, which were antioxidative response, oxidation inhibition, and antioxidative recovery. In addition, differences in bioaccumulation, Na(+) /K(+) -ATPase activity, and total SOD activity were also found in D. magna exposed to As(III) and As(V). These differences might have been the result of the high affinity of As(III) with sulfhydryl groups in enzymes and the structural similarity of As(V) to phosphate. Therefore, arsenate could be taken up by organisms through phosphate transporters, could substitute for phosphate in biochemical reactions, and could lead to a change in the bioaccumulation of arsenic and activity of enzymes. These characteristics were the possible reasons for the different toxicity mechanisms in the oxidative stress process of arsenite and arsenate.

  15. Synthesis, characterization and toxicological evaluation of Cr₂O₃ nanoparticles using Daphnia magna and Aliivibrio fischeri.

    PubMed

    Puerari, Rodrigo Costa; da Costa, Cristina H; Vicentini, Denice S; Fuzinatto, Cristiane F; Melegari, Silvia P; Schmidt, Éder C; Bouzon, Zenilda L; Matias, William G

    2016-06-01

    Chromium III oxide (Cr2O3) nanoparticles (NPs) are used in pigments for ceramics, dyes, paints and cosmetics. However, few studies addressing the toxic potential of these NPs have been reported in the literature. Thus, this research aimed to evaluate the acute and chronic effects of Cr2O3 NPs through acute toxicity tests with Daphnia magna and Aliivibrio fischeri and chronic toxicity tests with Daphnia magna. Cr2O3 NPs were synthesized by the sol-gel method and characterized through TEM, X-Ray diffraction (XRD), zeta potential (ZP) and surface area analysis. In the acute toxicity tests the EC(50,48h) value obtained with D. magna was 6.79 mg L(-1) and for A. fischeri the EC(50,15min) value was 16.10 mg L(-1) and the EC(50,30min) value was 12.91 mg L(-1). Regarding the chronic toxicity tests with D. magna, effects on longevity (OEC=1.00 mg L(-1)), reproduction (OEC=1.00 mg L(-1)) and growth (OEC=0.50 mg L(-1)) were observed. On the SEM and TEM images, ultrastructural alterations in the organelles of exposed organisms were also observed. Thus, toxicological studies with NPs are of great importance in order to reduce the risk of environmental contamination.

  16. Influence of food, aquatic humus, and alkalinity on methylmercury uptake by Daphnia magna

    SciTech Connect

    Monson, B.A.; Brezonik, P.L.

    1999-03-01

    Six-day-old Daphnia magna were exposed to low concentrations of methylmercury (MeHg) in synthetic freshwater and synthetic food. Uptake kinetics were determined in 24- to 72-h experiments, measuring both the loss of Hg from water and accumulation in D. magna. Dose-uptake response was linear for MeHg concentrations up to 4.0 ng/L; an initial concentration of 2.0 ng/L was used when other factors were varied. Concentrations of total Hg and MeHg in water and D. magna were measured in treatments with varied hardness and alkalinity, aquatic humus (AH), and food spiked with MeHg versus water spiked with MeHg. Uptake rate coefficients were derived from two versions of a first-order, two-compartment model. The first version assumed constant MeHg concentration; the second accounted for changing MeHg concentration in water over time. Both models accounted for a nonzero starting concentration of MeHg in plankton. Fitted rate coefficients were higher for the second model than the first: the uptake coefficient (k{sub u}) was nine times higher; the depuration coefficient (k{sub d}) was twice as high. Assuming a constant MeHg concentration for a one-time spike thus underestimated the rate coefficient. The source of MeHg was compared by exposing D. magna for 48 h to MeHg at 2 ng/L in food or water. Daphnia magna accumulated significantly more inorganic Hg (i.e., Hg{sup 2+}) from spiked food than from spiked water, but accumulation of MeHg was the same from both sources. A similar response was found when D. magna were exposed to a lake water extraction of AH at concentrations of C at 3 and 10 mg/L. At the higher AH concentration, total Hg in daphnids was higher, but MeHg was lower, suggesting that AH was a source of inorganic Hg but reduced the bioavailability of MeHg. Exposure of D. magna to MeHg at 2 ng/L in hard or soft water adjusted to pH 6.7 showed no significant difference in MeHg uptake, supporting an argument that hardness and alkalinity per se do not affect MeHg uptake by

  17. The arterial supply of the human spinal cord: a new approach to the arteria radicularis magna of Adamkiewicz.

    PubMed

    Rodriguez-Baeza, A; Muset-Lara, A; Rodriguez-Pazos, M; Domenech-Mateu, J M

    1991-01-01

    The arteria radicularis magna (Adamkiewicz's artery) was studied in 30 human spinal cords after arterial injection. The artery was present in all cases, between T8 and L2, and was identified by its diameter and position. The arteria radicularis magna was the main blood supply to the lowest region of the spinal cord. In one out of three cases it accompanied the ventral root at T9, and in 80% of the cases studied it was found on the left side. The arteria radicularis magna had a posterior component in 63% of the cases. We did not observe specific radiculo-medullary arteries in the conus medullaris region.

