Science.gov

Sample records for magna molecular fingerprints

  1. Molecular impact of juvenile hormone agonists on neonatal Daphnia magna.

    PubMed

    Toyota, Kenji; Kato, Yasuhiko; Miyakawa, Hitoshi; Yatsu, Ryohei; Mizutani, Takeshi; Ogino, Yukiko; Miyagawa, Shinichi; Watanabe, Hajime; Nishide, Hiroyo; Uchiyama, Ikuo; Tatarazako, Norihisa; Iguchi, Taisen

    2014-05-01

    Daphnia magna has been used extensively to evaluate organism- and population-level responses to pollutants in acute toxicity and reproductive toxicity tests. We have previously reported that exposure to juvenile hormone (JH) agonists results in a reduction of reproductive function and production of male offspring in a cyclic parthenogenesis, D. magna. Recent advances in molecular techniques have provided tools to understand better the responses to pollutants in aquatic organisms, including D. magna. DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to JH agonists: methoprene (125, 250 and 500 ppb), fenoxycarb (0.5, 1 and 2 ppb) and epofenonane (50, 100 and 200 ppb). Exposure to these JH analogs resulted in chemical-specific patterns of gene expression. The heat map analyses based on hierarchical clustering revealed a similar pattern between treatments with a high dose of methoprene and with epofenonane. In contrast, treatment with low to middle doses of methoprene resulted in similar profiles to fenoxycarb treatments. Hemoglobin and JH epoxide hydrolase genes were clustered as JH-responsive genes. These data suggest that fenoxycarb has high activity as a JH agonist, methoprene shows high toxicity and epofenonane works through a different mechanism compared with other JH analogs, agreeing with data of previously reported toxicity tests. In conclusion, D. magna DNA microarray is useful for the classification of JH analogs and identification of JH-responsive genes.

  2. Molecular fingerprint similarity search in virtual screening.

    PubMed

    Cereto-Massagué, Adrià; Ojeda, María José; Valls, Cristina; Mulero, Miquel; Garcia-Vallvé, Santiago; Pujadas, Gerard

    2015-01-01

    Molecular fingerprints have been used for a long time now in drug discovery and virtual screening. Their ease of use (requiring little to no configuration) and the speed at which substructure and similarity searches can be performed with them - paired with a virtual screening performance similar to other more complex methods - is the reason for their popularity. However, there are many types of fingerprints, each representing a different aspect of the molecule, which can greatly affect search performance. This review focuses on commonly used fingerprint algorithms, their usage in virtual screening, and the software packages and online tools that provide these algorithms.

  3. Molecular graph convolutions: moving beyond fingerprints.

    PubMed

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-08-01

    Molecular "fingerprints" encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular graph convolutions, a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph-atoms, bonds, distances, etc.-which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement.

  4. Molecular graph convolutions: moving beyond fingerprints

    NASA Astrophysics Data System (ADS)

    Kearnes, Steven; McCloskey, Kevin; Berndl, Marc; Pande, Vijay; Riley, Patrick

    2016-08-01

    Molecular "fingerprints" encoding structural information are the workhorse of cheminformatics and machine learning in drug discovery applications. However, fingerprint representations necessarily emphasize particular aspects of the molecular structure while ignoring others, rather than allowing the model to make data-driven decisions. We describe molecular graph convolutions, a machine learning architecture for learning from undirected graphs, specifically small molecules. Graph convolutions use a simple encoding of the molecular graph—atoms, bonds, distances, etc.—which allows the model to take greater advantage of information in the graph structure. Although graph convolutions do not outperform all fingerprint-based methods, they (along with other graph-based methods) represent a new paradigm in ligand-based virtual screening with exciting opportunities for future improvement.

  5. Identification of molecular mechanisms used by Finegoldia magna to penetrate and colonize human skin.

    PubMed

    Murphy, Elizabeth C; Mörgelin, Matthias; Reinhardt, Dieter P; Olin, Anders I; Björck, Lars; Frick, Inga-Maria

    2014-10-01

    Finegoldia magna is a Gram-positive anaerobic commensal of the human skin microbiota, but also known to act as an opportunistic pathogen. Two primary virulence factors of F. magna are the subtilisin-like extracellular serine protease SufA and the adhesive protein FAF. This study examines the molecular mechanisms F. magna uses when colonizing or establishing an infection in the skin. FAF was found to be essential in the initial adherence of F. magna to human skin biopsies. In the upper layers of the epidermis FAF mediates adhesion through binding to galectin-7 - a keratinocyte cell marker. Once the bacteria moved deeper into the skin to the basement membrane layer, SufA was found to degrade collagen IV which forms the backbone structure of the basement membrane. It also degraded collagen V, whereby F. magna could reach deeper dermal tissue sites. In the dermis, FAF interacts with collagen V and fibrillin, which presumably helps the bacteria to establish infection in this area. The findings of this study paint a clear picture of how F. magna interacts with human skin and explain how it is such a successful opportunistic pathogen in chronic wounds and ulcers.

  6. Linking molecular and population stress responses in Daphnia magna exposed to cadmium.

    PubMed

    Connon, Richard; Hooper, Helen L; Sibly, Richard M; Lim, Fei-Ling; Heckmann, Lars-Henrik; Moore, David J; Watanabe, Hajime; Soetaert, Anneleen; Cook, Katie; Maund, Steve J; Hutchinson, Thomas H; Moggs, Jonathan; De Coen, Wim; Iguchi, Taisen; Callaghan, Amanda

    2008-03-15

    DNA microarrays can be used to measure environmental stress responses. If they are to be predictive of environmental impact, we need to determine if altered gene expression translates into negative impacts on individuals and populations. A large cDNA microarray (14000 spots) was created to measure molecular stress responses to cadmium in Daphnia magna,the mostwidely used aquatic indicator species, and relate responses to population growth rate (pgr). We used the array to detect differences in the transcription of genes in juvenile D. magna (24 h old) after 24 h exposure to a control and three cadmium concentrations (6, 20, and 37 microg Cd2+ L(-1)). Stress responses at the population level were estimated following a further 8 days exposure. Pgr was approximately linear negative with increasing cadmium concentration over this range. The microarray profile of gene expression in response to acute cadmium exposure begins to provide an overview of the molecular responses of D. magna, especially in relation to growth and development. Of the responding genes, 29% were involved with metabolism including carbohydrate, fat and peptide metabolism, and energy production, 31% were involved with transcription/translation, while 40% of responding genes were associated with cellular processes like growth and moulting, ion transport, and general stress responses (which included oxidative stress). Our production and application of a large Daphnia magna microarray has shown that measured gene responses can be logically linked to the impact of a toxicant such as cadmium on somatic growth and development, and consequently pgr.

  7. Fingerprinting Electronic Molecular Complexes in Liquid

    NASA Astrophysics Data System (ADS)

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules.

  8. Fingerprinting Electronic Molecular Complexes in Liquid

    PubMed Central

    Nirmalraj, Peter; La Rosa, Andrea; Thompson, Damien; Sousa, Marilyne; Martin, Nazario; Gotsmann, Bernd; Riel, Heike

    2016-01-01

    Predicting the electronic framework of an organic molecule under practical conditions is essential if the molecules are to be wired in a realistic circuit. This demands a clear description of the molecular energy levels and dynamics as it adapts to the feedback from its evolving chemical environment and the surface topology. Here, we address this issue by monitoring in real-time the structural stability and intrinsic molecular resonance states of fullerene (C60)-based hybrid molecules in the presence of the solvent. Energetic levels of C60 hybrids are resolved by in situ scanning tunnelling spectroscopy with an energy resolution in the order of 0.1 eV at room-temperature. An ultra-thin organic spacer layer serves to limit contact metal-molecule energy overlap. The measured molecular conductance gap spread is statistically benchmarked against first principles electronic structure calculations and used to quantify the diversity in electronic species within a standard population of molecules. These findings provide important progress towards understanding conduction mechanisms at a single-molecular level and in serving as useful guidelines for rational design of robust nanoscale devices based on functional organic molecules. PMID:26743542

  9. Molecular mechanisms of tolerance to cyanobacterial protease inhibitors revealed by clonal differences in Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Kuster, Christian J; Von Elert, Eric

    2012-10-01

    Protease inhibitors of primary producers are a major food quality constraint for herbivores. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is mainly represented by Daphnia and cyanobacteria. Protease inhibitors have been found in many cyanobacterial blooms. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the daphnid's gut, that is, trypsins and chymotrypsins. In this study, we fed four different Daphnia magna genotypes with the trypsin-inhibitor-containing cyanobacterial strain Microcystis aeruginosa PCC 7806 Mut. Upon exposure to dietary trypsin inhibitors, all D. magna genotypes showed increased gene expression of digestive trypsins and chymotrypsins. Exposure to dietary trypsin inhibitors resulted in increased activity of chymotrypsins and reduced activity of trypsin. Strong intraspecific differences in tolerance of the four D. magna genotypes to the dietary trypsin inhibitors were found. The degree of tolerance depended on the D. magna genotype. The genotypes' tolerance was positively correlated with the residual trypsin activity and the different IC(50) values of the trypsins. On the genetic level, the different trypsin loci varied between the D. magna genotypes. The two tolerant Daphnia genotypes that both originate from the same lake, which frequently produces cyanobacterial blooms, clustered in a neighbour-joining phylogenetic tree based on the three trypsin loci. This suggests that the genetic variability of trypsin loci was an important cause for the observed intraspecific variability in tolerance to cyanobacterial trypsin inhibitors. Based on these findings, it is reasonable to assume that such genetic variability can also be found in natural populations and thus constitutes the basis for local adaptation of natural populations to dietary protease inhibitors.

  10. Phylogeny and molecular fingerprinting of green sulfur bacteria.

    PubMed

    Overmann, J; Tuschak, C

    1997-05-01

    The 16S rDNA sequences of nine strains of green sulfur bacteria (Chlorobiaceae) were determined and compared to the four known sequences of Chlorobiaceae and to sequences representative for all eubacterial phyla. The sequences of the Chlorobiaceae strains were consistent with the secondary structure model proposed earlier for Chlorobium vibrioforme strain 6030. Similarity values > 90.1% and Knuc values < 0.11 indicate a close phylogenetic relatedness among the green sulfur bacteria. As a group, these bacteria represent an isolated branch within the eubacterial radiation. In Chlorobiaceae, a similar morphology does not always reflect a close phylogenetic relatedness. While ternary fission is a morphological trait of phylogenetic significance, gas vesicle formation occurs also in distantly related species. Pigment composition is not an indicator of phylogenetic relatedness since very closely related species contain different bacteriochlorophylls and carotenoids. Two different molecular fingerprinting techniques for the rapid differentiation of Chlorobiaceae species were investigated. The 16S rDNA fragments of several species could not be separated by denaturing gradient gel electrophoresis. In contrast, all strains investigated during the present work gave distinct banding patterns when dispersed repetitive DNA sequences were used as targets in PCR. The latter technique is, therefore, well suited for the rapid screening of isolated pure cultures of green sulfur bacteria.

  11. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    PubMed

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  12. Telopathes magna gen. nov., spec. nov. (Cnidaria: Anthozoa: Antipatharia: Schizopathidae) from deep waters off Atlantic Canada and the first molecular phylogeny of the deep-sea family Schizopathidae.

    PubMed

    Macisaac, K G; Best, M; Brugler, M R; Kenchington, E L R; Anstey, L J; Jordan, T

    2013-01-01

    A new genus and species of deep-sea antipatharian, Telopathes magna gen. nov., spec. nov., is described from the western North Atlantic off the coast of Canada. Five additional paratypes, consisting ofjuvenile to adult forms, are reported from the New England and Corner Rise Seamounts (NW Atlantic). Preliminary sequencing of a subsection of the nuclear ribosomal cistron confirmed the phylogenetic affinity of T. magna to the order Antipatharia, and in particular the family Schizopathidae. Subsequent sequencing of three mitochondrial DNA segments from nine of the 11 currently-recognized genera within the Schizopathidae revealed a well-supported phylogenetic relationship between T. magna and Stauropathes. This is the first study to use molecular techniques to elucidate the evolutionary relationships of the Schizopathidae, a family of black corals almost exclusively found in the deep sea (depths > 200 m). Telopathes is distinguished from other genera within the family Schizopathidae by its largely pinnulated stalk, sparse branching pattern to the second degree that is not restricted to a single plane, two anterolateral rows of long, simple primary pinnules, arranged alternately to sub-opposite, and colony with an adhesive base. This record of T. magna brings the total number of nominal species of Antipatharia reported to occur off eastern Canada to 12 and represents the third new genus added to the Schizopathidae since a critical review of the family by Dennis Opresko in 2002.

  13. Molecular fingerprinting on the SIMD parallel processor Kestrel.

    PubMed

    Rice, E; Hughey, R

    2001-01-01

    In combinatorial library design and use, the conformation space of molecules can be represented using three-dimensional (3-D) pharmacophores. For large libraries of flexible molecules, the calculation of these 3-D pharmacophoric fingerprints can require examination of trillions of pharmacophores, presenting a significant practical challenge. Here we describe the mapping of this problem to the UCSC Kestrel parallel processor, a single-instruction multiple-data (SIMD) processor. Data parallelism is achieved by simultaneous processing of multiple conformations and by careful representation of the fingerprint structure in the array. The resulting application achieved a 35+ speedup over an SGI 2000 processor on the prototype Kestrel board.

  14. Linguini Models of Molecular Genetic Mapping and Fingerprinting.

    ERIC Educational Resources Information Center

    Thompson, James N., Jr.; Gray, Stanton B.; Hellack, Jenna J.

    1997-01-01

    Presents an exercise using linguini noodles to demonstrate an aspect of DNA fingerprinting. DNA maps that show genetic differences can be produced by digesting a certain piece of DNA with two or more restriction enzymes both individually and in combination. By rearranging and matching linguini fragments, students can recreate the original pattern…

  15. Comparison of molecular fingerprint methods on the basis of biological profile data.

    PubMed

    Steffen, Andreas; Kogej, Thierry; Tyrchan, Christian; Engkvist, Ola

    2009-02-01

    In this study we evaluated a set of molecular fingerprint methods with respect to their capability to reproduce similarities in the biological activity space. The evaluation presented in this paper is therefore different from many other fingerprint studies, in which the enrichment of active compounds binding to the same target as selected query structures was studied. Conversely, our data set was extracted from the BioPrint database, which contains uniformly derived biological activity profiles of mainly marketed drugs for a range of biological assays relevant for the pharmaceutical industry. We compared calculated molecular fingerprint similarity values between all compound pairs of the data set with the corresponding similarities in the biological activity space and additionally analyzed agreements of generated clusterings. A closer analysis of the compound pairs with a high biological activity similarity revealed that fingerprint methods such as CHEMGPS or TRUST4, which describe global features of a molecule such as physicochemical properties and pharmacophore patterns, might be better suited to describe similarity of biological activity profiles than purely structural fingerprint methods. It is therefore suggested that the usage of these fingerprint methods could increase the probability of finding molecules with a similar biological activity profile but yet a different chemical structure.

  16. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  17. Linear polyalkylamines as fingerprinting agents in capillary electrophoresis of low molecular weight heparins and glycosaminoglycans

    PubMed Central

    King, J. Timothy; Desai, Umesh R.

    2012-01-01

    Glycosaminoglycan (GAG) analysis represents a challenging frontier despite the advent of many high resolution technologies because of their unparalleled structural complexity. We previously developed a resolving agent aided capillary electrophoretic approach for fingerprinting low molecular weight heparins (LMWHs) to profile their microscopic differences and assess batch-to-batch variability. In this work, we study the application of this approach for fingerprinting other GAGs and analyze the basis for the fingerprints observed in CE. Whereas the resolving agents, linear polyalkylamines, could resolve the broad featureless electropherogram of LMWH into a large number of distinct, highly reproducible peaks, longer GAGs such as chondroitin sulfate, dermatan sulfate and heparin responded in a highly individualistic manner. Full-length heparin interacted with linear polyalkylamines very strongly followed by dermatan sulfate, while chondroitin sulfate remained essentially unaffected. Oversulfated chondroitin sulfate could be easily identified from full-length heparin. Scatchard analysis of the binding profile of enoxaparin with three linear polyalkylamines displayed a biphasic binding profile suggesting two distinctly different types of interactions. Some LMWH chains were found to interact with linear polyalkylamines with affinities as high as 10 nM, while others displayed nearly 5000-fold weaker affinities. These observations provide fundamental insight into the basis for fingerprinting of LMWHs by linear polyalkylamine-based resolving agents, which could be utilized in the design of advanced resolving agents for compositional profiling, direct sequencing and chemoinformatics studies. PMID:22002802

  18. [The problem of molecular-genetic identification of sweat and grease deposits in the human fingerprints].

    PubMed

    Faleeva, T G; Ivanov, I N; Mishin, E S; Vnukova, N V; Kornienko, I V

    2016-01-01

    The objective of the present experimental molecular-genetic study of DNA contained in of human fingerprints was to establish the relationship between the reference genetic profiles and the genotypes of the individuals leaving their fingerprints on a smooth metal object. The biological material for the purpose of the investigation was sampled at different time intervals. The were taken using a scotch tape and used to obtain the complete genetic profile immediately after the fingerprints had been left as well as within the next 24 hours and one week. It proved impossible to identify the complete genetic profile one month after the fingerprints had been left. The alleles not typical for reference samples were identified within one week after swabbing the material from the metal surface. The results of the sudy can be explained by the decrease of the concentration of the initial DNA-matrix in the samples due to its degradation in the course of time. It is concluded that the parallel genetic analysis is needed if reliable evidence of identity of the profiles of interest or its absence is to be obtained.

  19. Zika virus disrupts molecular fingerprinting of human neurospheres

    PubMed Central

    Garcez, Patricia P.; Nascimento, Juliana Minardi; de Vasconcelos, Janaina Mota; Madeiro da Costa, Rodrigo; Delvecchio, Rodrigo; Trindade, Pablo; Loiola, Erick Correia; Higa, Luiza M.; Cassoli, Juliana S.; Vitória, Gabriela; Sequeira, Patricia C.; Sochacki, Jaroslaw; Aguiar, Renato S.; Fuzii, Hellen Thais; de Filippis, Ana M. Bispo; da Silva Gonçalves Vianez Júnior, João Lídio; Tanuri, Amilcar; Martins-de-Souza, Daniel; Rehen, Stevens K.

    2017-01-01

    Zika virus (ZIKV) has been associated with microcephaly and other brain abnormalities; however, the molecular consequences of ZIKV to human brain development are still not fully understood. Here we describe alterations in human neurospheres derived from induced pluripotent stem (iPS) cells infected with the strain of Zika virus that is circulating in Brazil. Combining proteomics and mRNA transcriptional profiling, over 500 proteins and genes associated with the Brazilian ZIKV infection were found to be differentially expressed. These genes and proteins provide an interactome map, which indicates that ZIKV controls the expression of RNA processing bodies, miRNA biogenesis and splicing factors required for self-replication. It also suggests that impairments in the molecular pathways underpinning cell cycle and neuronal differentiation are caused by ZIKV. These results point to biological mechanisms implicated in brain malformations, which are important to further the understanding of ZIKV infection and can be exploited as therapeutic potential targets to mitigate it. PMID:28112162

  20. The fingerprint of the human gastrointestinal tract microbiota: a hypothesis of molecular mapping.

    PubMed

    Tomasello, G; Mazzola, M; Jurjus, A; Cappello, F; Carini, F; Damiani, P; Gerges Geagea, A; Zeenny, M N; Leone, A

    2017-01-01

    The precise etiology of Inflammatory Bowel Disease (IDB) remains unclear and several factors are believed to play a role in its development and progression, including the composition of microbial communities resident in the gastrointestinal tract. Human intestinal microbiota are extensive with at least 15,000-36,000 bacterial species. However, thanks to the new development in sequencing and molecular taxonomic methodologies, our understanding of the microbiota population composition, dynamics, and ecology has greatly increased. Intestinal microbiota play a critical role in the maintenance of the host intestinal barrier homeostasis, while dysbiosis, which involves reduction in the microbiome diversity, can lead to progression of inflammatory disorders, such as IBD and colorectal cancer. It is hypothesized that fingerprinting characterization of the microbiota community composition is the first step in the study of this complex bacterial ecosystem and a crucial step in the targeted therapy. Molecular fingerprinting of human gastrointestinal tract microbiota could be performed by different techniques including the semi quantitation, 16SrRNA, the DNA- microarray as well as other relatively new methods which were developed to study many complex bacterial ecosystems. These techniques provide individual data and profiles, using fast and sensitive tools for the high taxonomic level fingerprint of the human intestinal microbiota and provide estimation of the relative presence of the microbial target groups within each individual. Such personalized information serves as a remarkable and unprecedented opportunity to improve targeted medical treatment and probably develop strategies to prevent disease.

  1. Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

    PubMed

    McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

    2016-05-05

    One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. http://creativecommons.org/licenses/by-nc-nd/4.0/.

  2. Endoscopic Raman Spectroscopy for Molecular Fingerprinting of Gastric Cancer: Principle to Implementation.

    PubMed

    Kim, Hyung Hun

    2015-01-01

    Currently, positive endoscopic biopsy is the standard criterion for gastric cancer diagnosis but is invasive, often inconsistent, and delayed although early detection and early treatment is the most important policy. Raman spectroscopy is a spectroscopic technique based on inelastic scattering of monochromatic light. Raman spectrum represents molecular composition of the interrogated volume providing a direct molecular fingerprint. Several investigations revealed that Raman spectroscopy can differentiate normal, dysplastic, and adenocarcinoma gastric tissue with high sensitivity and specificity. Moreover, this technique can indentify malignant ulcer and showed the capability to analyze the carcinogenesis process. Automated on-line Raman spectral diagnostic system raised possibility to use Raman spectroscopy in clinical field. Raman spectroscopy can be applied in many fields such as guiding a target biopsy, optical biopsy in bleeding prone situation, and delineating the margin of the lesion. With wide field technology, Raman spectroscopy is expected to have specific role in our future clinical field.

  3. Molecular Fingerprinting Studies Do Not Support Intrahospital Transmission of Candida albicans among Candidemia Patients in Kuwait

    PubMed Central

    Asadzadeh, Mohammad; Ahmad, Suhail; Al-Sweih, Noura; Khan, Ziauddin

    2017-01-01

    Candida albicans, a constituent of normal microbial flora of human mucosal surfaces, is a major cause of candidemia in immunocompromised individuals and hospitalized patients with other debilitating diseases. Molecular fingerprinting studies have suggested nosocomial transmission of C. albicans based on the presence of clusters or endemic genotypes in some hospitals. However, intrahospital strain transmission or a common source of infection has not been firmly established. We performed multilocus sequence typing (MLST) on 102 C. albicans bloodstream isolates (representing 92% of all culture-confirmed candidemia patients over a 31-month period at seven major hospitals) to identify patient-to-patient transmission or infection from a common source in Kuwait, a small country in the Middle East where consanguineous marriages are common. Repeat bloodstream isolates from six patients and nine surveillance cultures from other anatomic sites from six patients were also analyzed. Fifty-five isolates belonged to unique genotypes. Forty-seven isolates from 47 patients formed 16 clusters, with each cluster containing 2–9 isolates. Multiple isolates from the same patient from bloodstream or other anatomical sites yielded identical genotypes. We identified four cases of potential patient-to-patient transmission or infection from a common source based on association analysis between patients' clinical/epidemiological data and the corresponding MLST genotypes of eight C. albicans isolates. However, further fingerprinting by whole genome-based amplified fragment length polymorphism (AFLP) analysis yielded 8 different genotypes, ruling out intrahospital transmission of infection. The findings suggest that related strains of C. albicans exist in the community and fingerprinting by MLST alone may complicate hospital infection control measures during outbreak investigations. PMID:28270801

  4. Molecular Dynamics Fingerprints (MDFP): Machine-Learning from MD Data to Predict Free-Energy Differences.

    PubMed

    Riniker, Sereina

    2017-04-03

    While the use of machine-learning (ML) techniques is well established in cheminformatics for the prediction of physicochemical properties and binding affinities, the training of ML models based on data from molecular dynamics (MD) simulations remains largely unexplored. Here, we present a fingerprint termed MDFP which is constructed from the distributions of properties such as potential-energy components, radius of gyration and solvent-accessible surface area extracted from MD simulations. The corresponding fingerprint elements are the first two statistical moments of the distributions and the median. By considering not only the average but also the spread of the distribution in the fingerprint, some degree of entropic information is encoded. Short MD simulations of the molecules in water (and in vacuum) are used to generate the MDFP. These are further combined with simple counts based on the 2D structure of the molecules into MDFP+. The resulting information-rich MDFP+ are used to train ML models for the prediction of solvation free energies in five different solvents (water, octanol, chloroform, hexadecane and cyclohexane) as well as partition coefficients in octanol/water, hexadecane/water and cyclohexane/water. The approach is easy to implement and computationally relatively inexpensive. Yet, it performs similarly well compared to more rigorous MD-based free-energy methods such as free-energy pertur- bation (FEP) as well as end-state methods such as linear interaction energy (LIE), the conductor-like screening model for realistic solvation (COSMO-RS) and the SMx family of solvation models.

  5. Molecular Fingerprinting Studies Do Not Support Intrahospital Transmission of Candida albicans among Candidemia Patients in Kuwait.

    PubMed

    Asadzadeh, Mohammad; Ahmad, Suhail; Al-Sweih, Noura; Khan, Ziauddin

    2017-01-01

    Candida albicans, a constituent of normal microbial flora of human mucosal surfaces, is a major cause of candidemia in immunocompromised individuals and hospitalized patients with other debilitating diseases. Molecular fingerprinting studies have suggested nosocomial transmission of C. albicans based on the presence of clusters or endemic genotypes in some hospitals. However, intrahospital strain transmission or a common source of infection has not been firmly established. We performed multilocus sequence typing (MLST) on 102 C. albicans bloodstream isolates (representing 92% of all culture-confirmed candidemia patients over a 31-month period at seven major hospitals) to identify patient-to-patient transmission or infection from a common source in Kuwait, a small country in the Middle East where consanguineous marriages are common. Repeat bloodstream isolates from six patients and nine surveillance cultures from other anatomic sites from six patients were also analyzed. Fifty-five isolates belonged to unique genotypes. Forty-seven isolates from 47 patients formed 16 clusters, with each cluster containing 2-9 isolates. Multiple isolates from the same patient from bloodstream or other anatomical sites yielded identical genotypes. We identified four cases of potential patient-to-patient transmission or infection from a common source based on association analysis between patients' clinical/epidemiological data and the corresponding MLST genotypes of eight C. albicans isolates. However, further fingerprinting by whole genome-based amplified fragment length polymorphism (AFLP) analysis yielded 8 different genotypes, ruling out intrahospital transmission of infection. The findings suggest that related strains of C. albicans exist in the community and fingerprinting by MLST alone may complicate hospital infection control measures during outbreak investigations.

  6. Quantitative Molecular Assay for Fingerprinting Microbial Communities of Wastewater and Estrogen-Degrading Consortia

    PubMed Central

    Yu, Chang-Ping; Ahuja, Rajiv; Sayler, Gary; Chu, Kung-Hui

    2005-01-01

    A quantitative fingerprinting method, called the real-time terminal restriction fragment length polymorphism (real-time-t-RFLP) assay, was developed for simultaneous determination of microbial diversity and abundance within a complex community. The real-time-t-RFLP assay was developed by incorporating the quantitative feature of real-time PCR and the fingerprinting feature of t-RFLP analysis. The assay was validated by using a model microbial community containing three pure strains, an Escherichia coli strain (gram negative), a Pseudomonas fluorescens strain (gram negative), and a Bacillus thuringiensis strain (gram positive). Subsequently, the real-time-t-RFLP assay was applied to and proven to be useful for environmental samples; the richness and abundance of species in microbial communities (expressed as the number of 16S rRNA gene copies of each ribotype per milliliter) of wastewater and estrogen-degrading consortia (enriched with 17α-estradiol, 17β-estradiol, or estrone) were successfully characterized. The results of this study strongly suggested that the real-time-t-RFLP assay can be a powerful molecular tool for gaining insight into microbial communities in various engineered systems and natural habitats. PMID:15746346

  7. Highland cattle and Radix labiata, the hosts of Fascioloides magna

    PubMed Central

    2014-01-01

    Background Fascioloides magna is a pathogenic fluke introduced to Europe ca 140 years ago. As it is spreading over the continent, new intermediate and definitive hosts might be involved in transmission of the parasite. In Europe, several studies reported potential new intermediate snail hosts (Radix spp.) for F. magna, and also several cases of fascioloidosis of wild and domestic animals were published. However, the data based on molecular and histological analyses confirming these findings remained unreported. This study aims to refer to unique findings of F. magna in European snails and domestic animals (the first observation in the Czech Republic in the last 30 years) and demonstrate the use of molecular techniques in determination of F. magna. Results Two snails of R. labiata naturally infected with F. magna were found; mature cercariae and daughter rediae were observed. Maturity of cercariae was checked by histological methods, however, their ability to encyst was not confirmed. Co-infection of F. magna and Fasciola hepatica in the liver of two highland cattle bulls was proved. Adult fasciolid flukes producing eggs were found in the liver pseudocysts (F. magna) and the bile ducts (F. hepatica). Identification of intermediate hosts, intramolluscan stages, adult flukes and eggs was performed by sequencing the ITS2 region. Connection of F. magna pseudocysts with the gut (via the bile ducts) was not confirmed by means of histological and coprological examinations. Conclusions For the first time, Radix labiata was confirmed as the snail host for F. magna under natural conditions and, together with the finding of F. magna infection in cattle, we can expect further transmission of F. magna from wildlife to livestock in localities shared by these hosts. PMID:24517409

  8. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    NASA Astrophysics Data System (ADS)

    Burgess, Jacob A. J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-09-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

  9. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope

    PubMed Central

    Burgess, Jacob A.J.; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-01-01

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface. PMID:26359203

  10. Magnetic fingerprint of individual Fe4 molecular magnets under compression by a scanning tunnelling microscope.

    PubMed

    Burgess, Jacob A J; Malavolti, Luigi; Lanzilotto, Valeria; Mannini, Matteo; Yan, Shichao; Ninova, Silviya; Totti, Federico; Rolf-Pissarczyk, Steffen; Cornia, Andrea; Sessoli, Roberta; Loth, Sebastian

    2015-09-11

    Single-molecule magnets (SMMs) present a promising avenue to develop spintronic technologies. Addressing individual molecules with electrical leads in SMM-based spintronic devices remains a ubiquitous challenge: interactions with metallic electrodes can drastically modify the SMM's properties by charge transfer or through changes in the molecular structure. Here, we probe electrical transport through individual Fe4 SMMs using a scanning tunnelling microscope at 0.5 K. Correlation of topographic and spectroscopic information permits identification of the spin excitation fingerprint of intact Fe4 molecules. Building from this, we find that the exchange coupling strength within the molecule's magnetic core is significantly enhanced. First-principles calculations support the conclusion that this is the result of confinement of the molecule in the two-contact junction formed by the microscope tip and the sample surface.

  11. Fingerprinting of poultry isolates of Enterococcus cecorum using three molecular typing methods.

    PubMed

    Wijetunge, Dona Saumya; Dunn, Patricia; Wallner-Pendleton, Eva; Lintner, Valerie; Lu, Huaguang; Kariyawasam, Subhashinie

    2012-11-01

    Enterococcus cecorum is an emerging challenge to the broiler industry. The organism has been implicated in septicemia, spondylitis, arthritis, and osteomyelitis in commercial broilers and broiler breeders, which lead to economic losses attributed to increased mortality and culling rates, decreased average processing weights, and increased feed conversion ratios. The current study evaluated the genetic variability of 30 clinical isolates of E. cecorum from outbreaks in Pennsylvania, using 3 molecular typing methods, namely, pulsed-field gel electrophoresis (PFGE), randomly amplified polymorphic DNA analysis, and enterobacterial repetitive intergenic consensus-PCR (polymerase chain reaction), in order to understand their genetic relatedness and to identify possible pathogenic clones. The study revealed the existence of genotypic polymorphism among E. cecorum associated with clinical disease. Of the 3 typing methods used, PFGE analysis demonstrated higher genetic variability of E. cecorum isolates compared to PCR-based methods. Also, each molecular typing method was evaluated in terms of typeability, discriminatory power, and reproducibility for application of these typing methods in fingerprinting of E. cecorum in future reference. Pulsed-field gel electrophoresis provided the most reliable results with greater discriminatory power and higher reproducibility compared to the 2 PCR-based methods.

