Science.gov

Sample records for magna molecular fingerprints

  1. Molecular impact of juvenile hormone agonists on neonatal Daphnia magna.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Miyakawa, Hitoshi; Yatsu, Ryohei; Mizutani, Takeshi; Ogino, Yukiko; Miyagawa, Shinichi; Watanabe, Hajime; Nishide, Hiroyo; Uchiyama, Ikuo; Tatarazako, Norihisa; Iguchi, Taisen

    2014-05-01

    Daphnia magna has been used extensively to evaluate organism- and population-level responses to pollutants in acute toxicity and reproductive toxicity tests. We have previously reported that exposure to juvenile hormone (JH) agonists results in a reduction of reproductive function and production of male offspring in a cyclic parthenogenesis, D. magna. Recent advances in molecular techniques have provided tools to understand better the responses to pollutants in aquatic organisms, including D. magna. DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to JH agonists: methoprene (125, 250 and 500 ppb), fenoxycarb (0.5, 1 and 2 ppb) and epofenonane (50, 100 and 200 ppb). Exposure to these JH analogs resulted in chemical-specific patterns of gene expression. The heat map analyses based on hierarchical clustering revealed a similar pattern between treatments with a high dose of methoprene and with epofenonane. In contrast, treatment with low to middle doses of methoprene resulted in similar profiles to fenoxycarb treatments. Hemoglobin and JH epoxide hydrolase genes were clustered as JH-responsive genes. These data suggest that fenoxycarb has high activity as a JH agonist, methoprene shows high toxicity and epofenonane works through a different mechanism compared with other JH analogs, agreeing with data of previously reported toxicity tests. In conclusion, D. magna DNA microarray is useful for the classification of JH analogs and identification of JH-responsive genes. PMID:24038158

  2. Molecular impact of juvenile hormone agonists on neonatal Daphnia magna.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Miyakawa, Hitoshi; Yatsu, Ryohei; Mizutani, Takeshi; Ogino, Yukiko; Miyagawa, Shinichi; Watanabe, Hajime; Nishide, Hiroyo; Uchiyama, Ikuo; Tatarazako, Norihisa; Iguchi, Taisen

    2014-05-01

    Daphnia magna has been used extensively to evaluate organism- and population-level responses to pollutants in acute toxicity and reproductive toxicity tests. We have previously reported that exposure to juvenile hormone (JH) agonists results in a reduction of reproductive function and production of male offspring in a cyclic parthenogenesis, D. magna. Recent advances in molecular techniques have provided tools to understand better the responses to pollutants in aquatic organisms, including D. magna. DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to JH agonists: methoprene (125, 250 and 500 ppb), fenoxycarb (0.5, 1 and 2 ppb) and epofenonane (50, 100 and 200 ppb). Exposure to these JH analogs resulted in chemical-specific patterns of gene expression. The heat map analyses based on hierarchical clustering revealed a similar pattern between treatments with a high dose of methoprene and with epofenonane. In contrast, treatment with low to middle doses of methoprene resulted in similar profiles to fenoxycarb treatments. Hemoglobin and JH epoxide hydrolase genes were clustered as JH-responsive genes. These data suggest that fenoxycarb has high activity as a JH agonist, methoprene shows high toxicity and epofenonane works through a different mechanism compared with other JH analogs, agreeing with data of previously reported toxicity tests. In conclusion, D. magna DNA microarray is useful for the classification of JH analogs and identification of JH-responsive genes.

  3. Molecular graph convolutions: moving beyond fingerprints.

    PubMed

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-08-01

    Molecular "fingerprints" encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular graph convolutions, a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph-atoms, bonds, distances, etc.-which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement. PMID:27558503

  4. Molecular graph convolutions: moving beyond fingerprints.

    PubMed

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-08-01

    Molecular "fingerprints" encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular graph convolutions, a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph-atoms, bonds, distances, etc.-which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement.

  5. Molecular graph convolutions: moving beyond fingerprints

    NASA Astrophysics Data System (ADS)

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-08-01

    Molecular "fingerprints" encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular "graph convolutions", a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph---atoms, bonds, distances, etc.---which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement.

  6. Molecular crime scene investigation - dusting for fingerprints.

    PubMed

    Jürgen Bajorath

    2013-12-01

    In chemoinformatics and drug design, fingerprints (FPs) are defined as string representations of molecular structure and properties and are popular descriptors for similarity searching. FPs are generally characterized by the simplicity of their design and ease of use. Despite a long history in chemoinformatics, the potential and limitations of FP searching are often not well under- stood. Standard FPs can also be subjected to engineering techniques to tune them for specific search applications.

  7. Molecular impact of propiconazole on Daphnia magna using a reproduction-related cDNA array.

    PubMed

    Soetaert, Anneleen; Moens, Lotte N; Van der Ven, Karlijn; Van Leemput, Koen; Naudts, Bart; Blust, Ronny; De Coen, Wim M

    2006-01-01

    We have developed a first version cDNA microarray of the cladoceran Daphnia magna. Through Suppression Subtractive Hybridisation PCR (SSH-PCR) 855 life stage-specific cDNAs were collected and used to document the toxicological mode of action of the pesticide propiconazole. DNA sequencing analysis revealed gene fragments related to important functional classes such as embryo development, energy metabolism, molting and cell cycle. Major changes in transcription were observed in organisms exposed for 4 and 8 days to 1 microg/mL. After 4 days a 3-fold down-regulation of the gene encoding the yolk protein, vitellogenin, was observed indicating impaired oocyte maturation. Moreover, genes such as a larval-specific gene and chaperonin were repressed, whereas the heat shock 90 protein and ATP synthase were induced. Organismal effects clearly confirmed the major molecular findings: at the highest concentration (1 microg/mL) adult growth was significantly (p < 0.05) impaired and increased developmental effects in the offspring could be noted. We have demonstrated the potential of microarray analysis in toxicity screening with D. magna. The use of vitellogenin mRNA as a rapid biomarker of reproductive effects in chronic toxicity studies with cladocerans is suggested. PMID:16311075

  8. Molecular impact of propiconazole on Daphnia magna using a reproduction-related cDNA array.

    PubMed

    Soetaert, Anneleen; Moens, Lotte N; Van der Ven, Karlijn; Van Leemput, Koen; Naudts, Bart; Blust, Ronny; De Coen, Wim M

    2006-01-01

    We have developed a first version cDNA microarray of the cladoceran Daphnia magna. Through Suppression Subtractive Hybridisation PCR (SSH-PCR) 855 life stage-specific cDNAs were collected and used to document the toxicological mode of action of the pesticide propiconazole. DNA sequencing analysis revealed gene fragments related to important functional classes such as embryo development, energy metabolism, molting and cell cycle. Major changes in transcription were observed in organisms exposed for 4 and 8 days to 1 microg/mL. After 4 days a 3-fold down-regulation of the gene encoding the yolk protein, vitellogenin, was observed indicating impaired oocyte maturation. Moreover, genes such as a larval-specific gene and chaperonin were repressed, whereas the heat shock 90 protein and ATP synthase were induced. Organismal effects clearly confirmed the major molecular findings: at the highest concentration (1 microg/mL) adult growth was significantly (p < 0.05) impaired and increased developmental effects in the offspring could be noted. We have demonstrated the potential of microarray analysis in toxicity screening with D. magna. The use of vitellogenin mRNA as a rapid biomarker of reproductive effects in chronic toxicity studies with cladocerans is suggested.

  9. Pulmonary embolization of immature Fascioloides magna causing fatal hemothorax confirmed by molecular technique in a heifer in the United States.

    PubMed

    Lee, Jung Keun; Rosser, Thomas Graham; Cooley, Jim

    2016-09-01

    The current report describes the use of a molecular technique to identify immature Fascioloides magna An 18-month-old Brangus heifer was found dead in the field without any prior clinical signs. The cause of death was exsanguination into the thoracic cavity associated with pulmonary embolization and infection by immature Fascioloides magna resulting in 2 large foci of pulmonary necrosis and focal arteriolar and lung rupture. The liver had a few random migratory tracts with typical iron and porphyrin fluke exhaust, but no identified fluke larvae. A single immature fluke was found in the lungs, and species level identification as F. magna was confirmed by DNA sequence analysis of the ribosomal internal transcribed spacer regions (ITS1 region, 5.8S rRNA gene, and ITS2) and of partial 28S rRNA gene sequence. This is one of only a few pulmonary fascioloidiasis cases associated with hemothorax in the veterinary literature. PMID:27423736

  10. Fingerprinting Electronic Molecular Complexes in Liquid

    NASA Astrophysics Data System (ADS)

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules.

  11. Fingerprinting Electronic Molecular Complexes in Liquid

    PubMed Central

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules. PMID:26743542

  12. Molecular mechanisms of tolerance to cyanobacterial protease inhibitors revealed by clonal differences in Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Kuster, Christian J; Von Elert, Eric

    2012-10-01

    Protease inhibitors of primary producers are a major food quality constraint for herbivores. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is mainly represented by Daphnia and cyanobacteria. Protease inhibitors have been found in many cyanobacterial blooms. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the daphnid's gut, that is, trypsins and chymotrypsins. In this study, we fed four different Daphnia magna genotypes with the trypsin-inhibitor-containing cyanobacterial strain Microcystis aeruginosa PCC 7806 Mut. Upon exposure to dietary trypsin inhibitors, all D. magna genotypes showed increased gene expression of digestive trypsins and chymotrypsins. Exposure to dietary trypsin inhibitors resulted in increased activity of chymotrypsins and reduced activity of trypsin. Strong intraspecific differences in tolerance of the four D. magna genotypes to the dietary trypsin inhibitors were found. The degree of tolerance depended on the D. magna genotype. The genotypes' tolerance was positively correlated with the residual trypsin activity and the different IC(50) values of the trypsins. On the genetic level, the different trypsin loci varied between the D. magna genotypes. The two tolerant Daphnia genotypes that both originate from the same lake, which frequently produces cyanobacterial blooms, clustered in a neighbour-joining phylogenetic tree based on the three trypsin loci. This suggests that the genetic variability of trypsin loci was an important cause for the observed intraspecific variability in tolerance to cyanobacterial trypsin inhibitors. Based on these findings, it is reasonable to assume that such genetic variability can also be found in natural populations and thus constitutes the basis for local adaptation of natural populations to dietary protease inhibitors.

  13. Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting

    PubMed Central

    Khan, Tarik A.; Friedensohn, Simon; de Vries, Arthur R. Gorter; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T.

    2016-01-01

    High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion—the intraclonal diversity index—which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

  14. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    PubMed

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  15. Linguini Models of Molecular Genetic Mapping and Fingerprinting.

    ERIC Educational Resources Information Center

    Thompson, James N., Jr.; Gray, Stanton B.; Hellack, Jenna J.

    1997-01-01

    Presents an exercise using linguini noodles to demonstrate an aspect of DNA fingerprinting. DNA maps that show genetic differences can be produced by digesting a certain piece of DNA with two or more restriction enzymes both individually and in combination. By rearranging and matching linguini fragments, students can recreate the original pattern…

  16. Telopathes magna gen. nov., spec. nov. (Cnidaria: Anthozoa: Antipatharia: Schizopathidae) from deep waters off Atlantic Canada and the first molecular phylogeny of the deep-sea family Schizopathidae.

    PubMed

    Macisaac, K G; Best, M; Brugler, M R; Kenchington, E L R; Anstey, L J; Jordan, T

    2013-01-01

    A new genus and species of deep-sea antipatharian, Telopathes magna gen. nov., spec. nov., is described from the western North Atlantic off the coast of Canada. Five additional paratypes, consisting ofjuvenile to adult forms, are reported from the New England and Corner Rise Seamounts (NW Atlantic). Preliminary sequencing of a subsection of the nuclear ribosomal cistron confirmed the phylogenetic affinity of T. magna to the order Antipatharia, and in particular the family Schizopathidae. Subsequent sequencing of three mitochondrial DNA segments from nine of the 11 currently-recognized genera within the Schizopathidae revealed a well-supported phylogenetic relationship between T. magna and Stauropathes. This is the first study to use molecular techniques to elucidate the evolutionary relationships of the Schizopathidae, a family of black corals almost exclusively found in the deep sea (depths > 200 m). Telopathes is distinguished from other genera within the family Schizopathidae by its largely pinnulated stalk, sparse branching pattern to the second degree that is not restricted to a single plane, two anterolateral rows of long, simple primary pinnules, arranged alternately to sub-opposite, and colony with an adhesive base. This record of T. magna brings the total number of nominal species of Antipatharia reported to occur off eastern Canada to 12 and represents the third new genus added to the Schizopathidae since a critical review of the family by Dennis Opresko in 2002. PMID:26106725

  17. Telopathes magna gen. nov., spec. nov. (Cnidaria: Anthozoa: Antipatharia: Schizopathidae) from deep waters off Atlantic Canada and the first molecular phylogeny of the deep-sea family Schizopathidae.

    PubMed

    Macisaac, K G; Best, M; Brugler, M R; Kenchington, E L R; Anstey, L J; Jordan, T

    2013-01-01

    A new genus and species of deep-sea antipatharian, Telopathes magna gen. nov., spec. nov., is described from the western North Atlantic off the coast of Canada. Five additional paratypes, consisting ofjuvenile to adult forms, are reported from the New England and Corner Rise Seamounts (NW Atlantic). Preliminary sequencing of a subsection of the nuclear ribosomal cistron confirmed the phylogenetic affinity of T. magna to the order Antipatharia, and in particular the family Schizopathidae. Subsequent sequencing of three mitochondrial DNA segments from nine of the 11 currently-recognized genera within the Schizopathidae revealed a well-supported phylogenetic relationship between T. magna and Stauropathes. This is the first study to use molecular techniques to elucidate the evolutionary relationships of the Schizopathidae, a family of black corals almost exclusively found in the deep sea (depths > 200 m). Telopathes is distinguished from other genera within the family Schizopathidae by its largely pinnulated stalk, sparse branching pattern to the second degree that is not restricted to a single plane, two anterolateral rows of long, simple primary pinnules, arranged alternately to sub-opposite, and colony with an adhesive base. This record of T. magna brings the total number of nominal species of Antipatharia reported to occur off eastern Canada to 12 and represents the third new genus added to the Schizopathidae since a critical review of the family by Dennis Opresko in 2002.

  18. Application of Fingerprinting Molecular Methods in Bioremediation Studies

    NASA Astrophysics Data System (ADS)

    Karpouzas, Dimitrios G.; Singh, Brajesh K.

    Bioremediation has been identified as a beneficial and effective strategy for the removal of recalcitrant environmental contaminants. Bioaugmentation of polluted environments with exogenous degrading microorganisms constitutes a major strategy of bioremediation. However, the ecological role of these strains and their impact on the endogenous microbial community of the micro-ecosystems where they are released should be known. Fingerprinting PCR-based methods, like denaturating gradient gel electrophoresis (DGGE) and terminal restriction fragment length polymorphism (TRFLP), could be used in studies exploring the ecology of pollutant-degrading microorganisms and their effects on the structure of the soil microbial community. This chapter provides a brief outline of the technical details involved in the application of DGGE and TRFLP fingerprinting in soil microbial ecology, with particular reference to bioremediation studies.

  19. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  20. [The problem of molecular-genetic identification of sweat and grease deposits in the human fingerprints].

    PubMed

    Faleeva, T G; Ivanov, I N; Mishin, E S; Vnukova, N V; Kornienko, I V

    2016-01-01

    The objective of the present experimental molecular-genetic study of DNA contained in of human fingerprints was to establish the relationship between the reference genetic profiles and the genotypes of the individuals leaving their fingerprints on a smooth metal object. The biological material for the purpose of the investigation was sampled at different time intervals. The were taken using a scotch tape and used to obtain the complete genetic profile immediately after the fingerprints had been left as well as within the next 24 hours and one week. It proved impossible to identify the complete genetic profile one month after the fingerprints had been left. The alleles not typical for reference samples were identified within one week after swabbing the material from the metal surface. The results of the sudy can be explained by the decrease of the concentration of the initial DNA-matrix in the samples due to its degradation in the course of time. It is concluded that the parallel genetic analysis is needed if reliable evidence of identity of the profiles of interest or its absence is to be obtained.

  1. [The problem of molecular-genetic identification of sweat and grease deposits in the human fingerprints].

    PubMed

    Faleeva, T G; Ivanov, I N; Mishin, E S; Vnukova, N V; Kornienko, I V

    2016-01-01

    The objective of the present experimental molecular-genetic study of DNA contained in of human fingerprints was to establish the relationship between the reference genetic profiles and the genotypes of the individuals leaving their fingerprints on a smooth metal object. The biological material for the purpose of the investigation was sampled at different time intervals. The were taken using a scotch tape and used to obtain the complete genetic profile immediately after the fingerprints had been left as well as within the next 24 hours and one week. It proved impossible to identify the complete genetic profile one month after the fingerprints had been left. The alleles not typical for reference samples were identified within one week after swabbing the material from the metal surface. The results of the sudy can be explained by the decrease of the concentration of the initial DNA-matrix in the samples due to its degradation in the course of time. It is concluded that the parallel genetic analysis is needed if reliable evidence of identity of the profiles of interest or its absence is to be obtained. PMID:27070033

  2. De novo design of caseinolytic protein proteases inhibitors based on pharmacophore and 2D molecular fingerprints.

    PubMed

    Wu, Guanzhong; Zhang, Zhen; Chen, Hong; Lin, Kejiang

    2015-06-01

    Caseinolytic protein proteases (ClpP) are large oligomeric protein complexes that contribute to cell homeostasis as well as virulence regulation in bacteria. Inhibitors of ClpP can significantly attenuate the capability to produce virulence factors of the bacteria. In this work, we developed a workflow to expand the chemical space of potential ClpP inhibitors based on a set of β-lactones. In our workflow, an artificial pharmacophore model was generated based on HipHop and HYPOGEN method. A de novo compound library based on molecular fingerprints was constructed and virtually screened by the pharmacophore model. The results were further investigated by molecular docking study. The workflow successfully achieved potential ClpP inhibitors. It could be applied to design more novel potential ClpP inhibitors and provide theoretical basis for the further optimization of the hit compounds. PMID:25937012

  3. De novo design of caseinolytic protein proteases inhibitors based on pharmacophore and 2D molecular fingerprints.

    PubMed

    Wu, Guanzhong; Zhang, Zhen; Chen, Hong; Lin, Kejiang

    2015-06-01

    Caseinolytic protein proteases (ClpP) are large oligomeric protein complexes that contribute to cell homeostasis as well as virulence regulation in bacteria. Inhibitors of ClpP can significantly attenuate the capability to produce virulence factors of the bacteria. In this work, we developed a workflow to expand the chemical space of potential ClpP inhibitors based on a set of β-lactones. In our workflow, an artificial pharmacophore model was generated based on HipHop and HYPOGEN method. A de novo compound library based on molecular fingerprints was constructed and virtually screened by the pharmacophore model. The results were further investigated by molecular docking study. The workflow successfully achieved potential ClpP inhibitors. It could be applied to design more novel potential ClpP inhibitors and provide theoretical basis for the further optimization of the hit compounds.

  4. Quantitative Molecular Assay for Fingerprinting Microbial Communities of Wastewater and Estrogen-Degrading Consortia

    PubMed Central

    Yu, Chang-Ping; Ahuja, Rajiv; Sayler, Gary; Chu, Kung-Hui

    2005-01-01

    A quantitative fingerprinting method, called the real-time terminal restriction fragment length polymorphism (real-time-t-RFLP) assay, was developed for simultaneous determination of microbial diversity and abundance within a complex community. The real-time-t-RFLP assay was developed by incorporating the quantitative feature of real-time PCR and the fingerprinting feature of t-RFLP analysis. The assay was validated by using a model microbial community containing three pure strains, an Escherichia coli strain (gram negative), a Pseudomonas fluorescens strain (gram negative), and a Bacillus thuringiensis strain (gram positive). Subsequently, the real-time-t-RFLP assay was applied to and proven to be useful for environmental samples; the richness and abundance of species in microbial communities (expressed as the number of 16S rRNA gene copies of each ribotype per milliliter) of wastewater and estrogen-degrading consortia (enriched with 17α-estradiol, 17β-estradiol, or estrone) were successfully characterized. The results of this study strongly suggested that the real-time-t-RFLP assay can be a powerful molecular tool for gaining insight into microbial communities in various engineered systems and natural habitats. PMID:15746346

  5. Design and evaluation of a molecular fingerprint involving the transformation of property descriptor values into a binary classification scheme.

    PubMed

    Xue, Ling; Godden, Jeffrey W; Stahura, Florence L; Bajorath, Jürgen

    2003-01-01

    A new fingerprint design concept is introduced that transforms molecular property descriptors into two-state descriptors and thus permits binary encoding. This transformation is based on the calculation of statistical medians of descriptor distributions in large compound collections and alleviates the need for value range encoding of these descriptors. For binary encoded property descriptors, bit positions that are set off capture as much information as bit positions that are set on, different from conventional fingerprint representations. Accordingly, a variant of the Tanimoto coefficient has been defined for comparison of these fingerprints. Following our design idea, a prototypic fingerprint termed MP-MFP was implemented by combining 61 binary encoded property descriptors with 110 structural fragment-type descriptors. The performance of this fingerprint was evaluated in systematic similarity search calculations in a database containing 549 molecules belonging to 38 different activity classes and 5000 background molecules. In these calculations, MP-MFP correctly recognized approximately 34% of all similarity relationships, with only 0.04% false positives, and performed better than previous designs and MACCS keys. The results suggest that combinations of simplified two-state property descriptors have predictive value in the analysis of molecular similarity.

  6. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    PubMed Central

    Burgess, Jacob A.J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-01-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface. PMID:26359203

  7. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope.

    PubMed

    Burgess, Jacob A J; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-09-11

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

  8. Highland cattle and Radix labiata, the hosts of Fascioloides magna

    PubMed Central

    2014-01-01

    Background Fascioloides magna is a pathogenic fluke introduced to Europe ca 140 years ago. As it is spreading over the continent, new intermediate and definitive hosts might be involved in transmission of the parasite. In Europe, several studies reported potential new intermediate snail hosts (Radix spp.) for F. magna, and also several cases of fascioloidosis of wild and domestic animals were published. However, the data based on molecular and histological analyses confirming these findings remained unreported. This study aims to refer to unique findings of F. magna in European snails and domestic animals (the first observation in the Czech Republic in the last 30 years) and demonstrate the use of molecular techniques in determination of F. magna. Results Two snails of R. labiata naturally infected with F. magna were found; mature cercariae and daughter rediae were observed. Maturity of cercariae was checked by histological methods, however, their ability to encyst was not confirmed. Co-infection of F. magna and Fasciola hepatica in the liver of two highland cattle bulls was proved. Adult fasciolid flukes producing eggs were found in the liver pseudocysts (F. magna) and the bile ducts (F. hepatica). Identification of intermediate hosts, intramolluscan stages, adult flukes and eggs was performed by sequencing the ITS2 region. Connection of F. magna pseudocysts with the gut (via the bile ducts) was not confirmed by means of histological and coprological examinations. Conclusions For the first time, Radix labiata was confirmed as the snail host for F. magna under natural conditions and, together with the finding of F. magna infection in cattle, we can expect further transmission of F. magna from wildlife to livestock in localities shared by these hosts. PMID:24517409

  9. Subtracted diversity array identifies novel molecular markers including retrotransposons for fingerprinting Echinacea species.

    PubMed

    Olarte, Alexandra; Mantri, Nitin; Nugent, Gregory; Pang, Edwin C K

    2013-01-01

    Echinacea, native to the Canadian prairies and the prairie states of the United States, has a long tradition as a folk medicine for the Native Americans. Currently, Echinacea are among the top 10 selling herbal medicines in the U.S. and Europe, due to increasing popularity for the treatment of common cold and ability to stimulate the immune system. However, the genetic relationship within the species of this genus is unclear, making the authentication of the species used for the medicinal industry more difficult. We report the construction of a novel Subtracted Diversity Array (SDA) for Echinacea species and demonstrate the potential of this array for isolating highly polymorphic sequences. In order to selectively isolate Echinacea-specific sequences, a Suppression Subtractive Hybridization (SSH) was performed between a pool of twenty-four Echinacea genotypes and a pool of other angiosperms and non-angiosperms. A total of 283 subtracted genomic DNA (gDNA) fragments were amplified and arrayed. Twenty-seven Echinacea genotypes including four that were not used in the array construction could be successfully discriminated. Interestingly, unknown samples of E. paradoxa and E. purpurea could be unambiguously identified from the cluster analysis. Furthermore, this Echinacea-specific SDA was also able to isolate highly polymorphic retrotransposon sequences. Five out of the eleven most discriminatory features matched to known retrotransposons. This is the first time retrotransposon sequences have been used to fingerprint Echinacea, highlighting the potential of retrotransposons as based molecular markers useful for fingerprinting and studying diversity patterns in Echinacea. PMID:23940565

  10. TdPIR minisatellite fingerprinting as a useful new tool for Torulaspora delbrueckii molecular typing.

    PubMed

    Canonico, Laura; Comitini, Francesca; Ciani, Maurizio

    2015-05-01

    Torulaspora delbrueckii yeast strains are being increasingly applied at the industrial level, such as in the winemaking process, and so their identification and characterisation require effective, fast, accurate, reproducible and reliable approaches. Therefore, the development of typing techniques that allow discrimination at the strain level will provide an essential tool for those working with T. delbrueckii strains. Here, 28 T. delbrueckii strains from various substrates were characterised using different PCR-fingerprinting molecular methods: random amplified polymorphic DNA with polymerase chain reaction (RAPD-PCR), minisatellites SED1, AGA1, DAN4 and the newly designed T. delbrueckii (Td)PIR, and microsatellites (GAC)5 and (GTG)5. The aim was to determine and compare the efficacies, reproducibilities and discriminating powers of these molecular methods. RAPD-PCR using the M13 primers and the newly designed TdPIR3 minisatellite primer pair provided discrimination of the greatest number of T. delbrueckii strains. TdPIR3 clustered the 28 strains into 16 different groups with an efficiency of 100%, while M13 clustered the strains into 17 different groups, although with a lower efficiency of 89%. Moreover, the TdPIR3 primers showed reproducible profiles when the stringency of the PCR protocol was varied, which highlighted the great robustness of this technique. In contrast, variation of the stringency of the M13 PCR protocol resulted in modification of the amplified profiles, which suggested low reproducibility of this technique.

  11. Exploring the vibrational fingerprint of the electronic excitation energy via molecular dynamics

    SciTech Connect

    Deyne, Andy Van Yperen-De; Pauwels, Ewald; Ghysels, An; Waroquier, Michel; Van Speybroeck, Veronique; Hemelsoet, Karen; De Meyer, Thierry; De Clerck, Karen

    2014-04-07

    A Fourier-based method is presented to relate changes of the molecular structure during a molecular dynamics simulation with fluctuations in the electronic excitation energy. The method implies sampling of the ground state potential energy surface. Subsequently, the power spectrum of the velocities is compared with the power spectrum of the excitation energy computed using time-dependent density functional theory. Peaks in both spectra are compared, and motions exhibiting a linear or quadratic behavior can be distinguished. The quadratically active motions are mainly responsible for the changes in the excitation energy and hence cause shifts between the dynamic and static values of the spectral property. Moreover, information about the potential energy surface of various excited states can be obtained. The procedure is illustrated with three case studies. The first electronic excitation is explored in detail and dominant vibrational motions responsible for changes in the excitation energy are identified for ethylene, biphenyl, and hexamethylbenzene. The proposed method is also extended to other low-energy excitations. Finally, the vibrational fingerprint of the excitation energy of a more complex molecule, in particular the azo dye ethyl orange in a water environment, is analyzed.

  12. Evaluation of the Orbitrap Mass Spectrometer for the Molecular Fingerprinting Analysis of Natural Dissolved Organic Matter.

    PubMed

    Hawkes, Jeffrey A; Dittmar, Thorsten; Patriarca, Claudia; Tranvik, Lars; Bergquist, Jonas

    2016-08-01

    We investigated the application of the LTQ-Orbitrap mass spectrometer (LTQ-Velos Pro, Thermo Fisher) for resolving complex mixtures of natural aquatic dissolved organic matter (DOM) and compared this technique to the more established state-of-the-art technique, Fourier transform ion cyclotron resonance mass spectrometry (FTICR-MS, Bruker Daltonics), in terms of the distribution of molecular masses detected and the reproducibility of the results collected. The Orbitrap was capable of excellent reproducibility: Bray-Curtis dissimilarity between duplicate measurements was 2.85 ± 0.42% (mean ± standard deviation). The Orbitrap was also capable of the detection of most major ionizable organic molecules in typical aquatic mixtures, with the exception of most sulfur and phosphorus containing masses. This result signifies that the Orbitrap is an appropriate technique for the investigation of very subtle biogeochemical processing of bulk DOM. The lower costs (purchase and maintenance) and wider availability of Orbitrap mass spectrometers in university departments means that the tools necessary for research into DOM processing at the molecular level should be accessible to a much wider group of scientists than before. The main disadvantage of the technique is that substantially fewer molecular formulas can be resolved from a complex mixture (roughly one third as many), meaning some loss of information. In balance, most biogeochemical studies that aim at molecularly fingerprinting the source of natural DOM could be satisfactorily carried out with Orbitrap mass spectrometry. For more targeted metabolomic studies where individual compounds are traced through natural systems, FTICR-MS remains advantageous. PMID:27400998

  13. Cytological and molecular description of Hamiltosporidium tvaerminnensis gen. et sp. nov., a microsporidian parasite of Daphnia magna, and establishment of Hamiltosporidium magnivora comb. nov.

    PubMed

    Haag, Karen Luisa; Larsson, J I Ronny; Refardt, Dominik; Ebert, Dieter

    2011-04-01

    We describe the new microsporidium Hamiltosporidium tvaerminnensis gen. et sp. nov. with an emphasis on its ultrastructural characteristics and phylogenetic position as inferred from the sequence data of SSU rDNA, alpha- and beta-tubulin. This parasite was previously identified as Octosporea bayeri Jírovec, 1936 and has become a model system to study the ecology, epidemiology, evolution and genomics of microsporidia - host interactions. Here, we present evidence that shows its differences from O. bayeri. Hamiltosporidium tvaerminnensis exclusively infects the adipose tissue, the ovaries and the hypodermis of Daphnia magna and is found only in host populations located in coastal rock pool populations in Finland and Sweden. Merogonial stages of H. tvaerminnensis have isolated nuclei; merozoites are formed by binary fission or by the cleaving of a plasmodium with a small number of nuclei. A sporogonial plasmodium with isolated nuclei yields 8 sporoblasts. Elongated spores are generated by the most finger-like plasmodia. The mature spores are polymorphic in shape and size. Most spores are pyriform (4·9-5·6×2·2-2·3 μm) and have their polar filament arranged in 12-13 coils. A second, elongated spore type (6·8-12·0×1·6-2·1 μm) is rod-shaped with blunt ends and measures 6·8-12·0×1·6-2·1 μm. The envelope of the sporophorous vesicle is thin and fragile, formed at the beginning of the sporogony. Cytological and molecular comparisons with Flabelliforma magnivora, a parasite infecting the same tissues in the same host species, reveal that these two species are very closely related, yet distinct. Moreover, both cytological and molecular data indicate that these species are quite distant from F. montana, the type species of the genus Flabelliforma. We therefore propose that F. magnivora also be placed in Hamiltosporidium gen. nov.

  14. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  15. Dietary carbohydrate source influences molecular fingerprints of the rat faecal microbiota

    PubMed Central

    Licht, Tine R; Hansen, Max; Poulsen, Morten; Dragsted, Lars O

    2006-01-01

    Background A study was designed to elucidate effects of selected carbohydrates on composition and activity of the intestinal microbiota. Five groups of eight rats were fed a western type diet containing cornstarch (reference group), sucrose, potato starch, inulin (a long- chained fructan) or oligofructose (a short-chained fructan). Fructans are, opposite sucrose and starches, not digestible by mammalian gut enzymes, but are known to be fermentable by specific bacteria in the large intestine. Results Animals fed with diets containing potato starch, or either of the fructans had a significantly (p < 0.05) higher caecal weight and lower caecal pH when compared to the reference group, indicating increased fermentation. Selective cultivation from faeces revealed a higher amount of lactic acid bacteria cultivable on Rogosa agar in these animals. Additionally, the fructan groups had a lower amount of coliform bacteria in faeces. In the inulin and oligofructose groups, higher levels of butyrate and propionate, respectively, were measured. Principal Component Analysis of profiles of the faecal microbiota obtained by Denaturing Gradient Gel Electrophoresis (DGGE) of PCR amplified bacterial 16S rRNA genes as well as of Reverse Transcriptase-PCR amplified bacterial 16S rRNA resulted in different phylogenetic profiles for each of the five animal groups as revealed by Principal Component Analysis (PCA) of band patterns. Conclusion Even though sucrose and cornstarch are both easily digestible and are not expected to reach the large intestine, the DGGE band patterns obtained indicated that these carbohydrates indeed affected the composition of bacteria in the large gut. Also the two fructans resulted in completely different molecular fingerprints of the faecal microbiota, indicating that even though they are chemically similar, different intestinal bacteria ferment them. Comparison of DNA-based and RNA-based profiles suggested that two species within the phylum Bacteroidetes were

  16. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  17. Common molecular basis of the sentence comprehension network revealed by neurotransmitter receptor fingerprints.

    PubMed

    Zilles, Karl; Bacha-Trams, Maraike; Palomero-Gallagher, Nicola; Amunts, Katrin; Friederici, Angela D

    2015-02-01

    The language network is a well-defined large-scale neural network of anatomically and functionally interacting cortical areas. The successful language process requires the transmission of information between these areas. Since neurotransmitter receptors are key molecules of information processing, we hypothesized that cortical areas which are part of the same functional language network may show highly similar multireceptor expression pattern ("receptor fingerprint"), whereas those that are not part of this network should have different fingerprints. Here we demonstrate that the relation between the densities of 15 different excitatory, inhibitory and modulatory receptors in eight language-related areas are highly similar and differ considerably from those of 18 other brain regions not directly involved in language processing. Thus, the fingerprints of all cortical areas underlying a large-scale cognitive domain such as language is a characteristic, functionally relevant feature of this network and an important prerequisite for the underlying neuronal processes of language functions.

  18. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering

    PubMed Central

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3′-diethylthiatricarbocyanine iodide] and DTDC [3,3′-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist. PMID:26730189

  19. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering.

    PubMed

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3'-diethylthiatricarbocyanine iodide] and DTDC [3,3'-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist.

  20. Fingerprint-imprinted polymer: rational selection of peptide epitope templates for the determination of proteins by molecularly imprinted polymers.

    PubMed

    Bossi, Alessandra M; Sharma, Piyush S; Montana, Luca; Zoccatelli, Gianni; Laub, Orgad; Levi, Raphael

    2012-05-01

    The pool of peptides composing a protein allows for its distinctive identification in a process named fingerprint (FP) analysis. Here, the FP concept is used to develop a method for the rational preparation of molecularly imprinted polymers (MIPs) for protein recognition. The fingerprint imprinting (FIP) is based on the following: (1) the in silico cleavage of the protein sequence of interest with specific agents; (2) the screening of all the peptide sequences generated against the UniProtKB database in order to allow for the rational selection of distinctive and unique peptides (named as epitopes) of the target protein; (3) the selected epitopes are synthesized and used as templates for the molecular imprinting process. To prove the principle, NT-proBNP, a marker of the risk of cardiovascular events, was chosen as an example. The in silico analysis of the NT-proBNP sequence allowed us to individuate the peptide candidates, which were next used as templates for the preparation of NT-pro-BNP-specific FIPs and tested for their ability to bind the NT-proBNP peptides in complex samples. Results indicated an imprinting factor, IF, of ~10, a binding capacity of 0.5-2 mg/g, and the ability to rebind 40% of the template in a complex sample, composed of the whole digests of NT-proBNP.

  1. Virtual fragment screening: discovery of histamine H3 receptor ligands using ligand-based and protein-based molecular fingerprints.

    PubMed

    Sirci, Francesco; Istyastono, Enade P; Vischer, Henry F; Kooistra, Albert J; Nijmeijer, Saskia; Kuijer, Martien; Wijtmans, Maikel; Mannhold, Raimund; Leurs, Rob; de Esch, Iwan J P; de Graaf, Chris

    2012-12-21

    Virtual fragment screening (VFS) is a promising new method that uses computer models to identify small, fragment-like biologically active molecules as useful starting points for fragment-based drug discovery (FBDD). Training sets of true active and inactive fragment-like molecules to construct and validate target customized VFS methods are however lacking. We have for the first time explored the possibilities and challenges of VFS using molecular fingerprints derived from a unique set of fragment affinity data for the histamine H(3) receptor (H(3)R), a pharmaceutically relevant G protein-coupled receptor (GPCR). Optimized FLAP (Fingerprints of Ligands and Proteins) models containing essential molecular interaction fields that discriminate known H(3)R binders from inactive molecules were successfully used for the identification of new H(3)R ligands. Prospective virtual screening of 156,090 molecules yielded a high hit rate of 62% (18 of the 29 tested) experimentally confirmed novel fragment-like H(3)R ligands that offer new potential starting points for the design of H(3)R targeting drugs. The first construction and application of customized FLAP models for the discovery of fragment-like biologically active molecules demonstrates that VFS is an efficient way to explore protein-fragment interaction space in silico. PMID:23140085

  2. Spatio-temporal variability of the molecular fingerprint of soil dissolved organic matter in a headwater agricultural catchment

    NASA Astrophysics Data System (ADS)

    Jeanneau, Laurent; Pierson-Wickmann, Anne-Catherine; Jaffrezic, Anne; Lambert, Thibault; Gruau, Gérard

    2013-04-01

    Dissolved organic matter (DOM) is implied in (i) ecosystem services such as the support of biodiversity, (ii) the alteration of the drinkable water quality by formation of trihalomethane and (iii) the transfer of micropollutants from soils to rivers. Moreover, since DOM connects soils and oceans that are interacting with the atmosphere, understanding its biogeochemistry will help in investigating the carbon cycle and in creating strategies to mitigate climate change. DOM in headwater stream ecosystems is mainly inherited from allochtonous inputs with different reservoirs being mobilized during storm and interstorm events at the scale of an hydrological year. Those changes in DOM reservoirs, if accompanied by composition and reactivity changes, may impact DOM ecosystem services and drinking water production processes. Elucidating the compositional changes due to changes in the source of DOM in rivers has thus become a important axis of DOM research. The aim of this study is to test the ability of the molecular tools of the organic geochemistry and more specifically the combination of thermochemiolysis and gas chromatography - mass spectrometry (THM-GC-MS) to (i) link the variability of the river DOM composition to different DOM reservoirs in catchment soils and (ii) provide hypothesis on the nature and the mechanisms of formation (microbial growth, litter decomposition) of those reservoirs. This analytical method seems particularly adapted since it allows the differentiation between vegetal and microbial inputs and the determination of the extent of the biodegradation process of biomolecules such as lignin. To test this method, the molecular fingerprint of soil DOM has been investigated in the wetland area of a small (500 ha) agricultural catchment (the so-called Kervidy-Naizin catchment) located in Brittany, western France. The soil DOM was sampled fortnightly at three depths using zero-tension lysimeters during the hydrological year 2010-2011. The samples were

  3. Molecular evolution of epizootic hemorrhagic disease viruses in North America based on historical isolates using motif fingerprints.

    PubMed

    Wilson, W C; Ruder, M G; Jasperson, D; Smith, T P L; Naraghi-Arani, P; Lenhoff, R; Stallknecht, D E; Valdivia-Granda, W A; Sheoran, D

    2016-08-01

    Epizootic hemorrhagic disease virus (EHDV) is an orbivirus of the Reoviridae family that has significant impact on wild and captive white-tailed deer. Although closely related to bluetongue virus that can cause disease in sheep and cattle, North American EHDV historically has not been associated with disease in cattle or sheep. Severe disease in cattle has been reported with other EHDV strains from East Asia and the Middle East. To understand the potential role of viral genetics in the epidemiology of epizootic hemorrhagic disease, a molecular characterization of North American EHDV strains from 1955 to 2012 was conducted via conventional phylogenetic analysis and a new classification approach using motif fingerprint patterns. Overall, this study indicates that the genetic make-up of EHDV populations in North America have slowly evolved over time. The data also suggested limited reassortment events between serotypes 1 and 2 and introduces a new analysis tool for more detailed sequence pattern analysis. PMID:27107856

  4. Morphological and molecular observations on the status of Crassicauda magna, a parasite of the subcutaneous tissues of the pygmy sperm whale, with a re-evaluation of the systematic relationships of the genus Crassicauda.

    PubMed

    Jabbar, Abdul; Beveridge, Ian; Bryant, Malcolm S

    2015-03-01

    Members of the genus Crassicauda (Nematoda: Spirurida) are parasites of the body tissues of whales and dolphins. Owing to the large size of worms and difficulties in the recovery of entire nematodes from the tissues of hosts, limited information is available on morphological descriptions of both male and female worms. Furthermore, there are currently no available sequence data for this genus to assist with such identifications. This paper describes for the first time features of the anterior extremity and the male tail of Crassicauda magna, suggesting that Crassicauda duguyi may be a synonym of this species. In addition, molecular data are presented for the genus for the first time suggesting that the genus belongs within the superfamily Acuarioidea rather than within the Habronematoidea, in which it is currently placed.

  5. Morphological and molecular observations on the status of Crassicauda magna, a parasite of the subcutaneous tissues of the pygmy sperm whale, with a re-evaluation of the systematic relationships of the genus Crassicauda.

    PubMed

    Jabbar, Abdul; Beveridge, Ian; Bryant, Malcolm S

    2015-03-01

    Members of the genus Crassicauda (Nematoda: Spirurida) are parasites of the body tissues of whales and dolphins. Owing to the large size of worms and difficulties in the recovery of entire nematodes from the tissues of hosts, limited information is available on morphological descriptions of both male and female worms. Furthermore, there are currently no available sequence data for this genus to assist with such identifications. This paper describes for the first time features of the anterior extremity and the male tail of Crassicauda magna, suggesting that Crassicauda duguyi may be a synonym of this species. In addition, molecular data are presented for the genus for the first time suggesting that the genus belongs within the superfamily Acuarioidea rather than within the Habronematoidea, in which it is currently placed. PMID:25482860

  6. New target prediction and visualization tools incorporating open source molecular fingerprints for TB Mobile 2.0

    PubMed Central

    2014-01-01

    Background We recently developed a freely available mobile app (TB Mobile) for both iOS and Android platforms that displays Mycobacterium tuberculosis (Mtb) active molecule structures and their targets with links to associated data. The app was developed to make target information available to as large an audience as possible. Results We now report a major update of the iOS version of the app. This includes enhancements that use an implementation of ECFP_6 fingerprints that we have made open source. Using these fingerprints, the user can propose compounds with possible anti-TB activity, and view the compounds within a cluster landscape. Proposed compounds can also be compared to existing target data, using a näive Bayesian scoring system to rank probable targets. We have curated an additional 60 new compounds and their targets for Mtb and added these to the original set of 745 compounds. We have also curated 20 further compounds (many without targets in TB Mobile) to evaluate this version of the app with 805 compounds and associated targets. Conclusions TB Mobile can now manage a small collection of compounds that can be imported from external sources, or exported by various means such as email or app-to-app inter-process communication. This means that TB Mobile can be used as a node within a growing ecosystem of mobile apps for cheminformatics. It can also cluster compounds and use internal algorithms to help identify potential targets based on molecular similarity. TB Mobile represents a valuable dataset, data-visualization aid and target prediction tool. PMID:25302078

  7. Sampling strategy in molecular microbial ecology: influence of soil sample size on DNA fingerprinting analysis of fungal and bacterial communities.

    PubMed

    Ranjard, Lionel; Lejon, David P H; Mougel, Christophe; Schehrer, Lucie; Merdinoglu, Didier; Chaussod, Rémi

    2003-11-01

    Assessing soil microbial community structure by the use of molecular techniques requires a satisfactory sampling strategy that takes into account the high microbial diversity and the heterogeneous distribution of microorganisms in the soil matrix. The influence of the sample size of three different soil types (sand, silt and clay soils) on the DNA yield and analysis of bacterial and fungal community structure were investigated. Six sample sizes from 0.125 g to 4 g were evaluated. The genetic community structure was assessed by automated ribosomal intergenic spacer analysis (A-RISA fingerprint). Variations between bacterial (B-ARISA) and fungal (F-ARISA) community structure were quantified by using principal component analysis (PCA). DNA yields were positively correlated with the sample size for the sandy and silty soils, suggesting an influence of the sample size on DNA recovery, whereas no correlation was observed in the clay soil. B-ARISA was shown to be consistent between the different sample sizes for each soil type indicating that the sampling procedure has no influence on the assessment of bacterial community structure. On the contrary for F-ARISA profiles, strong variations were observed between replicates of the smaller samples (<1 g). Principal component analysis analysis revealed that sampling aliquots of soil > or =1 g are required to obtain robust and reproducible fingerprinting analysis of the genetic structure of fungal communities. However, the smallest samples could be adequate for the detection of minor populations masked by dominant ones in larger samples. The sampling strategy should therefore be different according to the objectives: rather large soil samples (> or =1 g) for a global description of the genetic community structure, or a large number of small soil samples for a more complete inventory of microbial diversity.

  8. Molecular Fingerprinting of Cyanobacteria from River Biofilms as a Water Quality Monitoring Tool

    PubMed Central

    Loza, Virginia; Perona, Elvira

    2013-01-01

    Benthic cyanobacterial communities from Guadarrama River (Spain) biofilms were examined using temperature gradient gel electrophoresis (TGGE), comparing the results with microscopic analyses of field-fixed samples and the genetic characterization of cultured isolates from the river. Changes in the structure and composition of cyanobacterial communities and their possible association with eutrophication in the river downstream were studied by examining complex TGGE patterns, band extraction, and subsequent sequencing of 16S rRNA gene fragments. Band profiles differed among sampling sites depending on differences in water quality. The results showed that TGGE band richness decreased in a downstream direction, and there was a clear clustering of phylotypes on the basis of their origins from different locations according to their ecological requirements. Multivariate analyses (cluster analysis and canonical correspondence analysis) corroborated these differences. Results were consistent with those obtained from microscopic observations of field-fixed samples. According to the phylogenetic analysis, morphotypes observed in natural samples were the most common phylotypes in the TGGE sequences. These phylotypes were closely related to Chamaesiphon, Aphanocapsa, Pleurocapsa, Cyanobium, Pseudanabaena, Phormidium, and Leptolyngbya. Differences in the populations in response to environmental variables, principally nutrient concentrations (dissolved inorganic nitrogen and soluble reactive phosphorus), were found. Some phylotypes were associated with low nutrient concentrations and high levels of dissolved oxygen, while other phylotypes were associated with eutrophic-hypertrophic conditions. These results support the view that once a community has been characterized and its genetic fingerprint obtained, this technique could be used for the purpose of monitoring rivers. PMID:23263954

  9. Molecular fingerprinting of cyanobacteria from river biofilms as a water quality monitoring tool.

    PubMed

    Loza, Virginia; Perona, Elvira; Mateo, Pilar

    2013-03-01

    Benthic cyanobacterial communities from Guadarrama River (Spain) biofilms were examined using temperature gradient gel electrophoresis (TGGE), comparing the results with microscopic analyses of field-fixed samples and the genetic characterization of cultured isolates from the river. Changes in the structure and composition of cyanobacterial communities and their possible association with eutrophication in the river downstream were studied by examining complex TGGE patterns, band extraction, and subsequent sequencing of 16S rRNA gene fragments. Band profiles differed among sampling sites depending on differences in water quality. The results showed that TGGE band richness decreased in a downstream direction, and there was a clear clustering of phylotypes on the basis of their origins from different locations according to their ecological requirements. Multivariate analyses (cluster analysis and canonical correspondence analysis) corroborated these differences. Results were consistent with those obtained from microscopic observations of field-fixed samples. According to the phylogenetic analysis, morphotypes observed in natural samples were the most common phylotypes in the TGGE sequences. These phylotypes were closely related to Chamaesiphon, Aphanocapsa, Pleurocapsa, Cyanobium, Pseudanabaena, Phormidium, and Leptolyngbya. Differences in the populations in response to environmental variables, principally nutrient concentrations (dissolved inorganic nitrogen and soluble reactive phosphorus), were found. Some phylotypes were associated with low nutrient concentrations and high levels of dissolved oxygen, while other phylotypes were associated with eutrophic-hypertrophic conditions. These results support the view that once a community has been characterized and its genetic fingerprint obtained, this technique could be used for the purpose of monitoring rivers.

  10. Atom pair 2D-fingerprints perceive 3D-molecular shape and pharmacophores for very fast virtual screening of ZINC and GDB-17.

    PubMed

    Awale, Mahendra; Reymond, Jean-Louis

    2014-07-28

    Three-dimensional (3D) molecular shape and pharmacophores are important determinants of the biological activity of organic molecules; however, a precise computation of 3D-shape is generally too slow for virtual screening of very large databases. A reinvestigation of the concept of atom pairs initially reported by Carhart et al. and extended by Schneider et al. showed that a simple atom pair fingerprint (APfp) counting atom pairs at increasing topological distances in 2D-structures without atom property assignment correlates with various representations of molecular shape extracted from the 3D-structures. A related 55-dimensional atom pair fingerprint extended with atom properties (Xfp) provided an efficient pharmacophore fingerprint with good performance for ligand-based virtual screening such as the recovery of active compounds from decoys in DUD, and overlap with the ROCS 3D-pharmacophore scoring function. The APfp and Xfp data were organized for web-based extremely fast nearest-neighbor searching in ZINC (13.5 M compounds) and GDB-17 (50 M random subset) freely accessible at www.gdb.unibe.ch .

  11. Molecular fingerprinting of carbohydrate structure phenotypes of three porifera proteoglycan-like glyconectins.

    PubMed

    Guerardel, Yann; Czeszak, Xavier; Sumanovski, Lazar T; Karamanos, Yannis; Popescu, Octavian; Strecker, Gerard; Misevic, Gradimir N

    2004-04-01

    Glyconectins (GNs) represent a new class of proteoglycan-like cell adhesion and recognition molecules found in several Porifera species. Physico-chemical properties of GN carbohydrate moieties, such as size, composition, and resistance to most glycosaminoglycan-degrading enzymes, distinguish them from any other type of known glycoproteins. The molecular mechanism of GN-mediated self/non-self discrimination function is based on highly species-specific and Ca(2+)-dependent GN to GN associations that approach the selectivity of the evolutionarily advanced immunoglobulin superfamily. Carbohydrates of glyconectins 1, 2, and 3 are essential for species-specific auto-aggregation properties in three respective Porifera species. To obtain a structural insight into the molecular mechanisms, we performed carbohydrate structural analyses of glyconectins isolated from the three sponge model systems, Microciona prolifera (GN1), Halichondria panicea (GN2), and Cliona celata (GN3). The glycan content of all three GNs ranged between 40 and 60% of their total mass. Our approach using sequential and selective chemical degradation of GN glycans and subsequent mass spectrometric and NMR analyses revealed that each glyconectin presents novel and highly species-specific carbohydrate sequences. All three GNs include distinct acid-resistant and acid-labile carbohydrate domains, the latter composed of novel repetitive units. We have sequenced four short sulfated and one pyruvilated unit in GN1, eight larger and branched pyruvilated oligosaccharides in GN2, which represent a heterogeneous but related family of structures, and four sulfated units in GN3.

  12. Rotation commensurate echo of asymmetric molecules—Molecular fingerprints in the time domain

    SciTech Connect

    Chesnokov, E. N.; Kubarev, V. V.; Koshlyakov, P. V.

    2014-12-29

    Using the pulses of terahertz free electron laser and ultra-fast Schottky diode detectors, we observed the coherent transients within a free induction decay of gaseous nitrogen dioxide NO{sub 2}. The laser excited different sub-bands of rotation spectra of NO{sub 2} containing about 50–70 lines. The free induction signal continued more than 30 ns and consisted of many echo-like bursts duration about 0.2 ns. Unlike the similar effect observed previously for linear and symmetric top molecules, the sequence of echo bursts is not periodic. The values for delay of individual echo are stable, and the set of these delays can be considered as a “molecular fingerprint” in the time domain.

  13. Gene expression fingerprint of uterine serous papillary carcinoma: identification of novel molecular markers for uterine serous cancer diagnosis and therapy

    PubMed Central

    Santin, A D; Zhan, F; Cane', S; Bellone, S; Palmieri, M; Thomas, M; Burnett, A; Roman, J J; Cannon, M J; Shaughnessy, J; Pecorelli, S

    2005-01-01

    Uterine serous papillary cancer (USPC) represents a rare but highly aggressive variant of endometrial cancer, the most common gynecologic tumour in women. We used oligonucleotide microarrays that interrogate the expression of some 10 000 known genes to profile 10 highly purified primary USPC cultures and five normal endometrial cells (NEC). We report that unsupervised analysis of mRNA fingerprints readily distinguished USPC from normal endometrial epithelial cells and identified 139 and 390 genes that exhibited >5-fold upregulation and downregulation, respectively, in primary USPC when compared to NEC. Many of the genes upregulated in USPC were found to represent adhesion molecules, secreted proteins and oncogenes, such as L1 cell adhesion molecule, claudin-3 and claudin-4, kallikrein 6 (protease M) and kallikrein 10 (NES1), interleukin-6 and c-erbB2. Downregulated genes in USPC included SEMACAP3, ras homolog gene family, member I (ARHI), and differentially downregulated in ovarian carcinoma gene 1. Quantitative RT–PCR was used to validate differences in gene expression between USPC and NEC for several of these genes. Owing to its potential as a novel therapeutic marker, expression of the high-affinity epithelial receptor for Clostridium perfringens enterotoxin (CPE) claudin-4 was further validated through immunohistochemical analysis of formalin-fixed paraffin-embedded specimens from which the primary USPC cultures were obtained, as well as an independent set of archival USPC specimens. Finally, the sensitivity of primary USPC to the administration of scalar doses of CPE in vitro was also demonstrated. Our results highlight the novel molecular features of USPC and provide a foundation for the development of new type-specific therapies against this highly aggressive variant of endometrial cancer. PMID:15785748

  14. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    PubMed

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  15. Molecular fingerprinting of lacustrian cyanobacterial communities: regional patterns in summer diversity.

    PubMed

    Touzet, Nicolas; McCarthy, David; Fleming, Gerard T A

    2013-12-01

    The assessment of lacustrian water quality is necessary to comply with environmental regulations. At the regional scale, difficulties reside in the selection of representative lakes. Given the risks towards water quality associated with phytoplankton blooms, a mesoscale survey was carried out in Irish lakes to identify patterns in the distribution and diversity of planktonic cyanobacteria. A stratified sampling strategy was carried out via geographic information systems (GIS) analysis of river catchment attributes due to the range of hydrogeomorphological features and the high number of lakes within the study area. 16S rRNA gene denaturing gradient gel electrophoresis analysis showed variation between the cyanobacterial communities sampled, with lower occurrence of cyanobacteria in August concomitant to increased wind and precipitation regimes. Multivariate analysis delineated three ecoregions based on land cover typology and revealed significant patterns in the distribution of cyanobacterial diversity. A majority of filamentous cyanobacteria genotypes occurred in larger lakes contained river catchments with substantial forest cover. In contrast, higher diversity of spherical cyanobacteria genotypes was observed in lakes of lesser trophic state. In the context of aquatic resource management, the combined use of GIS-based sampling strategy and molecular methods offers promising prospects for assessing microbial community structure at varying scales of space and time. PMID:23802655

  16. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD.

    PubMed

    Sunil Kumar, K N; Maruthi, K R; Alfarhan, A H; Rajakrishnan, R; Thomas, J

    2016-05-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard's coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes.

  17. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD

    PubMed Central

    Sunil Kumar, K.N.; Maruthi, K.R.; Alfarhan, A.H.; Rajakrishnan, R.; Thomas, J.

    2015-01-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard’s coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  18. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD.

    PubMed

    Sunil Kumar, K N; Maruthi, K R; Alfarhan, A H; Rajakrishnan, R; Thomas, J

    2016-05-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard's coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  19. The dioxin fingerprint

    SciTech Connect

    Crane, G.K.; Brasowski, L.; Nagge, C.G.; Aldina, G.J.

    1996-12-31

    Insight into the identification of the sources of dioxins in the environment can be obtained from the combustion process itself. Several theories have attributed dioxin formation to a thermal breakdown and molecular rearrangement of precursor compounds available in the combustion process. Dioxin-like compounds studied include polychlorinated dibenzodioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs). Isomers of these compounds which have chlorides in the 2,3,7,8 position have been identified by the authors to have unique distributions or fingerprints associated with a combustion source. This indicates that each combustion source can be identified by its dioxin/furan fingerprint. This paper is a compilation of dioxin and furan data from which the writer has identified unique fingerprints for each combustion source. One important value of establishing a fingerprint of dioxin from a combustion source is in relating the ambient levels found in a local area to that source by its unique isomer distribution. As the data base matures, many other relevant applications of identifying a dioxin fingerprint may abound.

  20. Complete Mitochondrial Genome of Anoplocephala magna Solidifying the Species

    PubMed Central

    Guo, Aijiang

    2016-01-01

    The 2 species of the genus Anoplocephala (Anoplocephalidae), A. perfoliata and A. magna, are among the most important equine cestode parasites. However, there is little information about their differences at the molecular level. The present study revealed that the mitochondrial (mt) genome of A. magna was 13,759 bp in size and 700 bp shorter than that of A. perfoliata. The 2 species includes 2 rRNA, 22 tRNA, and 12 protein-coding genes each. The size of each of the 36 genes was the same as that of A. perfoliata, except for cox1, rrnL, trnC, trnS2(UCN), trnG, trnH, trnQ, and trnP. In the full mitochondrial genome, the sequence similarity was 87.1%. The divergence in the nucleotide and amino acid sequences of individual protein-coding genes ranged from 11.1% to 16% and 6.8% to 16.4%, respectively. The 2 noncoding regions of the mt genome of A. magna were 199 bp and 271 bp in length, while the equivalent regions in A. perfoliata were 875 bp and 276 bp, respectively. The results of this study support the proposal that A. magna and A. perfoliata are separate species, consistent with previous morphological analyses. PMID:27417096

  1. Combining molecular fingerprints with multidimensional scaling analyses to identify the source of spilled oil from highly similar suspected oils.

    PubMed

    Zhou, Peiyu; Chen, Changshu; Ye, Jianjun; Shen, Wenjie; Xiong, Xiaofei; Hu, Ping; Fang, Hongda; Huang, Chuguang; Sun, Yongge

    2015-04-15

    Oil fingerprints have been a powerful tool widely used for determining the source of spilled oil. In most cases, this tool works well. However, it is usually difficult to identify the source if the oil spill accident occurs during offshore petroleum exploration due to the highly similar physiochemical characteristics of suspected oils from the same drilling platform. In this report, a case study from the waters of the South China Sea is presented, and multidimensional scaling analysis (MDS) is introduced to demonstrate how oil fingerprints can be combined with mathematical methods to identify the source of spilled oil from highly similar suspected sources. The results suggest that the MDS calculation based on oil fingerprints and subsequently integrated with specific biomarkers in spilled oils is the most effective method with a great potential for determining the source in terms of highly similar suspected oils.

  2. Combining molecular fingerprints with multidimensional scaling analyses to identify the source of spilled oil from highly similar suspected oils.

    PubMed

    Zhou, Peiyu; Chen, Changshu; Ye, Jianjun; Shen, Wenjie; Xiong, Xiaofei; Hu, Ping; Fang, Hongda; Huang, Chuguang; Sun, Yongge

    2015-04-15

    Oil fingerprints have been a powerful tool widely used for determining the source of spilled oil. In most cases, this tool works well. However, it is usually difficult to identify the source if the oil spill accident occurs during offshore petroleum exploration due to the highly similar physiochemical characteristics of suspected oils from the same drilling platform. In this report, a case study from the waters of the South China Sea is presented, and multidimensional scaling analysis (MDS) is introduced to demonstrate how oil fingerprints can be combined with mathematical methods to identify the source of spilled oil from highly similar suspected sources. The results suggest that the MDS calculation based on oil fingerprints and subsequently integrated with specific biomarkers in spilled oils is the most effective method with a great potential for determining the source in terms of highly similar suspected oils. PMID:25765488

  3. Molecular fingerprint-region spectroscopy from 5 to 12  μm using an orientation-patterned gallium phosphide optical parametric oscillator.

    PubMed

    Maidment, Luke; Schunemann, Peter G; Reid, Derryck T

    2016-09-15

    We report a femtosecond optical parametric oscillator (OPO) based on the new semiconductor gain material orientation-patterned gallium phosphide (OP-GaP), which enables the production of high-repetition-rate femtosecond pulses spanning 5-12 μm with average powers in the few to tens of milliwatts range. This is the first example of a broadband OPO operating across the molecular fingerprint region, and we demonstrate its potential by conducting broadband Fourier-transform spectroscopy using water vapor and a polystyrene reference standard.

  4. Molecular fingerprint-region spectroscopy from 5 to 12  μm using an orientation-patterned gallium phosphide optical parametric oscillator.