  18. DNA fingerprinting in botany: past, present, future.

    PubMed

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-03

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  19. DNA fingerprinting in botany: past, present, future

    PubMed Central

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined “Fingerprint News” was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on “DNA fingerprinting: approaches and applications”. Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting (“the past”) was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as “DNA fingerprinting in the present”, and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA

  20. Rapid changes in water hardness and alkalinity: Calcite formation is lethal to Daphnia magna.

    PubMed

    Bogart, Sarah J; Woodman, Samuel; Steinkey, Dylan; Meays, Cindy; Pyle, Greg G

    2016-07-15

    There is growing concern that freshwater ecosystems may be negatively affected by ever-increasing anthropogenic inputs of extremely hard, highly alkaline effluent containing large quantities of Ca(2+), Mg(2+), CO3(2-), and HCO3(-) ions. In this study, the toxicity of rapid and extreme shifts in water hardness (38-600mg/L as CaCO3) and alkalinity (30-420mg/L as CaCO3) to Daphnia magna was tested, both independently and in combination. Within these ranges, where no precipitation event occurred, shifts in water hardness and/or alkalinity were not toxic to D. magna. In contrast, 98-100% of D. magna died within 96h after exposure to 600mg/L as CaCO3 water hardness and 420mg/L as CaCO3 alkalinity (LT50 of 60h with a 95% CI of 54.2-66.0h). In this treatment, a CaCO3 (calcite) precipitate formed in the water column which was ingested by and thoroughly coated the D. magna. Calcite collected from a mining impacted stream contained embedded organisms, suggesting field streams may also experience similar conditions and possibly increased mortality as observed in the lab tests. Although further investigation is required to determine the exact fate of aquatic organisms exposed to rapid calcite precipitation in the field, we caution that negative effects may occur more quickly or at lower concentrations of water hardness and alkalinity in which we observed effects in D. magna, because some species, such as aquatic insects, are more sensitive than cladocerans to changes in ionic strength. Our results provide evidence that both calcite precipitation and the major ion balance of waters should be managed in industrially affected ecosystems and we support the development of a hardness+alkalinity guideline for the protection of aquatic life.

  1. Bioaccumulation of silver in Daphnia magna: Waterborne and dietary exposure to nanoparticles and dissolved silver.

    PubMed

    Ribeiro, Fabianne; Van Gestel, Cornelis A M; Pavlaki, Maria D; Azevedo, Sofia; Soares, Amadeu M V M; Loureiro, Susana

    2017-01-01

    Silver nanoparticles (Ag-NP) are incorporated into commercial products as antimicrobial agents, which potentiate their emission to the environment. The toxicity of Ag-NP has been associated with the release of Ag ions (Ag(+)), which are more toxic to aquatic organisms than Ag-NP. In this study, a toxicokinetics approach was applied to compare the potential of Daphnia magna to accumulate Ag from either Ag-NP or AgNO3 through different exposure routes: a) water, b) diet and c) water and diet. A one-compartment kinetics model was applied to describe the development of Ag body concentrations over time and derive uptake (k1w; k1d) and elimination (k2) rate constants. Under water-only exposure, AgNO3 induced higher Ag uptake rate constants and bioconcentration factors when compared to Ag-NP. For dietary exposure, no differences in Ag concentrations in D. magna, along with the kinetics parameters, were found for both Ag forms. Simultaneous water and dietary exposures to Ag-NP induced higher Ag concentrations in D. magna compared to AgNO3. In this combined exposure, uptake from water explains most for the increase in Ag body concentration in D. magna for Ag-NP exposure, whereas uptake from the diet was the major contributor for the increase in Ag concentration in D. magna under AgNO3 exposure. Biomagnification was not observed for any of the exposure routes applied in this study, neither for Ag-NP nor for AgNO3.

  2. Enhancement of toxic effects of phenanthrene to Daphnia magna due to the presence of suspended sediment.

    PubMed

    Zhang, Xiaotian; Xia, Xinghui; Dong, Jianwei; Bao, Yimeng; Li, Husheng

    2014-06-01

    In the present work, the influences of suspended sediment (SPS) on the toxic effects of phenanthrene (PHE), one kind of polycyclic aromatic hydrocarbons, to Daphnia magna was studied using a dialysis bag simulation system, which equalized the freely dissolved concentration of PHE between outside the dialysis bag in the presence of SPS and inside the dialysis bag in the absence of SPS. The immobilization and total superoxide dismutase (T-SOD) activity of Daphnia magna caused by PHE (0-0.8 mg L(-1)) were investigated under the influence of different SPS concentrations (0, 1, 3, 5 g L(-1)) during a 96 h-exposure. The results showed that, compared to the absence of SPS, the presence of SPS (1-5 g L(-1)) increased the immobilization of Daphnia magna by 1.6-2.7 times when the freely dissolved concentration of PHE was identical in both systems. The inhibition of T-SOD activity of Daphnia magna by PHE was significantly greater in the presence of SPS than in the absence of SPS (p<0.01). This infers that the PHE sorbed on SPS might be bioavailable and enhanced the toxic effect of PHE to Daphnia magna. The bioavailable fraction of PHE sorbed on SPS ranged from 10.1% to 22.7%, and the contribution of PHE sorbed on SPS to the immobilization caused by total PHE in the exposure system increased with SPS concentration, with the contribution ratio increasing from 36.7% to 57.7% when SPS concentration increased from 1 to 5 g L(-1). This study suggests that only considering the concentrations of hydrophobic organic compounds in the water phase may underestimate their toxicity; and the hydrophobic organic compounds sorbed on SPS should not be ignored in assessment of water quality and the establishment of water quality standard in the future.