  12. Exploring the vibrational fingerprint of the electronic excitation energy via molecular dynamics

    SciTech Connect

    Deyne, Andy Van Yperen-De; Pauwels, Ewald; Ghysels, An; Waroquier, Michel; Van Speybroeck, Veronique; Hemelsoet, Karen; De Meyer, Thierry; De Clerck, Karen

    2014-04-07

    A Fourier-based method is presented to relate changes of the molecular structure during a molecular dynamics simulation with fluctuations in the electronic excitation energy. The method implies sampling of the ground state potential energy surface. Subsequently, the power spectrum of the velocities is compared with the power spectrum of the excitation energy computed using time-dependent density functional theory. Peaks in both spectra are compared, and motions exhibiting a linear or quadratic behavior can be distinguished. The quadratically active motions are mainly responsible for the changes in the excitation energy and hence cause shifts between the dynamic and static values of the spectral property. Moreover, information about the potential energy surface of various excited states can be obtained. The procedure is illustrated with three case studies. The first electronic excitation is explored in detail and dominant vibrational motions responsible for changes in the excitation energy are identified for ethylene, biphenyl, and hexamethylbenzene. The proposed method is also extended to other low-energy excitations. Finally, the vibrational fingerprint of the excitation energy of a more complex molecule, in particular the azo dye ethyl orange in a water environment, is analyzed.

  13. Molecular fingerprinting reflects different histotypes and brain region in low grade gliomas

    PubMed Central

    2013-01-01

    Background Paediatric low-grade gliomas (LGGs) encompass a heterogeneous set of tumours of different histologies, site of lesion, age and gender distribution, growth potential, morphological features, tendency to progression and clinical course. Among LGGs, Pilocytic astrocytomas (PAs) are the most common central nervous system (CNS) tumours in children. They are typically well-circumscribed, classified as grade I by the World Health Organization (WHO), but recurrence or progressive disease occurs in about 10-20% of cases. Despite radiological and neuropathological features deemed as classic are acknowledged, PA may present a bewildering variety of microscopic features. Indeed, tumours containing both neoplastic ganglion and astrocytic cells occur at a lower frequency. Methods Gene expression profiling on 40 primary LGGs including PAs and mixed glial-neuronal tumours comprising gangliogliomas (GG) and desmoplastic infantile gangliogliomas (DIG) using Affymetrix array platform was performed. A biologically validated machine learning workflow for the identification of microarray-based gene signatures was devised. The method is based on a sparsity inducing regularization algorithm l1l2 that selects relevant variables and takes into account their correlation. The most significant genetic signatures emerging from gene-chip analysis were confirmed and validated by qPCR. Results We identified an expression signature composed by a biologically validated list of 15 genes, able to distinguish infratentorial from supratentorial LGGs. In addition, a specific molecular fingerprinting distinguishes the supratentorial PAs from those originating in the posterior fossa. Lastly, within supratentorial tumours, we also identified a gene expression pattern composed by neurogenesis, cell motility and cell growth genes which dichotomize mixed glial-neuronal tumours versus PAs. Our results reinforce previous observations about aberrant activation of the mitogen-activated protein kinase

  14. Molecular typing of Cryptococcus neoformans by PCR fingerprinting, in comparison with serotyping and Fourier transform infrared-spectroscopy-based phenotyping.

    PubMed

    Lemmer, K; Naumann, D; Raddatz, B; Tintelnot, K

    2004-04-01

    Molecular typing by PCR fingerprinting using the single primer (GACA)4 was performed with 110 isolates of Cryptococcus neoformans. Seventy clinical isolates of C. neoformans var. neoformans from Germany (n = 52) and Africa (n = 18) were included. Of these, serotype A (C. neoformans var. grubii) accounted for 47 isolates, serotype D for 12 and serotype AD for 11. Fourier transform infrared (FT-IR) spectroscopy was evaluated for its discriminatory power in phenotyping. Molecular types, defined by different PCR fingerprinting patterns, were compared to serotypes, and both sets of results were compared with the results of analysis by FT-IR spectroscopy. PCR fingerprinting revealed genotypic diversity within each serotype; it showed three different genotypes (designated VNA1-VNA3) within serotype A, two within serotype D (VND1 and VND2), and three within serotype AD (VNAD1-VNAD3). The nomenclature of molecular types within C. n. var. neoformans, as seen in publications to date, is not uniform. In this study, the name assigned to each genotype was based on the 98.6% concordance of genotypes with serotypes, a correspondence that facilitates interlaboratory comparison. This nomenclature is tentatively recommended as a standard. FT-IR spectroscopy combined with hierarchical cluster analysis successfully distinguished C n. var. neoformans from C. n. var. gattii. For C. n. var. neoformans, FT-IR confirmed three distinct genotypes within serotype A and was able to distinguish isolates derived from particular patients as well as isolates differing at the sub-genotype level. Within C. n. var. gattii, the serotypes B and C did not correlate with the four genotypes VGI-VGIV. However, these serotypes could clearly be separated by FT-IR spectroscopy. The molecular profiles were reproducible, and were more stable and more discriminating than serotyping. In connection with a standardized nomenclature, PCR fingerprinting can be a beneficial tool for global epidemiological studies. FT

  15. Molecular fingerprinting with the resolved modes of a femtosecond laser frequency comb.

    PubMed

    Diddams, Scott A; Hollberg, Leo; Mbele, Vela

    2007-02-08

    The control of the broadband frequency comb emitted from a mode-locked femtosecond laser has permitted a wide range of scientific and technological advances--ranging from the counting of optical cycles for next-generation atomic clocks to measurements of phase-sensitive high-field processes. A unique advantage of the stabilized frequency comb is that it provides, in a single laser beam, about a million optical modes with very narrow linewidths and absolute frequency positions known to better than one part in 10(15) (ref. 5). One important application of this vast array of highly coherent optical fields is precision spectroscopy, in which a large number of modes can be used to map internal atomic energy structure and dynamics. However, an efficient means of simultaneously identifying, addressing and measuring the amplitude or relative phase of individual modes has not existed. Here we use a high-resolution disperser to separate the individual modes of a stabilized frequency comb into a two-dimensional array in the image plane of the spectrometer. We illustrate the power of this technique for high-resolution spectral fingerprinting of molecular iodine vapour, acquiring in a few milliseconds absorption images covering over 6 THz of bandwidth with high frequency resolution. Our technique for direct and parallel accessing of stabilized frequency comb modes could find application in high-bandwidth spread-spectrum communications with increased security, high-resolution coherent quantum control, and arbitrary optical waveform synthesis with control at the optical radian level.

  16. Investigating molecular structures: Rapidly examining molecular fingerprints through fast passage broadband fourier transform microwave spectroscopy

    NASA Astrophysics Data System (ADS)

    Grubbs, Garry Smith Smitty, II

    Microwave spectroscopy is a gas phase technique typically geared toward measuring the rotational transitions of molecules. The information contained in this type of spectroscopy pertains to a molecules structure, both geometric and electronic, which give insight into a molecule's chemistry. Typically this type of spectroscopy is high resolution, but narrowband ≤1 MHz in frequency. This is achieved by tuning a cavity, exciting a molecule with electromagnetic radiation in the microwave region, turning the electromagnetic radiation off, and measuring a signal from the molecular relaxation in the form of a free induction decay (FID). The FID is then Fourier transformed to give a frequency of the transition. "Fast passage" is defined as a sweeping of frequencies through a transition at a time much shorter (≤10 mus) than the molecular relaxation (≈100 mus). Recent advancements in technology have allowed for the creation of these fast frequency sweeps, known as "chirps", which allow for broadband capabilities. This work presents the design, construction, and implementation of one such novel, high-resolution microwave spectrometer with broadband capabilities. The manuscript also provides the theory, technique, and motivations behind building of such an instrument. In this manuscript it is demonstrated that, although a gas phase technique, solids, liquids, and transient species may be studied with the spectrometer with high sensitivity, making it a viable option for many molecules wanting to be rotationally studied. The spectrometer has a relative correct intensity feature that, when coupled with theory, may ease the difficulty in transition assignment and facilitate dynamic chemical studies of the experiment. Molecules studied on this spectrometer have, in turn, been analyzed and assigned using common rotational spectroscopic analysis. Detailed theory on the analysis of these molecules has been provided. Structural parameters such as rotational constants and

  17. Molecular Identification of Closely Related Candida Species Using Two Ribosomal Intergenic Spacer Fingerprinting Methods

    PubMed Central

    Cornet, Muriel; Sendid, Boualem; Fradin, Chantal; Gaillardin, Claude; Poulain, Daniel; Nguyen, Huu-Vang

    2011-01-01

    Recent changes in the epidemiology of candidiasis highlighted an increase in non- Candida albicans species emphasizing the need for reliable identification methods. Molecular diagnostics in fungal infections may improve species characterization, particularly in cases of the closely related species in the Candida complexes. We developed two PCR/restriction fragment length polymorphism assays, targeting either a part of the intergenic spacer 2 or the entire intergenic spacer (IGS) of ribosomal DNA using a panel of 270 isolates. A part of the intergenic spacer was used for discrimination between C. albicans and C. dubliniensis and between species of the C. glabrata complex (C. glabrata/C. bracarensis/C. nivariensis). The whole IGS was applied to C. parapsilosis, C. metapsilosis, and C. orthopsilosis, and to separate C. famata (Debaryomyces hansenii) from C. guilliermondii (Pichia guilliermondii) and from the other species within this complex (ie, C. carpophila, C. fermentati and C. xestobii). Sharing similar biochemical patterns, Pichia norvegensis and C. inconspicua exhibited specific IGS profiles. Our study confirmed that isolates of C. guilliermondii were frequently mis-identified as C. famata. As much as 67% of the clinical isolates phenotypically determined as C. famata were recognized mostly as true P. guilliermondii. Conversely, 44% of the isolates initially identified as C. guilliermondii were corrected by the IGS fingerprints as C. parapsilosis, C. fermentati, or C. zeylanoides. These two PCR/restriction fragment length polymorphism methods may be used as reference tools [either alternatively or adjunctively to the existing ribosomal DNA (26S or ITS) sequence comparisons] for unambiguous determination of the Candida species for which phenotypic characterization remains problematic. PMID:21227390

  18. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  19. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    PubMed

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL, matK, trnH-psbA, trnLC-trnLD, their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus, Conophallus and Amorphophallus. In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK, trnH-psbA, trnLC-trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL.

  20. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering

    PubMed Central

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3′-diethylthiatricarbocyanine iodide] and DTDC [3,3′-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist. PMID:26730189

  1. Improved molecular fingerprint analysis employing multi-branched gold nanoparticles in conjunction with surface-enhanced Raman scattering.

    PubMed

    Johnston, Jencilin; Taylor, Erik N; Gilbert, Richard J; Webster, Thomas J

    2016-01-01

    Vibrational spectroscopy is a powerful analytical tool that assesses molecular properties based on spectroscopic signatures. In this study, the effect of gold nanoparticle morphology (spherical vs multi-branched) was assessed for the characterization of a Raman signal (ie, molecular fingerprint) that may be helpful for numerous medical applications. Multi-branched gold nanoparticles (MBAuNPs) were fabricated using a green chemistry method which employed the reduction of gold ion solute by 2-[4-(2-hydroxyethyl)-1-piperazyl] ethane sulfonic acid. Two types of reporter dyes, indocyanine (IR820 and IR792) and carbocyanine (DTTC [3,3'-diethylthiatricarbocyanine iodide] and DTDC [3,3'-diethylthiadicarbocyanine iodide]), were functionalized to the surface of the MBAuNPs and stabilized with denatured bovine serum albumin, thus forming the surface-enhanced Raman spectroscopy tag. Fluorescein isothiocyanate-conjugated anti-epidermal growth factor receptor to the surface-enhanced Raman spectroscopy tags and the properties of the resulting conjugates were assessed through determination of the Raman signal. Using the MBAuNP Raman probes synthesized in this manner, we demonstrated that MBAuNP provided significantly more surface-enhanced Raman scattering signal when compared with the associated spherical gold nanoparticle of similar size and concentration. MBAuNP enhancements were retained in the surface-enhanced Raman spectroscopy tags complexed to anti-epidermal growth factor receptor, providing evidence that this could be a useful biological probe for enhanced Raman molecular fingerprinting. Furthermore, while utilizing IR820 as a novel reporter dye linked with MBAuNP, superior Raman signal fingerprint results were obtained. Such results provide significant promise for the use of MBAuNP in the detection of numerous diseases for which biologically specific surface markers exist.

  2. Fingerprint-imprinted polymer: rational selection of peptide epitope templates for the determination of proteins by molecularly imprinted polymers.

    PubMed

    Bossi, Alessandra M; Sharma, Piyush S; Montana, Luca; Zoccatelli, Gianni; Laub, Orgad; Levi, Raphael

    2012-05-01

    The pool of peptides composing a protein allows for its distinctive identification in a process named fingerprint (FP) analysis. Here, the FP concept is used to develop a method for the rational preparation of molecularly imprinted polymers (MIPs) for protein recognition. The fingerprint imprinting (FIP) is based on the following: (1) the in silico cleavage of the protein sequence of interest with specific agents; (2) the screening of all the peptide sequences generated against the UniProtKB database in order to allow for the rational selection of distinctive and unique peptides (named as epitopes) of the target protein; (3) the selected epitopes are synthesized and used as templates for the molecular imprinting process. To prove the principle, NT-proBNP, a marker of the risk of cardiovascular events, was chosen as an example. The in silico analysis of the NT-proBNP sequence allowed us to individuate the peptide candidates, which were next used as templates for the preparation of NT-pro-BNP-specific FIPs and tested for their ability to bind the NT-proBNP peptides in complex samples. Results indicated an imprinting factor, IF, of ~10, a binding capacity of 0.5-2 mg/g, and the ability to rebind 40% of the template in a complex sample, composed of the whole digests of NT-proBNP.

  3. Binding mode of triazole derivatives as aromatase inhibitors based on docking, protein ligand interaction fingerprinting, and molecular dynamics simulation studies

    PubMed Central

    Mojaddami, Ayyub; Sakhteman, Amirhossein; Fereidoonnezhad, Masood; Faghih, Zeinab; Najdian, Atena; Khabnadideh, Soghra; Sadeghpour, Hossein; Rezaei, Zahra

    2017-01-01

    Aromatase inhibitors (AIs) as effective candidates have been used in the treatment of hormone-dependent breast cancer. In this study, we have proposed 300 structures as potential AIs and filtered them by Lipinski's rule of five using DrugLito software. Subsequently, they were subjected to docking simulation studies to select the top 20 compounds based on their Gibbs free energy changes and also to perform more studies on the protein-ligand interaction fingerprint by AuposSOM software. In this stage, anastrozole and letrozole were used as positive control to compare their interaction fingerprint patterns with our proposed structures. Finally, based on the binding energy values, one active structure (ligand 15) was selected for molecular dynamic simulation in order to get information for the binding mode of these ligands within the enzyme cavity. The triazole of ligand 15 pointed to HEM group in aromatase active site and coordinated to Fe of HEM through its N4 atom. In addition, two π-cation interactions was also observed, one interaction between triazole and porphyrin of HEM group, and the other was 4-chloro phenyl moiety of this ligand with Arg115 residue. PMID:28255310

  4. Morphological and molecular observations on the status of Crassicauda magna, a parasite of the subcutaneous tissues of the pygmy sperm whale, with a re-evaluation of the systematic relationships of the genus Crassicauda.

    PubMed

    Jabbar, Abdul; Beveridge, Ian; Bryant, Malcolm S

    2015-03-01

    Members of the genus Crassicauda (Nematoda: Spirurida) are parasites of the body tissues of whales and dolphins. Owing to the large size of worms and difficulties in the recovery of entire nematodes from the tissues of hosts, limited information is available on morphological descriptions of both male and female worms. Furthermore, there are currently no available sequence data for this genus to assist with such identifications. This paper describes for the first time features of the anterior extremity and the male tail of Crassicauda magna, suggesting that Crassicauda duguyi may be a synonym of this species. In addition, molecular data are presented for the genus for the first time suggesting that the genus belongs within the superfamily Acuarioidea rather than within the Habronematoidea, in which it is currently placed.

  5. Spatio-temporal variability of the molecular fingerprint of soil dissolved organic matter in a headwater agricultural catchment

    NASA Astrophysics Data System (ADS)

    Jeanneau, Laurent; Pierson-Wickmann, Anne-Catherine; Jaffrezic, Anne; Lambert, Thibault; Gruau, Gérard

    2013-04-01

    Dissolved organic matter (DOM) is implied in (i) ecosystem services such as the support of biodiversity, (ii) the alteration of the drinkable water quality by formation of trihalomethane and (iii) the transfer of micropollutants from soils to rivers. Moreover, since DOM connects soils and oceans that are interacting with the atmosphere, understanding its biogeochemistry will help in investigating the carbon cycle and in creating strategies to mitigate climate change. DOM in headwater stream ecosystems is mainly inherited from allochtonous inputs with different reservoirs being mobilized during storm and interstorm events at the scale of an hydrological year. Those changes in DOM reservoirs, if accompanied by composition and reactivity changes, may impact DOM ecosystem services and drinking water production processes. Elucidating the compositional changes due to changes in the source of DOM in rivers has thus become a important axis of DOM research. The aim of this study is to test the ability of the molecular tools of the organic geochemistry and more specifically the combination of thermochemiolysis and gas chromatography - mass spectrometry (THM-GC-MS) to (i) link the variability of the river DOM composition to different DOM reservoirs in catchment soils and (ii) provide hypothesis on the nature and the mechanisms of formation (microbial growth, litter decomposition) of those reservoirs. This analytical method seems particularly adapted since it allows the differentiation between vegetal and microbial inputs and the determination of the extent of the biodegradation process of biomolecules such as lignin. To test this method, the molecular fingerprint of soil DOM has been investigated in the wetland area of a small (500 ha) agricultural catchment (the so-called Kervidy-Naizin catchment) located in Brittany, western France. The soil DOM was sampled fortnightly at three depths using zero-tension lysimeters during the hydrological year 2010-2011. The samples were

  6. New target prediction and visualization tools incorporating open source molecular fingerprints for TB Mobile 2.0

    PubMed Central

    2014-01-01

    Background We recently developed a freely available mobile app (TB Mobile) for both iOS and Android platforms that displays Mycobacterium tuberculosis (Mtb) active molecule structures and their targets with links to associated data. The app was developed to make target information available to as large an audience as possible. Results We now report a major update of the iOS version of the app. This includes enhancements that use an implementation of ECFP_6 fingerprints that we have made open source. Using these fingerprints, the user can propose compounds with possible anti-TB activity, and view the compounds within a cluster landscape. Proposed compounds can also be compared to existing target data, using a näive Bayesian scoring system to rank probable targets. We have curated an additional 60 new compounds and their targets for Mtb and added these to the original set of 745 compounds. We have also curated 20 further compounds (many without targets in TB Mobile) to evaluate this version of the app with 805 compounds and associated targets. Conclusions TB Mobile can now manage a small collection of compounds that can be imported from external sources, or exported by various means such as email or app-to-app inter-process communication. This means that TB Mobile can be used as a node within a growing ecosystem of mobile apps for cheminformatics. It can also cluster compounds and use internal algorithms to help identify potential targets based on molecular similarity. TB Mobile represents a valuable dataset, data-visualization aid and target prediction tool. PMID:25302078

  7. Molecular Fingerprinting of Cyanobacteria from River Biofilms as a Water Quality Monitoring Tool

    PubMed Central

    Loza, Virginia; Perona, Elvira

    2013-01-01

    Benthic cyanobacterial communities from Guadarrama River (Spain) biofilms were examined using temperature gradient gel electrophoresis (TGGE), comparing the results with microscopic analyses of field-fixed samples and the genetic characterization of cultured isolates from the river. Changes in the structure and composition of cyanobacterial communities and their possible association with eutrophication in the river downstream were studied by examining complex TGGE patterns, band extraction, and subsequent sequencing of 16S rRNA gene fragments. Band profiles differed among sampling sites depending on differences in water quality. The results showed that TGGE band richness decreased in a downstream direction, and there was a clear clustering of phylotypes on the basis of their origins from different locations according to their ecological requirements. Multivariate analyses (cluster analysis and canonical correspondence analysis) corroborated these differences. Results were consistent with those obtained from microscopic observations of field-fixed samples. According to the phylogenetic analysis, morphotypes observed in natural samples were the most common phylotypes in the TGGE sequences. These phylotypes were closely related to Chamaesiphon, Aphanocapsa, Pleurocapsa, Cyanobium, Pseudanabaena, Phormidium, and Leptolyngbya. Differences in the populations in response to environmental variables, principally nutrient concentrations (dissolved inorganic nitrogen and soluble reactive phosphorus), were found. Some phylotypes were associated with low nutrient concentrations and high levels of dissolved oxygen, while other phylotypes were associated with eutrophic-hypertrophic conditions. These results support the view that once a community has been characterized and its genetic fingerprint obtained, this technique could be used for the purpose of monitoring rivers. PMID:23263954

  8. First certified reference materials for molecular fingerprinting of two approved probiotic Bacillus strains.

    PubMed

    De Baets, L; Van Iwaarden, P; Meeus, N; Schimmel, H; Philipp, W; Emons, H

    2009-01-31

    At present probiotic bacteria are widely used in human and animal nutrition because they beneficially influence the balance of the intestinal flora of the host. Positive effects related to probiotics are various and include enhancement of digestion, strengthening of the immune system and stimulation of vitamin production. Moreover, implementation of probiotics is intended to reduce the use of antibiotics and improve animal growth and feed conversion. To protect human and animal health and to improve consumer confidence, a strict legislation on the use of probiotics exists within the European Union (EU). Official controls by national authorities are performed to ensure verification of compliance with feed and food law. Apart from the risk of using unauthorized strains, mislabelling is a known problem, partly because of the use of phenotyping or genotyping methods with a lack of discriminative power. In addition to official controls, private controls by food and feed producing companies are important in the frame of protection of patented strains and industrial property rights. To support these applications, IRMM has developed certified reference materials (CRMs) consisting of genomic DNA inserts of B. subtilis DSM 5749 and B. licheniformis DSM 5750, two strains that received EU approval. In this study we investigated the use of these CRMs, IRMM-311 and IRMM-312, for the detection and unambiguous discrimination of Bacillus strains by pulsed-field gel electrophoresis (PFGE). Identical fingerprints were obtained for the CRMs and control strains isolated from the feed additive Bioplus 2B. On the other hand a distinction could be made from other not approved B. licheniformis and B. subtilis strains. The reference materials discussed in this study are the first CRMs based on a whole bacterial genome and suitable for PFGE. They offer perspectives for applications in other domains such as analysis of foodborne pathogens in outbreaks or routine analysis.

  9. The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

    PubMed

    Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

    2015-01-01

    In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.

  10. Reversed-phase ion-pair ultra-high-performance-liquid chromatography-mass spectrometry for fingerprinting low-molecular-weight heparins.

    PubMed

    Langeslay, Derek J; Urso, Elena; Gardini, Cristina; Naggi, Annamaria; Torri, Giangiacomo; Larive, Cynthia K

    2013-05-31

    Heparin is a complex mixture of sulfated linear carbohydrate polymers. It is widely used as an antithrombotic drug, though it has been shown to have a myriad of additional biological activities. Heparin is often partially depolymerized in order to decrease the average molecular weight, as it has been shown that low molecular weight heparins (LMWH) possess more desirable pharmacokinetic and pharmacodynamic properties than unfractionated heparin (UFH). Due to the prevalence of LMWHs in the market and the emerging availability of generic LMWH products, it is important that analytical methods be developed to ensure the drug quality. This work explores the use of tributylamine (TrBA), dibutylamine (DBA), and pentylamine (PTA) as ion-pairing reagents in conjunction with acetonitrile and methanol modified mobile phases for reversed-phase ion-pairing ultraperformance liquid chromatography coupled to mass spectrometry (RPIP-UPLC-MS) for fingerprint analysis of LMWH preparations. RPIP-UPLC-MS fingerprints are presented and compared for tinzaparinand enoxaparin.

  11. Denaturing gradient electrophoresis (DGE) and single-strand conformation polymorphism (SSCP) molecular fingerprintings revisited by simulation and used as a tool to measure microbial diversity.

    PubMed

    Loisel, Patrice; Harmand, Jérôme; Zemb, Olivier; Latrille, Eric; Lobry, Claude; Delgenès, Jean-Philippe; Godon, Jean-Jacques

    2006-04-01

    The exact extent of microbial diversity remains unknowable. Nevertheless, fingerprinting patterns [denaturing gradient electrophoresis (DGE), single-strand conformation polymorphism (SSCP)] provide an image of a microbial ecosystem and contain diversity data. We generated numerical simulation fingerprinting patterns based on three types of distribution (uniform, geometric and lognormal) with a range of units from 10 to 500,000. First, simulated patterns containing a diversity of around 1000 units or more gave patterns similar to those obtained in experiments. Second, the number of bands or peaks saturated quickly to about 35 and were unrelated to the degree of diversity. Finally, assuming lognormal distribution, we used an estimator of diversity on in silico and experimental fingerprinting patterns. Results on in silico patterns corresponded to the simulation inputs. Diversity results in experimental patterns were in the same range as those obtained from the same DNA sample in molecular inventories. Thus, fingerprinting patterns contain extractable data about diversity although not on the basis of a number of bands or peaks, as is generally assumed to be the case.

  12. Complete Mitochondrial Genome of Anoplocephala magna Solidifying the Species

    PubMed Central

    Guo, Aijiang

    2016-01-01

    The 2 species of the genus Anoplocephala (Anoplocephalidae), A. perfoliata and A. magna, are among the most important equine cestode parasites. However, there is little information about their differences at the molecular level. The present study revealed that the mitochondrial (mt) genome of A. magna was 13,759 bp in size and 700 bp shorter than that of A. perfoliata. The 2 species includes 2 rRNA, 22 tRNA, and 12 protein-coding genes each. The size of each of the 36 genes was the same as that of A. perfoliata, except for cox1, rrnL, trnC, trnS2(UCN), trnG, trnH, trnQ, and trnP. In the full mitochondrial genome, the sequence similarity was 87.1%. The divergence in the nucleotide and amino acid sequences of individual protein-coding genes ranged from 11.1% to 16% and 6.8% to 16.4%, respectively. The 2 noncoding regions of the mt genome of A. magna were 199 bp and 271 bp in length, while the equivalent regions in A. perfoliata were 875 bp and 276 bp, respectively. The results of this study support the proposal that A. magna and A. perfoliata are separate species, consistent with previous morphological analyses. PMID:27417096

  13. Atom pair 2D-fingerprints perceive 3D-molecular shape and pharmacophores for very fast virtual screening of ZINC and GDB-17.

    PubMed

    Awale, Mahendra; Reymond, Jean-Louis

    2014-07-28

    Three-dimensional (3D) molecular shape and pharmacophores are important determinants of the biological activity of organic molecules; however, a precise computation of 3D-shape is generally too slow for virtual screening of very large databases. A reinvestigation of the concept of atom pairs initially reported by Carhart et al. and extended by Schneider et al. showed that a simple atom pair fingerprint (APfp) counting atom pairs at increasing topological distances in 2D-structures without atom property assignment correlates with various representations of molecular shape extracted from the 3D-structures. A related 55-dimensional atom pair fingerprint extended with atom properties (Xfp) provided an efficient pharmacophore fingerprint with good performance for ligand-based virtual screening such as the recovery of active compounds from decoys in DUD, and overlap with the ROCS 3D-pharmacophore scoring function. The APfp and Xfp data were organized for web-based extremely fast nearest-neighbor searching in ZINC (13.5 M compounds) and GDB-17 (50 M random subset) freely accessible at www.gdb.unibe.ch .

  14. Fingerprinting Of Materials

    NASA Technical Reports Server (NTRS)

    Workman, Gary L.

    1994-01-01

    Collection of three reports surveys emerging technology of chemical fingerprinting, which can be defined, loosely, as systematic application of modern methods of analysis to determine elemental or molecular compositions of materials, measure relative amounts of constituents of materials, and/or measure other relevant properties of materials.

  15. Myogenesis in the sea urchin embryo: the molecular fingerprint of the myoblast precursors

    PubMed Central

    2013-01-01

    Background In sea urchin larvae the circumesophageal fibers form a prominent muscle system of mesodermal origin. Although the morphology and later development of this muscle system has been well-described, little is known about the molecular signature of these cells or their precise origin in the early embryo. As an invertebrate deuterostome that is more closely related to the vertebrates than other commonly used model systems in myogenesis, the sea urchin fills an important phylogenetic gap and provides a unique perspective on the evolution of muscle cell development. Results Here, we present a comprehensive description of the development of the sea urchin larval circumesophageal muscle lineage beginning with its mesodermal origin using high-resolution localization of the expression of several myogenic transcriptional regulators and differentiation genes. A few myoblasts are bilaterally distributed at the oral vegetal side of the tip of the archenteron and first appear at the late gastrula stage. The expression of the differentiation genes Myosin Heavy Chain, Tropomyosin I and II, as well as the regulatory genes MyoD2, FoxF, FoxC, FoxL1, Myocardin, Twist, and Tbx6 uniquely identify these cells. Interestingly, evolutionarily conserved myogenic factors such as Mef2, MyoR and Six1/2 are not expressed in sea urchin myoblasts but are found in other mesodermal domains of the tip of the archenteron. The regulatory states of these domains were characterized in detail. Moreover, using a combinatorial analysis of gene expression we followed the development of the FoxF/FoxC positive cells from the onset of expression to the end of gastrulation. Our data allowed us to build a complete map of the Non-Skeletogenic Mesoderm at the very early gastrula stage, in which specific molecular signatures identify the precursors of different cell types. Among them, a small group of cells within the FoxY domain, which also express FoxC and SoxE, have been identified as plausible myoblast

  16. Rotation commensurate echo of asymmetric molecules—Molecular fingerprints in the time domain

    SciTech Connect

    Chesnokov, E. N.; Kubarev, V. V.; Koshlyakov, P. V.

    2014-12-29

    Using the pulses of terahertz free electron laser and ultra-fast Schottky diode detectors, we observed the coherent transients within a free induction decay of gaseous nitrogen dioxide NO{sub 2}. The laser excited different sub-bands of rotation spectra of NO{sub 2} containing about 50–70 lines. The free induction signal continued more than 30 ns and consisted of many echo-like bursts duration about 0.2 ns. Unlike the similar effect observed previously for linear and symmetric top molecules, the sequence of echo bursts is not periodic. The values for delay of individual echo are stable, and the set of these delays can be considered as a “molecular fingerprint” in the time domain.

  17. The culturome of the human nose habitats reveals individual bacterial fingerprint patterns.

    PubMed

    Kaspar, Ursula; Kriegeskorte, André; Schubert, Tanja; Peters, Georg; Rudack, Claudia; Pieper, Dietmar H; Wos-Oxley, Melissa; Becker, Karsten

    2016-07-01

    The complex anatomy of the human nose might offer distinct microbial niches. Microbiota composition may affect nose inflammatory diseases and Staphylococcus aureus carriage. Considering different nasal cavity locations, microbial colonization was analysed across individuals exhibiting chronic nasal inflammatory diseases (n = 18) and those without local inflammation signs (n = 16). Samples were collected systematically during surgery and examined by an extensive culture-based approach and, for a subset, by 16S rRNA gene community profiling. Cultivation yielded 141 taxa with members of Staphylococcus, Corynebacterium and Propionibacterium as most common isolates comprising the nasal core culturome together with Finegoldia magna. Staphylococcus aureus was most frequently found in association with Staphylococcus epidermidis and Propionibacterium acnes, and the posterior vestibules were redefined as S. aureus' principle habitat. Culturome analysis revealed host-specific bacterial 'fingerprints' irrespective of host-driven factors or intranasal sites. Comparisons between cultivable and molecular fingerprints demonstrated that only a small fraction of phylotypes (6.2%) was correlated. While the total number of different phylotypes was higher in the molecular dataset, the total number of identifications down to the species level was higher in the culturomic approach. To determine host-specific microbiomes, the advantages of molecular approaches should be combined with the resolution and reliability of species identification by culturomic analyses.

  18. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    PubMed

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  19. Molecular fingerprinting of Helicanthus elastica (Desr.) Danser growing on five different hosts by RAPD

    PubMed Central

    Sunil Kumar, K.N.; Maruthi, K.R.; Alfarhan, A.H.; Rajakrishnan, R.; Thomas, J.