    PubMed

    Maidment, Luke; Schunemann, Peter G; Reid, Derryck T

    2016-09-15

    We report a femtosecond optical parametric oscillator (OPO) based on the new semiconductor gain material orientation-patterned gallium phosphide (OP-GaP), which enables the production of high-repetition-rate femtosecond pulses spanning 5-12 μm with average powers in the few to tens of milliwatts range. This is the first example of a broadband OPO operating across the molecular fingerprint region, and we demonstrate its potential by conducting broadband Fourier-transform spectroscopy using water vapor and a polystyrene reference standard. PMID:27628372

  5. Molecular fingerprint-region spectroscopy from 5 to 12 μm using an orientation-patterned gallium phosphide optical parametric oscillator

    NASA Astrophysics Data System (ADS)

    Maidment, Luke; Schunemann, Peter G.; Reid, Derryck T.

    2016-09-01

    We report a femtosecond optical parametric oscillator (OPO) based on the new semiconductor gain material orientation patterned gallium phosphide (OP-GaP), which enables the production of high-repetition-rate femtosecond pulses spanning 5-12 \\mu m with average powers in the few to tens of milliwatts range. This is the first example of a broadband OPO operating across the molecular fingerprint region, and we demonstrate its potential by conducting broadband Fourier-transform spectroscopy using water vapor and a polystyrene reference standard.

  6. Fingerprint detection

    DOEpatents

    Saunders, George C.

    1992-01-01

    A method for detection and visualization of latent fingerprints is provided and includes contacting a substrate containing a latent print thereon with a colloidal metal composition for time sufficient to allow reaction of said colloidal metal composition with said latent print, and preserving or recording the observable print. Further, the method for detection and visualization of latent fingerprints can include contacting the metal composition-latent print reaction product with a secondary metal-containing solution for time sufficient to allow precipitation of said secondary metal thereby enhancing the visibility of the latent print, and preserving or recording the observable print.

  7. Peptide mass fingerprinting.

    PubMed

    Thiede, Bernd; Höhenwarter, Wolfgang; Krah, Alexander; Mattow, Jens; Schmid, Monika; Schmidt, Frank; Jungblut, Peter R

    2005-03-01

    Peptide mass fingerprinting by MALDI-MS and sequencing by tandem mass spectrometry have evolved into the major methods for identification of proteins following separation by two-dimensional gel electrophoresis, SDS-PAGE or liquid chromatography. One main technological goal of proteome analyses beside high sensitivity and automation was the comprehensive analysis of proteins. Therefore, the protein species level with the essential information on co- and post-translational modifications must be achieved. The power of peptide mass fingerprinting for protein identification was described here, as exemplified by the identification of protein species with high molecular masses (spectrin alpha and beta), low molecular masses (elongation factor EF-TU fragments), splice variants (alpha A crystallin), aggregates with disulfide bridges (alkylhydroperoxide reductase), and phosphorylated proteins (heat shock protein 27). Helpful tools for these analyses were the use of the minimal protein identifier concept and the software program MS-Screener to remove mass peaks assignable to contaminants and neighbor spots.

  8. [Study on action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis based on techniques of gene expression profile and molecular fingerprint].

    PubMed

    Zhou, Wei; Song, Xiang-gang; Chen, Chao; Wang, Shu-mei; Liang, Sheng-wang

    2015-08-01

    Action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis were discussed based on gene expression profile and molecular fingerprint in this paper. First, gene expression profiles of atherosclerotic carotid artery tissues and histologically normal tissues in human body were collected, and were screened using significance analysis of microarray (SAM) to screen out differential gene expressions; then differential genes were analyzed by Gene Ontology (GO) analysis and KEGG pathway analysis; to avoid some genes with non-outstanding differential expression but biologically importance, Gene Set Enrichment Analysis (GSEA) were performed, and 7 chemical ingredients with higher negative enrichment score were obtained by Cmap method, implying that they could reversely regulate the gene expression profiles of pathological tissues; and last, based on the hypotheses that similar structures have similar activities, 336 ingredients of compound Danshen dripping pills were compared with 7 drug molecules in 2D molecular fingerprints method. The results showed that 147 differential genes including 60 up-regulated genes and 87 down regulated genes were screened out by SAM. And in GO analysis, Biological Process ( BP) is mainly concerned with biological adhesion, response to wounding and inflammatory response; Cellular Component (CC) is mainly concerned with extracellular region, extracellular space and plasma membrane; while Molecular Function (MF) is mainly concerned with antigen binding, metalloendopeptidase activity and peptide binding. KEGG pathway analysis is mainly concerned with JAK-STAT, RIG-I like receptor and PPAR signaling pathway. There were 10 compounds, such as hexadecane, with Tanimoto coefficients greater than 0.85, which implied that they may be the active ingredients (AIs) of compound Danshen dripping pills in treatment of carotid atherosclerosis (CAs). The present method can be applied to the research on material

  9. [Study on action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis based on techniques of gene expression profile and molecular fingerprint].

    PubMed

    Zhou, Wei; Song, Xiang-gang; Chen, Chao; Wang, Shu-mei; Liang, Sheng-wang

    2015-08-01

    Action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis were discussed based on gene expression profile and molecular fingerprint in this paper. First, gene expression profiles of atherosclerotic carotid artery tissues and histologically normal tissues in human body were collected, and were screened using significance analysis of microarray (SAM) to screen out differential gene expressions; then differential genes were analyzed by Gene Ontology (GO) analysis and KEGG pathway analysis; to avoid some genes with non-outstanding differential expression but biologically importance, Gene Set Enrichment Analysis (GSEA) were performed, and 7 chemical ingredients with higher negative enrichment score were obtained by Cmap method, implying that they could reversely regulate the gene expression profiles of pathological tissues; and last, based on the hypotheses that similar structures have similar activities, 336 ingredients of compound Danshen dripping pills were compared with 7 drug molecules in 2D molecular fingerprints method. The results showed that 147 differential genes including 60 up-regulated genes and 87 down regulated genes were screened out by SAM. And in GO analysis, Biological Process ( BP) is mainly concerned with biological adhesion, response to wounding and inflammatory response; Cellular Component (CC) is mainly concerned with extracellular region, extracellular space and plasma membrane; while Molecular Function (MF) is mainly concerned with antigen binding, metalloendopeptidase activity and peptide binding. KEGG pathway analysis is mainly concerned with JAK-STAT, RIG-I like receptor and PPAR signaling pathway. There were 10 compounds, such as hexadecane, with Tanimoto coefficients greater than 0.85, which implied that they may be the active ingredients (AIs) of compound Danshen dripping pills in treatment of carotid atherosclerosis (CAs). The present method can be applied to the research on material

  10. Comparison of Two Highly Discriminatory Molecular Fingerprinting Assays for Analysis of Multiple Aspergillus fumigatus Isolates from Patients with Invasive Aspergillosis▿

    PubMed Central

    de Valk, Hanneke A.; Meis, Jacques F. G. M.; de Pauw, Ben E.; Donnelly, Peter J.; Klaassen, Corné H. W.

    2007-01-01

    Two highly discriminatory fingerprinting assays, short tandem repeat typing and amplified fragment length polymorphism (AFLP), were compared to determine the genetic relatedness between 55 isolates of Aspergillus fumigatus obtained from 15 different patients suffering from proven invasive aspergillosis. Both techniques showed that interpatient isolates belonged to different genotypes and that intrapatient isolates from deep sites were all of the same genotype. By contrast, multiple genotypes were found among isolates originating from respiratory samples. Both techniques have specific advantages and disadvantages. AFLP is more universally applicable, but short tandem repeat analysis offers better discriminatory power and should be the preferred method for standardizing typing of clinical isolates of Aspergillus fumigatus. PMID:17376887

  11. Efficiency of rep-PCR fingerprinting as a useful technique for molecular typing of plant pathogenic fungal species: Botryosphaeriaceae species as a case study.

    PubMed

    Abdollahzadeh, Jafar; Zolfaghari, Sajedeh

    2014-12-01

    Progress in molecular biology and the advent of rapid and accurate molecular techniques have contributed to precise and rapid detection and differentiation of microbial pathogens. Identification of the Botryosphaeriaceae species based on morphology has been problematic over time. In this study, we used rep-PCR technique as a molecular tool for typing and differentiation of the Botryosphaeriaceae species, well-known and cosmopolitan fungal pathogens on woody plants. Three primer sets BOX, ERIC and REP were used to differentiate 27 species belong to eight genera. The majority of them were examined in terms of typing and differentiation using molecular methods for the first time. All the primer sets were able to generate species-specific DNA fingerprints from all the tested strains, with two exceptions in the genera Diplodia and Spencermartinsia. Despite the deficiency of each primer sets to separate a few species, cluster analysis of combined data sets indicated the ability of rep-PCR technique to separate 26 out of 27 examined species in highly supported clusters corresponded to the species recognized based on DNA sequence data. Our findings revealed the efficiency of rep-PCR for detection and differentiation of the Botryosphaeriaceae species, especially cryptic species with the same ITS sequences and similar morphology.

  12. Theranostic profiling for actionable aberrations in advanced high risk osteosarcoma with aggressive biology reveals high molecular diversity: the human fingerprint hypothesis

    PubMed Central

    Egas-Bejar, Daniela; Anderson, Pete M.; Agarwal, Rishi; Corrales-Medina, Fernando; Devarajan, Eswaran; Huh, Winston W.; Brown, Robert E; Subbiah, Vivek

    2014-01-01

    The survival of patients with advanced osteosarcoma is poor with limited therapeutic options. There is an urgent need for new targeted therapies based on biomarkers. Recently, theranostic molecular profiling services for cancer patients by CLIA-certified commercial companies as well as in-house profiling in academic medical centers have expanded exponentially. We evaluated molecular profiles of patients with advanced osteosarcoma whose tumor tissue had been analyzed by one of the following methods: 1. 182-gene next-generation exome sequencing (Foundation Medicine, Boston, MA), 2. Immunohistochemistry (IHC)/PCR-based panel (CARIS Target Now, Irving, Tx), 3. Comparative genome hybridization (Oncopath, San Antonio, TX). 4. Single-gene PCR assays, PTEN IHC (MDACC CLIA), 5. UT Houston morphoproteomics (Houston, TX). The most common actionable aberrations occur in the PI3K/PTEN/ mTOR pathway. No patterns in genomic alterations beyond the above are readily identifiable, and suggest both high molecular diversity in osteosarcoma and the need for more analyses to define distinct subgroups of osteosarcoma defined by genomic alterations. Based on our preliminary observations we hypothesize that the biology of aggressive and the metastatic phenotype osteosarcoma at the molecular level is similar to human fingerprints, in that no two tumors are identical. Further large scale analyses of osteosarcoma samples are warranted to test this hypothesis. PMID:25126591

  13. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar. PMID:22558204

  14. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  15. Behavioral response of Daphnia magna to silver salt and nanoparticle exposure

    EPA Science Inventory

    Endpoints in the investigation of the toxicity of metallic nanoparticles have varied from genetic and molecular through whole organism responses such as death and reproduction. The work presented here is an effort to quantify behavioral responses of Daphnia magna to exposure to s...

  16. Aerogel Fingerprint Media

    SciTech Connect

    Miller, Fred S.; Andresen, Brian D.

    1999-09-21

    A fingerprint medium which is made of an aerogel having a predetermined density. The fingerprint medium may have a midrange density for forming plates or may be crushed forming a powder. The fingerprint medium may further include at least one of a metal and metal oxide to enhance characteristics desirable in a fingerprint medium.

  17. Phenotypic and molecular fingerprinting of fast growing rhizobia of field-grown pigeonpea from the eastern edge of the Brazilian Pantanal.

    PubMed

    Costa, F M; Schiavo, J A; Brasil, M S; Leite, J; Xavier, G R; Fernandes, P I

    2014-01-21

    The aim of this study was to evaluate the diversity of rhizobial isolates obtained from root nodules of pigeonpea plants grown at the eastern edge of the Brazilian Pantanal. The bacterial isolates were isolated from root nodules from field-growing pigeonpea grown in two rural settlements of the Aquidauana municipality. The bacterial isolates were characterized phenotypically by means of cultural characterization, intrinsic antibiotic resistance (IAR), salt and high incubation temperature tolerance, and amylolytic and cellulolytic activities. The molecular characterization of the bacterial isolates was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and Box-polymerase chain reaction (PCR) techniques. In addition, the symbiotic performance of selected rhizobial isolates was evaluated in a greenhouse experiment using sterile substrate. The phenotypic characterization revealed that the bacterial strains obtained from pigeonpea root nodules presented characteristics that are uncommon among rhizobial isolates, indicating the presence of new species nodulating the pigeonpea plants in the Brazilian Pantanal. The molecular fingerprinting of these bacterial isolates also showed a highly diverse collection, with both techniques revealing less than 25% similarity among bacterial isolates. The evaluation of symbiotic performance also indicated the presence of microorganisms with high potential to increase the growth and nitrogen content at the shoots of pigeonpea plants. The results obtained in this study indicate the presence of a highly diversified rhizobial community nodulating the pigeonpea at the eastern edge of the Brazilian Pantanal.

  18. First evidence for toxic defense based on the multixenobiotic resistance (MXR) mechanism in Daphnia magna.

    PubMed

    Campos, Bruno; Altenburger, Rolf; Gómez, Cristian; Lacorte, Silvia; Piña, Benjamin; Barata, Carlos; Luckenbach, Till

    2014-03-01

    The water flea Daphnia magna is widely used as test species in ecotoxicological bioassays. So far, there is no information available to which extent ATP binding cassette (ABC) transporter based multixenobiotic resistance (MXR) counteracts adverse chemical effects in this species. This, however, would be important for assessing to which extent the bio-active potential of a compound determined with this species depends on this cellular defense. We here present molecular, functional and toxicological studies that provide first evidence for ABC transporter-based MXR in D. magna. We cloned putatively MXR-related partial abcb1, abcc1/3, abcc4 and abcc5 coding sequences; respective transcripts were constitutively expressed in different D. magna life stages. MXR associated efflux activity was monitored in D. magna using the fluorescent substrate dyes rhodamine 123, rhodamine B and calcein-AM combined with inhibitors of human ABCB1 and/or ABCC transporter activities reversin 205, MK571 and cyclosporin A. With inhibitors present, efflux of dye substrates was reduced in D. magna in a concentration-dependent mode, as indicated by elevated accumulation of the dyes in D. magna tissues. In animals pre-exposed to mercury, pentachlorophenol or dacthal applied as inducers of ABC transporter expression, levels of some ABC transporter transcripts were increased in some cases showing that these genes can be chemically induced. Likewise, pre-exposure of animals to these chemicals decreased dye accumulation in tissue, indicating enhanced MXR transporter activity, likely associated with higher transporter protein levels. Toxicity assays with toxic transporter substrates mitoxantrone and chlorambucil that were applied singly and in combination with inhibitors were performed to study the tolerance role of Abcb1 and Abcc efflux transporters in D. magna. Joint toxicities of about half of the binary combinations of test compounds applied (substrate/inhibitor, substrate/substrate, inhibitor

  19. Advanced Fingerprint Analysis Project Fingerprint Constituents

    SciTech Connect

    GM Mong; CE Petersen; TRW Clauss

    1999-10-29

    The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

  20. Fingerprint comparison. I: Similarity of fingerprints.

    PubMed

    Lin, C H; Liu, J H; Osterburg, J W; Nicol, J D

    1982-04-01

    Fingerprints from 61 pairs of male monozygotic twins (MZ), 47 pairs of female MZ, 40 pairs of same-sex male dizygotic twins (DZ), 44 pairs of same-sex female DZ, 4 pairs of opposite-sex DZ, and 28 brothers and 31 sisters of those twins are used for the study of fingerprint similarities. Similarities of fingerprint pattern, ridge count, and minutiae are evaluated for two population groups genetically related to each other in different degrees. It is concluded that fingerprint similarities, including pattern, ridge count, and possibly minutiae, between MZ individuals are significantly higher than those between other population groups, including DZ twins.

  1. Fluorescence fingerprints and Cu2+-complexing ability of individual molecular size fractions in soil- and waste-borne DOM.

    PubMed

    Knoth de Zarruk, K; Scholer, G; Dudal, Y

    2007-09-01

    Land spreading of organic materials introduces large amounts of dissolved organic matter (DOM) into the soil. DOM has the ability to form stable complexes with heavy metals and can facilitate their transport towards the groundwater. The effects on soil processes are difficult to assess, because different DOM components might react differently towards metal ions. The objective of this study was to investigate the fluorescence signature and the Cu2+-binding capacity of individual molecular size fractions of DOM from various sources. DOM extracted from leaf compost, chicken manure, sugar cane vinasse and a fulvic hypercalcaric cambisol was fractionated by the means of dialysis into four molecular size classes: MW<500, 50012000-14000 Da. Vinasse and leaf compost contained around 80% and 70%, respectively, of the total organic carbon in the fractions with low molecular weight (MW<3500 Da); in chicken manure and soil these fractions accounted for 40% and 50% only. Fluorescence was highest in the fraction MW>12000 Da for leaf compost, chicken manure and soil. The opposite result was obtained for vinasse, where the fractions with low molecular weight showed highest fluorescence intensities, distinguishing it from all other samples. Vinasse showed the greatest ability to bind Cu2+ with a resulting complex concentration of 6.31mgl(-1) while in contact with an excess of Cu2+. Leaf compost, soil and chicken manure followed with 2.69, 1.12, and 0.85mgl(-1), respectively. Within vinasse, the fraction MW<500 Da was able to form the most DOM-Cu complexes, indicating the importance of low molecular weight fractions in metal binding. PMID:17498777

  2. Development of 3D-QSAR Model for Acetylcholinesterase Inhibitors Using a Combination of Fingerprint, Molecular Docking, and Structure-Based Pharmacophore Approaches.

    PubMed

    Lee, Sehan; Barron, Mace G

    2015-11-01

    Acetylcholinesterase (AChE), a serine hydrolase vital for regulating the neurotransmitter acetylcholine in animals, has been used as a target for drugs and pesticides. With the increasing availability of AChE crystal structures, with or without ligands bound, structure-based approaches have been successfully applied to AChE inhibitors (AChEIs). The major limitation of these approaches has been the small applicability domain due to the lack of structural diversity in the training set. In this study, we developed a 3 dimensional quantitative structure-activity relationship (3D-QSAR) for inhibitory activity of 89 reversible and irreversible AChEIs including drugs and insecticides. A 3D-fingerprint descriptor encoding protein-ligand interactions was developed using molecular docking and structure-based pharmacophore to rationalize the structural requirements responsible for the activity of these compounds. The obtained 3D-QSAR model exhibited high correlation value (R(2) = 0.93) and low mean absolute error (MAE = 0.32 log units) for the training set (n = 63). The model was predictive across a range of structures as shown by the leave-one-out cross-validated correlation coefficient (Q(2) = 0.89) and external validation results (n = 26, R(2) = 0.89, and MAE = 0.38 log units). The model revealed that the compounds with high inhibition potency had proper conformation in the active site gorge and interacted with key amino acid residues, in particular Trp84 and Phe330 at the catalytic anionic site, Trp279 at the peripheral anionic site, and Gly118, Gly119, and Ala201 at the oxyanion hole. The resulting universal 3D-QSAR model provides insight into the multiple molecular interactions determining AChEI potency that may guide future chemical design and regulation of toxic AChEIs.

  3. Development of 3D-QSAR Model for Acetylcholinesterase Inhibitors Using a Combination of Fingerprint, Molecular Docking, and Structure-Based Pharmacophore Approaches.

    PubMed

    Lee, Sehan; Barron, Mace G

    2015-11-01

    Acetylcholinesterase (AChE), a serine hydrolase vital for regulating the neurotransmitter acetylcholine in animals, has been used as a target for drugs and pesticides. With the increasing availability of AChE crystal structures, with or without ligands bound, structure-based approaches have been successfully applied to AChE inhibitors (AChEIs). The major limitation of these approaches has been the small applicability domain due to the lack of structural diversity in the training set. In this study, we developed a 3 dimensional quantitative structure-activity relationship (3D-QSAR) for inhibitory activity of 89 reversible and irreversible AChEIs including drugs and insecticides. A 3D-fingerprint descriptor encoding protein-ligand interactions was developed using molecular docking and structure-based pharmacophore to rationalize the structural requirements responsible for the activity of these compounds. The obtained 3D-QSAR model exhibited high correlation value (R(2) = 0.93) and low mean absolute error (MAE = 0.32 log units) for the training set (n = 63). The model was predictive across a range of structures as shown by the leave-one-out cross-validated correlation coefficient (Q(2) = 0.89) and external validation results (n = 26, R(2) = 0.89, and MAE = 0.38 log units). The model revealed that the compounds with high inhibition potency had proper conformation in the active site gorge and interacted with key amino acid residues, in particular Trp84 and Phe330 at the catalytic anionic site, Trp279 at the peripheral anionic site, and Gly118, Gly119, and Ala201 at the oxyanion hole. The resulting universal 3D-QSAR model provides insight into the multiple molecular interactions determining AChEI potency that may guide future chemical design and regulation of toxic AChEIs. PMID:26202430

  4. Identification of pili on the surface of Finegoldia magna--a gram-positive anaerobic cocci.

    PubMed

    Murphy, Elizabeth C; Janulczyk, Robert; Karlsson, Christofer; Mörgelin, Matthias; Frick, Inga-Maria

    2014-06-01

    Pili have only been discovered in the major Gram-positive pathogens in the past decade and they have been found to play an important role in colonisation and virulence. Pili have been shown to have many important functions including attachment to host tissues, mediating bacterial aggregation, biofilm formation and binding to proteins in the extracellular matrix. In this study, sortase-dependent pili have been found to be expressed on the surface of Finegoldia magna ALB8. F. magna is a Gram-positive anaerobic coccus that, primarily, is a commensal of the skin and mucous membranes, but has also been isolated from various clinical infection sites and is associated with soft-tissue abscesses, wound infections and bone and prosthetic joint infections. In this study, F. magna ALB8 was found to harbour three sortases at the pilus locus, two of which bear high similarity to class C sortases in Streptococcus pneumoniae. Two putative sortase-dependent pili proteins were found in the locus, with one being identified as the major pilus subunit, Fmp1 (F. magna pilus subunit 1), due to its high similarity to other major pilus proteins in prominent Gram-positive pathogens. The presence of sortase-dependent pili was confirmed experimentally through recombinant production of Fmp1 and production of antiserum. The Fmp1 antiserum was used in Western blot to show the presence of a high molecular weight protein ladder, characteristic of the presence of pili, in trypsin released cell wall surface proteins from F. magna. The presence of sortase-dependent pili was visually confirmed by transmission electron microscopy, which showed the binding of gold labelled anti-Fmp1 to individual pilus proteins along the pilus. Furthermore, pili could also be found to bind and interact with keratinocytes in the epidermal layer of human skin, suggesting an adhesive role for pili on F. magna. Our work represents the first description of pilus structures in F. magna. This discovery further

  5. Purification and studies on characteristics of cholinesterases from Daphnia magna *

    PubMed Central

    Yang, Yan-xia; Niu, Li-zhi; Li, Shao-nan

    2013-01-01

    Due to their significant value in both economy and ecology, Daphnia had long been employed to investigate in vivo response of cholinesterase (ChE) in anticholinesterase exposures, whereas the type constitution and property of the enzyme remained unclear. A type of ChE was purified from Daphnia magna using a three-step procedure, i.e., Triton X-100 extraction, ammonium sulfate precipitation, and diethylaminoethyl (DEAE)-Sepharose™-Fast-Flow chromatography. According to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), molecular mass of the purified ChE was estimated to be 84 kDa. Based on substrate studies, the purified enzyme preferred butyrylthiocholine iodide (BTCh) [with maximum velocity (V max)/Michaelis constant (K m)=8.428 L/(min·mg protein)] to acetylthiocholine iodide (ATCh) [with V max/K m=5.346 L/(min·mg protein)] as its substrate. Activity of the purified enzyme was suppressed by high concentrations of either ATCh or BTCh. Inhibitor studies showed that the purified enzyme was more sensitive towards inhibition by tetraisopropylpyrophosphoramide (iso-OMPA) than by 1,5-bis(4-allyldimethylammoniumphenyl) pentan-3-one dibromide (BW284C51). Result of the study suggested that the purified ChE was more like a type of pseudocholinesterase, and it also suggested that Daphnia magna contained multiple types of ChE in their bodies. PMID:23549850

  6. Fingerprints of molecular structure and hydrogen bonding effects in the /sup 13/C NMR spectra of monosaccharides with partially deuterated hydroxyls

    SciTech Connect

    Reuben, J.

    1984-10-17

    A new NMR approach to structure elucidation of carbohydrates in solution is presented. Examined in detail are the isotopic multiplets in /sup 13/C NMR spectra that result from partial deuteration of the hydroxyls for a series of monosaccharides and some of their deoxy and methyl glycoside derivatives in Me/sub 2/SO-d/sub 6/ solutions. Chemical shift and isotope effect data are presented for the pyranose and furanose forms of aldopentoses, aldohexoses, and ketohexoses. The results show that the magnitude of the ..gamma.. effect resulting from deuteration of a hydroxyl on a vicinal carbon atoms is sensitive to the relative geometric relationship, cis or trans, of the hydroxyls in vicinal diol arrays. Thus, the multiplet pattern for carbons 3 and 4 of the pyranose ring can serve as a fingerprint of molecular structure at the pentopyranose level. The aldopentoses and ketohexoses are amenable to structural analysis by this simple approach. Ambiguity will arise for pairs of aldohexoses related to each other by epimerization at C5. Intramolecular hydrogen bonding between the hydroxyls at C2 and C4 in ..cap alpha..-D-talopyranose gives rise to some unusual effects. A mechanism involving isotopic perturbation of the equilibrium between the hydrogen-bonded structures O4-H...O2-H and O2-H...O4-H is suggested as the possible source of these effects. Similarly, the extra splitting observed in the /sup 13/C resonance of C3 of ..beta..-D-fucofuranose are rationalized in terms of an equilibrium between the hydrogen-bonded structures C5-O5-H...O3-H and Cl-O1-H...O3-H. The approach of isotopic multiplets appears to be uniquely suited for the study of such structures.

  7. Conversion of the pathogenic fungus Colletotrichum magna to a nonpathogenic, endophytic mutualist by gene disruption

    USGS Publications Warehouse

    Redman, R.S.; Ranson, J.C.; Rodriguez, R.J.

    1999-01-01

    Hygromycin-resistant transformants of the cucurbit pathogen Colletotrichum magna (teleomorph: Glomerella magna) were generated by restriction enzyme-mediated integration (REMI) transformation. A rapid pathogenicity assay involving watermelon (Citrullus lanatus) seedlings was developed and 14,400 REMI transformants were screened and assessed for their ability to cause disease, colonize plant tissues, and confer disease resistance against wild-type C. magna. A total of 176 nonpathogenic REMI mutants capable of colonizing cucurbit plants were isolated and assigned to three groups based on their ability to confer disease resistance: phenotype A, 80 to 100% disease protection; phenotype B, 10 to 65% disease protection; and phenotype C, 0 to 4% disease protection. Molecular and genetic analyses of one REMI mutant (R1) indicated that the nonpathogenic phenotype A resulted from a single-site integration. R1 showed a 1:1 segregation of hygromycin resistance and nonpathogenicity and all hygromycin-resistant progeny were nonpathogenic. The integrated vector and 5.5 kb of flanking fungal genomic DNA were isolated from R1 and designated pGMR1. To verify that pGMR1 contained pathogenicity gene sequences, a wild-type isolate of C. magna was transformed with pGMR1 to induce gene disruptions by homologous integration. Approximately 47% of the pGMR1 transformants expressed phenotype A, indicating homologous integration and gene disruption.

  8. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    PubMed

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  9. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    PubMed

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop. PMID:17546067

  10. iCDI-PseFpt: identify the channel-drug interaction in cellular networking with PseAAC and molecular fingerprints.

    PubMed

    Xiao, Xuan; Min, Jian-Liang; Wang, Pu; Chou, Kuo-Chen

    2013-11-21

    Many crucial functions in life, such as heartbeat, sensory transduction and central nervous system response, are controlled by cell signalings via various ion channels. Therefore, ion channels have become an excellent drug target, and study of ion channel-drug interaction networks is an important topic for drug development. However, it is both time-consuming and costly to determine whether a drug and a protein ion channel are interacting with each other in a cellular network by means of experimental techniques. Although some computational methods were developed in this regard based on the knowledge of the 3D (three-dimensional) structure of protein, unfortunately their usage is quite limited because the 3D structures for most protein ion channels are still unknown. With the avalanche of protein sequences generated in the post-genomic age, it is highly desirable to develop the sequence-based computational method to address this problem. To take up the challenge, we developed a new predictor called iCDI-PseFpt, in which the protein ion-channel sample is formulated by the PseAAC (pseudo amino acid composition) generated with the gray model theory, the drug compound by the 2D molecular fingerprint, and the operation engine is the fuzzy K-nearest neighbor algorithm. The overall success rate achieved by iCDI-PseFpt via the jackknife cross-validation was 87.27%, which is remarkably higher than that by any of the existing predictors in this area. As a user-friendly web-server, iCDI-PseFpt is freely accessible to the public at the website http://www.jci-bioinfo.cn/iCDI-PseFpt/. Furthermore, for the convenience of most experimental scientists, a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated math equations presented in the paper just for its integrity. It has not escaped our notice that the current approach can also be used to study other drug-target interaction networks.

  11. Latent fingerprint matching.

    PubMed

    Jain, Anil K; Feng, Jianjiang

    2011-01-01

    Latent fingerprint identification is of critical importance to law enforcement agencies in identifying suspects: Latent fingerprints are inadvertent impressions left by fingers on surfaces of objects. While tremendous progress has been made in plain and rolled fingerprint matching, latent fingerprint matching continues to be a difficult problem. Poor quality of ridge impressions, small finger area, and large nonlinear distortion are the main difficulties in latent fingerprint matching compared to plain or rolled fingerprint matching. We propose a system for matching latent fingerprints found at crime scenes to rolled fingerprints enrolled in law enforcement databases. In addition to minutiae, we also use extended features, including singularity, ridge quality map, ridge flow map, ridge wavelength map, and skeleton. We tested our system by matching 258 latents in the NIST SD27 database against a background database of 29,257 rolled fingerprints obtained by combining the NIST SD4, SD14, and SD27 databases. The minutiae-based baseline rank-1 identification rate of 34.9 percent was improved to 74 percent when extended features were used. In order to evaluate the relative importance of each extended feature, these features were incrementally used in the order of their cost in marking by latent experts. The experimental results indicate that singularity, ridge quality map, and ridge flow map are the most effective features in improving the matching accuracy.

  12. How fingerprints came into use for personal identification.

    PubMed

    Caplan, R M

    1990-07-01

    The use of fingerprints for personal identification became widespread early in this century. How the fingerprints slowly became standardized involves many persons, including Nathaniel Grew, Johannes Purkinje, William Herschel, Henry Faulds, Charles Darwin, Francis Galton, Mark Twain, Juan Vucetich, Edward Henry, and J. Edgar Hoover. Although fingerprints have been noted and used since antiquity, a 25-year burst of activity that secured adoption of their use for identification began in about 1880. New modifications and applications have continued to the present. The history of fingerprints offers an excellent example of how society adopts innovations. This story also includes a bitter struggle for appropriate credit for various crucial steps in developing and adopting this important tool. More recent technical advances, including computers and molecular biology, now supplement the ease and usefulness of fingerprints, although the word fingerprinting continues in use by metaphoric extension.

  13. How fingerprints came into use for personal identification.

    PubMed

    Caplan, R M

    1990-07-01

    The use of fingerprints for personal identification became widespread early in this century. How the fingerprints slowly became standardized involves many persons, including Nathaniel Grew, Johannes Purkinje, William Herschel, Henry Faulds, Charles Darwin, Francis Galton, Mark Twain, Juan Vucetich, Edward Henry, and J. Edgar Hoover. Although fingerprints have been noted and used since antiquity, a 25-year burst of activity that secured adoption of their use for identification began in about 1880. New modifications and applications have continued to the present. The history of fingerprints offers an excellent example of how society adopts innovations. This story also includes a bitter struggle for appropriate credit for various crucial steps in developing and adopting this important tool. More recent technical advances, including computers and molecular biology, now supplement the ease and usefulness of fingerprints, although the word fingerprinting continues in use by metaphoric extension. PMID:2195070

  14. Survey of Fascioloides magna in farmed wapiti in Alberta.

    PubMed Central

    Kennedy, M J; Acorn, R C; Moraiko, D T

    1999-01-01

    The formalin-ethyl acetate sedimentation procedure was used to detect ova of the giant liver fluke, Fascioloides magna, in feces of farmed wapiti in Alberta. Twenty (3.2%) of the 629 fecal samples examined contained ova of F. magna. Thirteen (33.3%) of the 39 farms surveyed had wapiti positive for F. magna. The presence of F. magna in farmed wapiti north of the North Saskatchewan River is confirmed, and 3 areas where the infection has become endemic are identified. Images Figure 1. PMID:10200881

  15. Comparing Bacterial DNA Microarray Fingerprints

    SciTech Connect

    Willse, Alan R.; Chandler, Darrell P.; White, Amanda M.; Protic, Miroslava; Daly, Don S.; Wunschel, Sharon C.

    2005-08-15

    Detecting subtle genetic differences between microorganisms is an important problem in molecular epidemiology and microbial forensics. In a typical investigation, gel electrophoresis is used to compare randomly amplified DNA fragments between microbial strains, where the patterns of DNA fragment sizes are proxies for a microbe's genotype. The limited genomic sample captured on a gel is often insufficient to discriminate nearly identical strains. This paper examines the application of microarray technology to DNA fingerprinting as a high-resolution alternative to gel-based methods. The so-called universal microarray, which uses short oligonucleotide probes that do not target specific genes or species, is intended to be applicable to all microorganisms because it does not require prior knowledge of genomic sequence. In principle, closely related strains can be distinguished if the number of probes on the microarray is sufficiently large, i.e., if the genome is sufficiently sampled. In practice, we confront noisy data, imperfectly matched hybridizations, and a high-dimensional inference problem. We describe the statistical problems of microarray fingerprinting, outline similarities with and differences from more conventional microarray applications, and illustrate the statistical fingerprinting problem for 10 closely related strains from three Bacillus species, and 3 strains from non-Bacillus species.

  16. A DAPHNIA MAGNA SHORT-TERM SURVIVAL AND GROWTH TEST

    EPA Science Inventory

    With the change in acceptable test temperatures for invertebrate toxicity tests from <20oC to 25oC, it is now possible to use Daphnia magna for short-term chronic testing. When cultured at 25oC the dry weight of <24 hr old D. magna ranges from 7 to 15 g depending upon nutrition,...

  17. The Larva of Diplectrona magna Mosely, 1930 (Trichoptera: Hydropsychidae)

    PubMed Central

    WARINGER, JOHANN; GRAF, WOLFRAM

    2016-01-01

    The larva of Diplectrona magna Mosely, 1930 is described and compared with the other European Diplectrona larvae described so far. Information for the identification of three species (D. atra, D. felix and D. magna) is given and some zoogeographical and ecological notes are presented. PMID:26973367

  18. Teaching Magna Carta in American History: Land, Law, and Legacy

    ERIC Educational Resources Information Center

    Saxe, David W.

    2010-01-01

    Magna Carta, that great cornerstone of American liberty, has been in the news lately. Put up for sale by three-time U.S. Presidential candidate Ross Perot in December 2007, the 1297 version of Magna Carta displayed in the National Archives was sold to financier David Rubenstein for $21.3 million. While its sale demonstrates the cash value of the…

  19. Advanced fingerprint verification software

    NASA Astrophysics Data System (ADS)

    Baradarani, A.; Taylor, J. R. B.; Severin, F.; Maev, R. Gr.

    2016-05-01

    We have developed a fingerprint software package that can be used in a wide range of applications from law enforcement to public and private security systems, and to personal devices such as laptops, vehicles, and door- locks. The software and processing units are a unique implementation of new and sophisticated algorithms that compete with the current best systems in the world. Development of the software package has been in line with the third generation of our ultrasonic fingerprinting machine1. Solid and robust performance is achieved in the presence of misplaced and low quality fingerprints.

  20. Longitudinal study of fingerprint recognition

    PubMed Central

    Yoon, Soweon; Jain, Anil K.

    2015-01-01

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject’s age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis. PMID:26124106

  1. Longitudinal study of fingerprint recognition.

    PubMed

    Yoon, Soweon; Jain, Anil K

    2015-07-14

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject's age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis.

  2. Altered fingerprints: analysis and detection.

    PubMed

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K

    2012-03-01

    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem.

  3. Altered fingerprints: analysis and detection.

    PubMed

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K

    2012-03-01

    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem. PMID:21808092

  4. Fingerprinting of music scores

    NASA Astrophysics Data System (ADS)

    Irons, Jonathan; Schmucker, Martin

    2004-06-01

    Publishers of sheet music are generally reluctant in distributing their content via the Internet. Although online sheet music distribution's advantages are numerous the potential risk of Intellectual Property Rights (IPR) infringement, e.g. illegal online distributions, disables any innovation propensity. While active protection techniques only deter external risk factors, additional technology is necessary to adequately treat further risk factors. For several media types including music scores watermarking technology has been developed, which ebeds information in data by suitable data modifications. Furthermore, fingerprinting or perceptual hasing methods have been developed and are being applied especially for audio. These methods allow the identification of content without prior modifications. In this article we motivate the development of watermarking and fingerprinting technologies for sheet music. Outgoing from potential limitations of watermarking methods we explain why fingerprinting methods are important for sheet music and address potential applications. Finally we introduce a condept for fingerprinting of sheet music.

  5. Online fingerprint verification.

    PubMed

    Upendra, K; Singh, S; Kumar, V; Verma, H K

    2007-01-01

    As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications. PMID:17365425

  6. Expertise in fingerprint identification.

    PubMed

    Thompson, Matthew B; Tangen, Jason M; McCarthy, Duncan J

    2013-11-01

    Although fingerprint experts have presented evidence in criminal courts for more than a century, there have been few scientific investigations of the human capacity to discriminate these patterns. A recent latent print matching experiment shows that qualified, court-practicing fingerprint experts are exceedingly accurate (and more conservative) compared with novices, but they do make errors. Here, a rationale for the design of this experiment is provided. We argue that fidelity, generalizability, and control must be balanced to answer important research questions; that the proficiency and competence of fingerprint examiners are best determined when experiments include highly similar print pairs, in a signal detection paradigm, where the ground truth is known; and that inferring from this experiment the statement "The error rate of fingerprint identification is 0.68%" would be unjustified. In closing, the ramifications of these findings for the future psychological study of forensic expertise and the implications for expert testimony and public policy are considered.

  7. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  8. Network fingerprint: a knowledge-based characterization of biomedical networks.

    PubMed

    Cui, Xiuliang; He, Haochen; He, Fuchu; Wang, Shengqi; Li, Fei; Bo, Xiaochen

    2015-08-26

    It can be difficult for biomedical researchers to understand complex molecular networks due to their unfamiliarity with the mathematical concepts employed. To represent molecular networks with clear meanings and familiar forms for biomedical researchers, we introduce a knowledge-based computational framework to decipher biomedical networks by making systematic comparisons to well-studied "basic networks". A biomedical network is characterized as a spectrum-like vector called "network fingerprint", which contains similarities to basic networks. This knowledge-based multidimensional characterization provides a more intuitive way to decipher molecular networks, especially for large-scale network comparisons and clustering analyses. As an example, we extracted network fingerprints of 44 disease networks in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The comparisons among the network fingerprints of disease networks revealed informative disease-disease and disease-signaling pathway associations, illustrating that the network fingerprinting framework will lead to new approaches for better understanding of biomedical networks.

  9. Compounds altering fat storage in Daphnia magna.

    PubMed

    Jordão, Rita; Garreta, Elba; Campos, Bruno; Lemos, Marco F L; Soares, Amadeu M V M; Tauler, Romà; Barata, Carlos

    2016-03-01

    The analysis of lipid disruptive effects in invertebrates is limited by our poor knowledge of the lipid metabolic pathways. A recent study showed that tributyltin activated the ecdysteroid, juvenile hormone and retinoic X receptor signaling pathways, and disrupted the dynamics of neutral lipids in the crustacean Daphnia magna impairing the transfer of triacylglycerols to eggs and hence promoting their accumulation in post-spawning females. Tributyltin disruptive effects correlated with lower fitness for offspring and adults. The present study aims to addresses effects of existing compounds on storage lipids in post-spawning females and their health effects. D. magna individuals were exposed 12 chemicals that included vertebrate obesogens (tributyltin, triphenyltin, bisphenol A, nonylphenol, di-2-ethylhexyl phthalate), other contaminants known to affect arthropods (pyriproxyfen, fenarimol, methoprene, emamectin benzoate and fluoxetine), as well as the natural hormones methyl farnesoate and 20-hydroxyecdysone. Reproductive effects were also assessed. Quantitative changes in storage lipids accumulated in lipid droplets were studied using Nile red staining, which showed a close relationship with whole organism levels of triacylglycerols. Ten compounds altered storage lipids in a concentration related manner enhancing (tributyltin, bisphenol A, methyl farnesoate, pyriproxyfen and 20-hydroxyecdysone) or decreasing (nonylphenol, fenarimol, emamectin benzoate, methoprene and fluoxetine) their levels in post-spawning females. Eight compounds that altered lipid levels also had detrimental effects on growth and/or reproduction. PMID:26747981

  10. Compounds altering fat storage in Daphnia magna.

    PubMed

    Jordão, Rita; Garreta, Elba; Campos, Bruno; Lemos, Marco F L; Soares, Amadeu M V M; Tauler, Romà; Barata, Carlos

    2016-03-01

    The analysis of lipid disruptive effects in invertebrates is limited by our poor knowledge of the lipid metabolic pathways. A recent study showed that tributyltin activated the ecdysteroid, juvenile hormone and retinoic X receptor signaling pathways, and disrupted the dynamics of neutral lipids in the crustacean Daphnia magna impairing the transfer of triacylglycerols to eggs and hence promoting their accumulation in post-spawning females. Tributyltin disruptive effects correlated with lower fitness for offspring and adults. The present study aims to addresses effects of existing compounds on storage lipids in post-spawning females and their health effects. D. magna individuals were exposed 12 chemicals that included vertebrate obesogens (tributyltin, triphenyltin, bisphenol A, nonylphenol, di-2-ethylhexyl phthalate), other contaminants known to affect arthropods (pyriproxyfen, fenarimol, methoprene, emamectin benzoate and fluoxetine), as well as the natural hormones methyl farnesoate and 20-hydroxyecdysone. Reproductive effects were also assessed. Quantitative changes in storage lipids accumulated in lipid droplets were studied using Nile red staining, which showed a close relationship with whole organism levels of triacylglycerols. Ten compounds altered storage lipids in a concentration related manner enhancing (tributyltin, bisphenol A, methyl farnesoate, pyriproxyfen and 20-hydroxyecdysone) or decreasing (nonylphenol, fenarimol, emamectin benzoate, methoprene and fluoxetine) their levels in post-spawning females. Eight compounds that altered lipid levels also had detrimental effects on growth and/or reproduction.

  11. Small scale mass culture of Daphnia magna Straus

    SciTech Connect

    Rees, J.T.; Oldfather, J.M.

    1980-02-01

    Daphnia magna Straus 1820 was raised on a defined medium in 4-liter flasks with controlled light intensity, temperature, and algal food species. Adult D. magna tolerated high levels of ammonia (up to 108 ..mu..M) at high pH (> 10), although at these levels parthenogenic reproduction may be inhibited. Scenedesmus quadricauda and Ankistrodesmus sp. were satisfactory food sources, and by utilizing Ankistrodesmus densities greater than one animal per ml were achieved. Maintaining the pH at about 7 to 8 seems to be important for successful D. magna culture.

  12. Perspective automated inkless fingerprinting imaging software for fingerprint research.

    PubMed

    Nanakorn, Somsong; Poosankam, Pongsakorn; Mongconthawornchai, Paiboon

    2008-01-01

    Fingerprint collection using ink-and-paper image is a conventional method i.e. an ink-print, transparent-adhesive tape techniques which are slower and cumbersome. This is a pilot research for software development aimed at imaging an automated, inkless fingerprint using a fingerprint sensor, a development kit of the IT WORKS Company Limited, PC camera, and printer The development of software was performed to connect with the fingerprint sensor for collection of fingerprint images and recorded into a hard disk. It was also developed to connect with the PC camera for recording a face image of persons' fingerprints or identification card images. These images had been appropriately arranged in a PDF file prior to printing. This software is able to scan ten fingerprints and store high-quality electronics fingertip images with rapid, large, and clear images without dirt of ink or carbon. This fingerprint technology is helpful in a potential application in public health and clinical medicine research.

  13. Mating type-correlated molecular markers and demonstration of heterokaryosis in the phytopathogenic fungus Thanatephorus cucumeris (Rhizoctonia solani) AG 1-IC by AFLP DNA fingerprinting analysis.

    PubMed

    Julián, M C; Acero, J; Salazar, O; Keijer, J; Rubio, V

    1999-01-01

    The destructive soil-borne plant pathogenic basidiomycetous fungus Thanatephorus cucumeris (Frank) Donk [anamorph: Rhizoctonia solani Kühn] is not a homogeneous species, but is composed of at least twelve anastomosis groups (AG), which seem to be genetically isolated. The genetics of several T. cucumeris anastomosis groups has been studied by analysis of heterokaryotic tuft formation in the area of contact between homokaryotic single-spore isolates, revealing that AG 1 is heterokaryotic and bipolar. To prove that tuft formation is due to heterokaryosis, AFLP DNA fingerprinting has been applied to a heterokaryotic T. cucumeris AG 1-IC isolate, its homokaryotic single spore-derived progeny, and newly formed heterokaryons. By means of AFLP markers, it is demonstrated that fluffy tufts formed upon pairing of homokaryons from different mating types are newly formed heterokaryons. Mating type-correlated markers have also been found, which will be useful for future studies of the genetics of this fungal species complex.

  14. Lymnaea cubensis, an experimental intermediate host for Fascioloides magna.

    PubMed

    Vignoles, Philippe; Novobilský, Adam; Höglund, Johan; Kasný, Martin; Pankrác, Jan; Dreyfuss, Gilles; Pointier, Jean-Pierre; Rondelaud, Daniel

    2014-04-01

    Single-miracidium infections of Lymnaea cubensis (Pfeiffer) from Guadeloupe with the giant liver fluke Fascioloides magna (Bassi, 1875) (Digenea) were carried out during five successive snail generations to determine if this lymnaeid might sustain complete larval development of the parasite. Controls were constituted by a French population of Galba truncatula (Miller) (a single generation) infected according to the same protocol. It was recorded that prevalence and intensity of F. magna infection in L. cubensis progressively increased from F1 to F5 generations. Cercarial shedding of F. magna was noted only within F5 generation of L. cubensis. However, most measured parameters of infection in this species were significantly lower than those noted for G. truncatula and most L. cubensis died after a single shedding wave. Despite this, L. cubensis can be added to the list of potential intermediate hosts of F. magna. PMID:24822325

  15. An Introduction to DNA Fingerprinting.

    ERIC Educational Resources Information Center

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  16. Historeceptomic Fingerprints for Drug-Like Compounds

    PubMed Central

    Shmelkov, Evgeny; Grigoryan, Arsen; Swetnam, James; Xin, Junyang; Tivon, Doreen; Shmelkov, Sergey V.; Cardozo, Timothy

    2015-01-01

    Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology). The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300,000 experimentally determined bioactivity values from the ChEMBL database and 4.2 billion molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics) scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic, in vivo picture of the mechanism of any drug's action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at drugable.org for access through a user-friendly web site. PMID:26733872

  17. Fingerprinting with Wow

    NASA Astrophysics Data System (ADS)

    Yu, Eugene; Craver, Scott

    2006-02-01

    Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

  18. Effects of acid precipitation on Daphnia magna

    SciTech Connect

    Parent, S.; Cheetham, R.D.

    1980-08-01

    Pollutants derived from fossil fuel combustion and precipitated from the atmosphere have substantially increased in the past decades. These materials, precipitated in such industrialized areas as southeastern Canada, have caused considerable alterations in aquatic ecosystems. Precipitation over most of the eastern United States is presently 10 to 500 times more acidic than is natural. Most affected aquatic ecosystems contain oligotrophic waters in regions of thin poorly buffered soils. Zooplankton are an important link in food chains of aquatic ecosystems and their disappearance or decline could drastically affect trophic relationships. Declines in zooplankton density in response to acid precipitation have been reported and short term survival of Daphnia pulex between pH 4.3 and 10.4; however, its potential for reproduction was limited to a fairly narrow range. Anderson (1944) noted the advantages of using daphnia as test organisms, and concluded that Daphnia magna was representative of other abundant zooplankton in sensitivity to toxic substances.

  19. Multixenobiotic resistance efflux activity in Daphnia magna and Lumbriculus variegatus.

    PubMed

    Vehniäinen, Eeva-Riikka; Kukkonen, Jussi V K

    2015-04-01

    Multixenobiotic resistance is a phenomenon in which ATP-binding cassette (ABC) family proteins transfer harmful compounds out of cells. Daphnia magna and Lumbriculus variegatus are model species in aquatic ecotoxicology, but the presence and activity of ABC proteins have not been well described in these species. The aim of this work was to study the presence, activity, and inhibition of ABC transport proteins in D. magna and L. variegatus. The presence of abcb1 and abcc transcripts in 8-9-day-old D. magna was investigated by qRT-PCR. The activity of MXR in D. magna and L. variegatus was explored by influx of the fluorescent ABC protein substrates rhodamine B and calcein-AM, with and without the model inhibitors verapamil (unspecific ABC inhibitor), reversin 205 (ABCB1 inhibitor) and MK571 (ABCC inhibitor). Juvenile D. magna possessed all examined abcb and abcc transcripts, but only reversin 205 inhibited MXR activity. The MXR activity in L. variegatus was inhibited by MK571, and to a lesser extent by verapamil, whereas reversin 205 seemed to stimulate the transport activity. Whereas calcein-AM worked better as an MXR substrate in D. magna, rhodamine B was a better substrate for L. variegatus MXR activity measurements. This is the first report on MXR activity in the order Lumbriculida, subclass Oligochaeta, and class Clitellata.

  20. Experimental Fascioloides magna infections of mule deer (Odocoileus hemionus hemionus).

    PubMed

    Foreyt, W J

    1992-04-01

    Six mule deer (Odocoileus hemionus hemionus) and one white-tailed deer (Odocoileus virginianus), approximately 5-mo-old, each were inoculated orally with 500 metacercariae of Fascioloides magna. All mule deer died from liver fluke infection between 69 and 134 days (mean = 114, SE = 9.9) after inoculation. Between 38 and 326 immature F. magna (mean = 102, SE = 45.5) were recovered from each deer at necropsy. Flukes were present in livers, lungs, and free in pleural and peritoneal spaces. Infection was characterized by necrotizing hepatitis, fibrosing peritonitis and pleuritis, and hematin pigment accumulation in liver, lung, and many other internal organs. Eggs of F. magna first were detected in feces of the white-tailed deer 28 wk after inoculation, and weekly thereafter until the healthy deer was euthanized at 31 wk. At necropsy, 205 F. magna, including 12 encapsulated mature and 193 nonencapsulated immature flukes were recovered from liver, lungs, and free in abdominal and thoracic spaces of the white-tailed deer. Based on these results, F. magna may be fatal to mule deer within 5 mo of infection. Like domestic sheep and goats, mule deer may be highly susceptible to infection, and it is unlikely mule deer can survive infection with large numbers of F. magna.

  1. Differential levels of stress proteins (HSPs) in male and female Daphnia magna in response to thermal stress: a consequence of sex-related behavioral differences?

    PubMed

    Mikulski, Andrzej; Bernatowicz, Piotr; Grzesiuk, Małgorzata; Kloc, Małgorzata; Pijanowska, Joanna

    2011-07-01

    In two independent experiments, we compared: (1) water depth selection (and accompanying temperature selection) by male and female Daphnia magna under different kinds of environmental stress, including the presence of filamentous cyanobacteria, the risk of predation from fish, and the presence of toxic compounds; and (2) sex-dependent production of heat shock proteins (HSP60, 70, and 90) in response to a sudden change in temperature. Male D. magna selected deep water strata, which offer a relatively stable environment, and thereby avoided the threat of predation and the presence of toxic compounds in surface waters. Correlated with this behavior, males reduce their molecular defenses against stress, such as the production of heat shock proteins (HSPs), and do not maintain the physiological machinery that triggers an increase in HSP levels in response to stress. In contrast, female D. magna actively select habitats that offer optimal conditions for growth and production of offspring. Consequently, females are exposed to variable environmental conditions that may be associated with increased stress. To permit survival in these different habitats, D. magna females require molecular mechanisms to protect their cells from rapid changes in stress levels. Thus, they maintain high constitutive levels of the heat shock proteins from HSP 60, 70, and 90 families, and they have the potential to further enhance the production of the majority of these proteins under stress conditions. The results of this study indicate that the separate habitats selected by male and female D. magna result in different patterns of HSP production, leading us to hypothesize that that male and female Daphnia magna adopt different strategies to maximize the fitness of the species.

  2. Differential levels of stress proteins (HSPs) in male and female Daphnia magna in response to thermal stress: a consequence of sex-related behavioral differences?

    PubMed

    Mikulski, Andrzej; Bernatowicz, Piotr; Grzesiuk, Małgorzata; Kloc, Małgorzata; Pijanowska, Joanna

    2011-07-01

    In two independent experiments, we compared: (1) water depth selection (and accompanying temperature selection) by male and female Daphnia magna under different kinds of environmental stress, including the presence of filamentous cyanobacteria, the risk of predation from fish, and the presence of toxic compounds; and (2) sex-dependent production of heat shock proteins (HSP60, 70, and 90) in response to a sudden change in temperature. Male D. magna selected deep water strata, which offer a relatively stable environment, and thereby avoided the threat of predation and the presence of toxic compounds in surface waters. Correlated with this behavior, males reduce their molecular defenses against stress, such as the production of heat shock proteins (HSPs), and do not maintain the physiological machinery that triggers an increase in HSP levels in response to stress. In contrast, female D. magna actively select habitats that offer optimal conditions for growth and production of offspring. Consequently, females are exposed to variable environmental conditions that may be associated with increased stress. To permit survival in these different habitats, D. magna females require molecular mechanisms to protect their cells from rapid changes in stress levels. Thus, they maintain high constitutive levels of the heat shock proteins from HSP 60, 70, and 90 families, and they have the potential to further enhance the production of the majority of these proteins under stress conditions. The results of this study indicate that the separate habitats selected by male and female D. magna result in different patterns of HSP production, leading us to hypothesize that that male and female Daphnia magna adopt different strategies to maximize the fitness of the species. PMID:21614533

  3. Vulnerabilities of fingerprint reader to fake fingerprints attacks.

    PubMed

    Espinoza, Marcela; Champod, Christophe; Margot, Pierre

    2011-01-30

    The purpose of this research is to assess the vulnerabilities of a high resolution fingerprint sensor when confronted with fake fingerprints. The study has not been focused on the decision outcome of the biometric device, but essentially on the scores obtained following the comparison between a query (genuine or fake) and a template using an AFIS system. To do this, fake fingerprints of 12 subjects have been produced with and without their cooperation. These fake fingerprints have been used alongside with real fingers. The study led to three major observations: First, genuine fingerprints produced scores higher than fake fingers (translating a closer proximity) and this tendency is observed considering each subject separately. Second, scores are however not sufficient as a single measure to differentiate these samples (fake from genuine) given the variation due to the donors themselves. That explains why fingerprint readers without vitality detection can be fooled. Third, production methods and subjects greatly influence the scores obtained for fake fingerprints. PMID:21216360

  4. De novo design of N-(pyridin-4-ylmethyl)aniline derivatives as KDR inhibitors: 3D-QSAR, molecular fragment replacement, protein-ligand interaction fingerprint, and ADMET prediction.

    PubMed

    Zhang, Yanmin; Liu, Haichun; Jiao, Yu; Yuan, Haoliang; Wang, Fengxiao; Lu, Shuai; Yao, Sihui; Ke, Zhipeng; Tai, Wenting; Jiang, Yulei; Chen, Yadong; Lu, Tao

    2012-11-01

    Vascular endothelial growth factor (VEGF) and its receptor tyrosine kinase VEGFR-2 or kinase insert domain receptor (KDR) have been identified as promising targets for novel anticancer agents. To achieve new potent inhibitors of KDR, we conducted molecular fragment replacement (MFR) studies for the understanding of 3D-QSAR modeling and the docking investigation of arylphthalazines and 2-((1H-Azol-1-yl)methyl)-N-arylbenzamides-based KDR inhibitors. Two favorable 3D-QSAR models (CoMFA with q(2), 0.671; r(2), 0.969; CoMSIA with q(2), 0.608; r(2), 0.936) have been developed to predict the biological activity of new compounds. The new molecular database generated by MFR was virtually screened using Glide (docking) and further evaluated with CoMFA prediction, protein-ligand interaction fingerprint (PLIF) and ADMET analysis. 44 N-(pyridin-4-ylmethyl)aniline derivatives as novel potential KDR inhibitors were finally obtained. In this paper, the work flow developed could be applied to de novo drug design and virtual screening potential KDR inhibitors, and use hit compounds to further optimize and design new potential KDR inhibitors.

  5. DNA-based molecular fingerprinting of eukaryotic protists and cyanobacteria contributing to sinking particle flux at the Bermuda Atlantic time-series study

    NASA Astrophysics Data System (ADS)

    Amacher, Jessica; Neuer, Susanne; Lomas, Michael

    2013-09-01

    We used denaturing gradient gel electrophoresis (DGGE) to examine the protist and cyanobacterial communities in the euphotic zone (0-120 m) and in corresponding 150 m particle interceptor traps at the Bermuda Atlantic Time-series Study (BATS) in a two-year monthly time-series from May 2008 to April 2010. Dinoflagellates were the most commonly detected taxa in both water column and trap samples throughout the time series. Diatom sequences were found only eight times in the water column, and only four times in trap material. Small-sized eukaryotic taxa, including the prasinophyte genera Ostreococcus, Micromonas, and Bathycoccus, were present in trap samples, as were the cyanobacteria Prochlorococcus and Synechococcus. Synechococcus was usually overrepresented in trap material, whereas Prochlorococcus was underrepresented compared to the water column. Both seasonal and temporal variability affected patterns of ribosomal DNA found in sediment traps. The two years of this study were quite different hydrographically, with higher storm activity and the passing of a cyclonic eddy causing unusually deep mixing in winter 2010. This was reflected in the DGGE fingerprints of the water column, which showed greater phylotype richness of eukaryotes and a lesser richness of cyanobacteria in winter of 2010 compared with the winter of 2009. Increases in eukaryotic richness could be traced to increased diversity of prasinophytes and prymnesiophytes. The decrease in cyanobacterial richness was in turn reflected in the trap composition, but the increase in eukaryotes was not, indicating a disproportionate contribution of certain taxa to sinking particle flux.

  6. 4D-fingerprints, universal QSAR and QSPR descriptors.

    PubMed

    Senese, Craig L; Duca, J; Pan, D; Hopfinger, A J; Tseng, Y J

    2004-01-01

    An elusive goal in the field of chemoinformatics and molecular modeling has been the generation of a set of descriptors that, once calculated for a molecule, may be used in a wide variety of applications. Since such universal descriptors are generated free from external constraints, they are inherently independent of the data set in which they are employed. The realization of a set of universal descriptors would significantly streamline such chemoinformatics tasks as virtual high-throughout screening (VHTS) and toxicity profiling. The current study reports the derivation and validation of a potential set of universal descriptors, referred to as the 4D-fingerprints. The 4D-fingerprints are derived from the 4D-molecular similarity analysis. To evaluate the applicability of the 4D-fingerprints as universal descriptors, they are used to generate descriptive QSAR models for 5 independent training sets. Each of the training sets has been analyzed previously by several varying QSAR methods, and the results of the models generated using the 4D-fingerprints are compared to the results of the previous QSAR analyses. It was found that the models generated using the 4D-fingerprints are comparable in quality, based on statistical measures of fit and test set prediction, to the previously reported models for the other QSAR methods. This finding is particularly significant considering the 4D-fingerprints are generated independent of external constraints such as alignment, while the QSAR methods used for comparison all require an alignment analysis.

  7. Gabor filter based fingerprint image enhancement

    NASA Astrophysics Data System (ADS)

    Wang, Jin-Xiang

    2013-03-01

    Fingerprint recognition technology has become the most reliable biometric technology due to its uniqueness and invariance, which has been most convenient and most reliable technique for personal authentication. The development of Automated Fingerprint Identification System is an urgent need for modern information security. Meanwhile, fingerprint preprocessing algorithm of fingerprint recognition technology has played an important part in Automatic Fingerprint Identification System. This article introduces the general steps in the fingerprint recognition technology, namely the image input, preprocessing, feature recognition, and fingerprint image enhancement. As the key to fingerprint identification technology, fingerprint image enhancement affects the accuracy of the system. It focuses on the characteristics of the fingerprint image, Gabor filters algorithm for fingerprint image enhancement, the theoretical basis of Gabor filters, and demonstration of the filter. The enhancement algorithm for fingerprint image is in the windows XP platform with matlab.65 as a development tool for the demonstration. The result shows that the Gabor filter is effective in fingerprint image enhancement technology.