  3. Behavioral responses of juvenile Daphnia magna after exposure to glyphosate and glyphosate-copper complexes.

    PubMed

    Hansen, Lone Rykær; Roslev, Peter

    2016-10-01

    Glyphosate (N-(phosphonomethyl)glycine) is the active ingredient in a range of popular broad-spectrum herbicide formulations. Glyphosate is a chelating agent that can form stable complexes with divalent metal ions including Cu(II). Little is known about the bioavailability and ecotoxicity of glyphosate-Cu(II) complexes to aquatic organisms. In this study, we used video tracking and behavior analysis to investigate sublethal effects of binary mixtures of glyphosate and Cu(II) to juvenile D. magna. Behavioral responses were quantified for individual D. magna after 24h and 48h exposure to glyphosate and glyhosate-Cu(II) mixtures. Sublethal concentrations resulted in decreases in swimming velocity, acceleration speed, and distance moved whereas inactive time of D. magna increased. Distance moved and inactive time were the most responsive parameters to glyphosate and glyphosate-Cu(II) exposure. On a molar basis, glyphosate-Cu(II) complexes appeared more toxic to D. magna than glyphosate alone. The 48h EC50 for glyphosate and glyphosate-Cu(II) determined from swimming distance were 75.2μM and 8.4μM, respectively. In comparison, traditional visual observation of mobility resulted in 48h EC50 values of 52.8μM and 25.5μM for glyphosate and glyphosate-Cu(II), respectively. The behavioral responses indicated that exposure of D. magna to mixtures of glyphosate and Cu(II) attenuated acute metal toxicity but increased apparent glyphosate toxicity due to complexation with Cu(II). The study suggests that glyphosate is a likely mediator of aquatic metal toxicity, and that video tracking provides an opportunity for quantitative studies of sublethal effects of pesticide complexes.

  4. Probabilistic ecological hazard assessment of parabens using Daphnia magna and Pimephales promelas.

    PubMed

    Dobbins, Laura L; Usenko, Sascha; Brain, Richard A; Brooks, Bryan W

    2009-12-01

    Parabens are common antimicrobial agents found in thousands of pharmaceuticals and personal care products. Parabens are introduced into aquatic ecosystems from wastewater treatment plant effluents and have been detected in surface waters in the low microgram per liter range. Although these compounds display low toxicity in mammals, paraben toxicity to aquatic organisms has not been investigated. Standardized acute and subchronic endpoints in larval fish (Pimephales promelas) and cladoceran (Daphnia magna) models were examined for seven different parabens (methyl-, ethyl-, isopropyl-, propyl-, isobutyl-, butyl-, benzylparaben), which encompassed a range of log P values. Paraben 48 h median lethal concentration values (LC50) ranged from 4.0 to 24.6 mg/L in D. magna and 3.3 to >160.0 mg/L in fathead minnow. Growth and reproduction in D. magna had lowest-observed-effect concentrations (LOECs) ranging from 0.12 to 9.0 mg/L and 1.5 to 6.0 mg/L, respectively. Fathead minnow growth was adversely affected at levels ranging from 1.0 to 25.0 mg/L. Aquatic toxicity of the parabens was inversely related to lipophilicity, suggesting that responses using standardized endpoints resulted from narcosis. Utilizing toxicity benchmark concentrations (e.g., LC50s, LOECs) for each compound, chemical toxicity distributions, a probabilistic hazard assessment technique, were developed to assess the probabilities of detecting parabens that elicit a response at or below a given concentration. For the responses assessed in the present study, the 5th centile values (the concentration at which 5% of parabens elicit a response) ranged from 15 microg/L to 2.43 mg/L, with D. magna growth eliciting the lowest 5th centile value and acute D. magna mortality eliciting the highest. The distributions demonstrated that at environmentally relevant concentrations in developed countries there is limited acute or subchronic aquatic hazard of parabens to the organisms and responses examined.