    2015-01-01

    Mistletoes are hemiparasitic plants growing on aerial parts of other host trees. Many of the mistletoes are reported to be medicinally important. The hemiparasitic nature of these plants makes their chemical composition dependent on the host on which it grows. They are shown to exhibit morphological dissimilarities also when growing on different hosts. Helicanthus elastica (Desr.) Danser (mango mistletoe) is one such less explored medicinal mistletoe found on almost every mango tree in India. Traditionally, the leaves of this plant are used for checking abortion and for removing stones in the kidney and urinary bladder while significant antioxidant and antimicrobial properties are also attributed to this species of mistletoe. The current study was undertaken to evaluate molecular differences in the genomic DNA of the plant while growing on five different host trees using four random markers employing random amplified polymorphic DNA (RAPD) followed by similarity matrix by Jaccard’s coefficient and distance matrix by hierarchal clustering analysis. Similarity and distance matrix data employing just 4 random markers, separately and the pooled data as well, revealed significant difference in the genomic DNA of H. elastica growing on five different hosts. Pooled data of similarity from all the 4 primers cumulatively showed similarity between 0.256 and 0.311. Distance matrix ranged from of 0.256 to 0.281 on pooling the data from all the four primers. The result employing a minimum number of primers could conclude that genomic DNA of H. elastica differs depending upon the host on which it grows, hence the host must be considered while studying or utilizing this mistletoe for medicinal purposes. PMID:27081357

  20. Combining molecular fingerprints with multidimensional scaling analyses to identify the source of spilled oil from highly similar suspected oils.

    PubMed

    Zhou, Peiyu; Chen, Changshu; Ye, Jianjun; Shen, Wenjie; Xiong, Xiaofei; Hu, Ping; Fang, Hongda; Huang, Chuguang; Sun, Yongge

    2015-04-15

    Oil fingerprints have been a powerful tool widely used for determining the source of spilled oil. In most cases, this tool works well. However, it is usually difficult to identify the source if the oil spill accident occurs during offshore petroleum exploration due to the highly similar physiochemical characteristics of suspected oils from the same drilling platform. In this report, a case study from the waters of the South China Sea is presented, and multidimensional scaling analysis (MDS) is introduced to demonstrate how oil fingerprints can be combined with mathematical methods to identify the source of spilled oil from highly similar suspected sources. The results suggest that the MDS calculation based on oil fingerprints and subsequently integrated with specific biomarkers in spilled oils is the most effective method with a great potential for determining the source in terms of highly similar suspected oils.

  1. Molecular fingerprint-region spectroscopy from 5 to 12 μm using an orientation-patterned gallium phosphide optical parametric oscillator

    NASA Astrophysics Data System (ADS)

    Maidment, Luke; Schunemann, Peter G.; Reid, Derryck T.

    2016-09-01

    We report a femtosecond optical parametric oscillator (OPO) based on the new semiconductor gain material orientation patterned gallium phosphide (OP-GaP), which enables the production of high-repetition-rate femtosecond pulses spanning 5-12 \\mu m with average powers in the few to tens of milliwatts range. This is the first example of a broadband OPO operating across the molecular fingerprint region, and we demonstrate its potential by conducting broadband Fourier-transform spectroscopy using water vapor and a polystyrene reference standard.

  2. Molecular fingerprint-region spectroscopy from 5 to 12  μm using an orientation-patterned gallium phosphide optical parametric oscillator.

    PubMed

    Maidment, Luke; Schunemann, Peter G; Reid, Derryck T

    2016-09-15

    We report a femtosecond optical parametric oscillator (OPO) based on the new semiconductor gain material orientation-patterned gallium phosphide (OP-GaP), which enables the production of high-repetition-rate femtosecond pulses spanning 5-12 μm with average powers in the few to tens of milliwatts range. This is the first example of a broadband OPO operating across the molecular fingerprint region, and we demonstrate its potential by conducting broadband Fourier-transform spectroscopy using water vapor and a polystyrene reference standard.

  3. Rapid determination of Escherichia coli O157:H7 lineage types and molecular subtypes by using comparative genomic fingerprinting.

    PubMed

    Laing, Chad; Pegg, Crystal; Yawney, Davis; Ziebell, Kim; Steele, Marina; Johnson, Roger; Thomas, James E; Taboada, Eduardo N; Zhang, Yongxiang; Gannon, Victor P J

    2008-11-01

    In this study, variably absent or present (VAP) regions discovered through comparative genomics experiments were targeted for the development of a rapid, PCR-based method to subtype and fingerprint Escherichia coli O157:H7. Forty-four VAP loci were analyzed for discriminatory power among 79 E. coli O157:H7 strains of 13 phage types (PT). Twenty-three loci were found to maximize resolution among strains, generating 54 separate fingerprints, each of which contained strains of unique PT. Strains from the three previously identified major E. coli O157:H7 lineages, LSPA6-LI, LSPA6-LI/II, and LSPA6-LII, formed distinct branches on a dendrogram obtained by hierarchical clustering of comparative genomic fingerprinting (CGF) data. By contrast, pulsed-field gel electrophoresis (PFGE) typing generated 52 XbaI digestion profiles that were not unique to PT and did not cluster according to O157:H7 lineage. Our analysis identified a subpopulation comprised of 25 strains from a closed herd of cattle, all of which were of PT87 and formed a cluster distinct from all other E. coli O157:H7 strains examined. CGF found five related but unique fingerprints among the highly clonal herd strains, with two dominant subtypes characterized by a shift from the presence of locus fprn33 to its absence. CGF had equal resolution to PFGE typing but with greater specificity, generating fingerprints that were unique among phenotypically related E. coli O157:H7 lineages and PT. As a comparative genomics typing method that is amenable for use in high-throughput platforms, CGF may be a valuable tool in outbreak investigations and strain characterization.

  4. Fingerprint detection

    DOEpatents

    Saunders, George C.

    1992-01-01

    A method for detection and visualization of latent fingerprints is provided and includes contacting a substrate containing a latent print thereon with a colloidal metal composition for time sufficient to allow reaction of said colloidal metal composition with said latent print, and preserving or recording the observable print. Further, the method for detection and visualization of latent fingerprints can include contacting the metal composition-latent print reaction product with a secondary metal-containing solution for time sufficient to allow precipitation of said secondary metal thereby enhancing the visibility of the latent print, and preserving or recording the observable print.

  5. Peptide mass fingerprinting.

    PubMed

    Thiede, Bernd; Höhenwarter, Wolfgang; Krah, Alexander; Mattow, Jens; Schmid, Monika; Schmidt, Frank; Jungblut, Peter R

    2005-03-01

    Peptide mass fingerprinting by MALDI-MS and sequencing by tandem mass spectrometry have evolved into the major methods for identification of proteins following separation by two-dimensional gel electrophoresis, SDS-PAGE or liquid chromatography. One main technological goal of proteome analyses beside high sensitivity and automation was the comprehensive analysis of proteins. Therefore, the protein species level with the essential information on co- and post-translational modifications must be achieved. The power of peptide mass fingerprinting for protein identification was described here, as exemplified by the identification of protein species with high molecular masses (spectrin alpha and beta), low molecular masses (elongation factor EF-TU fragments), splice variants (alpha A crystallin), aggregates with disulfide bridges (alkylhydroperoxide reductase), and phosphorylated proteins (heat shock protein 27). Helpful tools for these analyses were the use of the minimal protein identifier concept and the software program MS-Screener to remove mass peaks assignable to contaminants and neighbor spots.

  6. Molecular characterization and fingerprinting of vanadyl porphyrin and non-porphyrin compounds in the asphaltenes of heavy crude petroleums using HPLC-GFAA analysis

    SciTech Connect

    Wines, B.K.; Vermeulen, T.; Fish, R.H.

    1983-08-01

    High performance liquid chromatography coupled with graphite furnace atomic absorption (HPLC-GFAA) analysis were used to study the precipitated asphaltene fraction of four heavy crude petroleums. Prudhoe Bay and Wilmington crude oils from Alaska and California, respectively, have low vanadium and asphaltene concentrations. Boscan and Cerro Negro are Venezuelan crudes with high levels of vanadium and asphaltenes. The emphasis of this study is the molecular characterization of classes of vanadyl compounds, with special emphasis placed on differentiating the locations of non-porphyrin and porphyrin compounds in the HPLC-GFAA analyses of the asphaltenes and their solvent extracts. Steric exclusion chromatography (SEC) columns were used to determine the molecular weight distribution of vanadium in the asphaltenes and extracts. Fingerprints obtained from SEC-HPLC-GFAA analysis of asphaltenes or normal and reverse phase HPLC-GFAA analysis of polar extracts provided information on the composition of the asphaltines. 122 references, 27 figures, 7 tables.

  7. [Study on action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis based on techniques of gene expression profile and molecular fingerprint].

    PubMed

    Zhou, Wei; Song, Xiang-gang; Chen, Chao; Wang, Shu-mei; Liang, Sheng-wang

    2015-08-01

    Action mechanism and material base of compound Danshen dripping pills in treatment of carotid atherosclerosis were discussed based on gene expression profile and molecular fingerprint in this paper. First, gene expression profiles of atherosclerotic carotid artery tissues and histologically normal tissues in human body were collected, and were screened using significance analysis of microarray (SAM) to screen out differential gene expressions; then differential genes were analyzed by Gene Ontology (GO) analysis and KEGG pathway analysis; to avoid some genes with non-outstanding differential expression but biologically importance, Gene Set Enrichment Analysis (GSEA) were performed, and 7 chemical ingredients with higher negative enrichment score were obtained by Cmap method, implying that they could reversely regulate the gene expression profiles of pathological tissues; and last, based on the hypotheses that similar structures have similar activities, 336 ingredients of compound Danshen dripping pills were compared with 7 drug molecules in 2D molecular fingerprints method. The results showed that 147 differential genes including 60 up-regulated genes and 87 down regulated genes were screened out by SAM. And in GO analysis, Biological Process ( BP) is mainly concerned with biological adhesion, response to wounding and inflammatory response; Cellular Component (CC) is mainly concerned with extracellular region, extracellular space and plasma membrane; while Molecular Function (MF) is mainly concerned with antigen binding, metalloendopeptidase activity and peptide binding. KEGG pathway analysis is mainly concerned with JAK-STAT, RIG-I like receptor and PPAR signaling pathway. There were 10 compounds, such as hexadecane, with Tanimoto coefficients greater than 0.85, which implied that they may be the active ingredients (AIs) of compound Danshen dripping pills in treatment of carotid atherosclerosis (CAs). The present method can be applied to the research on material

  8. Mid-infrared supercontinuum covering the 1.4-13.3 μm molecular fingerprint region using ultra-high NA chalcogenide step-index fibre

    NASA Astrophysics Data System (ADS)

    Petersen, Christian Rosenberg; Møller, Uffe; Kubat, Irnis; Zhou, Binbin; Dupont, Sune; Ramsay, Jacob; Benson, Trevor; Sujecki, Slawomir; Abdel-Moneim, Nabil; Tang, Zhuoqi; Furniss, David; Seddon, Angela; Bang, Ole

    2014-11-01

    The mid-infrared spectral region is of great technical and scientific interest because most molecules display fundamental vibrational absorptions in this region, leaving distinctive spectral fingerprints. To date, the limitations of mid-infrared light sources such as thermal emitters, low-power laser diodes, quantum cascade lasers and synchrotron radiation have precluded mid-infrared applications where the spatial coherence, broad bandwidth, high brightness and portability of a supercontinuum laser are all required. Here, we demonstrate experimentally that launching intense ultra-short pulses with a central wavelength of either 4.5 μm or 6.3 μm into short pieces of ultra-high numerical-aperture step-index chalcogenide glass optical fibre generates a mid-infrared supercontinuum spanning 1.5 μm to 11.7 μm and 1.4 μm to 13.3 μm, respectively. This is the first experimental demonstration to truly reveal the potential of fibres to emit across the mid-infrared molecularfingerprint region’, which is of key importance for applications such as early cancer diagnostics, gas sensing and food quality control.

  9. Comparison of two highly discriminatory molecular fingerprinting assays for analysis of multiple Aspergillus fumigatus isolates from patients with invasive aspergillosis.

    PubMed

    de Valk, Hanneke A; Meis, Jacques F G M; de Pauw, Ben E; Donnelly, Peter J; Klaassen, Corné H W

    2007-05-01

    Two highly discriminatory fingerprinting assays, short tandem repeat typing and amplified fragment length polymorphism (AFLP), were compared to determine the genetic relatedness between 55 isolates of Aspergillus fumigatus obtained from 15 different patients suffering from proven invasive aspergillosis. Both techniques showed that interpatient isolates belonged to different genotypes and that intrapatient isolates from deep sites were all of the same genotype. By contrast, multiple genotypes were found among isolates originating from respiratory samples. Both techniques have specific advantages and disadvantages. AFLP is more universally applicable, but short tandem repeat analysis offers better discriminatory power and should be the preferred method for standardizing typing of clinical isolates of Aspergillus fumigatus.

  10. Efficiency of rep-PCR fingerprinting as a useful technique for molecular typing of plant pathogenic fungal species: Botryosphaeriaceae species as a case study.

    PubMed

    Abdollahzadeh, Jafar; Zolfaghari, Sajedeh

    2014-12-01

    Progress in molecular biology and the advent of rapid and accurate molecular techniques have contributed to precise and rapid detection and differentiation of microbial pathogens. Identification of the Botryosphaeriaceae species based on morphology has been problematic over time. In this study, we used rep-PCR technique as a molecular tool for typing and differentiation of the Botryosphaeriaceae species, well-known and cosmopolitan fungal pathogens on woody plants. Three primer sets BOX, ERIC and REP were used to differentiate 27 species belong to eight genera. The majority of them were examined in terms of typing and differentiation using molecular methods for the first time. All the primer sets were able to generate species-specific DNA fingerprints from all the tested strains, with two exceptions in the genera Diplodia and Spencermartinsia. Despite the deficiency of each primer sets to separate a few species, cluster analysis of combined data sets indicated the ability of rep-PCR technique to separate 26 out of 27 examined species in highly supported clusters corresponded to the species recognized based on DNA sequence data. Our findings revealed the efficiency of rep-PCR for detection and differentiation of the Botryosphaeriaceae species, especially cryptic species with the same ITS sequences and similar morphology.

  11. Defining the Baseline and Oxidant Perturbed Lipidomic Profiles of Daphnia magna.

    PubMed

    Taylor, Nadine S; White, Thomas A; Viant, Mark R

    2017-03-15

    Recent technological advancement has enabled the emergence of lipidomics as an important tool for assessing molecular stress, one which has yet to be assessed fully as an approach in an environmental toxicological context. Here we have applied a high-resolution, non-targeted, nanoelectrospray ionisation (nESI) direct infusion mass spectrometry (DIMS) technique to assess the effects of oxidative stress to Daphnia magna both in vitro (air exposure of daphniid extracts) and in vivo (Cu(2+) exposure). Multivariate and univariate statistical analyses were used to distinguish any perturbations including oxidation to the D. magna baseline lipidome. This approach enabled the putative annotation of the baseline lipidome of D. magna with 65% of the lipid species discovered previously not reported. In vitro exposure of lipid extracts to air, primarily to test the methodology, revealed a significant perturbation to this baseline lipidome with detectable oxidation of peaks, in most cases attributed to single oxygen addition. Exposure of D. magna to Cu(2+) in vivo also caused a significant perturbation to the lipidome at an environmentally relevant concentration of 20 µg/L. This nESI DIMS approach has successfully identified perturbations and oxidative modifications to the D. magna lipidome in a high-throughput manner, highlighting its suitability for environmental lipidomic studies.

  12. Defining the Baseline and Oxidant Perturbed Lipidomic Profiles of Daphnia magna

    PubMed Central

    Taylor, Nadine S.; White, Thomas A.; Viant, Mark R.

    2017-01-01

    Recent technological advancement has enabled the emergence of lipidomics as an important tool for assessing molecular stress, one which has yet to be assessed fully as an approach in an environmental toxicological context. Here we have applied a high-resolution, non-targeted, nanoelectrospray ionisation (nESI) direct infusion mass spectrometry (DIMS) technique to assess the effects of oxidative stress to Daphnia magna both in vitro (air exposure of daphniid extracts) and in vivo (Cu2+ exposure). Multivariate and univariate statistical analyses were used to distinguish any perturbations including oxidation to the D. magna baseline lipidome. This approach enabled the putative annotation of the baseline lipidome of D. magna with 65% of the lipid species discovered previously not reported. In vitro exposure of lipid extracts to air, primarily to test the methodology, revealed a significant perturbation to this baseline lipidome with detectable oxidation of peaks, in most cases attributed to single oxygen addition. Exposure of D. magna to Cu2+ in vivo also caused a significant perturbation to the lipidome at an environmentally relevant concentration of 20 µg/L. This nESI DIMS approach has successfully identified perturbations and oxidative modifications to the D. magna lipidome in a high-throughput manner, highlighting its suitability for environmental lipidomic studies. PMID:28294984

  13. Behavioral response of Daphnia magna to silver salt and nanoparticle exposure

    EPA Science Inventory

    Endpoints in the investigation of the toxicity of metallic nanoparticles have varied from genetic and molecular through whole organism responses such as death and reproduction. The work presented here is an effort to quantify behavioral responses of Daphnia magna to exposure to s...

  14. First evidence for toxic defense based on the multixenobiotic resistance (MXR) mechanism in Daphnia magna.

    PubMed

    Campos, Bruno; Altenburger, Rolf; Gómez, Cristian; Lacorte, Silvia; Piña, Benjamin; Barata, Carlos; Luckenbach, Till

    2014-03-01

    The water flea Daphnia magna is widely used as test species in ecotoxicological bioassays. So far, there is no information available to which extent ATP binding cassette (ABC) transporter based multixenobiotic resistance (MXR) counteracts adverse chemical effects in this species. This, however, would be important for assessing to which extent the bio-active potential of a compound determined with this species depends on this cellular defense. We here present molecular, functional and toxicological studies that provide first evidence for ABC transporter-based MXR in D. magna. We cloned putatively MXR-related partial abcb1, abcc1/3, abcc4 and abcc5 coding sequences; respective transcripts were constitutively expressed in different D. magna life stages. MXR associated efflux activity was monitored in D. magna using the fluorescent substrate dyes rhodamine 123, rhodamine B and calcein-AM combined with inhibitors of human ABCB1 and/or ABCC transporter activities reversin 205, MK571 and cyclosporin A. With inhibitors present, efflux of dye substrates was reduced in D. magna in a concentration-dependent mode, as indicated by elevated accumulation of the dyes in D. magna tissues. In animals pre-exposed to mercury, pentachlorophenol or dacthal applied as inducers of ABC transporter expression, levels of some ABC transporter transcripts were increased in some cases showing that these genes can be chemically induced. Likewise, pre-exposure of animals to these chemicals decreased dye accumulation in tissue, indicating enhanced MXR transporter activity, likely associated with higher transporter protein levels. Toxicity assays with toxic transporter substrates mitoxantrone and chlorambucil that were applied singly and in combination with inhibitors were performed to study the tolerance role of Abcb1 and Abcc efflux transporters in D. magna. Joint toxicities of about half of the binary combinations of test compounds applied (substrate/inhibitor, substrate/substrate, inhibitor

  15. Fingerprint recognition with identical twin fingerprints.

    PubMed

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  16. Aerogel Fingerprint Media

    SciTech Connect

    Miller, Fred S.; Andresen, Brian D.

    1999-09-21

    A fingerprint medium which is made of an aerogel having a predetermined density. The fingerprint medium may have a midrange density for forming plates or may be crushed forming a powder. The fingerprint medium may further include at least one of a metal and metal oxide to enhance characteristics desirable in a fingerprint medium.

  17. Phenotypic and molecular fingerprinting of fast growing rhizobia of field-grown pigeonpea from the eastern edge of the Brazilian Pantanal.

    PubMed

    Costa, F M; Schiavo, J A; Brasil, M S; Leite, J; Xavier, G R; Fernandes, P I

    2014-01-21

    The aim of this study was to evaluate the diversity of rhizobial isolates obtained from root nodules of pigeonpea plants grown at the eastern edge of the Brazilian Pantanal. The bacterial isolates were isolated from root nodules from field-growing pigeonpea grown in two rural settlements of the Aquidauana municipality. The bacterial isolates were characterized phenotypically by means of cultural characterization, intrinsic antibiotic resistance (IAR), salt and high incubation temperature tolerance, and amylolytic and cellulolytic activities. The molecular characterization of the bacterial isolates was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and Box-polymerase chain reaction (PCR) techniques. In addition, the symbiotic performance of selected rhizobial isolates was evaluated in a greenhouse experiment using sterile substrate. The phenotypic characterization revealed that the bacterial strains obtained from pigeonpea root nodules presented characteristics that are uncommon among rhizobial isolates, indicating the presence of new species nodulating the pigeonpea plants in the Brazilian Pantanal. The molecular fingerprinting of these bacterial isolates also showed a highly diverse collection, with both techniques revealing less than 25% similarity among bacterial isolates. The evaluation of symbiotic performance also indicated the presence of microorganisms with high potential to increase the growth and nitrogen content at the shoots of pigeonpea plants. The results obtained in this study indicate the presence of a highly diversified rhizobial community nodulating the pigeonpea at the eastern edge of the Brazilian Pantanal.

  18. Comparison of 16S rDNA analysis and rep-PCR genomic fingerprinting for molecular identification of Yersinia pseudotuberculosis.

    PubMed

    Kim, Wonyong; Song, Mi-Ok; Song, Wonkeun; Kim, Ki-Jung; Chung, Sang-In; Choi, Chul-Soon; Park, Yong-Ha

    2003-01-01

    16S rDNA sequence analysis and repetitive element sequence-based PCR (rep-PCR) genomic fingerprinting were evaluated on 11 type strains of the genus Yersinia and 17 recognized serotype strains of Y. pseudotuberculosis to investigate their genetic relatedness and to establish the value of techniques for the identification of Y. pseudotuberculosis. A phylogenetic tree constructed from 16S rDNA sequences showed that the type strains of Yersinia species formed distinct clusters with the exception of Y. pestis and Y. pseudotuberculosis. Moreover, Y. pestis NCTC 5923T was found to be closely related to Y. pseudotuberculosis serotypes 1b, 3, and 7. Dendrograms generated from REP-PCR, and ERIC-PCR data revealed that members of the genus Yersinia differed from each other with the degree of similarity 62% and 58%, respectively. However, the BOX-PCR results showed that Y. pestis 5923T clustered with the Y. pseudotuberculosis group with a degree of similarity 74%. According to these findings, 16S rDNA sequence analysis was unable to reliably discriminate Y. pseudotuberculosis from Y. pestis. However, REP-PCR and especially ERIC-PCR provided an effective means of differentiating between members of the taxa.

  19. Advanced Fingerprint Analysis Project Fingerprint Constituents

    SciTech Connect

    GM Mong; CE Petersen; TRW Clauss

    1999-10-29

    The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

  20. Fluorescence fingerprints and Cu2+-complexing ability of individual molecular size fractions in soil- and waste-borne DOM.

    PubMed

    Knoth de Zarruk, K; Scholer, G; Dudal, Y

    2007-09-01

    Land spreading of organic materials introduces large amounts of dissolved organic matter (DOM) into the soil. DOM has the ability to form stable complexes with heavy metals and can facilitate their transport towards the groundwater. The effects on soil processes are difficult to assess, because different DOM components might react differently towards metal ions. The objective of this study was to investigate the fluorescence signature and the Cu2+-binding capacity of individual molecular size fractions of DOM from various sources. DOM extracted from leaf compost, chicken manure, sugar cane vinasse and a fulvic hypercalcaric cambisol was fractionated by the means of dialysis into four molecular size classes: MW<500, 50012000-14000 Da. Vinasse and leaf compost contained around 80% and 70%, respectively, of the total organic carbon in the fractions with low molecular weight (MW<3500 Da); in chicken manure and soil these fractions accounted for 40% and 50% only. Fluorescence was highest in the fraction MW>12000 Da for leaf compost, chicken manure and soil. The opposite result was obtained for vinasse, where the fractions with low molecular weight showed highest fluorescence intensities, distinguishing it from all other samples. Vinasse showed the greatest ability to bind Cu2+ with a resulting complex concentration of 6.31mgl(-1) while in contact with an excess of Cu2+. Leaf compost, soil and chicken manure followed with 2.69, 1.12, and 0.85mgl(-1), respectively. Within vinasse, the fraction MW<500 Da was able to form the most DOM-Cu complexes, indicating the importance of low molecular weight fractions in metal binding.

  1. Development of 3D-QSAR Model for Acetylcholinesterase Inhibitors Using a Combination of Fingerprint, Molecular Docking, and Structure-Based Pharmacophore Approaches.

    PubMed

    Lee, Sehan; Barron, Mace G

    2015-11-01

    Acetylcholinesterase (AChE), a serine hydrolase vital for regulating the neurotransmitter acetylcholine in animals, has been used as a target for drugs and pesticides. With the increasing availability of AChE crystal structures, with or without ligands bound, structure-based approaches have been successfully applied to AChE inhibitors (AChEIs). The major limitation of these approaches has been the small applicability domain due to the lack of structural diversity in the training set. In this study, we developed a 3 dimensional quantitative structure-activity relationship (3D-QSAR) for inhibitory activity of 89 reversible and irreversible AChEIs including drugs and insecticides. A 3D-fingerprint descriptor encoding protein-ligand interactions was developed using molecular docking and structure-based pharmacophore to rationalize the structural requirements responsible for the activity of these compounds. The obtained 3D-QSAR model exhibited high correlation value (R(2) = 0.93) and low mean absolute error (MAE = 0.32 log units) for the training set (n = 63). The model was predictive across a range of structures as shown by the leave-one-out cross-validated correlation coefficient (Q(2) = 0.89) and external validation results (n = 26, R(2) = 0.89, and MAE = 0.38 log units). The model revealed that the compounds with high inhibition potency had proper conformation in the active site gorge and interacted with key amino acid residues, in particular Trp84 and Phe330 at the catalytic anionic site, Trp279 at the peripheral anionic site, and Gly118, Gly119, and Ala201 at the oxyanion hole. The resulting universal 3D-QSAR model provides insight into the multiple molecular interactions determining AChEI potency that may guide future chemical design and regulation of toxic AChEIs.

  2. Conversion of the pathogenic fungus Colletotrichum magna to a nonpathogenic, endophytic mutualist by gene disruption

    USGS Publications Warehouse

    Redman, R.S.; Ranson, J.C.; Rodriguez, R.J.

    1999-01-01

    Hygromycin-resistant transformants of the cucurbit pathogen Colletotrichum magna (teleomorph: Glomerella magna) were generated by restriction enzyme-mediated integration (REMI) transformation. A rapid pathogenicity assay involving watermelon (Citrullus lanatus) seedlings was developed and 14,400 REMI transformants were screened and assessed for their ability to cause disease, colonize plant tissues, and confer disease resistance against wild-type C. magna. A total of 176 nonpathogenic REMI mutants capable of colonizing cucurbit plants were isolated and assigned to three groups based on their ability to confer disease resistance: phenotype A, 80 to 100% disease protection; phenotype B, 10 to 65% disease protection; and phenotype C, 0 to 4% disease protection. Molecular and genetic analyses of one REMI mutant (R1) indicated that the nonpathogenic phenotype A resulted from a single-site integration. R1 showed a 1:1 segregation of hygromycin resistance and nonpathogenicity and all hygromycin-resistant progeny were nonpathogenic. The integrated vector and 5.5 kb of flanking fungal genomic DNA were isolated from R1 and designated pGMR1. To verify that pGMR1 contained pathogenicity gene sequences, a wild-type isolate of C. magna was transformed with pGMR1 to induce gene disruptions by homologous integration. Approximately 47% of the pGMR1 transformants expressed phenotype A, indicating homologous integration and gene disruption.

  3. Quantitative structure-activity relationship modeling of the toxicity of organothiophosphate pesticides to Daphnia magna and Cyprinus carpio.

    PubMed

    Zvinavashe, Elton; Du, Tingting; Griff, Tamas; van den Berg, Hans H J; Soffers, Ans E M F; Vervoort, Jacques; Murk, Albertinka J; Rietjens, Ivonne M C M

    2009-06-01

    Within the REACH regulatory framework in the EU, quantitative structure-activity relationships (QSAR) models are expected to help reduce the number of animals used for experimental testing. The objective of this study was to develop QSAR models to describe the acute toxicity of organothiophosphate pesticides to aquatic organisms. Literature data sets for acute toxicity data of organothiophosphates to fish and one data set from experiments with 15 organothiophosphates on Daphniamagna performed in the present study were used to establish QSARs based on quantum mechanically derived molecular descriptors. The logarithm of the octanol/water partition coefficient, logK(ow,) the energy of the lowest unoccupied molecular orbital, E(lumo), and the energy of the highest occupied molecular orbital, E(homo) were used as descriptors. Additionally, it was investigated if toxicity data for the invertebrate D. magna could be used to build a QSAR model to predict toxicity to fish. Suitable QSAR models (0.80magna). Toxicity data for D. magna correlated well (r(2)=0.94) with toxicity data for C. carpio. This implies that by performing toxicity tests with D. magna, one can use our interspecies QSAR model to predict the acute toxicity of organothiophosphates to fish. The three QSAR models were validated either both internally and externally (D. magna) or internally only (carp and D. magna to carp). For each QSAR model, an applicability domain was defined based on the chemical structures and the ranges of the descriptor values of the training set compounds. From the 100196 European Inventory of Existing Commercial Chemical Substances (EINECS), 83 compounds were identified that fit the selection criteria for the QSAR models. For these compounds, using our QSAR models, one can obtain an indication of their toxicity without the need for additional experimental

  4. Comparison of multilocus sequence typing and Ca3 fingerprinting for molecular subtyping epidemiologically-related clinical isolates of Candida albicans.

    PubMed

    Chowdhary, Anuradha; Lee-Yang, Wendy; Lasker, Brent A; Brandt, Mary E; Warnock, David W; Arthington-Skaggs, Beth A

    2006-08-01

    Southern hybridization with the complex probe Ca3 is a well established tool for molecular subtyping of Candida albicans. Multilocus sequence typing (MLST) is a DNA sequence-based subtyping method recently applied to C. albicans and shown to have a high degree of intraspecies discriminatory power. However, its utility for studying the molecular epidemiology of sequential isolates from recurrent disease has not been established. We compared Ca3 Southern hybridization and MLST using seven housekeeping genes (CaAAT1a, CaACC1, CaADP1, CaPMI, CaSYA1, CaVPS13, CaZWF1b) for their ability to discriminate among 37 C. albicans isolates from recurrent cases of oropharyngeal candidiasis (OPC) in ten HIV-positive patients from India and the US. Among the 37 isolates, MLST identified 23 distinct genotypes (index of diversity = 97%); Ca3 Southern hybridization identified 21 distinct genotypes (index of diversity = 95%). Both methods clustered isolates into seven genetically-related groups and, with one exception, isolates that were indistinguishable by MLST were indistinguishable or highly related by Ca3 Southern hybridization. These results demonstrate that MLST performs equally well or better compared to Ca3 Southern hybridization for defining genetic-relatedness of sequential C. albicans isolates from recurrent cases of OPC in HIV-positive patients.

  5. Molecular fingerprinting of Salmonella typhimurium by IS200-typing as a tool for epidemiological and evolutionary studies.

    PubMed

    Soria, G; Barbé, J; Gibert, I

    1994-01-01

    The aim of this work was to develop and evaluate a molecular typing strategy for Salmonella based on hybridization of chromosomal DNA with two different probes derived from insertion sequence IS200. Probe IS200-TT was specifically constructed for this study as a trimer of a 112 pb TaqI-TaqI fragment of IS200. Among several restriction enzymes evaluated, two were selected: EcoRI, which cuts the insertion sequence in two pieces, each one complementary to one of the probes used, and PstI, a restriction enzyme with no recognition site into IS200. With several combinations of these restrictions enzymes and probes, 43 Salmonella typhimurium strains were analyzed for copy number and location of IS200, as well as reproducibility and stability of the patterns. IS200 types have been shown to be stable, both in strains isolated from different patients implicated in the same salmonellosis outbreak and in strains isolated from the same patient at different times or from different specimens. The discriminatory power of the method has been 0.91 to 0.94. As a comparison, S. typhimurium strains were also ribotyped. Discriminatory power of the ribotypes oscillated between 0.44 and 0.55, depending on the enzyme used, and achieved a 0.78 value when the information obtained with two restriction enzymes was combined. Moreover, IS200 typing was able to differentiate among a group of S. typhimurium strains which were identical by ribotype and enzymatic electrophoretic mobility. These results enable us to conclude that, for the stability, reproducibility and discriminatory power of the patterns generated, IS200 probes can be a very useful tool in the molecular typing of S. typhimurium.