  8. Complete Genome Sequence of Finegoldia magna, an Anaerobic Opportunistic Pathogen

    PubMed Central

    Goto, Takatsugu; Yamashita, Atsushi; Hirakawa, Hideki; Matsutani, Minenosuke; Todo, Kozo; Ohshima, Kenshiro; Toh, Hidehiro; Miyamoto, Kazuaki; Kuhara, Satoru; Hattori, Masahira; Shimizu, Tohru; Akimoto, Shigeru

    2008-01-01

    Finegoldia magna (formerly Peptostreptococcus magnus), a member of the Gram-positive anaerobic cocci (GPAC), is a commensal bacterium colonizing human skin and mucous membranes. Moreover, it is also recognized as an opportunistic pathogen responsible for various infectious diseases. Here, we report the complete genome sequence of F. magna ATCC 29328. The genome consists of a 1 797 577 bp circular chromosome and an 189 163 bp plasmid (pPEP1). The metabolic maps constructed based on the genome information confirmed that most F. magna strains cannot ferment most sugars, except fructose, and have various aminopeptidase activities. Three homologs of albumin-binding protein, a known virulence factor useful for antiphagocytosis, are encoded on the chromosome, and one albumin-binding protein homolog is encoded on the plasmid. A unique feature of the genome is that F. magna encodes many sortase genes, of which substrates may be involved in bacterial pathogenesis, such as antiphagocytosis and adherence to the host cell. The plasmid pPEP1 encodes seven sortase and seven substrate genes, whereas the chromosome encodes four sortase and 19 substrate genes. These plasmid-encoded sortases may play important roles in the pathogenesis of F. magna by enriching the variety of cell wall anchored surface proteins. PMID:18263572

  9. Sucralose induces biochemical responses in Daphnia magna.

    PubMed

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena

    2014-01-01

    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001-5 mg L(-1)). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology. PMID:24699280

  10. Sucralose Induces Biochemical Responses in Daphnia magna

    PubMed Central

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena

    2014-01-01

    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001–5 mg L−1). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology. PMID:24699280

  11. Fingerprinting of Materials

    NASA Technical Reports Server (NTRS)

    Workman, Gary L

    1992-01-01

    Recent issues emerging in our fiscal and ecological environments have promulgated that federal agencies shall promote activities which respond to the improvement of both. In response to these developments, the National Aeronautics and Space Administration (NASA) has undertaken an innovative approach to improve the control of materials used in all NASA manufacturing activities. In concert with this goal, NASA is requiring that its contractors and their sub-contractors perform a more intensive consolidation of technologies that can provide an accounting of materials, which includes in-coming materials, materials in process, end-products and waste materials. The purpose of this handbook is to provide guidelines to NASA and its contractor personnel for the planning and implementation of chemical fingerprinting programs and to illustrate the chemical and statistical fundamentals needed for successful use of chemical fingerprinting.

  12. Fingerprints in the Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1

    This graph, or spectrum, shows the light from a dusty, distant galaxy located 11 billion light-years away. The galaxy is invisible to optical telescopes, but NASA's Spitzer Space Telescope was able to capture the light from it and dozens of other similar galaxies using heat-seeking infrared eyes.

    Spectra are created when an instrument called a spectrograph spreads light out into its basic parts, like a prism turning sunlight into a rainbow. They contain the signatures, or 'fingerprints,' of molecules that contribute to an object's light.

    In this case, the galaxy's spectrum reveals the fingerprint for silicate dust (large dip at right), a planetary building block like sand, only smaller. This particular fingerprint is important because it helped astronomers determine how far away the galaxy lies, or more specifically, how much the galaxy's light had stretched, or 'redshifted,' during its journey to Spitzer's eyes. Because the universe is expanding, a galaxy's light will shift toward reddish wavelengths as it moves away from us. This galaxy was found to have a redshift of 1.95, which means that its light took about 11 billion years to get here.

    The presence of the silicate fingerprint is also significant because it implies that galaxies were ripe for planetary formation 11 billion years ago - back to a time when the universe was 3 billion years old. The universe is currently believed to be 13.5 billion years old. This is the furthest back in time that silicate dust has been detected around a galaxy.

    These data were taken by Spitzer's infrared spectrograph in July, 2004.

  13. Self Organizing Map-Based Classification of Cathepsin k and S Inhibitors with Different Selectivity Profiles Using Different Structural Molecular Fingerprints: Design and Application for Discovery of Novel Hits.

    PubMed

    Ihmaid, Saleh K; Ahmed, Hany E A; Zayed, Mohamed F; Abadleh, Mohammed M

    2016-01-30

    The main step in a successful drug discovery pipeline is the identification of small potent compounds that selectively bind to the target of interest with high affinity. However, there is still a shortage of efficient and accurate computational methods with powerful capability to study and hence predict compound selectivity properties. In this work, we propose an affordable machine learning method to perform compound selectivity classification and prediction. For this purpose, we have collected compounds with reported activity and built a selectivity database formed of 153 cathepsin K and S inhibitors that are considered of medicinal interest. This database has three compound sets, two K/S and S/K selective ones and one non-selective KS one. We have subjected this database to the selectivity classification tool 'Emergent Self-Organizing Maps' for exploring its capability to differentiate selective cathepsin inhibitors for one target over the other. The method exhibited good clustering performance for selective ligands with high accuracy (up to 100 %). Among the possibilites, BAPs and MACCS molecular structural fingerprints were used for such a classification. The results exhibited the ability of the method for structure-selectivity relationship interpretation and selectivity markers were identified for the design of further novel inhibitors with high activity and target selectivity.

  14. Fingerprint + Iris = IrisPrint

    NASA Astrophysics Data System (ADS)

    Othman, Asem; Ross, Arun

    2015-05-01

    We consider the problem of generating a biometric image from two different traits. Specifically, we focus on generating an IrisPrint that inherits its structure from a fingerprint image and an iris image. To facilitate this, the continuous phase of the fingerprint image, characterizing its ridge flow, is first extracted. Next, a scheme is developed to extract "minutiae" from an iris image. Finally, an IrisPrint, that resembles a fingerprint, is created by mixing the ridge flow of the fingerprint with the iris minutiae. Preliminary experiments suggest that the new biometric image (i.e., IrisPrint) (a) can potentially be used for authentication by an existing fingerprint matcher, and (b) can potentially conceal and preserve the privacy of the original fingerprint and iris images.

  15. Fossa navicularis magna detection on cone-beam computed tomography

    PubMed Central

    Mupparapu, Mel

    2016-01-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed. PMID:27051639

  16. Fossa navicularis magna detection on cone-beam computed tomography.

    PubMed

    Syed, Ali Z; Mupparapu, Mel

    2016-03-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed.

  17. SMALL SCALE MASS CULTURE OF DAPHNIA MAGNA STRAUS

    SciTech Connect

    Rees, John T.; Oldfather, Joan M.

    1980-03-01

    Daphnia magna Straus 1820 was reared on a defined medium in 4-liter flasks under controlled conditions of light, temperature and species of algal food. Adult D. magna were found to be tolerant to high levels of ammonia, up to 108 {micro}M, at high pH (>10), although parthenogenic reproduction may be inhibited at these high levels. Scenedesmus quadricauda and Ankistrodesmus sp. were found to be satisfactory food sources. Densities of greater than one animal per ml in culture were attained utilizing Ankistrodesmus sp. as a food source at a pH of 7.7. Maintenance of pH at around 7-8 appears to be important to successful D. magna culture.

  18. Chronic toxicity of 14 phthalate esters to Daphnia magna and rainbow trout (Oncorhynchus mykiss)

    SciTech Connect

    Rhodes, J.E.; Adams, W.J.; Biddinger, G.R.; Robillard, K.A.; Gorsuch, J.W.

    1995-11-01

    Chronic toxicity studies were performed with commercial phthalate esters and Daphnia magna (14 phthalates) and rainbow trout (Oncorhynchus mykiss) (six phthalates). For the lower-molecular-weight phthalate esters--dimethyl phthalate (DMP), diethyl phthalate (DEP), di-n-butyl phthalate (DBP), and butylbenzyl phthalate (BBP)--the results of the studies indicated a general trend in which toxicity for both species increased as water solubility decreased. The geometric mean maximum acceptable toxicant concentration(GM-MATC) for D. magna ranged from 0.63 to 34.8 mg/L. For the higher-molecular-weight phthalate esters--dihexyl phthalate (DHP), butyl 2-ethylhexyl phthalate (BOP), di-(n-hexyl, n-octyl, n-decyl) phthalate (610P), di-(2-ethylhexyl) phthalate (DEHP), diisooctyl phthalate (DIOP), diisononyl phthalate (DINP), di-(heptyl, nonyl, undecyl) phthalate (711P), diisodecyl phthalate (DIDP), diundecyl phthalate (DUP), and ditridecyl phthalate (DTDP)--the GM-MATC values ranged from 0.042 to 0.15 mg/L. Survival was equally sensitive and sometimes more sensitive than reproduction. The observed toxicity to daphnids with most of the higher-molecular-weight phthalate esters appeared to be due to surface entrapment or a mode of toxicity that is not due to exposure to dissolved aqueous-phase chemical. Early life-stage toxicity studies with rainbow trout indicated that survival (DMP) and growth (DBP) were affected at 24 and 0.19 mg/L, respectively. This pattern of observed toxicity with the lower-molecular-weight phthalate esters and not the higher-molecular-weight phthalate esters is consistent with previously reported acute toxicity studies for several aquatic species.

  19. Fingerprinting of Materials: Technical Supplement

    NASA Technical Reports Server (NTRS)

    Workman, Gary L.

    1992-01-01

    This supplement to the Guidelines for Maintaining a Chemical Fingerprinting Program has been developed to assist NASA personnel, contractors, and sub-contractors in defining the technical aspects and basic concepts which can be used in chemical fingerprinting programs. This material is not meant to be totally inclusive to all chemical fingerprinting programs, but merely to present current concepts. Each program will be tailored to meet the needs of the individual organizations using chemical fingerprinting to improve their quality and reliability in the production of aerospace systems.

  20. Petroleum fingerprinting with organic markers

    USGS Publications Warehouse

    Hostettler, Frances D.; Lorenson, T.D.; Bekins, Barbara A.

    2013-01-01

    Petroleum fingerprinting is an invaluable tool in forensic geochemistry. This article summarizes applications of fingerprinting in several oil spills and natural oil seepages that we have studied during the last 25 years. It shows how each unique chemical fingerprint can be used to correlate or differentiate oils. Fingerprints can provide information about processes in the environment that impact oils such as weathering and microbial degradation. They can be used to evaluate organic matter that contributed to oils, and classify oils with regard to the geological framework of their source, such as evaluating geological facies, age, lithology, and depositional environment.

  1. Importance of metallothioneins in the cadmium detoxification process in Daphnia magna.

    PubMed

    Fraysse, B; Geffard, O; Berthet, B; Quéau, H; Biagianti-Risbourg, S; Geffard, A

    2006-11-01

    Good knowledge of the relationship between toxic metals and biological systems, particularly the sub-cellular fraction, could be a suitable early indicator of toxic effects. These effects and the sub-cellular behaviour of cadmium were studied with a widely used species in freshwater toxicity bioassays, Daphnia magna. In spite of this very commonplace usage in ecotoxicological studies, very few data are available on its toxicant metabolism and in particular metal homeostasis. Combining multi-tools analysis, a soluble protein was found: it is heat-stable, rich in sulfhydryl groups (differential pulse polarography), characterised by a molecular mass of approximately 6.5 kDa, with a G-75 chromatographic profile corresponding to the rabbit metallothioneins monomer, with few if any aromatic-containing amino acids, it binds metals (e.g. Cd, Cu), and its concentration increases with Cd exposure. This evidence led us to hypothesise that metallothioneins (MTs) are present in D. magna. Up to 75% of the Cd body burden with Cd exposure is bound to the MTs fraction. The increase in the Cd concentration in the surrounding medium and concomitantly in daphnids induces sub-cellular reorganisation of essential metals such as Cu and Zn. The rate of metals in the soluble cellular fraction and associated with MTs increases with the Cd body burden. Monitoring sub-cellular distribution of metals after exposure in the natural environment could be very useful for ecotoxicological assessment. PMID:17113354

  2. Vibrational fingerprints of the Mn4CaO5 cluster in Photosystem II by mixed quantum-classical molecular dynamics.

    PubMed

    Bovi, Daniele; Capone, Matteo; Narzi, Daniele; Guidoni, Leonardo

    2016-10-01

    A detailed knowledge of the structures of the catalytic steps along the Kok-Joliot cycle of Photosystem II may help to understand the strategies adopted by this unique enzyme to achieve water oxidation. Vibrational spectroscopy has probed in the last decades the intermediate states of the catalytic cycle, although the interpretation of the data turned out to be often problematic. In the present work we use QM/MM molecular dynamics on the S2 state to obtain the vibrational density of states at room temperature. To help the interpretation of the computational and experimental data we propose a decomposition of the Mn4CaO5 moiety into five separate parts, composed by "diamond" motifs involving four atoms. The spectral signatures arising from this analysis can be easily interpreted to assign experimentally known bands to specific molecular motions. In particular, we focused in the low frequency region of the vibrational spectrum of the S2 state. We can therefore identify the observed bands around 600-620cm(-1) as characteristic for the stretching vibrations involving Mn1-O1-Mn2 or Mn3-O5 moieties. PMID:27444240

  3. Acute toxicity of benzophenone-type UV filters for Photobacterium phosphoreum and Daphnia magna: QSAR analysis, interspecies relationship and integrated assessment.

    PubMed

    Liu, Hui; Sun, Ping; Liu, Hongxia; Yang, Shaogui; Wang, Liansheng; Wang, Zunyao

    2015-09-01

    The hazardous potential of benzophenone (BP)-type UV filters is becoming an issue of great concern due to the wide application of these compounds in many personal care products. In the present study, the toxicities of BPs to Photobacterium phosphoreum and Daphnia magna were determined. Next, density functional theory (DFT) and comparative molecular field analysis (CoMFA) descriptors were used to obtain more detailed insight into the structure - activity relationships and to preliminarily discuss the toxicity mechanism. Additionally, the sensitivities of the two organisms to BPs and the interspecies toxicity relationship were compared. Moreover, an approach for providing a global index of the environmental risk of BPs to aquatic organisms is proposed. The results demonstrated that the mechanism underlying the toxicity of BPs to P. phosphoreum is primarily related to their electronic properties, and the mechanism of toxicity to D. magna is hydrophobicity. Additionally, D. magna was more sensitive than P. phosphoreum to most of the BPs, with the exceptions of the polyhydric BPs. Moreover, comparisons with published data revealed a high interspecies correlation coefficient among the experimental toxicity values for D. magna and Dugesia japonica. Furthermore, hydrophobicity was also found to be the most important descriptor of integrated toxicity. This investigation will provide insight into the toxicity mechanisms and useful information for assessing the potential ecological risk of BP-type UV filters.

  4. The heart of Daphnia magna: effects of four cardioactive drugs.

    PubMed

    Villegas-Navarro, Arturo; Rosas-L, Esperanza; Reyes, José L

    2003-10-01

    We used Daphnia magna bioassays to determine the LC(50) and the effects on the heart of the cardioactive drugs ouabain, verapamil, metaproterenol and metoprolol. Distinctions were made between the pharmacological and toxicological effects of these drugs and the adequacy of physicochemical characteristics of its habitat (reconstituted water). Video microscopy and digital image processing were used to study the pharmacological effects on the heart. D. magna exhibited the expected sensitivity to the reference toxicant sodium dodecyl sulfate with a LC(50) of 15.6+/-4.5 mg/l. All drugs were toxic with 48 h-LC(50) of 2.03 mg/l ouabain, 7.04 mg/l verapamil, 32.45 mg/l metaproterenol and 76.21 mg/l metoprolol. Ouabain was the most toxic and caused a positive concentration-dependent inotropic effect. Verapamil caused positive chronotropic and inotropic effects, while metaproterenol showed positive concentration-dependent chronotropic effects at high concentrations (10(-3) and 10(-4) M). Metoprolol induced a positive chronotropic effect at low concentrations (10(-8), 10(-7), 10(-6) M) and a negative chronotropic effect at high concentration (10(-4) M). Ouabain, metaproterenol and metoprolol in D. magna caused similar effects to those produced in mammals. In contrast, verapamil caused opposite effects. The results suggest the presence of Na(+), K(+)-ATPase receptors to verapamil and of non-specific adrenergic receptors in heart of D. magna.

  5. Magna Carta: Teaching Medieval Topics for Historical Significance

    ERIC Educational Resources Information Center

    Metzger, Scott Alan

    2010-01-01

    The Middle Ages are an immensely important era in the Western experience. Unfortunately, medieval studies are often marginalized or trivialized in school curriculum. With the approach of the 800th anniversary of Magna Carta, the famous charter of rights from medieval England, one has a timely and useful example for considering what a focus on…

  6. Magna Carta at 800: Ten Key Questions Answered

    ERIC Educational Resources Information Center

    Kaplan, Howard

    2014-01-01

    2015 marks the 800th anniversary of Magna Carta. For Americans, this iconic document is a formative element of our own legal and political heritage. This "Lessons on the Law" column offers an overview of the "Great Charter," why it is significant, and what students and teachers should know about it. The article also highlights…

  7. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    PubMed

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  8. Evaluation of Fingerprint Images Captured by Optical Fingerprint Scanner

    NASA Astrophysics Data System (ADS)

    Takeuchi, Hideyo; Matsumoto, Noriyuki; Kuwayama, Kiyoaki; Umezaki, Taizo

    In this paper, we propose the way to evaluate fingerprint image-quality and how to discriminate remnants from captured images. First, we investigate evaluating fingerprint image-quality. Fingerprint image-quality can be digitized using the "measure" we proposed. We simulate using the dataset consists of 1425 fingerprint images captured from 57 people in Feb, which contains a lot of faded images. In the simulation using all our database, recognition rate is 95.6% while type II error is 0.01%. Recognition rate is improved to 98.1%, with rejecting 3.7% faded images evaluated by our measure from the database. Recognition rate is improved to 99.6%, rejecting 14.2% faded images. And we investigate the way to apply the measure of image-quality to fingerprint verification device with customer’s satisfaction in real world. Next we propose the way to discriminate between remnants and fingerprint images captured from optical scanner by using frequency analysis. We can perfectly prevent the fingerprint verification device from malfunctioning caused by remnant, when strong flashlight or direct sunlight slant in optical scanner in real world.

  9. Fascioloides magna--epizootiology in a deer farm in Germany.

    PubMed

    Plötz, Cornelia; Rehbein, Steffen; Bamler, Helmut; Reindl, Hubert; Pfister, Kurt; Scheuerle, Miriam C

    2015-01-01

    After initial observations of suspicious cases in 2009, the occurrence of Fascioloides (F.) magna in deer of a deer farm located in northeastern Bavaria, Germany, at the border to the Czech Republic was confirmed in autumn 2011. In March 2012, the deer were treated for fascioloidosis with triclabendazole. To monitor the epizootiology of fascioloidosis in the farm, 80-100 faecal samples were examined for Fascioloides eggs at monthly intervals from June 2012 to June 2013 inclusive. In addition, livers of 27 red deer and one sika deer collected during winter 2012/2013 were examined for gross lesions suspicious for F. magna infection and 21 of the 28 livers were dissected for F. magna recovery. Fascioloides eggs were recorded in 63 (4.9%) of 1280 faecal samples (range 0.4 to 355 eggs per gram). Both, number of Fascioloides-egg positive samples and egg counts were low during the first eight months of the study but increased notably since February 2013. While Fascioloides egg-positive faecal samples were obtained from red deer (46/948,4.9%) and fallow deer (17/166, 10.2%), no Fascioloides eggs were demonstrated in the 166 samples obtained from sika deer. Livers of five red deer and the sika deer showed gross lesions characteristic for fascioloidosis, and F. magna were recovered from three of the five affected red deer livers (range, five to seven flukes). Results of this study confirm that F. magna is endemic in the deer farm, and measures should be implemented to minimize the transmission of the parasite.

  10. Fascioloides magna--epizootiology in a deer farm in Germany.

    PubMed

    Plötz, Cornelia; Rehbein, Steffen; Bamler, Helmut; Reindl, Hubert; Pfister, Kurt; Scheuerle, Miriam C

    2015-01-01

    After initial observations of suspicious cases in 2009, the occurrence of Fascioloides (F.) magna in deer of a deer farm located in northeastern Bavaria, Germany, at the border to the Czech Republic was confirmed in autumn 2011. In March 2012, the deer were treated for fascioloidosis with triclabendazole. To monitor the epizootiology of fascioloidosis in the farm, 80-100 faecal samples were examined for Fascioloides eggs at monthly intervals from June 2012 to June 2013 inclusive. In addition, livers of 27 red deer and one sika deer collected during winter 2012/2013 were examined for gross lesions suspicious for F. magna infection and 21 of the 28 livers were dissected for F. magna recovery. Fascioloides eggs were recorded in 63 (4.9%) of 1280 faecal samples (range 0.4 to 355 eggs per gram). Both, number of Fascioloides-egg positive samples and egg counts were low during the first eight months of the study but increased notably since February 2013. While Fascioloides egg-positive faecal samples were obtained from red deer (46/948,4.9%) and fallow deer (17/166, 10.2%), no Fascioloides eggs were demonstrated in the 166 samples obtained from sika deer. Livers of five red deer and the sika deer showed gross lesions characteristic for fascioloidosis, and F. magna were recovered from three of the five affected red deer livers (range, five to seven flukes). Results of this study confirm that F. magna is endemic in the deer farm, and measures should be implemented to minimize the transmission of the parasite. PMID:26054221

  11. Molecular Fingerprinting by PCR-Denaturing Gradient Gel Electrophoresis Reveals Differences in the Levels of Microbial Diversity for Musty-Earthy Tainted Corks ▿

    PubMed Central

    Prat, Chantal; Ruiz-Rueda, Olaya; Trias, Rosalia; Anticó, Enriqueta; Capone, Dimitra; Sefton, Mark; Bañeras, Lluís

    2009-01-01

    The microbial community structure of cork with marked musty-earthy aromas was analyzed using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Cork stoppers and discs were used for DNA extraction and were analyzed by using selective primers for bacteria and fungi. Stoppers clearly differed from discs harboring a different fungal community. Moreover, musty-earthy samples of both types were shown to have a specific microbiota. The fungi Penicillium glabrum and Neurospora spp. were present in all samples and were assumed to make only a small contribution to off-odor development. In contrast, Penicillium islandicum and Penicillium variabile were found almost exclusively in 2,4,6-trichloroanisole (TCA) tainted discs. Conversely, Rhodotorula minuta and Rhodotorula sloofiae were most common in cork stoppers, where only small amounts of TCA were detected. Alpha- and gammaproteobacteria were the most commonly found bacteria in either control or tainted cork stoppers. Specific Pseudomonas and Actinobacteria were detected in stoppers with low amounts of TCA and 2-methoxy-3,5-dimethylpyrazine. These results are discussed in terms of biological degradation of taint compounds by specific microorganisms. Reliable and straightforward microbial identification methods based on a molecular approach provided useful data to determine and evaluate the risk of taint formation in cork. PMID:19201983

  12. Video-based fingerprint verification.

    PubMed

    Qin, Wei; Yin, Yilong; Liu, Lili

    2013-09-04

    Conventional fingerprint verification systems use only static information. In this paper, fingerprint videos, which contain dynamic information, are utilized for verification. Fingerprint videos are acquired by the same capture device that acquires conventional fingerprint images, and the user experience of providing a fingerprint video is the same as that of providing a single impression. After preprocessing and aligning processes, "inside similarity" and "outside similarity" are defined and calculated to take advantage of both dynamic and static information contained in fingerprint videos. Match scores between two matching fingerprint videos are then calculated by combining the two kinds of similarity. Experimental results show that the proposed video-based method leads to a relative reduction of 60 percent in the equal error rate (EER) in comparison to the conventional single impression-based method. We also analyze the time complexity of our method when different combinations of strategies are used. Our method still outperforms the conventional method, even if both methods have the same time complexity. Finally, experimental results demonstrate that the proposed video-based method can lead to better accuracy than the multiple impressions fusion method, and the proposed method has a much lower false acceptance rate (FAR) when the false rejection rate (FRR) is quite low.

  13. Video-Based Fingerprint Verification

    PubMed Central

    Qin, Wei; Yin, Yilong; Liu, Lili

    2013-01-01

    Conventional fingerprint verification systems use only static information. In this paper, fingerprint videos, which contain dynamic information, are utilized for verification. Fingerprint videos are acquired by the same capture device that acquires conventional fingerprint images, and the user experience of providing a fingerprint video is the same as that of providing a single impression. After preprocessing and aligning processes, “inside similarity” and “outside similarity” are defined and calculated to take advantage of both dynamic and static information contained in fingerprint videos. Match scores between two matching fingerprint videos are then calculated by combining the two kinds of similarity. Experimental results show that the proposed video-based method leads to a relative reduction of 60 percent in the equal error rate (EER) in comparison to the conventional single impression-based method. We also analyze the time complexity of our method when different combinations of strategies are used. Our method still outperforms the conventional method, even if both methods have the same time complexity. Finally, experimental results demonstrate that the proposed video-based method can lead to better accuracy than the multiple impressions fusion method, and the proposed method has a much lower false acceptance rate (FAR) when the false rejection rate (FRR) is quite low. PMID:24008283

  14. Influence of skin diseases on fingerprint recognition.

    PubMed

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  15. Influence of Skin Diseases on Fingerprint Recognition

    PubMed Central

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  16. Influence of skin diseases on fingerprint recognition.

    PubMed

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described.

  17. Frequency-Based Fingerprint Recognition

    NASA Astrophysics Data System (ADS)

    Aguilar, Gualberto; Sánchez, Gabriel; Toscano, Karina; Pérez, Héctor

    abstract Fingerprint recognition is one of the most popular methods used for identification with greater success degree. Fingerprint has unique characteristics called minutiae, which are points where a curve track ends, intersects, or branches off. In this chapter a fingerprint recognition method is proposed in which a combination of Fast Fourier Transform (FFT) and Gabor filters is used for image enhancement. A novel recognition stage using local features for recognition is also proposed. Also a verification stage is introduced to be used when the system output has more than one person.

  18. DNA fingerprinting of medically important microorganisms by use of PCR.

    PubMed Central

    van Belkum, A

    1994-01-01

    Selected segments of any DNA molecule can be amplified exponentially by PCR. This technique provides a powerful tool to detect and identify minimal numbers of microorganisms. PCR is applicable both in diagnosis and in epidemiology. By amplification of hypervariable DNA domains, differences can be detected even among closely related strains. PCR fingerprinting is a valuable tool for medical microbiologists, epidemiologists, and microbial taxonomists. The current state of PCR-mediated genotyping is reviewed, and a comparison with conventional molecular typing methods is included. Because of its speed and versatility, PCR fingerprinting will play an important role in microbial genetics, epidemiology, and systematics. Images PMID:8055466

  19. Fingerprinting dark energy

    SciTech Connect

    Sapone, Domenico; Kunz, Martin

    2009-10-15

    Dark energy perturbations are normally either neglected or else included in a purely numerical way, obscuring their dependence on underlying parameters like the equation of state or the sound speed. However, while many different explanations for the dark energy can have the same equation of state, they usually differ in their perturbations so that these provide a fingerprint for distinguishing between different models with the same equation of state. In this paper we derive simple yet accurate approximations that are able to characterize a specific class of models (encompassing most scalar-field models) which is often generically called 'dark energy'. We then use the approximate solutions to look at the impact of the dark energy perturbations on the dark matter power spectrum and on the integrated Sachs-Wolfe effect in the cosmic microwave background radiation.

  20. Accumulation of dieldrin in an alga (Scenedesmus obliquus), Daphnia magna, and the guppy (Poecilia reticulata)

    USGS Publications Warehouse

    Reinert, Robert E.

    1972-01-01

    Scenedesmus obliquus, Daphnia magna, and Poecilia reticulata accumulated dieldrin directly from water; average concentration factors (concentration in organism, dry weight, divided by concentration in water) were 1282 for the alga, 13,954 for D. magna, and 49,307 (estimated) for the guppy. The amount accumulated by each species at equilibrium (after about 1.5, 3-4, and 18 days, respectively) was directly proportional to the concentration of dieldrin in the water. Daphnia magna and guppies accumulated more dieldrin from water than from food that had been exposed to similar concentrations in water. When guppies were fed equal daily rations of D. magna containing different concentrations of insecticide, the amounts of dieldrin accumulated by the fish were directly proportional to the concentration in D. magna; when two lots of guppies were fed different quantities of D. magna (10 and 20 organisms per day) containing identical concentrations of dieldrin, however, the amounts accumulated did not differ substantially.

  1. Interclonal proteomic responses to predator exposure in Daphnia magna may depend on predator composition of habitats.

    PubMed

    Otte, Kathrin A; Schrank, Isabella; Fröhlich, Thomas; Arnold, Georg J; Laforsch, Christian

    2015-08-01

    Phenotypic plasticity, the ability of one genotype to express different phenotypes in response to changing environmental conditions, is one of the most common phenomena characterizing the living world and is not only relevant for the ecology but also for the evolution of species. Daphnia, the water flea, is a textbook example for predator-induced phenotypic plastic defences; however, the analysis of molecular mechanisms underlying these inducible defences is still in its early stages. We exposed Daphnia magna to chemical cues of the predator Triops cancriformis to identify key processes underlying plastic defensive trait formation. To get a more comprehensive idea of this phenomenon, we studied four genotypes with five biological replicates each, originating from habitats characterized by different predator composition, ranging from predator-free habitats to habitats containing T. cancriformis. We analysed the morphologies as well as proteomes of predator-exposed and control animals. Three genotypes showed morphological changes when the predator was present. Using a high-throughput proteomics approach, we found 294 proteins which were significantly altered in their abundance after predator exposure in a general or genotype-dependent manner. Proteins connected to genotype-dependent responses were related to the cuticle, protein synthesis and calcium binding, whereas the yolk protein vitellogenin increased in abundance in all genotypes, indicating their involvement in a more general response. Furthermore, genotype-dependent responses at the proteome level were most distinct for the only genotype that shares its habitat with Triops. Altogether, our study provides new insights concerning genotype-dependent and general molecular processes involved in predator-induced phenotypic plasticity in D. magna.

  2. A multi-fingerprint browser for the ZINC database.

    PubMed

    Awale, Mahendra; Reymond, Jean-Louis

    2014-07-01

    To confirm the activity of an initial small molecule 'hit compound' from an activity screening, one needs to probe the structure-activity relationships by testing close analogs. The multi-fingerprint browser presented here (http://dcb-reymond23.unibe.ch:8080/MCSS/) enables one to rapidly identify such close analogs among commercially available compounds in the ZINC database (>13 million molecules). The browser retrieves nearest neighbors of any query molecule in multi-dimensional chemical spaces defined by four different fingerprints, each of which represents relevant structural and pharmacophoric features in a different way: sFP (substructure fingerprint), ECFP4 (extended connectivity fingerprint), MQNs (molecular quantum numbers) and SMIfp (SMILES fingerprint). Distances are calculated using the city-block distance, a similarity measure that performs as well as Tanimoto similarity but is much faster to compute. The list of up to 1000 nearest neighbors of any query molecule is retrieved by the browser and can be then clustered using the K-means clustering algorithm to produce a focused list of analogs with likely similar bioactivity to be considered for experimental evaluation.

  3. A multi-fingerprint browser for the ZINC database

    PubMed Central

    Awale, Mahendra; Reymond, Jean-Louis

    2014-01-01

    To confirm the activity of an initial small molecule ‘hit compound’ from an activity screening, one needs to probe the structure–activity relationships by testing close analogs. The multi-fingerprint browser presented here (http://dcb-reymond23.unibe.ch:8080/MCSS/) enables one to rapidly identify such close analogs among commercially available compounds in the ZINC database (>13 million molecules). The browser retrieves nearest neighbors of any query molecule in multi-dimensional chemical spaces defined by four different fingerprints, each of which represents relevant structural and pharmacophoric features in a different way: sFP (substructure fingerprint), ECFP4 (extended connectivity fingerprint), MQNs (molecular quantum numbers) and SMIfp (SMILES fingerprint). Distances are calculated using the city-block distance, a similarity measure that performs as well as Tanimoto similarity but is much faster to compute. The list of up to 1000 nearest neighbors of any query molecule is retrieved by the browser and can be then clustered using the K-means clustering algorithm to produce a focused list of analogs with likely similar bioactivity to be considered for experimental evaluation. PMID:24782520

  4. Recurrent abscesses due to Finegoldia magna, Dermabacter hominis and Staphylococcus aureus in an immunocompetent patient.

    PubMed

    Martin, J; Bemer, P; Touchais, S; Asseray, N; Corvec, S

    2009-10-01

    A case of recurrent abscesses in an immunocompetent patient is reported, involving the opportunistic human pathogen Dermabacter hominis, the virulent anaerobic pathogen Finegoldia magna and Staphylococcus aureus.

  5. Effect of Fascioloides magna (Digenea) on fecundity, shell height, and survival rate of Pseudosuccinea columella (Lymnaeidae).

    PubMed

    Pankrác, Jan; Novobilský, Adam; Rondelaud, Daniel; Leontovyč, Roman; Syrovátka, Vít; Rajský, Dušan; Horák, Petr; Kašný, Martin

    2016-08-01

    Infection with Fascioloides magna (Digenea) causes serious damage to liver tissue in definitive hosts represented by ruminants, especially cervids. The distribution of F. magna includes the indigenous areas in North America, and the areas to which F. magna was introduced-Central Europe, Southeast Europe, and Italy. The North American intermediate host of F. magna, the freshwater snail Pseudosuccinea columella (Lymnaeidae), is an invasive species recorded in South America, the Caribbean, Africa, Australia, and west and Southeast Europe. In Europe, Galba truncatula is the snail serving for transmission, but P. columella has potential to become here a new intermediate host of F. magna. Little is known about interactions between F. magna and P. columella. In this study, the susceptibility of P. columella (Oregon, USA) to the infection by a single miracidium of the Czech strain of F. magna and the influence of F. magna on snail fecundity, shell height, and survival were evaluated. The data show that the Oregon strain of P. columella is a highly suitable host for the Czech strain of F. magna, with the infection rate of 74 %. In addition, a negative effect on survival rate of infected snails was recorded only in the late phase of infection. The infection was accompanied by a major reduction in egg mass production and by a decrease in the number of eggs per egg mass. The shell height of infected snails did not significantly differ from that in unexposed controls. PMID:27098161

  6. Chronic toxicity of biphenyl to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Bartlett, E.A.; Murphy, P.G.; Milazzo, D.P. )

    1989-09-01

    The US Environmental Protection Agency (EPA) issued a final test rule (1985) for biphenyl on the authority of Section 4(a) of the Toxic Substances Control Act (TSCA). Contained within this rule was the requirement for generating chronic daphnid toxicity data for biphenyl. Biphenyl is used primarily to produce dye carriers, heat-transfer fluids and alkylated biphenyls. The acute toxicity of biphenyl to Daphnia magna has been reported. The 48-hr LC50 values were 4.7 and 2.1 mg/L, respectively. To date, the chronic toxicity of biphenyl to fish and aquatic invertebrates has not been investigated. The objective of this study was to determine the chronic toxicity of biphenyl to D. magna. The daphnid chronic toxicity test is designed to estimate the maximum acceptable toxicant concentration (MATC). The MATC is defined as the concentration falling between the highest concentration showing no effect and the next higher concentration showing a toxic effect when compared to the controls.

  7. Multigenerational cadmium acclimation and biokinetics in Daphnia magna.

    PubMed

    Guan, Rui; Wang, Wen-Xiong

    2006-05-01

    A Cd exposure (3 microg L(-1)) experiment was conducted for six successive generations to investigate the responses to chronic Cd stress in Daphnia magna. We observed a biphasic accumulation of Cd in the six generations and suggested a similar pattern with respect to daphnids' tolerance. Cd assimilation efficiencies, daphnid growth, and reproduction corresponded to the changes of tolerance, which was partially accounted for by metallothionein induction. When maternally exposed neonates grew in Cd-free water for one or two generations, their growth, MT concentration and biokinetic parameters partially or totally recovered. The rapid recovery suggests the high potential for ecological restoration from Cd pollution. Our results indicate that the tolerance of sensitive D. magna clones to Cd was dependent on long-term or multigenerational exposure. The tolerance developed within the first several generations might not be maintained, and the animals may become even more sensitive to Cd stress in subsequent generations.

  8. Bit silencing in fingerprints enables the derivation of compound class-directed similarity metrics.

    PubMed

    Wang, Yuan; Bajorath, Jürgen

    2008-09-01

    Fingerprints are molecular bit string representations and are among the most popular descriptors for similarity searching. In key-type fingerprints, each bit position monitors the presence or absence of a prespecified chemical or structural feature. In contrast to hashed fingerprints, this keyed design makes it possible to evaluate individual bit positions and the associated structural features during similarity searching. Bit silencing is introduced as a systematic approach to assess the contribution of each bit in a fingerprint to similarity search performance. From the resulting bit contribution profile, a bit position-dependent weight vector is derived that determines the relative weight of each bit on the basis of its individual contribution. By merging this weight vector with the Tanimoto coefficient, compound class-directed similarity metrics are obtained that further increase fingerprint search calculations compared to conventional calculations of Tanimoto similarity.

  9. Acute toxicity and QSAR of chlorophenols on Daphnia magna

    SciTech Connect

    Devillers, J.; Chambon, P.

    1986-10-01

    Chlorophenols which are released into natural waters from various industrial processes and from agricultural uses have been recognized as a group of chemical substances potentially hazardous to the aquatic environment. Therefore it is important to estimate their toxic impact on biota. Thus, the scope of this research was to obtain acute toxicity data for seventeen chlorophenols towards Daphnia magna and to explore the possibilities of deriving QSAR's (quantitative structure-activity relationship) from the above values.

  10. CRISPR/Cas-mediated targeted mutagenesis in Daphnia magna.

    PubMed

    Nakanishi, Takashi; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2014-01-01

    The water flea Daphnia magna has been used as an animal model in ecology, evolution, and environmental sciences. Thanks to the recent progress in Daphnia genomics, genetic information such as the draft genome sequence and expressed sequence tags (ESTs) is now available. To investigate the relationship between phenotypes and the available genetic information about Daphnia, some gene manipulation methods have been developed. However, a technique to induce targeted mutagenesis into Daphnia genome remains elusive. To overcome this problem, we focused on an emerging genome editing technique mediated by the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system to introduce genomic mutations. In this study, we targeted a functionally conserved regulator of eye development, the eyeless gene in D. magna. When we injected Cas9 mRNAs and eyeless-targeting guide RNAs into eggs, 18-47% of the survived juveniles exhibited abnormal eye morphology. After maturation, up to 8.2% of the adults produced progenies with deformed eyes, which carried mutations in the eyeless loci. These results showed that CRISPR/Cas system could introduce heritable mutations into the endogenous eyeless gene in D. magna. This is the first report of a targeted gene knockout technique in Daphnia and will be useful in uncovering Daphnia gene functions.

  11. Acute toxicity of 50 metals to Daphnia magna.

    PubMed

    Okamoto, Akira; Yamamuro, Masumi; Tatarazako, Norihisa

    2015-07-01

    Metals are essential for human life and physiological functions but may sometimes cause disorders. Therefore, we conducted acute toxicity testing of 50 metals in Daphnia magna: EC50s of seven elements (Be, Cu, Ag, Cd, Os, Au and Hg) were < 100 µg l(-1) ; EC50s of 13 elements (Al, Sc, Cr, Co, Ni, Zn, Se, Rb, Y, Rh, Pt, Tl and Pb) were between 100 and 1000 µg l(-1) ; EC50s of 14 elements (Li, V, Mn, Fe, Ge, As, In, Sn, Sb, Te, Cs, Ba, W and Ir) were between 1,001 and 100,000 µg l(-1) ; EC50s of six elements (Na, Mg, K, Ca, Sr and Mo) were > 100,000 µg l(-1) ; and. 7 elements (Ti, Zr, Bi, Nb, Hf, Re and Ta) did not show EC50 at the upper limit of respective aqueous solubility, and EC50s were not obtained. Ga, Ru and Pd adhered to the body of D. magna and physically retarded the movement of D. magna. These metals formed hydroxides after adjusting the pH. Therefore, here, we distinguished this physical effect from the physiological toxic effect. The acute toxicity results of 40 elements obtained in this study were not correlated with electronegativity. Similarly, the acute toxicity results of metals including the rare metals were also not correlated with first ionization energy, atomic weight, atomic number, covalent radius, atomic radius or ionic radius.

  12. Fingerprint image enhancement using CNN filtering techniques.

    PubMed

    Saatci, Ertugrul; Tavsanoglu, Vedat

    2003-12-01

    Due to noisy acquisition devices and variation in impression conditions, the ridgelines of fingerprint images are mostly corrupted by various kinds of noise causing cracks, scratches and bridges in the ridges as well as blurs. These cause matching errors in fingerprint recognition. For an effective recognition the correct ridge pattern is essential which requires the enhancement of fingerprint images. Segment by segment analysis of the fingerprint pattern yields various ridge direction and frequencies. By selecting a directional filter with correct filter parameters to match ridge features at each point, we can effectively enhance fingerprint ridges. This paper proposes a fingerprint image enhancement based on CNN Gabor-Type filters.

  13. A Tree Based Method for the Rapid Screening of Chemical Fingerprints

    NASA Astrophysics Data System (ADS)

    Kristensen, Thomas G.; Nielsen, Jesper; Pedersen, Christian N. S.

    The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules with fingerprints similar to a query fingerprint. In this paper, we present a method which efficiently finds all fingerprints in a database with Tanimoto coefficient to the query fingerprint above a user defined threshold. The method is based on two novel data structures for rapid screening of large databases: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds. We have implemented our method and tested it on a large data set from the industry. Our experiments show that our method yields a three-fold speed-up over previous methods.

  14. Phototoxic effects of titanium dioxide nanoparticles on Daphnia magna

    NASA Astrophysics Data System (ADS)

    Mansfield, Charles M.

    Titanium dioxide nanoparticles (TiO2-NP) are one of the most abundantly utilized nanomaterials in the world. Studies have demonstrated the mechanism of acute toxicity in TiO2-NP to be the production of reactive oxygen species (ROS) leading to oxidative stress and mortality in exposed organisms. It has also been demonstrated that the anatase crystalline conformation is capable of catalyzing the cleavage of water molecules to further increase the concentration of ROS in the presence of ultraviolet radiation. This photoenhanced toxicity significantly lowers the toxicity threshold of TiO2-NP to environmentally relevant concentrations (ppb). The goal of this study was to determine whether dietary uptake and accumulation of TiO2-NP in the aquatic filter feeder Daphnia magna resulted in photoenhanced toxicity. D. magna and S. caprincornatum were exposed to aqueous solutions of 20ppm and 200ppm TiO2-NP for 24hrs and then transferred to clean moderately hard water. Samples were taken at various time points, dried, and TiO 2 quantified using ICP-MS. Toxicity assays were run on D. magna using three TiO2-NP (20ppm, 200ppm) exposure protocols and two ultraviolet radiation treatments. The first exposure group was exposed to aqueous solutions of TiO2-NP for the duration of the test. The second exposure group was exposed to TiO2-NP for an hour and then transferred to clean water. The third exposure group was fed S. capricornatum that had been allowed to adsorb TiO2-NP. All samples were then placed in an outdoor UV exposure system and exposed to either full spectrum sunlight (with UV) or filtered sunlight (no UV). Here we show that TiO2 uptake peaked at one hour of exposure likely due to sedimentation of the particles out of suspension, thus decreasing bioavailability for the duration of the test. Interestingly, when D. magna were moved to clean water, aqueous concentrations of TiO2 increase as a result of depuration from the gut tract. Data also suggests these excreted particles

  15. Video fingerprinting for live events

    NASA Astrophysics Data System (ADS)

    Celik, Mehmet; Haitsma, Jaap; Barvinko, Pavlo; Langelaar, Gerhard; Maas, Martijn

    2009-02-01

    Multimedia fingerprinting (robust hashing) as a content identification technology is emerging as an effective tool for preventing unauthorized distribution of commercial content through user generated content (UGC) sites. Research in the field has mainly considered content types with slow distribution cycles, e.g. feature films, for which reference fingerprint ingestion and database indexing can be performed offline. As a result, research focus has been on improving the robustness and search speed. Live events, such as live sports broadcasts, impose new challenges on a fingerprinting system. For instance, highlights from a soccer match are often available-and viewed-on UGC sites well before the end of the match. In this scenario, the fingerprinting system should be able to ingest and index live content online and offer continuous search capability, where new material is identifiable within minutes of broadcast. In this paper, we concentrate on algorithmic and architectural challenges we faced when developing a video fingerprinting solution for live events. In particular, we discuss how to effectively utilize fast sorting algorithms and a master-slave architecture for fast and continuous ingestion of live broadcasts.

  16. Spectral Fingerprints of Habitability

    NASA Astrophysics Data System (ADS)

    Kaltenegger, L.; Selsis, F.

    2010-01-01

    The emerging field of extrasolar planet search has shown an extraordinary ability to combine research by astrophysics, chemistry, biology and geophysics into a new and exciting interdisciplinary approach to understand our place in the universe. Are there other worlds like ours? How can we characterize those planets and assess if they are habitable? After a decade rich in giant exoplanet detections, observation techniques have now reached the ability to find planets of less than 10 M_Earth (so called Super-Earths) that may potentially be habitable. The detection and characterization of Earth-like planet is approaching rapidly with dedicated space observatories already in operation (Corot) or in development phase (Kepler, James Webb Space Telescope, Extremely Large Telescope (ELT), Darwin/TPF). Space missions like CoRoT (CNES, Rouan et al. 1998) and Kepler (NASA, Borucki et al. 1997) will give us statistics on the number, size, period and orbital distance of planets, extending to terrestrial planets on the lower mass range end as a first step, while missions like Darwin/TPF are designed to characterize their atmospheres. In this chapter we discuss how we can read a planet's spectral fingerprint and characterize if it is potentially habitable. We discuss the first steps to detect a habitable planet and set biomarker detection in context in Section 1. In Section 2 we focus on biomarkers, their signatures at different wavelengths, abiotic sources and cryptic photosynthesis - using Earth as our primary example - the only habitable planet we know of so far. Section 3 concentrates on planets around different stars, and Section 4 summarizes the chapter.

  17. Rapid fingerprinting of methanogenic communities by high-resolution melting analysis.

    PubMed

    Kim, Jaai; Lee, Changsoo

    2014-12-01

    Characterizing microbial community structure using molecular techniques is becoming a popular approach in studies of waste/wastewater treatment processes. A rapid and robust tool to analyze microbial communities is required for efficient process monitoring and control. In this study, a new community fingerprinting method based on high-resolution melting (HRM) analysis was developed and applied to compare methanogenic community structures of five different anaerobic digesters. The new method produced robust community clustering and ordination results comparable to the results from the commonly used denaturing gradient gel electrophoresis (DGGE) performed in parallel. This method transforms melting peak plots (MPs) of community DNA samples generated by HRM analysis to molecular fingerprints and estimates the relationships between the communities based on the fingerprints. The MP-based fingerprinting would provide a good alternative to monitor variations in microbial community structure especially when handling large sample numbers due to its high-throughput capacity and short analysis time.

  18. Fingerprint separation: an application of ICA

    NASA Astrophysics Data System (ADS)

    Singh, Meenakshi; Singh, Deepak Kumar; Kalra, Prem Kumar

    2008-04-01

    Among all existing biometric techniques, fingerprint-based identification is the oldest method, which has been successfully used in numerous applications. Fingerprint-based identification is the most recognized tool in biometrics because of its reliability and accuracy. Fingerprint identification is done by matching questioned and known friction skin ridge impressions from fingers, palms, and toes to determine if the impressions are from the same finger (or palm, toe, etc.). There are many fingerprint matching algorithms which automate and facilitate the job of fingerprint matching, but for any of these algorithms matching can be difficult if the fingerprints are overlapped or mixed. In this paper, we have proposed a new algorithm for separating overlapped or mixed fingerprints so that the performance of the matching algorithms will improve when they are fed with these inputs. Independent Component Analysis (ICA) has been used as a tool to separate the overlapped or mixed fingerprints.

  19. Fingerprint fake detection by optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

    2013-03-01

    The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

  20. Group-Oriented Fingerprinting for Multimedia Forensics

    NASA Astrophysics Data System (ADS)

    Wang, Z. Jane; Wu, Min; Trappe, Wade; Liu, K. J. Ray

    2004-12-01

    Digital fingerprinting of multimedia data involves embedding information in the content signal and offers protection to the digital rights of the content by allowing illegitimate usage of the content to be identified by authorized parties. One potential threat to fingerprinting is collusion, whereby a group of adversaries combine their individual copies in an attempt to remove the underlying fingerprints. Former studies indicate that collusion attacks based on a few dozen independent copies can confound a fingerprinting system that employs orthogonal modulation. However, in practice an adversary is more likely to collude with some users than with other users due to geographic or social circumstances. To take advantage of prior knowledge of the collusion pattern, we propose a two-tier group-oriented fingerprinting scheme where users likely to collude with each other are assigned correlated fingerprints. Additionally, we extend our construction to represent the natural social and geographic hierarchical relationships between users by developing a more flexible tree-structure-based fingerprinting system. We also propose a multistage colluder identification scheme by taking advantage of the hierarchial nature of the fingerprints. We evaluate the performance of the proposed fingerprinting scheme by studying the collusion resistance of a fingerprinting system employing Gaussian-distributed fingerprints. Our results show that the group-oriented fingerprinting system provides the superior collusion resistance over a system employing orthogonal modulation when knowledge of the potential collusion pattern is available.

  1. Detection and Rectification of Distorted Fingerprints.

    PubMed

    Si, Xuanbin; Feng, Jianjiang; Zhou, Jie; Luo, Yuxuan

    2015-03-01

    Elastic distortion of fingerprints is one of the major causes for false non-match. While this problem affects all fingerprint recognition applications, it is especially dangerous in negative recognition applications, such as watchlist and deduplication applications. In such applications, malicious users may purposely distort their fingerprints to evade identification. In this paper, we proposed novel algorithms to detect and rectify skin distortion based on a single fingerprint image. Distortion detection is viewed as a two-class classification problem, for which the registered ridge orientation map and period map of a fingerprint are used as the feature vector and a SVM classifier is trained to perform the classification task. Distortion rectification (or equivalently distortion field estimation) is viewed as a regression problem, where the input is a distorted fingerprint and the output is the distortion field. To solve this problem, a database (called reference database) of various distorted reference fingerprints and corresponding distortion fields is built in the offline stage, and then in the online stage, the nearest neighbor of the input fingerprint is found in the reference database and the corresponding distortion field is used to transform the input fingerprint into a normal one. Promising results have been obtained on three databases containing many distorted fingerprints, namely FVC2004 DB1, Tsinghua Distorted Fingerprint database, and the NIST SD27 latent fingerprint database.

  2. Detection and Rectification of Distorted Fingerprints.

    PubMed

    Si, Xuanbin; Feng, Jianjiang; Zhou, Jie; Luo, Yuxuan

    2015-03-01

    Elastic distortion of fingerprints is one of the major causes for false non-match. While this problem affects all fingerprint recognition applications, it is especially dangerous in negative recognition applications, such as watchlist and deduplication applications. In such applications, malicious users may purposely distort their fingerprints to evade identification. In this paper, we proposed novel algorithms to detect and rectify skin distortion based on a single fingerprint image. Distortion detection is viewed as a two-class classification problem, for which the registered ridge orientation map and period map of a fingerprint are used as the feature vector and a SVM classifier is trained to perform the classification task. Distortion rectification (or equivalently distortion field estimation) is viewed as a regression problem, where the input is a distorted fingerprint and the output is the distortion field. To solve this problem, a database (called reference database) of various distorted reference fingerprints and corresponding distortion fields is built in the offline stage, and then in the online stage, the nearest neighbor of the input fingerprint is found in the reference database and the corresponding distortion field is used to transform the input fingerprint into a normal one. Promising results have been obtained on three databases containing many distorted fingerprints, namely FVC2004 DB1, Tsinghua Distorted Fingerprint database, and the NIST SD27 latent fingerprint database. PMID:26353261

  3. Forensic Chemistry: The Revelation of Latent Fingerprints

    ERIC Educational Resources Information Center

    Friesen, J. Brent

    2015-01-01

    The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

  4. 75 FR 12803 - Fingerprint Submission Requirements Rule

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-17

    ... AND PRIVACY COMPACT COUNCIL Fingerprint Submission Requirements Rule Authority: 42 U.S.C. 14616... checks during times of emergencies and disasters under the authority of the Fingerprint Submission... the Fingerprint Submission Requirements Rule (28 CFR, part 901) when health or safety of...

  5. Interspecific Differences between D. pulex and D. magna in Tolerance to Cyanobacteria with Protease Inhibitors

    PubMed Central

    Kuster, Christian J.; Von Elert, Eric

    2013-01-01

    It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids’ tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC− contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC−, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease inhibitors. PMID:23650523

  6. Fingerprints in the Dust

    NASA Technical Reports Server (NTRS)

    2001-01-01

    These MISR nadir-camera images of eastern China compare a somewhat hazy summer view from July 9, 2000 (left) with a spectacularly dusty spring view from April 7, 2001 (middle). The left-hand and middle images are from Terra orbits 2967 and 6928, respectively, and extend from central Manchuria near the top to portions of North and South Korea at the bottom. They are approximately 380 kilometers in width.

    Asia's desert areas are prone to soil erosion, as underground water tables are lowered by prolonged drought and by industrial and agricultural water use. Heavy winds blowing eastward across the arid and sparsely vegetated surfaces of Mongolia and western China pick up large quantities of yellow dust. Airborne dust clouds from the April 2001 storm blew across the Pacific Ocean and were carried as far as North America. The minerals transported in this manner are believed to provide nutrients for both oceanic and land ecosystems.

    According to the Xinhua News Agency in China, nearly one million tons of Gobi Desert dust blow into Beijing each year. During a similar dust outbreak last year, the Associated Press reported that the visibility in Beijing had been reduced the point where buildings were barely visible across city streets, and airline schedules were significantly disrupted. The dust has also been implicated in adverse health effects such as respiratory discomfort and eye irritation.

    The image on the right is a higher resolution MISR nadir-camera view of a portion of the April 7, 2001 dust cloud. It covers an area roughly 250 kilometers wide by 470 kilometers high. When viewed at full magnification, a number of atmospheric wave features, like the ridges and valleys of a fingerprint, are apparent. These are probably induced by surface topography, which can disturb the wind flow. A few small cumulus clouds are also visible, and are casting shadows on the thick lower dust layer.

    Analyses of images such as these constitute one phase of MISR

  7. Protective effects of ectoine on heat-stressed Daphnia magna.

    PubMed

    Adam, Bownik; Zofia, Stępniewska; Tadeusz, Skowroński

    2014-12-01

    Ectoine (ECT) is an amino acid produced and accumulated by halophilic bacteria in stressful conditions in order to prevent the loss of water from the cell. There is a lack of knowledge on the effects of ECT in heat-stressed aquatic animals. The purpose of our study was to determine the influence of ECT on Daphnia magna subjected to heat stress with two temperature gradients: 1 and 0.1 °C/min in the range of 23-42 °C. Time to immobilisation, survival during recovery, swimming performance, heart rate, thoracic limb movement and the levels of heat shock protein 70 kDa 1A (HSP70 1A), catalase (CAT) and nitric oxide species (NOx) were determined in ECT-exposed and unexposed daphnids; we showed protective effects of ECT on Daphnia magna subjected to heat stress. Time to immobilisation of daphnids exposed to ECT was longer when compared to the unexposed animals. Also, survival rate during the recovery of daphnids previously treated with ECT was higher. ECT significantly attenuated a rapid increase of mean swimming velocity which was elevated in the unexposed daphnids. Moreover, we observed elevation of thoracic limb movement and modulation of heart rate in ECT-exposed animals. HSP70 1A and CAT levels were reduced in the presence of ECT. On the other hand, NOx level was slightly elevated in both ECT-treated and unexposed daphnids, however slightly higher NOx level was found in ECT-treated animals. We conclude that the exposure to ectoine has thermoprotective effects on Daphnia magna, however their mechanisms are not associated with the induction of HSP70 1A.

  8. Protective effects of ectoine on heat-stressed Daphnia magna.

    PubMed

    Adam, Bownik; Zofia, Stępniewska; Tadeusz, Skowroński

    2014-12-01

    Ectoine (ECT) is an amino acid produced and accumulated by halophilic bacteria in stressful conditions in order to prevent the loss of water from the cell. There is a lack of knowledge on the effects of ECT in heat-stressed aquatic animals. The purpose of our study was to determine the influence of ECT on Daphnia magna subjected to heat stress with two temperature gradients: 1 and 0.1 °C/min in the range of 23-42 °C. Time to immobilisation, survival during recovery, swimming performance, heart rate, thoracic limb movement and the levels of heat shock protein 70 kDa 1A (HSP70 1A), catalase (CAT) and nitric oxide species (NOx) were determined in ECT-exposed and unexposed daphnids; we showed protective effects of ECT on Daphnia magna subjected to heat stress. Time to immobilisation of daphnids exposed to ECT was longer when compared to the unexposed animals. Also, survival rate during the recovery of daphnids previously treated with ECT was higher. ECT significantly attenuated a rapid increase of mean swimming velocity which was elevated in the unexposed daphnids. Moreover, we observed elevation of thoracic limb movement and modulation of heart rate in ECT-exposed animals. HSP70 1A and CAT levels were reduced in the presence of ECT. On the other hand, NOx level was slightly elevated in both ECT-treated and unexposed daphnids, however slightly higher NOx level was found in ECT-treated animals. We conclude that the exposure to ectoine has thermoprotective effects on Daphnia magna, however their mechanisms are not associated with the induction of HSP70 1A. PMID:25223383

  9. Mechanisms of chronic waterborne Zn toxicity in Daphnia magna.

    PubMed

    Muyssen, Brita T A; De Schamphelaere, Karel A C; Janssen, Colin R

    2006-05-25

    In order to gain better insights in the integrated response of Daphnia magna following chronic zinc exposure, several physiological parameters were measured in a time-dependent manner. D. magna juveniles were exposed for 21 days to dissolved Zn concentrations up to 340 microg/L. Next to standard endpoints such as mortality, growth and reproduction the following sub-lethal endpoints were measured: filtration and ingestion rate, respiration rate, energy reserves, internal Zn and total Ca concentrations in the organisms. Organisms exposed to 80 microg/L generally performed better than the Zn deprived control organisms. The former were used to elucidate the effects of higher Zn concentrations on the endpoints mentioned above. After 1 week, only 7% of the organisms exposed to 340 microg/L survived. Body Zn contents of these organisms were 281 +/- 76 microg g dry weight and a 37% decrease of the Ca contents was observed. This suggests a competitive effect of Zn on Ca uptake. Filtration rate (-51%), individual weight (-58%) and energy reserves (-35%) also exhibited a decreasing trend as a function of increasing Zn exposure concentrations. During the second and third exposure week an overall repair process was observed. In the surviving organisms mortality and reproduction were only slightly affected. This can be explained by (over)compensation reactions at lower levels of biological organisation: Ca contents (+24%) and filtration rate (+90%) increased as a function of the exposure concentration while respiration rate decreased (-29%) resulting in energy reserves remaining constant as a function of Zn exposure. It is hypothesized that a disturbed Ca balance is probably the first cause for zinc toxicity effects in D. magna. PMID:16472524

  10. Comet Assay on Daphnia magna in eco-genotoxicity testing.

    PubMed

    Pellegri, Valerio; Gorbi, Gessica; Buschini, Annamaria

    2014-10-01

    Detection of potentially hazardous compounds in water bodies is a priority in environmental risk assessment. For the evaluation and monitoring of water quality, a series of methodologies may be applied. Among them, the worldwide used toxicity tests with organisms of the genus Daphnia is one of the most powerful. In recent years, some attempts were made to utilize Daphnia magna in genotoxicity testing as many of the new environmental contaminants are described as DNA-damaging agents in aquatic organisms. The aim of this research was to develop a highly standardized protocol of the Comet Assay adapted for D. magna, especially regarding the isolation of cells derived from the same tissue (haemolymph) from newborn organisms exposed in vivo. Several methods for haemolymph extraction and different Comet Assay parameters were compared. Electrophoretic conditions were adapted in order to obtain minimum DNA migration in cells derived from untreated organisms and, at the same time, maximum sensitivity in specimens treated with known genotoxicants (CdCl2 and H2O2). Additional tests were performed to investigate if life-history traits of the cladoceran (such as the age of adult organisms that provide newborns, the clutch size of origin, the number of generations reared in standard conditions) and the water composition as well, might influence the response of the assay. This study confirms the potential application of the Comet Assay in D. magna for assessing genotoxic loads in aqueous solution. The newly developed protocol could integrate the acute toxicity bioassay, thus expanding the possibility of using this model species in freshwater monitoring (waters, sediment and soil elutriates) and is in line with the spirit of the EU Water Framework Directive in reducing the number of bioassays that involve medium-sized species.