  5. Activity-relevant similarity values for fingerprints and implications for similarity searching

    PubMed Central

    Jasial, Swarit; Hu, Ye; Vogt, Martin; Bajorath, Jürgen

    2016-01-01

    A largely unsolved problem in chemoinformatics is the issue of how calculated compound similarity relates to activity similarity, which is central to many applications. In general, activity relationships are predicted from calculated similarity values. However, there is no solid scientific foundation to bridge between calculated molecular and observed activity similarity. Accordingly, the success rate of identifying new active compounds by similarity searching is limited. Although various attempts have been made to establish relationships between calculated fingerprint similarity values and biological activities, none of these has yielded generally applicable rules for similarity searching. In this study, we have addressed the question of molecular versus activity similarity in a more fundamental way. First, we have evaluated if activity-relevant similarity value ranges could in principle be identified for standard fingerprints and distinguished from similarity resulting from random compound comparisons. Then, we have analyzed if activity-relevant similarity values could be used to guide typical similarity search calculations aiming to identify active compounds in databases. It was found that activity-relevant similarity values can be identified as a characteristic feature of fingerprints. However, it was also shown that such values cannot be reliably used as thresholds for practical similarity search calculations. In addition, the analysis presented herein helped to rationalize differences in fingerprint search performance. PMID:27127620

  6. Electron density fingerprints (EDprints): virtual screening using assembled information of electron density.

    PubMed

    Kooistra, Albert J; Binsl, Thomas W; van Beek, Johannes H G M; de Graaf, Chris; Heringa, Jaap

    2010-10-25

    We have designed a method to encode properties related to the electron densities of molecules (calculated (1)H and (13)C NMR shifts and atomic partial charges) in molecular fingerprints (EDprints). EDprints was evaluated in terms of their retrospective virtual screening accuracy against the Directory of Useful Decoys (DUD) and compared to the established ligand-based similarity search methods MOLPRINT 2D and FCFP-4. Although there are no significant differences in the overall virtual screening accuracies of the three methods, specific examples highlight interesting differences between the new EDprints fingerprint method and the atom-centered circular fingerprint methods of MOLPRINT 2D and FCFP-4. On one hand, EDprints similarity searches can be biased by the molecular protonation state, especially when reference ligands contain multiple ionizable groups. On the other hand, EDprints models are more robust toward subtle rearrangements of chemical groups and more suitable for screening against reference molecules with fused ring systems than MOLPRINT 2D and FCFP-4. EDprints is furthermore the fastest method under investigation in comparing fingerprints (average 56-233-fold increase in speed), which makes it highly suitable for all-against-all similarity searches and for repetitive virtual screening against large chemical databases of millions of compounds.

  7. Genomic fingerprinting of virulent and avirulent strains of Clavibacter michiganensis subspecies sepedonicus.

    PubMed

    Brown, Susan E; Reilley, Ann A; Knudson, Dennis L; Ishimaru, Carol A

    2002-02-01

    Genomic fingerprints of C. michiganensis subsp. sepedonicus were generated by CHEF gel electrophoresis of restriction digested high-molecular weight DNA. Low levels of intra-subspecific variation were detected by cluster analysis of the fingerprints. Four haplotypes were identified by genomic fingerprinting with HindIII, and eight were identified with EcoRI. Haplotypes generated with HindIII were less similar than those generated by EcoRI. Haplotypes generated with HindIII formed groups that corresponded well with plant reactions of the strains, but similar types of groupings were less apparent with haplotypes generated with EcoRI. When disease severity in eggplant and potato, population size in potato, and ability to induce a hypersensitive response (HR) in tobacco were overlaid onto dendograms of genetic similarity, avirulent HR-negative strains clustered separately from virulent HR-positive strains in both EcoRI and HindIII profiles. Avirulent HR-positive strains that lack pCS1 clustered with avirulent HR-negative strains in a EcoRI dendogram, but clustered with virulent HR-positive strains in a HindIII dendogram. Genomic fingerprinting of high-molecular weight DNA fragments provided a means for detecting genomic variability associated with virulence in C. michiganensis subsp. sepedonicus.

  8. Impact of Finger Type in Fingerprint Authentication

    NASA Astrophysics Data System (ADS)

    Gafurov, Davrondzhon; Bours, Patrick; Yang, Bian; Busch, Christoph

    Nowadays fingerprint verification system is the most widespread and accepted biometric technology that explores various features of the human fingers for this purpose. In general, every normal person has 10 fingers with different size. Although it is claimed that recognition performance with little fingers can be less accurate compared to other finger types, to our best knowledge, this has not been investigated yet. This paper presents our study on the topic of influence of the finger type into fingerprint recognition performance. For analysis we employ two fingerprint verification software packages (one public and one commercial). We conduct test on GUC100 multi sensor fingerprint database which contains fingerprint images of all 10 fingers from 100 subjects. Our analysis indeed confirms that performance with small fingers is less accurate than performance with the others fingers of the hand. It also appears that best performance is being obtained with thumb or index fingers. For example, performance deterioration from the best finger (i.e. index or thumb) to the worst fingers (i.e. small ones) can be in the range of 184%-1352%.

  9. Infrared Spectroscopic Imaging of Latent Fingerprints and Associated Forensic Evidence

    PubMed Central

    Chen, Tsoching; Schultz, Zachary D.; Levin, Ira W.