  6. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    PubMed

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  7. Latent fingerprint matching.

    PubMed

    Jain, Anil K; Feng, Jianjiang

    2011-01-01

    Latent fingerprint identification is of critical importance to law enforcement agencies in identifying suspects: Latent fingerprints are inadvertent impressions left by fingers on surfaces of objects. While tremendous progress has been made in plain and rolled fingerprint matching, latent fingerprint matching continues to be a difficult problem. Poor quality of ridge impressions, small finger area, and large nonlinear distortion are the main difficulties in latent fingerprint matching compared to plain or rolled fingerprint matching. We propose a system for matching latent fingerprints found at crime scenes to rolled fingerprints enrolled in law enforcement databases. In addition to minutiae, we also use extended features, including singularity, ridge quality map, ridge flow map, ridge wavelength map, and skeleton. We tested our system by matching 258 latents in the NIST SD27 database against a background database of 29,257 rolled fingerprints obtained by combining the NIST SD4, SD14, and SD27 databases. The minutiae-based baseline rank-1 identification rate of 34.9 percent was improved to 74 percent when extended features were used. In order to evaluate the relative importance of each extended feature, these features were incrementally used in the order of their cost in marking by latent experts. The experimental results indicate that singularity, ridge quality map, and ridge flow map are the most effective features in improving the matching accuracy.

  8. Use of Daphnia Magna to Assess Potentially Contaminated Buildings.

    DTIC Science & Technology

    1992-06-01

    Random concrete core samples taken from a loading dock were used in determining the toxicity of concrete to Daphnia magna . The cores were ground to...powder and analyzed for volatiles and chemical agents before being subjected to aquatic toxicology studies using Daphnia magna . Particle size, pH, and

  9. Teaching Magna Carta in American History: Land, Law, and Legacy

    ERIC Educational Resources Information Center

    Saxe, David W.

    2010-01-01

    Magna Carta, that great cornerstone of American liberty, has been in the news lately. Put up for sale by three-time U.S. Presidential candidate Ross Perot in December 2007, the 1297 version of Magna Carta displayed in the National Archives was sold to financier David Rubenstein for $21.3 million. While its sale demonstrates the cash value of the…

  10. A DAPHNIA MAGNA SHORT-TERM SURVIVAL AND GROWTH TEST

    EPA Science Inventory

    With the change in acceptable test temperatures for invertebrate toxicity tests from <20oC to 25oC, it is now possible to use Daphnia magna for short-term chronic testing. When cultured at 25oC the dry weight of <24 hr old D. magna ranges from 7 to 15 g depending upon nutrition,...

  11. iCDI-PseFpt: identify the channel-drug interaction in cellular networking with PseAAC and molecular fingerprints.

    PubMed

    Xiao, Xuan; Min, Jian-Liang; Wang, Pu; Chou, Kuo-Chen

    2013-11-21

    Many crucial functions in life, such as heartbeat, sensory transduction and central nervous system response, are controlled by cell signalings via various ion channels. Therefore, ion channels have become an excellent drug target, and study of ion channel-drug interaction networks is an important topic for drug development. However, it is both time-consuming and costly to determine whether a drug and a protein ion channel are interacting with each other in a cellular network by means of experimental techniques. Although some computational methods were developed in this regard based on the knowledge of the 3D (three-dimensional) structure of protein, unfortunately their usage is quite limited because the 3D structures for most protein ion channels are still unknown. With the avalanche of protein sequences generated in the post-genomic age, it is highly desirable to develop the sequence-based computational method to address this problem. To take up the challenge, we developed a new predictor called iCDI-PseFpt, in which the protein ion-channel sample is formulated by the PseAAC (pseudo amino acid composition) generated with the gray model theory, the drug compound by the 2D molecular fingerprint, and the operation engine is the fuzzy K-nearest neighbor algorithm. The overall success rate achieved by iCDI-PseFpt via the jackknife cross-validation was 87.27%, which is remarkably higher than that by any of the existing predictors in this area. As a user-friendly web-server, iCDI-PseFpt is freely accessible to the public at the website http://www.jci-bioinfo.cn/iCDI-PseFpt/. Furthermore, for the convenience of most experimental scientists, a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated math equations presented in the paper just for its integrity. It has not escaped our notice that the current approach can also be used to study other drug-target interaction networks.

  12. How fingerprints came into use for personal identification.

    PubMed

    Caplan, R M

    1990-07-01

    The use of fingerprints for personal identification became widespread early in this century. How the fingerprints slowly became standardized involves many persons, including Nathaniel Grew, Johannes Purkinje, William Herschel, Henry Faulds, Charles Darwin, Francis Galton, Mark Twain, Juan Vucetich, Edward Henry, and J. Edgar Hoover. Although fingerprints have been noted and used since antiquity, a 25-year burst of activity that secured adoption of their use for identification began in about 1880. New modifications and applications have continued to the present. The history of fingerprints offers an excellent example of how society adopts innovations. This story also includes a bitter struggle for appropriate credit for various crucial steps in developing and adopting this important tool. More recent technical advances, including computers and molecular biology, now supplement the ease and usefulness of fingerprints, although the word fingerprinting continues in use by metaphoric extension.

  13. Rapid Molecular Fingerprinting of Pathogens

    DTIC Science & Technology

    2006-08-31

    establishing appropriate biotinylation conditions and the availability of sufficient quantities of purified virus for library screening . Additionally...the level of peptide display on the cell surface was found to be lower than desired for optimal library screening . This problem was corrected by...remaining virus sample with the green fluroescent probe Alexa 488. However, Alexa labeling resulted in insufficient fluorescent signals for library

  14. Comparing Bacterial DNA Microarray Fingerprints

    SciTech Connect

    Willse, Alan R.; Chandler, Darrell P.; White, Amanda M.; Protic, Miroslava; Daly, Don S.; Wunschel, Sharon C.

    2005-08-15

    Detecting subtle genetic differences between microorganisms is an important problem in molecular epidemiology and microbial forensics. In a typical investigation, gel electrophoresis is used to compare randomly amplified DNA fragments between microbial strains, where the patterns of DNA fragment sizes are proxies for a microbe's genotype. The limited genomic sample captured on a gel is often insufficient to discriminate nearly identical strains. This paper examines the application of microarray technology to DNA fingerprinting as a high-resolution alternative to gel-based methods. The so-called universal microarray, which uses short oligonucleotide probes that do not target specific genes or species, is intended to be applicable to all microorganisms because it does not require prior knowledge of genomic sequence. In principle, closely related strains can be distinguished if the number of probes on the microarray is sufficiently large, i.e., if the genome is sufficiently sampled. In practice, we confront noisy data, imperfectly matched hybridizations, and a high-dimensional inference problem. We describe the statistical problems of microarray fingerprinting, outline similarities with and differences from more conventional microarray applications, and illustrate the statistical fingerprinting problem for 10 closely related strains from three Bacillus species, and 3 strains from non-Bacillus species.

  15. Small scale mass culture of Daphnia magna Straus

    SciTech Connect

    Rees, J.T.; Oldfather, J.M.

    1980-02-01

    Daphnia magna Straus 1820 was raised on a defined medium in 4-liter flasks with controlled light intensity, temperature, and algal food species. Adult D. magna tolerated high levels of ammonia (up to 108 ..mu..M) at high pH (> 10), although at these levels parthenogenic reproduction may be inhibited. Scenedesmus quadricauda and Ankistrodesmus sp. were satisfactory food sources, and by utilizing Ankistrodesmus densities greater than one animal per ml were achieved. Maintaining the pH at about 7 to 8 seems to be important for successful D. magna culture.

  16. Advanced fingerprint verification software

    NASA Astrophysics Data System (ADS)

    Baradarani, A.; Taylor, J. R. B.; Severin, F.; Maev, R. Gr.

    2016-05-01

    We have developed a fingerprint software package that can be used in a wide range of applications from law enforcement to public and private security systems, and to personal devices such as laptops, vehicles, and door- locks. The software and processing units are a unique implementation of new and sophisticated algorithms that compete with the current best systems in the world. Development of the software package has been in line with the third generation of our ultrasonic fingerprinting machine1. Solid and robust performance is achieved in the presence of misplaced and low quality fingerprints.

  17. Longitudinal study of fingerprint recognition.

    PubMed

    Yoon, Soweon; Jain, Anil K

    2015-07-14

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject's age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis.

  18. Longitudinal study of fingerprint recognition

    PubMed Central

    Yoon, Soweon; Jain, Anil K.

    2015-01-01

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject’s age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis. PMID:26124106

  19. Altered fingerprints: analysis and detection.

    PubMed

    Yoon, Soweon; Feng, Jianjiang; Jain, Anil K

    2012-03-01

    The widespread deployment of Automated Fingerprint Identification Systems (AFIS) in law enforcement and border control applications has heightened the need for ensuring that these systems are not compromised. While several issues related to fingerprint system security have been investigated, including the use of fake fingerprints for masquerading identity, the problem of fingerprint alteration or obfuscation has received very little attention. Fingerprint obfuscation refers to the deliberate alteration of the fingerprint pattern by an individual for the purpose of masking his identity. Several cases of fingerprint obfuscation have been reported in the press. Fingerprint image quality assessment software (e.g., NFIQ) cannot always detect altered fingerprints since the implicit image quality due to alteration may not change significantly. The main contributions of this paper are: 1) compiling case studies of incidents where individuals were found to have altered their fingerprints for circumventing AFIS, 2) investigating the impact of fingerprint alteration on the accuracy of a commercial fingerprint matcher, 3) classifying the alterations into three major categories and suggesting possible countermeasures, 4) developing a technique to automatically detect altered fingerprints based on analyzing orientation field and minutiae distribution, and 5) evaluating the proposed technique and the NFIQ algorithm on a large database of altered fingerprints provided by a law enforcement agency. Experimental results show the feasibility of the proposed approach in detecting altered fingerprints and highlight the need to further pursue this problem.

  20. Online fingerprint verification.

    PubMed

    Upendra, K; Singh, S; Kumar, V; Verma, H K

    2007-01-01

    As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications.

  1. Expertise in fingerprint identification.

    PubMed

    Thompson, Matthew B; Tangen, Jason M; McCarthy, Duncan J

    2013-11-01

    Although fingerprint experts have presented evidence in criminal courts for more than a century, there have been few scientific investigations of the human capacity to discriminate these patterns. A recent latent print matching experiment shows that qualified, court-practicing fingerprint experts are exceedingly accurate (and more conservative) compared with novices, but they do make errors. Here, a rationale for the design of this experiment is provided. We argue that fidelity, generalizability, and control must be balanced to answer important research questions; that the proficiency and competence of fingerprint examiners are best determined when experiments include highly similar print pairs, in a signal detection paradigm, where the ground truth is known; and that inferring from this experiment the statement "The error rate of fingerprint identification is 0.68%" would be unjustified. In closing, the ramifications of these findings for the future psychological study of forensic expertise and the implications for expert testimony and public policy are considered.

  2. Fingerprinting of music scores

    NASA Astrophysics Data System (ADS)

    Irons, Jonathan; Schmucker, Martin

    2004-06-01

    Publishers of sheet music are generally reluctant in distributing their content via the Internet. Although online sheet music distribution's advantages are numerous the potential risk of Intellectual Property Rights (IPR) infringement, e.g. illegal online distributions, disables any innovation propensity. While active protection techniques only deter external risk factors, additional technology is necessary to adequately treat further risk factors. For several media types including music scores watermarking technology has been developed, which ebeds information in data by suitable data modifications. Furthermore, fingerprinting or perceptual hasing methods have been developed and are being applied especially for audio. These methods allow the identification of content without prior modifications. In this article we motivate the development of watermarking and fingerprinting technologies for sheet music. Outgoing from potential limitations of watermarking methods we explain why fingerprinting methods are important for sheet music and address potential applications. Finally we introduce a condept for fingerprinting of sheet music.

  3. Making DNA Fingerprints.

    ERIC Educational Resources Information Center

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  4. Effects of acid precipitation on Daphnia magna

    SciTech Connect

    Parent, S.; Cheetham, R.D.

    1980-08-01

    Pollutants derived from fossil fuel combustion and precipitated from the atmosphere have substantially increased in the past decades. These materials, precipitated in such industrialized areas as southeastern Canada, have caused considerable alterations in aquatic ecosystems. Precipitation over most of the eastern United States is presently 10 to 500 times more acidic than is natural. Most affected aquatic ecosystems contain oligotrophic waters in regions of thin poorly buffered soils. Zooplankton are an important link in food chains of aquatic ecosystems and their disappearance or decline could drastically affect trophic relationships. Declines in zooplankton density in response to acid precipitation have been reported and short term survival of Daphnia pulex between pH 4.3 and 10.4; however, its potential for reproduction was limited to a fairly narrow range. Anderson (1944) noted the advantages of using daphnia as test organisms, and concluded that Daphnia magna was representative of other abundant zooplankton in sensitivity to toxic substances.

  5. Multixenobiotic resistance efflux activity in Daphnia magna and Lumbriculus variegatus.

    PubMed

    Vehniäinen, Eeva-Riikka; Kukkonen, Jussi V K

    2015-04-01

    Multixenobiotic resistance is a phenomenon in which ATP-binding cassette (ABC) family proteins transfer harmful compounds out of cells. Daphnia magna and Lumbriculus variegatus are model species in aquatic ecotoxicology, but the presence and activity of ABC proteins have not been well described in these species. The aim of this work was to study the presence, activity, and inhibition of ABC transport proteins in D. magna and L. variegatus. The presence of abcb1 and abcc transcripts in 8-9-day-old D. magna was investigated by qRT-PCR. The activity of MXR in D. magna and L. variegatus was explored by influx of the fluorescent ABC protein substrates rhodamine B and calcein-AM, with and without the model inhibitors verapamil (unspecific ABC inhibitor), reversin 205 (ABCB1 inhibitor) and MK571 (ABCC inhibitor). Juvenile D. magna possessed all examined abcb and abcc transcripts, but only reversin 205 inhibited MXR activity. The MXR activity in L. variegatus was inhibited by MK571, and to a lesser extent by verapamil, whereas reversin 205 seemed to stimulate the transport activity. Whereas calcein-AM worked better as an MXR substrate in D. magna, rhodamine B was a better substrate for L. variegatus MXR activity measurements. This is the first report on MXR activity in the order Lumbriculida, subclass Oligochaeta, and class Clitellata.

  6. Mathematical correction for fingerprint similarity measures to improve chemical retrieval.

    PubMed

    Swamidass, S Joshua; Baldi, Pierre

    2007-01-01

    In many modern chemoinformatics systems, molecules are represented by long binary fingerprint vectors recording the presence or absence of particular features or substructures, such as labeled paths or trees, in the molecular graphs. These long fingerprints are often compressed to much shorter fingerprints using a simple modulo operation. As the length of the fingerprints decreases, their typical density and overlap tend to increase, and so does any similarity measure based on overlap, such as the widely used Tanimoto similarity. Here we show that this correlation between shorter fingerprints and higher similarity can be thought of as a systematic error introduced by the fingerprint folding algorithm and that this systematic error can be corrected mathematically. More precisely, given two molecules and their compressed fingerprints of a given length, we show how a better estimate of their uncompressed overlap, hence of their similarity, can be derived to correct for this bias. We show how the correction can be implemented not only for the Tanimoto measure but also for all other commonly used measures. Experiments on various data sets and fingerprint sizes demonstrate how, with a negligible computational overhead, the correction noticeably improves the sensitivity and specificity of chemical retrieval.

  7. Perspective automated inkless fingerprinting imaging software for fingerprint research.

    PubMed

    Nanakorn, Somsong; Poosankam, Pongsakorn; Mongconthawornchai, Paiboon

    2008-01-01

    Fingerprint collection using ink-and-paper image is a conventional method i.e. an ink-print, transparent-adhesive tape techniques which are slower and cumbersome. This is a pilot research for software development aimed at imaging an automated, inkless fingerprint using a fingerprint sensor, a development kit of the IT WORKS Company Limited, PC camera, and printer The development of software was performed to connect with the fingerprint sensor for collection of fingerprint images and recorded into a hard disk. It was also developed to connect with the PC camera for recording a face image of persons' fingerprints or identification card images. These images had been appropriately arranged in a PDF file prior to printing. This software is able to scan ten fingerprints and store high-quality electronics fingertip images with rapid, large, and clear images without dirt of ink or carbon. This fingerprint technology is helpful in a potential application in public health and clinical medicine research.

  8. An Introduction to DNA Fingerprinting.

    ERIC Educational Resources Information Center

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  9. Bioaccumulation and uptake routes of perfluoroalkyl acids in Daphnia magna.

    PubMed

    Dai, Zhineng; Xia, Xinghui; Guo, Jia; Jiang, Xiaoman

    2013-02-01

    Perfluoroalkyl acids (PFAs), one kind of emerging contaminants, have attracted great attentions in recent years. However, the study about their bioaccumulation mechanism remains scarce. In this research, the bioaccumulation of six kinds of PFAs in water flea Daphnia magna was studied. The uptake rates of PFAs in D. magna ranged from 178 to 1338 L kg(-1) d(-1), and they increased with increasing perfluoroalkyl chain length; the elimination rates ranged from 0.98 to 2.82 d(-1). The bioaccumulation factors (BAFs) of PFAs ranged from 91 to 380 L kg(-1) in wet weight after 25 d exposure; they increased with increasing perfluoroalkyl chain length and had a significant positive correlation with the n-octanol/water partition coefficients (logK(ow)) of PFAs (p<0.05). This indicated that the hydrophobicity of PFAs plays an important role in their bioaccumulation. The BAFs almost kept constant when the PFA concentrations in aqueous phase increased from 1 to 10 μg L(-1). Scenedesmus subspicatus, as the food of D. magna, did not significantly affect the bioaccumulation of PFAs by D. magna. Furthermore, the body burden of PFAs in the dead D. magna was 1.08-2.52 times higher than that in the living ones, inferring that the body surface sorption is a main uptake route of PFAs in D. magna. This study suggested that the bioaccumulation of PFAs in D. magna is mainly controlled by their partition between organisms and water; further research should be conducted to study the intrinsic mechanisms, especially the roles of protein and lipid in organisms.

  10. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    PubMed

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  11. Predicting the Metabolic Sites by Flavin-Containing Monooxygenase on Drug Molecules Using SVM Classification on Computed Quantum Mechanics and Circular Fingerprints Molecular Descriptors

    PubMed Central

    Fu, Chien-wei; Lin, Thy-Hou

    2017-01-01

    As an important enzyme in Phase I drug metabolism, the flavin-containing monooxygenase (FMO) also metabolizes some xenobiotics with soft nucleophiles. The site of metabolism (SOM) on a molecule is the site where the metabolic reaction is exerted by an enzyme. Accurate prediction of SOMs on drug molecules will assist the search for drug leads during the optimization process. Here, some quantum mechanics features such as the condensed Fukui function and attributes from circular fingerprints (called Molprint2D) are computed and classified using the support vector machine (SVM) for predicting some potential SOMs on a series of drugs that can be metabolized by FMO enzymes. The condensed Fukui function fA− representing the nucleophilicity of central atom A and the attributes from circular fingerprints accounting the influence of neighbors on the central atom. The total number of FMO substrates and non-substrates collected in the study is 85 and they are equally divided into the training and test sets with each carrying roughly the same number of potential SOMs. However, only N-oxidation and S-oxidation features were considered in the prediction since the available C-oxidation data was scarce. In the training process, the LibSVM package of WEKA package and the option of 10-fold cross validation are employed. The prediction performance on the test set evaluated by accuracy, Matthews correlation coefficient and area under ROC curve computed are 0.829, 0.659, and 0.877 respectively. This work reveals that the SVM model built can accurately predict the potential SOMs for drug molecules that are metabolizable by the FMO enzymes. PMID:28072829

  12. Predicting the Metabolic Sites by Flavin-Containing Monooxygenase on Drug Molecules Using SVM Classification on Computed Quantum Mechanics and Circular Fingerprints Molecular Descriptors.

    PubMed

    Fu, Chien-Wei; Lin, Thy-Hou

    2017-01-01

    As an important enzyme in Phase I drug metabolism, the flavin-containing monooxygenase (FMO) also metabolizes some xenobiotics with soft nucleophiles. The site of metabolism (SOM) on a molecule is the site where the metabolic reaction is exerted by an enzyme. Accurate prediction of SOMs on drug molecules will assist the search for drug leads during the optimization process. Here, some quantum mechanics features such as the condensed Fukui function and attributes from circular fingerprints (called Molprint2D) are computed and classified using the support vector machine (SVM) for predicting some potential SOMs on a series of drugs that can be metabolized by FMO enzymes. The condensed Fukui function fA- representing the nucleophilicity of central atom A and the attributes from circular fingerprints accounting the influence of neighbors on the central atom. The total number of FMO substrates and non-substrates collected in the study is 85 and they are equally divided into the training and test sets with each carrying roughly the same number of potential SOMs. However, only N-oxidation and S-oxidation features were considered in the prediction since the available C-oxidation data was scarce. In the training process, the LibSVM package of WEKA package and the option of 10-fold cross validation are employed. The prediction performance on the test set evaluated by accuracy, Matthews correlation coefficient and area under ROC curve computed are 0.829, 0.659, and 0.877 respectively. This work reveals that the SVM model built can accurately predict the potential SOMs for drug molecules that are metabolizable by the FMO enzymes.

  13. Metabolite fingerprinting in transgenic lettuce.

    PubMed

    Garratt, Lee C; Linforth, Robert; Taylor, Andrew J; Lowe, Kenneth C; Power, J Brian; Davey, Michael R

    2005-03-01

    Metabolite fingerprinting has been achieved using direct atmospheric pressure chemical ionization-mass spectrometry (APCI-MS) and linked gas chromatography (GC-APCI/EI-MS) for transgenic lettuce (Lactuca sativa L. cv. Evola) plants expressing an IPT gene under the control of the senescence-specific SAG12 promoter from Arabidopsis thaliana (P(SAG12)-IPT). Mature heads of transgenic lettuce and their azygous controls were maintained under defined conditions to assess their shelf life. Transgenic lettuce plants exhibited delayed senescence and significant increases (up to a maximum of threefold) in the concentrations of three volatile organic compounds (VOCs), corresponding to molecular masses of 45, 47 and 63, when compared with heads from azygous plants. These VOCs were identified as acetaldehyde (45), ethanol (47) and dimethyl sulphide (63). The increase in dimethyl sulphide was paralleled by an accumulation of reactive oxygen species (ROS) in the heads of transgenic plants. These results demonstrate the applicability of metabolic fingerprinting techniques to elucidate the underlying pleiotropic responses of plants to transgene expression.

  14. Fingerprinting with Wow

    NASA Astrophysics Data System (ADS)

    Yu, Eugene; Craver, Scott

    2006-02-01

    Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

  15. Historeceptomic Fingerprints for Drug-Like Compounds

    PubMed Central

    Shmelkov, Evgeny; Grigoryan, Arsen; Swetnam, James; Xin, Junyang; Tivon, Doreen; Shmelkov, Sergey V.; Cardozo, Timothy

    2015-01-01

    Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology). The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300,000 experimentally determined bioactivity values from the ChEMBL database and 4.2 billion molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics) scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic, in vivo picture of the mechanism of any drug's action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at drugable.org for access through a user-friendly web site. PMID:26733872

  16. Historeceptomic Fingerprints for Drug-Like Compounds.

    PubMed

    Shmelkov, Evgeny; Grigoryan, Arsen; Swetnam, James; Xin, Junyang; Tivon, Doreen; Shmelkov, Sergey V; Cardozo, Timothy

    2015-01-01

    Most drugs exert their beneficial and adverse effects through their combined action on several different molecular targets (polypharmacology). The true molecular fingerprint of the direct action of a drug has two components: the ensemble of all the receptors upon which a drug acts and their level of expression in organs/tissues. Conversely, the fingerprint of the adverse effects of a drug may derive from its action in bystander tissues. The ensemble of targets is almost always only partially known. Here we describe an approach improving upon and integrating both components: in silico identification of a more comprehensive ensemble of targets for any drug weighted by the expression of those receptors in relevant tissues. Our system combines more than 300,000 experimentally determined bioactivity values from the ChEMBL database and 4.2 billion molecular docking scores. We integrated these scores with gene expression data for human receptors across a panel of human tissues to produce drug-specific tissue-receptor (historeceptomics) scores. A statistical model was designed to identify significant scores, which define an improved fingerprint representing the unique activity of any drug. These multi-dimensional historeceptomic fingerprints describe, in a novel, intuitive, and easy to interpret style, the holistic, in vivo picture of the mechanism of any drug's action. Valuable applications in drug discovery and personalized medicine, including the identification of molecular signatures for drugs with polypharmacologic modes of action, detection of tissue-specific adverse effects of drugs, matching molecular signatures of a disease to drugs, target identification for bioactive compounds with unknown receptors, and hypothesis generation for drug/compound phenotypes may be enabled by this approach. The system has been deployed at drugable.org for access through a user-friendly web site.

  17. Evolutionary Fingerprinting of Genes

    PubMed Central

    Kosakovsky Pond, Sergei L.; Scheffler, Konrad; Gravenor, Michael B.; Poon, Art F.Y.; Frost, Simon D.W.

    2010-01-01

    Over time, natural selection molds every gene into a unique mosaic of sites evolving rapidly or resisting change—an “evolutionary fingerprint” of the gene. Aspects of this evolutionary fingerprint, such as the site-specific ratio of nonsynonymous to synonymous substitution rates (dN/dS), are commonly used to identify genetic features of potential biological interest; however, no framework exists for comparing evolutionary fingerprints between genes. We hypothesize that protein-coding genes with similar protein structure and/or function tend to have similar evolutionary fingerprints and that comparing evolutionary fingerprints can be useful for discovering similarities between genes in a way that is analogous to, but independent of, discovery of similarity via sequence-based comparison tools such as Blast. To test this hypothesis, we develop a novel model of coding sequence evolution that uses a general bivariate discrete parameterization of the evolutionary rates. We show that this approach provides a better fit to the data using a smaller number of parameters than existing models. Next, we use the model to represent evolutionary fingerprints as probability distributions and present a methodology for comparing these distributions in a way that is robust against variations in data set size and divergence. Finally, using sequences of three rapidly evolving RNA viruses (HIV-1, hepatitis C virus, and influenza A virus), we demonstrate that genes within the same functional group tend to have similar evolutionary fingerprints. Our framework provides a sound statistical foundation for efficient inference and comparison of evolutionary rate patterns in arbitrary collections of gene alignments, clustering homologous and nonhomologous genes, and investigation of biological and functional correlates of evolutionary rates. PMID:19864470

  18. Sucralose Induces Biochemical Responses in Daphnia magna

    PubMed Central

    Eriksson Wiklund, Ann-Kristin; Adolfsson-Erici, Margaretha; Liewenborg, Birgitta; Gorokhova, Elena

    2014-01-01

    The intense artificial sweetener sucralose has no bioconcentration properties, and no adverse acute toxic effects have been observed in standard ecotoxicity tests, suggesting negligible environmental risk. However, significant feeding and behavioural alterations have been reported in non-standard tests using aquatic crustaceans, indicating possible sublethal effects. We hypothesized that these effects are related to alterations in acetylcholinesterase (AChE) and oxidative status in the exposed animals and investigated changes in AChE and oxidative biomarkers (oxygen radical absorbing capacity, ORAC, and lipid peroxidation, TBARS) in the crustacean Daphnia magna exposed to sucralose (0.0001–5 mg L−1). The sucralose concentration was a significant positive predictor for ORAC, TBARS and AChE in the daphnids. Moreover, the AChE response was linked to both oxidative biomarkers, with positive and negative relationships for TBARS and ORAC, respectively. These joint responses support our hypothesis and suggest that exposure to sucralose may induce neurological and oxidative mechanisms with potentially important consequences for animal behaviour and physiology. PMID:24699280

  19. Complete Genome Sequence of Finegoldia magna, an Anaerobic Opportunistic Pathogen

    PubMed Central

    Goto, Takatsugu; Yamashita, Atsushi; Hirakawa, Hideki; Matsutani, Minenosuke; Todo, Kozo; Ohshima, Kenshiro; Toh, Hidehiro; Miyamoto, Kazuaki; Kuhara, Satoru; Hattori, Masahira; Shimizu, Tohru; Akimoto, Shigeru

    2008-01-01

    Finegoldia magna (formerly Peptostreptococcus magnus), a member of the Gram-positive anaerobic cocci (GPAC), is a commensal bacterium colonizing human skin and mucous membranes. Moreover, it is also recognized as an opportunistic pathogen responsible for various infectious diseases. Here, we report the complete genome sequence of F. magna ATCC 29328. The genome consists of a 1 797 577 bp circular chromosome and an 189 163 bp plasmid (pPEP1). The metabolic maps constructed based on the genome information confirmed that most F. magna strains cannot ferment most sugars, except fructose, and have various aminopeptidase activities. Three homologs of albumin-binding protein, a known virulence factor useful for antiphagocytosis, are encoded on the chromosome, and one albumin-binding protein homolog is encoded on the plasmid. A unique feature of the genome is that F. magna encodes many sortase genes, of which substrates may be involved in bacterial pathogenesis, such as antiphagocytosis and adherence to the host cell. The plasmid pPEP1 encodes seven sortase and seven substrate genes, whereas the chromosome encodes four sortase and 19 substrate genes. These plasmid-encoded sortases may play important roles in the pathogenesis of F. magna by enriching the variety of cell wall anchored surface proteins. PMID:18263572

  20. Vulnerabilities of fingerprint reader to fake fingerprints attacks.

    PubMed

    Espinoza, Marcela; Champod, Christophe; Margot, Pierre

    2011-01-30

    The purpose of this research is to assess the vulnerabilities of a high resolution fingerprint sensor when confronted with fake fingerprints. The study has not been focused on the decision outcome of the biometric device, but essentially on the scores obtained following the comparison between a query (genuine or fake) and a template using an AFIS system. To do this, fake fingerprints of 12 subjects have been produced with and without their cooperation. These fake fingerprints have been used alongside with real fingers. The study led to three major observations: First, genuine fingerprints produced scores higher than fake fingers (translating a closer proximity) and this tendency is observed considering each subject separately. Second, scores are however not sufficient as a single measure to differentiate these samples (fake from genuine) given the variation due to the donors themselves. That explains why fingerprint readers without vitality detection can be fooled. Third, production methods and subjects greatly influence the scores obtained for fake fingerprints.

  1. Evaluation of Daphnia Magna Neonate Viability under Low Temperature Exposure Conditions

    DTIC Science & Technology

    2007-01-25

    code) Evaluation of Daphnia magna Neonate Viability under Low Temperature Exposure Conditions Prepared For: United States Army...LIST OF ATTACHMENTS ATTACHMENT I DAPHNIA MAGNA 21-DAY REPRODUCTION TEST DATA – FIRST SERIES (JULY 28, 2006 - AUGUST 18, 2006...I ATTACHMENT II DAPHNIA MAGNA 21-DAY REPRODUCTION TEST DATA – SECOND SERIES (SEPTEMBER 19, 2006 - OCTOBER 21, 2006) ....II

  2. Development of a Daphnia magna DNA microarray for evaluating the toxicity of environmental chemicals.

    PubMed

    Watanabe, Hajime; Takahashi, Eri; Nakamura, Yuko; Oda, Shigeto; Tatarazako, Norihisa; Iguchi, Taisen

    2007-04-01

    Toxic chemical contaminants have a variety of detrimental effects on various species, and the impact of pollutants on ecosystems has become an urgent issue. However, the majority of studies regarding the effects of chemical contaminants have focused on vertebrates. Among aquatic organisms, Daphnia magna has been used extensively to evaluate organism- and population-level responses of invertebrates to pollutants in acute toxicity or reproductive toxicity tests. Although these types of tests can provide information concerning hazardous concentrations of chemicals, they provide no information about their mode of action. Recent advances in molecular genetic techniques have provided tools to better understand the responses of aquatic organisms to pollutants. In the present study, we adapted some of the techniques of molecular genetics to develop new tools, which form the basis for an ecotoxicogenomic assessment of D. magna. Based on a Daphnia expressed sequence tag database, we developed an oligonucleotide-based DNA microarray with high reproducibility. The DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to several different chemicals: Copper sulfate, hydrogen peroxide, pentachlorophenol, or beta-naphthoflavone. Exposure to these chemicals resulted in characteristic patterns of gene expression that were chemical-specific, indicating that the Daphnia DNA microarray can be used for classification of toxic chemicals and for development of a mechanistic understanding of chemical toxicity on a common freshwater organism.