  11. Increasing toxicity of enrofloxacin over four generations of Daphnia magna.

    PubMed

    Dalla Bona, Mirco; Lizzi, Francesca; Borgato, Arianna; De Liguoro, Marco

    2016-10-01

    The effects of both continuous and alternate exposure to 2mgL(-1) of enrofloxacin (EFX) on survival, growth and reproduction were evaluated over four generations of Daphnia magna. Mortality increased, reaching 100% in most groups by the end of the third generation. Growth inhibition was detected in only one group of the fourth generation. Reproduction inhibition was >50% in all groups and, in second and third generations, groups transferred to pure medium showed a greater inhibition of reproduction than those exposed to EFX. To verify whether the effects observed in these groups could be explained by the perinatal exposure to the antibacterial, a reproduction test with daphnids obtained from in vitro exposed D. magna embryos was also carried out. Perinatal exposure to EFX seemed to act as an 'all-or-nothing' toxicity effect as 31.4% of embryos died, but the surviving daphnids did not show any inhibition of reproduction activity. However, the embryonic mortality may at least partially justify the inhibition of reproduction observed in exposed groups along the multigenerational test. Concluding, the multigenerational test with D. magna did show disruption to a population that cannot be evidenced by the official tests. The increasing deterioration across generations might be inferred as the consequence of heritable alterations. Whilst the concentration tested was higher than those usually detected in the natural environment, the increasing toxicity of EFX across generations and the possible additive toxicity of fluoroquinolone mixtures, prevent harm to crustacean populations by effects in the real context from being completely ruled out. PMID:27379980

  12. Statistical validation of structured population models for Daphnia magna

    PubMed Central

    Adoteye, Kaska; Banks, H.T.; Cross, Karissa; Eytcheson, Stephanie; Flores, Kevin B.; LeBlanc, Gerald A.; Nguyen, Timothy; Ross, Chelsea; Smith, Emmaline; Stemkovski, Michael; Stokely, Sarah

    2016-01-01

    In this study we use statistical validation techniques to verify density-dependent mechanisms hypothesized for populations of Daphnia magna. We develop structured population models that exemplify specific mechanisms, and use multi-scale experimental data in order to test their importance. We show that fecundity and survival rates are affected by both time-varying density-independent factors, such as age, and density-dependent factors, such as competition. We perform uncertainty analysis and show that our parameters are estimated with a high degree of confidence. Further, we perform a sensitivity analysis to understand how changes in fecundity and survival rates affect population size and age-structure. PMID:26092608

  13. [Megacisterna magna as incidental finding in a boy with ADHD].

    PubMed

    Schevenels, S; Klockaerts, C

    2016-01-01

    In this case report we describe how a 13-year-old boy with a complex development profile was diagnosed with adhd and who was also found to have a megacisterna magna, a posterior fossa anomaly in the Dandy-Walker continuum. We searched the literature for reports of other patients who had this (mild) brain anomaly along with psychiatric problems in general and attention problems in particular. Our search of the literature suggested a possible link between the two diagnostic entities. PMID:27639888

  14. Effects of metal salt mixtures on Daphnia magna reproduction

    SciTech Connect

    Biesinger, K.E.; Christensen, G.M.; Fiandt, J.T.

    1986-02-01

    Three binary metal experiments were conducted using a complete block design; testing the chlorides of Cd, Hg, and Zn individually and in combinations of Cd-Hg, Cd-Zn, and Zn-Hg on Daphnia magna reproduction. These mixtures were tested at one-half, once, and twice the 16% reproductive impairment concentration previously determined for individual metals. The Cd-Hg, Cd-Zn, and Zn-Hg mixtures all showed significant reductions in reproduction at concentrations where the metal salts alone caused no significant effect.

  15. The Chaoulli Case: a two-tier Magna Carta?

    PubMed

    Marchildon, Gregory P

    2005-01-01

    There has been considerable speculation about the potential impact of the Supreme Court of Canada's judgment in Chaoulli v. Quebec. Even if those who are most friendly--or most hostile--to Canadian medicare are exaggerating the impact of the decision, its impact will be large. While the decision does not strike down any existing single-payer medicare system in any province, including Quebec's single-payer system, it is certainly capable of becoming the Magna Carta for two-tier medicare through future judicial interpretation and extension. In any event, it has already become the battering ram of choice for medicare's most tenacious opponents.

  16. Fingerprint reconstruction: from minutiae to phase.

    PubMed

    Feng, Jianjiang; Jain, Anil K

    2011-02-01

    Fingerprint matching systems generally use four types of representation schemes: grayscale image, phase image, skeleton image, and minutiae, among which minutiae-based representation is the most widely adopted one. The compactness of minutiae representation has created an impression that the minutiae template does not contain sufficient information to allow the reconstruction of the original grayscale fingerprint image. This belief has now been shown to be false; several algorithms have been proposed that can reconstruct fingerprint images from minutiae templates. These techniques try to either reconstruct the skeleton image, which is then converted into the grayscale image, or reconstruct the grayscale image directly from the minutiae template. However, they have a common drawback: Many spurious minutiae not included in the original minutiae template are generated in the reconstructed image. Moreover, some of these reconstruction techniques can only generate a partial fingerprint. In this paper, a novel fingerprint reconstruction algorithm is proposed to reconstruct the phase image, which is then converted into the grayscale image. The proposed reconstruction algorithm not only gives the whole fingerprint, but the reconstructed fingerprint contains very few spurious minutiae. Specifically, a fingerprint image is represented as a phase image which consists of the continuous phase and the spiral phase (which corresponds to minutiae). An algorithm is proposed to reconstruct the continuous phase from minutiae. The proposed reconstruction algorithm has been evaluated with respect to the success rates of type-I attack (match the reconstructed fingerprint against the original fingerprint) and type-II attack (match the reconstructed fingerprint against different impressions of the original fingerprint) using a commercial fingerprint recognition system. Given the reconstructed image from our algorithm, we show that both types of attacks can be successfully launched against

  17. Identification of chemical-specific protein profiles in Daphnia magna using neural networks

    SciTech Connect

    Iamonte, T.; Broadt, T.; Bradley, B.

    1995-12-31

    One dimensional gel electrophoresis was performed on whole-animal homogenates of 10 Daphnia magna exposed for 48 hours to one toxic and one non-toxic concentration of 2,4-dinitrophenol and sodium pentachlorophenate, two uncouplers of oxidative phosphorylation; malathion, an organophosphate; and permethrine, a pyrethroid, along with culture water and solvent controls, as appropriate. Ten randomized complete block exposures were conducted to minimize among-cohort variability. The 10-animal samples were gel electrophoresed, visualized using neutral silver staining and digitized with a Molecular Dynamics personal laser densitometer equipped with ImageQuant software. Densitometric data were used in a commercial neural network software package to construct a learning set, or database, of the protein profiles induced by the known chemical treatments. Novel data sets were then presented to the neural network program for assignment to treatment categories. Although no differences in protein profile between controls and chemical treatments and among chemical treatments could be detected visually in one dimensional gels, the neural network was able to correctly assign each sample to the appropriate learned treatment category about 70 percent of the time. Key proteins used by the neural network software to learn the protein profile of each chemical were identified by molecular weight and assigned a relative importance for identification of that chemical.

  18. Toxicity of new generation flame retardants to Daphnia magna.

    PubMed

    Waaijers, Susanne L; Hartmann, Julia; Soeter, A Marieke; Helmus, Rick; Kools, Stefan A E; de Voogt, Pim; Admiraal, Wim; Parsons, John R; Kraak, Michiel H S

    2013-10-01

    There is a tendency to substitute frequently used, but relatively hazardous brominated flame retardants (BFRs) with halogen-free flame retardants (HFFRs). Consequently, information on the persistence, bioaccumulation and toxicity (PBT) of these HFFRs is urgently needed, but large data gaps and inconsistencies exist. Therefore, in the present study the toxicity of a wide range of HFFRs to the water flea Daphnia magna was investigated. Our results revealed that four HFFRs were showing no effect at their Sw (saturated water concentration) and three had a low toxicity (EC50>10 mg L(-1)), suggesting that these compounds are not hazardous. Antimony trioxide had a moderate toxicity (EC50=3.01 mg L(-1), 95% CL: 2.76-3.25) and triphenyl phosphate and the brominated reference compound tetra bromobisphenol A were highly toxic to D. magna (EC50=0.55 mg L(-1), 95% CL: 0.53-0.55 and EC50=0.60 mg L(-1), 95% CL: 0.24-0.97 respectively). Aluminum trihydroxide and bisphenol A bis(diphenyl phosphate) caused limited mortality at Sw (26 and 25% respectively) and have a low solubility (<10 mg L(-1)). Hence, increased toxicity of these compounds may be observed when for instance decreasing pH could increase solubility. By testing all compounds under identical conditions we provided missing insights in the environmental hazards of new generation flame retardants and propose as best candidates for BFR replacements: APP, ALPI, DOPO, MHO, MPP, ZHS and ZS. PMID:23886749

  19. Aquatic acute toxicity assessments of molybdenum (+VI) to Daphnia magna.

    PubMed

    Wang, Chi-Wei; Liang, Chenju; Yeh, Hui-Ju

    2016-03-01

    Generally, molybdenum (Mo) metals in the environment are very rare, but wastewater discharges from industrial processes may contain high concentrations of Mo, which has the potential to contaminate water or soil if not handled properly. In this study, the impact of three common compounds of hexavalent Mo (sodium molybdate (Na2MoO4‧2H2O), ammonium molybdate ((NH4)6Mo7O24‧4H2O) and molybdenum trioxide (MoO3)) in an aquatic system were assessed based on 48-h exposure acute toxicity to Daphnia magna (D. magna). The LC50 toxicities for associated conjugate ions including Na(+), Cl(-), SO4(2-), and NH4(+) were determined. Furthermore, the LC50 values for the three forms of hexavalent Mo were determined, and the acute toxicities of the Mo forms were found to follow the order: (NH4)6Mo7O24‧4H2O > MoO3 > Na2MoO4‧2H2O in solution. (NH4)6Mo7O24‧4H2O exhibited the lowest LC50 of 43.3 mg L(-1) (corresponding to 23.5 mg Mo L(-1)) among the three molybdenum salts. The research confirmed that the toxicity of molybdenum in the aquatic system is highly dependent on the form of molybdenum salts used, and is also associated with the influence of the background water quality.

  20. Microdialysis in cisterna magna during cerebral air embolism in swine.

    PubMed

    Medby, C; Rø, H; Koteng, S; Juul, R; Krossnes, B K; Brubakk, A O

    2002-01-01

    Arterial gas embolism may occur as a consequence of lung rupture, decompression sickness, following operative procedures or as accidental infusion of gas during various diagnostic procedures. It can lead to severe morbidity or even death. Microdialysis is a technique that has been extensively used for evaluating localized changes in the brain. The microdialysis probe is only capable of measuring changes in the immediate adjacent tissue. In arterial gas embolism the changes are multifocal. Thus a probe located in the cerebral cortex will not detect the total amount of damage. We used microdialysis in the cisterna magna of 9 anaesthetized pigs to study the diffuse injury following arterial gas embolism. After injection of 5.0 mL of air in the internal carotid artery, we found a significantly increased lactate-pyruvate ratio in the cerebrospinal fluid, lasting for 2 hours. This indicates anaerobic metabolism. Mean levels of glycerol were significantly increased, indicating membrane disruption. Glutamate levels were also elevated, although not significantly. The injection of air affected carotid flow. Flow in the carotid artery of the side of injection decreased significantly, but returned to baseline in 1 hour. Flow in the contralateral carotid was increased, but not significantly. We conclude that massive air embolism causes ischemia and reduced blood flow in the brain that can be detected in the cisterna magna. PMID:12670124

  1. Parasite-mediated selection in experimental metapopulations of Daphnia magna.

    PubMed Central

    Haag, Christoph R.; Ebert, Dieter

    2004-01-01

    In metapopulations, only a fraction of all local host populations may be infected with a given parasite species, and limited dispersal of parasites suggests that colonization of host populations by parasites may involve only a small number of parasite strains. Using hosts and parasites obtained from a natural metapopulation, we studied the evolutionary consequences of invasion by single strains of parasites in experimental populations of the cyclical parthenogen Daphnia magna. In two experiments, each spanning approximately one season, we monitored clone frequency changes in outdoor container populations consisting of 13 and 19 D. magna clones, respectively. The populations were either infected with single strains of the microsporidian parasites Octosporea bayeri or Ordospora colligata or left unparasitized. In both experiments, infection changed the representation of clones over time significantly, indicating parasite-mediated evolution in the experimental populations. Furthermore, the two parasite species changed clone frequencies differently, suggesting that the interaction between infection and competitive ability of the hosts was specific to the parasite species. Taken together, our results suggest that parasite strains that invade local host populations can lead to evolutionary changes in the genetic composition of the host population and that this change is parasite-species specific. PMID:15475335

  2. [Acute toxicity of different type pesticide surfactants to Daphnia magna].

    PubMed

    Li, Xiu-huan; Li, Hua; Chen, Cheng-yu; Li, Jian-tao; Liu, Feng

    2013-08-01

    By using the standard test methods in Experimental Guideline for Environmental Safety Evaluation of Chemical Pesticide to aquatic organisms, a comparative study was conducted on the acute toxicity of 39 nonionic, 6 anionic, and 3 cationic surfactants to Daphnia magna. The acute toxicity of three cationic surfactants 1427, 1227 and C8-10 to D. magna belonged to virulent level, and the toxicity of 1427 was the highest, with the EC50 value being 0.97 x 10(-2) mg x L(-1). The acute toxicity of nonionic surfactants polyoxyethylene ether castor oil EL, Tween, and Span emulsifiers belonged to low level, but the toxicity of alkylphenol polyoxyethylene ether and fatty alcohol polyoxyethylene ether surfactants was relatively high, of which, AEO-7 and AEO-5 displayed high toxicity, with the EC50 value being 0.82 and 0.97 mg x L(-1), respectively. In these surfactants, the more liposolubility, the higher the toxicity was. Most of the anionic surfactants were medium in toxicity, but the acute toxicity of NNO belonged to high toxicity, with the EC50 value being 0.17 mg x L(-1).

  3. Chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Milazzo, D.P.

    1988-01-01

    Data generated from daphnid chronic toxicity tests are used by various regulatory agencies for the development of water quality criteria. Two chemicals which are lacking reported chronic data are aniline and 2,4-dichlorophenol. The acute toxicity of 2,4-dichlorophenol to Daphnia magna has been reported; the toxicity of aniline to D. magna also has been reported. Chronic data for these chemicals are lacking for invertebrates. The objective of this study was to estimate the chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus, using a standard 21-day static renewal procedure.

  4. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    NASA Astrophysics Data System (ADS)

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-07-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm-1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light-matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon-phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications.

  5. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    PubMed Central

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-01-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm−1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light–matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon–phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications. PMID:27460765

  6. Orientation field estimation for latent fingerprint enhancement.

    PubMed

    Feng, Jianjiang; Zhou, Jie; Jain, Anil K

    2013-04-01

    Identifying latent fingerprints is of vital importance for law enforcement agencies to apprehend criminals and terrorists. Compared to live-scan and inked fingerprints, the image quality of latent fingerprints is much lower, with complex image background, unclear ridge structure, and even overlapping patterns. A robust orientation field estimation algorithm is indispensable for enhancing and recognizing poor quality latents. However, conventional orientation field estimation algorithms, which can satisfactorily process most live-scan and inked fingerprints, do not provide acceptable results for most latents. We believe that a major limitation of conventional algorithms is that they do not utilize prior knowledge of the ridge structure in fingerprints. Inspired by spelling correction techniques in natural language processing, we propose a novel fingerprint orientation field estimation algorithm based on prior knowledge of fingerprint structure. We represent prior knowledge of fingerprints using a dictionary of reference orientation patches. which is constructed using a set of true orientation fields, and the compatibility constraint between neighboring orientation patches. Orientation field estimation for latents is posed as an energy minimization problem, which is solved by loopy belief propagation. Experimental results on the challenging NIST SD27 latent fingerprint database and an overlapped latent fingerprint database demonstrate the advantages of the proposed orientation field estimation algorithm over conventional algorithms.

  7. Optical wavelet transform for fingerprint identification

    NASA Astrophysics Data System (ADS)

    MacDonald, Robert P.; Rogers, Steven K.; Burns, Thomas J.; Fielding, Kenneth H.; Warhola, Gregory T.; Ruck, Dennis W.

    1994-03-01

    The Federal Bureau of Investigation (FBI) has recently sanctioned a wavelet fingerprint image compression algorithm developed for reducing storage requirements of digitized fingerprints. This research implements an optical wavelet transform of a fingerprint image, as the first step in an optical fingerprint identification process. Wavelet filters are created from computer- generated holograms of biorthogonal wavelets, the same wavelets implemented in the FBI algorithm. Using a detour phase holographic technique, a complex binary filter mask is created with both symmetry and linear phase. The wavelet transform is implemented with continuous shift using an optical correlation between binarized fingerprints written on a Magneto-Optic Spatial Light Modulator and the biorthogonal wavelet filters. A telescopic lens combination scales the transformed fingerprint onto the filters, providing a means of adjusting the biorthogonal wavelet filter dilation continuously. The wavelet transformed fingerprint is then applied to an optical fingerprint identification process. Comparison between normal fingerprints and wavelet transformed fingerprints shows improvement in the optical identification process, in terms of rotational invariance.

  8. A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

    PubMed Central

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  9. Study on internal to surface fingerprint correlation using optical coherence tomography and internal fingerprint extraction

    NASA Astrophysics Data System (ADS)

    Darlow, Luke Nicholas; Connan, James

    2015-11-01

    Surface fingerprint scanners are limited to a two-dimensional representation of the fingerprint topography, and thus, are vulnerable to fingerprint damage, distortion, and counterfeiting. Optical coherence tomography (OCT) scanners are able to image (in three dimensions) the internal structure of the fingertip skin. Techniques for obtaining the internal fingerprint from OCT scans have since been developed. This research presents an internal fingerprint extraction algorithm designed to extract high-quality internal fingerprints from touchless OCT fingertip scans. Furthermore, it serves as a correlation study between surface and internal fingerprints. Provided the scanned region contains sufficient fingerprint information, correlation to the surface topography is shown to be good (74% have true matches). The cross-correlation of internal fingerprints (96% have true matches) is substantial that internal fingerprints can constitute a fingerprint database. The internal fingerprints' performance was also compared to the performance of cropped surface counterparts, to eliminate bias owing to information level present, showing that the internal fingerprints' performance is superior 63.6% of the time.

  10. A support vector machine approach for truncated fingerprint image detection from sweeping fingerprint sensors.

    PubMed

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-03-31

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates.

  11. A support vector machine approach for truncated fingerprint image detection from sweeping fingerprint sensors.

    PubMed

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  12. Graphene Nanopres for DNA Fingerprinting

    NASA Astrophysics Data System (ADS)

    Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

    2013-03-01

    The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

  13. FROG - Fingerprinting Genomic Variation Ontology.

    PubMed

    Abinaya, E; Narang, Pankaj; Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: "FingeRprinting Ontology of Genomic variations" is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog.

  14. A Computational Discriminability Analysis on Twin Fingerprints

    NASA Astrophysics Data System (ADS)

    Liu, Yu; Srihari, Sargur N.

    Sharing similar genetic traits makes the investigation of twins an important study in forensics and biometrics. Fingerprints are one of the most commonly found types of forensic evidence. The similarity between twins’ prints is critical establish to the reliability of fingerprint identification. We present a quantitative analysis of the discriminability of twin fingerprints on a new data set (227 pairs of identical twins and fraternal twins) recently collected from a twin population using both level 1 and level 2 features. Although the patterns of minutiae among twins are more similar than in the general population, the similarity of fingerprints of twins is significantly different from that between genuine prints of the same finger. Twins fingerprints are discriminable with a 1.5%~1.7% higher EER than non-twins. And identical twins can be distinguished by examine fingerprint with a slightly higher error rate than fraternal twins.

  15. The Influence of Suspended Solids on the Combined Toxicity of Galaxolide and Lead to Daphnia magna.

    PubMed

    Chen, Fang; Yao, Qiang; Zhou, Xiuyan

    2015-07-01

    Polycyclic musks and heavy metals are often present in natural aquatic environment. The aims of this study were to evaluate the toxic effects on Daphnia magna from exposure to the polycyclic musks and the heavy metals in combination with stress from suspended solids exposure. Galaxolide and lead were used as typical pollutants. The toxic effects on D. magna decreased with addition of suspended solids within the single experiments having galaxolide after 24 and 48 h. A similar result was observed for the toxic effect of lead on the D. magna with adding suspended solids during exposure. Synergism on D. magna was found within the combined tests having galaxolide and lead during the 24 and 48 h exposure based on additive index analysis. The combined toxic effect of galaxolide and lead was significantly decreased by adding suspended solids. The results could provide useful information for the toxic risks assessments of surface aquatic systems.

  16. Draft Genome Sequence of Serratia sp. Strain DD3, Isolated from the Guts of Daphnia magna.

    PubMed

    Poehlein, Anja; Freese, Heike M; Daniel, Rolf; Simeonova, Diliana D

    2014-01-01

    We report the draft genome sequence of Serratia sp. strain DD3, a gammaproteobacterium from the family Enterobacteriaceae. It was isolated from homogenized guts of Daphnia magna. The genome size is 5,274 Mb.

  17. Draft Genome Sequence of Serratia sp. Strain DD3, Isolated from the Guts of Daphnia magna

    PubMed Central

    Poehlein, Anja; Freese, Heike M.; Daniel, Rolf

    2014-01-01

    We report the draft genome sequence of Serratia sp. strain DD3, a gammaproteobacterium from the family Enterobacteriaceae. It was isolated from homogenized guts of Daphnia magna. The genome size is 5,274 Mb. PMID:25212623

  18. Recurrent abscesses due to Finegoldia magna, Dermabacter hominis and Staphylococcus aureus in an immunocompetent patient.

    PubMed

    Martin, J; Bemer, P; Touchais, S; Asseray, N; Corvec, S

    2009-10-01

    A case of recurrent abscesses in an immunocompetent patient is reported, involving the opportunistic human pathogen Dermabacter hominis, the virulent anaerobic pathogen Finegoldia magna and Staphylococcus aureus. PMID:19332143

  19. An objective fingerprint quality-grading system.

    PubMed

    Pulsifer, Drew P; Muhlberger, Sarah A; Williams, Stephanie F; Shaler, Robert C; Lakhtakia, Akhlesh

    2013-09-10

    The grading of fingerprint quality by fingerprint examiners as currently practised is a subjective process. Therefore, an objective system was devised to remove the subjectivity. The devised grading system is quantitative and uses three separate, easily available, software packages to ultimately identify the portions of a fingerprint that correspond to low-, medium-, and high-quality definitive minutiae as defined on the Universal Latent Workstation of the US Federal Bureau of Investigation.

  20. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    SciTech Connect

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  1. Microorganism Identification Based On MALDI-TOF-MS Fingerprints

    NASA Astrophysics Data System (ADS)

    Elssner, Thomas; Kostrzewa, Markus; Maier, Thomas; Kruppa, Gary

    Advances in MALDI-TOF mass spectrometry have enabled the ­development of a rapid, accurate and specific method for the identification of bacteria directly from colonies picked from culture plates, which we have named the MALDI Biotyper. The picked colonies are placed on a target plate, a drop of matrix solution is added, and a pattern of protein molecular weights and intensities, "the protein fingerprint" of the bacteria, is produced by the MALDI-TOF mass spectrometer. The obtained protein mass fingerprint representing a molecular signature of the microorganism is then matched against a database containing a library of previously measured protein mass fingerprints, and scores for the match to every library entry are produced. An ID is obtained if a score is returned over a pre-set threshold. The sensitivity of the techniques is such that only approximately 104 bacterial cells are needed, meaning that an overnight culture is sufficient, and the results are obtained in minutes after culture. The improvement in time to result over biochemical methods, and the capability to perform a non-targeted identification of bacteria and spores, potentially makes this method suitable for use in the detect-to-treat timeframe in a bioterrorism event. In the case of white-powder samples, the infectious spore is present in sufficient quantity in the powder so that the MALDI Biotyper result can be obtained directly from the white powder, without the need for culture. While spores produce very different patterns from the vegetative colonies of the corresponding bacteria, this problem is overcome by simply including protein fingerprints of the spores in the library. Results on spores can be returned within minutes, making the method suitable for use in the "detect-to-protect" timeframe.

  2. Acute toxicity of cyanogen chloride to Daphnia magna

    SciTech Connect

    Kononen, D.W.

    1988-09-01

    The destruction of cyanide in waste waters by chlorination has been shown to result in the formation of the extremely toxic compound, cyanogen chloride. Industrial cyanide-containing waste waters may be treated by a batch chlorination process under highly alkaline conditions prior to being discharged into a receiving water systems. Alternatively, if the concentration of cyanide is relatively low, and such waste waters may be diverted to municipal waste treatment facilities where they may be subjected to a process of chlorination which may not be sufficient for the complete oxidative destruction of the available cyanide. Although a large body of literature exists concerning the toxicity of HCN and metallic cyanide compounds to aquatic organisms, there is a comparative scarcity of information concerning cyanogen chloride toxicity. This study was designed to determine the acute toxicity of CNCl to Daphnia magna neonates under static bioassay conditions.

  3. Purification and characterization of phosphoglucose isomerase allozymes from Daphnia magna.

    PubMed

    Boriss, H

    2001-10-01

    Phosphoglucose isomerase (PGI, EC 5.3.1.9) is polymorphic in many populations. Frequently, it has been shown that naturally occurring allozymes exhibit strong deviations form Hardy-Weinberg expectations, suggesting fitness relevant mutations. To investigate the nature of this allozymic variation, PGI was purified from Daphnia magna to high purity yielding a specific activity of 135.2 U/mg. The kinetic parameters of the allozymes were characterized depending upon ionic strength, pH and viscosity. The half-saturation constants of the allozymes were all equal, while the specific activity of the PGI from heterozygotes was consistently higher than the PGI of the homozygotes, independent of pH, ionic strength and viscosity of the solution. PMID:11728637

  4. Fingerprint multicast in secure video streaming.

    PubMed

    Zhao, H Vicky; Liu, K J Ray

    2006-01-01

    Digital fingerprinting is an emerging technology to protect multimedia content from illegal redistribution, where each distributed copy is labeled with unique identification information. In video streaming, huge amount of data have to be transmitted to a large number of users under stringent latency constraints, so the bandwidth-efficient distribution of uniquely fingerprinted copies is crucial. This paper investigates the secure multicast of anticollusion fingerprinted video in streaming applications and analyzes their performance. We first propose a general fingerprint multicast scheme that can be used with most spread spectrum embedding-based multimedia fingerprinting systems. To further improve the bandwidth efficiency, we explore the special structure of the fingerprint design and propose a joint fingerprint design and distribution scheme. From our simulations, the two proposed schemes can reduce the bandwidth requirement by 48% to 87%, depending on the number of users, the characteristics of video sequences, and the network and computation constraints. We also show that under the constraint that all colluders have the same probability of detection, the embedded fingerprints in the two schemes have approximately the same collusion resistance. Finally, we propose a fingerprint drift compensation scheme to improve the quality of the reconstructed sequences at the decoder's side without introducing extra communication overhead.

  5. A registration problem for functional fingerprinting.

    PubMed

    Kaplan, David M; Craver, Carl F

    2016-01-01

    Functional fingerprints aggregate over heterogeneous tasks, protocols, and controls. The appearance of functional diversity might be explained by task heterogeneity and conceptual imprecision. PMID:27561900

  6. On relative distortion in fingerprint comparison.

    PubMed

    Kalka, Nathan D; Hicklin, R Austin

    2014-11-01

    When fingerprints are deposited, non-uniform pressure in conjunction with the inherent elasticity of friction ridge skin often causes linear and non-linear distortions in the ridge and valley structure. The effects of these distortions must be considered during analysis of fingerprint images. Even when individual prints are not notably distorted, relative distortion between two prints can have a serious impact on comparison. In this paper we discuss several metrics for quantifying and visualizing linear and non-linear fingerprint deformations, and software tools to assist examiners in accounting for distortion in fingerprint comparisons.

  7. Managing a large database of camera fingerprints

    NASA Astrophysics Data System (ADS)

    Goljan, Miroslav; Fridrich, Jessica; Filler, Tomáš

    2010-01-01

    Sensor fingerprint is a unique noise-like pattern caused by slightly varying pixel dimensions and inhomogeneity of the silicon wafer from which the sensor is made. The fingerprint can be used to prove that an image came from a specific digital camera. The presence of a camera fingerprint in an image is usually established using a detector that evaluates cross-correlation between the fingerprint and image noise. The complexity of the detector is thus proportional to the number of pixels in the image. Although computing the detector statistic for a few megapixel image takes several seconds on a single-processor PC, the processing time becomes impractically large if a sizeable database of camera fingerprints needs to be searched through. In this paper, we present a fast searching algorithm that utilizes special "fingerprint digests" and sparse data structures to address several tasks that forensic analysts will find useful when deploying camera identification from fingerprints in practice. In particular, we develop fast algorithms for finding if a given fingerprint already resides in the database and for determining whether a given image was taken by a camera whose fingerprint is in the database.

  8. Molecular tools used in agriculture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A summary of molecular tools used for research in agriculture were presented. Examples of DNA sequencing, library preparation, use of fingerprinting for pathogens and plant crops, high throughput sequencing, whole-genome amplification, reporter genes, and other methods....

  9. Quantitative structure-activity relationship for toxicity of ionic liquids to Daphnia magna: aromaticity vs. lipophilicity.

    PubMed

    Roy, Kunal; Das, Rudra Narayan; Popelier, Paul L A

    2014-10-01

    Water solubility of ionic liquids (ILs) allows their dispersion into aquatic systems and raises concerns on their pollutant potential. Again, lipophilicity can contribute to the toxicity of ILs due to increased ability of the compounds to cross lipoidal bio-membranes. In the present work, we have performed statistical model development for toxicity of a set of ionic liquids to Daphnia magna, a widely accepted model organism for toxicity testing, using computed lipophilicity, atom-type fragment, quantum topological molecular similarity (QTMS) and extended topochemical atom (ETA) descriptors. The models have been developed and validated in accordance with the Organization for Economic Co-operation and Development (OECD) guidelines for quantitative structure-activity relationships (QSARs). The best partial least squares (PLS) model outperforms the previously reported multiple linear regression (MLR) model in statistical quality and predictive ability (R(2)=0.955, Q(2)=0.917, Rpred(2)=0.848). In this work, the ETA descriptors show importance of branching and aromaticity while the QTMS descriptor ellipticity efficiently shows which compounds are influential in the data set, with reference to the model. While obvious importance of lipophilicity is evident from the models, the best model clearly shows the importance of aromaticity suggesting that more lipophilic ILs with less toxicity may be designed by avoiding aromaticity, nitrogen atoms and increasing branching in the cationic structure. The developed quantitative models are in consonance with the recent hypothesis of importance of aromaticity for toxicity of ILs.

  10. Genes mirror geography in Daphnia magna.

    PubMed

    Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

    2015-09-01

    Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history.

  11. Genes mirror geography in Daphnia magna.

    PubMed

    Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

    2015-09-01

    Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history. PMID:26190313

  12. Diofenolan induces male offspring production through binding to the juvenile hormone receptor in Daphnia magna.

    PubMed

    Abe, Ryoko; Toyota, Kenji; Miyakawa, Hitoshi; Watanabe, Haruna; Oka, Tomohiro; Miyagawa, Shinichi; Nishide, Hiroyo; Uchiyama, Ikuo; Tollefsen, Knut Erik; Iguchi, Taisen; Tatarazako, Norihisa

    2015-02-01

    Juvenile hormone (JH) and JH agonists have been reported to induce male offspring production in various daphnid species including Daphnia magna. We recently established a short-term in vivo screening assay to detect chemicals having male offspring induction activity in adult D. magna. Diofenolan has been developed as a JH agonist for insect pest control, but its male offspring induction activity in daphnids has not been investigated yet. In this study, we found that the insect growth regulator (IGR) diofenolan exhibited a potent male offspring induction activity at low ng/L to μg/L concentrations, as demonstrated by the short-term in vivo screening assay and the recently developed TG211 ANNEX 7 test protocol. A two-hybrid assay performed using the D. magna JH receptor confirmed that diofenolan had a strong JH activity. Global whole body transcriptome analysis of D. magna exposed to 10 ng/L diofenolan showed an up-regulation of JH-responsive genes and modulation of several genes involved in the ecdysone receptor signaling pathway. These results clearly demonstrate that diofenolan has strong JH activity and male offspring induction activity, and that a combination of modified standardized regulatory testing protocols and rapid in vitro and in vivo screening assays are able to identify potential endocrine disruptors in D. magna. The observation that diofenolan modulates multiple endocrine signaling pathways in D. magna suggests that further investigation of potential interference with growth, development and reproduction is warranted.

  13. Effects of Microcystis aeruginosa on life history of water flea Daphnia magna

    NASA Astrophysics Data System (ADS)

    Liu, Liping; Li, Kang; Chen, Taoying; Dai, Xilin; Jiang, Min; Diana, James S.

    2011-07-01

    Cyanobacterial blooms in eutrophic freshwater systems are a worldwide problem, creating adverse effects for many aquatic organisms by producing toxic microcystins and deteriorating water quality. In this study, microcystins (MCs) in Microcystis aeruginosa, and Daphnia magna exposed to M. aeruginosa, were analyzed by HPLC-MS, and the effects of M. aeruginosa on D. magna were investigated. When D. magna was exposed to M. aeruginosa for more than 2 h, Microcystin-LR (MC-LR) was detected. When exposed to 1.5 × 106, 3 × 106, 0.75 × 107, and 1.5 × 107 cell/mL of M. aeruginosa for 96 h, average survival of D. magna for treatments were 23.33%, 33.33%, 13.33%, 16.67%, respectively, which were significantly lower than the average 100% survival in the control group ( P < 0.05). The adverse effects of M. aeruginosa on body length, time for the first brood, brood numbers, gross fecundity, lifespan, and population growth of D. magna were density-dependent. These results suggest that the occurrence of M. aeruginosa blooms could strongly inhibit the population growth of D. magna through depression of survival, individual growth and gross fecundity. In the most serious situations, M. aeruginosa blooms could undermine the food web by eliminating filter-feeding zooplankton, which would destroy the ecological balance of aquaculture water bodies.

  14. Experimental models of microcystin accumulation in Daphnia magna grazing on Planktothrix rubescens: implications for water management.

    PubMed

    Shams, Shiva; Cerasino, Leonardo; Salmaso, Nico; Dietrich, Daniel R

    2014-03-01

    In this study, we investigated the kinetic aspects of the microcystin (MC) transfer from Planktothrix rubescens to Daphnia magna by carrying out exposure experiments in small simple mesocosms. We hypothesized that higher fractions of toxic cyanobacteria in the diet of grazers would shift the balance towards a greater than linear, i.e. non-linear accumulation of MC in D. magna. This hypothesis was tested by exposing D. magna to varying initial densities of MC-producing P. rubescens. The evolving models of MC accumulation differed largely as a result of the duration of exposure and initial MC concentrations used. Within the first 24h of exposure, MC accumulation in D. magna was linear, irrespective of the initial densities of toxic P. rubescens and thus MC concentrations. After 48 h of exposure, MC accumulation in D. magna showed an exponential pattern, possibly due to a delayed digestion of P. rubescens and/or decreased MC detoxification capabilities when compared with higher ambient concentrations of MC. After 72 h toxin concentrations in Daphnia drop in all experiments as a consequence of the reduced cyanobacterial cells in the medium and the detoxification of MC within Daphnia. The results obtained suggest that in lakes with higher MC content and longer cyanobacterial bloom period MC accumulation in D. magna should be more pronounced than in mesotrophic lakes with lower MC content. The latter interpretation, however, should be verified investigating accumulation of MC both in larger mesocosms and in situ, in lakes of different trophic status.

  15. Fingerprint image enhancement via log-Gabor filtering

    NASA Astrophysics Data System (ADS)

    Lu, Zhen-kun; Yu, Zhen-ming

    2011-11-01

    In this paper, a method to enhance the fingerprint image by using Log-Gabor filters is proposed. Firstly, a filter for extracting fingerprint image texture feature is designed. Then, the high frequency components of fingerprint image are extracted by filtering. Finally, the fingerprint image details can be improved by enhancing high frequency components. Experimental results show that the proposed algorithm can effectively improve the quality of fingerprint image and the reliability of fingerprint identification.

  16. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    PubMed

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

  17. Fingerprinting Codes for Multimedia Data against Averaging Attack

    NASA Astrophysics Data System (ADS)

    Yagi, Hideki; Matsushima, Toshiyasu; Hirasawa, Shigeichi

    Code construction for digital fingerprinting, which is a copyright protection technique for multimedia, is considered. Digital fingerprinting should deter collusion attacks, where several fingerprinted copies of the same content are mixed to disturb their fingerprints. In this paper, we consider the averaging attack, which is known to be effective for multimedia fingerprinting with the spread spectrum technique. We propose new methods for constructing fingerprinting codes to increase the coding rate of conventional fingerprinting codes, while they guarantee to identify the same number of colluders. Due to the new fingerprinting codes, the system can deal with a larger number of users to supply digital contents.

  18. Proteomic analysis in Daphnia magna exposed to As(III), As(V) and Cd heavy metals and their binary mixtures for screening potential biomarkers.

    PubMed

    Le, Thai-Hoang; Lim, Eun-Suk; Hong, Nam-Hui; Lee, Sung-Kyu; Shim, Yon Sik; Hwang, Jin Rae; Kim, Yang-Hoon; Min, Jiho

    2013-11-01

    In this study, the effects of three widespread heavy metals, As(III), As(V) and Cd, and their binary mixtures on the proteomic profile in D. magna were examined to screen novel protein biomarkers using the two-dimensional gel electrophoresis method (2DE). Ten 20d daphnia were exposed to the LC20 concentrations for each of a total of 8 treatments, including the control, As(III), As(V), Cd, [As(III)+As(V)], [As(III)+Cd], [As(V)+Cd], and [As(III), As(V), Cd], for 24h before protein isolation. Three replicates were performed for each treatment. These protein samples were employed for 2DE experiments with a pH gradient gel strip from pH 3 to pH 10. The protein spots were detected by a silver staining process and their intensities were analyzed by Progenesis software to discover the differentially expressed proteins (DEPs) in response to each heavy metal. A total of 117 differentially expressed proteins (DEPs) were found in daphnia responding to the 8 treatments and mapped onto a 2D proteome map, which provides some information of the molecular weight (MW) and pI value for each protein. All of these DEPs are considered as potential candidates for protein biomarkers in D. magna for detecting heavy metals in the aquatic ecosystem. Comparing the proteomic results among these treatments suggested that exposing D. magna to binary mixtures of heavy metals may result in some complex interactive molecular responses within them, rather than just the simple sum of the proteomic profiles of the individual chemicals, (As(III), As(V), and Cd).

  19. Chemical Fingerprinting Program for RSRM Critical Materials

    NASA Technical Reports Server (NTRS)

    McClennen, William H.; Fife, Dennis J.; Killpack, Michael O.; Golde, Rick P.; Cash, Steve (Technical Monitor)

    2002-01-01

    This viewgraph presentation provides information on the chemical fingerprinting of RSRM (Reusable Sold Rocket Motor) components. A chemical fingerprint can be used to identify a material, to differentiate it from similar looking materials, or lead to its source. It can also identify unexpected changes to a vendor or supplier's material, and monitor aging.

  20. DNA Fingerprinting in a Forensic Teaching Experiment

    ERIC Educational Resources Information Center

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  1. Image enhancement method for fingerprint recognition system.

    PubMed

    Li, Shunshan; Wei, Min; Tang, Haiying; Zhuang, Tiange; Buonocore, Michael

    2005-01-01

    Image enhancement plays an important role in Fingerprint Recognition System. In this paper fingerprint image enhancement method, a refined Gabor filter, is presented. This enhancement method can connect the ridge breaks, ensures the maximal gray values located at the ridge center and has the ability to compensate for the nonlinear deformations. The result shows it can improve the performance of image enhancement.

  2. Tools for quality control of fingerprint databases

    NASA Astrophysics Data System (ADS)

    Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

    2010-04-01

    Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

  3. Spectroscopic fingerprint of tea varieties by surface enhanced Raman spectroscopy.

    PubMed

    Buyukgoz, Guluzar Gorkem; Soforoglu, Mehmet; Basaran Akgul, Nese; Boyaci, Ismail Hakki

    2016-03-01

    The fingerprinting method is generally performed to determine specific molecules or the behavior of specific molecular bonds in the desired sample content. A novel, robust and simple method based on surface enhanced Raman spectroscopy (SERS) was developed to obtain the full spectrum of tea varieties for detection of the purity of the samples based on the type of processing and cultivation. For this purpose, the fingerprint of seven different varieties of tea samples (herbal tea (rose hip, chamomile, linden, green and sage tea), black tea and earl grey tea) combined with silver colloids was obtained by SERS in the range of 200-2000 cm(-1) with an analysis time of 20 s. Each of the thirty-nine tea samples tested showed its own specific SERS spectra. Principal Component Analysis (PCA) was also applied to separate of each tea variety and different models developed for tea samples including three different models for the herbal teas and two different models for black and earl grey tea samples. Herbal tea samples were separated using mean centering, smoothing and median centering pre-processing steps while baselining and derivatisation pre-processing steps were applied to SERS data of black and earl grey tea. The novel spectroscopic fingerprinting technique combined with PCA is an accurate, rapid and simple methodology for the assessment of tea types based on the type of processing and cultivation differences. This method is proposed as an alternative tool in order to determine the characteristics of tea varieties. PMID:27570296

  4. Chemical imaging of latent fingerprint residues.

    PubMed

    Ricci, Camilla; Phiriyavityopas, Phiraporn; Curum, Nicholas; Chan, K L Andrew; Jickells, Sue; Kazarian, Sergei G

    2007-05-01

    In situ attenuated total reflection Fourier transform infrared (ATR-FT-IR) spectroscopic imaging has been used to obtain chemical images of fingerprints under controlled humidity and temperature. The distribution of lipid and amino acid components in the fingerprints from different donors left on the surface of the ZnSe crystal has been studied using an in situ FT-IR spectroscopic imaging approach under a controlled environment and studied as a function of time. Univariate and multivariate analyses were employed to analyze the spectroscopic dataset. Changes in the spectra of lipids with temperature and time have been detected. This information is needed to understand aging of the fingerprints. The ATR-FT-IR spectroscopic imaging offers a new and complementary means for studying the chemistry of fingerprints that are left pristine for further analysis. This study demonstrates the potential for visualizing the chemical changes of fingerprints for forensic applications by spectroscopic imaging.

  5. Fingerprint Compression Based on Sparse Representation.

    PubMed

    Shao, Guangqi; Wu, Yanping; A, Yong; Liu, Xiao; Guo, Tiande

    2014-02-01

    A new fingerprint compression algorithm based on sparse representation is introduced. Obtaining an overcomplete dictionary from a set of fingerprint patches allows us to represent them as a sparse linear combination of dictionary atoms. In the algorithm, we first construct a dictionary for predefined fingerprint image patches. For a new given fingerprint images, represent its patches according to the dictionary by computing l(0)-minimization and then quantize and encode the representation. In this paper, we consider the effect of various factors on compression results. Three groups of fingerprint images are tested. The experiments demonstrate that our algorithm is efficient compared with several competing compression techniques (JPEG, JPEG 2000, and WSQ), especially at high compression ratios. The experiments also illustrate that the proposed algorithm is robust to extract minutiae.

  6. Encoding protein-ligand interaction patterns in fingerprints and graphs.

    PubMed

    Desaphy, Jérémy; Raimbaud, Eric; Ducrot, Pierre; Rognan, Didier

    2013-03-25

    We herewith present a novel and universal method to convert protein-ligand coordinates into a simple fingerprint of 210 integers registering the corresponding molecular interaction pattern. Each interaction (hydrophobic, aromatic, hydrogen bond, ionic bond, metal complexation) is detected on the fly and physically described by a pseudoatom centered either on the interacting ligand atom, the interacting protein atom, or the geometric center of both interacting atoms. Counting all possible triplets of interaction pseudoatoms within six distance ranges, and pruning the full integer vector to keep the most frequent triplets enables the definition of a simple (210 integers) and coordinate frame-invariant interaction pattern descriptor (TIFP) that can be applied to compare any pair of protein-ligand complexes. TIFP fingerprints have been calculated for ca. 10,000 druggable protein-ligand complexes therefore enabling a wide comparison of relationships between interaction pattern similarity and ligand or binding site pairwise similarity. We notably show that interaction pattern similarity strongly depends on binding site similarity. In addition to the TIFP fingerprint which registers intermolecular interactions between a ligand and its target protein, we developed two tools (Ishape, Grim) to align protein-ligand complexes from their interaction patterns. Ishape is based on the overlap of interaction pseudoatoms using a smooth Gaussian function, whereas Grim utilizes a standard clique detection algorithm to match interaction pattern graphs. Both tools are complementary and enable protein-ligand complex alignments capitalizing on both global and local pattern similarities. The new fingerprint and companion alignment tools have been successfully used in three scenarios: (i) interaction-biased alignment of protein-ligand complexes, (ii) postprocessing docking poses according to known interaction patterns for a particular target, and (iii) virtual screening for bioisosteric

  7. DNA fingerprints come to court

    SciTech Connect

    Not Available

    1988-04-15

    DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person.

  8. FROG - Fingerprinting Genomic Variation Ontology

    PubMed Central

    Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: “FingeRprinting Ontology of Genomic variations” is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog. PMID:26244889

  9. The inheritance of fingerprint patterns.

    PubMed Central

    Slatis, H M; Katznelson, M B; Bonné-Tamir, B

    1976-01-01

    Analysis of the fingerprints of 571 members of the Habbanite isolate suggest inherited patterns and pattern sequences. A genetic theory has been developed; it assumes that the basic fingerprint pattern sequence is all ulnar loops and that a variety of genes cause deviations from this pattern sequence. Genes that have been proposed include: (1) a semidominant gene for whorls on the thumbs (one homozygote has whorls on both thumbs, the other has ulnar loops on both thumbs and the heterozygote usually has two ulnar loops or one ulnar loop and one whorl); (2) a semidominant gene for whorls on the ring fingers which acts like the gene for whorls on the thumbs; (3) a dominant gene for arches on the thumbs and often on other fingers; (4) one or more dominant genes for arches on the fingers; (5) a dominant gene for whorls on all fingers except for an ulnar loop on the middle finger; (6) a dominant gene for radial loops on the index fingers, frequently associated with an arch on the middle fingers; and (7) a recessive gene for radial loops on the ring and little fingers. These genes may act independently or may show epistasis. PMID:1266855

  10. Analysis and comparison of 2D fingerprints: insights into database screening performance using eight fingerprint methods.

    PubMed

    Duan, Jianxin; Dixon, Steven L; Lowrie, Jeffrey F; Sherman, Woody

    2010-09-01

    Virtual screening is a widely used strategy in modern drug discovery and 2D fingerprint similarity is an important tool that has been successfully applied to retrieve active compounds from large datasets. However, it is not always straightforward to select an appropriate fingerprint method and associated settings for a given problem. Here, we applied eight different fingerprint methods, as implemented in the new cheminformatics package Canvas, on a well-validated dataset covering five targets. The fingerprint methods include Linear, Dendritic, Radial, MACCS, MOLPRINT2D, Pairwise, Triplet, and Torsion. We find that most fingerprints have similar retrieval rates on average; however, each has special characteristics that distinguish its performance on different query molecules and ligand sets. For example, some fingerprints exhibit a significant ligand size dependency whereas others are more robust with respect to variations in the query or active compounds. In cases where little information is known about the active ligands, MOLPRINT2D fingerprints produce the highest average retrieval actives. When multiple queries are available, we find that a fingerprint averaged over all query molecules is generally superior to fingerprints derived from single queries. Finally, a complementarity metric is proposed to determine which fingerprint methods can be combined to improve screening results.

  11. Detection of a novel arginine vasopression defect by dideoxy fingerprinting

    SciTech Connect

    Krishnamani, M.R.S.; Phillips, J.A. III; Copeland, K.C. Univ. of Vermont College of Medicine, Burlington, VT )

    1993-09-01

    Autosomal dominant neurohypophyseal diabetes insipidus is a familial form of diabetes insipidus. This disorder is associated with variable levels of arginine vasopressin (AVP) and diabetes insipidus of varying severity, which responds to exogenous AVP. To determine the molecular basis of autosomal dominant neurohypophyseal diabetes insipidus, the AVP genes of members of a large kindred were analyzed. A new method, called dideoxy fingerprinting, was used to detect an AVP mutation that was characterized by DNA sequencing. The novel defect found changes the last codon of the AVP signal peptide from alanine to threonine, which should perturb cleavage of mature AVP from its precursor protein and inhibit its secretion or action. 18 refs., 3 figs.

  12. DNA fingerprinting in zoology: past, present, future.

    PubMed

    Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

    2014-02-03

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

  13. DNA fingerprinting of jute germplasm by RAPD.

    PubMed

    Hossain, Mohammad Belayat; Haque, Samiul; Khan, Haseena

    2002-07-31

    The genotype characteristic of cultivars was investigated, along with varieties of both of the jute species, Corchorus olitorius and Corchorus capsularis, in the germplasm collection at the Bangladesh Jute Research Institute (BJRI). DNA fingerprinting was generated for 9 different varieties and 12 accessions of jute cultivars by using random amplified polymorphic DNA (RAPD). A total of 29 arbitrary oligonucleotide primers were screened. Seven primers gave polymorphism within the varieties, and 6 primers detected polymorphism within the accessions that were tested. A dendrogram was engendered from these data, and this gave a distinct clustering of the cultivated species of jute. Therefore, we generated RAPD markers, which are species-specific. These primers can distinguish between C. olitorius and C. capsularis. From the dendrogram that we generated between the various members of these two species, we found the existing genetic classification that agrees with our molecular marking data. A different dendrogram showed that jute accessions could be clustered into three groups. These data will be invaluable in the conservation and utilization of the genetic pool in the germplasm collection.

  14. Fingerprint Minutiae from Latent and Matching Tenprint Images

    National Institute of Standards and Technology Data Gateway

    NIST Fingerprint Minutiae from Latent and Matching Tenprint Images (PC database for purchase)   NIST Special Database 27 contains latent fingerprints from crime scenes and their matching rolled fingerprint mates. This database can be used to develop and test new fingerprint algorithms, test commercial and research AFIS systems, train latent examiners, and promote the ANSI/NIST file format standard.

  15. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  16. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  17. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  18. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  19. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  20. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  1. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  2. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  3. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  4. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Interpretation of fingerprint submission... FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact requires the submission of fingerprints or other approved forms of...

  5. Tertiary treatment for wastewater reuse based on the Daphnia magna filtration - comparison with conventional tertiary treatments.

    PubMed

    Serra, Teresa; Colomer, Jordi; Pau, Conxi; Marín, Maribel; Sala, Lluís

    2014-01-01

    Tertiary treatments are required to permit safe reuse of wastewater. The performance of a new biological tertiary treatment based on the filtration by a population of Daphnia magna was studied and compared with the performance of other conventional tertiary treatments such as coagulation-flocculation, settling tank, disc filtration, sand filtering and ultraviolet (UV) light. The analysis was based on the efficiency in the particle removal and Escherichia coli inactivation. The Daphnia magna treatment reduced the concentration of particles with diameters below 30 μm by 35%, depending on abiotic parameters such as water temperature and the hydraulic retention time (HRT). The Daphnia magna filtration increased with water temperature for water temperatures >20 °C, while it remained constant for water temperatures <20 °C. Lower HRTs induced the growth of the Daphnia magna population, maintaining the same water quality. Furthermore, the Daphnia magna treatment inactivated E. coli in 1.2 log units. This inactivation was six times larger than that obtained by the conventional macrofiltration systems analyzed, although lower than the inactivation attained by UV light, which ranged between 1.5 and 4 log units.

  6. FAF and SufA: proteins of Finegoldia magna that modulate the antibacterial activity of histones.

    PubMed

    Murphy, Elizabeth C; Mohanty, Tirthankar; Frick, Inga-Maria

    2014-01-01

    Many bacterial pathogens have developed methods to overcome the defences of the host innate immune system. One such defence is the release of antimicrobial peptides (AMPs). Histones have been found to function as AMPs, in addition to their main biological function of packaging and organising DNA into nucleosomes. In this study, the Gram-positive anaerobic coccus Finegoldia magna was found to bind histones by Western blot and immunoprecipitation analysis. F. magna, which is normally a commensal of the skin and mucous membranes, is also known to act as an opportunistic pathogen and has been isolated from various clinical infection sites. It was found to bind to histones extracted from human skin epidermis through its surface and extracellular adhesion protein FAF. Through FAF binding, F. magna was protected from histone bactericidal activity. Furthermore, the histones were found to be degraded by SufA, a subtilisin-like extracellular serine protease of F. magna. Hence, the results of the present study will give more insight into how F. magna persists both as a commensal organism at the basement membrane of the skin and as an opportunistic pathogen during infection.

  7. 77 FR 41807 - New Gear Process, a Division of Magna Powertrain, Including On-Site Leased Workers From ABM...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-16

    ... Gear, a Division of Magna Powertrain, East Syracuse, New York. The workers produce automotive components. The Notice was published in the Federal Register on January 26, 2011 (75 FR 77669). At the... Employment and Training Administration New Gear Process, a Division of Magna Powertrain, Including On-...

  8. Interaction of functionalized fullerenes and metal accumulation in Daphnia magna.

    PubMed

    Yu, Zhi-Guo; Wang, Wen-Xiong

    2014-05-01

    In aquatic environments, transformation of pollutants by association with functionalized carbon-based nanoparticles can dramatically change their cycling pathways. The present study quantified the uptake and depuration behavior of cadmium and zinc bound with functionalized fullerene nanoparticles (f-nC(60)) in a freshwater cladoceran, Daphnia magna, in a well-dispersed medium. Metal uptake proceeded with a linear pattern during the 8-h exposure period, and the uptake rate constants (ku) were 1.3-fold to 1.4-fold higher for Cd or comparable for Zn bound with f-nC(60) than those of the free ones. The assimilation efficiencies of Cd and Zn bound with f-nC(60) were significantly enhanced when compared with those metals bound with algal food. Furthermore, the depuration of metals bound with f-nC(60) was relatively slower compared to the depuration of metals bound with carbon nanotubes. A longer exposure to f-nC(60) resulted in an even slower depuration of metals. The authors conclude that metal binding with f-nC(60) as modified nanoparticles could serve as a new pathway for the elevated metal accumulation in Daphnia.

  9. Mated Fingerprint Card Pairs 2 (MFCP2)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs 2 (MFCP2) (PC database for purchase)   NIST Special Database 14 is being distributed for use in development and testing of automated fingerprint classification and matching systems on a set of images which approximate a natural horizontal distribution of the National Crime Information Center (NCIC) fingerprint classes. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  10. Correlation between heavy metal acute toxicity values in Daphnia magna and fish

    SciTech Connect

    Khangarot, B.S.; Ray, P.K.

    1987-04-01

    In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species have been of recent interest as test models due to the need for developing nonmammalian tests system. The cladoceran Daphnia magna bioassays have several practical advantages. D. magna has been used as a useful test species and its sensitivity to environmental pollutants have been recognized as a general representative of other freshwater zooplankton species. The objectives of this study were to determine the acute toxicity of various heavy metals to Daphnia magna for 48 h of exposure and to compare these values with the existing LC50 values for rainbow trout (Salmo gairdneri); which is commonly used as a test animal in aquatic bioassay studies.

  11. Annotation of the Daphnia magna nuclear receptors: comparison to Daphnia pulex.

    PubMed

    Litoff, Elizabeth J; Garriott, Travis E; Ginjupalli, Gautam K; Butler, LaToya; Gay, Claudy; Scott, Kiandra; Baldwin, William S

    2014-11-15

    Most nuclear receptors (NRs) are ligand-dependent transcription factors crucial in homeostatic physiological responses or environmental responses. We annotated the Daphnia magna NRs and compared them to Daphnia pulex and other species, primarily through phylogenetic analysis. Daphnia species contain 26 NRs spanning all seven gene subfamilies. Thirteen of the 26 receptors found in Daphnia species phylogenetically segregate into the NR1 subfamily, primarily involved in energy metabolism and resource allocation. Some of the Daphnia NRs, such as RXR, HR96, and E75 show strong conservation between D. magna and D. pulex. Other receptors, such as EcRb, THRL-11 and RARL-10 have diverged considerably and therefore may show different functions in the two species. Curiously, there is an inverse association between the number of NR splice variants and conservation of the LBD. Overall, D. pulex and D. magna possess the same NRs; however not all of the NRs demonstrate high conservation indicating the potential for a divergence of function.

  12. A comparison of the toxicity of 30 reference chemicals to Daphnia magna and Daphnia pulex

    SciTech Connect

    Lilius, H.; Haestbacka, T.; Isomaa, B.

    1995-12-01

    To determine whether significant differences exist in the sensitivity of different Daphnia species to toxicants, the acute toxicity of the first 30 MEIC (multicenter evaluation of in vitro cytotoxicity) reference chemicals was determined in two species of Daphnia: D. magna and D. pulex. Correlation and regression analysis of the EC50 data for immobilization showed a very good concordance (r = 0.97, slope = 1.02). A comparison between the EC50 data obtained for D. magna by two laboratories independently for the 50 MEIC chemicals also showed a good concordance (r = 0.93, slope = 0.91). In both comparisons the regression line did not differ significantly from the regression line for a 1:1 regression. The authors conclude that their study, including a set of reference chemicals, indicates that is no difference in the overall sensitivity of the two Daphnia species and the two clones of D. magna.

  13. Toxicity of aqueous C70-gallic acid suspension in Daphnia magna.

    PubMed

    Seda, Brandon C; Ke, Pu-Chun; Mount, Andrew S; Klaine, Stephen J

    2012-01-01

    The present study assessed the toxic effects of stable aqueous colloidal suspensions of gallic-acid-stabilized C(70) fullerene on Daphnia magna. The suspensions were stabilized through noncovalent surface modification with gallic acid. In addition to whole-organism responses, changes in antioxidative processes in D. magna were quantified. Acute toxicity was observed with 96LC50 for C(70) -gallic acid of 0.4 ± 0.1 mg/L C(70) . Daphnia magna fecundity was significantly reduced in 21-d bioassays at C(70) -gallic aqcid concentrations below quantifiable limits. Antioxidant enzyme activities of glutathione peroxidase and superoxide dismutase as well as lipid peroxidation suggested that exposed organisms experienced oxidative stress. Microscopic techniques used to determine cellular toxicity via apoptosis proved unsuccessful.

  14. The detection of drugs of abuse in fingerprints using Raman spectroscopy I: latent fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-02-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in latent fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were studied in both sweat-rich and sebum-rich latent fingerprints. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in latent fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in sweat-rich latent fingerprints were of a similar quality to spectra that obtained from the substances under normal sampling conditions. Interfering Raman bands arising from latent fingerprint material were present in the spectra obtained from the substances in sebum-rich fingerprints. These bands did not prevent identification of the substances and could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in latent fingerprints was visually locating the substance in the fingerprint in order to obtain a Raman spectrum.

  15. Exploring methods for compositional and particle size analysis of noble metal nanoparticles in Daphnia magna.

    PubMed

    Krystek, Petra; Brandsma, Sicco; Leonards, Pim; de Boer, Jacob

    2016-01-15

    The identification and quantification of the bioaccumulation of noble metal engineered nanoparticles (ENPs) by aquatic organisms is of great relevance to understand the exposure and potential toxicity mechanisms of nanoscale materials. Four analytical scenarios were investigated in relation to various sized and composed noble metal (gold (Au), platinum (Pt) and silver (Ag)) ENPs during acute, short-term exposure of Daphnia (D.) magna. Next to the total elemental quantification of absorbed ENPs by D. magna, especially information on the size and particle distribution of ENPs in D. magna is of relevance. Dissolution of the exposed biological material prior to measurement by asymmetric flow field flow fractionation coupled to inductively coupled plasma mass spectrometry (AF4-ICPMS) is challenging because the ENPs must stay stable regarding to particle size and composition. Next to dissolution of exposed D. magna by tetra methyl ammonium hydroxide (TMAH), a new enzymatic dissolution approach was explored by using trypsin. The presence of various sized and composed ENPs has been confirmed by AF4-ICPMS but the chosen dissolution medium was crucial for the results. TMAH and trypsin led to comparable results for medium-sized (50nm) noble metals ENPs in exposed D. magna. But it was also shown that the dissolution of biological materials with smaller (<5nm) ENPs led to different results in particle size and elemental concentration depending on the selected dissolution medium. A significant uptake of Au and Pt ENPs by D. magna or adsorption to particles occurred because only 1-5% of the exposed ENPs remained in the exposure medium.