    2011-01-01

    Fingerprints reflecting a specific chemical history, such as exposure to explosives, are clearly distinguished from overlapping, and interfering latent fingerprints using infrared spectroscopic imaging techniques and multivariate analysis. PMID:19684917

  10. Solving the Mystery of Fading Fingerprints with London Dispersion Forces.

    ERIC Educational Resources Information Center

    Kimbrough, Doris R.; DeLorenzo, Ronald

    1998-01-01

    Focuses on the kidnapping of a child whose fingerprints were not found inside the crime vehicle. Discusses the investigation that followed and led to knowledge of the differences between the fingerprints of children and adults. (DDR)

  11. Solving the Mystery of Fading Fingerprints with London Dispersion Forces.

    ERIC Educational Resources Information Center

    Kimbrough, Doris R.; DeLorenzo, Ronald

    1998-01-01

    Focuses on the kidnapping of a child whose fingerprints were not found inside the crime vehicle. Discusses the investigation that followed and led to knowledge of the differences between the fingerprints of children and adults. (DDR)

  12. Localized Dictionaries Based Orientation Field Estimation for Latent Fingerprints.

    PubMed

    Xiao Yang; Jianjiang Feng; Jie Zhou

    2014-05-01

    Dictionary based orientation field estimation approach has shown promising performance for latent fingerprints. In this paper, we seek to exploit stronger prior knowledge of fingerprints in order to further improve the performance. Realizing that ridge orientations at different locations of fingerprints have different characteristics, we propose a localized dictionaries-based orientation field estimation algorithm, in which noisy orientation patch at a location output by a local estimation approach is replaced by real orientation patch in the local dictionary at the same location. The precondition of applying localized dictionaries is that the pose of the latent fingerprint needs to be estimated. We propose a Hough transform-based fingerprint pose estimation algorithm, in which the predictions about fingerprint pose made by all orientation patches in the latent fingerprint are accumulated. Experimental results on challenging latent fingerprint datasets show the proposed method outperforms previous ones markedly.

  13. Fingerprinting Communication and Computation on HPC Machines

    SciTech Connect

    Peisert, Sean

    2010-06-02

    How do we identify what is actually running on high-performance computing systems? Names of binaries, dynamic libraries loaded, or other elements in a submission to a batch queue can give clues, but binary names can be changed, and libraries provide limited insight and resolution on the code being run. In this paper, we present a method for"fingerprinting" code running on HPC machines using elements of communication and computation. We then discuss how that fingerprint can be used to determine if the code is consistent with certain other types of codes, what a user usually runs, or what the user requested an allocation to do. In some cases, our techniques enable us to fingerprint HPC codes using runtime MPI data with a high degree of accuracy.

  14. [HPLC fingerprint of Calendula officinalis flower].

    PubMed

    Xing, Zhan-Fen; Cheng, Hong-Da; Zhang, Ping-Ping; Gong, Lei; Ma, Li-Ya

    2014-07-01

    To establish an HPLC fingerprint of Calendula officinalis flower for its quality control. Hypersil ODS C18 column (250 mm x 4.6 mm, 5 μm) was used with acetonitrile and water as mobile phase in a gradient mode at the flow rate of 1.0 mL/min. The detection wavelength was 220 nm and the temperature of column was set at 35 degrees C. The similarity was analyzed with the Estimating System of Similarity on the Chinese Medicine Fingerprint Chromatogram. The HPLC fingerprint of Calendula officinalis flower containing eleven peaks was set up. The similarity of Calendula officinalis flower from different habitats was greater than 0.90. This method is easy and reliable, which can be used to judge the habitat and control the quality of Calendula officinalis flower.

  15. Audio fingerprint extraction for content identification

    NASA Astrophysics Data System (ADS)

    Shiu, Yu; Yeh, Chia-Hung; Kuo, C. C. J.

    2003-11-01

    In this work, we present an audio content identification system that identifies some unknown audio material by comparing its fingerprint with those extracted off-line and saved in the music database. We will describe in detail the procedure to extract audio fingerprints and demonstrate that they are robust to noise and content-preserving manipulations. The main feature in the proposed system is the zero-crossing rate extracted with the octave-band filter bank. The zero-crossing rate can be used to describe the dominant frequency in each subband with a very low computational cost. The size of audio fingerprint is small and can be efficiently stored along with the compressed files in the database. It is also robust to many modifications such as tempo change and time-alignment distortion. Besides, the octave-band filter bank is used to enhance the robustness to distortion, especially those localized on some frequency regions.

  16. Image and video fingerprinting: forensic applications

    NASA Astrophysics Data System (ADS)

    Lefebvre, Frédéric; Chupeau, Bertrand; Massoudi, Ayoub; Diehl, Eric

    2009-02-01

    Fighting movie piracy often requires automatic content identification. The most common technique to achieve this uses watermarking, but not all copyrighted content is watermarked. Video fingerprinting is an efficient alternative solution to identify content, to manage multimedia files in UGC sites or P2P networks and to register pirated copies with master content. When registering by matching copy fingerprints with master ones, a model of distortion can be estimated. In case of in-theater piracy, the model of geometric distortion allows the estimation of the capture location. A step even further is to determine, from passive image analysis only, whether different pirated versions were captured with the same camcorder. In this paper we present three such fingerprinting-based forensic applications: UGC filtering, estimation of capture location and source identification.