  3. Antineoplastic Agents 553. The Texas Grasshopper Brachystola magna1

    PubMed Central

    Pettit, George R.; Meng, Yanhui; Herald, Delbert L.; Knight, John C.; Day, John F.

    2011-01-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) -guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2) and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis (a.k.a. Pancratium littorale Jacq) and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study a crystal of pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1–3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed. PMID:16124772

  4. Antineoplastic agents. 553. The Texas grasshopper Brachystola magna.

    PubMed

    Pettit, George R; Meng, Yanhui; Herald, Delbert L; Knight, John C; Day, John F

    2005-08-01

    Bioassay (P388 lymphocytic leukemia cell line and human cancer cell lines) guided separation of an extract prepared from the previously chemically uninvestigated Texas grasshopper Brachystola magna led to isolation of the cancer cell growth inhibitory pancratistatin (1), narciclasine (2), and ungeremine (3). Pancratistatin (1) was first isolated from the bulbs of Hymenocallis littoralis), and the original crystal structure was deduced by X-ray analysis of a monomethyl ether derivative. In the present study pancratistatin (1) was isolated from an extract of B. magna, which led to the X-ray crystal structure of this anticancer drug. Since isoquinoline derivatives 1-3 are previously known only as constituents of amaryllidaceous plants, some of the interesting implications of their rediscovery in the grasshopper B. magna that does not appear to utilize amaryllis family plants were discussed.

  5. Fossa navicularis magna detection on cone-beam computed tomography

    PubMed Central

    Mupparapu, Mel

    2016-01-01

    Herein, we report and discuss the detection of fossa navicularis magna, a close radiographic anatomic variant of canalis basilaris medianus of the basiocciput, as an incidental finding in cone-beam computed tomography (CBCT) imaging. The CBCT data of the patients in question were referred for the evaluation of implant sites and to rule out pathology in the maxilla and mandible. CBCT analysis showed osseous, notch-like defects on the inferior aspect of the clivus in all four cases. The appearance of fossa navicularis magna varied among the cases. In some, it was completely within the basiocciput and mimicked a small rounded, corticated, lytic defect, whereas it appeared as a notch in others. Fossa navicularis magna is an anatomical variant that occurs on the inferior aspect of the clivus. The pertinent literature on the anatomical variations occurring in this region was reviewed. PMID:27051639

  6. Medical-biological aspects of radiation effects in Daphnia magna

    NASA Astrophysics Data System (ADS)

    Sarapultseva, E.; Uskalova, D.; Savina, N.; Ustenko, K.

    2017-01-01

    We have shown that γ-irradiation at doses of 100 and 1000 mGy significantly compromised fecundity and reproductive success of the directly exposed D. magna. These effects were also observed among the non-exposed first-generation progeny of irradiated parents, thus implying the manifestation of transgenerational effects in Daphnia. We have also shown that compromised viability of irradiated D. magna can be attributed cytotoxic effects of irradiation. It would therefore appear that the compromised viability may be attributed to the cytotoxic effects resulted from epigenetic changes affecting some metabolic pathways involved in detoxification of free-radicals. Additionally we have analyzed more distant progeny of irradiated at doses of 10, 100 and 1000 mGy Daphnia. Our data demonstrated that multicellular crustacean D. magna represent a very useful experimental model for analyse of long-term effects of ionising radiation at the organismal level.

  7. SMALL SCALE MASS CULTURE OF DAPHNIA MAGNA STRAUS

    SciTech Connect

    Rees, John T.; Oldfather, Joan M.

    1980-03-01

    Daphnia magna Straus 1820 was reared on a defined medium in 4-liter flasks under controlled conditions of light, temperature and species of algal food. Adult D. magna were found to be tolerant to high levels of ammonia, up to 108 {micro}M, at high pH (>10), although parthenogenic reproduction may be inhibited at these high levels. Scenedesmus quadricauda and Ankistrodesmus sp. were found to be satisfactory food sources. Densities of greater than one animal per ml in culture were attained utilizing Ankistrodesmus sp. as a food source at a pH of 7.7. Maintenance of pH at around 7-8 appears to be important to successful D. magna culture.

  8. DNA-based molecular fingerprinting of eukaryotic protists and cyanobacteria contributing to sinking particle flux at the Bermuda Atlantic time-series study

    NASA Astrophysics Data System (ADS)

    Amacher, Jessica; Neuer, Susanne; Lomas, Michael

    2013-09-01

    We used denaturing gradient gel electrophoresis (DGGE) to examine the protist and cyanobacterial communities in the euphotic zone (0-120 m) and in corresponding 150 m particle interceptor traps at the Bermuda Atlantic Time-series Study (BATS) in a two-year monthly time-series from May 2008 to April 2010. Dinoflagellates were the most commonly detected taxa in both water column and trap samples throughout the time series. Diatom sequences were found only eight times in the water column, and only four times in trap material. Small-sized eukaryotic taxa, including the prasinophyte genera Ostreococcus, Micromonas, and Bathycoccus, were present in trap samples, as were the cyanobacteria Prochlorococcus and Synechococcus. Synechococcus was usually overrepresented in trap material, whereas Prochlorococcus was underrepresented compared to the water column. Both seasonal and temporal variability affected patterns of ribosomal DNA found in sediment traps. The two years of this study were quite different hydrographically, with higher storm activity and the passing of a cyclonic eddy causing unusually deep mixing in winter 2010. This was reflected in the DGGE fingerprints of the water column, which showed greater phylotype richness of eukaryotes and a lesser richness of cyanobacteria in winter of 2010 compared with the winter of 2009. Increases in eukaryotic richness could be traced to increased diversity of prasinophytes and prymnesiophytes. The decrease in cyanobacterial richness was in turn reflected in the trap composition, but the increase in eukaryotes was not, indicating a disproportionate contribution of certain taxa to sinking particle flux.

  9. Multigenerational effects of carbendazim in Daphnia magna.

    PubMed

    Silva, Ana Rita R; Cardoso, Diogo N; Cruz, Andreia; Pestana, João L T; Mendo, Sónia; Soares, Amadeu M V M; Loureiro, Susana

    2017-02-01

    Carbendazim is a fungicide largely used in agriculture as a plant protection product. As a result of agricultural runoffs, drainage, and leaching, it reaches surface waters at concentrations possibly hazardous to aquatic communities. Because of potential and continuous release of carbendazim to aquatic systems, long-term exposure to aquatic organisms should be addressed. To fill the knowledge gap, the present study evaluated the responses of multiple generations of Daphnia magna (clone K6) to an environmentally relevant concentration of carbendazim (5 μg/L). Twelve successive generations were evaluated, and the effects in these offspring were compared with those from a control population. Neonates' fitness was assessed through immobilization, reproduction, and feeding activity tests, along with the comet assay for in vivo DNA damage evaluation. Recovery from long-term exposure was also assessed. In the F5 generation, the results revealed that when daphnids were re-exposed to carbendazim, DNA damage was higher in daphnids continuously exposed to carbendazim than those from clean medium. After daphnids were moved to a clean medium, a low recovery potential was observed for DNA damage. Daphnids exposed continuously for 6 generations (F6) to carbendazim displayed an increase in feeding rates when re-exposed to carbendazim compared with F6 daphnids reared in clean medium. Continuous exposure of daphnids to carbendazim induced a significant increase in DNA damage from the F0 to the F12 generation. Deleterious effects of the multigenerational exposure to carbendazim were more prominent at a subcellular level (DNA damage) compared with the individual level. Environ Toxicol Chem 2017;36:383-394. © 2016 SETAC.

  10. Chronic toxicity of 14 phthalate esters to Daphnia magna and rainbow trout (Oncorhynchus mykiss)

    SciTech Connect

    Rhodes, J.E.; Adams, W.J.; Biddinger, G.R.; Robillard, K.A.; Gorsuch, J.W.

    1995-11-01

    Chronic toxicity studies were performed with commercial phthalate esters and Daphnia magna (14 phthalates) and rainbow trout (Oncorhynchus mykiss) (six phthalates). For the lower-molecular-weight phthalate esters--dimethyl phthalate (DMP), diethyl phthalate (DEP), di-n-butyl phthalate (DBP), and butylbenzyl phthalate (BBP)--the results of the studies indicated a general trend in which toxicity for both species increased as water solubility decreased. The geometric mean maximum acceptable toxicant concentration(GM-MATC) for D. magna ranged from 0.63 to 34.8 mg/L. For the higher-molecular-weight phthalate esters--dihexyl phthalate (DHP), butyl 2-ethylhexyl phthalate (BOP), di-(n-hexyl, n-octyl, n-decyl) phthalate (610P), di-(2-ethylhexyl) phthalate (DEHP), diisooctyl phthalate (DIOP), diisononyl phthalate (DINP), di-(heptyl, nonyl, undecyl) phthalate (711P), diisodecyl phthalate (DIDP), diundecyl phthalate (DUP), and ditridecyl phthalate (DTDP)--the GM-MATC values ranged from 0.042 to 0.15 mg/L. Survival was equally sensitive and sometimes more sensitive than reproduction. The observed toxicity to daphnids with most of the higher-molecular-weight phthalate esters appeared to be due to surface entrapment or a mode of toxicity that is not due to exposure to dissolved aqueous-phase chemical. Early life-stage toxicity studies with rainbow trout indicated that survival (DMP) and growth (DBP) were affected at 24 and 0.19 mg/L, respectively. This pattern of observed toxicity with the lower-molecular-weight phthalate esters and not the higher-molecular-weight phthalate esters is consistent with previously reported acute toxicity studies for several aquatic species.

  11. Distribution of Virulence Factors and Molecular Fingerprinting of Aeromonas Species Isolates from Water and Clinical Samples: Suggestive Evidence of Water-to-Human Transmission ▿ †

    PubMed Central

    Khajanchi, Bijay K.; Fadl, Amin A.; Borchardt, Mark A.; Berg, Richard L.; Horneman, Amy J.; Stemper, Mary E.; Joseph, Sam W.; Moyer, Nelson P.; Sha, Jian; Chopra, Ashok K.

    2010-01-01

    A total of 227 isolates of Aeromonas obtained from different geographical locations in the United States and different parts of the world, including 28 reference strains, were analyzed to determine the presence of various virulence factors. These isolates were also fingerprinted using biochemical identification and pulse-field gel electrophoresis (PFGE). Of these 227 isolates, 199 that were collected from water and clinical samples belonged to three major groups or complexes, namely, the A. hydrophila group, the A. caviae-A. media group, and the A. veronii-A. sobria group, based on biochemical profiles, and they had various pulsotypes. When virulence factor activities were examined, Aeromonas isolates obtained from clinical sources had higher cytotoxic activities than isolates obtained from water sources for all three Aeromonas species groups. Likewise, the production of quorum-sensing signaling molecules, such as N-acyl homoserine lactone, was greater in clinical isolates than in isolates from water for the A. caviae-A. media and A. hydrophila groups. Based on colony blot DNA hybridization, the heat-labile cytotonic enterotoxin gene and the DNA adenosine methyltransferase gene were more prevalent in clinical isolates than in water isolates for all three Aeromonas groups. Using colony blot DNA hybridization and PFGE, we obtained three sets of water and clinical isolates that had the same virulence signature and had indistinguishable PFGE patterns. In addition, all of these isolates belonged to the A. caviae-A. media group. The findings of the present study provide the first suggestive evidence of successful colonization and infection by particular strains of certain Aeromonas species after transmission from water to humans. PMID:20154106

  12. Application of DNA fingerprinting in medicolegal practice.

    PubMed

    Raina, Anupuma; Dogra, T D

    2002-12-01

    Fingerprinting is thought to establish the identify of an individual in forensic cases. The technique is extensively used for forensic purposes. Deoxyribonucleic acid (DNA) is the vehicle of generational transference of heritable unit. While arching markers for genetic disease professor Alec Jeffreys discovered that certain regions of DNA showed variations in the number of tandem repeats known as variable number of tandem repeats (VNTRs). Thus DNA fingerprint was named by observing the number of repeated sequences which differ from individual to individual. The structure of DNA is quite flexible, within the nucleus of each cell resides an identical copy of the individual's genetic material, DNA. The coding regions of the genomic DNA are known as genes. The DNA fingerprinting in forensic science has generated considerable excitement in the criminal justice community. DNA fingerprinting can be applied to identify an individual in criminal and civil cases. Polymerase chain reaction has revolutionised molecular biology it has an ability to amplify (usually fewer than 3000 bp) a particular sequence of DNA into million of copies in a very short period. Consequently only a very tiny amount of an organism's DNA needs to be available originally. This property of polymerase chain reaction has enabled to analyse many forensic samples particularly which are degraded. Microsatellite DNA or commonly as short tandem repeats are scattered throughout the human genome and occur on an average of every 10,000 nucleotides. Microsatellite markers are considered to be the most powerful genetic markers. Collection, preservation and handling are the integral part of DNA fingerprinting analysis. There are various methods to isolate DNA from different biological materials but presently most of the laboratories prefer using FTA paper. The age of humans can be estimated by using DNA based on telomere shortening.

  13. Quantifying the fingerprint descriptor dependence of structure-activity relationship information on a large scale.

    PubMed

    Dimova, Dilyana; Stumpfe, Dagmar; Bajorath, Jürgen

    2013-09-23

    It is well-known that different molecular representations, e.g., graphs, numerical descriptors, fingerprints, or 3D models, change the numerical results of molecular similarity calculations. Because the assessment of structure-activity relationships (SARs) requires similarity and potency comparisons of active compounds, this representation dependence inevitably also affects SAR analysis. But to what extent? How exactly does SAR information change when alternative fingerprints are used as descriptors? What is the proportion of active compounds with substantial changes in SAR information induced by different fingerprints? To provide answers to these questions, we have quantified changes in SAR information across many different compound classes using six different fingerprints. SAR profiling was carried out on 128 target-based data sets comprising more than 60,000 compounds with high-confidence activity annotations. A numerical measure of SAR discontinuity was applied to assess SAR information on a per compound basis. For ~70% of all test compounds, changes in SAR characteristics were detected when different fingerprints were used as molecular representations. Moreover, the SAR phenotype of ~30% of the compounds changed, and distinct fingerprint-dependent local SAR environments were detected. The fingerprints we compared were found to generate SAR models that were essentially not comparable. Atom environment and pharmacophore fingerprints produced the largest differences in compound-associated SAR information. Taken together, the results of our systematic analysis reveal larger fingerprint-dependent changes in compound-associated SAR information than would have been anticipated.

  14. Parasitism drives host genome evolution: Insights from the Pasteuria ramosa-Daphnia magna system.

    PubMed

    Bourgeois, Yann; Roulin, Anne C; Müller, Kristina; Ebert, Dieter

    2017-02-23

    Because parasitism is thought to play a major role in shaping host genomes, it has been predicted that genomic regions associated with resistance to parasites should stand out in genome scans, revealing signals of selection above the genomic background. To test whether parasitism is indeed such a major factor in host evolution and to better understand host-parasite interaction at the molecular level, we studied genome-wide polymorphisms in 97 genotypes of the planktonic crustacean Daphnia magna originating from three localities across Europe. Daphnia magna is known to coevolve with the bacterial pathogen Pasteuria ramosa for which host genotypes (clonal lines) are either resistant or susceptible. Using association mapping, we identified two genomic regions involved in resistance to P. ramosa, one of which was already known from a previous QTL analysis. We then performed a naïve genome scan to test for signatures of positive selection and found that the two regions identified with the association mapping further stood out as outliers. Several other regions with evidence for selection were also found, but no link between these regions and phenotypic variation could be established. Our results are consistent with the hypothesis that parasitism is driving host genome evolution.

  15. Fingerprinting of Materials

    NASA Technical Reports Server (NTRS)

    Workman, Gary L

    1992-01-01

    Recent issues emerging in our fiscal and ecological environments have promulgated that federal agencies shall promote activities which respond to the improvement of both. In response to these developments, the National Aeronautics and Space Administration (NASA) has undertaken an innovative approach to improve the control of materials used in all NASA manufacturing activities. In concert with this goal, NASA is requiring that its contractors and their sub-contractors perform a more intensive consolidation of technologies that can provide an accounting of materials, which includes in-coming materials, materials in process, end-products and waste materials. The purpose of this handbook is to provide guidelines to NASA and its contractor personnel for the planning and implementation of chemical fingerprinting programs and to illustrate the chemical and statistical fundamentals needed for successful use of chemical fingerprinting.

  16. Fingerprints in the Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    [figure removed for brevity, see original site] Figure 1

    This graph, or spectrum, shows the light from a dusty, distant galaxy located 11 billion light-years away. The galaxy is invisible to optical telescopes, but NASA's Spitzer Space Telescope was able to capture the light from it and dozens of other similar galaxies using heat-seeking infrared eyes.

    Spectra are created when an instrument called a spectrograph spreads light out into its basic parts, like a prism turning sunlight into a rainbow. They contain the signatures, or 'fingerprints,' of molecules that contribute to an object's light.

    In this case, the galaxy's spectrum reveals the fingerprint for silicate dust (large dip at right), a planetary building block like sand, only smaller. This particular fingerprint is important because it helped astronomers determine how far away the galaxy lies, or more specifically, how much the galaxy's light had stretched, or 'redshifted,' during its journey to Spitzer's eyes. Because the universe is expanding, a galaxy's light will shift toward reddish wavelengths as it moves away from us. This galaxy was found to have a redshift of 1.95, which means that its light took about 11 billion years to get here.

    The presence of the silicate fingerprint is also significant because it implies that galaxies were ripe for planetary formation 11 billion years ago - back to a time when the universe was 3 billion years old. The universe is currently believed to be 13.5 billion years old. This is the furthest back in time that silicate dust has been detected around a galaxy.

    These data were taken by Spitzer's infrared spectrograph in July, 2004.

  17. Probing with and into fingerprints.

    PubMed

    Dahiya, Ravinder S; Gori, Monica

    2010-07-01

    A recent report by Scheibert et al. highlights the role of fingerprints in enhancing tactile sensitivity. By scanning a surface with a biometric force sensor they demonstrate the dominance of the frequencies that fall within the optimal sensitivity range of Pacinian afferents. The sensor, in this study, has a soft cover patterned with parallel ridges-mimicking the fingerprints. However, the skin structure is quite complex. Elasticity of the skin varies with depth and the ridge like pattern is comprised of not just papillary ridges or fingerprints. Besides fingerprints there exist intermediate ridges, positioned exactly under the papillary ridges, and limiting ridges at dermis-epidermis junction. These structures are usually considered as single unit. If so, it is important to revisit and see if the role of fingerprints remains the same, should the sensor cover have both fingerprints and intermediate ridges.

  18. Postoperative Mediastinitis Due to Finegoldia magna with Negative Blood Cultures▿

    PubMed Central

    Kernéis, Solen; Matta, Matta; Hoï, Annie Buu; Podglajen, Isabelle; Gutmann, Laurent; Novara, Ana; Latremouille, Christian; Mainardi, Jean-Luc

    2009-01-01

    We report a case of Finegoldia magna (formerly known as Peptostreptococcus magnus) mediastinitis following coronary artery bypass in a 50-year-old patient. Even if staphylococci remain the main causative organism of postoperative mediastinitis, the responsibility of anaerobic bacteria must be considered in cases of fever and sternal drainage with negative blood cultures. PMID:19812272

  19. Magna Carta: Teaching Medieval Topics for Historical Significance

    ERIC Educational Resources Information Center

    Metzger, Scott Alan

    2010-01-01

    The Middle Ages are an immensely important era in the Western experience. Unfortunately, medieval studies are often marginalized or trivialized in school curriculum. With the approach of the 800th anniversary of Magna Carta, the famous charter of rights from medieval England, one has a timely and useful example for considering what a focus on…

  20. The heart of Daphnia magna: effects of four cardioactive drugs.

    PubMed

    Villegas-Navarro, Arturo; Rosas-L, Esperanza; Reyes, José L

    2003-10-01

    We used Daphnia magna bioassays to determine the LC(50) and the effects on the heart of the cardioactive drugs ouabain, verapamil, metaproterenol and metoprolol. Distinctions were made between the pharmacological and toxicological effects of these drugs and the adequacy of physicochemical characteristics of its habitat (reconstituted water). Video microscopy and digital image processing were used to study the pharmacological effects on the heart. D. magna exhibited the expected sensitivity to the reference toxicant sodium dodecyl sulfate with a LC(50) of 15.6+/-4.5 mg/l. All drugs were toxic with 48 h-LC(50) of 2.03 mg/l ouabain, 7.04 mg/l verapamil, 32.45 mg/l metaproterenol and 76.21 mg/l metoprolol. Ouabain was the most toxic and caused a positive concentration-dependent inotropic effect. Verapamil caused positive chronotropic and inotropic effects, while metaproterenol showed positive concentration-dependent chronotropic effects at high concentrations (10(-3) and 10(-4) M). Metoprolol induced a positive chronotropic effect at low concentrations (10(-8), 10(-7), 10(-6) M) and a negative chronotropic effect at high concentration (10(-4) M). Ouabain, metaproterenol and metoprolol in D. magna caused similar effects to those produced in mammals. In contrast, verapamil caused opposite effects. The results suggest the presence of Na(+), K(+)-ATPase receptors to verapamil and of non-specific adrenergic receptors in heart of D. magna.

  1. Magna Carta at 800: Ten Key Questions Answered

    ERIC Educational Resources Information Center

    Kaplan, Howard

    2014-01-01

    2015 marks the 800th anniversary of Magna Carta. For Americans, this iconic document is a formative element of our own legal and political heritage. This "Lessons on the Law" column offers an overview of the "Great Charter," why it is significant, and what students and teachers should know about it. The article also highlights…

  2. Hereditary nodular heterotopia accompanied by mega cisterna magna.

    PubMed

    Oda, T; Nagai, Y; Fujimoto, S; Sobajima, H; Kobayashi, M; Togari, H; Wada, Y

    1993-08-15

    This is the first report of hereditary nodular heterotopia accompanied by mega cisterna magna. Magnetic resonance imaging documented multiple bilateral subependymal nodules, which were isointense to gray matter. This disease entity is considered a dominant trait, since the mother and two daughters, half-sisters, were affected.

  3. Acute toxicity of benzophenone-type UV filters for Photobacterium phosphoreum and Daphnia magna: QSAR analysis, interspecies relationship and integrated assessment.

    PubMed

    Liu, Hui; Sun, Ping; Liu, Hongxia; Yang, Shaogui; Wang, Liansheng; Wang, Zunyao

    2015-09-01

    The hazardous potential of benzophenone (BP)-type UV filters is becoming an issue of great concern due to the wide application of these compounds in many personal care products. In the present study, the toxicities of BPs to Photobacterium phosphoreum and Daphnia magna were determined. Next, density functional theory (DFT) and comparative molecular field analysis (CoMFA) descriptors were used to obtain more detailed insight into the structure - activity relationships and to preliminarily discuss the toxicity mechanism. Additionally, the sensitivities of the two organisms to BPs and the interspecies toxicity relationship were compared. Moreover, an approach for providing a global index of the environmental risk of BPs to aquatic organisms is proposed. The results demonstrated that the mechanism underlying the toxicity of BPs to P. phosphoreum is primarily related to their electronic properties, and the mechanism of toxicity to D. magna is hydrophobicity. Additionally, D. magna was more sensitive than P. phosphoreum to most of the BPs, with the exceptions of the polyhydric BPs. Moreover, comparisons with published data revealed a high interspecies correlation coefficient among the experimental toxicity values for D. magna and Dugesia japonica. Furthermore, hydrophobicity was also found to be the most important descriptor of integrated toxicity. This investigation will provide insight into the toxicity mechanisms and useful information for assessing the potential ecological risk of BP-type UV filters.

  4. Fingerprinting of Materials: Technical Supplement

    NASA Technical Reports Server (NTRS)

    Workman, Gary L.

    1992-01-01

    This supplement to the Guidelines for Maintaining a Chemical Fingerprinting Program has been developed to assist NASA personnel, contractors, and sub-contractors in defining the technical aspects and basic concepts which can be used in chemical fingerprinting programs. This material is not meant to be totally inclusive to all chemical fingerprinting programs, but merely to present current concepts. Each program will be tailored to meet the needs of the individual organizations using chemical fingerprinting to improve their quality and reliability in the production of aerospace systems.

  5. Petroleum fingerprinting with organic markers

    USGS Publications Warehouse

    Hostettler, Frances D.; Lorenson, T.D.; Bekins, Barbara A.

    2013-01-01

    Petroleum fingerprinting is an invaluable tool in forensic geochemistry. This article summarizes applications of fingerprinting in several oil spills and natural oil seepages that we have studied during the last 25 years. It shows how each unique chemical fingerprint can be used to correlate or differentiate oils. Fingerprints can provide information about processes in the environment that impact oils such as weathering and microbial degradation. They can be used to evaluate organic matter that contributed to oils, and classify oils with regard to the geological framework of their source, such as evaluating geological facies, age, lithology, and depositional environment.

  6. Fascioloides magna--epizootiology in a deer farm in Germany.

    PubMed

    Plötz, Cornelia; Rehbein, Steffen; Bamler, Helmut; Reindl, Hubert; Pfister, Kurt; Scheuerle, Miriam C

    2015-01-01

    After initial observations of suspicious cases in 2009, the occurrence of Fascioloides (F.) magna in deer of a deer farm located in northeastern Bavaria, Germany, at the border to the Czech Republic was confirmed in autumn 2011. In March 2012, the deer were treated for fascioloidosis with triclabendazole. To monitor the epizootiology of fascioloidosis in the farm, 80-100 faecal samples were examined for Fascioloides eggs at monthly intervals from June 2012 to June 2013 inclusive. In addition, livers of 27 red deer and one sika deer collected during winter 2012/2013 were examined for gross lesions suspicious for F. magna infection and 21 of the 28 livers were dissected for F. magna recovery. Fascioloides eggs were recorded in 63 (4.9%) of 1280 faecal samples (range 0.4 to 355 eggs per gram). Both, number of Fascioloides-egg positive samples and egg counts were low during the first eight months of the study but increased notably since February 2013. While Fascioloides egg-positive faecal samples were obtained from red deer (46/948,4.9%) and fallow deer (17/166, 10.2%), no Fascioloides eggs were demonstrated in the 166 samples obtained from sika deer. Livers of five red deer and the sika deer showed gross lesions characteristic for fascioloidosis, and F. magna were recovered from three of the five affected red deer livers (range, five to seven flukes). Results of this study confirm that F. magna is endemic in the deer farm, and measures should be implemented to minimize the transmission of the parasite.

  7. Effect of deltamethrin (pyrethroid insecticide) on two clones of Daphnia magna (Crustacea, Cladocera): a proteomic investigation.

    PubMed

    Toumi, Héla; Boumaiza, Moncef; Immel, Françoise; Sohm, Bénédicte; Felten, Vincent; Férard, Jean-François

    2014-03-01

    Deltamethrin is a class II pyrethroid insecticide commonly used in agriculture. It is hazardous to freshwater ecosystems, especially for the cladoceran Daphnia magna (Straus 1820). The results of our previous studies based on acute and chronic ecotoxicity experiments revealed differences in the sensitivity between two different clones. In this work, to investigate deltamethrin toxicity mechanisms in two clones of D. magna, we used a proteomic approach in order to analyze changes in protein expression profiles after 48 h of exposure. We detected 1339 spots; then applying statistical criteria (ANOVA p<0.001 and minimum fold change 1.5), only 128 spots were significantly different in the normalized volume. Among the preselected proteins there were 88 up-regulated and 40 down-regulated proteins. Results showed differences in sensitivities after deltamethrin exposure between the clones. Moreover, using the 2-DIGE method, proteomic investigation for deltamethrin exposure proved to be a reliable and powerful approach to investigate effects of deltamethrin as part of research for new metabolic and cellular biomarkers. After identification by mass spectrometry, there were 39 proteins recognized and identified, in which 21 and 18 were up- and down-regulated, respectively, in deltamethrin-exposed clone A compared to three other conditions (controls of each clone and deltamethrin-exposed clone 2). Up- and down-regulated proteins belonged to 12 biological processes (i.e. metabolic processes, apoptosis and stimulus response) and 5 molecular functions (i.e. catalytic activity, binding, structural molecular activity, antioxidant and receptor activities). Identification of these deregulated proteins opens a new way in discovering new molecular targets and putative biomarkers in daphnids exposed to deltamethrin.

  8. Wavelet Features Based Fingerprint Verification

    NASA Astrophysics Data System (ADS)

    Bagadi, Shweta U.; Thalange, Asha V.; Jain, Giridhar P.

    2010-11-01

    In this work; we present a automatic fingerprint identification system based on Level 3 features. Systems based only on minutiae features do not perform well for poor quality images. In practice, we often encounter extremely dry, wet fingerprint images with cuts, warts, etc. Due to such fingerprints, minutiae based systems show poor performance for real time authentication applications. To alleviate the problem of poor quality fingerprints, and to improve overall performance of the system, this paper proposes fingerprint verification based on wavelet statistical features & co-occurrence matrix features. The features include mean, standard deviation, energy, entropy, contrast, local homogeneity, cluster shade, cluster prominence, Information measure of correlation. In this method, matching can be done between the input image and the stored template without exhaustive search using the extracted feature. The wavelet transform based approach is better than the existing minutiae based method and it takes less response time and hence suitable for on-line verification, with high accuracy.

  9. One-qubit fingerprinting schemes

    SciTech Connect

    Beaudrap, J. Niel de

    2004-02-01

    Fingerprinting is a technique in communication complexity in which two parties (Alice and Bob) with large data sets send short messages to a third party (a referee), who attempts to compute some function of the larger data sets. For the equality function, the referee attempts to determine whether Alice's data and Bob's data are the same. In this paper, we consider the extreme scenario of performing fingerprinting where Alice and Bob both send either one bit (classically) or one qubit (in the quantum regime) messages to the referee for the equality problem. Restrictive bounds are demonstrated for the error probability of one-bit fingerprinting schemes, and show that it is easy to construct one-qubit fingerprinting schemes which can outperform any one-bit fingerprinting scheme. The author hopes that this analysis will provide results useful for performing physical experiments, which may help to advance implementations for more general quantum communication protocols.

  10. Accumulation of dieldrin in an alga (Scenedesmus obliquus), Daphnia magna, and the guppy (Poecilia reticulata)

    USGS Publications Warehouse

    Reinert, Robert E.

    1972-01-01

    Scenedesmus obliquus, Daphnia magna, and Poecilia reticulata accumulated dieldrin directly from water; average concentration factors (concentration in organism, dry weight, divided by concentration in water) were 1282 for the alga, 13,954 for D. magna, and 49,307 (estimated) for the guppy. The amount accumulated by each species at equilibrium (after about 1.5, 3-4, and 18 days, respectively) was directly proportional to the concentration of dieldrin in the water. Daphnia magna and guppies accumulated more dieldrin from water than from food that had been exposed to similar concentrations in water. When guppies were fed equal daily rations of D. magna containing different concentrations of insecticide, the amounts of dieldrin accumulated by the fish were directly proportional to the concentration in D. magna; when two lots of guppies were fed different quantities of D. magna (10 and 20 organisms per day) containing identical concentrations of dieldrin, however, the amounts accumulated did not differ substantially.

  11. Molecular characterization and fingerprinting of vanadyl porphyrin and non-porphyrin compounds in heavy crude petroleums using HPLC-GFAA analysis

    SciTech Connect

    Komlenic, J.J.; Vermeulen, T.; Fish, R.H.

    1982-12-01

    Element-specific high performance liquid chromatography-graphite furnace atomic absorption (HPLC-GFAA) analysis was used to classify vanadyl porphyrin and nonporphyrin compounds present in Boscan, Cerro Negro, Wilmington, and Prudhoe Bay heavy crude oils, containing 1100, 550, 49, and 19 ppM V. The crude oils and pyridine extraction products have been analyzed using the HPLC-GFAA technique with steric exclusion chromatography (SEC) and polar amino-cyano (PAC) columns to yield molecular weight and polarity distributions. 50% of the V present, in the form of low molecular weight vanadyl compounds, is extracted, primarily from the asphaltene fraction of each oil. HPLC-GFAA reveal two classes of extracted vanadyl nonporphyrin compounds. One class, present in Cerro Negro, Wilmington, and Prudhoe Bay pyrdine extract, consists of relatively nonpolar compound(s) with maximum uv-Vis absorbance at 300 nm. The other class, present in Boscan and Cerro Negro crude oils, consists of a more polar nonporphyrin compound(s) with maximum absorbance of 265 nm. The two Venezuelan, high sulfur crude oils contain proportionally greater percentages of vanadyl porphyrin compounds, while the two North American, low sulfur crude oils contain predominantly vanadyl nonporphyrin and nickel porphyrin compounds. A correlation relating V concentration and sulfur and asphaltene content has been observed, while correlations involving V content and depth of burial or age of deposit were not apparent. 21 figures, 5 tables.