  16. Development of an NMR microprobe procedure for high-throughput environmental metabolomics of Daphnia magna.

    PubMed

    Nagato, Edward G; Lankadurai, Brian P; Soong, Ronald; Simpson, André J; Simpson, Myrna J

    2015-09-01

    Nuclear magnetic resonance (NMR) is the primary platform used in high-throughput environmental metabolomics studies because its non-selectivity is well suited for non-targeted approaches. However, standard NMR probes may limit the use of NMR-based metabolomics for tiny organisms because of the sample volumes required for routine metabolic profiling. Because of this, keystone ecological species, such as the water flea Daphnia magna, are not commonly studied because of the analytical challenges associated with NMR-based approaches. Here, the use of a 1.7-mm NMR microprobe in analyzing tissue extracts from D. magna is tested. Three different extraction procedures (D2O-based buffer, Bligh and Dyer, and acetonitrile : methanol : water) were compared in terms of the yields and breadth of polar metabolites. The D2O buffer extraction yielded the most metabolites and resulted in the best reproducibility. Varying amounts of D. magna dry mass were extracted to optimize metabolite isolation from D. magna tissues. A ratio of 1-1.5-mg dry mass to 40 µl of extraction solvent provided excellent signal-to-noise and spectral resolution using (1)H NMR. The metabolite profile of a single daphnid was also investigated (approximately 0.2 mg). However, the signal-to-noise of the (1)H NMR was considerably lower, and while feasible for select applications would likely not be appropriate for high-throughput NMR-based metabolomics. Two-dimensional NMR experiments on D. magna extracts were also performed using the 1.7-mm NMR probe to confirm (1)H NMR metabolite assignments. This study provides an NMR-based analytical framework for future metabolomics studies that use D. magna in ecological and ecotoxicity studies.

  17. A Study on the D. magna and V. fischeri Toxicity Relationship of Industrial Wastewater from Korea

    NASA Astrophysics Data System (ADS)

    Pyo, S.; Lee, S.; Chun Sang, H.; Park, T. J.; Kim, M. S.

    2015-12-01

    It is well known that high concentration of TDS (total dissolved solid) in industrial effluent gives rise to the toxicity to the Daphnia magna toxicity test. D. magna is vulnerable to relatively low TDS concentration showing the 24-hr EC50 of Salinity 0.6% (as the sea salt concentration). Recently, standard mandatory toxicity testing using Daphnia magna has been used to monitor industrial effluent toxicity according to Korea standard method (Acute Toxicity Test Method of the Daphnia magna Straus (Cladocera, Crustacea), ES 04704. 1a) under regulation. Since only one acute toxicity testing is applied in the present, we are trying to introduce microbial battery for more complete toxicity assessment. In this study, the acute toxicities between daphnids and microbes were compared. The results of D. magna and Vibrio fischeri toxicity test from 165 industrial wastewater effluents showed high positive correlation. In addition, the possibility of predicting daphnia toxicity from the bacterial toxicity data amounts to 92.6% if we consider salinity effect (>5ppt) together. From this study, we found that the V. fischeri toxicity test is a powerful battery tool to assess the industrial wastewater toxicity. Here, we suggest that luminescent bacteria toxicity test be useful not only for complete toxicity assessment which can't be obtained by daphnia toxicity testing only but also for the reduction cost, time, and labor in the Korean society. Keywords : D. magna, V. fischeri, Industrial waste water, battery test Acknowledgement This research was supported by a grant (15IFIP-B089908-02) from Plant Research Program funded by Ministry of Land, Infrastructure and Transport of Korean government

  18. Effects of N-heterocyclic polyaromatic hydrocarbons on survival, reproduction, and biochemical parameters in Daphnia magna.

    PubMed

    Feldmannová, M; Hilscherová, K; Marsálek, B; Bláha, L

    2006-08-01

    N-heterocyclic polycyclic aromatic hydrocarbons (N-PAHs) belong among newly identified classes of environmental pollutants with relatively high toxic potential. N-PAHs have been detected in air, soil, marine environments, and freshwater sediments. The N-PAHs are present at lower concentrations than their nonsubstituted analogues but their greater solubility would lead to greater bioavailibity and potential for toxic effects. Here we present results of acute and chronic toxicity in traditional aquatic invertebrate ecotoxicological model (Daphnia magna) along with assessment of biochemical responses. Studied biomarkers in D. magna exposed to N-heterocyclic derivatives included glutathione levels and activities of detoxication and antioxidative enzymes glutathione S-transferase and glutathione peroxidase. Phenanthrene and 1,10-phenathroline were the most toxic of all tested compounds (EC50 < 6 microM after 48 h exposure) and all tested N-PAHs suppressed reproduction of Daphnia magna. The data suggest that N-PAHs can induce oxidative stress in D. magna. The significant decline of glutathione content was found in animals treated with acridine, 1,10-phenanthroline, benzo(h)quinoline, phenantridine, and phenazine. Significant decrease of GPx activities relative to controls was found for all tested compounds except of phenanthrene and phenazine. Activities of GST increased after exposure to phenanthridine, phenazine, and benzo(h)quinoline, and declined in D. magna treated with phenanthrene (significant at one concentration) or anthracene (not significant). Our results confirmed significant acute as well as chronic toxicities of N-PAHs as well as potential of biochemical parameters to be used as early warning signals of toxicity in Daphnia magna. PMID:16841315

  19. Scores of extended connectivity fingerprint as descriptors in QSPR study of melting point and aqueous solubility.

    PubMed

    Zhou, Diansong; Alelyunas, Yun; Liu, Ruifeng

    2008-05-01

    QSPR studies, using scores of SciTegic's extended connectivity fingerprint as raw descriptors, were extended to the prediction of melting points and aqueous solubility of organic compounds. Robust partial least-squares models were developed that perform as well as the best published QSPR models for structurally diverse organic compounds. Satisfactory performance of the QSPR models indicates that the scores of extended connectivity fingerprint are high performance molecular descriptors for QSAR/QSPR studies. Performance of the fingerprint-based descriptors is further validated by the satisfactory prediction of aqueous solubility of nearly 1300 organic compounds (squared correlation coefficient of 0.83 and RMSE of 0.85 log unit) with Yalkowsky's general solubility equation using both calculated melting points and calculated octanol-water partition coefficients. It demonstrates for the first time that it is feasible to predict aqueous solubility of structurally diverse organic compounds with the general solubility equation using both the calculated melting points and the partition coefficients.

  20. Gas Chromatography/Atmospheric Pressure Chemical Ionization Tandem Mass Spectrometry for Fingerprinting the Macondo Oil Spill.

    PubMed

    Lobodin, Vladislav V; Maksimova, Ekaterina V; Rodgers, Ryan P

    2016-07-01

    We report the first application of a new mass spectrometry technique (gas chromatography combined to atmospheric pressure chemical ionization tandem mass spectrometry, GC/APCI-MS/MS) for fingerprinting a crude oil and environmental samples from the largest accidental marine oil spill in history (the Macondo oil spill, the Gulf of Mexico, 2010). The fingerprinting of the oil spill is based on a trace analysis of petroleum biomarkers (steranes, diasteranes, and pentacyclic triterpanes) naturally occurring in crude oil. GC/APCI enables soft ionization of petroleum compounds that form abundant molecular ions without (or little) fragmentation. The ability to operate the instrument simultaneously in several tandem mass spectrometry (MS/MS) modes (e.g., full scan, product ion scan, reaction monitoring) significantly improves structural information content and sensitivity of analysis. For fingerprinting the oil spill, we constructed diagrams and conducted correlation studies that measure the similarity between environmental samples and enable us to differentiate the Macondo oil spill from other sources.

  1. Improved fingerprint identification with supervised filtering enhancement.

    PubMed

    Bal, Abdullah; El-Saba, Aed M; Alam, Mohammad S

    2005-02-10

    An important step in the fingerprint identification system is the reliable extraction of distinct features from fingerprint images. Identification performance is directly related to the enhancement of fingerprint images during or after the enrollment phase. Among the various enhancement algorithms, artificial-intelligence-based feature-extraction techniques are attractive owing to their adaptive learning properties. We present a new supervised filtering technique that is based on a dynamic neural-network approach to develop a robust fingerprint enhancement algorithm. For pattern matching, a joint transform correlation (JTC) algorithm has been incorporated that offers high processing speed for real-time applications. Because the fringe-adjusted JTC algorithm has been found to yield a significantly better correlation output compared with alternate JTCs, we used this algorithm for the identification process. Test results are presented to verify the effectiveness of the proposed algorithm.

  2. Defining the Crystallographic Fingerprint of Extraterrestrial Treasures

    NASA Astrophysics Data System (ADS)

    Forman, L. V.; Bland, P. A.; Timms, N. E.; Daly, L.; Benedix, G. K.; Trimby, P. W.

    2016-08-01

    An approach to determine the crystallographic fingerprint of chondritic matrix grains, which is complimentary to the geochemical signature commonly identified to constrain some aspects of the petrogenesis of a sample.

  3. Chemical characterization of components in fingerprints

    SciTech Connect

    Jarboe, S.G.; Asano, K.G.; Buchanan, M.V.; Bohanan, A.

    1997-12-31

    Investigations into the chemical composition of fingerprints were initiated after it was observed that the latent fingerprints of children disappear more rapidly from surfaces than those of adults. Initial work included the use of GUMS for the identification of compounds present in fingerprints. The relative concentrations of fatty acids and alkyl esters in children and adults appear to contribute to the higher rate of disappearance of prints from the younger subjects. The presence of alkyl esters is linked to sebaceous excretions originating from the face, which increase markedly after puberty. This work has been expanded to include characterization of other classes of components, including amino acids and triacylglycerols. This research is part of an ongoing project to identify various components of fingerprints and explore possible clinical and forensic applications. Through large sampling pools, trends that can indicate personal characteristics (i.e., gender, age), habits (smoking, drug use), and health-related issues (diabetes) are being investigated.

  4. Forensic Identification of Gender from Fingerprints.

    PubMed

    Huynh, Crystal; Brunelle, Erica; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2015-11-17

    In the past century, forensic investigators have universally accepted fingerprinting as a reliable identification method, which relies mainly on pictorial comparisons. Despite developments to software systems in order to increase the probability and speed of identification, there has been limited success in the efforts that have been made to move away from the discipline's absolute dependence on the existence of a prerecorded matching fingerprint. Here, we have revealed that an information-rich latent fingerprint has not been used to its full potential. In our approach, the content present in the sweat left behind-namely the amino acids-can be used to determine physical such as gender of the originator. As a result, we were able to focus on the biochemical content in the fingerprint using a biocatalytic assay, coupled with a specially designed extraction protocol, for determining gender rather than focusing solely on the physical image.

  5. Forensic Identification of Gender from Fingerprints.

    PubMed

    Huynh, Crystal; Brunelle, Erica; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2015-11-17

    In the past century, forensic investigators have universally accepted fingerprinting as a reliable identification method, which relies mainly on pictorial comparisons. Despite developments to software systems in order to increase the probability and speed of identification, there has been limited success in the efforts that have been made to move away from the discipline's absolute dependence on the existence of a prerecorded matching fingerprint. Here, we have revealed that an information-rich latent fingerprint has not been used to its full potential. In our approach, the content present in the sweat left behind-namely the amino acids-can be used to determine physical such as gender of the originator. As a result, we were able to focus on the biochemical content in the fingerprint using a biocatalytic assay, coupled with a specially designed extraction protocol, for determining gender rather than focusing solely on the physical image. PMID:26460203

  6. Dual Resolution Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Dual Resolution Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  7. Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

    PubMed

    Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

    2008-01-01

    Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

  8. Free ionic nickel accumulation and localization in the freshwater zooplankter, Daphnia magna

    SciTech Connect

    Hall, T.M.

    1982-01-01

    The processes which lead to the accumulation of free ionic nickel (radioactive) from solution by Daphnia magna were studied and incorporated into a model which describes accummulation at different concentrations. Adsorption proved to be a relatively small component of nickel accummulation. The accummulation rate eventually approached zero, which represented an equilibrium between uptake and loss of nickel. However, elimination experiments did reveal a pool of relatively static nickel. The appearance and distribution of nickel within five body parts (body fluid, carapace, gut, filtering appendages, and eggs) of D. magna supported the accummulation data and added to the understanding of the pathways of nickel through the organism.

  9. Reproducibility of a life-cycle toxicity test with Daphnia magna

    SciTech Connect

    Parkhurst, B.R.; Forte, J.L.; Wright, G.P.

    1981-01-01

    Standardized chronic life-cycle toxicity testing procedures for aquatic species are described. The reproducibility of chronic toxicity and points using the static-renewal method with Daphnia magna are investigated. The objectives were to determine if the lowest rejected concentrations tested (LRCTs) obtained for six different toxicity criteria in static-renewal tests with acridine were reproducible over time and to determine the relative sensitivity and variability of the toxicity criteria. Two of the six toxicity criteria, numbers of young per brood and the young produced per female, were found to be reliable and sensitive for estimating the LRCT for acridine to D. magna. (RJC)

  10. Petroleum fingerprinting: Dating a gasoline release

    SciTech Connect

    Johnson, M.D.; Morrison, R.D.

    1996-09-01

    Dating a gasoline releases is particularly important in situations involving a contaminated gasoline service station. Often the station begins under the control of a major oil company, and as it ages and deteriorates it may be operated by a series of smaller operators. When facing a claim for contamination, often operators blame former operators. Fingerprinting is one of several successful methods used to date petroleum releases on contaminated sites. The topics covered in this article are inventory reconciliation; reverse groundwater modeling; hydrocarbon fingerprinting.

  11. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  12. Privacy protection schemes for fingerprint recognition systems

    NASA Astrophysics Data System (ADS)

    Marasco, Emanuela; Cukic, Bojan

    2015-05-01

    The deployment of fingerprint recognition systems has always raised concerns related to personal privacy. A fingerprint is permanently associated with an individual and, generally, it cannot be reset if compromised in one application. Given that fingerprints are not a secret, potential misuses besides personal recognition represent privacy threats and may lead to public distrust. Privacy mechanisms control access to personal information and limit the likelihood of intrusions. In this paper, image- and feature-level schemes for privacy protection in fingerprint recognition systems are reviewed. Storing only key features of a biometric signature can reduce the likelihood of biometric data being used for unintended purposes. In biometric cryptosystems and biometric-based key release, the biometric component verifies the identity of the user, while the cryptographic key protects the communication channel. Transformation-based approaches only a transformed version of the original biometric signature is stored. Different applications can use different transforms. Matching is performed in the transformed domain which enable the preservation of low error rates. Since such templates do not reveal information about individuals, they are referred to as cancelable templates. A compromised template can be re-issued using a different transform. At image-level, de-identification schemes can remove identifiers disclosed for objectives unrelated to the original purpose, while permitting other authorized uses of personal information. Fingerprint images can be de-identified by, for example, mixing fingerprints or removing gender signature. In both cases, degradation of matching performance is minimized.

  13. Fingerprint composition and aging: A literature review.

    PubMed

    Cadd, Samuel; Islam, Meez; Manson, Peter; Bleay, Stephen

    2015-07-01

    Fingerprints have a key role in criminal investigations and are the most commonly used form of evidence worldwide. Significant gaps remain however, in the understanding of fingerprint chemistry, including enhancement reaction mechanisms and the effect of environmental variables and time on composition. Determining the age of a fingerprint is also a relatively unexplored area. A successful method, with reliable and quantitative estimates, would have numerous advantages. Previous unreliable methods have predominantly focused on enhancement success based on physical and chemical changes. This review explores variations in composition due to donor characteristics and environmental variables, and identifies gaps for further research. We also present a qualitative and quantitative summary of the effect of time on composition. Kinetics are presented where known, with summary schematics for reaction mechanisms. Previous studies exploring methods for determining the age of a fingerprint are also discussed, including their advantages and disadvantages. Lastly we propose a potentially more accurate and reliable methodology for determining fingerprint age based on quantitative kinetic changes to the composition of a fingerprint over time.

  14. Quantifying the limits of fingerprint variability.

    PubMed

    Fagert, Michael; Morris, Keith

    2015-09-01

    The comparison and identification of fingerprints are made difficult by fingerprint variability arising from distortion. This study seeks to quantify both the limits of fingerprint variability when subject to heavy distortion, and the variability observed in repeated inked planar impressions. A total of 30 fingers were studied: 10 right slant loops, 10 plain whorls, and 10 plain arches. Fingers were video recorded performing several distortion movements under heavy deposition pressure: left, right, up, and down translation of the finger, clockwise and counter-clockwise torque of the finger, and planar impressions. Fingerprint templates, containing 'true' minutiae locations, were created for each finger using 10 repeated inked planar impressions. A minimal amount of variability, 0.18mm globally, was observed for minutiae in repeated inked planar impressions. When subject to heavy distortion minutiae can be displaced by upwards of 3mm and their orientation altered by as much as 30° in relation to their template positions. Minutiae displacements of 1mm and 10° changes in orientation are readily observed. The results of this study will allow fingerprint examiners to identify and understand the degree of variability that can be reasonably expected throughout the various regions of fingerprints.

  15. Comparative toxicity of leachates from 52 textiles to Daphnia magna.

    PubMed

    Dave, Göran; Aspegren, Pia

    2010-10-01

    The environmental aspects of textiles are very complex and include production, processing, transport, usage, and recycling. Textiles are made from a variety of materials and can contain a large number of chemicals. Chemicals are used during production of fibres, for preservation and colouring and they are released during normal wear and during washing. The aim of this study was to investigate the release to water of toxic chemicals from various textiles. Altogether 52 samples of textiles made from cotton (21), linen (4), cotton and linen (7), cellulose (3), synthetic fibres (7), cotton and synthetic fibres (8) and wool (2). Seven were eco-labelled. All textiles were cut into squares and placed into Petri dishes with 50 ml ISO test medium in a concentration series (4-256 cm(2)/50 ml) and tested for acute toxicity to Daphnia magna. Estimated EC50s were converted into weight/volume, and 48-h EC50s ranged between <1 and >182 g/L. It was not possible to detect any difference between fibre type and toxicity (ANOVA), but a significantly higher toxicity was found for printed versus unprinted cotton and cotton/linen textiles, while the opposite was found for synthetic textiles. Eco-labelled products were evenly distributed on a toxicity scale, which means that eco-labelling in its present form does not necessarily protect users or the environment from exposure to toxic chemicals. Therefore, the results from the present study suggest that bioassays and toxicity tests should become an integrated part of textile environmental quality control programs.

  16. Acute toxicity of the herbicide bromoxynil to Daphnia magna

    USGS Publications Warehouse

    Buhl, Kevin J.; Hamilton, Steven J.; Schmulbach, James C.

    1993-01-01

    The acute toxicities of technical-grade bromoxynil octanoate (BO) and two commercial formulations, Buctril® and Bronate®, to < 24-h-old neonate Daphnia magna (Straus) were determined in soft, hard, and oligosaline water. In addition, effects of life stage, feeding, aging the herbicide, and exposure duration on BO toxicity to daphnids were investigated. Regardless of formulation, life stage, and water quality, BO was found to be extremely to highly toxic to daphnids in standard tests; 48-h EC50 values ranged from 41 to 161 m̈g/L. Bromoxynil octanoate was the most toxic to neonates in soft water and the least toxic in hard water. The acute toxicities of the three bromoxynil herbicides to a given age group of daphnids were similar within the same water type. Overall, neonates and 7-d-old adults were more sensitive than 14- or 15-d-old adults to each herbicide. Feeding daphnids during the toxicity test significantly decreased BO toxicity compared to not feeding them. Aging BO (as Buctril) in hard water decreased its toxicity, and the rate of deactivation was rapid, with an estimated half-life of biological activity of 13 h. Daphnids immobilized by exposures to toxic BO concentrations for ≤ 6 h recovered their mobility, whereas exposures of 18 and 24 h to BO produced toxic effects in daphnids similar to those exposed for 48 h. These results indicated that standard continuous exposure tests may not adequately predict the acute toxicity of BO to freshwater animals in the field.

  17. Uncovering Cryptic Asexuality in Daphnia magna by RAD Sequencing.

    PubMed

    Svendsen, Nils; Reisser, Celine M O; Dukić, Marinela; Thuillier, Virginie; Ségard, Adeline; Liautard-Haag, Cathy; Fasel, Dominique; Hürlimann, Evelin; Lenormand, Thomas; Galimov, Yan; Haag, Christoph R

    2015-11-01

    The breeding systems of many organisms are cryptic and difficult to investigate with observational data, yet they have profound effects on a species' ecology, evolution, and genome organization. Genomic approaches offer a novel, indirect way to investigate breeding systems, specifically by studying the transmission of genetic information from parents to offspring. Here we exemplify this method through an assessment of self-fertilization vs. automictic parthenogenesis in Daphnia magna. Self-fertilization reduces heterozygosity by 50% compared to the parents, but under automixis, whereby two haploid products from a single meiosis fuse, the expected heterozygosity reduction depends on whether the two meiotic products are separated during meiosis I or II (i.e., central vs. terminal fusion). Reviewing the existing literature and incorporating recombination interference, we derive an interchromosomal and an intrachromosomal prediction of how to distinguish various forms of automixis from self-fertilization using offspring heterozygosity data. We then test these predictions using RAD-sequencing data on presumed automictic diapause offspring of so-called nonmale producing strains and compare them with "self-fertilized" offspring produced by within-clone mating. The results unequivocally show that these offspring were produced by automixis, mostly, but not exclusively, through terminal fusion. However, the results also show that this conclusion was only possible owing to genome-wide heterozygosity data, with phenotypic data as well as data from microsatellite markers yielding inconclusive or even misleading results. Our study thus demonstrates how to use the power of genomic approaches for elucidating breeding systems, and it provides the first demonstration of automictic parthenogenesis in Daphnia.

  18. An effective one-dimensional anisotropic fingerprint enhancement algorithm

    NASA Astrophysics Data System (ADS)

    Ye, Zhendong; Xie, Mei

    2012-01-01

    Fingerprint identification is one of the most important biometric technologies. The performance of the minutiae extraction and the speed of the fingerprint verification system rely heavily on the quality of the input fingerprint images, so the enhancement of the low fingerprint is a critical and difficult step in a fingerprint verification system. In this paper we proposed an effective algorithm for fingerprint enhancement. Firstly we use normalization algorithm to reduce the variations in gray level values along ridges and valleys. Then we utilize the structure tensor approach to estimate each pixel of the fingerprint orientations. At last we propose a novel algorithm which combines the advantages of onedimensional Gabor filtering method and anisotropic method to enhance the fingerprint in recoverable region. The proposed algorithm has been evaluated on the database of Fingerprint Verification Competition 2004, and the results show that our algorithm performs within less time.

  19. An effective one-dimensional anisotropic fingerprint enhancement algorithm

    NASA Astrophysics Data System (ADS)

    Ye, Zhendong; Xie, Mei

    2011-12-01

    Fingerprint identification is one of the most important biometric technologies. The performance of the minutiae extraction and the speed of the fingerprint verification system rely heavily on the quality of the input fingerprint images, so the enhancement of the low fingerprint is a critical and difficult step in a fingerprint verification system. In this paper we proposed an effective algorithm for fingerprint enhancement. Firstly we use normalization algorithm to reduce the variations in gray level values along ridges and valleys. Then we utilize the structure tensor approach to estimate each pixel of the fingerprint orientations. At last we propose a novel algorithm which combines the advantages of onedimensional Gabor filtering method and anisotropic method to enhance the fingerprint in recoverable region. The proposed algorithm has been evaluated on the database of Fingerprint Verification Competition 2004, and the results show that our algorithm performs within less time.

  20. Toward Surface-Enhanced Raman Imaging of Latent Fingerprints

    SciTech Connect

    Connatser, Raynella M; Prokes, Sharka M.; Glembocki, Orest; Schuler, Rebecca A.; Gardner, Charles W.; Lewis Sr, Samuel Arthur; Lewis, Linda A

    2010-01-01

    Exposure to light or heat, or simply a dearth of fingerprint material, renders some latent fingerprints undetectable using conventional methods. We begin to address such elusive fingerprints using detection targeting photo- and thermally stable fingerprint constituents: surface-enhanced Raman spectroscopy (SERS). SERS can give descriptive vibrational spectra of amino acids, among other robust fingerprint constituents, and good sensitivity can be attained by improving metal-dielectric nanoparticle substrates. With SERS chemical imaging, vibrational bands intensities recreate a visual of fingerprint topography. The impact of nanoparticle synthesis route, dispersal methodology-deposition solvent, and laser wavelength are discussed, as are data from enhanced vibrational spectra of fingerprint components. SERS and Raman chemical images of fingerprints and realistic contaminants are shown. To our knowledge, this represents the first SERS imaging of fingerprints. In conclusion, this work progresses toward the ultimate goal of vibrationally detecting latent prints that would otherwise remain undetected using traditional development methods.

  1. Changes in iTRAQ-Based Proteomic Profiling of the Cladoceran Daphnia magna Exposed to Microcystin-Producing and Microcystin-Free Microcystis aeruginosa.

    PubMed

    Lyu, Kai; Meng, Qingguo; Zhu, Xuexia; Dai, Daoxin; Zhang, Lu; Huang, Yuan; Yang, Zhou

    2016-05-01

    Global warming and increased nutrient fluxes cause cyanobacterial blooms in freshwater ecosystems. These phenomena have increased the concern for human health and ecosystem services. The mass occurrences of toxic cyanobacteria strongly affect freshwater zooplankton communities, especially the unselective filter feeder Daphnia. However, the molecular mechanisms of cyanobacterial toxicity remain poorly understood. This study is the first to combine the established body growth rate (BGR), which is an indicator of life-history fitness, with differential peptide labeling (iTRAQ)-based proteomics in Daphnia magna influenced by microcystin-producing (MP) and microcystin-free (MF) Microcystis aeruginosa. A significant decrease in BGR was detected when D. magna was exposed to MP or MF M. aeruginosa. Conducting iTRAQ proteomic analyses, we successfully identified and quantified 211 proteins with significant changes in expression. A cluster of orthologous groups revealed that M. aeruginosa-affected differential proteins were strongly associated with lipid, carbohydrate, amino acid, and energy metabolism. These parameters could potentially explain the reduced fitness based on the cost of the substance metabolism. PMID:27057760

  2. Dental DNA fingerprinting in identification of human remains

    PubMed Central

    Girish, KL; Rahman, Farzan S; Tippu, Shoaib R

    2010-01-01

    The recent advances in molecular biology have revolutionized all aspects of dentistry. DNA, the language of life yields information beyond our imagination, both in health or disease. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. It is being increasingly used in analyzing various scenarios related to forensic science. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. DNA is an excellent means for identification of unidentified human remains. As dental pulp is surrounded by dentin and enamel, which forms dental armor, it offers the best source of DNA for reliable genetic type in forensic science. This paper summarizes the recent literature on use of this technique in identification of unidentified human remains. PMID:21731342

  3. The detection of drugs of abuse in fingerprints using Raman spectroscopy II: cyanoacrylate-fumed fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-07-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in cyanoacrylate-fumed fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. These fingerprints were enhanced by cyanoacrylate fuming, a process in which a layer of white cyanoacrylate polymer is deposited on the fingerprint material, enabling visual detection. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were used. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in cyanoacrylate-fumed fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in cyanoacrylate-fumed fingerprints were of a similar quality to spectra obtained from the substances under normal sampling conditions, however, interfering Raman bands arising from the cyanoacrylate polymer were present in the spectra. In most cases the only interfering band was the CN stretching mode of the polymer, and there were no cases where the interfering bands prevented identification of the substances. If necessary, the interfering bands could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in cyanoacrylate-fumed fingerprints was visually locating the substance in the fingerprint beneath the polymer layer in order to obtain a Raman spectrum.

  4. Exploring the role of quantum chemical descriptors in modeling acute toxicity of diverse chemicals to Daphnia magna.

    PubMed

    Reenu; Vikas

    2015-09-01

    Various quantum-mechanically computed molecular and thermodynamic descriptors along with physico-chemical, electrostatic and topological descriptors are compared while developing quantitative structure-activity relationships (QSARs) for the acute toxicity of 252 diverse organic chemicals towards Daphnia magna. QSAR models based on the quantum-chemical descriptors, computed with routinely employed advanced semi-empirical and ab-initio methods, along with the electron-correlation contribution (CORR) of the descriptors, are analyzed for the external predictivity of the acute toxicity. The models with reliable internal stability and external predictivity are found to be based on the HOMO energy along with the physico-chemical, electrostatic and topological descriptors. Besides this, the total energy and electron-correlation energy are also observed as highly reliable descriptors, suggesting that the intra-molecular interactions between the electrons play an important role in the origin of the acute toxicity, which is in fact an unexplored phenomenon. The models based on quantum-chemical descriptors such as chemical hardness, absolute electronegativity, standard Gibbs free energy and enthalpy are also observed to be reliable. A comparison of the robust models based on the quantum-chemical descriptors computed with various quantum-mechanical methods suggests that the advanced semi-empirical methods such as PM7 can be more reliable than the ab-initio methods which are computationally more expensive.

  5. Exploring the role of quantum chemical descriptors in modeling acute toxicity of diverse chemicals to Daphnia magna.

    PubMed

    Reenu; Vikas

    2015-09-01

    Various quantum-mechanically computed molecular and thermodynamic descriptors along with physico-chemical, electrostatic and topological descriptors are compared while developing quantitative structure-activity relationships (QSARs) for the acute toxicity of 252 diverse organic chemicals towards Daphnia magna. QSAR models based on the quantum-chemical descriptors, computed with routinely employed advanced semi-empirical and ab-initio methods, along with the electron-correlation contribution (CORR) of the descriptors, are analyzed for the external predictivity of the acute toxicity. The models with reliable internal stability and external predictivity are found to be based on the HOMO energy along with the physico-chemical, electrostatic and topological descriptors. Besides this, the total energy and electron-correlation energy are also observed as highly reliable descriptors, suggesting that the intra-molecular interactions between the electrons play an important role in the origin of the acute toxicity, which is in fact an unexplored phenomenon. The models based on quantum-chemical descriptors such as chemical hardness, absolute electronegativity, standard Gibbs free energy and enthalpy are also observed to be reliable. A comparison of the robust models based on the quantum-chemical descriptors computed with various quantum-mechanical methods suggests that the advanced semi-empirical methods such as PM7 can be more reliable than the ab-initio methods which are computationally more expensive. PMID:26188798

  6. Iron-Tolerant Cyanobacteria: Ecophysiology and Fingerprinting

    NASA Technical Reports Server (NTRS)

    Brown, I. I.; Mummey, D.; Lindsey, J.; McKay, D. S.

    2006-01-01

    Although the iron-dependent physiology of marine and freshwater cyanobacterial strains has been the focus of extensive study, very few studies dedicated to the physiology and diversity of cyanobacteria inhabiting iron-depositing hot springs have been conducted. One of the few studies that have been conducted [B. Pierson, 1999] found that cyanobacterial members of iron depositing bacterial mat communities might increase the rate of iron oxidation in situ and that ferrous iron concentrations up to 1 mM significantly stimulated light dependent consumption of bicarbonate, suggesting a specific role for elevated iron in photosynthesis of cyanobacteria inhabiting iron-depositing hot springs. Our recent studies pertaining to the diversity and physiology of cyanobacteria populating iron-depositing hot springs in Great Yellowstone area (Western USA) indicated a number of different isolates exhibiting elevated tolerance to Fe(3+) (up to 1 mM). Moreover, stimulation of growth was observed with increased Fe(3+) (0.02-0.4 mM). Molecular fingerprinting of unialgal isolates revealed a new cyanobacterial genus and species Chroogloeocystis siderophila, an unicellular cyanobacterium with significant EPS sheath harboring colloidal Fe(3+) from iron enriched media. Our preliminary data suggest that some filamentous species of iron-tolerant cyanobacteria are capable of exocytosis of iron precipitated in cytoplasm. Prior to 2.4 Ga global oceans were likely significantly enriched in soluble iron [Lindsay et al, 2003], conditions which are not conducive to growth of most contemporary oxygenic cyanobacteria. Thus, iron-tolerant CB may have played important physiological and evolutionary roles in Earths history.

  7. Social media fingerprints of unemployment.

    PubMed

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets.

  8. Social Media Fingerprints of Unemployment

    PubMed Central

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

  9. Multispectral fingerprint imaging for spoof detection

    NASA Astrophysics Data System (ADS)

    Nixon, Kristin A.; Rowe, Robert K.

    2005-03-01

    Fingerprint systems are the most widespread form of biometric authentication. Used in locations such as airports and in PDA's and laptops, fingerprint readers are becoming more common in everyday use. As they become more familiar, the security weaknesses of fingerprint sensors are becoming better known. Numerous websites now exist describing in detail how to create a fake fingerprint usable for spoofing a biometric system from both a cooperative user and from latent prints. While many commercial fingerprint readers claim to have some degree of spoof detection incorporated, they are still generally susceptible to spoof attempts using various artificial fingerprint samples made from gelatin or silicone or other materials and methods commonly available on the web. This paper describes a multispectral sensor that has been developed to collect data for spoof detection. The sensor has been designed to work in conjunction with a conventional optical fingerprint reader such that all images are collected during a single placement of the finger on the sensor. The multispectral imaging device captures sub-surface information about the finger that makes it very difficult to spoof. Four attributes of the finger that are collected with the multispectral imager will be described and demonstrated in this paper: spectral qualities of live skin, chromatic texture of skin, sub-surface image of live skin, and blanching on contact. Each of these attributes is well suited to discriminating against particular kinds of spoofing samples. A series of experiments was conducted to demonstrate the capabilities of the individual attributes as well as the collective spoof detection performance.

  10. Statistical quality assessment of a fingerprint

    NASA Astrophysics Data System (ADS)

    Hwang, Kyungtae

    2004-08-01

    The quality of a fingerprint is essential to the performance of AFIS (Automatic Fingerprint Identification System). Such a quality may be classified by clarity and regularity of ridge-valley structures.1,2 One may calculate thickness of ridge and valley to measure the clarity and regularity. However, calculating a thickness is not feasible in a poor quality image, especially, severely damaged images that contain broken ridges (or valleys). In order to overcome such a difficulty, the proposed approach employs the statistical properties in a local block, which involve the mean and spread of the thickness of both ridge and valley. The mean value is used for determining whether a fingerprint is wet or dry. For example, the black pixels are dominant if a fingerprint is wet, the average thickness of ridge is larger than one of valley, and vice versa on a dry fingerprint. In addition, a standard deviation is used for determining severity of damage. In this study, the quality is divided into three categories based on two statistical properties mentioned above: wet, good, and dry. The number of low quality blocks is used to measure a global quality of fingerprint. In addition, a distribution of poor blocks is also measured using Euclidean distances between groups of poor blocks. With this scheme, locally condensed poor blocks decreases the overall quality of an image. Experimental results on the fingerprint images captured by optical devices as well as by a rolling method show the wet and dry parts of image were successfully captured. Enhancing an image by employing morphology techniques that modifying the detected poor quality blocks is illustrated in section 3. However, more work needs to be done on designing a scheme to incorporate the number of poor blocks and their distributions for a global quality.

  11. Development and validation of a Daphnia magna four-day survival and growth test method.

    PubMed

    Lazorchak, James M; Smith, Mark E; Haring, Herman J

    2009-05-01

    Zooplankton are an important part of the aquatic ecology of all lakes and streams. As a result, numerous methods have been developed to assess the quality of waterbodies using various zooplankton species. Included in these is the freshwater species Daphnia magna. Current test methods using D. magna involve acute lethality test methods ranging from 24 to 96 h in duration and chronic test methods with durations of 21 to 28 d. Whereas the current acute and chronic test methods are useful, a need exists for a shorter-duration test method that will provide a chronic or subchronic endpoint with this, species. In the present study, a 4-d, static-renewal survival and growth test was developed for use with D. magna. The test results were compared to performance criteria and results from 7-d survival and reproduction tests with Ceriodaphnia dubia to determine the level of comparability between the two methods. Results from the 4-d D. magna survival and growth test method indicated that this method will produce consistent results with various reference toxicant materials and provide data that are both reproducible and useful for detecting potential toxicity in aquatic environments.

  12. Daphnia magna transcriptome by RNA-Seq across 12 environmental stressors.

    PubMed

    Orsini, Luisa; Gilbert, Donald; Podicheti, Ram; Jansen, Mieke; Brown, James B; Solari, Omid Shams; Spanier, Katina I; Colbourne, John K; Rush, Douglas; Decaestecker, Ellen; Asselman, Jana; De Schamphelaere, Karel A C; Ebert, Dieter; Haag, Christoph R; Kvist, Jouni; Laforsch, Christian; Petrusek, Adam; Beckerman, Andrew P; Little, Tom J; Chaturvedi, Anurag; Pfrender, Michael E; De Meester, Luc; Frilander, Mikko J

    2016-01-01

    The full exploration of gene-environment interactions requires model organisms with well-characterized ecological interactions in their natural environment, manipulability in the laboratory and genomic tools. The waterflea Daphnia magna is an established ecological and toxicological model species, central to the food webs of freshwater lentic habitats and sentinel for water quality. Its tractability and cyclic parthenogenetic life-cycle are ideal to investigate links between genes and the environment. Capitalizing on this unique model system, the STRESSFLEA consortium generated a comprehensive RNA-Seq data set by exposing two inbred genotypes of D. magna and a recombinant cross of these genotypes to a range of environmental perturbations. Gene models were constructed from the transcriptome data and mapped onto the draft genome of D. magna using EvidentialGene. The transcriptome data generated here, together with the available draft genome sequence of D. magna and a high-density genetic map will be a key asset for future investigations in environmental genomics. PMID:27164179

  13. Probabilistic neural networks modeling of the 48-h LC50 acute toxicity endpoint to Daphnia magna.

    PubMed

    Niculescu, S P; Lewis, M A; Tigner, J

    2008-01-01

    Two modeling experiments based on the maximum likelihood estimation paradigm and targeting prediction of the Daphnia magna 48-h LC50 acute toxicity endpoint for both organic and inorganic compounds are reported. The resulting models computational algorithms are implemented as basic probabilistic neural networks with Gaussian kernel (statistical corrections included). The first experiment uses strictly D. magna information for 971 structures as training/learning data and the resulting model targets practical applications. The second experiment uses the same training/learning information plus additional data on another 29 compounds whose endpoint information is originating from D. pulex and Ceriodaphnia dubia. It only targets investigation of the effect of mixing strictly D. magna 48-h LC50 modeling information with small amounts of similar information estimated from related species, and this is done as part of the validation process. A complementary 81 compounds dataset (involving only strictly D. magna information) is used to perform external testing. On this external test set, the Gaussian character of the distribution of the residuals is confirmed for both models. This allows the use of traditional statistical methodology to implement computation of confidence intervals for the unknown measured values based on the models predictions. Examples are provided for the model targeting practical applications. For the same model, a comparison with other existing models targeting the same endpoint is performed.

  14. Synthesis, characterization and toxicological evaluation of Cr₂O₃ nanoparticles using Daphnia magna and Aliivibrio fischeri.

    PubMed

    Puerari, Rodrigo Costa; da Costa, Cristina H; Vicentini, Denice S; Fuzinatto, Cristiane F; Melegari, Silvia P; Schmidt, Éder C; Bouzon, Zenilda L; Matias, William G

    2016-06-01

    Chromium III oxide (Cr2O3) nanoparticles (NPs) are used in pigments for ceramics, dyes, paints and cosmetics. However, few studies addressing the toxic potential of these NPs have been reported in the literature. Thus, this research aimed to evaluate the acute and chronic effects of Cr2O3 NPs through acute toxicity tests with Daphnia magna and Aliivibrio fischeri and chronic toxicity tests with Daphnia magna. Cr2O3 NPs were synthesized by the sol-gel method and characterized through TEM, X-Ray diffraction (XRD), zeta potential (ZP) and surface area analysis. In the acute toxicity tests the EC(50,48h) value obtained with D. magna was 6.79 mg L(-1) and for A. fischeri the EC(50,15min) value was 16.10 mg L(-1) and the EC(50,30min) value was 12.91 mg L(-1). Regarding the chronic toxicity tests with D. magna, effects on longevity (OEC=1.00 mg L(-1)), reproduction (OEC=1.00 mg L(-1)) and growth (OEC=0.50 mg L(-1)) were observed. On the SEM and TEM images, ultrastructural alterations in the organelles of exposed organisms were also observed. Thus, toxicological studies with NPs are of great importance in order to reduce the risk of environmental contamination.

  15. EFFECTIVE CONCENTRATIONS OF 6 CONTAMINANTS TO LEMMA MINOR, PIMEPHALES PROMELA, DAPHNIA MAGNA, AND CERIODAPHNIA DUBIA

    EPA Science Inventory

    The research presented here resulted in EC50 and LOEC values for the contaminants copper, cadmium, diazinon, atrazine, and cyanide to the species Lemna Minor, Pimephales promelas, Daphnia magna, and Ceriodaphnia dubia. Observed values were used as benchmarks for assessing the se...

  16. Development and validation of a Daphnia magna four-day survival and growth test method

    EPA Science Inventory

    Zooplankton are an important part of the aquatic ecology of all lakes and streams. As a result, numerous methods have been developed to assess the quality of waterbodies using various zooplankton species. Included in these is the freshwater species Daphnia magna. Current test me...

  17. Growth of Daphnia magna exposed to mixtures of chemicals with diverse modes of action

    SciTech Connect

    Deneer, J.W.; Seinen, W.; Hermens, J.L.

    1988-02-01

    Concentrations causing inhibition of growth of Daphnia magna after 16 days of exposure were determined for nine chemicals that presumably act through different modes of action. The joint toxic effect of a mixture of these chemicals is found to be nonadditive.

  18. Impact of imidacloprid on Daphnia magna under different food quality regimes.

    PubMed

    Ieromina, Oleksandra; Peijnenburg, Willie J G M; de Snoo, Geert; Müller, Jutta; Knepper, Thomas P; Vijver, Martina G

    2014-03-01

    Aquatic ecosystems are characterized by fluctuating conditions that have direct effects on aquatic communities but also indirect influences such as changing the toxicity of chemicals. Because the effect of food quality on pesticide toxicity has rarely been studied, in the present study Daphnia magna juveniles supplied with 4 different food quality levels were exposed to a range of imidacloprid concentrations for 21 d. Food quality was expressed as carbon:phosphorus ratios of algae Pseudokirchneriella subcapitata (C:P 35, C:P 240, C:P 400, and C:P 1300). Survival, growth rates, and reproduction of D. magna were monitored, and the combined effects of imidacloprid exposure and the phosphorus content of algae were analyzed. A stronger effect on survival was observed at the P-deficient diet (C:P 1300), confirmed by lower 10% effect concentration (EC10) values at days 7, 9, 15, and 21 compared with diets with higher phosphorus contents. Similarly, the growth rate was reduced when D. magna were supplied with algae of low phosphorus content at imidacloprid exposure conditions. The highest reproductive output was observed for D. magna fed the optimal phosphorus diet (C:P 240), both at control and exposed conditions. Poor food quality increased the sensitivity of nontarget species to pesticide exposure, potentially leading to an underestimation of adverse effects on aquatic communities in the field.

  19. Bioaccumulation and oxidative stress in Daphnia magna exposed to arsenite and arsenate.

    PubMed

    Fan, Wenhong; Ren, Jinqian; Li, Xiaomin; Wei, Chaoyang; Xue, Feng; Zhang, Nan

    2015-11-01

    Arsenic pollution and its toxicity to aquatic organisms have attracted worldwide attention. The bioavailability and toxicity of arsenic are highly related to its speciation. The present study investigated the differences in bioaccumulation and oxidative stress responses in an aquatic organism, Daphnia magna, induced by 2 inorganic arsenic species (As(III) and As(V)). The bioaccumulation of arsenic, Na(+) /K(+) -adenosine triphosphatase (ATPase) activity, reactive oxygen species (ROS) content, total superoxide dismutase (SOD) activity, total antioxidative capability, and malondialdehyde content in D. magna were determined after exposure to 500 µg/L of arsenite and arsenate for 48 h. The results showed that the oxidative stress and antioxidative process in D. magna exposed to arsenite and arsenate could be divided into 3 phases, which were antioxidative response, oxidation inhibition, and antioxidative recovery. In addition, differences in bioaccumulation, Na(+) /K(+) -ATPase activity, and total SOD activity were also found in D. magna exposed to As(III) and As(V). These differences might have been the result of the high affinity of As(III) with sulfhydryl groups in enzymes and the structural similarity of As(V) to phosphate. Therefore, arsenate could be taken up by organisms through phosphate transporters, could substitute for phosphate in biochemical reactions, and could lead to a change in the bioaccumulation of arsenic and activity of enzymes. These characteristics were the possible reasons for the different toxicity mechanisms in the oxidative stress process of arsenite and arsenate.

  20. [Lifetime of hydrobionts Daphnia magna in a noncontact-activated water].

    PubMed

    Iksanova, T I; Stekhin, A A; Iakovleva, G V; Kamentskaia, D B

    2015-01-01

    The article is devoted to the study of the influence of non-contact activated water on the lifetime and replicative function of aquatic organisms Daphnia magna, belonging to a highly organized animal organisms. There was established the proportional relationship between the concentration of hydrogen peroxide (in the anion-radical form) and the duration of aquatic lifetime of hydrobionts. In a non contact activated water media with values of redox -potential (Eh)~130mV (against Eh = 213mV--in the control) the lifetime of hydrobionts Daphnia magna is shown to increase in average up to 9 days and reaches 34 days (as 25 days in the control). Replicative junction activated in the aquatic environment does not change, but there was noted a delay in the time of dropping by 7 days in average. Noted regularities in the change in the lifetime of aquatic organisms Daphnia magna in aquatic activated environments are interpreted on the basis of the dependence of the proliferative activity of cells on the concentration of hydrogen peroxide in water. The obtained data on lifetime of Daphnia magna in activated electron-donor environments can serve as proof of the hygienic safety and biological activity of physically-activated (non-contact) drinking water.

  1. Genome sequence of Shinella sp. strain DD12, isolated from homogenized guts of starved Daphnia magna.

    PubMed

    Poehlein, Anja; Freese, Heike; Daniel, Rolf; Simeonova, Diliana D

    2016-01-01

    Shinella sp. strain DD12, a novel phosphite assimilating bacterium, has been isolated from homogenized guts of 4 days starved zooplankton Daphnia magna. Here we report the draft genome of this bacterium, which comprises 7,677,812 bp and 7505 predicted protein-coding genes.

  2. Daphnia magna transcriptome by RNA-Seq across 12 environmental stressors

    PubMed Central

    Orsini, Luisa; Gilbert, Donald; Podicheti, Ram; Jansen, Mieke; Brown, James B.; Solari, Omid Shams; Spanier, Katina I.; Colbourne, John K.; Rush, Douglas; Decaestecker, Ellen; Asselman, Jana; De Schamphelaere, Karel A.C.; Ebert, Dieter; Haag, Christoph R.; Kvist, Jouni; Laforsch, Christian; Petrusek, Adam; Beckerman, Andrew P.; Little, Tom J.; Chaturvedi, Anurag; Pfrender, Michael E.; De Meester, Luc; Frilander, Mikko J.

    2016-01-01

    The full exploration of gene-environment interactions requires model organisms with well-characterized ecological interactions in their natural environment, manipulability in the laboratory and genomic tools. The waterflea Daphnia magna is an established ecological and toxicological model species, central to the food webs of freshwater lentic habitats and sentinel for water quality. Its tractability and cyclic parthenogenetic life-cycle are ideal to investigate links between genes and the environment. Capitalizing on this unique model system, the STRESSFLEA consortium generated a comprehensive RNA-Seq data set by exposing two inbred genotypes of D. magna and a recombinant cross of these genotypes to a range of environmental perturbations. Gene models were constructed from the transcriptome data and mapped onto the draft genome of D. magna using EvidentialGene. The transcriptome data generated here, together with the available draft genome sequence of D. magna and a high-density genetic map will be a key asset for future investigations in environmental genomics. PMID:27164179

  3. Synthesis, characterization and toxicological evaluation of Cr₂O₃ nanoparticles using Daphnia magna and Aliivibrio fischeri.

    PubMed

    Puerari, Rodrigo Costa; da Costa, Cristina H; Vicentini, Denice S; Fuzinatto, Cristiane F; Melegari, Silvia P; Schmidt, Éder C; Bouzon, Zenilda L; Matias, William G

    2016-06-01

    Chromium III oxide (Cr2O3) nanoparticles (NPs) are used in pigments for ceramics, dyes, paints and cosmetics. However, few studies addressing the toxic potential of these NPs have been reported in the literature. Thus, this research aimed to evaluate the acute and chronic effects of Cr2O3 NPs through acute toxicity tests with Daphnia magna and Aliivibrio fischeri and chronic toxicity tests with Daphnia magna. Cr2O3 NPs were synthesized by the sol-gel method and characterized through TEM, X-Ray diffraction (XRD), zeta potential (ZP) and surface area analysis. In the acute toxicity tests the EC(50,48h) value obtained with D. magna was 6.79 mg L(-1) and for A. fischeri the EC(50,15min) value was 16.10 mg L(-1) and the EC(50,30min) value was 12.91 mg L(-1). Regarding the chronic toxicity tests with D. magna, effects on longevity (OEC=1.00 mg L(-1)), reproduction (OEC=1.00 mg L(-1)) and growth (OEC=0.50 mg L(-1)) were observed. On the SEM and TEM images, ultrastructural alterations in the organelles of exposed organisms were also observed. Thus, toxicological studies with NPs are of great importance in order to reduce the risk of environmental contamination. PMID:26890188

  4. Impact of imidacloprid on Daphnia magna under different food quality regimes.

    PubMed

    Ieromina, Oleksandra; Peijnenburg, Willie J G M; de Snoo, Geert; Müller, Jutta; Knepper, Thomas P; Vijver, Martina G

    2014-03-01

    Aquatic ecosystems are characterized by fluctuating conditions that have direct effects on aquatic communities but also indirect influences such as changing the toxicity of chemicals. Because the effect of food quality on pesticide toxicity has rarely been studied, in the present study Daphnia magna juveniles supplied with 4 different food quality levels were exposed to a range of imidacloprid concentrations for 21 d. Food quality was expressed as carbon:phosphorus ratios of algae Pseudokirchneriella subcapitata (C:P 35, C:P 240, C:P 400, and C:P 1300). Survival, growth rates, and reproduction of D. magna were monitored, and the combined effects of imidacloprid exposure and the phosphorus content of algae were analyzed. A stronger effect on survival was observed at the P-deficient diet (C:P 1300), confirmed by lower 10% effect concentration (EC10) values at days 7, 9, 15, and 21 compared with diets with higher phosphorus contents. Similarly, the growth rate was reduced when D. magna were supplied with algae of low phosphorus content at imidacloprid exposure conditions. The highest reproductive output was observed for D. magna fed the optimal phosphorus diet (C:P 240), both at control and exposed conditions. Poor food quality increased the sensitivity of nontarget species to pesticide exposure, potentially leading to an underestimation of adverse effects on aquatic communities in the field. PMID:24288231

  5. The Role of Secure Knowledge in Enabling Year 7 to Write Essays on Magna Carta

    ERIC Educational Resources Information Center

    King, Mark

    2015-01-01

    Setting out to teach Magna Carta to the full attainment range in Year 7, Mark King decided to choose a question that reflected real scholarly debates and also to ensure that pupils held enough knowledge in long-term memory to be able to think about that question meaningfully. As he gradually prepared his pupils to produce their own causation…

  6. Mule deer (Odocoileus hemionus) and elk (Cervus elaphus) as experimental definitive hosts for Fascioloides magna.

    PubMed

    Foreyt, W J

    1996-10-01

    In August 1992, six mule deer (Odocoileus hemionus hemionus) fawns and four elk (Cervus elaphus) calves (n = 2) or yearlings (n = 2) each were inoculated orally with 50, 250, or 2,000 metacercariae of the liver fluke Fascioloides magna to evaluate their potential to serve as definitive hosts. Animals were maintained for up to 403 days. Three mule deer each inoculated with 50 metacercariae survived the infection and shed eggs in feces; thus mule deer can function as definitive hosts for F. magna. The other three mule deer inoculated with 50 (n = 1) or 250 (n = 2) metacercariae died from fluke infection on days 91, 150, and 162 days postinoculation, respectively, and only immature F. magna were recovered. One elk calf inoculated with 2,000 metacercariae died from fluke infection 44 days after inoculation. The remaining three elk, each inoculated with 250 metacercariae, survived infection, and two of the three shed eggs in feces. The third elk contained only one immature F. magna at necropsy. The prepatent period in mule deer and elk was approximately 6 to 7 months.

  7. Activity-relevant similarity values for fingerprints and implications for similarity searching

    PubMed Central

    Jasial, Swarit; Hu, Ye; Vogt, Martin; Bajorath, Jürgen

    2016-01-01

    A largely unsolved problem in chemoinformatics is the issue of how calculated compound similarity relates to activity similarity, which is central to many applications. In general, activity relationships are predicted from calculated similarity values. However, there is no solid scientific foundation to bridge between calculated molecular and observed activity similarity. Accordingly, the success rate of identifying new active compounds by similarity searching is limited. Although various attempts have been made to establish relationships between calculated fingerprint similarity values and biological activities, none of these has yielded generally applicable rules for similarity searching. In this study, we have addressed the question of molecular versus activity similarity in a more fundamental way. First, we have evaluated if activity-relevant similarity value ranges could in principle be identified for standard fingerprints and distinguished from similarity resulting from random compound comparisons. Then, we have analyzed if activity-relevant similarity values could be used to guide typical similarity search calculations aiming to identify active compounds in databases. It was found that activity-relevant similarity values can be identified as a characteristic feature of fingerprints. However, it was also shown that such values cannot be reliably used as thresholds for practical similarity search calculations. In addition, the analysis presented herein helped to rationalize differences in fingerprint search performance. PMID:27127620

  8. Influence of food, aquatic humus, and alkalinity on methylmercury uptake by Daphnia magna

    SciTech Connect

    Monson, B.A.; Brezonik, P.L.

    1999-03-01

    Six-day-old Daphnia magna were exposed to low concentrations of methylmercury (MeHg) in synthetic freshwater and synthetic food. Uptake kinetics were determined in 24- to 72-h experiments, measuring both the loss of Hg from water and accumulation in D. magna. Dose-uptake response was linear for MeHg concentrations up to 4.0 ng/L; an initial concentration of 2.0 ng/L was used when other factors were varied. Concentrations of total Hg and MeHg in water and D. magna were measured in treatments with varied hardness and alkalinity, aquatic humus (AH), and food spiked with MeHg versus water spiked with MeHg. Uptake rate coefficients were derived from two versions of a first-order, two-compartment model. The first version assumed constant MeHg concentration; the second accounted for changing MeHg concentration in water over time. Both models accounted for a nonzero starting concentration of MeHg in plankton. Fitted rate coefficients were higher for the second model than the first: the uptake coefficient (k{sub u}) was nine times higher; the depuration coefficient (k{sub d}) was twice as high. Assuming a constant MeHg concentration for a one-time spike thus underestimated the rate coefficient. The source of MeHg was compared by exposing D. magna for 48 h to MeHg at 2 ng/L in food or water. Daphnia magna accumulated significantly more inorganic Hg (i.e., Hg{sup 2+}) from spiked food than from spiked water, but accumulation of MeHg was the same from both sources. A similar response was found when D. magna were exposed to a lake water extraction of AH at concentrations of C at 3 and 10 mg/L. At the higher AH concentration, total Hg in daphnids was higher, but MeHg was lower, suggesting that AH was a source of inorganic Hg but reduced the bioavailability of MeHg. Exposure of D. magna to MeHg at 2 ng/L in hard or soft water adjusted to pH 6.7 showed no significant difference in MeHg uptake, supporting an argument that hardness and alkalinity per se do not affect MeHg uptake by

  9. Dynamic multipathway modeling of Cd bioaccumulation in Daphnia magna using waterborne and dietborne exposures.

    PubMed

    Goulet, Richard R; Krack, Susannah; Doyle, Patrick J; Hare, Landis; Vigneault, Bernard; McGeer, James C

    2007-02-28

    We tested the predictive ability of the dynamic multipathway bioaccumulation model (DYMBAM) to characterize Cd accumulation in Daphnia magna, a species commonly used in toxicity tests and because of its sensitivity, particularly to metals, a species that is relied upon in ecological risk assessments. We conducted chronic exposure experiments in which D. magna were exposed to either dietborne Cd alone or to both dietborne and waterborne Cd. In the food-only treatments, the algae Chlamydomonas reinhardtii or Pseudokirchneriella subcapitata were pre-exposed to free Cd ion concentrations, [Cd(2+)], from 0.001 to 100nM (0.001-11microgL(-1)) then, on a daily feeding renewal basis, fed to D. magna over 21 days. In the water plus food treatment, D. magna were exposed for 21 days to the same range of [Cd(2+)] and fed with the same algal species that had been exposed to Cd at various concentrations. In the algal exposure media, Cd concentrations in algae were directly related to those in water and were characterized by a linear regression model using the log transformed concentration of the WHAM predicted Cd(2+) concentration. The DYMBAM was used with estimated values of the model constants for ingestion rate (0.08-0.34gg(-1)day(-1)) and growth rate (0.085-0.131day(-1)) based on our experimental data and with literature values for rate constants of Cd influx and efflux as well as Cd assimilation efficiency. Measured Cd concentrations in D. magna agreed with model predictions within a factor of 3. Using the model, we predict that food is an important contributor of Cd burden to D. magna, particularly at lower Cd exposure concentrations over an environmentally realistic gradient of free Cd in water. However, this cladoceran also takes up Cd from water and this exposure route becomes increasingly important at very high concentrations of free Cd (>10nM or 1.1microgL(-1)). Nevertheless, Cd produced lethal effects in D. magna that were exposed to this metal in water and diet, but

  10. Chronic toxicity of dietary copper to Daphnia magna.

    PubMed

    De Schamphelaere, K A C; Forrez, I; Dierckens, K; Sorgeloos, P; Janssen, C R

    2007-03-30

    There is a growing concern that dietborne metal toxicity might be important in aquatic ecosystems. However, the science behind this matter is insufficiently developed to explicitly and accurately account for this in metal regulation or risk assessment. We investigated the effects of a chronic exposure of Daphnia magna to an elevated level of Cu (3000 microg Cu/g dry wt) in their diet (the green alga Pseudokirchneriella subcapitata). Compared to daphnids fed with P. subcapitata containing a background of 10.6 microg Cu/g dry wt, daphnids fed for 21 days with this Cu-contaminated food accumulated a total copper body burden of 325 microg Cu/g dry wt, which is about 30-fold higher than the control body burden of 12.1 microg/g dry wt. The exposed daphnids experienced a 38% reduction of growth (measured as final dry body weight), a 50% reduction of reproduction (total number of juveniles produced per daphnid), and only produced three broods versus four broods by the control daphnids. Unlike most other studies, we were able to demonstrate that these effects were most likely not due to a reduced nutritional quality of the food, based on C:P ratios and fatty acid content and composition of the Cu-contaminated algae. Life-history analysis showed that time to first brood was not affected by dietary Cu, while the second and third broods were significantly delayed by 0.7 and 1.5 days, respectively. On the other hand, brood sizes of all three broods were significantly lower in Cu exposed daphnids, i.e. by 32-55%. The variety of effects observed suggest the possible, and perhaps simultaneous, involvement of several toxicity mechanisms such as increased metabolic cost, reduced energy acquisition (potentially via inhibition of digestive enzyme activity), targeted inhibition of reproduction (potentially via inhibition of vitellogenesis), and/or direct inhibition of molting. Further research is needed to differentiate between these postulated mechanisms of dietary Cu toxicity and to

  11. DNA fingerprinting in botany: past, present, future

    PubMed Central

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined “Fingerprint News” was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on “DNA fingerprinting: approaches and applications”. Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting (“the past”) was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as “DNA fingerprinting in the present”, and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA

  12. DNA fingerprinting in botany: past, present, future.

    PubMed

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-03

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  13. Impact of Finger Type in Fingerprint Authentication

    NASA Astrophysics Data System (ADS)

    Gafurov, Davrondzhon; Bours, Patrick; Yang, Bian; Busch, Christoph

    Nowadays fingerprint verification system is the most widespread and accepted biometric technology that explores various features of the human fingers for this purpose. In general, every normal person has 10 fingers with different size. Although it is claimed that recognition performance with little fingers can be less accurate compared to other finger types, to our best knowledge, this has not been investigated yet. This paper presents our study on the topic of influence of the finger type into fingerprint recognition performance. For analysis we employ two fingerprint verification software packages (one public and one commercial). We conduct test on GUC100 multi sensor fingerprint database which contains fingerprint images of all 10 fingers from 100 subjects. Our analysis indeed confirms that performance with small fingers is less accurate than performance with the others fingers of the hand. It also appears that best performance is being obtained with thumb or index fingers. For example, performance deterioration from the best finger (i.e. index or thumb) to the worst fingers (i.e. small ones) can be in the range of 184%-1352%.

  14. Verification watermarks on fingerprint recognition and retrieval

    NASA Astrophysics Data System (ADS)

    Yeung, Minerva M.; Pankanti, Sharatchandra

    2000-10-01

    Current `invisible' watermarking techniques aim at producing watermarked data that suffer no or little quality degradation and are perceptually identical to the original versions. The most common utility of a watermarked image is (1) for image viewing and display, and (2) for extracting the embedded watermark in subsequent copy protection applications. The issue is often centered on the robustness of the watermark for detection and extraction. In addition to robustness studies, a fundamental question will center on the utilization value of the watermarked images beyond perceptual quality evaluation. Essentially we have to study how the watermarks inserted affect the subsequent processing and utility of images, and what watermarking schemes we can develop that will cater to these processing tasks. This work focuses on the study of watermarking on images used in automatic personal identification technology based on fingerprints. We investigate the effects of watermarking fingerprint images on the recognition and retrieval accuracy using a proposed invisible fragile watermarking technique for image verification applications on a specific fingerprint recognition system. We shall also describe the watermarking scheme, fingerprint recognition and feature extraction techniques used. We believe that watermarking of images will provide value-added protection, as well as copyright notification capability, to the fingerprint data collection processes and subsequent usage.