  17. Fingerprint recovery from human skin surfaces.

    PubMed

    Trapecar, Matej; Balazic, Joze

    2007-11-01

    A study was conducted to investigate whether certain dactyloscopic powders and reagents can recover latent fingerprints on human skin surfaces. Four fingerprint powders, Magnetic Jet Black, Magnetic Silver, Silver Special, Swedish Black, and two other methods, cyanoacrylate fuming (CA) and Ruthenium tetroxide (RTX), were used. Having examined skin surfaces with a forensic light source, we observed that the fingerprint impressions remained visible up to 15 min after intentionally placing them on the skin surface of living subjects and dead bodies. Finger marks were recovered and positive results were achieved with Magnetic Black and Swedish Black powder on living subjects. On dead bodies finger marks treated with cyanoacrylate were visible but those treated with RTX, Swedish Black and Magnetic Jet Black powder were useful for potential comparison. On dead bodies best results were obtained with RTX method.

  18. Chemical Fingerprinting of Materials Developed Due to Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    Instrumental chemical analysis methods are developed and used to chemically fingerprint new and modified External Tank materials made necessary by changing environmental requirements. Chemical fingerprinting can detect and diagnose variations in material composition. To chemically characterize each material, fingerprint methods are selected from an extensive toolbox based on the material's chemistry and the ability of the specific methods to detect the material's critical ingredients. Fingerprint methods have been developed for a variety of materials including Thermal Protection System foams, adhesives, primers, and composites.

  19. Waveform Fingerprinting for Efficient Seismic Signal Detection

    NASA Astrophysics Data System (ADS)

    Yoon, C. E.; OReilly, O. J.; Beroza, G. C.

    2013-12-01

    Cross-correlating an earthquake waveform template with continuous waveform data has proven a powerful approach for detecting events missing from earthquake catalogs. If templates do not exist, it is possible to divide the waveform data into short overlapping time windows, then identify window pairs with similar waveforms. Applying these approaches to earthquake monitoring in seismic networks has tremendous potential to improve the completeness of earthquake catalogs, but because effort scales quadratically with time, it rapidly becomes computationally infeasible. We develop a fingerprinting technique to identify similar waveforms, using only a few compact features of the original data. The concept is similar to human fingerprints, which utilize key diagnostic features to identify people uniquely. Analogous audio-fingerprinting approaches have accurately and efficiently found similar audio clips within large databases; example applications include identifying songs and finding copyrighted content within YouTube videos. In order to fingerprint waveforms, we compute a spectrogram of the time series, and segment it into multiple overlapping windows (spectral images). For each spectral image, we apply a wavelet transform, and retain only the sign of the maximum magnitude wavelet coefficients. This procedure retains just the large-scale structure of the data, providing both robustness to noise and significant dimensionality reduction. Each fingerprint is a high-dimensional, sparse, binary data object that can be stored in a database without significant storage costs. Similar fingerprints within the database are efficiently searched using locality-sensitive hashing. We test this technique on waveform data from the Northern California Seismic Network that contains events not detected in the catalog. We show that this algorithm successfully identifies similar waveforms and detects uncataloged low magnitude events in addition to cataloged events, while running to completion

  20. Multiplexed Imaging of Trace Residues in a Single Latent Fingerprint.

    PubMed

    Zhang, Yuyan; Zhou, Wen; Xue, Yang; Yang, Jie; Liu, Dingbin

    2016-12-20

    The development of highly sensitive, selective, nondestructive, and multiplexed imaging modalities is essential for latent fingerprint (LFP) identification and fingerprint residues detection. Herein, we present a versatile strategy to identify LFPs and to probe the multiple trace residues in a single LFP simultaneously. With the purpose of achieving high sensitivity, we for the first time introduced a polydopamine (PDA)-triggered Au growth method to prepare superbright and multiplex surface-enhanced Raman scattering (SERS) tags, which were endowed with high selectivity by conjugating with specific antibodies. In combination with a rapid Raman mapping technique, the sensitivity of the SERS probes was down to picogram scale and all the three levels of LFP features can be clearly seen. More significantly, the multiplexed imaging of diverse residues in a single LFP provides more accurate information than that using monochromatic imaging of individuals alone. The high analytical figures of merit enable this approach great promise for use in the fields ranging from chemical detection to molecular imaging.

  1. DNA fingerprinting in forensics: past, present, future.

    PubMed

    Roewer, Lutz

    2013-11-18

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting.

  2. DNA fingerprinting in forensics: past, present, future

    PubMed Central

    2013-01-01

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting. PMID:24245688

  3. Photoluminescent semiconductor nanocrystals for fingerprint detection.

    PubMed

    Menzel, E R; Savoy, S M; Ulvick, S J; Cheng, K H; Murdock, R H; Sudduth, M R

    2000-05-01

    The concept of utilizing photoluminescent semiconductor nanocrystals for latent fingerprint detection, especially in concert with phase-resolved imaging for background fluorescence suppression, is reduced to practice with CdS nanocrystals that are capped with dioctyl sulfosuccinate. The nanocrystals are dissolved in heptane or hexane and are applied in much the same way as staining with fluorescent dye, on articles that have been pre-fumed with cyanoacrylate ester and also on the sticky side of electrical tape without pre-fuming. Since CdS can form a photoluminescent nanocomposite with dendrimers, a feasibility examination of dendrimer tagging of fingerprints has also been conducted.