  12. Interclonal proteomic responses to predator exposure in Daphnia magna may depend on predator composition of habitats.

    PubMed

    Otte, Kathrin A; Schrank, Isabella; Fröhlich, Thomas; Arnold, Georg J; Laforsch, Christian

    2015-08-01

    Phenotypic plasticity, the ability of one genotype to express different phenotypes in response to changing environmental conditions, is one of the most common phenomena characterizing the living world and is not only relevant for the ecology but also for the evolution of species. Daphnia, the water flea, is a textbook example for predator-induced phenotypic plastic defences; however, the analysis of molecular mechanisms underlying these inducible defences is still in its early stages. We exposed Daphnia magna to chemical cues of the predator Triops cancriformis to identify key processes underlying plastic defensive trait formation. To get a more comprehensive idea of this phenomenon, we studied four genotypes with five biological replicates each, originating from habitats characterized by different predator composition, ranging from predator-free habitats to habitats containing T. cancriformis. We analysed the morphologies as well as proteomes of predator-exposed and control animals. Three genotypes showed morphological changes when the predator was present. Using a high-throughput proteomics approach, we found 294 proteins which were significantly altered in their abundance after predator exposure in a general or genotype-dependent manner. Proteins connected to genotype-dependent responses were related to the cuticle, protein synthesis and calcium binding, whereas the yolk protein vitellogenin increased in abundance in all genotypes, indicating their involvement in a more general response. Furthermore, genotype-dependent responses at the proteome level were most distinct for the only genotype that shares its habitat with Triops. Altogether, our study provides new insights concerning genotype-dependent and general molecular processes involved in predator-induced phenotypic plasticity in D. magna.

  13. Chronic toxicity of biphenyl to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Bartlett, E.A.; Murphy, P.G.; Milazzo, D.P. )

    1989-09-01

    The US Environmental Protection Agency (EPA) issued a final test rule (1985) for biphenyl on the authority of Section 4(a) of the Toxic Substances Control Act (TSCA). Contained within this rule was the requirement for generating chronic daphnid toxicity data for biphenyl. Biphenyl is used primarily to produce dye carriers, heat-transfer fluids and alkylated biphenyls. The acute toxicity of biphenyl to Daphnia magna has been reported. The 48-hr LC50 values were 4.7 and 2.1 mg/L, respectively. To date, the chronic toxicity of biphenyl to fish and aquatic invertebrates has not been investigated. The objective of this study was to determine the chronic toxicity of biphenyl to D. magna. The daphnid chronic toxicity test is designed to estimate the maximum acceptable toxicant concentration (MATC). The MATC is defined as the concentration falling between the highest concentration showing no effect and the next higher concentration showing a toxic effect when compared to the controls.

  14. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    PubMed

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  15. Fluorescence fingerprints of Eisenia fetida and Eisenia andrei.

    PubMed

    Albani, J R; Demuynck, S; Grumiaux, F; Leprêtre, A

    2003-12-01

    We describe a fluorescent method that allows to differentiate the worms Eisenia fetida and Eisenia andrei. In fact, the coelomic fluid of E. andrei displays specific fluorescence absent in that of E. fetida. The two species do not metabolize the same types of molecules and thus can be differentiated at the molecular level. Each species has specific fluorescence fingerprints.

  16. Chapelieria magna, a new species of Rubiaceae from eastern Madagascar

    PubMed Central

    Kainulainen, Kent; Razafimandimbison, Sylvain G.

    2015-01-01

    Abstract A new species of Chapelieria was discovered during a recent field trip to the Masoala National Park in eastern Madagascar, and is described here as Chapelieria magna Kainul., sp. nov. This species is readily distinguishable from previously described species of the genus by its quadrangular shoots, triangular-calyptrate stipules, sessile leaves, pubescent styles, and ridged fruits. It also differs in the larger number of ovules and the much larger size of leaves and fruits. PMID:25698895

  17. Collaborative Study of Daphnia magna Static Renewal Assays.

    DTIC Science & Technology

    1986-01-01

    Report for Contract DAMD17-80-C-OO11, titled "Determination of the Toxicity to Aquatic Orarisms of HMX and Related Wastewater Constituents." The...identify by block number) Collaborative, interlaboratory, Daphnia magna, static renewal, copper. sodium pentachlorophenate, toxicity , 120. A(ITRAcr...identified to all collaborative laboratories. This material, sodium pentachlorophenate (NaPCP), served as the reference toxicant , and enabled the

  18. Acute toxicity and QSAR of chlorophenols on Daphnia magna

    SciTech Connect

    Devillers, J.; Chambon, P.

    1986-10-01

    Chlorophenols which are released into natural waters from various industrial processes and from agricultural uses have been recognized as a group of chemical substances potentially hazardous to the aquatic environment. Therefore it is important to estimate their toxic impact on biota. Thus, the scope of this research was to obtain acute toxicity data for seventeen chlorophenols towards Daphnia magna and to explore the possibilities of deriving QSAR's (quantitative structure-activity relationship) from the above values.

  19. Prediction of the Clinical Outcome in Invasive Candidiasis Patients Based on Molecular Fingerprints of Five Anti-Candida Antibodies in Serum*

    PubMed Central

    Pitarch, Aida; Nombela, César; Gil, Concha

    2011-01-01

    Better prognostic predictors for invasive candidiasis (IC) are needed to tailor and individualize therapeutic decision-making and minimize its high morbidity and mortality. We investigated whether molecular profiling of IgG-antibody response to the whole soluble Candida proteome could reveal a prognostic signature that may serve to devise a clinical-outcome prediction model for IC and contribute to known IC prognostic factors. By serological proteome analysis and data-mining procedures, serum 31-IgG antibody-reactivity patterns were examined in 45 IC patients randomly split into training and test sets. Within the training cohort, unsupervised two-way hierarchical clustering and principal-component analyses segregated IC patients into two antibody-reactivity subgroups with distinct prognoses that were unbiased by traditional IC prognostic factors and other patients-related variables. Supervised discriminant analysis with leave-one-out cross-validation identified a five-IgG antibody-reactivity signature as the most simplified and accurate IC clinical-outcome predictor, from which an IC prognosis score (ICPS) was derived. Its robustness was confirmed in the test set. Multivariate logistic-regression and receiver-operating-characteristic curve analyses demonstrated that the ICPS was able to accurately discriminate IC patients at high risk for death from those at low risk and outperformed conventional IC prognostic factors. Further validation of the five-IgG antibody-reactivity signature on a multiplexed immunoassay supported the serological proteome analysis results. The five IgG antibodies incorporated in the ICPS made biologic sense and were associated either with good-prognosis and protective patterns (those to Met6p, Hsp90p, and Pgk1p, putative Candida virulence factors and antiapoptotic mediators) or with poor-prognosis and risk patterns (those to Ssb1p and Gap1p/Tdh3p, potential Candida proapoptotic mediators). We conclude that the ICPS, with additional

  20. Acute toxicity of 50 metals to Daphnia magna.

    PubMed

    Okamoto, Akira; Yamamuro, Masumi; Tatarazako, Norihisa

    2015-07-01

    Metals are essential for human life and physiological functions but may sometimes cause disorders. Therefore, we conducted acute toxicity testing of 50 metals in Daphnia magna: EC50s of seven elements (Be, Cu, Ag, Cd, Os, Au and Hg) were < 100 µg l(-1) ; EC50s of 13 elements (Al, Sc, Cr, Co, Ni, Zn, Se, Rb, Y, Rh, Pt, Tl and Pb) were between 100 and 1000 µg l(-1) ; EC50s of 14 elements (Li, V, Mn, Fe, Ge, As, In, Sn, Sb, Te, Cs, Ba, W and Ir) were between 1,001 and 100,000 µg l(-1) ; EC50s of six elements (Na, Mg, K, Ca, Sr and Mo) were > 100,000 µg l(-1) ; and. 7 elements (Ti, Zr, Bi, Nb, Hf, Re and Ta) did not show EC50 at the upper limit of respective aqueous solubility, and EC50s were not obtained. Ga, Ru and Pd adhered to the body of D. magna and physically retarded the movement of D. magna. These metals formed hydroxides after adjusting the pH. Therefore, here, we distinguished this physical effect from the physiological toxic effect. The acute toxicity results of 40 elements obtained in this study were not correlated with electronegativity. Similarly, the acute toxicity results of metals including the rare metals were also not correlated with first ionization energy, atomic weight, atomic number, covalent radius, atomic radius or ionic radius.

  1. CRISPR/Cas-mediated targeted mutagenesis in Daphnia magna.

    PubMed

    Nakanishi, Takashi; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2014-01-01

    The water flea Daphnia magna has been used as an animal model in ecology, evolution, and environmental sciences. Thanks to the recent progress in Daphnia genomics, genetic information such as the draft genome sequence and expressed sequence tags (ESTs) is now available. To investigate the relationship between phenotypes and the available genetic information about Daphnia, some gene manipulation methods have been developed. However, a technique to induce targeted mutagenesis into Daphnia genome remains elusive. To overcome this problem, we focused on an emerging genome editing technique mediated by the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas) system to introduce genomic mutations. In this study, we targeted a functionally conserved regulator of eye development, the eyeless gene in D. magna. When we injected Cas9 mRNAs and eyeless-targeting guide RNAs into eggs, 18-47% of the survived juveniles exhibited abnormal eye morphology. After maturation, up to 8.2% of the adults produced progenies with deformed eyes, which carried mutations in the eyeless loci. These results showed that CRISPR/Cas system could introduce heritable mutations into the endogenous eyeless gene in D. magna. This is the first report of a targeted gene knockout technique in Daphnia and will be useful in uncovering Daphnia gene functions.

  2. Increasing toxicity of enrofloxacin over four generations of Daphnia magna.

    PubMed

    Dalla Bona, Mirco; Lizzi, Francesca; Borgato, Arianna; De Liguoro, Marco

    2016-10-01

    The effects of both continuous and alternate exposure to 2mgL(-1) of enrofloxacin (EFX) on survival, growth and reproduction were evaluated over four generations of Daphnia magna. Mortality increased, reaching 100% in most groups by the end of the third generation. Growth inhibition was detected in only one group of the fourth generation. Reproduction inhibition was >50% in all groups and, in second and third generations, groups transferred to pure medium showed a greater inhibition of reproduction than those exposed to EFX. To verify whether the effects observed in these groups could be explained by the perinatal exposure to the antibacterial, a reproduction test with daphnids obtained from in vitro exposed D. magna embryos was also carried out. Perinatal exposure to EFX seemed to act as an 'all-or-nothing' toxicity effect as 31.4% of embryos died, but the surviving daphnids did not show any inhibition of reproduction activity. However, the embryonic mortality may at least partially justify the inhibition of reproduction observed in exposed groups along the multigenerational test. Concluding, the multigenerational test with D. magna did show disruption to a population that cannot be evidenced by the official tests. The increasing deterioration across generations might be inferred as the consequence of heritable alterations. Whilst the concentration tested was higher than those usually detected in the natural environment, the increasing toxicity of EFX across generations and the possible additive toxicity of fluoroquinolone mixtures, prevent harm to crustacean populations by effects in the real context from being completely ruled out.

  3. Acute and chronic toxicity of veterinary antibiotics to Daphnia magna.

    PubMed

    Wollenberger, L; Halling-Sørensen, B; Kusk, K O

    2000-04-01

    The acute and chronic toxicity of nine antibiotics used both therapeutically and as growth promoters in intensive farming was investigated on the freshwater crustacean Daphnia magna. The effect of the antibiotics metronidazole (M), olaquindox (OL), oxolinic acid (OA), oxytetracycline (OTC), streptomycin (ST), sulfadiazine (SU), tetracycline (TC), tiamulin (TI) and tylosin (TY) was tested in accordance to the ISO (1989) and OECD (1996) standard procedures. The acute toxicities (48-h EC50 value, mg/l) in decreasing order were OA (4.6), TI (40), SU (221), ST (487), TY (680) and OTC (approximately 1000). NOECs were 340 mg/l for TC and 1000 mg/l for M and OL. Toxic effect on reproduction occurred generally at concentrations, which were one order of magnitude below the acute toxic levels. The chronic toxicity (EC50 values, mg/l) in the D. magna reproduction test in decreasing order were TI (5.4), SU (13.7), TC (44.8) and OTC (46.2). The NOECs (mg/l) obtained in the reproduction test with OA, ST, TY and M were 0.38 for OA, 32 for ST, 45 for TY and 250 for M. The observed toxicity of OA to D. magna indicates that this substance, which is a commonly used feed additive in fish farms, has a potential to cause adverse effects on the aquatic environment.

  4. Video-based fingerprint verification.

    PubMed

    Qin, Wei; Yin, Yilong; Liu, Lili

    2013-09-04

    Conventional fingerprint verification systems use only static information. In this paper, fingerprint videos, which contain dynamic information, are utilized for verification. Fingerprint videos are acquired by the same capture device that acquires conventional fingerprint images, and the user experience of providing a fingerprint video is the same as that of providing a single impression. After preprocessing and aligning processes, "inside similarity" and "outside similarity" are defined and calculated to take advantage of both dynamic and static information contained in fingerprint videos. Match scores between two matching fingerprint videos are then calculated by combining the two kinds of similarity. Experimental results show that the proposed video-based method leads to a relative reduction of 60 percent in the equal error rate (EER) in comparison to the conventional single impression-based method. We also analyze the time complexity of our method when different combinations of strategies are used. Our method still outperforms the conventional method, even if both methods have the same time complexity. Finally, experimental results demonstrate that the proposed video-based method can lead to better accuracy than the multiple impressions fusion method, and the proposed method has a much lower false acceptance rate (FAR) when the false rejection rate (FRR) is quite low.

  5. Molecular fingerprinting by PCR-denaturing gradient gel electrophoresis reveals differences in the levels of microbial diversity for musty-earthy tainted corks.

    PubMed

    Prat, Chantal; Ruiz-Rueda, Olaya; Trias, Rosalia; Anticó, Enriqueta; Capone, Dimitra; Sefton, Mark; Bañeras, Lluís

    2009-04-01

    The microbial community structure of cork with marked musty-earthy aromas was analyzed using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Cork stoppers and discs were used for DNA extraction and were analyzed by using selective primers for bacteria and fungi. Stoppers clearly differed from discs harboring a different fungal community. Moreover, musty-earthy samples of both types were shown to have a specific microbiota. The fungi Penicillium glabrum and Neurospora spp. were present in all samples and were assumed to make only a small contribution to off-odor development. In contrast, Penicillium islandicum and Penicillium variabile were found almost exclusively in 2,4,6-trichloroanisole (TCA) tainted discs. Conversely, Rhodotorula minuta and Rhodotorula sloofiae were most common in cork stoppers, where only small amounts of TCA were detected. Alpha- and gammaproteobacteria were the most commonly found bacteria in either control or tainted cork stoppers. Specific Pseudomonas and Actinobacteria were detected in stoppers with low amounts of TCA and 2-methoxy-3,5-dimethylpyrazine. These results are discussed in terms of biological degradation of taint compounds by specific microorganisms. Reliable and straightforward microbial identification methods based on a molecular approach provided useful data to determine and evaluate the risk of taint formation in cork.

  6. Identification and molecular epidemiology of dermatophyte isolates by repetitive-sequence-PCR-based DNA fingerprinting using the DiversiLab system in Turkey.

    PubMed

    Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize

    2017-05-01

    Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR.

  7. Molecular Fingerprinting by PCR-Denaturing Gradient Gel Electrophoresis Reveals Differences in the Levels of Microbial Diversity for Musty-Earthy Tainted Corks ▿

    PubMed Central

    Prat, Chantal; Ruiz-Rueda, Olaya; Trias, Rosalia; Anticó, Enriqueta; Capone, Dimitra; Sefton, Mark; Bañeras, Lluís

    2009-01-01

    The microbial community structure of cork with marked musty-earthy aromas was analyzed using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Cork stoppers and discs were used for DNA extraction and were analyzed by using selective primers for bacteria and fungi. Stoppers clearly differed from discs harboring a different fungal community. Moreover, musty-earthy samples of both types were shown to have a specific microbiota. The fungi Penicillium glabrum and Neurospora spp. were present in all samples and were assumed to make only a small contribution to off-odor development. In contrast, Penicillium islandicum and Penicillium variabile were found almost exclusively in 2,4,6-trichloroanisole (TCA) tainted discs. Conversely, Rhodotorula minuta and Rhodotorula sloofiae were most common in cork stoppers, where only small amounts of TCA were detected. Alpha- and gammaproteobacteria were the most commonly found bacteria in either control or tainted cork stoppers. Specific Pseudomonas and Actinobacteria were detected in stoppers with low amounts of TCA and 2-methoxy-3,5-dimethylpyrazine. These results are discussed in terms of biological degradation of taint compounds by specific microorganisms. Reliable and straightforward microbial identification methods based on a molecular approach provided useful data to determine and evaluate the risk of taint formation in cork. PMID:19201983

  8. Influence of skin diseases on fingerprint recognition.

    PubMed

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described.

  9. Influence of Skin Diseases on Fingerprint Recognition

    PubMed Central

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  10. Fingerprinting dark energy

    SciTech Connect

    Sapone, Domenico; Kunz, Martin

    2009-10-15

    Dark energy perturbations are normally either neglected or else included in a purely numerical way, obscuring their dependence on underlying parameters like the equation of state or the sound speed. However, while many different explanations for the dark energy can have the same equation of state, they usually differ in their perturbations so that these provide a fingerprint for distinguishing between different models with the same equation of state. In this paper we derive simple yet accurate approximations that are able to characterize a specific class of models (encompassing most scalar-field models) which is often generically called 'dark energy'. We then use the approximate solutions to look at the impact of the dark energy perturbations on the dark matter power spectrum and on the integrated Sachs-Wolfe effect in the cosmic microwave background radiation.

  11. Phototoxic effects of titanium dioxide nanoparticles on Daphnia magna

    NASA Astrophysics Data System (ADS)

    Mansfield, Charles M.

    Titanium dioxide nanoparticles (TiO2-NP) are one of the most abundantly utilized nanomaterials in the world. Studies have demonstrated the mechanism of acute toxicity in TiO2-NP to be the production of reactive oxygen species (ROS) leading to oxidative stress and mortality in exposed organisms. It has also been demonstrated that the anatase crystalline conformation is capable of catalyzing the cleavage of water molecules to further increase the concentration of ROS in the presence of ultraviolet radiation. This photoenhanced toxicity significantly lowers the toxicity threshold of TiO2-NP to environmentally relevant concentrations (ppb). The goal of this study was to determine whether dietary uptake and accumulation of TiO2-NP in the aquatic filter feeder Daphnia magna resulted in photoenhanced toxicity. D. magna and S. caprincornatum were exposed to aqueous solutions of 20ppm and 200ppm TiO2-NP for 24hrs and then transferred to clean moderately hard water. Samples were taken at various time points, dried, and TiO 2 quantified using ICP-MS. Toxicity assays were run on D. magna using three TiO2-NP (20ppm, 200ppm) exposure protocols and two ultraviolet radiation treatments. The first exposure group was exposed to aqueous solutions of TiO2-NP for the duration of the test. The second exposure group was exposed to TiO2-NP for an hour and then transferred to clean water. The third exposure group was fed S. capricornatum that had been allowed to adsorb TiO2-NP. All samples were then placed in an outdoor UV exposure system and exposed to either full spectrum sunlight (with UV) or filtered sunlight (no UV). Here we show that TiO2 uptake peaked at one hour of exposure likely due to sedimentation of the particles out of suspension, thus decreasing bioavailability for the duration of the test. Interestingly, when D. magna were moved to clean water, aqueous concentrations of TiO2 increase as a result of depuration from the gut tract. Data also suggests these excreted particles

  12. Toxicity Determination of Explosive Contaminated Soil Leachates to Daphnia magna Using an Adapted Toxicity Characteristic Leaching Procedure

    DTIC Science & Technology

    1993-06-01

    An adapted toxicity characteristic leaching procedure was used to determine toxicity of soils to Daphnia magna . Soil samples were collected from U.S...vol/vol). Contaminated boils, Munition residues, Daphnia magna , EC50 Toxicity.

  13. A multi-fingerprint browser for the ZINC database

    PubMed Central

    Awale, Mahendra; Reymond, Jean-Louis

    2014-01-01

    To confirm the activity of an initial small molecule ‘hit compound’ from an activity screening, one needs to probe the structure–activity relationships by testing close analogs. The multi-fingerprint browser presented here (http://dcb-reymond23.unibe.ch:8080/MCSS/) enables one to rapidly identify such close analogs among commercially available compounds in the ZINC database (>13 million molecules). The browser retrieves nearest neighbors of any query molecule in multi-dimensional chemical spaces defined by four different fingerprints, each of which represents relevant structural and pharmacophoric features in a different way: sFP (substructure fingerprint), ECFP4 (extended connectivity fingerprint), MQNs (molecular quantum numbers) and SMIfp (SMILES fingerprint). Distances are calculated using the city-block distance, a similarity measure that performs as well as Tanimoto similarity but is much faster to compute. The list of up to 1000 nearest neighbors of any query molecule is retrieved by the browser and can be then clustered using the K-means clustering algorithm to produce a focused list of analogs with likely similar bioactivity to be considered for experimental evaluation. PMID:24782520

  14. Environmental Effects of Dredging. Use of Daphnia Magna to Predict Consequences of Bioaccumulation.

    DTIC Science & Technology

    1987-03-01

    and biological effects in the freshwater crustacean, Daphnia magna (commonly known as the water flea). Procedures presented here for a 28-day Daphnia ... magna toxicity test could be used in screening for water-column toxicity resulting from open-water disposal of a specific dredged material. As a part

  15. Design and Analysis of Chronic Aquatic Tests of Toxicity with Daphnia magna.

    DTIC Science & Technology

    1981-12-01

    toxicity with Daphnia magna and statistical issues involved in the planning of such tests. All procedures are illustrated with examples based on real...keywords: Daphnia Magna ; Chronic aquatic toxicity tests; Statistical analysis; Graphical data display; Tests of hypothesis; Confidence intervals; Dose

  16. 'Fingerprinting' of HLA-DQA by polymerase chain reaction and heteroduplex analysis.

    PubMed

    Martinelli, G; Trabetti, E; Farabegoli, P; Buzzi, M; Zaccaria, A; Testoni, N; Amabile, M; Casartelli, A; de Vivo, A; Pignatti, P F; Tura, S

    1996-04-01

    We have developed a rapid, non-radioisotopic PCR fingerprinting technique for analysis of the HLA-Class II DQA gene second exon polymorphism, and have applied it to DNA samples from 210 healthy individuals. The technique is based on the formation of specific patterns (fingerprints) of homoduplexes or heteroduplexes between in vitro amplified DNA sequences. After electrophoresis on non-denaturing polyacrylamide gels and ethidium bromide fluorescence or silver staining, different HLA-DQA types give allele-specific banding patterns. HLA DQA typing is done by visual comparison between the sample's fingerprint patterns and appropriate controls. Similar fingerprints can be resolved by mixing the sample with a standard DNA in an amplified 'DNA crossmatch'. This application of PCR fingerprinting is useful to confirm the HLA-DQA serological typing and to improve the molecular characterization of this polymorphic region.

  17. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis

    PubMed Central

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F.; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  18. Interspecific Differences between D. pulex and D. magna in Tolerance to Cyanobacteria with Protease Inhibitors

    PubMed Central

    Kuster, Christian J.; Von Elert, Eric

    2013-01-01

    It is known that cyanobacteria negatively affect herbivores due to their production of toxins such as protease inhibitors. In the present study we investigated potential interspecific differences between two major herbivores, Daphnia magna and Daphnia pulex, in terms of their tolerance to cyanobacteria with protease inhibitors. Seven clones each of D. magna and of D. pulex were isolated from different habitats in Europe and North America. To test for interspecific differences in the daphnids’ tolerance to cyanobacteria, their somatic and population growth rates were determined for each D. magna and D. pulex clone after exposure to varying concentrations of two Microcystis aeruginosa strains. The M. aeruginosa strains NIVA and PCC− contained either chymotrypsin or trypsin inhibitors, but no microcystins. Mean somatic and population growth rates on a diet with 20% NIVA were significantly more reduced in D. pulex than in D. magna. On a diet with 10% PCC−, the population growth of D. pulex was significantly more reduced than that of D. magna. This indicates that D. magna is more tolerant to cyanobacteria with protease inhibitors than D. pulex. The reduction of growth rates was possibly caused by an interference of cyanobacterial inhibitors with proteases in the gut of Daphnia, as many other conceivable factors, which might have been able to explain the reduced growth, could be excluded as causal factors. Protease assays revealed that the sensitivities of chymotrypsins and trypsins to cyanobacterial protease inhibitors did not differ between D. magna and D. pulex. However, D. magna exhibited a 2.3-fold higher specific chymotrypsin activity than D. pulex, which explains the observed higher tolerance to cyanobacterial protease inhibitors of D. magna. The present study suggests that D. magna may control the development of cyanobacterial blooms more efficiently than D. pulex due to differences in their tolerance to cyanobacteria with protease inhibitors. PMID:23650523

  19. Generating cancelable fingerprint templates.

    PubMed

    Ratha, Nalini K; Chikkerur, Sharat; Connell, Jonathan H; Bolle, Ruud M

    2007-04-01

    Biometrics-based authentication systems offer obvious usability advantages over traditional password and token-based authentication schemes. However, biometrics raises several privacy concerns. A biometric is permanently associated with a user and cannot be changed. Hence, if a biometric identifier is compromised, it is lost forever and possibly for every application where the biometric is used. Moreover, if the same biometric is used in multiple applications, a user can potentially be tracked from one application to the next by cross-matching biometric databases. In this paper, we demonstrate several methods to generate multiple cancelable identifiers from fingerprint images to overcome these problems. In essence, a user can be given as many biometric identifiers as needed by issuing a new transformation "key." The identifiers can be cancelled and replaced when compromised. We empirically compare the performance of several algorithms such as Cartesian, polar, and surface folding transformations of the minutiae positions. It is demonstrated through multiple experiments that we can achieve revocability and prevent cross-matching of biometric databases. It is also shown that the transforms are noninvertible by demonstrating that it is computationally as hard to recover the original biometric identifier from a transformed version as by randomly guessing. Based on these empirical results and a theoretical analysis we conclude that feature-level cancelable biometric construction is practicable in large biometric deployments.

  20. Protective effects of ectoine on heat-stressed Daphnia magna.

    PubMed

    Adam, Bownik; Zofia, Stępniewska; Tadeusz, Skowroński

    2014-12-01

    Ectoine (ECT) is an amino acid produced and accumulated by halophilic bacteria in stressful conditions in order to prevent the loss of water from the cell. There is a lack of knowledge on the effects of ECT in heat-stressed aquatic animals. The purpose of our study was to determine the influence of ECT on Daphnia magna subjected to heat stress with two temperature gradients: 1 and 0.1 °C/min in the range of 23-42 °C. Time to immobilisation, survival during recovery, swimming performance, heart rate, thoracic limb movement and the levels of heat shock protein 70 kDa 1A (HSP70 1A), catalase (CAT) and nitric oxide species (NOx) were determined in ECT-exposed and unexposed daphnids; we showed protective effects of ECT on Daphnia magna subjected to heat stress. Time to immobilisation of daphnids exposed to ECT was longer when compared to the unexposed animals. Also, survival rate during the recovery of daphnids previously treated with ECT was higher. ECT significantly attenuated a rapid increase of mean swimming velocity which was elevated in the unexposed daphnids. Moreover, we observed elevation of thoracic limb movement and modulation of heart rate in ECT-exposed animals. HSP70 1A and CAT levels were reduced in the presence of ECT. On the other hand, NOx level was slightly elevated in both ECT-treated and unexposed daphnids, however slightly higher NOx level was found in ECT-treated animals. We conclude that the exposure to ectoine has thermoprotective effects on Daphnia magna, however their mechanisms are not associated with the induction of HSP70 1A.

  1. Comet Assay on Daphnia magna in eco-genotoxicity testing.

    PubMed

    Pellegri, Valerio; Gorbi, Gessica; Buschini, Annamaria

    2014-10-01

    Detection of potentially hazardous compounds in water bodies is a priority in environmental risk assessment. For the evaluation and monitoring of water quality, a series of methodologies may be applied. Among them, the worldwide used toxicity tests with organisms of the genus Daphnia is one of the most powerful. In recent years, some attempts were made to utilize Daphnia magna in genotoxicity testing as many of the new environmental contaminants are described as DNA-damaging agents in aquatic organisms. The aim of this research was to develop a highly standardized protocol of the Comet Assay adapted for D. magna, especially regarding the isolation of cells derived from the same tissue (haemolymph) from newborn organisms exposed in vivo. Several methods for haemolymph extraction and different Comet Assay parameters were compared. Electrophoretic conditions were adapted in order to obtain minimum DNA migration in cells derived from untreated organisms and, at the same time, maximum sensitivity in specimens treated with known genotoxicants (CdCl2 and H2O2). Additional tests were performed to investigate if life-history traits of the cladoceran (such as the age of adult organisms that provide newborns, the clutch size of origin, the number of generations reared in standard conditions) and the water composition as well, might influence the response of the assay. This study confirms the potential application of the Comet Assay in D. magna for assessing genotoxic loads in aqueous solution. The newly developed protocol could integrate the acute toxicity bioassay, thus expanding the possibility of using this model species in freshwater monitoring (waters, sediment and soil elutriates) and is in line with the spirit of the EU Water Framework Directive in reducing the number of bioassays that involve medium-sized species.

  2. A Tree Based Method for the Rapid Screening of Chemical Fingerprints

    NASA Astrophysics Data System (ADS)

    Kristensen, Thomas G.; Nielsen, Jesper; Pedersen, Christian N. S.

    The fingerprint of a molecule is a bitstring based on its structure, constructed such that structurally similar molecules will have similar fingerprints. Molecular fingerprints can be used in an initial phase for identifying novel drug candidates by screening large databases for molecules with fingerprints similar to a query fingerprint. In this paper, we present a method which efficiently finds all fingerprints in a database with Tanimoto coefficient to the query fingerprint above a user defined threshold. The method is based on two novel data structures for rapid screening of large databases: the kD grid and the Multibit tree. The kD grid is based on splitting the fingerprints into k shorter bitstrings and utilising these to compute bounds on the similarity of the complete bitstrings. The Multibit tree uses hierarchical clustering and similarity within each cluster to compute similar bounds. We have implemented our method and tested it on a large data set from the industry. Our experiments show that our method yields a three-fold speed-up over previous methods.

  3. Statistical validation of structured population models for Daphnia magna.

    PubMed

    Adoteye, Kaska; Banks, H T; Cross, Karissa; Eytcheson, Stephanie; Flores, Kevin B; LeBlanc, Gerald A; Nguyen, Timothy; Ross, Chelsea; Smith, Emmaline; Stemkovski, Michael; Stokely, Sarah

    2015-08-01

    In this study we use statistical validation techniques to verify density-dependent mechanisms hypothesized for populations of Daphnia magna. We develop structured population models that exemplify specific mechanisms and use multi-scale experimental data in order to test their importance. We show that fecundity and survival rates are affected by both time-varying density-independent factors, such as age, and density-dependent factors, such as competition. We perform uncertainty analysis and show that our parameters are estimated with a high degree of confidence. Furthermore, we perform a sensitivity analysis to understand how changes in fecundity and survival rates affect population size and age-structure.

  4. Effects of metal salt mixtures on Daphnia magna reproduction

    SciTech Connect

    Biesinger, K.E.; Christensen, G.M.; Fiandt, J.T.

    1986-02-01

    Three binary metal experiments were conducted using a complete block design; testing the chlorides of Cd, Hg, and Zn individually and in combinations of Cd-Hg, Cd-Zn, and Zn-Hg on Daphnia magna reproduction. These mixtures were tested at one-half, once, and twice the 16% reproductive impairment concentration previously determined for individual metals. The Cd-Hg, Cd-Zn, and Zn-Hg mixtures all showed significant reductions in reproduction at concentrations where the metal salts alone caused no significant effect.