  15. Verification watermarks on fingerprint recognition and retrieval

    NASA Astrophysics Data System (ADS)

    Pankanti, Sharatchandra; Yeung, Minerva M.

    1999-04-01

    Current 'invisible' watermarking techniques aim at producing watermarked data that suffer no or little quality degradation and perceptually identical to the original versions. The most common utility of a watermarked image is (1) for image viewing and display, and (2) for extracting the embedded watermark in subsequent copy protection applications. The issue is often centered on the robustness of the watermark for detection and extraction. In addition to robustness studies, a fundamental question will center on the utilization value of the watermarked images beyond perceptual quality evaluation. Essentially we have to study how the watermarks inserted affect the subsequent processing and utility of images, and what watermarking schemes we can develop that will cater to these processing tasks. This work focuses on the study of watermarking on images used in automatic personal identification technology based fingerprints. We investigate the effects of watermarking fingerprint images on the recognition and retrieval accuracy using a proposed invisible fragile watermarking technique for image verification applications on a specific fingerprint recognition system. We shall also describe the watermarking scheme, fingerprint recognition and feature extraction techniques used. We believe that watermarking of images will provided value-added protection, as well as copyright notification capability, to the fingerprint data collection processes and subsequent usage.

  16. Visualization of latent fingerprint corrosion of brass.

    PubMed

    Bond, John W

    2009-09-01

    Visualization of latent fingerprint deposits on metals by enhancing the fingerprint-induced corrosion is now an established technique. However, the corrosion mechanism itself is less well understood. Here, we describe the apparatus constructed to measure the spatial variation (DeltaV) in applied potential (V) over the surface of brass disks corroded by latent fingerprint deposits. Measurement of DeltaV for potential of 1400 V has enabled visualization of fingerprint ridges and characteristics in terms of this potential difference with DeltaV typically of a few volts. This visualization is consistent with the formation of a Schottky barrier at the brass-corrosion product junction. Measurement of the work function of the corroded brass of up to 4.87 +/- 0.03 eV supports previous results that suggested that the corrosion product is composed of p-type copper oxides. A model for the galvanic corrosion of brass by ionic salts present in fingerprint deposits is proposed that is consistent with these experimental results.

  17. Enhancement of toxic effects of phenanthrene to Daphnia magna due to the presence of suspended sediment.

    PubMed

    Zhang, Xiaotian; Xia, Xinghui; Dong, Jianwei; Bao, Yimeng; Li, Husheng

    2014-06-01

    In the present work, the influences of suspended sediment (SPS) on the toxic effects of phenanthrene (PHE), one kind of polycyclic aromatic hydrocarbons, to Daphnia magna was studied using a dialysis bag simulation system, which equalized the freely dissolved concentration of PHE between outside the dialysis bag in the presence of SPS and inside the dialysis bag in the absence of SPS. The immobilization and total superoxide dismutase (T-SOD) activity of Daphnia magna caused by PHE (0-0.8 mg L(-1)) were investigated under the influence of different SPS concentrations (0, 1, 3, 5 g L(-1)) during a 96 h-exposure. The results showed that, compared to the absence of SPS, the presence of SPS (1-5 g L(-1)) increased the immobilization of Daphnia magna by 1.6-2.7 times when the freely dissolved concentration of PHE was identical in both systems. The inhibition of T-SOD activity of Daphnia magna by PHE was significantly greater in the presence of SPS than in the absence of SPS (p<0.01). This infers that the PHE sorbed on SPS might be bioavailable and enhanced the toxic effect of PHE to Daphnia magna. The bioavailable fraction of PHE sorbed on SPS ranged from 10.1% to 22.7%, and the contribution of PHE sorbed on SPS to the immobilization caused by total PHE in the exposure system increased with SPS concentration, with the contribution ratio increasing from 36.7% to 57.7% when SPS concentration increased from 1 to 5 g L(-1). This study suggests that only considering the concentrations of hydrophobic organic compounds in the water phase may underestimate their toxicity; and the hydrophobic organic compounds sorbed on SPS should not be ignored in assessment of water quality and the establishment of water quality standard in the future.

  18. Rapid changes in water hardness and alkalinity: Calcite formation is lethal to Daphnia magna.

    PubMed

    Bogart, Sarah J; Woodman, Samuel; Steinkey, Dylan; Meays, Cindy; Pyle, Greg G

    2016-07-15

    There is growing concern that freshwater ecosystems may be negatively affected by ever-increasing anthropogenic inputs of extremely hard, highly alkaline effluent containing large quantities of Ca(2+), Mg(2+), CO3(2-), and HCO3(-) ions. In this study, the toxicity of rapid and extreme shifts in water hardness (38-600mg/L as CaCO3) and alkalinity (30-420mg/L as CaCO3) to Daphnia magna was tested, both independently and in combination. Within these ranges, where no precipitation event occurred, shifts in water hardness and/or alkalinity were not toxic to D. magna. In contrast, 98-100% of D. magna died within 96h after exposure to 600mg/L as CaCO3 water hardness and 420mg/L as CaCO3 alkalinity (LT50 of 60h with a 95% CI of 54.2-66.0h). In this treatment, a CaCO3 (calcite) precipitate formed in the water column which was ingested by and thoroughly coated the D. magna. Calcite collected from a mining impacted stream contained embedded organisms, suggesting field streams may also experience similar conditions and possibly increased mortality as observed in the lab tests. Although further investigation is required to determine the exact fate of aquatic organisms exposed to rapid calcite precipitation in the field, we caution that negative effects may occur more quickly or at lower concentrations of water hardness and alkalinity in which we observed effects in D. magna, because some species, such as aquatic insects, are more sensitive than cladocerans to changes in ionic strength. Our results provide evidence that both calcite precipitation and the major ion balance of waters should be managed in industrially affected ecosystems and we support the development of a hardness+alkalinity guideline for the protection of aquatic life.

  19. Rapid changes in water hardness and alkalinity: Calcite formation is lethal to Daphnia magna.

    PubMed

    Bogart, Sarah J; Woodman, Samuel; Steinkey, Dylan; Meays, Cindy; Pyle, Greg G

    2016-07-15

    There is growing concern that freshwater ecosystems may be negatively affected by ever-increasing anthropogenic inputs of extremely hard, highly alkaline effluent containing large quantities of Ca(2+), Mg(2+), CO3(2-), and HCO3(-) ions. In this study, the toxicity of rapid and extreme shifts in water hardness (38-600mg/L as CaCO3) and alkalinity (30-420mg/L as CaCO3) to Daphnia magna was tested, both independently and in combination. Within these ranges, where no precipitation event occurred, shifts in water hardness and/or alkalinity were not toxic to D. magna. In contrast, 98-100% of D. magna died within 96h after exposure to 600mg/L as CaCO3 water hardness and 420mg/L as CaCO3 alkalinity (LT50 of 60h with a 95% CI of 54.2-66.0h). In this treatment, a CaCO3 (calcite) precipitate formed in the water column which was ingested by and thoroughly coated the D. magna. Calcite collected from a mining impacted stream contained embedded organisms, suggesting field streams may also experience similar conditions and possibly increased mortality as observed in the lab tests. Although further investigation is required to determine the exact fate of aquatic organisms exposed to rapid calcite precipitation in the field, we caution that negative effects may occur more quickly or at lower concentrations of water hardness and alkalinity in which we observed effects in D. magna, because some species, such as aquatic insects, are more sensitive than cladocerans to changes in ionic strength. Our results provide evidence that both calcite precipitation and the major ion balance of waters should be managed in industrially affected ecosystems and we support the development of a hardness+alkalinity guideline for the protection of aquatic life. PMID:27060657

  20. Behavioral responses of juvenile Daphnia magna after exposure to glyphosate and glyphosate-copper complexes.

    PubMed

    Hansen, Lone Rykær; Roslev, Peter

    2016-10-01

    Glyphosate (N-(phosphonomethyl)glycine) is the active ingredient in a range of popular broad-spectrum herbicide formulations. Glyphosate is a chelating agent that can form stable complexes with divalent metal ions including Cu(II). Little is known about the bioavailability and ecotoxicity of glyphosate-Cu(II) complexes to aquatic organisms. In this study, we used video tracking and behavior analysis to investigate sublethal effects of binary mixtures of glyphosate and Cu(II) to juvenile D. magna. Behavioral responses were quantified for individual D. magna after 24h and 48h exposure to glyphosate and glyhosate-Cu(II) mixtures. Sublethal concentrations resulted in decreases in swimming velocity, acceleration speed, and distance moved whereas inactive time of D. magna increased. Distance moved and inactive time were the most responsive parameters to glyphosate and glyphosate-Cu(II) exposure. On a molar basis, glyphosate-Cu(II) complexes appeared more toxic to D. magna than glyphosate alone. The 48h EC50 for glyphosate and glyphosate-Cu(II) determined from swimming distance were 75.2μM and 8.4μM, respectively. In comparison, traditional visual observation of mobility resulted in 48h EC50 values of 52.8μM and 25.5μM for glyphosate and glyphosate-Cu(II), respectively. The behavioral responses indicated that exposure of D. magna to mixtures of glyphosate and Cu(II) attenuated acute metal toxicity but increased apparent glyphosate toxicity due to complexation with Cu(II). The study suggests that glyphosate is a likely mediator of aquatic metal toxicity, and that video tracking provides an opportunity for quantitative studies of sublethal effects of pesticide complexes.

  1. Behavioral responses of juvenile Daphnia magna after exposure to glyphosate and glyphosate-copper complexes.

    PubMed

    Hansen, Lone Rykær; Roslev, Peter

    2016-10-01

    Glyphosate (N-(phosphonomethyl)glycine) is the active ingredient in a range of popular broad-spectrum herbicide formulations. Glyphosate is a chelating agent that can form stable complexes with divalent metal ions including Cu(II). Little is known about the bioavailability and ecotoxicity of glyphosate-Cu(II) complexes to aquatic organisms. In this study, we used video tracking and behavior analysis to investigate sublethal effects of binary mixtures of glyphosate and Cu(II) to juvenile D. magna. Behavioral responses were quantified for individual D. magna after 24h and 48h exposure to glyphosate and glyhosate-Cu(II) mixtures. Sublethal concentrations resulted in decreases in swimming velocity, acceleration speed, and distance moved whereas inactive time of D. magna increased. Distance moved and inactive time were the most responsive parameters to glyphosate and glyphosate-Cu(II) exposure. On a molar basis, glyphosate-Cu(II) complexes appeared more toxic to D. magna than glyphosate alone. The 48h EC50 for glyphosate and glyphosate-Cu(II) determined from swimming distance were 75.2μM and 8.4μM, respectively. In comparison, traditional visual observation of mobility resulted in 48h EC50 values of 52.8μM and 25.5μM for glyphosate and glyphosate-Cu(II), respectively. The behavioral responses indicated that exposure of D. magna to mixtures of glyphosate and Cu(II) attenuated acute metal toxicity but increased apparent glyphosate toxicity due to complexation with Cu(II). The study suggests that glyphosate is a likely mediator of aquatic metal toxicity, and that video tracking provides an opportunity for quantitative studies of sublethal effects of pesticide complexes. PMID:27564378

  2. Solving the Mystery of Fading Fingerprints with London Dispersion Forces.

    ERIC Educational Resources Information Center

    Kimbrough, Doris R.; DeLorenzo, Ronald

    1998-01-01

    Focuses on the kidnapping of a child whose fingerprints were not found inside the crime vehicle. Discusses the investigation that followed and led to knowledge of the differences between the fingerprints of children and adults. (DDR)

  3. Localized Dictionaries Based Orientation Field Estimation for Latent Fingerprints.

    PubMed

    Xiao Yang; Jianjiang Feng; Jie Zhou

    2014-05-01

    Dictionary based orientation field estimation approach has shown promising performance for latent fingerprints. In this paper, we seek to exploit stronger prior knowledge of fingerprints in order to further improve the performance. Realizing that ridge orientations at different locations of fingerprints have different characteristics, we propose a localized dictionaries-based orientation field estimation algorithm, in which noisy orientation patch at a location output by a local estimation approach is replaced by real orientation patch in the local dictionary at the same location. The precondition of applying localized dictionaries is that the pose of the latent fingerprint needs to be estimated. We propose a Hough transform-based fingerprint pose estimation algorithm, in which the predictions about fingerprint pose made by all orientation patches in the latent fingerprint are accumulated. Experimental results on challenging latent fingerprint datasets show the proposed method outperforms previous ones markedly.

  4. A fingerprint inpainting technique using improved partial differential equation methods

    NASA Astrophysics Data System (ADS)

    Yang, Xiukun; Wang, Dan; Yang, Zhigang

    2011-10-01

    In an automatic fingerprint identification system (AFIS), fingerprint inpainting is a critical step in the preprocessing procedures. Because partially fouled, breaking or scratched latent fingerprint is difficult to be correctly matched to a known fingerprint. However, fingerprint restoration proved to be a particularly challenging problem because conventional image restoration schemes can not be directly applied to fingerprint due to the unique ridge and valley structures in typical fingerprint images. Based on partial differential equations algorithm, this paper presents a fingerprint restoration algorithm composing gradient and orientation field. According to gradient and orientation field of the known pixel points, different weights are used in different orientation field in the restoration process. Experimental results demonstrate that the proposed restoration algorithm can effectively reduce the false feature points.

  5. Audio fingerprint extraction for content identification

    NASA Astrophysics Data System (ADS)

    Shiu, Yu; Yeh, Chia-Hung; Kuo, C. C. J.

    2003-11-01

    In this work, we present an audio content identification system that identifies some unknown audio material by comparing its fingerprint with those extracted off-line and saved in the music database. We will describe in detail the procedure to extract audio fingerprints and demonstrate that they are robust to noise and content-preserving manipulations. The main feature in the proposed system is the zero-crossing rate extracted with the octave-band filter bank. The zero-crossing rate can be used to describe the dominant frequency in each subband with a very low computational cost. The size of audio fingerprint is small and can be efficiently stored along with the compressed files in the database. It is also robust to many modifications such as tempo change and time-alignment distortion. Besides, the octave-band filter bank is used to enhance the robustness to distortion, especially those localized on some frequency regions.

  6. Fingerprint recovery from human skin surfaces.

    PubMed

    Trapecar, Matej; Balazic, Joze

    2007-11-01

    A study was conducted to investigate whether certain dactyloscopic powders and reagents can recover latent fingerprints on human skin surfaces. Four fingerprint powders, Magnetic Jet Black, Magnetic Silver, Silver Special, Swedish Black, and two other methods, cyanoacrylate fuming (CA) and Ruthenium tetroxide (RTX), were used. Having examined skin surfaces with a forensic light source, we observed that the fingerprint impressions remained visible up to 15 min after intentionally placing them on the skin surface of living subjects and dead bodies. Finger marks were recovered and positive results were achieved with Magnetic Black and Swedish Black powder on living subjects. On dead bodies finger marks treated with cyanoacrylate were visible but those treated with RTX, Swedish Black and Magnetic Jet Black powder were useful for potential comparison. On dead bodies best results were obtained with RTX method.

  7. Fingerprinting Communication and Computation on HPC Machines

    SciTech Connect

    Peisert, Sean

    2010-06-02

    How do we identify what is actually running on high-performance computing systems? Names of binaries, dynamic libraries loaded, or other elements in a submission to a batch queue can give clues, but binary names can be changed, and libraries provide limited insight and resolution on the code being run. In this paper, we present a method for"fingerprinting" code running on HPC machines using elements of communication and computation. We then discuss how that fingerprint can be used to determine if the code is consistent with certain other types of codes, what a user usually runs, or what the user requested an allocation to do. In some cases, our techniques enable us to fingerprint HPC codes using runtime MPI data with a high degree of accuracy.

  8. DNA fingerprints from hypervariable mitochondrial genotypes.

    PubMed

    Avise, J C; Bowen, B W; Lamb, T

    1989-05-01

    Conventional surveys of restriction-fragment polymorphisms in mitochondrial DNA of menhaden fish (Brevoortia tyrannus/patronus complex) and chuckwalla lizards (Sauromalus obesus) revealed exceptionally high levels of genetic variation, attributable to differences in mtDNA size as well as in restriction sites. The observed probabilities that any two randomly drawn individuals differed detectably in mtDNA genotype were 0.998 and 0.983 in the two species, respectively. Thus, the variable gel profiles provided unique mtDNA "fingerprints" for most conspecific animals assayed. mtDNA fingerprints differ from nuclear DNA fingerprints in several empirical respects and should find special application in the genetic assessment of maternity. PMID:2576092

  9. Chemical Fingerprinting of Materials Developed Due to Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    Instrumental chemical analysis methods are developed and used to chemically fingerprint new and modified External Tank materials made necessary by changing environmental requirements. Chemical fingerprinting can detect and diagnose variations in material composition. To chemically characterize each material, fingerprint methods are selected from an extensive toolbox based on the material's chemistry and the ability of the specific methods to detect the material's critical ingredients. Fingerprint methods have been developed for a variety of materials including Thermal Protection System foams, adhesives, primers, and composites.

  10. Fingerprint enhancement using a multispectral sensor

    NASA Astrophysics Data System (ADS)

    Rowe, Robert K.; Nixon, Kristin A.

    2005-03-01

    The level of performance of a biometric fingerprint sensor is critically dependent on the quality of the fingerprint images. One of the most common types of optical fingerprint sensors relies on the phenomenon of total internal reflectance (TIR) to generate an image. Under ideal conditions, a TIR fingerprint sensor can produce high-contrast fingerprint images with excellent feature definition. However, images produced by the same sensor under conditions that include dry skin, dirt on the skin, and marginal contact between the finger and the sensor, are likely to be severely degraded. This paper discusses the use of multispectral sensing as a means to collect additional images with new information about the fingerprint that can significantly augment the system performance under both normal and adverse sample conditions. In the context of this paper, "multispectral sensing" is used to broadly denote a collection of images taken under different illumination conditions: different polarizations, different illumination/detection configurations, as well as different wavelength illumination. Results from three small studies using an early-stage prototype of the multispectral-TIR (MTIR) sensor are presented along with results from the corresponding TIR data. The first experiment produced data from 9 people, 4 fingers from each person and 3 measurements per finger under "normal" conditions. The second experiment provided results from a study performed to test the relative performance of TIR and MTIR images when taken under extreme dry and dirty conditions. The third experiment examined the case where the area of contact between the finger and sensor is greatly reduced.

  11. Waveform Fingerprinting for Efficient Seismic Signal Detection

    NASA Astrophysics Data System (ADS)

    Yoon, C. E.; OReilly, O. J.; Beroza, G. C.

    2013-12-01

    Cross-correlating an earthquake waveform template with continuous waveform data has proven a powerful approach for detecting events missing from earthquake catalogs. If templates do not exist, it is possible to divide the waveform data into short overlapping time windows, then identify window pairs with similar waveforms. Applying these approaches to earthquake monitoring in seismic networks has tremendous potential to improve the completeness of earthquake catalogs, but because effort scales quadratically with time, it rapidly becomes computationally infeasible. We develop a fingerprinting technique to identify similar waveforms, using only a few compact features of the original data. The concept is similar to human fingerprints, which utilize key diagnostic features to identify people uniquely. Analogous audio-fingerprinting approaches have accurately and efficiently found similar audio clips within large databases; example applications include identifying songs and finding copyrighted content within YouTube videos. In order to fingerprint waveforms, we compute a spectrogram of the time series, and segment it into multiple overlapping windows (spectral images). For each spectral image, we apply a wavelet transform, and retain only the sign of the maximum magnitude wavelet coefficients. This procedure retains just the large-scale structure of the data, providing both robustness to noise and significant dimensionality reduction. Each fingerprint is a high-dimensional, sparse, binary data object that can be stored in a database without significant storage costs. Similar fingerprints within the database are efficiently searched using locality-sensitive hashing. We test this technique on waveform data from the Northern California Seismic Network that contains events not detected in the catalog. We show that this algorithm successfully identifies similar waveforms and detects uncataloged low magnitude events in addition to cataloged events, while running to completion

  12. Chemical Fingerprinting of Materials Developed Due To Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    This paper presents viewgraphs on chemical fingerprinting of materials developed due to environmental issues. Some of the topics include: 1) Aerospace Materials; 2) Building Blocks of Capabilities; 3) Spectroscopic Techniques; 4) Chromatographic Techniques; 5) Factors that Determine Fingerprinting Approach; and 6) Fingerprinting: Combination of instrumental analysis methods that diagnostically characterize a material.

  13. Semi-spectrum correlation methods for fingerprint recognition

    NASA Astrophysics Data System (ADS)

    Perju, Veacheslav L.; Casasent, David P.; Perju, Veacheslav V.; Saranciuc, Dorian I.

    2003-08-01

    There are presented the results of the investigations of the fingerprints' images correlation recognition in conditions of different distortions -- scale, angular orientation change, image's surface reducing, noises' influence. There are examined possibilities of the person's identification and their verification. There are proposed and investigated the method of the fingerprints' semi-spectrums recognition and the method of the fingerprints' space-dependent recognition.

  14. Fingerprint Ridge Count: A Polygenic Trait Useful in Classroom Instruction.

    ERIC Educational Resources Information Center

    Mendenhall, Gordon; And Others

    1989-01-01

    Describes the use of the polygenic trait of total fingerprint ridge count in the classroom as a laboratory investigation. Presents information on background of topic, fingerprint patterns which are classified into three major groups, ridge count, the inheritance model, and activities. Includes an example data sheet format for fingerprints. (RT)

  15. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  16. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  17. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  18. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  19. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  20. Digital Video of Live-Scan Fingerprint Data

    National Institute of Standards and Technology Data Gateway

    NIST Digital Video of Live-Scan Fingerprint Data (PC database for purchase)   NIST Special Database 24 contains MPEG-2 (Moving Picture Experts Group) compressed digital video of live-scan fingerprint data. The database is being distributed for use in developing and testing of fingerprint verification systems.

  1. Fingerprint image enhancement by differential hysteresis processing.

    PubMed

    Blotta, Eduardo; Moler, Emilce

    2004-05-10

    A new method to enhance defective fingerprints images through image digital processing tools is presented in this work. When the fingerprints have been taken without any care, blurred and in some cases mostly illegible, as in the case presented here, their classification and comparison becomes nearly impossible. A combination of spatial domain filters, including a technique called differential hysteresis processing (DHP), is applied to improve these kind of images. This set of filtering methods proved to be satisfactory in a wide range of cases by uncovering hidden details that helped to identify persons. Dactyloscopy experts from Policia Federal Argentina and the EAAF have validated these results. PMID:15062948

  2. DNA fingerprinting in forensics: past, present, future.

    PubMed

    Roewer, Lutz

    2013-11-18

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting.

  3. DNA fingerprinting in forensics: past, present, future

    PubMed Central

    2013-01-01

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting. PMID:24245688

  4. Fingerprint image enhancement by differential hysteresis processing.

    PubMed

    Blotta, Eduardo; Moler, Emilce

    2004-05-10

    A new method to enhance defective fingerprints images through image digital processing tools is presented in this work. When the fingerprints have been taken without any care, blurred and in some cases mostly illegible, as in the case presented here, their classification and comparison becomes nearly impossible. A combination of spatial domain filters, including a technique called differential hysteresis processing (DHP), is applied to improve these kind of images. This set of filtering methods proved to be satisfactory in a wide range of cases by uncovering hidden details that helped to identify persons. Dactyloscopy experts from Policia Federal Argentina and the EAAF have validated these results.

  5. X-ray and electron microscopy studies on the biodistribution and biomodification of iron oxide nanoparticles in Daphnia magna.

    PubMed

    Kwon, Dongwook; Nho, Hyun Woo; Yoon, Tae Hyun

    2014-10-01

    Biodistribution and biomodification of iron oxide (Fe3O4 and α-Fe2O3) nanoparticles (NPs) in a well-known toxicity test organism, Daphnia magna (D. magna), were investigated using transmission electron microscopy (TEM) and scanning transmission X-ray microscopy (STXM). In addition to the morphological changes in the gut tissues of D. magna, biodistribution and biomodification of iron oxide NPs in the digestive tract of D. magna were also monitored in this study. Upon exposures to both iron oxide NPs, unique morphological changes (e.g., irregular shaped microvilli, epithelial cell protrusion, and dilatation of cytoplasmic inclusion) in the gut tissues of D. magna were observed along with bacterial colonization of the gut lumen. However, despite their heavy accumulations in the digesitive tract, TEM and STXM images confirmed us that both Fe3O4 and α-Fe2O3 NPs were not penetrating into the gut tissues of D. magna. Moreover, for the Fe3O4 NPs in direct contact with the gut microvilli of D. magna, slight but significant spectral changes were observed in their Fe L-edge X-ray absorption near edge structure (XANES) spectra, which indicated that there were biomodifications of Fe3O4 NPs, probably involving oxidative dissolution of Fe3O4 NPs followed by rapid precipitation of ferric oxide or hydroxide. However, no significant changes were observed in the Fe L-edge XANES spectra of the α-Fe2O3 NPs present in the gut lumen of D. magna. These X-ray and electron microscopic observations confirmed us that, despite similarities in core sizes and chemical compositions, NPs with different crystalline phase and dissolution rates can interact quite differently with their local environment, may result in different biodistribution and cause completely dissimilar toxicities.

  6. The use of genomic DNA fingerprinting in studies of the epidemiology of bacteria in periodontitis.

    PubMed

    Genco, R J; Loos, B G

    1991-07-01

    Recent studies of microbial epidemiology emphasizing the genetic organization and distribution of organisms associated with orofacial infections have led to new insights into the possible origins of pathogenicity. Studies into genetic heterogeneity, acquisition and transmission of these organisms have been markedly advanced by the utilization of the powerful technique of genomic DNA fingerprinting. Characteristic fingerprints for each bacterial isolate can be produced by cleavage of high molecular weight genomic DNA by restriction endonucleases. It is assumed that each DNA fingerprint represents a clonal type. In this report, we review and analyze studies of the epidemiology of bacteria associated with orofacial infections with an emphasis on periodontal disease. Studies of nontypable (NT) Haemophilus influenzae associated with recurrent otitis media illustrate the utility of this technique. DNA fingerprinting clearly demonstrates genetic heterogeneity of NT H. influenzae isolates, and clonality of infection of any individual. Furthermore, DNA fingerprinting has shown that the same clonal type is seen in siblings concurrently suffering from otitis media, suggesting horizontal transmission within the family. Studies of mutans Streptococci also show extensive genetic heterogeneity and show vertical transmission of a predominant clonal type only from mother to infant, but not from father to infant. Studies of Actinobacillus actinomycetemcomitans show considerable genetic heterogeneity among monkey isolates. Thus far, three clonal types have been reported with DNA fingerprinting among isolates from periodontal patients, but additional genetic heterogeneity can be found using specific DNA fragments as probes in hybridization experiments. Intrafamilial transmission of A. actinomycetemcomitans has been demonstrated. Porphyromonas (Bacteroides) gingivalis shows extensive genetic heterogeneity and case reports suggest clonal infection of any one individual. In contrast

  7. Silver Coating for High-Mass-Accuracy Imaging Mass Spectrometry of Fingerprints on Nanostructured Silicon.

    PubMed

    Guinan, Taryn M; Gustafsson, Ove J R; McPhee, Gordon; Kobus, Hilton; Voelcker, Nicolas H

    2015-11-17

    Nanostructure imaging mass spectrometry (NIMS) using porous silicon (pSi) is a key technique for molecular imaging of exogenous and endogenous low molecular weight compounds from fingerprints. However, high-mass-accuracy NIMS can be difficult to achieve as time-of-flight (ToF) mass analyzers, which dominate the field, cannot sufficiently compensate for shifts in measured m/z values. Here, we show internal recalibration using a thin layer of silver (Ag) sputter-coated onto functionalized pSi substrates. NIMS peaks for several previously reported fingerprint components were selected and mass accuracy was compared to theoretical values. Mass accuracy was improved by more than an order of magnitude in several cases. This straightforward method should form part of the standard guidelines for NIMS studies for spatial characterization of small molecules.

  8. Application of a redox-proteomics toolbox to Daphnia magna challenged with model pro-oxidants copper and paraquat.

    PubMed

    Rainville, Louis-Charles; Coelho, Ana Varela; Sheehan, David

    2015-01-01

    The redox status of cells is involved in the regulation of several cellular stress-response pathways. It is frequently altered by xenobiotics, as well as by environmental stressors. As such, there is an increasing interest in understanding the redox status of proteins in different scenarios. Recent advances in proteomics enable researchers to measure oxidative lesions in a wide range of proteins. This opens the door to the sensitive detection of toxicity targets and helps decipher the molecular impact of pollutants and environmental stressors. The present study applies the measurement of protein carbonyls, the most common oxidative lesion of proteins, to gel-based proteomics in Daphnia magna. Daphnids were exposed to copper and paraquat, 2 well-known pro-oxidants. Catalase activity was decreased by paraquat, whereas global measurement of protein carbonyls and thiols indicated no change with treatment. Despite the absence of observed oxidative stress, 2-dimensional electrophoresis of the daphnid proteins and measurement of their carbonylation status revealed that 32 features were significantly affected by the treatments, showing higher sensitivity than single measurements. Identified proteins affected by copper indicated a decrease in the heat-shock response, whereas paraquat affected glycolysis. The present study demonstrates the applicability of redox-proteomics in daphnids, and indicates that the heat-shock response plays a counterintuitive role in metal resistance in daphnids. PMID:25263122

  9. Coping with predator stress: interclonal differences in induction of heat-shock proteins in the water flea Daphnia magna.

    PubMed

    Pauwels, K; Stoks, R; de Meester, L

    2005-07-01

    Although predation is a strong selection pressure, little is known about the molecular mechanisms to cope with predator stress. This is crucial to understanding of the mechanisms and constraints involved in the evolution of antipredator traits. We quantified the expression of heat-shock protein 60 (Hsp60), a potential marker for predator stress, in four clones of the water flea Daphnia magna, when exposed to fish kairomones. Expression of Hsp60 induction increased after 6 h and returned to base levels after 24 h of predator stress. This suggests that it is a costly transient mechanism to temporarily cope with novel predator stress, before other defences are induced. We found genetic variation in the fixed levels and in the fish-induced levels of Hsp60, which seemed to be linked to each clone's history of fish predation. Our data suggest that Hsp60 can be considered part of a multiple-trait antipredator defence strategy of Daphnia clones to cope with predator stress. PMID:16033558

  10. Linear solvation energy relationships for toxicity of selected organic chemicals to Daphnia pulex and Daphnia magna

    USGS Publications Warehouse

    Passino, Dora R.M.; Hickey, James P.; Frank, Anthony M.

    1988-01-01

    In the Laurentian Great Lakes, more than 300 contaminants have been identified in fish, other biota, water, and sediment. Current hazard assessment of these chemicals by the National Fisheries Research Center-Great Lakes is based on their toxicity, occurrence in the environment, and source. Although scientists at the Center have tested over 70 chemicals with the crustacean Daphnia pulex, the number of experimental data needed to screen the huge array of chemicals in the Great Lakes exceeds the practical capabilities of conducting bioassays. This limitation can be partly circumvented, however, by using mathematical models based on quantitative structure-activity relationships (QSAR) to provide rapid, inexpensive estimates of toxicity. Many properties of chemicals, including toxicity, bioaccumulation and water solubility are well correlated and can be predicted by equations of the generalized linear solvation energy relationships (LSER). The equation we used to model solute toxicity is Toxicity = constant + mVI/100 + s (π* + dδ) + bβm + aαm where VI = intrinsic (Van der Waals) molar volume; π* = molecular dipolarity/polarizability; δ = polarizability 'correction term'; βm = solute hydrogen bond acceptor basicity; and αm = solute hydrogen bond donor acidity. The subscript m designates solute monomer values for α and β. We applied the LSER model to 48-h acute toxicity data (measured as immobilization) for six classes of chemicals detected in Great Lakes fish. The following regression was obtained for Daphnia pulex (concentration = μM): log EC50 = 4.86 - 4.35 VI/100; N = 38, r2 = 0.867, sd = 0.403 We also used the LSER modeling approach to analyze to a large published data set of 24-h acute toxicity for Daphnia magna; the following regression resulted, for eight classes of compounds (concentration = mM): log EC50 = 3.88 - 4.52 VI/100 - 1.62 π* + 1.66 βm - 0.916 αm; N = 62, r2 = 0.859, sd = 0.375 In addition we developed computer software that identifies

  11. Comparative toxicity of rac- and S-tebuconazole to Daphnia magna.

    PubMed

    Qi, Su Z; Chen, Xiao F; Liu, Yong; Jiang, Jia Z; Wang, Cheng J

    2015-01-01

    Tebuconazole is a chiral triazole fungicide used as raceme in a variety of agricultural applications. Earlier studies showed that tebuconazole is toxic to many non-target aquatic organisms but relative data for tebuconazole enantiomers are lacking. Thus, goal of this study was to evaluate and compare the toxicity of rac- and S-tebuconazole with Daphnia magna at both acute and chronic levels according to Organization for Economic Cooperation and Development (OECD) guidelines 202 and 211 respectively, to provide some guidelines for optimizing chiral pesticides application and management. The exposure concentrations were 0.1, 0.5, 1, 2, 4, 8, 10 mg L(-1) for both rac- and S-tebuconazole and their 48-h EC(50) values to D. magna were 3.53 (3.32-3.78) and 2.74 (2.33-3.10) mg L(-1) respectively, indicating that these both are medium toxic to D. magna with no significant toxicity difference at acute level. In chronic test, <24-h old D. magna were exposed to 0.01, 0.05, 0.10, 0.20, and 0.40 mg L(-1) of rac- and S-tebuconazole with one blank and one solvent control for 21 days according to OECD guideline 211. Four developmental (molting rate, days to the 1st and 3rd brood, and body length) and five reproductive (size of the 1st and 3rd brood, number of broods, and number of neonates) parameters for each D. magna were determined. Results showed that both rac- and S-tebuconazole significantly reduced the reproduction and impacted the development of D. magna at concentrations of 0.05 mg L(-1) or higher. Furthermore, S-tebuconazole was more toxic than raceme, and the difference between effects on the same parameters induced by rac- and S-tebuconazole was statistically significant. These results demonstrated that the chronic toxicity of S-tebuconazole might be underestimated in general use, and further studies should focus more on the biological behaviors of enantiomers and not just the raceme of tebuconazole and other chiral pesticides in the environment. PMID:25996809

  12. Comparative toxicity of rac- and S-tebuconazole to Daphnia magna.

    PubMed

    Qi, Su Z; Chen, Xiao F; Liu, Yong; Jiang, Jia Z; Wang, Cheng J

    2015-01-01

    Tebuconazole is a chiral triazole fungicide used as raceme in a variety of agricultural applications. Earlier studies showed that tebuconazole is toxic to many non-target aquatic organisms but relative data for tebuconazole enantiomers are lacking. Thus, goal of this study was to evaluate and compare the toxicity of rac- and S-tebuconazole with Daphnia magna at both acute and chronic levels according to Organization for Economic Cooperation and Development (OECD) guidelines 202 and 211 respectively, to provide some guidelines for optimizing chiral pesticides application and management. The exposure concentrations were 0.1, 0.5, 1, 2, 4, 8, 10 mg L(-1) for both rac- and S-tebuconazole and their 48-h EC(50) values to D. magna were 3.53 (3.32-3.78) and 2.74 (2.33-3.10) mg L(-1) respectively, indicating that these both are medium toxic to D. magna with no significant toxicity difference at acute level. In chronic test, <24-h old D. magna were exposed to 0.01, 0.05, 0.10, 0.20, and 0.40 mg L(-1) of rac- and S-tebuconazole with one blank and one solvent control for 21 days according to OECD guideline 211. Four developmental (molting rate, days to the 1st and 3rd brood, and body length) and five reproductive (size of the 1st and 3rd brood, number of broods, and number of neonates) parameters for each D. magna were determined. Results showed that both rac- and S-tebuconazole significantly reduced the reproduction and impacted the development of D. magna at concentrations of 0.05 mg L(-1) or higher. Furthermore, S-tebuconazole was more toxic than raceme, and the difference between effects on the same parameters induced by rac- and S-tebuconazole was statistically significant. These results demonstrated that the chronic toxicity of S-tebuconazole might be underestimated in general use, and further studies should focus more on the biological behaviors of enantiomers and not just the raceme of tebuconazole and other chiral pesticides in the environment.

  13. Use of SSR markers for DNA fingerprinting and diversity analysis of Pakistani sugarcane (Saccharum spp. hybrids) cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years SSR markers have been used widely for genetic analysis. The objective of this study was to use an SSR-based marker system to develop the molecular fingerprints and analyze the genetic relationship of sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers wer...

  14. Evidence of Porphyrin-Like Structures in Natural Melanin Pigments Using Electrochemical Fingerprinting.

    PubMed

    Kim, Young Jo; Khetan, Abhishek; Wu, Wei; Chun, Sang-Eun; Viswanathan, Venkatasubramanian; Whitacre, Jay F; Bettinger, Christopher J

    2016-04-01

    Eumelanins are extended heterogeneous biopolymers composed of molecular subunits with ambiguous macromolecular topology. Here, an electrochemical fingerprinting technique is described, which suggests that natural eumelanin pigments contain indole-based tetramers that are arranged into porphyrin-like domains. Spectroscopy and density functional theory calculations suggest that sodium ions undergo occupancy-dependent stepwise insertion into the core of porphyrin-like tetramers in natural eumelanins at discrete potentials.

  15. Fingerprint analysis of Flos Carthami by capillary electrophoresis.

    PubMed

    Sun, Yi; Guo, Tao; Sui, Yin; Li, Famei

    2003-07-25

    Capillary electrophoresis (CE) was employed in fingerprint analysis of Flos Carthami. A standardized procedure was used to develop the CE fingerprint. An electrophoretic profile of genuine Flos Carthami from Fengqiu, He'nan, China, was first established as the characteristic fingerprint. This profile was then used to identify and assess the consistency of the herb. A study with a limited number of samples from nine sources showed a fair consistency in their CE fingerprints with that of the genuine sample. Flos Carthami was well distinguished from Stigma Croci, a possible substitute in traditional Chinese medicine, and Flos Hemerocallis, a commercial adulterant, by comparing the fingerprints of each herb. PMID:12860022

  16. A cancellable and fuzzy fingerprint scheme for mobile computing security

    NASA Astrophysics Data System (ADS)

    Yang, Wencheng; Xi, Kai; Li, Cai

    2012-09-01

    Fingerprint recognition provides an effective user authentication solution for mobile computing systems. However, as a fingerprint template protection scheme, fingerprint fuzzy vault is subject to cross-matching attacks, since the same finger might be registered for various applications. In this paper, we propose a fingerprint-based biometric security scheme named the cancellable and fuzzy fingerprint scheme, which combines a cancellable non-linear transformation with the client/server version of fuzzy vault, to address the cross-matching attack in a mobile computing system. Experimental results demonstrate that our scheme can provide reliable and secure protection to the mobile computing system while achieving an acceptable matching performance.

  17. Eliminate background interference from latent fingerprints using ultraviolet multispectral imaging

    NASA Astrophysics Data System (ADS)

    Huang, Wei; Xu, Xiaojing; Wang, Guiqiang

    2014-02-01

    Fingerprints are the most important evidence in crime scene. The technology of developing latent fingerprints is one of the hottest research areas in forensic science. Recently, multispectral imaging which has shown great capability in fingerprints development, questioned document detection and trace evidence examination is used in detecting material evidence. This paper studied how to eliminate background interference from non-porous and porous surface latent fingerprints by rotating filter wheel ultraviolet multispectral imaging. The results approved that background interference could be removed clearly from latent fingerprints by using multispectral imaging in ultraviolet bandwidth.

  18. Chemical imaging of latent fingerprints by mass spectrometry based on laser activated electron tunneling.

    PubMed

    Tang, Xuemei; Huang, Lulu; Zhang, Wenyang; Zhong, Hongying

    2015-03-01

    Identification of endogenous and exogenous chemicals contained in latent fingerprints is important for forensic science in order to acquire evidence of criminal identities and contacts with specific chemicals. Mass spectrometry has emerged as a powerful technique for such applications without any derivatization or fluorescent tags. Among these techniques, MALDI (Matrix Assisted Laser Desorption Ionization) provides small beam size but has interferences with MALDI matrix materials, which cause ion suppressions as well as limited spatial resolution resulting from uneven distribution of MALDI matrix crystals with different sizes. LAET (Laser Activated Electron Tunneling) described in this work offers capabilities for chemical imaging through electron-directed soft ionization. A special film of semiconductors has been designed for collection of fingerprints. Nanoparticles of bismuth cobalt zinc oxide were compressed on a conductive metal substrate (Al or Cu sticky tape) under 10 MPa pressure. Resultant uniform thin films provide tight and shining surfaces on which fingers are impressed. Irradiation of ultraviolet laser pulses (355 nm) on the thin film instantly generates photoelectrons that can be captured by adsorbed organic molecules and subsequently cause electron-directed ionization and fragmentation. Imaging of latent fingerprints is achieved by visualization of the spatial distribution of these molecular ions and structural information-rich fragment ions. Atomic electron emission together with finely tuned laser beam size improve spatial resolution. With the LAET technique, imaging analysis not only can identify physical shapes but also reveal endogenous metabolites present in females and males, detect contacts with prohibited substances, and resolve overlapped latent fingerprints. PMID:25647159

  19. Chemical imaging of latent fingerprints by mass spectrometry based on laser activated electron tunneling.

    PubMed

    Tang, Xuemei; Huang, Lulu; Zhang, Wenyang; Zhong, Hongying

    2015-03-01

    Identification of endogenous and exogenous chemicals contained in latent fingerprints is important for forensic science in order to acquire evidence of criminal identities and contacts with specific chemicals. Mass spectrometry has emerged as a powerful technique for such applications without any derivatization or fluorescent tags. Among these techniques, MALDI (Matrix Assisted Laser Desorption Ionization) provides small beam size but has interferences with MALDI matrix materials, which cause ion suppressions as well as limited spatial resolution resulting from uneven distribution of MALDI matrix crystals with different sizes. LAET (Laser Activated Electron Tunneling) described in this work offers capabilities for chemical imaging through electron-directed soft ionization. A special film of semiconductors has been designed for collection of fingerprints. Nanoparticles of bismuth cobalt zinc oxide were compressed on a conductive metal substrate (Al or Cu sticky tape) under 10 MPa pressure. Resultant uniform thin films provide tight and shining surfaces on which fingers are impressed. Irradiation of ultraviolet laser pulses (355 nm) on the thin film instantly generates photoelectrons that can be captured by adsorbed organic molecules and subsequently cause electron-directed ionization and fragmentation. Imaging of latent fingerprints is achieved by visualization of the spatial distribution of these molecular ions and structural information-rich fragment ions. Atomic electron emission together with finely tuned laser beam size improve spatial resolution. With the LAET technique, imaging analysis not only can identify physical shapes but also reveal endogenous metabolites present in females and males, detect contacts with prohibited substances, and resolve overlapped latent fingerprints.

  20. Peptide Mass Fingerprinting of Egg White Proteins

    ERIC Educational Resources Information Center

    Alty, Lisa T.; LaRiviere, Frederick J.

    2016-01-01

    Use of advanced mass spectrometry techniques in the undergraduate setting has burgeoned in the past decade. However, relatively few undergraduate experiments examine the proteomics tools of protein digestion, peptide accurate mass determination, and database searching, also known as peptide mass fingerprinting. In this experiment, biochemistry…

  1. Optical security verification for blurred fingerprints

    NASA Astrophysics Data System (ADS)

    Soon, Boon Y.; Karim, Mohammad A.; Alam, Mohammad S.

    1998-12-01

    Optical fingerprint security verification is gaining popularity, as it has the potential to perform correlation at the speed of light. With advancement in optical security verification techniques, authentication process can be almost foolproof and reliable for financial transaction, banking, etc. In law enforcement, when a fingerprint is obtained from a crime scene, it may be blurred and can be an unhealthy candidate for correlation purposes. Therefore, the blurred fingerprint needs to be clarified before it is used for the correlation process. There are a several different types of blur, such as linear motion blur and defocus blur, induced by aberration of imaging system. In addition, we may or may not know the blur function. In this paper, we propose the non-singularity inverse filtering in frequency/power domain for deblurring known motion-induced blur in fingerprints. This filtering process will be incorporated with the pow spectrum subtraction technique, uniqueness comparison scheme, and the separated target and references planes method in the joint transform correlator. The proposed hardware implementation is a hybrid electronic-optical correlator system. The performance of the proposed system would be verified with computer simulation for both cases: with and without additive random noise corruption.

  2. Discrimination among Panax species using spectral fingerprinting

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Spectral fingerprints of samples of three Panax species (P. quinquefolius L., P. ginseng, and P. notoginseng) were acquired using UV, NIR, and MS spectrometry. With principal components analysis (PCA), all three methods allowed visual discrimination between all three species. All three methods wer...

  3. Compression of gray-scale fingerprint images

    NASA Astrophysics Data System (ADS)

    Hopper, Thomas

    1994-03-01

    The FBI has developed a specification for the compression of gray-scale fingerprint images to support paperless identification services within the criminal justice community. The algorithm is based on a scalar quantization of a discrete wavelet transform decomposition of the images, followed by zero run encoding and Huffman encoding.

  4. Fingerprints for fruit and nut crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We in horticulture should be more aware of the identity of the plants that we use. We appreciate scientists who can determine species and cultivars with their botanical knowledge and keen powers of observation. However, sometimes plant identity is more than meets the eye. Fingerprints serve as a hi...

  5. Piezoelectric micromachined ultrasonic transducers for fingerprint sensing

    NASA Astrophysics Data System (ADS)

    Lu, Yipeng

    Fingerprint identification is the most prevalent biometric technology due to its uniqueness, universality and convenience. Over the past two decades, a variety of physical mechanisms have been exploited to capture an electronic image of a human fingerprint. Among these, capacitive fingerprint sensors are the ones most widely used in consumer electronics because they are fabricated using conventional complementary metal oxide semiconductor (CMOS) integrated circuit technology. However, capacitive fingerprint sensors are extremely sensitive to finger contamination and moisture. This thesis will introduce an ultrasonic fingerprint sensor using a PMUT array, which offers a potential solution to this problem. In addition, it has the potential to increase security, as it allows images to be collected at various depths beneath the epidermis, providing images of the sub-surface dermis layer and blood vessels. Firstly, PMUT sensitivity is maximized by optimizing the layer stack and electrode design, and the coupling coefficient is doubled via series transduction. Moreover, a broadband PMUT with 97% fractional bandwidth is achieved by utilizing a thinner structure excited at two adjacent mechanical vibration modes with overlapping bandwidth. In addition, we proposed waveguide PMUTs, which function to direct acoustic waves, confine acoustic energy, and provide mechanical protection for the PMUT array. Furthermore, PMUT arrays were fabricated with different processes to form the membrane, including front-side etching with a patterned sacrificial layer, front-side etching with additional anchor, cavity SOI wafers and eutectic bonding. Additionally, eutectic bonding allows the PMUT to be integrated with CMOS circuits. PMUTs were characterized in the mechanical, electrical and acoustic domains. Using transmit beamforming, a narrow acoustic beam was achieved, and high-resolution (sub-100 microm) and short-range (~1 mm) pulse-echo ultrasonic imaging was demonstrated using a steel

  6. Fingerprint indexing based on minutiae-dependent statistical codes

    NASA Astrophysics Data System (ADS)

    Iloanusi, Ogechukwu N.; Osuagwu, Charles C.

    2014-07-01

    Methods based on minutiae matching have been extensively used in fingerprint recognition because minutiae can be reliably extracted from poor quality and noisy fingerprints. However, structures have to be defined due to minutiae displacements and irreproducibility. Some of the structures, though very efficient, incur large computational complexities. In this article, a feature vector of statistically based values derived from the minutiae pattern in a fingerprint is proposed for indexing fingerprints using the incremental search retrieval method. The proposed indexing technique in combination with the incremental retrieval method proves to have an added advantage over certain minutiae-based structures, especially when the minutiae points are numerous in a fingerprint. The feature vector for a fingerprint requires negligible storage resources and, consequently, the computational time in the retrieval of a candidate list for a query fingerprint is very little.

  7. Analysis of Fingerprint Image to Verify a Person

    NASA Astrophysics Data System (ADS)

    Jahankhani, Hossein; Mohid, Maktuba

    Identification and authentication technologies are increasing day by day to protect people and goods from crime and terrorism. This paper is aimed to discuss fingerprint technology in depth and analysis of fingerprint image. Verify a person with a highlight on fingerprint matching. Some fingerprint matching algorithms are analysed and compared. The outcomes of the analysis has identified some major issues or factors of fingerprinting, which are location, rotation, clipping, noise, non-linear distortion sensitiveness/ insensitiveness properties, computational cost and accuracy level of fingerprint matching algorithms. Also a new fingerprint matching algorithm proposed in this research work. The proposed algorithm has used Euclidean distance, angle difference, type as matching parameters instead of specific location parameter (like, x or y coordinates), which makes the algorithm location and rotation insensitive. The matching of local neighbourhoods at each stage makes the algorithm non-linear distortion insensitive.

  8. Fingerprint enhancement based on MRF with curve accumulation

    NASA Astrophysics Data System (ADS)

    Huang, Zhongwen; Qi, Feihu

    2001-09-01

    The uniqueness of fingerprints has been used for identification for a long time. Automatic fingerprint identification system (AFIS) depends on minutiae to identify a person that rely heavily on the quality of fingerprint image. This paper presents a novel fingerprint enhancement scheme based on a Markov Random Field (MRF). The MRF model is applied to capture local statistical regularities of ridges and then the curve accumulation based on the MRF model is presented to enhance the fingerprint. Such procedure is repeated until the statistics difference can be got between fingerprint ridges and valleys (accumulation). In the end, the adaptive binarisation is made. The results of experiments show that this method can effectively improve the clarity of ridge and valley structures of input fingerprint images and meanwhile preserve the minutiae very well.

  9. Uniqueness: skews bit occurrence frequencies in randomly generated fingerprint libraries.

    PubMed

    Chen, Nelson G

    2016-08-01

    Requiring that randomly generated chemical fingerprint libraries have unique fingerprints such that no two fingerprints are identical causes a systematic skew in bit occurrence frequencies, the proportion at which specified bits are set. Observed frequencies (O) at which each bit is set within the resulting libraries systematically differ from frequencies at which bits are set at fingerprint generation (E). Observed frequencies systematically skew toward 0.5, with the effect being more pronounced as library size approaches the compound space, which is the total number of unique possible fingerprints given the number of bit positions each fingerprint contains. The effect is quantified for varying library sizes as a fraction of the overall compound space, and for changes in the specified frequency E. The cause and implications for this systematic skew are subsequently discussed. When generating random libraries of chemical fingerprints, the imposition of a uniqueness requirement should either be avoided or taken into account.

  10. Chromosomal assignment of human DNA fingerprint sequences by simultaneous hybridization to arbitrarily primed PCR products from human/rodent monochromosome cell hybrids

    SciTech Connect

    Yasuda, Jun; Sekiya, Takao; Navarro, J.M.

    1996-05-15

    We have developed a technique for the simultaneous chromosomal assignment of multiple human DNA sequences from DNA fingerprints obtained by the arbitrarily primed polymerase chain reaction (AP-PCR). Radioactively labeled human AP-PCR products are hybridized to DNA fingerprints generated with the same arbitrary primer from human/rodent monochromosome cell hybrids after electroblotting to a nylong membrane. Human-specific hybridization bands in the human/rodent fingerprints unambiguously determine their chromosome of origin. We named this method simultaneous hybridization of arbitrarily primed PCR DNA fingerprinting products (SHARP). Using this approach, we determined the chromosomal origins of most major bands of human AP-PCR fingerprints obtained with two arbitrary primers. Altogether, the chromosomal localization of near 50 DNA fragments, comprehensive of all human chromosomes except chromosomes 21 and Y, was achieved in this simple manner. Chromosome assignment of fingerprint bands is essential for molecular karyotyping of cancer by AP-PCR DNA fingerprinting. The SHARP method provides a convenient and powerful tool for this purpose. 23 refs., 3 figs., 2 tabs.

  11. Male meiosis in Crustacea: synapsis, recombination, epigenetics and fertility in Daphnia magna.

    PubMed

    Gómez, Rocío; Van Damme, Kay; Gosálvez, Jaime; Morán, Eugenio Sánchez; Colbourne, John K

    2016-09-01

    We present the first detailed cytological study of male meiosis in Daphnia (Crustacea: Branchiopoda: Cladocera)-an aquatic microcrustacean with a cyclical parthenogenetic life cycle. Using immunostaining of the testes in Daphnia magna for baseline knowledge, we characterized the different stages of meiotic division and spermiogenesis in relation to the distribution of proteins involved in synapsis, early recombination events and sister chromatid cohesion. We also studied post-translational histone modifications in male spermatocytes, in relation to the dynamic chromatin progression of meiosis. Finally, we applied a DNA fragmentation test to measure sperm quality of D. magna, with respect to levels of inbreeding. As a proxy for fertility, this technique may be used to assess the reproductive health of a sentinel species of aquatic ecosystems. Daphnia proves to be a model species for comparative studies of meiosis that is poised to improve our understanding of the cytological basis of sexual and asexual reproduction.

  12. Male meiosis in Crustacea: synapsis, recombination, epigenetics and fertility in Daphnia magna.

    PubMed

    Gómez, Rocío; Van Damme, Kay; Gosálvez, Jaime; Morán, Eugenio Sánchez; Colbourne, John K

    2016-09-01

    We present the first detailed cytological study of male meiosis in Daphnia (Crustacea: Branchiopoda: Cladocera)-an aquatic microcrustacean with a cyclical parthenogenetic life cycle. Using immunostaining of the testes in Daphnia magna for baseline knowledge, we characterized the different stages of meiotic division and spermiogenesis in relation to the distribution of proteins involved in synapsis, early recombination events and sister chromatid cohesion. We also studied post-translational histone modifications in male spermatocytes, in relation to the dynamic chromatin progression of meiosis. Finally, we applied a DNA fragmentation test to measure sperm quality of D. magna, with respect to levels of inbreeding. As a proxy for fertility, this technique may be used to assess the reproductive health of a sentinel species of aquatic ecosystems. Daphnia proves to be a model species for comparative studies of meiosis that is poised to improve our understanding of the cytological basis of sexual and asexual reproduction. PMID:26685998

  13. Environmental effects of dredging. Use of daphnia magna to predict consequences of bioaccumulation

    SciTech Connect

    1987-03-01

    Results reported herein represent a portion of the laboratory research evaluating the relationship between mercury and cadmium tissue residues and biological effects in the freshwater crustacean, Daphnia magna (commonly known as the water flea). Procedures presented here for a 28-day Daphnia magna toxicity test could be used in screening for water-column toxicity resulting from open-water disposal of a specific dredged material. As a part of its regulatory and dredging programs, the U. S. Army Corps of Engineers often conducts, or requires to be conducted, an assessment of the potential for bioaccumulation of environmental contaminants from sediment scheduled for dredging and open-water disposal. There is, at present, no generally accepted guidance available to aid in the interpretation of the biological consequences of bioaccumulation. To provide an initial basis for such guidance, the Environmental Laboratory is conducting both literature database analyses and experimental laboratory studies as part of the Long-Term Effects of Dredging Operations (LEDO) Program.

  14. Multigenerational contaminant exposures produce non-monotonic, transgenerational responses in Daphnia magna.

    PubMed

    Kimberly, David A; Salice, Christopher J

    2015-12-01

    Generally, ecotoxicologists rely on short-term tests that assume populations to be static. Conversely, natural populations may be exposed to the same stressors for many generations, which can alter tolerance to the same (or other) stressors. The objective of this study was to improve our understanding of how multigenerational stressors alter life history traits and stressor tolerance. After continuously exposing Daphnia magna to cadmium for 120 days, we assessed life history traits and conducted a challenge at higher temperature and cadmium concentrations. Predictably, individuals exposed to cadmium showed an overall decrease in reproductive output compared to controls. Interestingly, control D. magna were the most cadmium tolerant to novel cadmium, followed by those exposed to high cadmium. Our data suggest that long-term exposure to cadmium alter tolerance traits in a non-monotonic way. Because we observed effects after one-generation removal from cadmium, transgenerational effects may be possible as a result of multigenerational exposure.

  15. Rapid toxicity screening tests for aquatic biota. 1. Methodology and experiments with Daphnia magna

    SciTech Connect

    Janssen, C.R.; Persoone, G. )

    1993-04-01

    A promising new and rapid toxicity screening test was developed, the concept and principles of which are presented. The method consists of visual observation of in vivo inhibition of an enzymatic process, using a fluorescent substrate. Juvenile Daphnia magna was exposed to a toxicant dilution series for 1 h, after which the substrate was added and the enzymatic inhibition was observed visually, using a long-wave UV light. The 1-h EC50 results of 11 pure compounds are presented and compared to the conventional 24- and 48-h Daphnia magna EC50s. All 1-h fluorescence EC50s were of the same order of magnitude and correlated very well with the 24- and 48-h EC50s. The sensitivity and reproducibility of this cost-effective screening test were compared to those of the Microtox[reg sign] test. The scope for application and the potential of this new rapid toxicity screening test are evaluated.

  16. Accumulation and regulation of zinc in Daphnia magna: links with homeostasis and toxicity.

    PubMed

    Muyssen, B T A; Janssen, C R

    2002-11-01

    Zinc accumulation in Daphnia magna was investigated, and the results were linked to the previously established optimal concentration range for zinc and D. magna. It was observed that organisms cultured in this optimal range (300-600 microg Zn/L) contained 212 +/- 57 to 254 +/- 79 microg Zn/g dry weight. Lower and higher zinc contents were obtained after acclimation to previously established culture concentrations inducing deficiency and toxicity, respectively. The calculation of bioconcentration factors indicated that zinc was actively regulated, at least up to a concentration of 600 microg Zn/L. Zinc uptake and elimination are rapid processes; major increases and decreases in body content occurred within 1 day. Zinc concentrations in daphnids exposed to 600 microg Zn/L fluctuated with 2- to 3-day intervals, suggesting a role of molting in the regulation and elimination of zinc. PMID:12399922

  17. Acute toxicity of alkylpolyglucosides to Vibrio fischeri, Daphnia magna and microalgae: a comparative study.

    PubMed

    Jurado, E; Fernández-Serrano, M; Núñez Olea, J; Lechuga, M; Jiménez, J L; Ríos, F

    2012-02-01

    In this paper, toxicity values of alkylpolyglucosides have been determined by applying the 24-h immobilization test with Daphnia magna, the LumiStox(®) 300 test which employs the luminescent bacteria Photobacterium phosphoreum and the test with Selenastrum capricornutum. Three alkylpolyglucosides with different alkyl chain and degree of polymerisation have been tested. For all tests, the results indicated that Vibrio fischeri was more sensitive to toxic effects from alkylpolyglucosides than was D. magna or S. capricornutum. The results demonstrate considerable variation in toxicity responses within structurally related glucose-based surfactants regardless of the species tested. The toxicity increased as the critical micelle concentration decreased, and as the alkyl chain length and resultant hydrophobicity increased.

  18. Morphological evidence of mechanoreceptive gravity perception in a water flea - Daphnia magna

    NASA Technical Reports Server (NTRS)

    Meyers, D. G.

    1985-01-01

    Hair-like structures or setae located in the basal membrane of the swimming antennae of the water flea, D. magna, were observed by scanning electron microscopy and compared to mechanoreceptors in the Higher Order Crustacea. Similarities in anatomy, size, attachment, number, length, and orientation support the hypothesis that the setae are rheoceptive mechanoreceptors which mediate gravity perception through deflection by water currents during the sink phase of hop-and-sink swimming behavior.

  19. Effects of algal food quality on sexual reproduction of Daphnia magna.

    PubMed

    Choi, Jong-Yun; Kim, Seong-Ki; La, Geung-Hwan; Chang, Kwang-Hyeon; Kim, Dong-Kyun; Jeong, Keon-Young; Park, Min S; Joo, Gea-Jae; Kim, Hyun-Woo; Jeong, Kwang-Seuk

    2016-05-01

    The objective of our study was to investigate sexual reproduction of Daphnia magna associated with mating behaviors and hatching rates, according to different algal food sources. Since a diatom is known to contain more abundant long-chain poly unsaturated fatty acids (PUFAs), we hypothesized that the diatom-consuming D. magna would exhibit more successful reproduction rates. Upon the hypothesis, we designed three experiments using two algal species, a green alga (Chlorella vulgaris) and a diatom (Stephanodiscus hantzschii). From the results, we found that the mating frequency and copulation duration increased in the treatment with S. hantzschii, resulting in a significant increase of hatching rates of resting eggs. In the other two repetitive mating strategies (e.g., one female vs. multiple males, and one male vs. multiple females), we found that the hatching rates of resting eggs were greater in the S. hantzschii treatment. In addition to the mating strategy, male body size significantly increased in the diatom treatment, hence average diameter of penis was also statistically different among the treatments (greater diameter in the S. hantzschii treatment). To examine the effect of algal food quality, we estimated quantity of fatty acids in the two algal species. Our result showed that S. hantzschii had a higher proportion of long-chain PUFAs than C. vulgaris. Furthermore, a stable isotope analysis revealed that carbon and nitrogen originated from S. hantzschii were more assimilated to D. magna. In summary, our study manifested that diatom consumption of D. magna leads to more successful sexual reproduction. We then discussed how the diatom consumption of zooplankton influences food web dynamics in a freshwater ecosystem.