  4. Fingerprint image enhancement by differential hysteresis processing.

    PubMed

    Blotta, Eduardo; Moler, Emilce

    2004-05-10

    A new method to enhance defective fingerprints images through image digital processing tools is presented in this work. When the fingerprints have been taken without any care, blurred and in some cases mostly illegible, as in the case presented here, their classification and comparison becomes nearly impossible. A combination of spatial domain filters, including a technique called differential hysteresis processing (DHP), is applied to improve these kind of images. This set of filtering methods proved to be satisfactory in a wide range of cases by uncovering hidden details that helped to identify persons. Dactyloscopy experts from Policia Federal Argentina and the EAAF have validated these results.

  5. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  6. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  7. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  8. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  9. 22 CFR 41.105 - Supporting documents and fingerprinting.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Supporting documents and fingerprinting. 41.105... and fingerprinting. (a) Supporting documents—(1) Authority to require documents. The consular officer... through NATO-4 or NATO-6. (b) Fingerprinting. Every applicant for a nonimmigrant visa must...

  10. 22 CFR 41.105 - Supporting documents and fingerprinting.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Supporting documents and fingerprinting. 41.105... and fingerprinting. (a) Supporting documents—(1) Authority to require documents. The consular officer... through NATO-4 or NATO-6. (b) Fingerprinting. Every applicant for a nonimmigrant visa must...

  11. 22 CFR 41.105 - Supporting documents and fingerprinting.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Supporting documents and fingerprinting. 41.105... and fingerprinting. (a) Supporting documents—(1) Authority to require documents. The consular officer... through NATO-4 or NATO-6. (b) Fingerprinting. Every applicant for a nonimmigrant visa must...

  12. Chemical Fingerprinting of Materials Developed Due To Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    This paper presents viewgraphs on chemical fingerprinting of materials developed due to environmental issues. Some of the topics include: 1) Aerospace Materials; 2) Building Blocks of Capabilities; 3) Spectroscopic Techniques; 4) Chromatographic Techniques; 5) Factors that Determine Fingerprinting Approach; and 6) Fingerprinting: Combination of instrumental analysis methods that diagnostically characterize a material.

  13. 78 FR 33436 - 2013 Final Fee Rate and Fingerprint Fees

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-04

    ... National Indian Gaming Commission 2013 Final Fee Rate and Fingerprint Fees AGENCY: National Indian Gaming... its new fingerprint processing fees of $22 per card effective June 1st, 2013. FOR FURTHER INFORMATION... Commission shall also review annually the costs involved in processing fingerprint cards based on fees...

  14. Fingerprint Ridge Count: A Polygenic Trait Useful in Classroom Instruction.

    ERIC Educational Resources Information Center

    Mendenhall, Gordon; And Others

    1989-01-01

    Describes the use of the polygenic trait of total fingerprint ridge count in the classroom as a laboratory investigation. Presents information on background of topic, fingerprint patterns which are classified into three major groups, ridge count, the inheritance model, and activities. Includes an example data sheet format for fingerprints. (RT)

  15. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local law...

  16. Digital Video of Live-Scan Fingerprint Data

    National Institute of Standards and Technology Data Gateway

    NIST Digital Video of Live-Scan Fingerprint Data (PC database for purchase)   NIST Special Database 24 contains MPEG-2 (Moving Picture Experts Group) compressed digital video of live-scan fingerprint data. The database is being distributed for use in developing and testing of fingerprint verification systems.

  17. Fingerprint Ridge Count: A Polygenic Trait Useful in Classroom Instruction.

    ERIC Educational Resources Information Center

    Mendenhall, Gordon; And Others

    1989-01-01

    Describes the use of the polygenic trait of total fingerprint ridge count in the classroom as a laboratory investigation. Presents information on background of topic, fingerprint patterns which are classified into three major groups, ridge count, the inheritance model, and activities. Includes an example data sheet format for fingerprints. (RT)

  18. X-ray and electron microscopy studies on the biodistribution and biomodification of iron oxide nanoparticles in Daphnia magna.