  5. Fake fingerprint detection based on image analysis

    NASA Astrophysics Data System (ADS)

    Jin, Sang-il; Bae, You-suk; Maeng, Hyun-ju; Lee, Hyun-suk

    2010-01-01

    Fingerprint recognition systems have become prevalent in various security applications. However, recent studies have shown that it is not difficult to deceive the system with fake fingerprints made of silicon or gelatin. The fake fingerprints have almost the same ridge-valley patterns as ones of genuine fingerprints so that conventional systems are unable to detect fake fingerprints without a particular detection method. Many previous works against fake fingers required extra sensors; thus, they lacked practicality. This paper proposes a practical and effective method that detects fake fingerprints, using only an image sensor. Two criteria are introduced to differentiate genuine and fake fingerprints: the histogram distance and Fourier spectrum distance. In the proposed method, after identifying an input fingerprint of a user, the system computes two distances between the input and the reference that comes from the registered fingerprints of the user. Depending on the two distances, the system classifies the input as a genuine fingerprint or a fake. In the experiment, 2,400 fingerprint images including 1,600 fakes were tested, and the proposed method has shown a high recognition rate of 95%. The fake fingerprints were all accepted by a commercial system; thus, the use of these fake fingerprints qualifies the experiment.

  6. Video fingerprinting for live events

    NASA Astrophysics Data System (ADS)

    Celik, Mehmet; Haitsma, Jaap; Barvinko, Pavlo; Langelaar, Gerhard; Maas, Martijn

    2009-02-01

    Multimedia fingerprinting (robust hashing) as a content identification technology is emerging as an effective tool for preventing unauthorized distribution of commercial content through user generated content (UGC) sites. Research in the field has mainly considered content types with slow distribution cycles, e.g. feature films, for which reference fingerprint ingestion and database indexing can be performed offline. As a result, research focus has been on improving the robustness and search speed. Live events, such as live sports broadcasts, impose new challenges on a fingerprinting system. For instance, highlights from a soccer match are often available-and viewed-on UGC sites well before the end of the match. In this scenario, the fingerprinting system should be able to ingest and index live content online and offer continuous search capability, where new material is identifiable within minutes of broadcast. In this paper, we concentrate on algorithmic and architectural challenges we faced when developing a video fingerprinting solution for live events. In particular, we discuss how to effectively utilize fast sorting algorithms and a master-slave architecture for fast and continuous ingestion of live broadcasts.

  7. Electronic fingerprinting of the dead.

    PubMed

    Rutty, G N; Stringer, K; Turk, E E

    2008-01-01

    To date, a number of methods exist for the capture of fingerprints from cadavers that can then be used in isolation as a primary method for the identification of the dead. We report the use of a handheld, mobile wireless unit used in conjunction with a personal digital assistant (PDA) device for the capture of fingerprints from the dead. We also consider a handheld single-digit fingerprint scanner that utilises a USB laptop connection for the electronic capture of cadaveric fingerprints. Both are single-operator units that, if ridge detail is preserved, can collect a 10-set of finger pad prints in approximately 45 and 90 s, respectively. We present our observations on the restrictions as to when such devices can be used with cadavers. We do, however, illustrate that the images are of sufficient quality to allow positive identification from finger pad prints of the dead. With the development of mobile, handheld, biometric, PDA-based units for the police, we hypothesize that, under certain circumstances, devices such as these could be used for the accelerated acquisition of fingerprint identification data with the potential for rapid near-patient identification in the future.

  8. Determination of mRNA expression of DMRT93B, vitellogenin, and cuticle 12 in Daphnia magna and their biomarker potential for endocrine disruption.

    PubMed

    Kim, Jungkon; Kim, Younghee; Lee, Sangwoo; Kwak, Kyunghee; Chung, Wook-Jin; Choi, Kyungho

    2011-11-01

    We explored the use of molecular genetic biomarkers for endocrine disruption in Daphnia magna after the exposure to fenoxycarb (FOC), a model juvenile hormone analog. For this purpose, the mRNA expression patterns of DMRT93B (DMRT, sex determination), cuticle 12 (CUT, molting), and vitellogenin (VTG, embryo development) were determined in D. magna. Furthermore, these results were compared with developmental abnormality and reproduction performance. The fold changes of CUT and VTG mRNA expression showed significant dose-response relationship with FOC exposure. Relative mRNA expressions of DMRT and CUT showed notable changes at as low as 1 ng/l FOC. After chronic exposure FOC significantly delayed the first day of reproduction and decreased the number of young and growth rate even at 10 ng/l FOC. A concentration-dependant trend in reproduction effect was also observed. Developmental abnormality such as poorly developed second antennae and curved or unextended shell spines were observed. These results suggest that the three mRNAs, i.e., DMRT, CUT, and VTG can be used as biomarkers of endocrine disrupting effects in D. magna.

  9. Toxicity of new generation flame retardants to Daphnia magna.

    PubMed

    Waaijers, Susanne L; Hartmann, Julia; Soeter, A Marieke; Helmus, Rick; Kools, Stefan A E; de Voogt, Pim; Admiraal, Wim; Parsons, John R; Kraak, Michiel H S

    2013-10-01

    There is a tendency to substitute frequently used, but relatively hazardous brominated flame retardants (BFRs) with halogen-free flame retardants (HFFRs). Consequently, information on the persistence, bioaccumulation and toxicity (PBT) of these HFFRs is urgently needed, but large data gaps and inconsistencies exist. Therefore, in the present study the toxicity of a wide range of HFFRs to the water flea Daphnia magna was investigated. Our results revealed that four HFFRs were showing no effect at their Sw (saturated water concentration) and three had a low toxicity (EC50>10 mg L(-1)), suggesting that these compounds are not hazardous. Antimony trioxide had a moderate toxicity (EC50=3.01 mg L(-1), 95% CL: 2.76-3.25) and triphenyl phosphate and the brominated reference compound tetra bromobisphenol A were highly toxic to D. magna (EC50=0.55 mg L(-1), 95% CL: 0.53-0.55 and EC50=0.60 mg L(-1), 95% CL: 0.24-0.97 respectively). Aluminum trihydroxide and bisphenol A bis(diphenyl phosphate) caused limited mortality at Sw (26 and 25% respectively) and have a low solubility (<10 mg L(-1)). Hence, increased toxicity of these compounds may be observed when for instance decreasing pH could increase solubility. By testing all compounds under identical conditions we provided missing insights in the environmental hazards of new generation flame retardants and propose as best candidates for BFR replacements: APP, ALPI, DOPO, MHO, MPP, ZHS and ZS.

  10. Biotransformation and bioconcentration of pyrene in Daphnia magna.

    PubMed

    Akkanen, Jarkko; Kukkonen, Jussi V K

    2003-06-19

    Water fleas (Daphnia magna) were exposed to [14C]pyrene in the presence and absence of piperonyl butoxide (PBO), a general cytochrome P450 (CYP) inhibitor, in organic carbon-free artificial freshwater (AFW, DOC<0.2 mg l(-1)) and in natural lake water (DOC=19.9 mg l(-1)) for 24 h. The bioconcentration of total radioactivity after 24 h exposure was 50% lower in the natural lake water, indicating decreased bioavailability of pyrene by the dissolved organic matter. However, the proportions of parent compound were only ca. 12 and 19% of the total body burden in daphnids exposed in AFW and natural lake water, respectively. Therefore, the tissue concentration of the parent pyrene was not significantly different in the daphnids exposed in the two different waters. Due to extensive biotransformation the bioconcentration factor (BCF) of parent pyrene was only 16 and 23% of the BCF calculated on the basis of total radioactivity in the daphnids in AFW and natural lake water, respectively. The proportion of parent pyrene was significantly higher (over 60%) in the daphnids exposed simultaneously to PBO, which indicates the involvement of CYP monooxygenases in the biotransformation. Furthermore, increasing PBO concentration decreased the accumulation of total radioactivity in AFW but not in the natural lake water. The data demonstrate capability and importance of CYP monooxygenases in biotransformation of polycyclic aromatic hydrocarbons in D. magna.

  11. Aquatic acute toxicity assessments of molybdenum (+VI) to Daphnia magna.

    PubMed

    Wang, Chi-Wei; Liang, Chenju; Yeh, Hui-Ju

    2016-03-01

    Generally, molybdenum (Mo) metals in the environment are very rare, but wastewater discharges from industrial processes may contain high concentrations of Mo, which has the potential to contaminate water or soil if not handled properly. In this study, the impact of three common compounds of hexavalent Mo (sodium molybdate (Na2MoO4‧2H2O), ammonium molybdate ((NH4)6Mo7O24‧4H2O) and molybdenum trioxide (MoO3)) in an aquatic system were assessed based on 48-h exposure acute toxicity to Daphnia magna (D. magna). The LC50 toxicities for associated conjugate ions including Na(+), Cl(-), SO4(2-), and NH4(+) were determined. Furthermore, the LC50 values for the three forms of hexavalent Mo were determined, and the acute toxicities of the Mo forms were found to follow the order: (NH4)6Mo7O24‧4H2O > MoO3 > Na2MoO4‧2H2O in solution. (NH4)6Mo7O24‧4H2O exhibited the lowest LC50 of 43.3 mg L(-1) (corresponding to 23.5 mg Mo L(-1)) among the three molybdenum salts. The research confirmed that the toxicity of molybdenum in the aquatic system is highly dependent on the form of molybdenum salts used, and is also associated with the influence of the background water quality.

  12. Acute toxicities of six manufactured nanomaterial suspensions to Daphnia magna

    NASA Astrophysics Data System (ADS)

    Zhu, Xiaoshan; Zhu, Lin; Chen, Yongsheng; Tian, Shengyan

    2009-01-01

    The rapid growth of nanotechnology is stimulating research on the potential environmental impacts of manufactured nanomaterials (MNMs). This paper summarizes a comprehensive study on the 48-h acute toxicity of water suspensions of six MNMs (i.e., ZnO, TiO2, Al2O3, C60, SWCNTs, and MWCNTs) to Daphnia magna, using immobilization and mortality as toxicological endpoints. The results show that the acute toxicities of all MNMs tested are dose dependent. The EC50 values for immobilization ranged from 0.622 mg/L (ZnO NPs) to 114.357 mg/L (Al2O3 NPs), while the LC50 values for mortality ranged from 1.511 mg/L (ZnO NPs) to 162.392 mg/L (Al2O3 NPs). In these tests, TiO2, Al2O3, and carbon-based nanomaterials were more toxic than their bulk counterparts. Moreover, D. magna were found to ingest nanomaterials from the test solutions through feeding behaviors, which indicates that the potential ecotoxicities and environmental health effects of these MNMs cannot be neglected.

  13. [Acute toxicity of different type pesticide surfactants to Daphnia magna].

    PubMed

    Li, Xiu-huan; Li, Hua; Chen, Cheng-yu; Li, Jian-tao; Liu, Feng

    2013-08-01

    By using the standard test methods in Experimental Guideline for Environmental Safety Evaluation of Chemical Pesticide to aquatic organisms, a comparative study was conducted on the acute toxicity of 39 nonionic, 6 anionic, and 3 cationic surfactants to Daphnia magna. The acute toxicity of three cationic surfactants 1427, 1227 and C8-10 to D. magna belonged to virulent level, and the toxicity of 1427 was the highest, with the EC50 value being 0.97 x 10(-2) mg x L(-1). The acute toxicity of nonionic surfactants polyoxyethylene ether castor oil EL, Tween, and Span emulsifiers belonged to low level, but the toxicity of alkylphenol polyoxyethylene ether and fatty alcohol polyoxyethylene ether surfactants was relatively high, of which, AEO-7 and AEO-5 displayed high toxicity, with the EC50 value being 0.82 and 0.97 mg x L(-1), respectively. In these surfactants, the more liposolubility, the higher the toxicity was. Most of the anionic surfactants were medium in toxicity, but the acute toxicity of NNO belonged to high toxicity, with the EC50 value being 0.17 mg x L(-1).

  14. Fingerprint fake detection by optical coherence tomography

    NASA Astrophysics Data System (ADS)

    Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

    2013-03-01

    The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

  15. Secure Fingerprint Identification of High Accuracy

    DTIC Science & Technology

    2014-01-01

    work on secure face recognition ([12], [29] and others), DNA matching ([35], [6], and others), iris code comparisons ([9], [7]), fingerprint ...1 Secure Fingerprint Identification of High Accuracy Marina Blanton and Siddharth Saraph Department of Computer Science and Engineering University of...In this work, we treat the problem of privacy- preserving matching of two fingerprints , which can be used for secure fingerprint authentication and

  16. Identification of chemical-specific protein profiles in Daphnia magna using neural networks

    SciTech Connect

    Iamonte, T.; Broadt, T.; Bradley, B.

    1995-12-31

    One dimensional gel electrophoresis was performed on whole-animal homogenates of 10 Daphnia magna exposed for 48 hours to one toxic and one non-toxic concentration of 2,4-dinitrophenol and sodium pentachlorophenate, two uncouplers of oxidative phosphorylation; malathion, an organophosphate; and permethrine, a pyrethroid, along with culture water and solvent controls, as appropriate. Ten randomized complete block exposures were conducted to minimize among-cohort variability. The 10-animal samples were gel electrophoresed, visualized using neutral silver staining and digitized with a Molecular Dynamics personal laser densitometer equipped with ImageQuant software. Densitometric data were used in a commercial neural network software package to construct a learning set, or database, of the protein profiles induced by the known chemical treatments. Novel data sets were then presented to the neural network program for assignment to treatment categories. Although no differences in protein profile between controls and chemical treatments and among chemical treatments could be detected visually in one dimensional gels, the neural network was able to correctly assign each sample to the appropriate learned treatment category about 70 percent of the time. Key proteins used by the neural network software to learn the protein profile of each chemical were identified by molecular weight and assigned a relative importance for identification of that chemical.

  17. Optical Wavelet Transform for Fingerprint Identification

    DTIC Science & Technology

    1993-12-15

    requirements of digitized fingerprints. This research implements an optical wavelet transform of a fingerprint image, as the first step in an optical... wavelet transform is implemented with continuous shift using an optical correlation between binarized fingerprints written on a Magneto-Optic Spatial

  18. Capturing Cognitive Fingerprints for Active Authentication

    DTIC Science & Technology

    2014-10-01

    CAPTURING COGNITIVE FINGERPRINTS FOR ACTIVE AUTHENTICATION IOWA STATE UNIVERSITY OF SCIENCE & TECHNOLOGY OCTOBER 2014 FINAL TECHNICAL REPORT...REPORT TYPE FINAL TECHNICAL REPORT 3. DATES COVERED (From - To) SEP 2013 – APR 2014 4. TITLE AND SUBTITLE CAPTURING COGNITIVE FINGERPRINTS FOR ACTIVE... fingerprints from individuals and use it as a biometric for continual authentication. This project proposed studying new biometric modalities for

  19. Forensic Chemistry: The Revelation of Latent Fingerprints

    ERIC Educational Resources Information Center

    Friesen, J. Brent

    2015-01-01

    The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

  20. Detection and Rectification of Distorted Fingerprints.

    PubMed

    Si, Xuanbin; Feng, Jianjiang; Zhou, Jie; Luo, Yuxuan

    2015-03-01

    Elastic distortion of fingerprints is one of the major causes for false non-match. While this problem affects all fingerprint recognition applications, it is especially dangerous in negative recognition applications, such as watchlist and deduplication applications. In such applications, malicious users may purposely distort their fingerprints to evade identification. In this paper, we proposed novel algorithms to detect and rectify skin distortion based on a single fingerprint image. Distortion detection is viewed as a two-class classification problem, for which the registered ridge orientation map and period map of a fingerprint are used as the feature vector and a SVM classifier is trained to perform the classification task. Distortion rectification (or equivalently distortion field estimation) is viewed as a regression problem, where the input is a distorted fingerprint and the output is the distortion field. To solve this problem, a database (called reference database) of various distorted reference fingerprints and corresponding distortion fields is built in the offline stage, and then in the online stage, the nearest neighbor of the input fingerprint is found in the reference database and the corresponding distortion field is used to transform the input fingerprint into a normal one. Promising results have been obtained on three databases containing many distorted fingerprints, namely FVC2004 DB1, Tsinghua Distorted Fingerprint database, and the NIST SD27 latent fingerprint database.

  1. Fingerprints in the Dust

    NASA Technical Reports Server (NTRS)

    2001-01-01

    These MISR nadir-camera images of eastern China compare a somewhat hazy summer view from July 9, 2000 (left) with a spectacularly dusty spring view from April 7, 2001 (middle). The left-hand and middle images are from Terra orbits 2967 and 6928, respectively, and extend from central Manchuria near the top to portions of North and South Korea at the bottom. They are approximately 380 kilometers in width.

    Asia's desert areas are prone to soil erosion, as underground water tables are lowered by prolonged drought and by industrial and agricultural water use. Heavy winds blowing eastward across the arid and sparsely vegetated surfaces of Mongolia and western China pick up large quantities of yellow dust. Airborne dust clouds from the April 2001 storm blew across the Pacific Ocean and were carried as far as North America. The minerals transported in this manner are believed to provide nutrients for both oceanic and land ecosystems.

    According to the Xinhua News Agency in China, nearly one million tons of Gobi Desert dust blow into Beijing each year. During a similar dust outbreak last year, the Associated Press reported that the visibility in Beijing had been reduced the point where buildings were barely visible across city streets, and airline schedules were significantly disrupted. The dust has also been implicated in adverse health effects such as respiratory discomfort and eye irritation.

    The image on the right is a higher resolution MISR nadir-camera view of a portion of the April 7, 2001 dust cloud. It covers an area roughly 250 kilometers wide by 470 kilometers high. When viewed at full magnification, a number of atmospheric wave features, like the ridges and valleys of a fingerprint, are apparent. These are probably induced by surface topography, which can disturb the wind flow. A few small cumulus clouds are also visible, and are casting shadows on the thick lower dust layer.

    Analyses of images such as these constitute one phase of MISR

  2. Chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus

    SciTech Connect

    Gersich, F.M.; Milazzo, D.P.

    1988-01-01

    Data generated from daphnid chronic toxicity tests are used by various regulatory agencies for the development of water quality criteria. Two chemicals which are lacking reported chronic data are aniline and 2,4-dichlorophenol. The acute toxicity of 2,4-dichlorophenol to Daphnia magna has been reported; the toxicity of aniline to D. magna also has been reported. Chronic data for these chemicals are lacking for invertebrates. The objective of this study was to estimate the chronic toxicity of aniline and 2,4-dichlorophenol to Daphnia magna Straus, using a standard 21-day static renewal procedure.

  3. Evolving transcriptomic fingerprint based on genome‐wide data as prognostic tools in prostate cancer

    PubMed Central

    Schliekelman, Mark; Shin, Heesun; Erho, Nicholas; Davicioni, Elai

    2015-01-01

    Background Information Prostate cancer (PCa) is a common disease but only a small subset of patients are at risk of developing metastasis and lethal disease, and identifying which patients will progress is challenging because of the heterogeneity underlying tumour progression. Understanding this heterogeneity at the molecular level and the resulting clinical impact is a critical step necessary for risk stratification. Defining genomic fingerprint elucidates molecular variation and may improve PCa risk stratification, providing more accurate prognostic information of tumour aggressiveness (or lethality) for prognostic biomarker development. Therefore, we explored transcriptomic differences between patients with indolent disease outcome and patients who developed metastasis post‐radical prostatectomy using genome‐wide expression data in the post radical prostatectomy clinical space before metastatic spread. Results Based on differential expression analysis, patients with adverse pathological findings who are at higher risk of developing metastasis have a distinct transcriptomic fingerprint that can be detected on surgically removed prostate specimens several years before metastasis detection. Nearly half of the transcriptomic fingerprint features were non‐coding RNA highlighting their pivotal role in PCa progression. Protein‐coding RNA features in the fingerprint are involved in multiple pathways including cell cycle, chromosome structure maintenance and cytoskeleton organisation. The metastatic transcriptomic fingerprint was determined in independent cohorts verifying the association between the fingerprint and metastatic patients. Further, the fingerprint was confirmed in metastasis lesions demonstrating that the fingerprint represents early metastatic transcriptomic changes, suggesting its utility as a prognostic tool to predict metastasis and provide clinical value in the early radical prostatectomy setting. Conclusions Here, we show that transcriptomic

  4. Neurogenesis in the water flea Daphnia magna (Crustacea, Branchiopoda) suggests different mechanisms of neuroblast formation in insects and crustaceans.

    PubMed

    Ungerer, Petra; Eriksson, Bo Joakim; Stollewerk, Angelika

    2011-09-01

    Within euarthropods, the morphological and molecular mechanisms of early nervous system development have been analysed in insects and several representatives of chelicerates and myriapods, while data on crustaceans are fragmentary. Neural stem cells (neuroblasts) generate the nervous system in insects and in higher crustaceans (malacostracans); in the remaining euarthropod groups, the chelicerates (e.g. spiders) and myriapods (e.g. millipedes), neuroblasts are missing. In the latter taxa, groups of neural precursors segregate from the neuroectoderm and directly differentiate into neurons and glial cells. In all euarthropod groups, achaete-scute homologues are required for neuroblast/neural precursor group formation. In the insects Drosophila melanogaster and Tribolium castaneum achaete-scute homologues are initially expressed in clusters of cells (proneural clusters) in the neuroepithelium but expression becomes restricted to the future neuroblast. Subsequently genes such as snail and prospero are expressed in the neuroblasts which are required for asymmetric division and differentiation. In contrast to insects, malacostracan neuroblasts do not segregate into the embryo but remain in the outer neuroepithelium, similar to vertebrate neural stem cells. It has been suggested that neuroblasts are present in another crustacean group, the branchiopods, and that they also remain in the neuroepithelium. This raises the questions how the molecular mechanisms of neuroblast selection have been modified during crustacean and insect evolution and if the segregation or the maintenance of neuroblasts in the neuroepithelium represents the ancestral state. Here we take advantage of the recently published Daphnia pulex (branchiopod) genome and identify genes in Daphnia magna that are known to be required for the selection and asymmetric division of neuroblasts in the fruit fly D. melanogaster. We unambiguously identify neuroblasts in D. magna by molecular marker gene expression and

  5. On the spatial distribution of fingerprint singularities.

    PubMed

    Cappelli, Raffaele; Maltoni, Davide

    2009-04-01

    Fingerprint singularities play an important role in several fingerprint recognition and classification systems. Although some general relationships and constraints about the location of singularities in the different fingerprint classes are well known, to the best of our knowledge no statistical models have been developed until now. This paper studies the spatial distributions of singularity locations in nature and derives, from a representative dataset of labelled samples, the probability density functions of the four main fingerprint classes. The results obtained can be directly exploited to improve the accuracy of many techniques relying on the position of singularities, as confirmed by the results of two experiments on fingerprint classification and synthesis.

  6. The dichotomous oxyregulatory behaviour of the planktonic crustacean Daphnia magna.

    PubMed

    Pirow, R; Buchen, I

    2004-02-01

    The dual function of appendage movement (food acquisition, ventilation) proved to be the key to explaining the peculiar oxyregulatory repertoire of the planktonic filter feeder Daphnia magna. Short-term hypoxic exposure experiments with normoxia-acclimated animals under varying food concentrations revealed a dichotomous response pattern with a compensatory tachycardia under food-free conditions and a ventilatory compensation prevailing under food-rich conditions. Food-free, normoxic conditions resulted in maximum appendage beating rates (fA) and half-maximum heart rates (fH), which restricted the scope for oxyregulation to the circulatory system. Food-rich conditions (10(5) algal cells ml(-1)), on the contrary, had a depressing effect on fA whereas fH increased to 83% of the maximum. In this physiological state, D. magna was able to respond to progressive hypoxia with a compensatory increase in ventilation. A conceptual and mathematical model was developed to analyse the efficiency of ventilatory and circulatory adjustments in improving oxygen transport to tissue. Model predictions showed that an increase in perfusion rate was most effective under both food-free and food-rich conditions in reducing the critical ambient oxygen tension (PO2crit) at which oxygen supply to the tissue started to become impeded. By contrast, a hypothetical increase in ventilation rate had almost no effect on PO2crit under food-free conditions, indicating that appendage movement is driven by nutritive rather than respiratory requirements. However, the model predicted a moderate reduction of PO2crit by hyperventilation under food-rich conditions. Since the regulatory scope for an adjustment in fH was found to be limited in D. magna under these conditions, the increase in ventilation rate is the means of choice for a fed animal to cope with short-term, moderate reductions in ambient oxygen availability. Under long-term and more severe hypoxic conditions, however, the increase in the

  7. Enhancing contrast of fingerprints on plastic tape.

    PubMed

    Steele, Charles A; Ball, Mikki S

    2003-11-01

    Many of the currently available fingerprinting methods have limited ability to visualize fingerprints on plastic tape without expensive equipment or significant handling of the sample. This is especially true for visualizing fingerprints on black electrical tape. This study sought a hands-off method to produce easy visualization of fingerprints on different types of plastic tape, including black electrical tape, without the need for expensive equipment. The methods selected were to sublime disperse dyes into the tape, both with and without the fuming of cyanoacrylate, everywhere except for where the fingerprint was applied. The resulting color contrasts provided enough differentiation to visualize fingerprints on plastic tape under ambient light. Sequential fuming with cyanoacrylate followed by disperse dyes provided the best visualizations on all tapes, and cyanoacrylate followed by disperse yellow 211 clearly visualized fingerprints on black electrical tape.

  8. Network fingerprint: a knowledge-based characterization of biomedical networks

    PubMed Central

    Cui, Xiuliang; He, Haochen; He, Fuchu; Wang, Shengqi; Li, Fei; Bo, Xiaochen

    2015-01-01

    It can be difficult for biomedical researchers to understand complex molecular networks due to their unfamiliarity with the mathematical concepts employed. To represent molecular networks with clear meanings and familiar forms for biomedical researchers, we introduce a knowledge-based computational framework to decipher biomedical networks by making systematic comparisons to well-studied “basic networks”. A biomedical network is characterized as a spectrum-like vector called “network fingerprint”, which contains similarities to basic networks. This knowledge-based multidimensional characterization provides a more intuitive way to decipher molecular networks, especially for large-scale network comparisons and clustering analyses. As an example, we extracted network fingerprints of 44 disease networks in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The comparisons among the network fingerprints of disease networks revealed informative disease-disease and disease-signaling pathway associations, illustrating that the network fingerprinting framework will lead to new approaches for better understanding of biomedical networks. PMID:26307246

  9. Fingerprint reconstruction: from minutiae to phase.

    PubMed

    Feng, Jianjiang; Jain, Anil K

    2011-02-01

    Fingerprint matching systems generally use four types of representation schemes: grayscale image, phase image, skeleton image, and minutiae, among which minutiae-based representation is the most widely adopted one. The compactness of minutiae representation has created an impression that the minutiae template does not contain sufficient information to allow the reconstruction of the original grayscale fingerprint image. This belief has now been shown to be false; several algorithms have been proposed that can reconstruct fingerprint images from minutiae templates. These techniques try to either reconstruct the skeleton image, which is then converted into the grayscale image, or reconstruct the grayscale image directly from the minutiae template. However, they have a common drawback: Many spurious minutiae not included in the original minutiae template are generated in the reconstructed image. Moreover, some of these reconstruction techniques can only generate a partial fingerprint. In this paper, a novel fingerprint reconstruction algorithm is proposed to reconstruct the phase image, which is then converted into the grayscale image. The proposed reconstruction algorithm not only gives the whole fingerprint, but the reconstructed fingerprint contains very few spurious minutiae. Specifically, a fingerprint image is represented as a phase image which consists of the continuous phase and the spiral phase (which corresponds to minutiae). An algorithm is proposed to reconstruct the continuous phase from minutiae. The proposed reconstruction algorithm has been evaluated with respect to the success rates of type-I attack (match the reconstructed fingerprint against the original fingerprint) and type-II attack (match the reconstructed fingerprint against different impressions of the original fingerprint) using a commercial fingerprint recognition system. Given the reconstructed image from our algorithm, we show that both types of attacks can be successfully launched against

  10. Developmental outcome of children with enlargement of the cisterna magna identified in utero.

    PubMed

    Dror, Raheli; Malinger, Gustavo; Ben-Sira, Liat; Lev, Dorit; Pick, Chaim G; Lerman-Sagie, Tally

    2009-12-01

    An enlarged cisterna magna can be identified during routine ultrasound screening in the second half of pregnancy. It is important to be able to give an accurate prognosis. We evaluated the developmental outcome of these children. A total of 29 fetuses with a large cisterna magna identified in utero were compared to 35 children with a normal fetal ultrasound. The children were evaluated by the Gesell Developmental Schedules and the Peabody Developmental Motor Scale. The study group showed a significantly worse performance in the Gesell test. However, the overall performance for both groups was within normal limits. Four children in the study group had a borderline developmental quotient. Both groups performed similarly in the Peabody test. Walking age was significantly delayed in the study group. Children with an enlarged cisterna magna may be at risk for mild developmental delay. In cases of nonisolated enlargement of the cisterna magna, the outcome may be guarded.

  11. Ecotoxicological evaluation of selected pharmaceuticals to Vibrio fischeri and Daphnia magna before and after photooxidation process.

    PubMed

    Czech, Bożena; Jośko, Izabela; Oleszczuk, Patryk

    2014-06-01

    The aim of the research was the determination of the toxicity of photocatalytically treated water contaminated by different pharmaceuticals: chloramphenicol (CPL), diclofenac (DCF) or metoprolol (MT). Daphtoxkit F™ with Dapnia magna and Microtox(®) with Vibrio fischeri were used to evaluate the toxicity of the water before and after treatment. D. magna showed higher sensitivity to the presence of pharmaceuticals than V. fischeri. Generally, both tested organisms revealed the greatest sensitivity to the presence of CPL. The application of photocatalytic oxidation has resulted in decreased toxicity. It may confirm the reduction of high toxic parent compounds to less toxic metabolites. The toxicity was reduced in the range from 30% to 100% depending on pharmaceutical tested. The highest reduction of toxicity to V. fischeri and D. magna was observed to MT and CPL respectively. Depending on bioassay the toxicity decrease as follows: CPL>DCF>MT for D. magna and CPL>MT>DCF for V. fischeri.

  12. Acute toxicity of cyanogen chloride to Daphnia magna

    SciTech Connect

    Kononen, D.W.

    1988-09-01

    The destruction of cyanide in waste waters by chlorination has been shown to result in the formation of the extremely toxic compound, cyanogen chloride. Industrial cyanide-containing waste waters may be treated by a batch chlorination process under highly alkaline conditions prior to being discharged into a receiving water systems. Alternatively, if the concentration of cyanide is relatively low, and such waste waters may be diverted to municipal waste treatment facilities where they may be subjected to a process of chlorination which may not be sufficient for the complete oxidative destruction of the available cyanide. Although a large body of literature exists concerning the toxicity of HCN and metallic cyanide compounds to aquatic organisms, there is a comparative scarcity of information concerning cyanogen chloride toxicity. This study was designed to determine the acute toxicity of CNCl to Daphnia magna neonates under static bioassay conditions.

  13. Genes mirror geography in Daphnia magna.

    PubMed

    Fields, Peter D; Reisser, Céline; Dukić, Marinela; Haag, Christoph R; Ebert, Dieter

    2015-09-01

    Identifying the presence and magnitude of population genetic structure remains a major consideration in evolutionary biology as doing so allows one to understand the demographic history of a species as well as make predictions of how the evolutionary process will proceed. Next-generation sequencing methods allow us to reconsider previous ideas and conclusions concerning the distribution of genetic variation, and what this distribution implies about a given species evolutionary history. A previous phylogeographic study of the crustacean Daphnia magna suggested that, despite strong genetic differentiation among populations at a local scale, the species shows only moderate genetic structure across its European range, with a spatially patchy occurrence of individual lineages. We apply RAD sequencing to a sample of D. magna collected across a wide swath of the species' Eurasian range and analyse the data using principle component analysis (PCA) of genetic variation and Procrustes analytical approaches, to quantify spatial genetic structure. We find remarkable consistency between the first two PCA axes and the geographic coordinates of individual sampling points, suggesting that, on a continent-wide scale, genetic differentiation is driven to a large extent by geographic distance. The observed pattern is consistent with unimpeded (i.e. no barriers, landscape or otherwise) migration at large spatial scales, despite the fragmented and patchy nature of favourable habitats at local scales. With high-resolution genetic data similar patterns may be uncovered for other species with wide geographic distributions, allowing an increased understanding of how genetic drift and selection have shaped their evolutionary history.