  20. Effects of algal food quality on sexual reproduction of Daphnia magna.

    PubMed

    Choi, Jong-Yun; Kim, Seong-Ki; La, Geung-Hwan; Chang, Kwang-Hyeon; Kim, Dong-Kyun; Jeong, Keon-Young; Park, Min S; Joo, Gea-Jae; Kim, Hyun-Woo; Jeong, Kwang-Seuk

    2016-05-01

    The objective of our study was to investigate sexual reproduction of Daphnia magna associated with mating behaviors and hatching rates, according to different algal food sources. Since a diatom is known to contain more abundant long-chain poly unsaturated fatty acids (PUFAs), we hypothesized that the diatom-consuming D. magna would exhibit more successful reproduction rates. Upon the hypothesis, we designed three experiments using two algal species, a green alga (Chlorella vulgaris) and a diatom (Stephanodiscus hantzschii). From the results, we found that the mating frequency and copulation duration increased in the treatment with S. hantzschii, resulting in a significant increase of hatching rates of resting eggs. In the other two repetitive mating strategies (e.g., one female vs. multiple males, and one male vs. multiple females), we found that the hatching rates of resting eggs were greater in the S. hantzschii treatment. In addition to the mating strategy, male body size significantly increased in the diatom treatment, hence average diameter of penis was also statistically different among the treatments (greater diameter in the S. hantzschii treatment). To examine the effect of algal food quality, we estimated quantity of fatty acids in the two algal species. Our result showed that S. hantzschii had a higher proportion of long-chain PUFAs than C. vulgaris. Furthermore, a stable isotope analysis revealed that carbon and nitrogen originated from S. hantzschii were more assimilated to D. magna. In summary, our study manifested that diatom consumption of D. magna leads to more successful sexual reproduction. We then discussed how the diatom consumption of zooplankton influences food web dynamics in a freshwater ecosystem. PMID:27217941

  1. Silver Nanowire Exposure Results in Internalization and Toxicity to Daphnia Magna

    PubMed Central

    Scanlan, Leona D.; Reed, Robert B.; Loguinov, Alexandre V.; Antczak, Philipp; Tagmount, Abderrahmane; Aloni, Shaul; Nowinski, Daniel Thomas; Luong, Pauline; Tran, Christine; Karunaratne, Nadeeka; Pham, Don; Lin, Xin Xin; Falciani, Francesco; Higgins, Chris P.; Ranville, James F.; Vulpe, Chris D.; Gilbert, Benjamin

    2013-01-01

    Nanowires (NWs), high-aspect-ratio nanomaterials, are increasingly used in technological materials and consumer products and may have toxicological characteristics distinct from nanoparticles. We carried out a comprehensive evaluation of the physico-chemical stability of four silver nanowires (AgNWs) of two sizes and coatings and their toxicity to Daphnia magna. Inorganic aluminum-doped silica coatings were less effective than organic poly(vinyl pyrrolidone) coatings at preventing silver oxidation or Ag+ release and underwent a significant morphological transformation within one-hour following addition to low ionic strength Daphnia growth media. All AgNWs were highly toxic to D. magna but less toxic than ionic silver. Toxicity varied as a function of AgNW dimension, coating and solution chemistry. Ag+ release in the media could not account for observed AgNW toxicity. Single-particle inductively coupled plasma mass spectrometry (spICPMS) distinguished and quantified dissolved and nanoparticulate silver in microliter-scale volumes of Daphnia magna hemolymph with a limit of detection of approximately 10 ppb. The silver levels within the hemolymph of Daphnia exposed to both Ag+ and AgNW met or exceeded the initial concentration in the growth medium, indicating effective accumulation during filter feeding. Silver-rich particles were the predominant form of silver in hemolymph following exposure to both AgNWs and Ag+. Scanning electron microscopy (SEM) imaging of dried hemolymph found both AgNWs and silver precipitates that were not present in the AgNW stock or the growth medium. Both organic and inorganic coatings on the AgNW were transformed during ingestion or absorption. Pathway, gene ontology and clustering analyses of gene expression response indicated effects of AgNWs distinct from ionic silver on Daphnia magna. PMID:24099093

  2. Toxicity identification evaluation of anaerobically treated swine slurry: a comparison between Daphnia magna and Raphanus sativus.

    PubMed

    Villamar, Cristina A; Silva, Jeannette; Bay-Schmith, Enrique; Vidal, Gladys

    2014-01-01

    Anaerobic digestion does not efficiently reduce ionic compounds present in swine slurry, which could present a potential risk to aquatic ecosystems (surface runoff) and terrestrial ambient (irrigation). The objective of this study was to evaluate the ecotoxicological characteristics of anaerobically treated swine slurry using acute and chronic (epicotyl elongation) toxicity tests with Daphnia magna and Raphanus sativus and identification of suspected toxic compounds using the Toxicity Identification Evaluation (TIE) method. The evaluation was performed in three phases: physicochemical characterization of the slurry; acute/chronic toxicity testing with Daphnia magna and Raphanus sativus for each fraction of the TIE (cation and anion exchange columns, activated carbon, pH modification/aeration and EDTA) and identification of suspected toxic compounds. The anaerobically treated slurry contained concentrations of ammonium of 1,072 mg L(-1), chloride of 815 mg L(-1) and metals below 1 mg L(-1) with a D. magna acute toxicity (48h-LC50) of 5.3% and R. sativus acute toxicity (144h-LC50) of 48.1%. Epicotyl elongation of R. sativus was inhibited at concentrations above 25% (NOEC). The cation exchange reduced the toxicity and free ammonia by more than 90% for both bio-indicators. Moreover, this condition stimulated the epicotyl growth of R. sativus between 10% and 37%. In conclusion, the main compound suspected of causing acute toxicity in D. magna and acute/chronic toxicity in R. sativus is the ammonium. The findings suggest the need the ammonium treatment prior to the agricultural reuse of swine slurry given the high risk to contaminate the aquatic environment by runoff and toxicity of sensitive plants.

  3. A comparison of the response of Simocephalus mixtus (Cladocera) and Daphnia magna to contaminated freshwater sediments.

    PubMed

    Martínez-Jerónimo, Fernando; Cruz-Cisneros, Jade Lizette; García-Hernández, Leonardo

    2008-09-01

    The southeast region of Mexico is characterized by intensive oil industry activities carried out by the national public enterprise Petróleos Mexicanos (PEMEX). The freshwater lagoon "El Limón", located in the municipality of Macuspana, state of Tabasco, Mexico, has received over 40 years discharges of untreated waste waters from the Petrochemical Complex "Ciudad PEMEX", located on the border of the lagoon. To assess the toxicity of the sediments and, hence, to obtain information on the biological effects of these contaminating discharges, the cladoceran Simocephalus mixtus was used as a test organism in acute (48h) and chronic (12d) toxicity assays. For comparison purposes, bioassays were also conducted with the reference cladoceran Daphnia magna. The sediments of this lagoon contain important amounts of metals and hydrocarbons that have been accumulated over time; however, the acute tests only registered reduced lethal effects on the test organisms (maxima of 10% and 17% mortality for D. magna and S. mixtus, respectively). This may be due to low bioavailability of the pollutants present in the sediments. On the other hand, partial or total inhibition and delay in the start of reproduction, reduction in clutch sizes, reduced survival, as well as reduction in the size of adults and offspring were recorded in the chronic assays. The most evident chronic effects were found in S. mixtus; in this species, reproduction was inhibited up to 72%, whereas D. magna was only affected by 24%. We determined that S. mixtus is a more sensitive test organism than D. magna to assess whole-sediment toxicity in tropical environments, and that chronic exposure bioassays are required for an integrated sediment evaluation. The sediments from "El Limón" lagoon induced chronic intoxication responses and, therefore, remediation measures are urgently needed to recover environmental conditions suitable for the development of its aquatic biota.

  4. Bioaccumulation of perfluoroalkyl substances by Daphnia magna in water with different types and concentrations of protein.

    PubMed

    Xia, Xinghui; Rabearisoa, Andry H; Jiang, Xiaoman; Dai, Zhineng

    2013-10-01

    Perfluoroalkyl substances (PFASs) are sometimes regarded as proteinophilic compounds, however, there is no research report about the effect of environmental protein on the bioaccumulation of PFASs in waters. In the present study we investigated influences of protein on the bioaccumulation of six kinds of PFASs by Daphnia magna in water; it included perfluorooctane sulfonate, perfluorooctanoic acid, perfluorononanoic acid, perfluorodecanoic acid, perfluoroundecanoic acid, and perfluorododecanoic acid. Two types of protein including bovine albumin from animal and soy peptone from plant were compared and the effects of protein concentration were investigated. Both types of protein at high concentrations (10 and 20 mg L(-1)) suppressed the bioaccumulation of PFASs. When protein concentration increased from 0 to 20 mg L(-1), the decreasing ratios of the PFAS body burden (35.3-52.9%) in Daphnia magna induced by bovine albumin were significantly higher than those (22.0-36.6%) by soy peptone. The dialysis bag experiment results showed that the binding of PFASs to protein followed the Freundlich isotherm, suggesting it is not a linear partitioning process but an adsorption-like process. The partition coefficients of PFASs between bovine albumin and water were higher compared to soy peptone; this resulted in higher reducing rates of freely dissolved concentrations of PFASs with increasing bovine albumin concentration, leading to a stronger suppression of PFAS bioaccumulation. However, the presence of both types of protein with a low concentration (1 mg L(-1)) enhanced the bioaccumulation of PFASs. Furthermore, the water-based bioaccumulation factor based on the freely dissolved concentrations of PFASs even increased with and the depuration rate constants of PFASs from Daphnia magna decreased with protein concentration, suggesting that protein would not only reduce the bioavailable concentrations and uptake rates of PFASs but also lower the elimination rates of PFASs in

  5. Energy allocation in Daphnia magna exposed to xenobiotics: A biochemical approach

    SciTech Connect

    Coen, W.M. De; Janssen, C.R.; Persoone, G.

    1995-12-31

    A new approach to sublethal aquatic toxicity testing based on a biochemical assessment of the energy budget of Daphnia magna was developed and evaluated. With this method energy consumption (E{sub c}) is estimated by measuring the electron transport activity based on the calorimetric measurement of a tetrazolium salt reduction. Total available energy (E{sub a}) is assessed by measuring the lipid, protein and sugar content of the test organism using calorimetric methods. E{sub a} {minus} E{sup c} can subsequently be calculated and represents the ``surplus`` energy available for growth and reproduction. D. magna neonates were exposed to cadmium and 2,4-dichlorophenoxy acetic acid for 4 days after which the electron transport activity and the total lipid, protein and sugar content of the test organisms were determined. Using the enthalpy of combustion of the different macromolecular groups and converting the oxygen consumption into oxyenthalpic equivalents, an estimation of the total energy budget of the test organisms was made. Additionally, the age specific survival and reproduction and the growth of D. magna populations exposed to the same sublethal concentrations was assessed in 21 day life table experiments. Energy allocation patterns of stressed D. magna obtained with the new biochemical approach were similar to those obtained with the conventional Scope for Growth determinations. Although more research is needed, comparison between the suborganismal (biochemical) and supraorganismal (life table) endpoints indicate that the proposed short-term assay based on energy allocation could be used to predict long-term effects on the survival, growth and reproduction of daphnids.

  6. Chronic effects of contaminated sediment on Daphnia magna and Chironomus tentans (journal version)

    SciTech Connect

    Nebeker, A.V.; Onjukka, S.T.; Cairns, M.A.

    1988-01-01

    Chronic tests were conducted with Daphnia magna (cladoceran) and Chironomus tentans (midge) to determine their usefulness as test organisms for chronic sediment assays, and to estimate the potential long-term impact of contaminated freshwater sediments and contaminated Superfund-site soils on freshwater invertebrates. These two species were used successfully in acute sediment tests and were shown to be useful in chronic tests in water.

  7. How reliable are data for the ecotoxicity of trivalent chromium to Daphnia magna?

    PubMed

    Ponti, Benedetta; Bettinetti, Roberta; Dossi, Carlo; Vignati, Davide Anselmo Luigi

    2014-10-01

    Risk assessments from the European Union and the World Health Organization report values for acute and chronic toxicity of Cr(III) to Daphnia magna in the range of 0.6 mg/L to 111 mg/L and 0.047 mg/L to 3.4 mg/L, respectively. To understand whether factors other than the use of different test media and data reporting contribute to this variability, the authors tested the acute (48-h) and chronic (21-d) toxicities of Cr(III) to D. magna according to Organisation for Economic Co-operation and Development (OECD) methods. Filterable (0.45-µm) chromium concentrations were measured at 0 h, 6 h, 24 h, and 48 h, the latter value corresponding to the total duration of the acute tests and to the interval between medium renewals in chronic tests. In highly alkaline media (4.9 meq/L), Cr concentrations decreased rapidly below the analytical detection limit, and no toxicity was observed. In less alkaline media (approximately 0.8 meq/L), the decrease in filterable Cr concentrations was inversely proportional to the quantity of added Cr(III). The authors concluded that existing data likely underestimate the ecotoxicity of Cr(III) to D. magna. A reliable assessment of the hazard of Cr(III) to D. magna must consider that exposure concentrations can decrease markedly from the beginning to the end of a test and that medium alkalinity strongly influences the outcome of laboratory toxicity tests.

  8. Development of miniaturized acute toxicity tests for Daphnia magna and Pimephales promelas

    SciTech Connect

    Powell, R.L.; Kimerle, R.A.; Moser, E.M.; McKee, M.J.

    1995-12-31

    Standard EPA methods for conducting static, 48-hour, acute toxicity tests using Daphnia magna and Pimephales promelas (fathead minnows) can be miniaturized to successfully yield accurate LC50/EC50 values. The screening procedure involves exposing the test organisms to 1 mL of test solution, in test chambers which consist of the wells on 48-well microliter plates. Toxicity of the microliter plates and solvent, DO concentration, organism biomass to test solution ratio, partitioning of the chemicals and dilution of the test solution during transfer of the test organisms were examined. Survival and exposure were not significantly altered using non-standard test chambers. Toxicity of linear alkylbenzene sulfonate (LAS), pentachlorophenol (PCP), kepone, and sodium lauryl sulfate (SLS) was determined using D. magna and fathead minnows. Serial dilutions were made and 1 mL aliquots pipetted into the wells. Daphnia magna, < 24 hours old, and newly hatched fathead minnows, were transferred into the wells, twenty individuals per concentration, one per well. Dose-response curves were established for all test compounds. LC50/EC50`s values obtained using miniaturized methods strongly correlated with those obtained using standard EPA procedures. The tests were repeated a number of times with coefficient of variances for D. magna ranging from 10% with kepone to 64% with SLS. For fathead minnows CVs ranged from 0% with PCP to 23% with kepone. It was concluded that current methods can be miniaturized, yet still provide accurate information regarding toxicity for compounds in limited supply. This method may also be amenable to effluent testing i.e. TIE fractions. Other benefits include reducing the amount of equipment and space needed to conduct a test and the time involved.

  9. Evaluation of the ultrasonic method for solubilizing Daphnia magna before liquid scintillation counting

    SciTech Connect

    Dauble, D.D.; Hanf, R.W. Jr.; Carlile, D.W.

    1984-11-01

    Adult Daphnia magna were exposed to /sup 14/C-labeled phenol and tissues analyzed for /sup 14/C uptake by three methods: (1) tissue solubilizer, (2) tissue solubilizer plus sonication, and (3) sonication alone. Analysis by liquid scintillation counting revealed that measurements of total activity among treatments were not significantly different (..cap alpha.. less than or equal to 0.10) at two count levels. Sonicated samples showed less variation than tissue samples that were solubilized. 5 references, 1 table.

  10. Chronic effects of contaminated sediment on Daphnia magna and Chironomus tentans

    SciTech Connect

    Nebeker, A.V.; Onjukka, S.T.; Cairns, M.A.

    1988-10-01

    Chronic tests were conducted with Daphnia magna (cladoceran) and Chironomus tentans (midge) to determine their usefulness as test organisms for chronic sediment assays, and to estimate the potential long-term impact of contaminated freshwater sediments and contaminated Superfund site soils on freshwater invertebrates. These two species have been used successfully in acute sediment tests, and have been shown to be useful in chronic tests in water--only bioassays.

  11. Silver nanowire exposure results in internalization and toxicity to Daphnia magna.

    PubMed

    Scanlan, Leona D; Reed, Robert B; Loguinov, Alexandre V; Antczak, Philipp; Tagmount, Abderrahmane; Aloni, Shaul; Nowinski, Daniel Thomas; Luong, Pauline; Tran, Christine; Karunaratne, Nadeeka; Pham, Don; Lin, Xin Xin; Falciani, Francesco; Higgins, Christopher P; Ranville, James F; Vulpe, Chris D; Gilbert, Benjamin

    2013-12-23

    Nanowires (NWs), high-aspect-ratio nanomaterials, are increasingly used in technological materials and consumer products and may have toxicological characteristics distinct from nanoparticles. We carried out a comprehensive evaluation of the physicochemical stability of four silver nanowires (AgNWs) of two sizes and coatings and their toxicity to Daphnia magna . Inorganic aluminum-doped silica coatings were less effective than organic poly(vinyl pyrrolidone) coatings at preventing silver oxidation or Ag(+) release and underwent a significant morphological transformation within 1 h following addition to low ionic strength Daphnia growth media. All AgNWs were highly toxic to D. magna but less toxic than ionic silver. Toxicity varied as a function of AgNW dimension, coating, and solution chemistry. Ag(+) release in the media could not account for observed AgNW toxicity. Single-particle inductively coupled plasma mass spectrometry distinguished and quantified dissolved and nanoparticulate silver in microliter-scale volumes of Daphnia magna hemolymph with a limit of detection of approximately 10 ppb. The silver levels within the hemolymph of Daphnia exposed to both Ag(+) and AgNW met or exceeded the initial concentration in the growth medium, indicating effective accumulation during filter feeding. Silver-rich particles were the predominant form of silver in hemolymph following exposure to both AgNWs and Ag(+). Scanning electron microscopy imaging of dried hemolymph found both AgNWs and silver precipitates that were not present in the AgNW stock or the growth medium. Both organic and inorganic coatings on the AgNW were transformed during ingestion or absorption. Pathway, gene ontology, and clustering analyses of gene expression response indicated effects of AgNWs distinct from ionic silver on Daphnia magna .

  12. Life history and biology of Fascioloides magna (Trematoda) and its native and exotic hosts

    PubMed Central

    Malcicka, Miriama

    2015-01-01

    Host–parasite interactions are model systems in a wide range of ecological and evolutionary fields and may be utilized for testing numerous theories and hypotheses in terms of both applied and fundamental research. For instance, they are important in terms of studying coevolutionary arms races, species invasions, and in economic terms the health of livestock and humans. Here, I present a comprehensive description of the life history, biogeography, and biology of the giant liver fluke, Fascioloides magna, and both its intermediate and definitive hosts. F. magna is native to North America where it uses several species of freshwater snails (Lymnaeidae) as intermediate hosts and four main species of ungulates as definitive hosts. The fluke has also been introduced into parts of Europe where it is now established in two lymnaeid snail species and three ungulate species. This study gives a comprehensive description of different developmental stages of the fluke in its two host classes, as well as detailed notes on historical and present distributions of F. magna in North America and Europe as well as in its snail and deer hosts (with range maps provided). Aberrant and dead-end hosts are also discussed in detail, and descriptive phylogenies are provided for all of the organisms. I briefly discuss how F. magna represents a model example of multiple-level ecological fitting, a phenomenon not yet described in the empirical literature. Lastly, I explore possible future scenarios for fluke invasion in Europe, where it is currently expanding its range. PMID:25897378

  13. Toxicity of silver and titanium dioxide nanoparticle suspensions to the aquatic invertebrate, Daphnia magna.

    PubMed

    Das, Pranab; Xenopoulos, Marguerite A; Metcalfe, Chris D

    2013-07-01

    The purpose of this study was to investigate the 48 h acute toxicity of capped silver nanoparticles (AgNPs), and capped and uncapped titanium dioxide (nTiO₂) to Daphnia magna neonates. In addition, a 24 days chronic toxicity study was performed for D. magna exposed to uncapped nTiO₂ to evaluate effects on growth, reproduction and survival. The 48 h median lethal concentrations (LC₅₀) for carboxy-functionalized capped AgNPs and uncapped nTiO₂ were 2.75 μg/L and 7.75 mg/L, respectively. In contrast, no mortalities were observed for Daphnia exposed to carboxy-functionalized capped nTiO₂ at concentrations up to 30 mg/L. In the chronic toxicity experiment with uncapped nTiO₂, the growth, reproduction and survival of D. magna were significantly (p < 0.05) reduced at concentrations ranging from 4.5 to 7.5 mg/L. Growth and reproduction were reduced by 35 % and 93 %, respectively in the treatments at the highest uncapped nTiO₂ concentration (7.5 mg/L). Time to first reproduction was delayed by 2-3 days in D. magna and the test organisms produced only 1-2 broods over 24 days exposure to the highest concentration of uncapped nTiO₂. Overall, the results from the present study indicate that exposures of aquatic invertebrates to nanoparticles could have important ecological effects on lower trophic levels in aquatic ecosystems.

  14. A chronic cannula for obtaining CSF from the cisterna magna of awake dogs.

    PubMed

    Jennings, D B; Tobin, P

    1979-01-01

    We have designed a cannula system that can be chronically implanted to end above the dura of the cisterna magna of the dog. During experiments in the awake dog, a screw cap with stylet is removed from the cannula and a spinal needle inserted for the withdrawal of samples of cisternal cerebrospinal fluid (CSF) or for making continuous measurements of pressure. The system can be used for repeated experiments extending over several weeks.

  15. Toxicity identification evaluation of five metals performed with two organisms (Daphnia magna and Lactuca sativa).

    PubMed

    Fjällborg, B; Li, B; Nilsson, E; Dave, G

    2006-02-01

    When trying to identify the main toxicants in effluents, natural waters, sediments, soil leachates, and leachates from products, the Toxicity Identification Evaluation (TIE) procedure has proven useful. To enhance the use of this procedure for soil, sewage, and sediment samples, we wanted to evaluate this TIE procedure, regarding metal toxicity, for the 96-h root elongation test performed with Lactuca sativa (lettuce) seeds. We also wanted to evaluate the effect of TIE treatment on the toxicity of Mn and Fe to Daphnia magna. Bioassays were performed with Daphnia magna (48-h immobility) and lettuce seeds (96-h root elongation) to determine the effect concentrations for both organisms of Ag, Cu, Fe, Mn, and Zn. The TIE was then performed at the determined Daphnia 48-h EC(84) and Lactuca 96-h EC(50) for each metal. Our results showed that the order of the metal toxicity was Ag>Cu>Zn>Fe>Mn, for Daphnia and Ag = Zn = Fe = Cu > Mn for lettuce seeds. We also found that toxicity of the metals for Daphnia magna was reduced according to the prevailing knowledge regarding Cu, Zn, and Ag. However, the toxicity of Ag and Cu for Daphnia was also reduced by filtration through a C18 resin. Toxicity of Mn and Fe was reduced by filtration through a CM resin and increase of pH. For lettuce seeds, toxicity of the metals was reduced by the same treatments as for Daphnia magna with the exception of EDTA addition, which did not affect Cu toxicity to lettuce seeds. No effects were found for filtration through a C18 resin. We suggest that the TIE procedure using lettuce seeds can be used in toxicity identification of metals. However, the effects of pH manipulations were often stronger with lettuce and should be interpreted with care. PMID:16328613

  16. Reduced cadmium accumulation and toxicity in Daphnia magna under carbon nanotube exposure.

    PubMed

    Liu, Jie; Wang, Wen-Xiong

    2015-12-01

    With increasing application and commercial production, carbon nanotubes (CNTs) will inevitably be released into aquatic environments and affect the transport and toxicity of toxic metals in ecosystems. The present study examined how CNTs affected the biokinetics and toxicity of a toxic metal, cadmium (Cd), in the freshwater zooplankton Daphnia magna. The authors quantified the dissolved uptake and the 50% lethal concentration (LC50, 48 h and 72 h) of Cd in daphnids in the presence of functionalized multiwalled nanotubes (F-CNTs) with different lengths (10-30 µm vs 0.5-2 µm) and concentrations (4 mg/L and 8 mg/L). Compared with the control treatment without CNTs, both CNTs slowed down the accumulation rate of Cd in D. magna over 8 h of exposure and further reduced the accumulation thereafter. Mechanisms for the reduced Cd uptake were mainly related to the influences of CNTs on the physiological activity of daphnids. The LC50 of D. magna in the presence of Cd and shorter CNTs was almost the same as that of the control group without CNTs. However, the LC50 of the groups with normal CNTs was significantly higher than that of the control group (i.e., F-CNTs decreased Cd toxicity significantly). Meanwhile, CNTs also decreased the tolerance of D. magna to Cd. The present study suggests that different physical properties of CNTs, such as length, need to be considered in the environmental risk assessment of CNTs.

  17. Palindromic Genes in the Linear Mitochondrial Genome of the Nonphotosynthetic Green Alga Polytomella magna

    PubMed Central

    Smith, David Roy; Hua, Jimeng; Archibald, John M.; Lee, Robert W.

    2013-01-01

    Organelle DNA is no stranger to palindromic repeats. But never has a mitochondrial or plastid genome been described in which every coding region is part of a distinct palindromic unit. While sequencing the mitochondrial DNA of the nonphotosynthetic green alga Polytomella magna, we uncovered precisely this type of genic arrangement. The P. magna mitochondrial genome is linear and made up entirely of palindromes, each containing 1–7 unique coding regions. Consequently, every gene in the genome is duplicated and in an inverted orientation relative to its partner. And when these palindromic genes are folded into putative stem-loops, their predicted translational start sites are often positioned in the apex of the loop. Gel electrophoresis results support the linear, 28-kb monomeric conformation of the P. magna mitochondrial genome. Analyses of other Polytomella taxa suggest that palindromic mitochondrial genes were present in the ancestor of the Polytomella lineage and lost or retained to various degrees in extant species. The possible origins and consequences of this bizarre genomic architecture are discussed. PMID:23940100

  18. Miocene-Pliocene mantle depletion event in the northern Fossa Magna, western NE Japan

    NASA Astrophysics Data System (ADS)

    Okamura, Satoshi; Inaba, Mitsuru; Adachi, Yoshiko; Shinjo, Ryuichi

    2016-07-01

    New isotopic and trace element data presented here imply a temporal change in magma sources and thermal conditions beneath the northern Fossa Magna of NE Japan from the Miocene to the Pliocene. Less radiogenic 176Hf/177Hf and 143Nd/144Nd, high Zr/Hf, and little or no Hf anomaly characterize the Early Miocene volcanism in the northern Fossa Magna region. The mantle wedge consisted of chemically heterogeneous mantle source. Based on out isotope proxies, we propose that during the onset of subduction, influx of hot asthenospheric mantle provided sufficient heat to partially melt newly subducting sediment. Geochemical modeling demonstrates that slab-derived melt mixed with mantle wedge produces the observed isotopic and trace elemental characteristics. In the Middle Miocene, the injection of hot and depleted asthenospheric material replaced the mantle beneath the northern Fossa Magna region of NE Japan. This caused the isotopic signature of the rocks to change from enriched to depleted. Then, the mantle wedge was gradually cooled during the Middle Miocene to the Pliocene with back-arc opening ending in the Late Miocene. Slab surface temperatures were still high enough for sediments to melt but not too high (<∼780 °C) to lose zircon as a residual phase. The Late Miocene and Pliocene volcanism at the post stage of the back-arc opening is best explained by a partial melting of subducted metasediment saturated with trace quantities of zircon and rutile.

  19. Life-Cycle Traits of Paraleucilla magna, a Calcareous Sponge Invasive in a Coastal Mediterranean Basin

    PubMed Central

    Longo, Caterina; Pontassuglia, Carmen; Corriero, Giuseppe; Gaino, Elda

    2012-01-01

    The calcareous sponge Paraleucilla magna, originally observed along the Brazilian coast (Atlantic Ocean), is the only allochthonous invasive species of Porifera reported in the Mediterranean Sea. A 1-year investigation of the population dynamics and life-cycle of this exotic species in the Mar Piccolo di Taranto (southern Italy, central Mediterranean Sea) has provided a good opportunity to test how environmental variations can influence its life-cycle and to ascertain what strategy can be adopted to successfully colonize a new environment. In the Mar Piccolo di Taranto, P. magna exhibits marked temporal changes in biomass. The studied specimens reproduce almost all year round, showing a seasonal pattern that peaks during warm months. This prolonged sexual activity allows P. magna to continuously produce young specimens, with repeated recruitment events taking place throughout the year, thus offsetting the seasonal mortality of adult specimens. This r-strategy enables the non-indigenous sponge to achieve a high degree of maintenance over relatively long periods (ten years at least). PMID:22905128

  20. The influence of benthic fish bioturbation on cadmium bioavailability to Daphnia magna

    SciTech Connect

    Wall, S.B.; Isely, J.J.; La Point, T.W.

    1994-12-31

    The authors are interested in how benthic fish bioturbation of contaminated sediments influences bioaccumulation into planktonic and, ultimately, nektonic organisms. They performed a series of exposures with cadmium-spiked sediment, 1 {mu}g/g nominal concentration, and koi carp Cyprinus carpio. Daphnia magna were placed in exposure aquaria with and without carp for six days and bioaccumulation after 48 h was measured. Preliminary results indicate that carp increased total suspended solids from 0.0 mg/L to 44.4 mg/L and mean total cadmium water concentrations, 1.4 {mu}g/L and 2.8 {mu}g/L, without and with fish, respectively. However, body burdens of Daphnia magna did not reflect the water concentration trend. Mean Cd residues of daphnids exposed without fish, 9.377 {mu}g/g, were not statistically different from those in the with-fish exposure, 8.348 {mu}g/g. Similarity in daphnid body burdens was probably due to cadmium binding with suspended sediment particles and dissolved organic carbon in the exposure chambers, therefore minimizing Cd bioavailability to D. magna. The present focus is on determining the bioavailable cadmium concentration.

  1. Identification of multiple steroid hydroxylases in Daphnia magna and their modulation by xenobiotics

    SciTech Connect

    Baldwin, W.S.; LeBlanc, G.A. . Dept. of Toxicology)

    1994-07-01

    Steroid hydroxylase activities were characterized in Daphnia magna and evaluated for potential use as biomarkers of xenobiotic exposure. Microsomes prepared from Daphnia magna generated as single NADPH-dependent metabolite of [[sup 14]C] testosterone. However, intact daphnids excreted at least 10 polar metabolites of [[sup 14]C] testosterone into the test medium. Six of these metabolites were identified as 2[alpha]-, 16[beta]-, 6[beta]-, 6[alpha]-, 7[alpha]-, and 15[alpha]-[[sup 14]C]hydroxytestosterone. The unidentified metabolites are also presumed to be hydroxylated products of testosterone, based on their relative migrations during TLC. The inefficient metabolism of [[sup 14]C] testosterone during the in vitro microsomal incubations may have been due to the release of P450 inhibitors during microsome preparation. Exposure of daphnids to the P450 modulators phenobarbital, [beta]-naphthoflavone, piperonyl butoxide, and malathion differentially inhibited the steroid hydroxylase activities. Results from this study indicate that Daphnia magna expresses several P450 enzymes and that these enzymes are differentially modulated by xenobiotic exposure. Steroid hydroxylase activities may serve not only as a biomarker of toxicant exposure, but also as a predictor of toxicant effects involving perturbations of steroid hormone homeostasis.

  2. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.

    PubMed

    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely

    2014-08-01

    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna.

  3. Cohorts and populations in chronic toxicity studies with Daphnia magna: a cadmium example

    SciTech Connect

    van Leeuwen, C.J.; Luttmer, W.J.; Griffioen, P.S.

    1985-02-01

    Two semistatic life table experiments with Daphnia magna were carried out on reconstituted and Lake Ijssel water. The nontoxic concentrations for cadmium with respect to the intrinsic rate of natural increase, derived from age-specific survival and fecundity were 1 and 3.2 micrograms/liter, respectively. Body length appeared to be a sensitive parameter. A third intermittent-flow experiment was started with small, exponentially growing populations. These populations had a stable age distribution, were composed of cohorts of different ages and showed an almost perfect logistic growth. Cadmium was shown to reduce the upper numerical limit (carrying capacity) for D. magna and was inversely related to this parameter: log Y = 2.85 -0.20 log (Cd); r = -0.99. A nontoxic concentration could not be established. Based on the background concentration of cadmium, a freshwater quality criterion of 0.1 microgram/liter is proposed. The results are used to discuss several shortcomings of the current methods. Finally it is stated that the introduction of the concepts of population dynamics in reproduction tests with D. magna is a realistic step towards ecotoxicology.

  4. Toxicity Thresholds for Diclofenac, Acetaminophen and Ibuprofen in the Water Flea Daphnia magna.

    PubMed

    Du, Juan; Mei, Cheng-Fang; Ying, Guang-Guo; Xu, Mei-Ying

    2016-07-01

    Non-steroid anti-inflammatory drugs (NSAIDs) have been frequently detected in aquatic ecosystem and posed a huge risk to non-target organisms. The aim of this study was to evaluate the toxic effects of three typical NSAIDs, diclofenac (DFC), acetaminophen (APAP) and ibuprofen (IBP), toward the water flea Daphnia magna. All three NSAIDs showed remarkable time-dependent and concentration-dependent effects on D. magna, with DFC the highest and APAP the lowest toxic. Survival, growth and reproduction data of D. magna from all bioassays were used to determine the LC10 and LC50 (10 % lethal and median lethal concentrations) values of NSAIDs, as well as the EC10 and EC50 (10 % effect and median effect concentrations) values. Concentrations for the lethal and sublethal toxicity endpoints were mainly in the low ppm-range, of which reproduction was the most sensitive one, indicating that non-target organisms might be adversely affected by relevant ambient low-level concentrations of NSAIDs after long-time exposures. PMID:27098253

  5. Assessment of the effects of the carbamazepine on the endogenous endocrine system of Daphnia magna.

    PubMed

    Oropesa, A L; Floro, A M; Palma, P

    2016-09-01

    In the present study, the endocrine activity of the antiepileptic pharmaceutical carbamazepine (CBZ) in the crustacean Daphnia magna was assessed. To assess the hormonal activity of the drug, we exposed maternal daphnids and embryos to environmental relevant concentrations of CBZ (ranging from 10 to 200 μg/L) and to mixtures of CBZ with fenoxycarb (FEN; 1 μg/L). Chronic exposure to CBZ significantly decreased the reproductive output and the number of molts of D. magna at 200 μg/L. This compound induced the production of male offspring (12 ± 1.7 %), in a non-concentration-dependent manner, acting as a weak juvenile hormone analog. Results showed that this substance, at tested concentrations, did not antagonize the juvenoid action of FEN. Further, CBZ has shown to be toxic to daphnid embryos through maternal exposure interfering with their normal gastrulation and organogenesis stages but not producing direct embryo toxicity. These findings suggest that CBZ could act as an endocrine disruptor in D. magna as it decreases the reproductive output, interferes with sex determination, and causes development abnormality in offspring. Therefore, CBZ could directly affect the population sustainability. PMID:27225007

  6. Assessment of the effects of the carbamazepine on the endogenous endocrine system of Daphnia magna.

    PubMed

    Oropesa, A L; Floro, A M; Palma, P

    2016-09-01

    In the present study, the endocrine activity of the antiepileptic pharmaceutical carbamazepine (CBZ) in the crustacean Daphnia magna was assessed. To assess the hormonal activity of the drug, we exposed maternal daphnids and embryos to environmental relevant concentrations of CBZ (ranging from 10 to 200 μg/L) and to mixtures of CBZ with fenoxycarb (FEN; 1 μg/L). Chronic exposure to CBZ significantly decreased the reproductive output and the number of molts of D. magna at 200 μg/L. This compound induced the production of male offspring (12 ± 1.7 %), in a non-concentration-dependent manner, acting as a weak juvenile hormone analog. Results showed that this substance, at tested concentrations, did not antagonize the juvenoid action of FEN. Further, CBZ has shown to be toxic to daphnid embryos through maternal exposure interfering with their normal gastrulation and organogenesis stages but not producing direct embryo toxicity. These findings suggest that CBZ could act as an endocrine disruptor in D. magna as it decreases the reproductive output, interferes with sex determination, and causes development abnormality in offspring. Therefore, CBZ could directly affect the population sustainability.

  7. Clinical Improvement of Alpha-mannosidosis Cat Following a Single Cisterna Magna Infusion of AAV1.

    PubMed

    Yoon, Sea Young; Bagel, Jessica H; O'Donnell, Patricia A; Vite, Charles H; Wolfe, John H

    2016-02-01

    Lysosomal storage diseases (LSDs) are debilitating neurometabolic disorders for most of which long-term effective therapies have not been developed. Gene therapy is a potential treatment but a critical barrier to treating the brain is the need for global correction. We tested the efficacy of cisterna magna infusion of adeno-associated virus type 1 (AAV1) expressing feline alpha-mannosidase gene in the postsymptomatic alpha-mannosidosis (AMD) cat, a homologue of the human disease. Lysosomal alpha-mannosidase (MANB) activity in the cerebrospinal fluid (CSF) and serum were increased above the control values in untreated AMD cats. Clinical neurological signs were delayed in onset and reduced in severity. The lifespan of the treated cats was significantly extended. Postmortem histopathology showed resolution of lysosomal storage lesions throughout the brain. MANB activity in brain tissue was significantly above the levels of untreated tissues. The results demonstrate that a single cisterna magna injection of AAV1 into the CSF can mediate widespread neuronal transduction of the brain and meaningful clinical improvement. Thus, cisterna magna gene delivery by AAV1 appears to be a viable strategy for treatment of the whole brain in AMD and should be applicable to many of the neurotropic LSDs as well as other neurogenetic disorders.

  8. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    SciTech Connect

    Redman, R.S.; Rodriguez, R.J. Univ. of Washington, Seattle, WA . Dept. of Botany); Clifton, D.R.; Morrel, J.; Brown, G. ); Freeman, S. . Dept. of Plant Pathology)

    1999-02-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) plant-defense response were investigated in anthracnose-resistant and-susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1-colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  9. Annotation of the Daphnia magna nuclear receptors: Comparison to Daphnia pulex

    PubMed Central

    Litoff, Elizabeth J; Garriott, Travis E.; Ginjupalli, Gautam K.; Butler, LaToya; Gay, Claudy; Scott, Kiandra; Baldwin, William S.

    2014-01-01

    Most Nuclear Receptors (NRs) are ligand-dependent transcription factors crucial in homeostatic physiological responses or environmental responses. We annotated the D. magna NRs and compared them to D. pulex and other species, primarily through phylogenetic analysis. Daphnia species contain 26 NRs spanning all seven gene subfamilies. Thirteen of the 26 receptors found in Daphnia species phylogenetically segregate into the NR1 subfamily, primarily involved in energy metabolism and resource allocation. Some of the Daphnia NRs, such as RXR, HR96, and E75 show strong conservation between D. magna and D. pulex. Other receptors, such as EcRb, THRL-11 and RARL-10 have diverged considerably and therefore may show different functions in the two species. Curiously, there is an inverse association between the number of NR splice variants and conservation of the LBD. Overall, D. pulex and D. magna possess the same NRs; however not all of the NRs demonstrate high conservation indicating the potential for a divergence of function. PMID:25239664

  10. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    USGS Publications Warehouse

    Redman, R.S.; Freeman, S.; Clifton, D.R.; Morrel, J.; Brown, G.; Rodriguez, R.J.

    1999-01-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) 'plant-defense' response were investigated in anthracnose-resistant and -susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1 colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  11. A fluorescence-based hydrolytic enzyme activity assay for quantifying toxic effects of Roundup® to Daphnia magna.

    PubMed

    Ørsted, Michael; Roslev, Peter

    2015-08-01

    Daphnia magna is a widely used model organism for aquatic toxicity testing. In the present study, the authors investigated the hydrolytic enzyme activity of D. magna after exposure to toxicant stress. In vivo enzyme activity was quantified using 15 fluorogenic enzyme probes based on 4-methylumbelliferyl or 7-amino-4-methylcoumarin. Probing D. magna enzyme activity was evaluated using short-term exposure (24-48 h) to the reference chemical K2 Cr2 O7 or the herbicide formulation Roundup®. Toxicant-induced changes in hydrolytic enzyme activity were compared with changes in mobility (International Organization for Standardization standard 6341). The results showed that hydrolytic enzyme activity was quantifiable as a combination of whole body fluorescence of D. magna and the fluorescence of the surrounding water. Exposure of D. magna to lethal and sublethal concentrations of Roundup resulted in loss of whole body enzyme activity and release of cell constituents, including enzymes and DNA. Roundup caused comparable inhibition of mobility and alkaline phosphatase activity with median effective concentration values at 20 °C of 8.7 mg active ingredient (a.i.)/L to 11.7 mg a.i./L. Inhibition of alkaline phosphatase activity by Roundup was lowest at 14 °C and greater at 20 °C and 26 °C. The results suggest that the fluorescence-based hydrolytic enzyme activity assay (FLEA assay) can be used as an index of D. magna stress. Combining enzyme activity with fluorescence measurements may be applied as a simple and quantitative supplement for toxicity testing with D. magna.

  12. Recognition technology research based on 3D fingerprint

    NASA Astrophysics Data System (ADS)

    Tian, Qianxiao; Huang, Shujun; Zhang, Zonghua

    2014-11-01

    Fingerprint has been widely studied and applied to personal recognition in both forensics and civilian. However, the current widespread used fingerprint is identified by 2D (two-dimensional) fingerprint image and the mapping from 3D (three-dimensional) to 2D loses 1D information, which leads to low accurate and even wrong recognition. This paper presents a 3D fingerprint recognition method based on the fringe projection technique. A series of fringe patterns generated by software are projected onto a finger surface through a projecting system. From another viewpoint, the fringe patterns are deformed by the finger surface and captured by a CCD camera. The deformed fringe pattern images give the 3D shape data of the finger and the 3D fingerprint features. Through converting the 3D fingerprints to 2D space, traditional 2D fingerprint recognition method can be used to 3D fingerprints recognition. Experimental results on measuring and recognizing some 3D fingerprints show the accuracy and availability of the developed 3D fingerprint system.

  13. Forensic analysis of nonlinear collusion attacks for multimedia fingerprinting.

    PubMed

    Zhao, H Vicky; Wu, Min; Wang, Z Jane; Liu, K J Ray

    2005-05-01

    Digital fingerprinting is a technology for tracing the distribution of multimedia content and protecting them from unauthorized redistribution. Unique identification information is embedded into each distributed copy of multimedia signal and serves as a digital fingerprint. Collusion attack is a cost-effective attack against digital fingerprinting, where colluders combine several copies with the same content but different fingerprints to remove or attenuate the original fingerprints. In this paper, we investigate the average collusion attack and several basic nonlinear collusions on independent Gaussian fingerprints, and study their effectiveness and the impact on the perceptual quality. With unbounded Gaussian fingerprints, perceivable distortion may exist in the fingerprinted copies as well as the copies after the collusion attacks. In order to remove this perceptual distortion, we introduce bounded Gaussian-like fingerprints and study their performance under collusion attacks. We also study several commonly used detection statistics and analyze their performance under collusion attacks. We further propose a preprocessing technique of the extracted fingerprints specifically for collusion scenarios to improve the detection performance.

  14. Fingerprint pattern restoration by digital image processing techniques.

    PubMed

    Wen, Che-Yen; Yu, Chiu-Chung

    2003-09-01

    Fingerprint evidence plays an important role in solving criminal problems. However, defective (lacking information needed for completeness) or contaminated (undesirable information included) fingerprint patterns make identifying and recognizing processes difficult. Unfortunately. this is the usual case. In the recognizing process (enhancement of patterns, or elimination of "false alarms" so that a fingerprint pattern can be searched in the Automated Fingerprint Identification System (AFIS)), chemical and physical techniques have been proposed to improve pattern legibility. In the identifying process, a fingerprint examiner can enhance contaminated (but not defective) fingerprint patterns under guidelines provided by the Scientific Working Group on Friction Ridge Analysis, Study and Technology (SWGFAST), the Scientific Working Group on Imaging Technology (SWGIT), and an AFIS working group within the National Institute of Justice. Recently, the image processing techniques have been successfully applied in forensic science. For example, we have applied image enhancement methods to improve the legibility of digital images such as fingerprints and vehicle plate numbers. In this paper, we propose a novel digital image restoration technique based on the AM (amplitude modulation)-FM (frequency modulation) reaction-diffusion method to restore defective or contaminated fingerprint patterns. This method shows its potential application to fingerprint pattern enhancement in the recognizing process (but not for the identifying process). Synthetic and real images are used to show the capability of the proposed method. The results of enhancing fingerprint patterns by the manual process and our method are evaluated and compared. PMID:14535661

  15. Forensic applications of DNA fingerprinting.

    PubMed

    Sullivan, K M

    1994-02-01

    In many ways, DNA profiling technology is very similar to the conventional techniques used for forensic identification. As with, for example, blood grouping techniques, the molecular characteristics of the scene of crime sample may be determined and compared with those of the scene of reference samples from suspects and victim. If the molecular characteristics of the crime sample and the suspect are different, then they cannot be from the same person, whereas if they match, then the possibility remains that they may be from a single source. Similar material, such as blood or semen stains, may be used for both biochemical and genetic tests, and the main applications of identification and relationship testing are shared by both techniques. At this point, the similarity ends; DNA profiling has the following characteristics: 1. It is more sensitive, being able to generate sound data from only a tiny amount of even partially degraded biological material. 2. It is capable of resolving mixtures of semen or tissue from up to several individuals. 3. It has a far greater power of discrimination between individuals--sometimes up to 1 millionfold higher than conventional techniques. 4. It provides considerably more information on the nature of relationships, particularly in cases of incest. As such, the technique represents a quantum leap in forensic identification and relationship testing.

  16. Trophic transfer of differently functionalized zinc oxide nanoparticles from crustaceans (Daphnia magna) to zebrafish (Danio rerio).

    PubMed

    Skjolding, L M; Winther-Nielsen, M; Baun, A

    2014-12-01

    The potential uptake and trophic transfer of nanoparticles (NP) is not well understood so far and for ZnO NP the data presented in peer-reviewed literature is limited. In this paper the influence of surface functionalization on the uptake and depuration behavior of ZnO NP, ZnO-OH NP and ZnO-octyl NP in D. magna was studied. Bulk ZnO particles (≤5 μm) and ZnCl2 were used as references for uptake of particles and dissolved species of Zn, respectively. Furthermore, the trophic transfer of ZnO NP and ZnO-octyl NP from daphnids (Daphnia magna) to zebra fish (Danio rerio) was studied. For ZnO NP and ZnO-octyl NP fast uptakes in D. magna were observed, whereas no measurable uptake took place for ZnO-OH NP. Lower body burden of ZnCl2 was found compared to both ZnO NP and ZnO-octyl. Contrary, the body burden for bulk ZnO was higher than that of ZnO NP but lower than ZnO-octyl. The higher body burdens found for functionalized ZnO-octyl NP than for non-functionalized ZnO NP showed that that the functionalization of the NP has a high influence on the uptake and depuration behavior. Though no mortality was observed, the resulting body burdens were 9.6 times (ZnO NP) and 47 times (ZnO-octyl NP) higher than toxic levels reported for zinc in D. magna. Consequently, the zinc recovered in the animals was not solely due to soluble zinc, but agglomerates/aggregates of ZnO NP or ZnO-octyl NP contributed to the body burdens. The trophic transfer study showed uptake of both ZnO NP and ZnO-octyl NP reaching more than tenfold higher levels than those obtained through aqueous exposure in other studies. This study contributes to expand the available data on uptake behavior of differently functionalized ZnO NP in D. magna and the potential trophic transfer from zooplankton to fish.

  17. FBI compression standard for digitized fingerprint images

    NASA Astrophysics Data System (ADS)

    Brislawn, Christopher M.; Bradley, Jonathan N.; Onyshczak, Remigius J.; Hopper, Thomas

    1996-11-01

    The FBI has formulated national standards for digitization and compression of gray-scale fingerprint images. The compression algorithm for the digitized images is based on adaptive uniform scalar quantization of a discrete wavelet transform subband decomposition, a technique referred to as the wavelet/scalar quantization method. The algorithm produces archival-quality images at compression ratios of around 15 to 1 and will allow the current database of paper fingerprint cards to be replaced by digital imagery. A compliance testing program is also being implemented to ensure high standards of image quality and interchangeability of data between different implementations. We will review the current status of the FBI standard, including the compliance testing process and the details of the first-generation encoder.

  18. Chemotherapy and Fingerprint Loss: Beyond Cosmetic

    PubMed Central

    2012-01-01

    Hand–foot syndrome (HFS) is a common adverse reaction to several chemotherapy drugs. Focus has been on the clinically relevant sequelae associated with this condition, with fingerprint loss receiving little attention. We report the case of a 53-year old male patient with terminal metastatic adenocarcinoma of the rectum involving the liver and lungs who developed grade 3 HFS while on capecitabine therapy. This resulted in his inability to process required government papers as a result of the loss of his fingerprints, imposing significant inconvenience and frustration on a person severely challenged by his deteriorating health. We believe clinicians should pay more attention to this possible outcome that can add additional stress in the lives of patients whose quality of life is already severely compromised. PMID:22298801

  19. Reference Device-Assisted Adaptive Location Fingerprinting

    PubMed Central

    Wu, Dongjin; Xia, Linyuan

    2016-01-01

    Location fingerprinting suffers in dynamic environments and needs recalibration from time to time to maintain system performance. This paper proposes an adaptive approach for location fingerprinting. Based on real-time received signal strength indicator (RSSI) samples measured by a group of reference devices, the approach applies a modified Universal Kriging (UK) interpolant to estimate adaptive temporal and environmental radio maps. The modified UK can take the spatial distribution characteristics of RSSI into account. In addition, the issue of device heterogeneity caused by multiple reference devices is further addressed. To compensate the measuring differences of heterogeneous reference devices, differential RSSI metric is employed. Extensive experiments were conducted in an indoor field and the results demonstrate that the proposed approach not only adapts to dynamic environments and the situation of changing APs’ positions, but it is also robust toward measuring differences of heterogeneous reference devices. PMID:27258284

  20. Rapidly Probing Antibacterial Activity of Graphene Oxide by Mass Spectrometry-based Metabolite Fingerprinting

    PubMed Central

    Zhang, Ning; Hou, Jian; Chen, Suming; Xiong, Caiqiao; Liu, Huihui; Jin, Yulong; Wang, Jianing; He, Qing; Zhao, Rui; Nie, Zongxiu

    2016-01-01

    Application of nanomaterials as anti-bacteria agents has aroused great attention. To investigate the antibacterial activity and antibacterial mechanism of nanomaterials from a molecular perspective is important for efficient developing of nanomaterial antibiotics. In the current work, a new mass spectrometry-based method was established to investigate the bacterial cytotoxicity of graphene oxide (GO) by the metabolite fingerprinting of microbes. The mass spectra of extracted metabolites from two strains DH5α and ATCC25922 were obtained before and after the incubation with nanomaterials respectively. Then principal component analysis (PCA) of these spectra was performed to reveal the relationship between the metabolism disorder of microbes and bactericidal activity of GO. A parameter “D” obtained from PCA scores was proposed that is capable to quantitatively evaluate the antibacterial activity of GO in concentration and time-dependent experiments. Further annotation of the fingerprinting spectra shows the variabilities of important metabolites such as phosphatidylethanolamine, phosphatidylglycerol and glutathione. This metabolic perturbation of E. coli indicates cell membrane destruction and oxidative stress mechanisms for anti-bacteria activity of graphene oxide. It is anticipated that this mass spectrometry-based metabolite fingerprinting method will be applicable to other antibacterial nanomaterials and provide more clues as to their antibacterial mechanism at molecular level. PMID:27306507

  1. Performance evaluation of fingerprint verification systems.

    PubMed

    Cappelli, Raffaele; Maio, Dario; Maltoni, Davide; Wayman, James L; Jain, Anil K

    2006-01-01

    This paper is concerned with the performance evaluation of fingerprint verification systems. After an initial classification of biometric testing initiatives, we explore both the theoretical and practical issues related to performance evaluation by presenting the outcome of the recent Fingerprint Verification Competition (FVC2004). FVC2004 was organized by the authors of this work for the purpose of assessing the state-of-the-art in this challenging pattern recognition application and making available a new common benchmark for an unambiguous comparison of fingerprint-based biometric systems. FVC2004 is an independent, strongly supervised evaluation performed at the evaluators' site on evaluators' hardware. This allowed the test to be completely controlled and the computation times of different algorithms to be fairly compared. The experience and feedback received from previous, similar competitions (FVC2000 and FVC2002) allowed us to improve the organization and methodology of FVC2004 and to capture the attention of a significantly higher number of academic and commercial organizations (67 algorithms were submitted for FVC2004). A new, "Light" competition category was included to estimate the loss of matching performance caused by imposing computational constraints. This paper discusses data collection and testing protocols, and includes a detailed analysis of the results. We introduce a simple but effective method for comparing algorithms at the score level, allowing us to isolate difficult cases (images) and to study error correlations and algorithm "fusion." The huge amount of information obtained, including a structured classification of the submitted algorithms on the basis of their features, makes it possible to better understand how current fingerprint recognition systems work and to delineate useful research directions for the future.

  2. Bioaccumulation and biomarker responses of cubic and octahedral Cu2O micro/nanocrystals in Daphnia magna.

    PubMed

    Fan, Wenhong; Shi, Zhiwei; Yang, Xiuping; Cui, Minming; Wang, Xiaolong; Zhang, Dongfeng; Liu, Hong; Guo, Lin

    2012-11-15

    Great progress has been made in the controlled fabrication of nanomaterials with given sizes, shapes, and geometries. However, how such changes in structure potentially affect the bioavailability and toxicity of metal nanoparticles to aquatic organisms remains mostly unknown. The present study reports the different behaviors of two types of Cu(2)O micro/nanocrystals (micro/nano-Cu(2)O) with different shapes (cubic and octahedral) and crystallographies (with exposed surfaces as {100} or {111}). The bioaccumulation, median lethal concentration, and biomarker responses of Daphnia magna exposed to the two micro/nanocrystals are also investigated. The Cu accumulation, production of metallothionein (MT), and inhibition ratio of D. magna increased gradually with increasing micro/nano-Cu(2)O concentration. The two crystals showed slight Cu accumulation differences toward D. magna, and their biomarker responses and toxicities to D. magna differed significantly as well. The octahedral Cu(2)O micro/nanocrystals were more toxic to D. magna compared with the cubic micro/nanocrystals probably because of the higher surface activities of the {111} facets compared with those of the {100} facets for cuprites. Food ingestion was the main entry pathway of the micro/nanocrystals into organisms, and toxicity was consequently determined based on the dissolution behavior of the micro/nanocrystals in vivo.

  3. The response of European Daphnia magna Straus and Australian Daphnia carinata King to changes in geomagnetic field.

    PubMed

    Krylov, Viacheslav V; Bolotovskaya, Irina V; Osipova, Elena A

    2013-03-01

    This study investigates the effects of lifelong exposure to reversed geomagnetic and zero geomagnetic fields (the latter means absence of geomagnetic field) on the life history of Daphnia carinata King from Australia and Daphnia magna Straus from Europe. Considerable deviation in the geomagnetic field from the usual strength, leads to a decrease in daphnia size and life span. Reduced brood sizes and increased body length of neonates are observed in D. magna exposed to unusual magnetic background. The most apparent effects are induced by zero geomagnetic field in both species of Daphnia. A delay in the first reproduction in zero geomagnetic field is observed only in D. magna. No adaptive maternal effects to reversed geomagnetic field are found in a line of D. magna maintained in these magnetic conditions for eight generations. Integrally, the responses of D. magna to unusual geomagnetic conditions are more extensive than that in D. carinata. We suggest that the mechanism of the effects of geomagnetic field reversal on Daphnia may be related to differences in the pattern of distribution of the particles that have a magnetic moment, or to moving charged organic molecules owing to a change in combined outcome and orientation of the geomagnetic field and Earth's gravitational field. The possibility of modulation of self-oscillating processes with changes in geomagnetic field is also discussed.

  4. β-N-methylamino-L-alanine (BMAA) uptake by the animal model, Daphnia magna and subsequent oxidative stress.

    PubMed

    Esterhuizen-Londt, Maranda; Wiegand, Claudia; Downing, Tim G

    2015-06-15

    β-N-methylamino-l-alanine (BMAA), produced by cyanobacteria, is a neurotoxin implicated in Amyotrophic lateral sclerosis/Parkinsonism dementia complex (ALS/PDC). BMAA concentrations in cyanobacteria are lower than those thought to be necessary to result in neurological damage thus bioaccumulation or biomagnification is required to achieve concentrations able to cause neurodegeneration. Many cyanobacteria produce BMAA and uptake routes into the food web require examination. In this study we investigate the uptake of BMAA by adult phytoplanktivorus Daphnia magna via exposure to dissolved pure BMAA and BMAA containing cyanobacteria, as well as the subsequent oxidative stress response in the daphnia. Free BMAA and protein-associated BMAA were quantified by LC-MS/MS. Dissolved BMAA was taken up and was found as free BMAA in D. magna. No protein-associated BMAA was detected in D. magna after a 24-h exposure period. No BMAA was detectable in D. magna after exposure to BMAA containing cyanobacteria. BMAA inhibited the oxidative stress defence and biotransformation enzymes within 24-h exposure in the tested Daphnia and could therefore impair the oxidant status and the capability of detoxifying other substances in D. magna.

  5. The response of European Daphnia magna Straus and Australian Daphnia carinata King to changes in geomagnetic field.

    PubMed

    Krylov, Viacheslav V; Bolotovskaya, Irina V; Osipova, Elena A

    2013-03-01

    This study investigates the effects of lifelong exposure to reversed geomagnetic and zero geomagnetic fields (the latter means absence of geomagnetic field) on the life history of Daphnia carinata King from Australia and Daphnia magna Straus from Europe. Considerable deviation in the geomagnetic field from the usual strength, leads to a decrease in daphnia size and life span. Reduced brood sizes and increased body length of neonates are observed in D. magna exposed to unusual magnetic background. The most apparent effects are induced by zero geomagnetic field in both species of Daphnia. A delay in the first reproduction in zero geomagnetic field is observed only in D. magna. No adaptive maternal effects to reversed geomagnetic field are found in a line of D. magna maintained in these magnetic conditions for eight generations. Integrally, the responses of D. magna to unusual geomagnetic conditions are more extensive than that in D. carinata. We suggest that the mechanism of the effects of geomagnetic field reversal on Daphnia may be related to differences in the pattern of distribution of the particles that have a magnetic moment, or to moving charged organic molecules owing to a change in combined outcome and orientation of the geomagnetic field and Earth's gravitational field. The possibility of modulation of self-oscillating processes with changes in geomagnetic field is also discussed. PMID:23320498

  6. Molecular Fingerprints Identify Historic Pear Trees in US National Parks

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The U.S. Department of Interior, National Park Service (NPS) has developed conservation plans for historic orchards within National Park boundaries. Variety identification of significant fruit trees is an important part of these plans. The U.S. Department of Agriculture, Agricultural Research Servic...

  7. Noninvasive Molecular Fingerprinting of Host Microbiome Interactions in Neonates

    PubMed Central

    Donovan, Sharon M.; Wang, Mei; Monaco, Marcia H.; Martin, Camilia R.; Davidson, Laurie A.; Ivanov, Ivan; Chapkin, Robert S.

    2014-01-01

    The early postnatal period is a critical window for intestinal and immune maturation. Intestinal development and microbiome diversity and composition differ between breast- (BF) and formula-fed (FF) infants. Mechanistic examination into host-microbe relationships in healthy infants has been hindered by ethical constraints surrounding tissue biopsies. Thus, a statistically rigorous analytical framework to simultaneously examine both host and microbial responses to dietary/environmental factors using exfoliated intestinal epithelial cells was developed. Differential expression of ~1,200 genes, including genes regulating intestinal proliferation, differentiation and barrier function, was observed between BF and FF term infants. Canonical correlation analysis uncovered a relationship between microbiome virulence genes and host immunity and defense genes. Lastly, exfoliated cells from preterm and term infants were compared. Pathways associated with immune cell function and inflammation were up-regulated in preterm, whereas cell growth-related genes were up-regulated in the term infants. Thus, coordinate measurement of the transcriptomes of exfoliated epithelial cells and microbiome allows inquiry into mutualistic host-microbe interactions in the infant, which can be used to prospectively study gut development or, retrospectively, to identify potential triggers of disease in banked samples. PMID:25042036

  8. Security analysis for fingerprint fuzzy vaults

    NASA Astrophysics Data System (ADS)

    Hartloff, Jesse; Bileschi, Maxwell; Tulyakov, Sergey; Dobler, Jimmy; Rudra, Atri; Govindaraju, Venu

    2013-05-01

    In this work we place some of the traditional biometrics work on fingerprint verification via the fuzzy vault scheme within a cryptographic framework. We show that the breaking of a fuzzy vault leads to decoding of Reed-Solomon codes from random errors, which has been proposed as a hard problem in the cryptography community. We provide a security parameter for the fuzzy vault in terms of the decoding problem, which gives context for the breaking of the fuzzy vault, whereas most of the existing literature measures the strength of the fuzzy vault in terms of its resistance to pre-defined attacks or by the entropy of the vault. We keep track of our security parameter, and provide it alongside ROC statistics. We also aim to be more aware of the nature of the fingerprints when placing them in the fuzzy vault, noting that the distribution of minutiae is far from uniformly random. The results we show provide additional support that the fuzzy vault can be a viable scheme for secure fingerprint verification.