    PubMed

    Kwon, Dongwook; Nho, Hyun Woo; Yoon, Tae Hyun

    2014-10-01

    Biodistribution and biomodification of iron oxide (Fe3O4 and α-Fe2O3) nanoparticles (NPs) in a well-known toxicity test organism, Daphnia magna (D. magna), were investigated using transmission electron microscopy (TEM) and scanning transmission X-ray microscopy (STXM). In addition to the morphological changes in the gut tissues of D. magna, biodistribution and biomodification of iron oxide NPs in the digestive tract of D. magna were also monitored in this study. Upon exposures to both iron oxide NPs, unique morphological changes (e.g., irregular shaped microvilli, epithelial cell protrusion, and dilatation of cytoplasmic inclusion) in the gut tissues of D. magna were observed along with bacterial colonization of the gut lumen. However, despite their heavy accumulations in the digesitive tract, TEM and STXM images confirmed us that both Fe3O4 and α-Fe2O3 NPs were not penetrating into the gut tissues of D. magna. Moreover, for the Fe3O4 NPs in direct contact with the gut microvilli of D. magna, slight but significant spectral changes were observed in their Fe L-edge X-ray absorption near edge structure (XANES) spectra, which indicated that there were biomodifications of Fe3O4 NPs, probably involving oxidative dissolution of Fe3O4 NPs followed by rapid precipitation of ferric oxide or hydroxide. However, no significant changes were observed in the Fe L-edge XANES spectra of the α-Fe2O3 NPs present in the gut lumen of D. magna. These X-ray and electron microscopic observations confirmed us that, despite similarities in core sizes and chemical compositions, NPs with different crystalline phase and dissolution rates can interact quite differently with their local environment, may result in different biodistribution and cause completely dissimilar toxicities.

  19. Secreted protein eco-corona mediates uptake and impacts of polystyrene nanoparticles on Daphnia magna.

    PubMed

    Nasser, Fatima; Lynch, Iseult

    2016-03-30

    Nanoparticles (NPs) are defined as having at least one external dimension between 1 and 100 nm. Due to their small size, NPs have a large surface area to volume ratio giving them unique characteristics that differ from bulk material of the same chemical composition. As a result these novel materials have found numerous applications in medical and industrial fields with the result that environmental exposure to NPs is increasingly likely. Similarly, increased reliance on plastic, which degrades extremely slowly in the environment, is resulting in increased accumulation of micro-/nano-plastics in fresh and marine waters, whose ecotoxicological impacts are as yet poorly understood. Although NPs are well known to adsorb macromolecules from their environment, forming a biomolecule corona which changes the NP identity and how it interacts with organisms, significantly less research has been performed on the ecological corona (eco-corona). Secretion of biomolecules is a well established predator-prey response in aquatic food chains, raising the question of whether NPs interact with secreted proteins, and the impact of such interaction on NP uptake and ecotoxicity. We report here initial studies, including optimisation of protocols using carboxylic-acid and amino modified spherical polystyrene NPs, to assess interaction of NPs with biomolecules secreted by Daphnia magna and the impact of these interactions on NP uptake, retention and toxicity towards Daphnia magna. Daphnia magna are an important environmental indicator species who may be especially sensitive to nanoparticles (NPs) as a result of being filter-feeders. This paper demonstrates for the first time that proteins released by Daphnia magna create an eco-corona around polystyrene NPs which causes heightened uptake of the NPs and consequently increases toxicity. The secreted protein eco-corona also causes the NPs to be less efficiently removed from the gut of D. magna and NPs remaining in the gut of D. magna

  20. Comparative toxicity of rac- and S-tebuconazole to Daphnia magna.

    PubMed

    Qi, Su Z; Chen, Xiao F; Liu, Yong; Jiang, Jia Z; Wang, Cheng J

    2015-01-01

    Tebuconazole is a chiral triazole fungicide used as raceme in a variety of agricultural applications. Earlier studies showed that tebuconazole is toxic to many non-target aquatic organisms but relative data for tebuconazole enantiomers are lacking. Thus, goal of this study was to evaluate and compare the toxicity of rac- and S-tebuconazole with Daphnia magna at both acute and chronic levels according to Organization for Economic Cooperation and Development (OECD) guidelines 202 and 211 respectively, to provide some guidelines for optimizing chiral pesticides application and management. The exposure concentrations were 0.1, 0.5, 1, 2, 4, 8, 10 mg L(-1) for both rac- and S-tebuconazole and their 48-h EC(50) values to D. magna were 3.53 (3.32-3.78) and 2.74 (2.33-3.10) mg L(-1) respectively, indicating that these both are medium toxic to D. magna with no significant toxicity difference at acute level. In chronic test, <24-h old D. magna were exposed to 0.01, 0.05, 0.10, 0.20, and 0.40 mg L(-1) of rac- and S-tebuconazole with one blank and one solvent control for 21 days according to OECD guideline 211. Four developmental (molting rate, days to the 1st and 3rd brood, and body length) and five reproductive (size of the 1st and 3rd brood, number of broods, and number of neonates) parameters for each D. magna were determined. Results showed that both rac- and S-tebuconazole significantly reduced the reproduction and impacted the development of D. magna at concentrations of 0.05 mg L(-1) or higher. Furthermore, S-tebuconazole was more toxic than raceme, and the difference between effects on the same parameters induced by rac- and S-tebuconazole was statistically significant. These results demonstrated that the chronic toxicity of S-tebuconazole might be underestimated in general use, and further studies should focus more on the biological behaviors of enantiomers and not just the raceme of tebuconazole and other chiral pesticides in the environment.