  9. Relation between fingerprints and different blood groups.

    PubMed

    Fayrouz, I Noor Eldin; Farida, Noor; Irshad, A H

    2012-01-01

    Fingerprint is one of the oldest, reliable and mature biometric technologies and is considered one of the best, cheapest and legitimate proofs of identification. A correlation between physical characteristics like fingerprints and blood group was demonstrated in previous studies. This study was carried out in 2010 on 305 Libyan medical students of Al-Jabal Al-Gharbi, University, Zawia, Libya and were selected randomly having different ABO blood groups, with the objective to a) Study distribution of fingerprint pattern among the subjects having different ABO and Rh blood group b) Correlate any relation between their characters and blood group. The data from the study showed that male: female ratio was 1.2:1. Majority of subjects (48.9%) in this study were of blood group O followed by blood group A (33.1%), B (12.8%) and AB (5.2%). Rh-positive cases constitute about 87.2% of all studied cases. The general distribution of pattern of finger showed high frequency of Loops registering 50.5%; followed by whorls (35.1%) and arches (14.4%). In Rh+ve cases of blood group A and O loops incidences were the highest (52% and 54.3% respectively) then whorls (33.4% and 30.6% respectively), while in blood group B whorls were predominance in both Rh+ve and Rh-ve cases. In all blood groups there were high frequency of loops in thumb, index and little fingers.

  10. Laser speckle decorrelation for fingerprint acquisition

    NASA Astrophysics Data System (ADS)

    Schirripa Spagnolo, Giuseppe; Cozzella, Lorenzo

    2012-09-01

    Biometry is gaining popularity as a physical security approach in situations where a high level of security is necessary. Currently, biometric solutions are embedded in a very large and heterogeneous group of applications. One of the most sensible is for airport security access to boarding gates. More airports are introducing biometric solutions based on face, fingerprint or iris recognition for passenger identification. In particular, fingerprints are the most widely used biometric, and they are mandatorily included in electronic identification documents. One important issue, which is difficult to address in traditional fingerprint acquisition systems, is preventing contact between subsequent users; sebum, which can be a potential vector for contagious diseases. Currently, non-contact devices are used to overcome this problem. In this paper, a new contact device based on laser speckle decorrelation is presented. Our system has the advantage of being compact and low-cost compared with an actual contactless system, allowing enhancement of the sebum pattern imaging contrast in a simple and low-cost way. Furthermore, it avoids the spreading of contagious diseases.

  11. Water content of latent fingerprints - Dispelling the myth.

    PubMed

    Kent, Terry

    2016-09-01

    Changing procedures in the handling of rare and precious documents in museums and elsewhere, based on assumptions about constituents of latent fingerprints, have led the author to an examination of available data. These changes appear to have been triggered by one paper using general biological data regarding eccrine sweat production to infer that deposited fingerprints are mostly water. Searching the fingerprint literature has revealed a number of reference works similarly quoting figures for average water content of deposited fingerprints of 98% or more. Whilst accurate estimation is difficult there is no evidence that the residue on fingers could be anything like 98% water, even if there were no contamination from sebaceous glands. Consideration of published analytical data of real fingerprints, and several theoretical considerations regarding evaporation and replenishment rates, indicates a probable initial average water content of a fingerprint, soon after deposition, of 20% or less. PMID:27262684

  12. Rolled fingerprint construction using MRF-based nonrigid image registration.

    PubMed

    Kwon, Dongjin; Yun, Il Dong; Lee, Sang Uk

    2010-12-01

    This paper proposes a new rolled fingerprint construction approach incorporating a state-of-the-art nonrigid image registration method based upon a Markov random field (MRF) energy model. The proposed method finds dense correspondences between images from a rolled fingerprint sequence and warps the entire fingerprint area to synthesize a rolled fingerprint. This method can generate conceptually more accurate rolled fingerprints by preserving the geometric properties of the finger surface as opposed to ink-based rolled impressions and other existing rolled fingerprint construction methods. To verify the accuracy of the proposed method, various comparative experiments were designed to reveal differences among the rolled construction methods. The results show that the proposed method is significantly superior in various aspects compared to previous approaches.

  13. Water content of latent fingerprints - Dispelling the myth.

    PubMed

    Kent, Terry

    2016-09-01

    Changing procedures in the handling of rare and precious documents in museums and elsewhere, based on assumptions about constituents of latent fingerprints, have led the author to an examination of available data. These changes appear to have been triggered by one paper using general biological data regarding eccrine sweat production to infer that deposited fingerprints are mostly water. Searching the fingerprint literature has revealed a number of reference works similarly quoting figures for average water content of deposited fingerprints of 98% or more. Whilst accurate estimation is difficult there is no evidence that the residue on fingers could be anything like 98% water, even if there were no contamination from sebaceous glands. Consideration of published analytical data of real fingerprints, and several theoretical considerations regarding evaporation and replenishment rates, indicates a probable initial average water content of a fingerprint, soon after deposition, of 20% or less.

  14. A network identity authentication system based on Fingerprint identification technology

    NASA Astrophysics Data System (ADS)

    Xia, Hong-Bin; Xu, Wen-Bo; Liu, Yuan

    2005-10-01

    Fingerprint verification is one of the most reliable personal identification methods. However, most of the automatic fingerprint identification system (AFIS) is not run via Internet/Intranet environment to meet today's increasing Electric commerce requirements. This paper describes the design and implementation of the archetype system of identity authentication based on fingerprint biometrics technology, and the system can run via Internet environment. And in our system the COM and ASP technology are used to integrate Fingerprint technology with Web database technology, The Fingerprint image preprocessing algorithms are programmed into COM, which deployed on the internet information server. The system's design and structure are proposed, and the key points are discussed. The prototype system of identity authentication based on Fingerprint have been successfully tested and evaluated on our university's distant education applications in an internet environment.

  15. Time-resolved imaging of latent fingerprints with nanosecond resolution

    NASA Astrophysics Data System (ADS)

    Seah, L. K.; Dinish, U. S.; Ong, S. K.; Chao, Z. X.; Murukeshan, V. M.

    2004-07-01

    Imaging of latent fingerprints using time-resolved (TR) method offers a broader platform to eliminate the unwanted background emission. In this paper, a novel TR imaging technique is demonstrated and implemented, which facilitates the detection of latent fingerprints with nanosecond resolution. Simulated experiments were carried out with two overlapping fingerprints treated with two fluorescent powders having different lifetimes in nanosecond range. The dependence of the fluorescence emission intensity in nanosecond resolution of TR imaging is also revealed.

  16. 8-Bit Gray Scale Images of Fingerprint Image Groups

    National Institute of Standards and Technology Data Gateway

    NIST 8-Bit Gray Scale Images of Fingerprint Image Groups (PC database for purchase)   The NIST database of fingerprint images contains 2000 8-bit gray scale fingerprint image pairs. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  17. Recovery of latent fingerprints and DNA on human skin.

    PubMed

    Färber, Doris; Seul, Andrea; Weisser, Hans-Joachim; Bohnert, Michael

    2010-11-01

    The project "Latent Fingerprints and DNA on Human Skin" was the first systematic research in Europe dealing with detection of fingerprints and DNA left by offenders on the skin of corpses. One thousand samples gave results that allow general statements on the materials and methods used. The tests were carried out according to a uniform trial structure. Fingerprints were deposited by natural donors on corpses. The latent fingerprints were treated with magnetic powder or black fingerprint powder. Afterward, they were lifted with silicone casting material (Isomark(®)) or gelatine foil. All lifts were swabbed to recover DNA. It was possible to visualize comparable and identifiable fingerprints on the skin of corpses (16%). In the same categories, magnetic powder (18.4%) yielded better results than black fingerprint powder (13.6%). The number of comparable and identifiable fingerprints decreased on the lifts (12.7%). Isomark(®) (14.9%) was the better lifting material in comparison with gelatine foil (10.1%). In one-third of the samples, DNA could be extracted from the powdered and lifted latents. Black fingerprint powder delivered the better result with a rate of 2.2% for full DNA profiles and profiles useful for exclusion in comparison with 1.8% for the magnetic powder traces. Isomark(®) (3.1%) yielded better results than gelatine foil (0.6%).

  18. Capacity and optimal collusion attack channels for Gaussian fingerprinting games

    NASA Astrophysics Data System (ADS)

    Wang, Ying; Moulin, Pierre

    2007-02-01

    In content fingerprinting, the same media covertext - image, video, audio, or text - is distributed to many users. A fingerprint, a mark unique to each user, is embedded into each copy of the distributed covertext. In a collusion attack, two or more users may combine their copies in an attempt to "remove" their fingerprints and forge a pirated copy. To trace the forgery back to members of the coalition, we need fingerprinting codes that can reliably identify the fingerprints of those members. Researchers have been focusing on designing or testing fingerprints for Gaussian host signals and the mean square error (MSE) distortion under some classes of collusion attacks, in terms of the detector's error probability in detecting collusion members. For example, under the assumptions of Gaussian fingerprints and Gaussian attacks (the fingerprinted signals are averaged and then the result is passed through a Gaussian test channel), Moulin and Briassouli1 derived optimal strategies in a game-theoretic framework that uses the detector's error probability as the performance measure for a binary decision problem (whether a user participates in the collusion attack or not); Stone2 and Zhao et al. 3 studied average and other non-linear collusion attacks for Gaussian-like fingerprints; Wang et al. 4 stated that the average collusion attack is the most efficient one for orthogonal fingerprints; Kiyavash and Moulin 5 derived a mathematical proof of the optimality of the average collusion attack under some assumptions. In this paper, we also consider Gaussian cover signals, the MSE distortion, and memoryless collusion attacks. We do not make any assumption about the fingerprinting codes used other than an embedding distortion constraint. Also, our only assumptions about the attack channel are an expected distortion constraint, a memoryless constraint, and a fairness constraint. That is, the colluders are allowed to use any arbitrary nonlinear strategy subject to the above

  19. Comparative study of minutiae selection algorithms for ISO fingerprint templates

    NASA Astrophysics Data System (ADS)

    Vibert, B.; Charrier, C.; Le Bars, J.-M.; Rosenberger, C.

    2015-03-01

    We address the selection of fingerprint minutiae given a fingerprint ISO template. Minutiae selection plays a very important role when a secure element (i.e. a smart-card) is used. Because of the limited capability of computation and memory, the number of minutiae of a stored reference in the secure element is limited. We propose in this paper a comparative study of 6 minutiae selection methods including 2 methods from the literature and 1 like reference (No Selection). Experimental results on 3 fingerprint databases from the Fingerprint Verification Competition show their relative efficiency in terms of performance and computation time.

  20. Improved Prediction of CYP-Mediated Metabolism with Chemical Fingerprints.

    PubMed

    Zaretzki, Jed; Boehm, Kevin M; Swamidass, S Joshua

    2015-05-26

    Molecule and atom fingerprints, similar to path-based Daylight fingerprints, can substantially improve the accuracy of P450 site-of-metabolism prediction models. Only two chemical fingerprints have been used in metabolism prediction, so little is known about the importance of fingerprint parameters on site of metabolism predictions. It is possible that different fingerprints might yield more accurate models. Here, we study if tuning fingerprints to specific site of metabolism data sets can lead to improved models. We measure the impact of 484 specific chemical fingerprints on the accuracy of P450 site-of-metabolism prediction models on nine P450 isoform site of metabolism data sets. Using a range of search depths, we study path, circular, and subgraph fingerprints. Two different labelings, also, are considered, both standard SMILES labels and also a labeling that marks ring bonds differently than nonring bonds, enabling ortho, para, and meta positioning of substituents to be more clearly encoded. Optimal fingerprint models chosen by cross-validation performance on the full training data are, on average, 3.8% (Top-2; percent of molecules with a site of metabolism in the top two predictions) and 1.4% (AUC; area under the ROC curve) more accurate than base fingerprint models. These gains represent, respectively, a 25.6% and 16.7% reduction in error. A more rigorous assessment selects fingerprints within each cross-validation fold, sometimes selecting different fingerprints for different folds, but yielding a more reliable estimate of generalization error. In this assessment, averaging the scores from the top few fingerprints yields performances improvements of, on average, 3.0% (Top-2) and 0.7% (AUC). These gains are statistically significant and represent, respectively, a 20.1% and 8.8% reduction in error. Between different isoforms, not many consistencies were observed among the top performing fingerprints, with different fingerprints working best for different

  1. Emotional experiences and motivating factors associated with fingerprint analysis.

    PubMed

    Charlton, David; Fraser-Mackenzie, Peter A F; Dror, Itiel E

    2010-03-01

    In this study, we investigated the emotional and motivational factors involved in fingerprint analysis in day-to-day routine case work and in significant and harrowing criminal investigations. Thematic analysis was performed on interviews with 13 experienced fingerprint examiners from a variety of law enforcement agencies. The data revealed factors relating to job satisfaction and the use of skill. Individual satisfaction related to catching criminals was observed; this was most notable in solving high profile, serious, or long-running cases. There were positive emotional effects associated with matching fingerprints and apparent fear of making errors. Finally, we found evidence for a need of cognitive closure in fingerprint examiner decision-making.

  2. Capturing the vital vascular fingerprint with optical coherence tomography.

    PubMed

    Liu, Gangjun; Chen, Zhongping

    2013-08-01

    Using fingerprints as a method to identify an individual has been accepted in forensics since the nineteenth century, and the fingerprint has become one of the most widely used biometric characteristics. Most of the modern fingerprint recognition systems are based on the print pattern of the finger surface and are not robust against spoof attaching. We demonstrate a novel vital vascular fingerprint system using Doppler optical coherence tomography that provides highly sensitive and reliable personal identification. Because the system is based on blood flow, which only exists in a livng person, the technique is robust against spoof attaching.

  3. Supplemental Fingerprint Card Data (SFCD) for NIST Special Database 9

    National Institute of Standards and Technology Data Gateway

    Supplemental Fingerprint Card Data (SFCD) for NIST Special Database 9 (PC database for purchase)   NIST Special Database 10 (Supplemental Fingerprint Card Data for Special Database 9 - 8-Bit Gray Scale Images) provides a larger sample of fingerprint patterns that have a low natural frequency of occurrence and transitional fingerprint classes in NIST Special Database 9. The software is the same code used with NIST Special Database 4 and 9. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  4. Mated Fingerprint Card Pairs (Volumes 1-5)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs (Volumes 1-5) (PC database for purchase)   The NIST database of mated fingerprint card pairs (Special Database 9) consists of multiple volumes. Currently five volumes have been released. Each volume will be a 3-disk set with each CD-ROM containing 90 mated card pairs of segmented 8-bit gray scale fingerprint images (900 fingerprint image pairs per CD-ROM). A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  5. Plain and Rolled Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Plain and Rolled Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 29 is being distributed for use in development and testing fingerprint matching systems. The data consist of 216 ten-print fingerprint card pairs with both the rolled and plains (from a bottom of the fingerprint card) scanned at 19.7 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  6. Retrieval of noisy fingerprint patterns using metric attractor networks.

    PubMed

    González, Mario; Dominguez, David; Rodríguez, Francisco B; Sánchez, Ángel

    2014-11-01

    This work experimentally analyzes the learning and retrieval capabilities of the diluted metric attractor neural network when applied to collections of fingerprint images. The computational cost of the network decreases with the dilution, so we can increase the region of interest to cover almost the complete fingerprint. The network retrieval was successfully tested for different noisy configurations of the fingerprints, and proved to be robust with a large basin of attraction. We showed that network topologies with a 2D-Grid arrangement adapt better to the fingerprints spatial structure, outperforming the typical 1D-Ring configuration. An optimal ratio of local connections to random shortcuts that better represent the intrinsic spatial structure of the fingerprints was found, and its influence on the retrieval quality was characterized in a phase diagram. Since the present model is a set of nonlinear equations, it is possible to go beyond the naïve static solution (consisting in matching two fingerprints using a fixed distance threshold value), and a crossing evolution of similarities was shown, leading to the retrieval of the right fingerprint from an apparently more distant candidate. This feature could be very useful for fingerprint verification to discriminate between fingerprints pairs.

  7. Development of latent fingerprint by ZnO deposition.

    PubMed

    Yu, I-Heng; Jou, Shyankay; Chen, Chin-Min; Wang, Kuang-Chuan; Pang, Lei-Jang; Liao, Jeh Shane

    2011-04-15

    Vacuum metal deposition (VMD) utilizing sequential Au and Zn depositions has been an effective technique to develop latent fingerprint on plastic surfaces. A simplified vacuum deposition process was conducted to develop fingerprint in this study. While pure ZnO was thermally evaporated in a vacuum system, ZnO could condense on polyethylene terephthalate (PET) surface. Direct deposition of ZnO, without applying Au seeding, yielded normal development of latent fingerprint. The development of aged fingerprint by ZnO deposition was more effective than that by Au/Zn VMD.

  8. Evaluating the ameliorative effect of natural dissolved organic matter (DOM) quality on copper toxicity to Daphnia magna: improving the BLM.

    PubMed

    Al-Reasi, Hassan A; Smith, D Scott; Wood, Chris M

    2012-03-01

    Various quality predictors of seven different natural dissolved organic matter (DOM) and humic substances were evaluated for their influence on protection of Daphnia magna neonates against copper (Cu) toxicity. Protection was examined at 3 and 6 mg l(-1) of dissolved organic carbon (DOC) of each DOM isolate added to moderately hard, dechlorinated water. Other water chemistry parameters (pH, concentrations of DOC, calcium, magnesium and sodium) were kept relatively constant. Predictors included absorbance ratios Abs(254/365) (index of molecular weight) and Abs-octanol(254)/Abs-water(254) (index of lipophilicity), specific absorption coefficient (SAC(340); index of aromaticity), and fluorescence index (FI; index of source). In addition, the fluorescent components (humic-like, fulvic-like, tryptophan-like, and tyrosine-like) of the isolates were quantified by parallel factor analysis (PARAFAC). Up to 4-fold source-dependent differences in protection were observed amongst the different DOMs. Significant correlations in toxicity amelioration were found with Abs(254/365), Abs-octanol(254)/Abs-water(254), SAC(340), and with the humic-like fluorescent component. The relationships with FI were not significant and there were no relationships with the tryptophan-like or tyrosine-like fluorescent components at 3 mg C l(-1), whereas a negative correlation was seen with the fulvic-like component. In general, the results indicate that larger, optically dark, more lipophilic, more aromatic DOMs of terrigenous origin, with higher humic-like content, are more protective against Cu toxicity. A method for incorporating SAC(340) as a DOM quality indicator into the Biotic Ligand Model is presented; this may increase the accuracy for predicting Cu toxicity in natural waters.

  9. Bioavailability and toxicity of trace metals to the cladoceran Daphnia magna in relation to cadmium exposure history

    NASA Astrophysics Data System (ADS)

    Guan, Rui

    The cladoceran Daphnia magna is widely used in freshwater bioassessments and ecological risk assessments. This study designed a series of experiments employing radiotracer methodology to quantify the trace metals (mainly Cd and Zn) biokinetics in D. magna under different environmental and biological conditions and to investigate the influences of different Cd exposure histories on the bioavailability and toxicity of trace metals to D. magna. A bioenergetic-based kinetic model was finally applied in predicting the Cd accumulation dynamics in D. magna and the model validity under non-steady state was assessed. Cd assimilation was found in this study to be influenced by the food characteristics (e.g., metal concentration in food particles), the metal exposure history of the animals, and the genetic characteristics. Some of these influences could be interpreted by the capacity and/or competition of those metal binding sites within the digestive tract and/or the detoxifying proteins metallothionein (MT). My study demonstrated a significant induction of MT in response to Cd exposure and it was the dominant fraction in sequestering the internal nonessential trace metals in D. magna. The ratio of Cd body burden to MT might better predict the Cd toxicity on the digestion systems of D. magna than the Cd tissue burden alone within one-generational exposure to Cd. It was found that metal elimination (rate constant and contribution of different release routes) was independent of the food concentration and the dietary metal concentration, implying that the elimination may not be metabolically controlled. The incorporation of the bioenergetic-based kinetic model, especially under non-steady state, is invaluable in helping to understand the fate of trace metals in aquatic systems and potential environmental risks. The dependence of biokinetic parameters on environmental factors rather than on genotypes implies a great potential of using biokinetics in inter-laboratory comparisons.

  10. Toxic effect of selenium on the zooplankton, Daphnia magna and Daphnia pulicaria, in water and the food source (Chlamydomonas reinhardtii)

    SciTech Connect

    Boyum, K.W.

    1984-01-01

    Acute and chronic toxicity experiments were performed on the zooplankton, Daphnia magna and Daphnia pulicaria, to investigate the toxicity of selenium on these aquatic invertebrates. The acute 48 h LC/sub 50/ of sodium selenate for Daphnia magna and Daphnia pulicaria were 1.01 and 0.25 mg Se/1, respectively. The 48 h LC/sub 50/ of sodium selenite for D. magna and D. pulicaria were 0.45 and 0.006 mg Se/1, respectively. Chronic 28-day toxicity tests were performed on D. magna at 0.05, 0.10, 0.50, and 1.00 mg Se/1 as sodium selenate in the water and with two food types. One food type was algae raised in clean Lake Michigan water and the second treatment was algae raised in media with selenium concentrations corresponding to those in the water cited above. When compared to Daphnia fed selenium-free algae, D. magna fed selenium-laden algae had greater survival, a greater number of offspring produced, and a greater intrinsic growth rate, r, at the toxicant concentration in the water of 0.05, 0.10, and 0.50 mg Se/1. These parameters were, however, lower than those observed in the controls. Uptake of /sup 75/Se as sodium selenate in D. magna was reduced in the presence of selenium-laden algae and DL-selenomethionine, while L-methionine increased the uptake of /sup 75/Se. Selenium bound to an amino acid such as Dl-selenomethionine or organically bound within an algal food source appears to be preferentially incorporated thereby reducing the uptake of inorganic forms from the water.

  11. Strategies for potential age dating of fingerprints through the diffusion of sebum molecules on a nonporous surface analyzed using time-of-flight secondary ion mass spectrometry.

    PubMed

    Muramoto, Shin; Sisco, Edward

    2015-08-18

    Age dating of fingerprints could have a significant impact in forensic science, as it has the potential to facilitate the judicial process by assessing the relevance of a fingerprint found at a crime scene. However, no method currently exists that can reliably predict the age of a latent fingerprint. In this manuscript, time-of-flight secondary ion imaging mass spectrometry (TOF-SIMS) was used to measure the diffusivity of saturated fatty acid molecules from a fingerprint on a silicon wafer. It was found that their diffusion from relatively fresh fingerprints (t ≤ 96 h) could be modeled using an error function, with diffusivities (mm(2)/h) that followed a power function when plotted against molecular weight. The equation x = 0.02t(0.5) was obtained for palmitic acid that could be used to find its position in millimeters (where the concentration is 50% of its initial value or c0/2) as a function of time in hours. The results show that on a clean silicon substrate, the age of a fingerprint (t ≤ 96 h) could reliably be obtained through the extent of diffusion of palmitic acid.

  12. Deciphering mechanisms of malathion toxicity under pulse exposure of the freshwater cladoceran Daphnia magna.

    PubMed

    Trac, Lam Ngoc; Andersen, Ole; Palmqvist, Annemette

    2016-02-01

    The organophosphate pesticide (OP) malathion is highly toxic to freshwater invertebrates, including the cladoceran Daphnia magna, a widely used test organism in ecotoxicology. To assess whether toxic effects of malathion are driven primarily by exposure concentration or exposure duration, D. magna was pulse exposed to equivalent integrated doses (duration × concentration): 3 h × 16 μg/L, 24 h × 2 μg/L, and 48 h × 1 μg/L. After recovery periods of 3 h, 24 h, and 48 h, the toxicity of malathion on different biological levels in D. magna was examined by analyzing the following endpoints: survival and immobilization; enzyme activities of acetylcholinesterase (AChE), carboxylesterase (CbE), and glutathione S-transferase (GST); and AChE gene expression. The results showed no difference in survival among equivalent integrated doses. Adverse sublethal effects were driven by exposure concentration rather than pulse duration. Specifically, short pulse exposure to a high concentration of malathion resulted in more immobilized daphnids, lower AChE and CbE activities, and a higher transcript level of AChE gene compared with long pulse exposure to low concentration. The expression of the AChE gene was up-regulated, indicating a compensatory mechanism to cope with enzyme inhibition. The study shows the need for obtaining a better understanding of the processes underlying toxicity under realistic exposure scenarios, so this can be taken into account in environmental risk assessment of pesticides.

  13. Evaluation of ecotoxicological effects of drugs on Daphnia magna using different enzymatic biomarkers.

    PubMed

    Oliveira, Laira L D; Antunes, Sara C; Gonçalves, Fernando; Rocha, Odete; Nunes, Bruno

    2015-09-01

    The increasing occurrence of pharmaceutical drugs in the aquatic environment is cause of concern, due to the possibility of toxic phenomena in non-target species, including oxidative stress and neurotoxicity. The present study aimed to assess the acute effect of four widely used therapeutic agents: acetaminophen (analgesic), chlorpromazine (antipsychotic), diclofenac (anti-inflammatory) and propranolol (antihypertensive), in the cladoceran species Daphnia magna. Considering the involvement of the mentioned compounds in the impairment of cholinesterasic activity and modifications in cellular redox systems, the purpose of this study was to analyze their effects on biomarkers of neuronal regulation, such as total cholinesterases (ChEs), and enzymatic oxidative stress defense, including as catalase (CAT), glutathione-S-transferases (GSTs), and total and selenium-dependent glutathione-peroxidase (total GPx; Se-GPx) activities. Exposure to acetaminophen caused a significant inhibition of AChE and Se-GPx activities in D. magna relative to the control. Among the biomarkers of oxidative stress, only the activity of CAT was significantly altered in concentration of 0.001mg L(-1) of chlorpromazine, which was not always consistent with the literature. Diclofenac caused a significant inhibition of AChE and Se-dependent GPx, and also in total GPx activities. Propranolol was responsible for a significant decrease in the activity of the latter two enzymes, and also a slight increase of GSTs activity. The results indicated that the exposure to all the tested compounds induced alterations on the cellular redox status in the studied species. In addition, acetaminophen and diclofenac were shown to have the capability of interfering with D. magna neurotransmission, through the inhibition of ChEs. Our data enlighten the need for more research on the ecological consequences of pharmaceuticals in non-target organisms.

  14. Comparison of nanosilver and ionic silver toxicity in Daphnia magna and Pimephales promelas.

    PubMed

    Hoheisel, Sarah M; Diamond, Steve; Mount, David

    2012-11-01

    The increasing use of nanosilver in consumer products and the likelihood of environmental exposure warrant investigation into the toxicity of nanosilver to aquatic organisms. A series of studies were conducted comparing the potency of nanosilver to ionic silver (Ag(+)) at acute and sublethal levels using two test organisms (Daphnia magna and Pimephales promelas). The 48-h D. magna median lethal concentration (LC50) of multiple sizes (10, 20, 30, and 50 nm) of commercially prepared nanosilver (nanoComposix) ranged from 4.31 to 30.36 µg total Ag L(-1) with increasing toxicity associated with decreasing particle size. A strong relationship between estimated specific particle surface area and acute toxicity was observed. Nanosilver suspensions (10 nm) treated with cation exchange resin to reduce the concentration of Ag(+) associated with it were approximately equally toxic to D. magna compared to untreated nanosilver (48-h LC50s were 2.15 and 2.79 µg total Ag L(-1), respectively). The 96-h LC50 and 7-d sublethal 20% effective concentrations (EC20s) for P. promelas were 89.4 and 46.1 µg total Ag L(-1), respectively, for 10 nm nanosilver and 4.70 and 1.37 µg total Ag L(-1), respectively, for Ag(+); the resulting ratios of 96-h LC50 to 7-d EC20 were not significantly different for nanosilver and ionic silver. Overall, these studies did not provide strong evidence that nanosilver either acts by a different mechanism of toxicity than ionic silver, or is likely to cause acute or lethal toxicity beyond that which would be predicted by mass concentration of total silver. This in turn suggests that regulatory approaches based on the toxicity of ionic silver to aquatic life would not be underprotective for environmental releases of nanosilver.

  15. Thresholds for sterol-limited growth of Daphnia magna: a comparative approach using 10 different sterols.

    PubMed

    Martin-Creuzburg, Dominik; Oexle, Sarah; Wacker, Alexander

    2014-09-01

    Arthropods are incapable of synthesizing sterols de novo and thus require a dietary source to cover their physiological demands. The most prominent sterol in animal tissues is cholesterol, which is an indispensable structural component of cell membranes and serves as precursor for steroid hormones. Instead of cholesterol, plants and algae contain a variety of different phytosterols. Consequently, herbivorous arthropods have to metabolize dietary phytosterols to cholesterol to meet their requirements for growth and reproduction. Here, we investigated sterol-limited growth responses of the freshwater herbivore Daphnia magna by supplementing a sterol-free diet with increasing amounts of 10 different phytosterols and comparing thresholds for sterol-limited growth. In addition, we analyzed the sterol composition of D. magna to explore sterol metabolic constraints and bioconversion capacities. We show that dietary phytosterols strongly differ in their potential to support somatic growth of D. magna. The dietary threshold concentrations obtained by supplementing the different sterols cover a wide range (3.5-34.4 μg mg C(-1)) and encompass the one for cholesterol (8.9 μg mg C(-1)), indicating that certain phytosterols are more efficient in supporting somatic growth than cholesterol (e.g., fucosterol, brassicasterol) while others are less efficient (e.g., dihydrocholesterol, lathosterol). The dietary sterol concentration gradients revealed that the poor quality of particular sterols can be alleviated partially by increasing dietary concentrations, and that qualitative differences among sterols are most pronounced at low to moderate dietary concentrations. We infer that the dietary sterol composition has to be considered in zooplankton nutritional ecology to accurately assess potential sterol limitations under field conditions.

  16. Fish bioturbation of cadmium-contaminated sediments: Factors affecting Cd availability to Daphnia magna

    SciTech Connect

    Wall, S.B.; La Point, T.W.; Isely, J.J.

    1996-03-01

    Benthic fish bioturbation of contaminated sediments is thought to enhance exposure and, potentially, bioaccumulation into planktonic organisms. Exposures were conducted with cadmium-spiked sediment, 1.0 mg/kg nominal concentrations, and koi carp (Cyprinus carpio). Daphnia magna were placed in aquaria with and without fish for 6 d and Cd bioaccumulation was measured every 48 h. Koi carp bioturbation increased mean total suspended solids (TSS) in two trials from 0.001 mg/L to 44.4 mg/L and 19.2 mg/L to 762.4 mg/L. Mean aqueous Cd concentrations increased from1.4 {micro}g/L to 2.8 {micro}g/L, and from 1.6 {micro}g/L to 13.2 {micro}g/L. Cadmium binding capacity increased from 28.9 {micro}g/L to 169.8 {micro}g/L in with-fish treatments when compared to controls. However, Daphnia magna body burdens did not increase. Mean Cd residues of daphnids exposed with fish, 9.2 {micro}g/g, were not statistically different from without-fish exposures, 8.0 {micro}g/g. Body burdens slightly decreased in the first trial after the with-fish treatment, 9.4 {micro}g/g to 8.3 {micro}g/g. Fish size was partially correlated with TSS and aqueous Cd concentrations and TSS positively correlated with binding capacity. Because increased TSS in the with-fish treatment resulted in increased binding capacity, it is probable that cadmium bioavailability decreased. Although koi carp were capable of remobilizing Cd from sediment, Cd bioaccumulation into Daphnia magna was not significant.

  17. Aminomethylphosphonic acid has low chronic toxicity to Daphnia magna and Pimephales promelas.

    PubMed

    Levine, Steven L; von Mérey, Georg; Minderhout, Tui; Manson, Philip; Sutton, Peter

    2015-06-01

    Aminomethylphosphonic acid (AMPA) is the simplest member of a class of compounds known as aminomethylenephosphonates and the only environmental metabolite measured in significant amounts during the degradation of the herbicide glyphosate in soil. However, there are additional sources of AMPA in the environment, originating from organic phosphonates which are used in water treatment to inhibit scale formation and corrosion. Like glyphosate, AMPA has low acute toxicity to aquatic animals, and the no-observed-adverse effect concentration (NOAEC) obtained from a fish full-life cycle study for glyphosate was determined to be 26 mg/L. However, the chronic toxicity of AMPA to aquatic animals has not been evaluated before. The purpose of the present study was to assess the potential for chronic toxicity of AMPA to fathead minnow (Pimephales promelas) and Daphnia magna. Chronic toxicity to P. promelas was evaluated in a fish early-life stage study. The primary endpoints were larval survival, growth, and development. The NOAEC for P. promelas was determined to be 12 mg/L, the highest concentration tested. The chronic toxicity to D. magna was evaluated in a Daphnia reproduction test. The primary endpoints were survival, growth, and reproduction. The no-observed-effect concentration for D. magna was determined to be 15 mg/L. Conservatively predicted environmental surface water concentrations for AMPA from typical foliar agricultural application rates and values from surface water monitoring programs are 100 to 1000 times less than the NOAEC values from both studies. Consequently, there is a large and highly protective margin of safety between realistic environmental exposures to AMPA and chronic toxicity to aquatic vertebrates and invertebrates.

  18. Population level effects of multiwalled carbon nanotubes in Daphnia magna exposed to pulses of triclocarban.

    PubMed

    Simon, Anne; Preuss, Thomas G; Schäffer, Andreas; Hollert, Henner; Maes, Hanna M

    2015-08-01

    Due to the rapid increase of carbon nanotubes (CNT) applications and their inevitable release into the aquatic environment, CNT may interact with and further influence the fate and transport of other pollutants such as triclocarban (TCC). TCC is a high-production-volume chemical that is widely used as an antimicrobial agent, is continually released into the aquatic environment, and is biologically active and persistent. In the present study, the population test with Daphnia magna was performed over 93 days. Different treatments were examined: (a) control, (b) solvent control, (c) 1 mg CNT/L from the beginning, (d) 1 mg CNT/L as of day 14, (e) control with a 2-day pulse of 25 µg TCC/L on day 14, 41 µg TCC/L (day 54), and 61 µg TCC/L (day 68) and (f) same pulses of TCC with co-exposure to 1 mg CNT/L. Significant changes in all three size classes were observed as a result of the long-term exposure to 1 mg CNT/L. Increasing in number of neonates, and decreasing in number of juveniles and adults were observed. Moreover, daphnids were significantly smaller when they were exposed to MWCNT. The exposure with TCC led to size-dependent mortality in Daphnia magna populations and a subsequent recovery. Lower toxicity of TCC was observed, with the presence of MWCNT in the medium. The reported effects of TCC on population level were compared to the output of an individual-based Daphnia magna population model, in order to verify the model predictions with laboratory data.

  19. Cd and Zn uptake kinetics in Daphnia magna in relation to Cd exposure history.

    PubMed

    Guan, Rui; Wang, Wen-Xiong

    2004-11-15

    The uptake kinetics of Cd and Zn in a freshwater cladoceran Daphnia magna after exposure to different concentrations of Cd for various durations was quantified. The accumulated Cd concentrations increased with ambient Cd concentration and exposure duration. As a detoxification mechanism, metallothioneins (MTs) were induced when the Cd preexposure condition was beyond the noneffect threshold. The MT induction was dependent on both Cd concentration and duration of preexposure. Increasing the Cd exposure concentration to 20 microg L(-1) for 3 d caused a 44% reduction in Cd assimilation efficiency (AE, the fraction assimilated by the animals after digestion) by the daphnids from the dietary phase, but a 2.4-fold increase in Zn AE. Generally, the dissolved metal uptake rate was not significantly affected by the different Cd preexposure regimes, except at a much higher Cd concentration (20 microg L(-1)) when the Zn influx was enhanced. Significant effects from Cd exposure on the ingestion rate of the daphnids were also observed. When the MT synthesis was not coupled with the accumulated Cd tissue burden (e.g., a delay in MT synthesis), apparent Cd toxicity on the feeding behavior and the Cd AE was observed, thus highlighting the importance of MTs in modifying the metal uptake kinetics of D. magna. Overall, daphnids responded to acute Cd exposure by reducing their Cd AE and ingestion, whereas they developed a tolerance to Cd following chronic exposure. The bioavailability of Zn was enhanced as a result of Cd preexposure. This study highlights the important influences of Cd preexposure history on the biokinetics and potential toxicity of Cd and Zn to D. magna.

  20. Obesogens beyond Vertebrates: Lipid Perturbation by Tributyltin in the Crustacean Daphnia magna

    PubMed Central

    Jordão, Rita; Casas, Josefina; Fabrias, Gemma; Campos, Bruno; Piña, Benjamín; Lemos, Marco F.L.; Soares, Amadeu M.V.M.; Tauler, Romà

    2015-01-01

    Background The analysis of obesogenic effects in invertebrates is limited by our poor knowledge of the regulatory pathways of lipid metabolism. Recent data from the crustacean Daphnia magna points to three signaling hormonal pathways related to the molting and reproductive cycles [retinoic X receptor (RXR), juvenile hormone (JH), and ecdysone] as putative targets for exogenous obesogens. Objective The present study addresses the disruptive effects of the model obesogen tributyltin (TBT) on the lipid homeostasis in Daphnia during the molting and reproductive cycle, its genetic control, and health consequences of its disruption. Methods D. magna individuals were exposed to low and high levels of TBT. Reproductive effects were assessed by Life History analysis methods. Quantitative and qualitative changes in lipid droplets during molting and the reproductive cycle were studied using Nile red staining. Lipid composition and dynamics were analyzed by ultra-performance liquid chromatography coupled to a time-of-flight mass spectrometer. Relative abundances of mRNA from different genes related to RXR, ecdysone, and JH signaling pathways were studied by qRT-PCR. Results and Conclusions TBT disrupted the dynamics of neutral lipids, impairing the transfer of triacylglycerols to eggs and hence promoting their accumulation in adult individuals. TBT’s disruptive effects translated into a lower fitness for offspring and adults. Co-regulation of gene transcripts suggests that TBT activates the ecdysone, JH, and RXR receptor signaling pathways, presumably through the already proposed interaction with RXR. These findings indicate the presence of obesogenic effects in a nonvertebrate species. Citation Jordão R, Casas J, Fabrias G, Campos B, Piña B, Lemos MF, Soares AM, Tauler R, Barata C. 2015. Obesogens beyond vertebrates: lipid perturbation by tributyltin in the crustacean Daphnia magna. Environ Health Perspect 123:813–819; http://dx.doi.org/10.1289/ehp.1409163 PMID

  1. Effects of algae frozen at different temperatures on chronic assessment endpoints observed with Daphnia magna.

    PubMed

    Cotelle, S; Ferard, J F

    1996-03-01

    The Daphnia magna 21-day juvenile production test is not yet fully standardized because of many sources of variation. One is the diet provided to daphnids: the ration must be sufficient and the quality of algal cells must be optimal for achieving the required number of offspring defined by the new OECD guidelines. The experiments reported herein first examined the effects of Raphidocelis subcapitata after it had been maintained under four different conditions of storage (4, -20, -80, and -196 degrees C) on the survival, reproductive performance (over 21 days), and growth (ascertained by dry weight) of individually held D. magna for three generations. Under all of the four regimes tested, daphnids survived and reproduced in a manner which fulfilled the current OECD guidelines for a valid test, but the best results were obtained with fresh algae and algae frozen at -80 degrees C. Second, although D. magna has been widely used to determine toxicity of chemical substances, there are no reports in the literature that describe a rigorous study of the nutritional quality of the algae given to daphnids. Therefore, cell number, optical density, amount of organic carbon, and esterasic activity (assessed by intracellular breakdown of FDA to fluorescein) of algae that have been preserved at 4, -20, -80, and -196 degrees C were investigated. This part of the study indicated that freezing had no effect on cell numbers, in contrast to optical density, amount of organic carbon, and esterasic activity. First, it was found that esterasic activity was closely correlated to the reproductive performance of daphnids. It appears important, therefore, to consider the inclusion of this enzymatic activity as part of the routine quality control given to this microinvertebrate chronic procedure. PMID:8723750

  2. Comparison of ethanol toxicity to Daphnia magna and Ceriodaphnia dubia tested at two different temperatures: static acute toxicity test results

    SciTech Connect

    Takahashi, I.T.; Cowgill, U.M.; Murphy, P.G.

    1987-08-01

    Ethanol is a commonly used solvent in toxicity testing, yet there are few studies in the literature devoted to its toxicity to zooplankton. The purpose of this study was to compare the response of Daphnia magna Straus 1820 and Ceriodaphnia dubia J. Richard 1894 to ethanol. Two temperatures were selected because most toxicity data involving D. magna has been carried out at 20/sup 0/C while all discussions concerning C. dubia appear to relate to temperatures oscillating around 25/sup 0/C. Thus, the response of these two organisms to ethanol was examined at 20/sup 0/C and at 24/sup 0/C.r

  3. Cysticercoids of Anoplocephala magna (Eucestoda: Anoplocephalidae) experimentally grown in oribatid mites (Acari: Oribatida).

    PubMed

    Schuster, Rolf K; Coetzee, Louise

    2012-11-23

    Anoplocephala magna eggs found in the rectal content of a naturally infected zebra from South Africa were fed to Scheloribates pallidulus under laboratory condition. Mites remained in contact with the eggs for one week and were late kept for 30 days in an incubator at 28°C. At the end of the experiment, 19 out of 136 mites contained typical anoplocephalidae cysticercoids in their body cavity in numbers between one and three. The average size of the metacestodes varied depending on intensity of infection. Cysticercoid infected mites were less likely to carry mite eggs.

  4. The relationship of total copper 48-h LC50s to Daphnia magna dry weight

    SciTech Connect

    Lazorchak, J.M. ); Waller, W.T. )

    1993-05-01

    A study was conducted with Daphnia magna to determine the effect of neonate weight loss or lack of weight gain on experimentally derived copper 48-h LC50s. Standard unfed tests as well as algal-fed (Selenastrum capricornutum) tests were used to look at weight loss and gain. No significant relationship was found between amount of weight loss and copper LC50s. However, dry weight of unfed and algal-fed control organisms could be used to predict total copper LC50s.

  5. Effect of nutrient limitation of cyanobacteria on protease inhibitor production and fitness of Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Sadler, Thomas; Von Elert, Eric

    2013-10-01

    Herbivore-plant interactions have been well studied in both terrestrial and aquatic ecosystems as they are crucial for the trophic transfer of energy and matter. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is to a large extent represented by Daphnia and cyanobacteria. The occurrence of cyanobacterial blooms in lakes and ponds has, at least partly, been attributed to cyanotoxins, which negatively affect the major grazer of planktonic cyanobacteria, i.e. Daphnia. Among these cyanotoxins are the widespread protease inhibitors. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the gut of Daphnia, i.e. trypsins and chymotrypsins, and to reduce Daphnia growth. In this study we grew cultures of the cyanobacterium Microcystis sp. strain BM25 on nutrient-replete, N-depleted or P-depleted medium. We identified three different micropeptins to be the cause for the inhibitory activity of BM25 against chymotrypsins. The micropeptin content depended on nutrient availability: whereas N limitation led to a lower concentration of micropeptins per biomass, P limitation resulted in a higher production of these chymotrypsin inhibitors. The altered micropeptin content of BM25 was accompanied by changed effects on the fitness of Daphnia magna: a higher content of micropeptins led to lower IC50 values for D. magna gut proteases and vice versa. Following expectations, the lower micropeptin content in the N-depleted BM25 caused higher somatic growth of D. magna. Therefore, protease inhibitors can be regarded as a nutrient-dependent defence against grazers. Interestingly, although the P limitation of the cyanobacterium led to a higher micropeptin content, high growth of D. magna was observed when they were fed with P-depleted BM25. This might be due to reduced digestibility of P-depleted cells with putatively thick mucilaginous sheaths. These findings indicate that

  6. Usefulness of the lipid index for biouptake studies with Daphnia magna

    SciTech Connect

    Dauble, D.D.; Klopfer, D.C.; Carlile, D.W.; Hanf, R.W.

    1984-04-01

    Adult Daphnia magna were starved and monitored for lipid content and brood production. Mean lipid index values declined for 72 hours to less than 50% of 24 hour values. Number of hatched young was inversely related to lipid storage and ovary production. Uptake kinetics of /sup 14/C-labelled quinoline was compared between two daphnid test groups with mean lipid scores of 5.4 and 2.8, respectively. Total /sup 14/C counts were significantly higher for the high lipid group at 8 hour. Our studies indicated that lipid reserves of daphnid test populations can be routinely monitored as an indicator of environmental stress.

  7. Effect of nutrient limitation of cyanobacteria on protease inhibitor production and fitness of Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Sadler, Thomas; Von Elert, Eric

    2013-10-01

    Herbivore-plant interactions have been well studied in both terrestrial and aquatic ecosystems as they are crucial for the trophic transfer of energy and matter. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is to a large extent represented by Daphnia and cyanobacteria. The occurrence of cyanobacterial blooms in lakes and ponds has, at least partly, been attributed to cyanotoxins, which negatively affect the major grazer of planktonic cyanobacteria, i.e. Daphnia. Among these cyanotoxins are the widespread protease inhibitors. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the gut of Daphnia, i.e. trypsins and chymotrypsins, and to reduce Daphnia growth. In this study we grew cultures of the cyanobacterium Microcystis sp. strain BM25 on nutrient-replete, N-depleted or P-depleted medium. We identified three different micropeptins to be the cause for the inhibitory activity of BM25 against chymotrypsins. The micropeptin content depended on nutrient availability: whereas N limitation led to a lower concentration of micropeptins per biomass, P limitation resulted in a higher production of these chymotrypsin inhibitors. The altered micropeptin content of BM25 was accompanied by changed effects on the fitness of Daphnia magna: a higher content of micropeptins led to lower IC50 values for D. magna gut proteases and vice versa. Following expectations, the lower micropeptin content in the N-depleted BM25 caused higher somatic growth of D. magna. Therefore, protease inhibitors can be regarded as a nutrient-dependent defence against grazers. Interestingly, although the P limitation of the cyanobacterium led to a higher micropeptin content, high growth of D. magna was observed when they were fed with P-depleted BM25. This might be due to reduced digestibility of P-depleted cells with putatively thick mucilaginous sheaths. These findings indicate that

  8. A New Approach for Fingerprint Image Compression

    SciTech Connect

    Mazieres, Bertrand

    1997-12-01

    The FBI has been collecting fingerprint cards since 1924 and now has over 200 million of them. Digitized with 8 bits of grayscale resolution at 500 dots per inch, it means 2000 terabytes of information. Also, without any compression, transmitting a 10 Mb card over a 9600 baud connection will need 3 hours. Hence we need a compression and a compression as close to lossless as possible: all fingerprint details must be kept. A lossless compression usually do not give a better compression ratio than 2:1, which is not sufficient. Compressing these images with the JPEG standard leads to artefacts which appear even at low compression rates. Therefore the FBI has chosen in 1993 a scheme of compression based on a wavelet transform, followed by a scalar quantization and an entropy coding : the so-called WSQ. This scheme allows to achieve compression ratios of 20:1 without any perceptible loss of quality. The publication of the FBI specifies a decoder, which means that many parameters can be changed in the encoding process: the type of analysis/reconstruction filters, the way the bit allocation is made, the number of Huffman tables used for the entropy coding. The first encoder used 9/7 filters for the wavelet transform and did the bit allocation using a high-rate bit assumption. Since the transform is made into 64 subbands, quite a lot of bands receive only a few bits even at an archival quality compression rate of 0.75 bit/pixel. Thus, after a brief overview of the standard, we will discuss a new approach for the bit-allocation that seems to make more sense where theory is concerned. Then we will talk about some implementation aspects, particularly for the new entropy coder and the features that allow other applications than fingerprint image compression. Finally, we will compare the performances of the new encoder to those of the first encoder.

  9. Fingerprint image mosaicking by recursive ridge mapping.

    PubMed

    Choi, Kyoungtaek; Choi, Heeseung; Lee, Sangyoun; Kim, Jaihie

    2007-10-01

    To obtain a large fingerprint image from several small partial images, mosaicking of fingerprint images has been recently researched. However, existing approaches cannot provide accurate transformations for mosaics when it comes to aligning images because of the plastic distortion that may occur due to the nonuniform contact between a finger and a sensor or the deficiency of the correspondences in the images. In this paper, we propose a new scheme for mosaicking fingerprint images, which iteratively matches ridges to overcome the deficiency of the correspondences and compensates for the amount of plastic distortion between two partial images by using a thin-plate spline model. The proposed method also effectively eliminates erroneous correspondences and decides how well the transformation is estimated by calculating the registration error with a normalized distance map. The proposed method consists of three phases: feature extraction, transform estimation, and mosaicking. Transform is initially estimated with matched minutia and the ridges attached to them. Unpaired ridges in the overlapping area between two images are iteratively matched by minimizing the registration error, which consists of the ridge matching error and the inverse consistency error. During the estimation, erroneous correspondences are eliminated by considering the geometric relationship between the correspondences and checking if the registration error is minimized or not. In our experiments, the proposed method was compared with three existing methods in terms of registration accuracy, image quality, minutia extraction rate, processing time, reject to fuse rate, and verification performance. The average registration error of the proposed method was less than three pixels, and the maximum error was not more than seven pixels. In a verification test, the equal error rate was reduced from 10% to 2.7% when five images were combined by our proposed method. The proposed method was superior to other

  10. Cytometric fingerprinting: quantitative characterization of multivariate distributions.

    PubMed

    Rogers, Wade T; Moser, Allan R; Holyst, Herbert A; Bantly, Andrew; Mohler, Emile R; Scangas, George; Moore, Jonni S

    2008-05-01

    Recent technological advances in flow cytometry instrumentation provide the basis for high-dimensionality and high-throughput biological experimentation in a heterogeneous cellular context. Concomitant advances in scalable computational algorithms are necessary to better utilize the information that is contained in these high-complexity experiments. The development of such tools has the potential to expand the utility of flow cytometric analysis from a predominantly hypothesis-driven mode to one of discovery, or hypothesis-generating research. A new method of analysis of flow cytometric data called Cytometric Fingerprinting (CF) has been developed. CF captures the set of multivariate probability distribution functions corresponding to list-mode data and then "flattens" them into a computationally efficient fingerprint representation that facilitates quantitative comparisons of samples. An experimental and synthetic data were generated to act as reference sets for evaluating CF. Without the introduction of prior knowledge, CF was able to "discover" the location and concentration of spiked cells in ungated analyses over a concentration range covering four orders of magnitude, to a lower limit on the order of 10 spiked events in a background of 100,000 events. We describe a new method for quantitative analysis of list-mode cytometric data. CF includes a novel algorithm for space subdivision that improves estimation of the probability density function by dividing space into nonrectangular polytopes. Additionally it renders a multidimensional distribution in the form of a one-dimensional multiresolution hierarchical fingerprint that creates a computationally efficient representation of high dimensionality distribution functions. CF supports both the generation and testing of hypotheses, eliminates sources of operator bias, and provides an increased level of automation of data analysis.

  11. Sequence fingerprints of microRNA conservation.

    PubMed

    Shi, Bing; Gao, Wei; Wang, Juan

    2012-01-01

    It is known that the conservation of protein-coding genes is associated with their sequences both various species, such as animals and plants. However, the association between microRNA (miRNA) conservation and their sequences in various species remains unexplored. Here we report the association of miRNA conservation with its sequence features, such as base content and cleavage sites, suggesting that miRNA sequences contain the fingerprints for miRNA conservation. More interestingly, different species show different and even opposite patterns between miRNA conservation and sequence features. For example, mammalian miRNAs show a positive/negative correlation between conservation and AU/GC content, whereas plant miRNAs show a negative/positive correlation between conservation and AU/GC content. Further analysis puts forward the hypothesis that the introns of protein-coding genes may be a main driving force for the origin and evolution of mammalian miRNAs. At the 5' end, conserved miRNAs have a preference for base U, while less-conserved miRNAs have a preference for a non-U base in mammals. This difference does not exist in insects and plants, in which both conserved miRNAs and less-conserved miRNAs have a preference for base U at the 5' end. We further revealed that the non-U preference at the 5' end of less-conserved mammalian miRNAs is associated with miRNA function diversity, which may have evolved from the pressure of a highly sophisticated environmental stimulus the mammals encountered during evolution. These results indicated that miRNA sequences contain the fingerprints for conservation, and these fingerprints vary according to species. More importantly, the results suggest that although species share common mechanisms by which miRNAs originate and evolve, mammals may develop a novel mechanism for miRNA origin and evolution. In addition, the fingerprint found in this study can be predictor of miRNA conservation, and the findings are helpful in achieving a

  12. Comparative oligonucleotide fingerprints of three plant viroids.

    PubMed Central

    Gross, H J; Domdey, H; Sänger, H L

    1977-01-01

    5' Phosphorylation in vitro with gamma-32P-ATP and T4 phage induced polynucleotide kinase was used to obtain RNAase A and RNAase T1 fingerprints of three plant viroids: Potato spindle tuber viroid from tomato (PSTV-tom), chrysanthemum stunt viroid from cineraria (ChSV-cin) and citrus exocortis viroid from Gynura aurantiaca (CEV-gyn). These three viroids differ significantly from each other as judged from their oligonucleotide patterns. This supports the concept of individual viroid species. Images PMID:896482

  13. Raman Fingerprints of Atomically Precise Graphene Nanoribbons

    PubMed Central

    2016-01-01

    Bottom-up approaches allow the production of ultranarrow and atomically precise graphene nanoribbons (GNRs) with electronic and optical properties controlled by the specific atomic structure. Combining Raman spectroscopy and ab initio simulations, we show that GNR width, edge geometry, and functional groups all influence their Raman spectra. The low-energy spectral region below 1000 cm–1 is particularly sensitive to edge morphology and functionalization, while the D peak dispersion can be used to uniquely fingerprint the presence of GNRs and differentiates them from other sp2 carbon nanostructures. PMID:26907096

  14. Method for characterization of adhesion properties of trace explosives in fingerprints and fingerprint simulations.

    PubMed

    Phares, D J; Holt, J K; Smedley, G T; Flagan, R C

    2000-07-01

    The near inevitable transfer of explosive particulate matter through fingerprints makes it possible to detect concealed explosives through surface sampling. Repeatable and well-characterized fingerprint simulation facilitates quantitative comparison between particulate sampling methods for subsequent detection of trace explosive residues. This study employs a simple, but reproducible sampling system to determine the accuracy of a fingerprint simulation. The sampling system uses a gas jet to entrain particles from a substrate and the resulting airborne particles are then aspirated onto a Teflon filter. A calibrated Barringer IonScan 400 ion mobility spectrometer was used to determine the mass of explosive material collected on the filter. The IonScan 400 was calibrated with known masses of 2,4,6-trinitrotoluene (TNT). The resulting calibration curve is in good agreement with that obtained by Garofolo et al. (1994) for an earlier model of the instrument. The collection efficiency of the sampling system was measured for three particle sizes (8.0. 10.0, and 13.0 microm) using spherical polystyrene particles laced with known quantities of TNT. Collection efficiency ranged from less than 1% for the larger particles to 5% for the smaller particles. Particle entrainment from the surface was monitored with dark field imaging of the remaining particles. The sampling system was then applied to two C4 test samples--a fingerprint transfer and a dry Teflon transfer. Over 100 ng of RDX was collected from the dry transfer sample, while less than 1 ng was collected from the fingerprint transfer. Possible explanations for this large difference are presented based on the system calibration.

  15. Transplanted fingerprints: a preliminary case report 40 months posttransplant.

    PubMed

    Szajerka, T; Jurek, B; Jablecki, J

    2010-11-01

    For the past century, fingerprints have been considered permanent and specific for each individual. However, with the advances in transplantology, fingerprints have lost their permanence. Because no study has yet been described, we examined possible changes in the fingerprint pattern of a transplanted hand. In 2006, we performed a hand transplantation on a 32-year-old man. The donor was revealed to have had a criminal record; his fingerprints were stored in the Polish automated fingerprint identification system. A forensic technician fingerprinted the transplanted hand nine times between June 2006 and September 2009. The appearance of minutiae and white lines and the change in the distance between papillary ridges were assessed in the thumbprints of the transplanted hand. The appearance of white lines was only temporary; at no point did they impair fingerprint identification. No significant changes occurred in the distance between the friction ridges. The observed small differences were ascribed to the two techniques used to collect the prints (spoon vs rolling). The number of minutiae ranged from 1 to 3, reaching a maximum in the third posttransplant month. A 40-month observation showed no significant changes in the fingerprints of the transplanted hand. Nevertheless, a long-term study is needed because of the risk of chronic rejection. The noninvasiveness of dactylography argues for inspecting its application to diagnose acute rejection. Finally, lawmakers should be made aware of the personal-protection issues related to the growing number of hand-transplant recipients. PMID:21094851

  16. Study of noninvasive detection of latent fingerprints using UV laser

    NASA Astrophysics Data System (ADS)

    Li, Hong-xia; Cao, Jing; Niu, Jie-qing; Huang, Yun-gang; Mao, Lin-jie; Chen, Jing-rong

    2011-06-01

    Latent fingerprints present a considerable challenge in forensics, and noninvasive procedure that captures a digital image of the latent fingerprints is significant in the field of criminal investigation. The capability of photography technologies using 266nm UV Nd:YAG solid state laser as excitation light source to provide detailed images of unprocessed latent fingerprints is demonstrated. Unprocessed latent fingerprints were developed on various non-absorbent and absorbing substrates. According to the special absorption, reflection, scattering and fluorescence characterization of the various residues in fingerprints (fatty acid ester, protein, and carbosylic acid salts etc) to the UV light to weaken or eliminate the background disturbance and increase the brightness contrast of fingerprints with the background, and using 266nm UV laser as excitation light source, fresh and old latent fingerprints on the surface of four types of non-absorbent objects as magazine cover, glass, back of cellphone, wood desktop paintwork and two types of absorbing objects as manila envelope, notebook paper were noninvasive detected and appeared through reflection photography and fluorescence photography technologies, and the results meet the fingerprint identification requirements in forensic science.

  17. Teaching DNA Fingerprinting using a Hands-on Simulation.

    ERIC Educational Resources Information Center

    Schug, Thatcher

    1998-01-01

    Presents an inexpensive hands-on lesson in DNA fingerprinting that can be completed in a single class period. Involves students in solving a murder in which a drop of blood is fingerprinted and matched with the blood of the murderer. (DDR)

  18. A Practical Workshop for Generating Simple DNA Fingerprints of Plants

    ERIC Educational Resources Information Center

    Rouziere, A.-S.; Redman, J. E.

    2011-01-01

    Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of…

  19. Visualization of latent fingerprint corrosion of metallic surfaces.

    PubMed

    Bond, John W

    2008-07-01

    Chemical reactions between latent fingerprints and a variety of metal surfaces are investigated by heating the metal up to temperatures of approximately 600 degrees C after deposition of the fingerprint. Ionic salts present in the fingerprint residue corrode the metal surface to produce an image of the fingerprint that is both durable and resistant to cleaning of the metal. The degree of fingerprint enhancement appears independent of the elapsed time between deposition and heating but is very dependent on both the composition of the metal and the level of salt secretion by the fingerprint donor. Results are presented that show practical applications for the enhancement to fingerprints deposited in arson crime scenes, contaminated by spray painting, or deposited on brass cartridge cases prior to discharge. The corrosion of the metal surface is further exploited by the demonstration of a novel technique for fingerprint enhancement based on the electrostatic charging of the metal and then the preferential adherence of a metallic powder to the corroded part of the metal surface.

  20. Jan Evangelista Purkynje (1787-1869): first to describe fingerprints.

    PubMed

    Grzybowski, Andrzej; Pietrzak, Krzysztof

    2015-01-01

    Fingerprints have been used for years as the accepted tool in criminology and for identification. The first system of classification of fingerprints was introduced by Jan Evangelista Purkynje (1787-1869), a Czech physiologist, in 1823. He divided the papillary lines into nine types, based on their geometric arrangement. This work, however, was not recognized internationally for many years. In 1858, Sir William Herschel (1833-1917) registered fingerprints for those signing documents at the Indian magistrate's office in Jungipoor. Henry Faulds (1843-1930) in 1880 proposed using ink for fingerprint determination and people identification, and Francis Galton (1822-1911) collected 8000 fingerprints and developed their classification based on the spirals, loops, and arches. In 1892, Juan Vucetich (1858-1925) created his own fingerprint identification system and proved that a woman was responsible for killing two of her sons. In 1896, a London police officer Edward Henry (1850-1931) expanded on earlier systems of classification and used papillary lines to identify criminals; it was his system that was adopted by the forensic world. The work of Jan Evangelista Purkynje (1787-1869) (Figure 1), who in 1823 was the first to describe in detail fingerprints, is almost forgotten. He also established their classification. The year 2013 marked the 190th anniversary of the publication of his work on this topic. Our contribution is an attempt to introduce the reader to this scientist and his discoveries in the field of fingerprint identification. PMID:25530005