  14. Investigation of PDE5/PDE6 and PDE5/PDE11 selective potent tadalafil-like PDE5 inhibitors using combination of molecular modeling approaches, molecular fingerprint-based virtual screening protocols and structure-based pharmacophore development.

    PubMed

    Kayık, Gülru; Tüzün, Nurcan Ş; Durdagi, Serdar

    2017-12-01

    The essential biological function of phosphodiesterase (PDE) type enzymes is to regulate the cytoplasmic levels of intracellular second messengers, 3',5'-cyclic guanosine monophosphate (cGMP) and/or 3',5'-cyclic adenosine monophosphate (cAMP). PDE targets have 11 isoenzymes. Of these enzymes, PDE5 has attracted a special attention over the years after its recognition as being the target enzyme in treating erectile dysfunction. Due to the amino acid sequence and the secondary structural similarity of PDE6 and PDE11 with the catalytic domain of PDE5, first-generation PDE5 inhibitors (i.e. sildenafil and vardenafil) are also competitive inhibitors of PDE6 and PDE11. Since the major challenge of designing novel PDE5 inhibitors is to decrease their cross-reactivity with PDE6 and PDE11, in this study, we attempt to identify potent tadalafil-like PDE5 inhibitors that have PDE5/PDE6 and PDE5/PDE11 selectivity. For this aim, the similarity-based virtual screening protocol is applied for the "clean drug-like subset of ZINC database" that contains more than 20 million small compounds. Moreover, molecular dynamics (MD) simulations of selected hits complexed with PDE5 and off-targets were performed in order to get insights for structural and dynamical behaviors of the selected molecules as selective PDE5 inhibitors. Since tadalafil blocks hERG1 K channels in concentration dependent manner, the cardiotoxicity prediction of the hit molecules was also tested. Results of this study can be useful for designing of novel, safe and selective PDE5 inhibitors.

  15. Acute toxicity of furazolidone on Artemia salina, Daphnia magna, and Culex pipiens molestus larvae

    SciTech Connect

    Macri, A.; Stazi, A.V.; Dojmi di Delupis, G.

    1988-10-01

    As a result of evidence of the ecotoxicity of nitrofurans, the acute toxicity of furazolidone was tested in vivo on two aquatic organisms, Artemia salina and Daphnia magna, which are both crustaceans. Toxicity studies were also performed on larvae of Culex pipiens molestus. Results indicated a significant toxicity of the compound on Culex pipiens and Daphnia magna, while Artemia salina proved to be the least sensitive.

  16. Toxaphene detoxification and acclimation in Daphnia magna: do cytochrome P-450 enzymes play a role?

    PubMed

    Kashian, Donna R

    2004-01-01

    Toxaphene is a persistent environmental contaminant that has been shown to alter male production in Daphnia magna and to induce P-450 activity in mammals. Cytochrome P-450-mediated metabolism may lead to xenobiotic detoxification resulting in acclimation. To determine if D. magna acclimate to toxaphene via P-450 pathways, chronic and acute toxicity tests were conducted with D. magna exposed to toxaphene in the presence and absence of piperonyl butoxide (PBO), an inhibitor of cytochrome P-450 enzymes. Toxaphene exposure increased male production in acute but not chronic assays, indicating that D. magna may acclimate to chronic toxaphene exposure. Upon co-administration of toxaphene and PBO in chronic tests, D. magna exhibited a decline in growth rate, fecundity and survival. The observed toxaphene acclimation in chronic tests, along with its increased toxicity in the presence of a P-450 suppressor, suggests that P-450 enzymes may contribute to detoxification and subsequent acclimation of D. magna to chronic toxaphene exposure. Additional chronic toxicity tests indicated that toxaphene acclimation occurs between 7 and 12 days following initial exposure, at which time sex determination is no longer affected. Thus, sublethal toxaphene toxicity effects such as reproductive impairments may be detectable with acute but not chronic tests, potentially due to the upregulation of P-450 isozymes.

  17. SufA--a novel subtilisin-like serine proteinase of Finegoldia magna.

    PubMed

    Karlsson, Christofer; Andersson, Marie-Louise; Collin, Mattias; Schmidtchen, Artur; Björck, Lars; Frick, Inga-Maria

    2007-12-01

    Finegoldia magna is an anaerobic Gram-positive bacterium and commensal, which is also associated with clinically important conditions such as skin and soft tissue infections. This study describes a novel subtilisin-like extracellular serine proteinase of F. magna, denoted SufA (subtilase of Finegoldia magna), which is believed to be the first subtilase described among Gram-positive anaerobic cocci. SufA is associated with the bacterial cell surface, but is also released in substantial amounts during bacterial growth. Papain was used to release SufA from the surface of F. magna and the enzyme was purified by ion-exchange chromatography and gel filtration. A protein band on SDS-PAGE corresponding to the dominating proteolytic activity on gelatin zymography was analysed by MS/MS. Based on the peptide sequences obtained, the sufA gene was sequenced. The gene comprises 3466 bp corresponding to a preprotein of 127 kDa. Like other members of the subtilase family, SufA contains the catalytic triad of aspartic acid, histidine and serine with surrounding conserved residues. A SufA homologue was identified in 33 of 34 investigated isolates of F. magna, as revealed by PCR and immunoprinting. The enzyme forms dimers, which are more proteolytically active than the monomeric protein. SufA was found to efficiently cleave and inactivate the antibacterial peptide LL-37 and the CXC chemokine MIG/CXCL9, indicating that the enzyme promotes F. magna survival and colonization.

  18. Experimental models of microcystin accumulation in Daphnia magna grazing on Planktothrix rubescens: implications for water management.

    PubMed

    Shams, Shiva; Cerasino, Leonardo; Salmaso, Nico; Dietrich, Daniel R

    2014-03-01

    In this study, we investigated the kinetic aspects of the microcystin (MC) transfer from Planktothrix rubescens to Daphnia magna by carrying out exposure experiments in small simple mesocosms. We hypothesized that higher fractions of toxic cyanobacteria in the diet of grazers would shift the balance towards a greater than linear, i.e. non-linear accumulation of MC in D. magna. This hypothesis was tested by exposing D. magna to varying initial densities of MC-producing P. rubescens. The evolving models of MC accumulation differed largely as a result of the duration of exposure and initial MC concentrations used. Within the first 24h of exposure, MC accumulation in D. magna was linear, irrespective of the initial densities of toxic P. rubescens and thus MC concentrations. After 48 h of exposure, MC accumulation in D. magna showed an exponential pattern, possibly due to a delayed digestion of P. rubescens and/or decreased MC detoxification capabilities when compared with higher ambient concentrations of MC. After 72 h toxin concentrations in Daphnia drop in all experiments as a consequence of the reduced cyanobacterial cells in the medium and the detoxification of MC within Daphnia. The results obtained suggest that in lakes with higher MC content and longer cyanobacterial bloom period MC accumulation in D. magna should be more pronounced than in mesotrophic lakes with lower MC content. The latter interpretation, however, should be verified investigating accumulation of MC both in larger mesocosms and in situ, in lakes of different trophic status.

  19. Effects of vertebrate hormones on development and sex determination in Daphnia magna.

    PubMed

    Kashian, Donna R; Dodson, Stanley I

    2004-05-01

    Daphnia (Crustacea) are extensively used as model organisms in ecotoxicology; however, little is known regarding their endocrine system. This study examines Daphnia vulnerability to vertebrate hormones. Twelve natural or synthetic vertebrate hormones were screened for activity on developmental and reproductive processes in Daphnia magna. Natural hormones tested included: beta-estradiol, gonadotropin, hydrocortisone, insulin, melatonin, progesterone, somatostatin, testosterone, and thyroxine at concentrations ranging from 1 to 100 microg/L. Synthetic hormones tested included diethylstilbestrol (estrogenic), R-1881 (androgen), and ICI-182,780 (antiestrogen); all hormones were screened with a 6-d assay. Additionally, progesterone, insulin, testosterone, and thyroxine were screened for 25 d. Diethylstilbestrol decreased D. magna growth rate while thyroxine increased it. Short-term testosterone exposure reduced D. magna fecundity; however, long-term exposure did not, potentially indicating testosterone hydroxylation with long-term exposure. Hormones commonly considered sex-hormones (estrogens and androgens) in vertebrates do not appear to control sexual differentiation in D. magna; however, several vertebrate hormones do affect reproduction and development in D. magna making D. magna a potentially useful tool in monitoring for the presence of these hormones or compounds that mimic them.

  20. Effects of Microcystis aeruginosa on life history of water flea Daphnia magna

    NASA Astrophysics Data System (ADS)

    Liu, Liping; Li, Kang; Chen, Taoying; Dai, Xilin; Jiang, Min; Diana, James S.

    2011-07-01

    Cyanobacterial blooms in eutrophic freshwater systems are a worldwide problem, creating adverse effects for many aquatic organisms by producing toxic microcystins and deteriorating water quality. In this study, microcystins (MCs) in Microcystis aeruginosa, and Daphnia magna exposed to M. aeruginosa, were analyzed by HPLC-MS, and the effects of M. aeruginosa on D. magna were investigated. When D. magna was exposed to M. aeruginosa for more than 2 h, Microcystin-LR (MC-LR) was detected. When exposed to 1.5 × 106, 3 × 106, 0.75 × 107, and 1.5 × 107 cell/mL of M. aeruginosa for 96 h, average survival of D. magna for treatments were 23.33%, 33.33%, 13.33%, 16.67%, respectively, which were significantly lower than the average 100% survival in the control group ( P < 0.05). The adverse effects of M. aeruginosa on body length, time for the first brood, brood numbers, gross fecundity, lifespan, and population growth of D. magna were density-dependent. These results suggest that the occurrence of M. aeruginosa blooms could strongly inhibit the population growth of D. magna through depression of survival, individual growth and gross fecundity. In the most serious situations, M. aeruginosa blooms could undermine the food web by eliminating filter-feeding zooplankton, which would destroy the ecological balance of aquaculture water bodies.

  1. Systems Biology Approach Reveals a Calcium-Dependent Mechanism for Basal Toxicity in Daphnia magna.

    PubMed

    Antczak, Philipp; White, Thomas A; Giri, Anirudha; Michelangeli, Francesco; Viant, Mark R; Cronin, Mark T D; Vulpe, Chris; Falciani, Francesco

    2015-09-15

    The expanding diversity and ever increasing amounts of man-made chemicals discharged to the environment pose largely unknown hazards to ecosystem and human health. The concept of adverse outcome pathways (AOPs) emerged as a comprehensive framework for risk assessment. However, the limited mechanistic information available for most chemicals and a lack of biological pathway annotation in many species represent significant challenges to effective implementation of this approach. Here, a systems level, multistep modeling strategy demonstrates how to integrate information on chemical structure with mechanistic insight from genomic studies, and phenotypic effects to define a putative adverse outcome pathway. Results indicated that transcriptional changes indicative of intracellular calcium mobilization were significantly overrepresented in Daphnia magna (DM) exposed to sublethal doses of presumed narcotic chemicals with log Kow ≥ 1.8. Treatment of DM with a calcium ATPase pump inhibitor substantially recapitulated the common transcriptional changes. We hypothesize that calcium mobilization is a potential key molecular initiating event in DM basal (narcosis) toxicity. Heart beat rate analysis and metabolome analysis indicated sublethal effects consistent with perturbations of calcium preceding overt acute toxicity. Together, the results indicate that altered calcium homeostasis may be a key early event in basal toxicity or narcosis induced by lipophilic compounds.

  2. Evolutionary variation in neural gene expression in the developing sense organs of the crustacean Daphnia magna.

    PubMed

    Klann, Marleen; Stollewerk, Angelika

    2017-04-01

    Arthropods have numerous sense organs, which are adapted to their habitat. While some sense organs are similar in structure and function in all arthropod groups, structural differences in functionally related sense organs have been described, as well as the absence of particular sense organ subtypes in individual arthropod groups. Here we address the question of how the diverse structures of arthropod sense organs have evolved by analysing the underlying molecular developmental processes in a crustacean, an arthropod group that has been neglected so far. We have investigated the development of four types of chemo- and mechanosensory sense organs in the branchiopod Daphnia magna (Cladocera) that either cannot be found in arthropods other than crustaceans or represent adaptations to an aquatic environment. The formation of the sensory organ precursors shows greater similarity to the arthropod taxa Chelicerata and Myriapoda than to the more closely related insects. All analysed sense organ types co-express the proneural genes ASH and atonal regardless of their structure and function. In contrast, in Drosophila melanogaster, ASH and atonal expression does not overlap and the genes confer different sense organ subtype identities. We performed experimental co-expression studies in D. melanogaster and found that the combinatorial expression of ato and ASH can change the external structure of sense organs. Our results indicate a central role for ASH and Atonal family members in the emergence of structural variations in arthropod sense organs.

  3. Evidence of transmission of tuberculosis by DNA fingerprinting.

    PubMed Central

    Godfrey-Faussett, P.; Mortimer, P. R.; Jenkins, P. A.; Stoker, N. G.

    1992-01-01

    OBJECTIVE--To determine whether a subject who had died of tuberculous meningitis had been infected by a neighbour. DESIGN--Retrospective comparison of isolates of Mycobacterium tuberculosis from the two cases and from 10 controls by DNA fingerprinting. SETTING--Public Health Service Reference Laboratory for Mycobacteria and bacterial molecular genetics unit of the London School of Hygiene and Tropical Medicine. SUBJECTS--Deceased and neighbour; 10 controls from the same city, from whom isolates had been collected over three months before the subject's death. MAIN OUTCOME MEASURES--Identity and similarity values (SAB) between fingerprint patterns from different isolates obtained by hybridisation of restriction fragments produced by PvuII with a probe from the insertion element IS6110/986, present in multiple copies throughout the genome of M tuberculosis. RESULTS--Isolates from the two cases under investigation had identical fingerprints whereas those from the controls were all distinct. Two clusters of isolates with a similarity coefficient > 0.25 were identified: in one, four out of five patients were born in the midlands (the birth place of the fifth was not known) and in the other all three patients were born in the Indian subcontinent. CONCLUSIONS--The data are consistent with, but do not prove, transmission of tuberculosis from the neighbour to the deceased. Geographical separation of the pools of infection may have led to the evolution of distinct clusters of fingerprint patterns. DNA fingerprinting of M tuberculosis is a powerful new tool for study of the epidemiology and pathogenesis of tuberculosis. Images FIG 1 PMID:1392824

  4. Optical wavelet transform for fingerprint identification

    NASA Astrophysics Data System (ADS)

    MacDonald, Robert P.; Rogers, Steven K.; Burns, Thomas J.; Fielding, Kenneth H.; Warhola, Gregory T.; Ruck, Dennis W.

    1994-03-01

    The Federal Bureau of Investigation (FBI) has recently sanctioned a wavelet fingerprint image compression algorithm developed for reducing storage requirements of digitized fingerprints. This research implements an optical wavelet transform of a fingerprint image, as the first step in an optical fingerprint identification process. Wavelet filters are created from computer- generated holograms of biorthogonal wavelets, the same wavelets implemented in the FBI algorithm. Using a detour phase holographic technique, a complex binary filter mask is created with both symmetry and linear phase. The wavelet transform is implemented with continuous shift using an optical correlation between binarized fingerprints written on a Magneto-Optic Spatial Light Modulator and the biorthogonal wavelet filters. A telescopic lens combination scales the transformed fingerprint onto the filters, providing a means of adjusting the biorthogonal wavelet filter dilation continuously. The wavelet transformed fingerprint is then applied to an optical fingerprint identification process. Comparison between normal fingerprints and wavelet transformed fingerprints shows improvement in the optical identification process, in terms of rotational invariance.

  5. Orientation field estimation for latent fingerprint enhancement.

    PubMed

    Feng, Jianjiang; Zhou, Jie; Jain, Anil K

    2013-04-01

    Identifying latent fingerprints is of vital importance for law enforcement agencies to apprehend criminals and terrorists. Compared to live-scan and inked fingerprints, the image quality of latent fingerprints is much lower, with complex image background, unclear ridge structure, and even overlapping patterns. A robust orientation field estimation algorithm is indispensable for enhancing and recognizing poor quality latents. However, conventional orientation field estimation algorithms, which can satisfactorily process most live-scan and inked fingerprints, do not provide acceptable results for most latents. We believe that a major limitation of conventional algorithms is that they do not utilize prior knowledge of the ridge structure in fingerprints. Inspired by spelling correction techniques in natural language processing, we propose a novel fingerprint orientation field estimation algorithm based on prior knowledge of fingerprint structure. We represent prior knowledge of fingerprints using a dictionary of reference orientation patches. which is constructed using a set of true orientation fields, and the compatibility constraint between neighboring orientation patches. Orientation field estimation for latents is posed as an energy minimization problem, which is solved by loopy belief propagation. Experimental results on the challenging NIST SD27 latent fingerprint database and an overlapped latent fingerprint database demonstrate the advantages of the proposed orientation field estimation algorithm over conventional algorithms.

  6. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    PubMed Central

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-01-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm−1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light–matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon–phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications. PMID:27460765

  7. Far-field nanoscale infrared spectroscopy of vibrational fingerprints of molecules with graphene plasmons

    NASA Astrophysics Data System (ADS)

    Hu, Hai; Yang, Xiaoxia; Zhai, Feng; Hu, Debo; Liu, Ruina; Liu, Kaihui; Sun, Zhipei; Dai, Qing

    2016-07-01

    Infrared spectroscopy, especially for molecular vibrations in the fingerprint region between 600 and 1,500 cm-1, is a powerful characterization method for bulk materials. However, molecular fingerprinting at the nanoscale level still remains a significant challenge, due to weak light-matter interaction between micron-wavelengthed infrared light and nano-sized molecules. Here we demonstrate molecular fingerprinting at the nanoscale level using our specially designed graphene plasmonic structure on CaF2 nanofilm. This structure not only avoids the plasmon-phonon hybridization, but also provides in situ electrically-tunable graphene plasmon covering the entire molecular fingerprint region, which was previously unattainable. In addition, undisturbed and highly confined graphene plasmon offers simultaneous detection of in-plane and out-of-plane vibrational modes with ultrahigh detection sensitivity down to the sub-monolayer level, significantly pushing the current detection limit of far-field mid-infrared spectroscopies. Our results provide a platform, fulfilling the long-awaited expectation of high sensitivity and selectivity far-field fingerprint detection of nano-scale molecules for numerous applications.

  8. A support vector machine approach for truncated fingerprint image detection from sweeping fingerprint sensors.

    PubMed

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-03-31

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates.

  9. A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

    PubMed Central

    Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

    2015-01-01

    A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

  10. Graphene Nanopres for DNA Fingerprinting

    NASA Astrophysics Data System (ADS)

    Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

    2013-03-01

    The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

  11. Self-assembled dynamic 3D fingerprints in liquid-crystal coatings towards controllable friction and adhesion.

    PubMed

    Liu, Danqing; Broer, Dirk J

    2014-04-25

    Chiral-nematic polymer network coatings form a "fingerprint" texture through self-assembly. For this purpose the molecular helix of the coating is oriented parallel to the substrate. The coating has a flat surface but when actuated by light in the presence of a copolymerized azobenzene compound, 3D fingerprint structures appear in the coating. The helix forms protrusions at the positions where the molecules are aligned parallel to the surface and withdraws at the positions where the orientation is perpendicular. This process proceeds rapidly and is reversible, that is, the fingerprint-shaped protrusions disappear when the light is switched off. The texture in the on-state resembles that of a human fingerprint and is used to manipulate the gripping friction of a robotic finger. The friction coefficient drops by a factor of four to five when the fingerprint switched on because of reduced surface contacts.

  12. FROG - Fingerprinting Genomic Variation Ontology.

    PubMed

    Abinaya, E; Narang, Pankaj; Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: "FingeRprinting Ontology of Genomic variations" is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog.

  13. A novel approach for fingerprinting mummified hands.

    PubMed

    Fields, Roy; Molina, D Kimberley

    2008-07-01

    Fingerprinting has long been used as a method for identifying bodies and, since first discovered, many advances have been made in both fingerprint acquisition and interpretation. However, in the field of forensic pathology, the attainment of fingerprints from mummified bodies has remained difficult. The most common technique historically used to obtain fingerprints in these cases usually employs the amputation of the fingers combined with soaking and/or injecting the fingers with various solutions in order to enhance the fingerprints. A novel approach to fingerprinting mummified fingers is presented which involves removal and rehydration of the fingerpads (including the epidermal, dermal, and adipose tissues) followed by inking and rolling, using a gloved finger for support. The technique presented produces a superior quality of print without amputation of the finger, yielding excellent results and assisting in obtaining positive identification.

  14. Proteomic analysis in Daphnia magna exposed to As(III), As(V) and Cd heavy metals and their binary mixtures for screening potential biomarkers.

    PubMed

    Le, Thai-Hoang; Lim, Eun-Suk; Hong, Nam-Hui; Lee, Sung-Kyu; Shim, Yon Sik; Hwang, Jin Rae; Kim, Yang-Hoon; Min, Jiho

    2013-11-01

    In this study, the effects of three widespread heavy metals, As(III), As(V) and Cd, and their binary mixtures on the proteomic profile in D. magna were examined to screen novel protein biomarkers using the two-dimensional gel electrophoresis method (2DE). Ten 20d daphnia were exposed to the LC20 concentrations for each of a total of 8 treatments, including the control, As(III), As(V), Cd, [As(III)+As(V)], [As(III)+Cd], [As(V)+Cd], and [As(III), As(V), Cd], for 24h before protein isolation. Three replicates were performed for each treatment. These protein samples were employed for 2DE experiments with a pH gradient gel strip from pH 3 to pH 10. The protein spots were detected by a silver staining process and their intensities were analyzed by Progenesis software to discover the differentially expressed proteins (DEPs) in response to each heavy metal. A total of 117 differentially expressed proteins (DEPs) were found in daphnia responding to the 8 treatments and mapped onto a 2D proteome map, which provides some information of the molecular weight (MW) and pI value for each protein. All of these DEPs are considered as potential candidates for protein biomarkers in D. magna for detecting heavy metals in the aquatic ecosystem. Comparing the proteomic results among these treatments suggested that exposing D. magna to binary mixtures of heavy metals may result in some complex interactive molecular responses within them, rather than just the simple sum of the proteomic profiles of the individual chemicals, (As(III), As(V), and Cd).

  15. An objective fingerprint quality-grading system.

    PubMed

    Pulsifer, Drew P; Muhlberger, Sarah A; Williams, Stephanie F; Shaler, Robert C; Lakhtakia, Akhlesh

    2013-09-10

    The grading of fingerprint quality by fingerprint examiners as currently practised is a subjective process. Therefore, an objective system was devised to remove the subjectivity. The devised grading system is quantitative and uses three separate, easily available, software packages to ultimately identify the portions of a fingerprint that correspond to low-, medium-, and high-quality definitive minutiae as defined on the Universal Latent Workstation of the US Federal Bureau of Investigation.

  16. Fingerprinting Software Defined Networks and Controllers

    DTIC Science & Technology

    2015-03-01

    FINGERPRINTING SOFTWARE DEFINED NETWORKS AND CONTROLLERS THESIS Zachary J. Zeitlin, 2nd Lt, USAF AFIT-ENG-MS-15-M-067 DEPARTMENT OF THE AIR FORCE AIR...copyright protection in the United States. AFIT-ENG-MS-15-M-067 FINGERPRINTING SOFTWARE DEFINED NETWORKS AND CONTROLLERS THESIS Presented to the Faculty...B.S.C.S. 2nd Lt, USAF March 2015 DISTRIBUTION STATEMENT A: APPROVED FOR PUBLIC RELEASE; DISTRIBUTION UNLIMITED AFIT-ENG-MS-15-M-067 FINGERPRINTING SOFTWARE

  17. On relative distortion in fingerprint comparison.

    PubMed

    Kalka, Nathan D; Hicklin, R Austin

    2014-11-01

    When fingerprints are deposited, non-uniform pressure in conjunction with the inherent elasticity of friction ridge skin often causes linear and non-linear distortions in the ridge and valley structure. The effects of these distortions must be considered during analysis of fingerprint images. Even when individual prints are not notably distorted, relative distortion between two prints can have a serious impact on comparison. In this paper we discuss several metrics for quantifying and visualizing linear and non-linear fingerprint deformations, and software tools to assist examiners in accounting for distortion in fingerprint comparisons.

  18. The connecting link! Lip prints and fingerprints

    PubMed Central

    Negi, Amita; Negi, Anurag

    2016-01-01

    Background: Lip prints and fingerprints are considered to be unique to each individual. The study of fingerprints and lip prints is very popular in personal identification of the deceased and in criminal investigations. Aims: This study was done to find the predominant lip and fingerprint patterns in males and females in the North Indian population and also to find any correlation between lip print and fingerprint patterns within a gender. Materials and Methods: Two hundred students (100 males, 100 females) were included in the study. Lip prints were recorded for each individual using a dark-colored lipstick and the right thumb impression was recorded using an ink pad. The lip prints and fingerprints were analyzed using a magnifying glass. The Chi-square test was used for statistical analysis. Results: The branched pattern in males and the vertical pattern in females were the predominant lip print patterns. The predominant fingerprint pattern in both males and females was found to be the loop pattern, followed by the whorl pattern and then the arch pattern. No statistically significant correlation was found between lip prints and fingeprints. However, the arch type of fingerprint was found to be associated with different lip print patterns in males and females. Conclusion: Lip prints and fingerprints can be used for personal identification in a forensic scenario. Further correlative studies between lip prints and fingerprints could be useful in forensic science for gender identification. PMID:28123281

  19. Fingerprint imaging of dry finger using photoacoustics.

    PubMed

    Choi, Won Young; Park, Kwan Kyu

    2017-03-01

    Fingerprint imaging has been widely used in biometric identification systems. This work presents a photoacoustic (PA) fingerprint imaging system that provides acoustic resolution using a pulsed laser and focused ultrasound transducer operating as a receiver. This PA system can measure dry fingers with a wide-range laser field based on the differences in the ultrasound coupling between the fingertip areas contacting and not contacting a solid plate. To demonstrate and validate the image accuracy of the PA system, PA fingerprint images were compared to images captured using a pulse-echo ultrasound system and an ink-pressed fingerprint scan.

  20. Toxicity of three strobilurins (kresoxim-methyl, pyraclostrobin, and trifloxystrobin) on Daphnia magna.

    PubMed

    Cui, Feng; Chai, Tingting; Liu, Xiaoxu; Wang, Chengju

    2017-01-01

    Strobilurins constitute a new class of fungicides that is the most widely used in the world. The present study was conducted to investigate the aquatic toxicity of 3 common strobilurin fungicides (kresoxim-methyl, pyraclostrobin, and trifloxystrobin) to Daphnia magna. The neonate acute immobilization test showed that the 48-h 50% effective concentration (EC50) values of kresoxim-methyl, pyraclostrobin, and trifloxystrobin were 443.3 µg/L, 20.9 µg/L, and 23.0 µg/L, respectively. In addition, the 3 strobilurins significantly induced activity of the important detoxification enzyme glutathione S-transferase (GST) in D. magna, and there was a significant positive relationship between GST activity and immobility of D. magna after acute exposure. The 3 strobilurins showed higher toxicity to D. magna embryos, and the 48-h EC50 were 157.3 µg/L, 3.9 µg/L, and 1.7 µg/L for kresoxim-methyl, pyraclostrobin, and trifloxystrobin, respectively. The 21-d chronic test revealed that the strobilurins could also significantly affect the reproduction, development, and growth of D. magna at sublethal concentrations. The lowest-observed-effect concentrations of kresoxim-methyl, pyraclostrobin, and trifloxystrobin for reproduction were 20 µg/L, 0.15 µg/L, and 0.2 µg/L, respectively, which were close to environmental concentrations. The findings indicate that strobilurin fungicides are very toxic to D. magna and they are sufficient to cause harm to D. magna at environmentally relevant concentrations. Environ Toxicol Chem 2017;36:182-189. © 2016 SETAC.

  1. Experimental infection of liver flukes, Fasciola hepatica and Fascioloides magna, in Bison (Bison bison).

    PubMed

    Foreyt, William J; Drew, M L

    2010-01-01

    This experimental study was conducted to evaluate the susceptibility of American bison (Bison bison) to liver flukes, Fascioloides magna and Fasciola hepatica. Six bison were each experimentally inoculated with 600 metacercariae of Fascioloides magna, and three were later treated with triclabendazole suspension at 40 mg/kg of body weight. Four additional bison were each experimentally inoculated with 600 metacercariae of Fasciola hepatica. Five control bison were placebo controls. Two controls and all inoculated bison were euthanized 10 mo (Fascioloides magna) and 7 mo (Fasciola hepatica) after inoculation. None of the control bison or the bison inoculated with Fascioloides magna had flukes or lesions characteristic of fluke infection at necropsy. All four bison inoculated with Fasciola hepatica had characteristic liver fluke lesions at necropsy, and three of four bison contained four, 103, and 111 adult flukes, respectively. Fluke eggs were detected in feces of all Fasciola hepatica-inoculated bison during the experiment, but not from the Fascioloides magna-infected bison or control bison. Clinical signs of infection were not observed during the experiment, but hemoglobin and packed cell volumes were lower in the Fasciola hepatica bison when compared to controls, and eosinophil levels were increased. Triclabendazole at 40 mg/kg of body weight appeared to be safe in bison because no toxic reactions were observed. Results from this study indicated bison are susceptible to infection with Fasciola hepatica and are efficient definitive hosts. Because no Fascioloides magna were recovered, bison may have a decreased susceptibility or innate resistance to Fascioloides magna infection, which may account for a lack of reported infections in this host.

  2. Molecular tools used in agriculture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A summary of molecular tools used for research in agriculture were presented. Examples of DNA sequencing, library preparation, use of fingerprinting for pathogens and plant crops, high throughput sequencing, whole-genome amplification, reporter genes, and other methods....

  3. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    PubMed

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

  4. Toxicity of cerium and thorium on Daphnia magna.

    PubMed

    Ma, Yuhui; Wang, Jingkun; Peng, Can; Ding, Yayun; He, Xiao; Zhang, Peng; Li, Na; Lan, Tu; Wang, Dongqi; Zhang, Zhaohui; Sun, Fuhong; Liao, Haiqing; Zhang, Zhiyong

    2016-12-01

    Cerium (Ce) and thorium (Th) are always thought to be chemically similar and have comparable toxic properties on living organisms. In the present study, the acute and chronic toxicity of these two elements to freshwater crustacean Daphnia magna were investigated in the modified reconstituted water (6mg/L KCl, 123mg/L MgSO4·7H2O, and 294mg/L CaCl2·2H2O in Milli-Q water, pH 7.8). It seemed that Ce and Th had comparable acute toxicity on Daphnia: 24/48h EC50 for Th and Ce were 7.3/4.7μM and 16.4/10.7μM, respectively. However, Ce was present as soluble ions while all of Th was present as particulate ThO2 in the exposure medium. Considering their different chemical forms and bioavailability, the toxic mechanisms of Ce(3+) and ThO2 on Daphnia would be totally different. To our knowledge, this is the first time to investigate the aquatic toxicity of thorium and cerium based on their actual chemical speciation in the exposure medium. The results also suggest that more attention should be paid on the detrimental effect of Th in the form of particulate ThO2.

  5. Silver nanoparticle-specific mitotoxicity in Daphnia magna.

    PubMed

    Stensberg, Matthew C; Madangopal, Rajtarun; Yale, Gowri; Wei, Qingshan; Ochoa-Acuña, Hugo; Wei, Alexander; McLamore, Eric S; Rickus, Jenna; Porterfield, D Marshall; Sepúlveda, Maria S

    2014-12-01

    Silver nanoparticles (Ag NPs) are gaining popularity as bactericidal agents in commercial products; however, the mechanisms of toxicity (MOT) of Ag NPs to other organisms are not fully understood. It is the goal of this research to determine differences in MOT induced by ionic Ag(+) and Ag NPs in Daphnia magna, by incorporating a battery of traditional and novel methods. Daphnia embryos were exposed to sublethal concentrations of AgNO3 and Ag NPs (130-650 ng/L), with uptake of the latter confirmed by confocal reflectance microscopy. Mitochondrial function was non-invasively monitored by measuring proton flux using self-referencing microsensors. Proton flux measurements revealed that while both forms of silver significantly affected proton efflux, the change induced by Ag NPs was greater than that of Ag(+). This could be correlated with the effects of Ag NPs on mitochondrial dysfunction, as determined by confocal fluorescence microscopy and JC-1, an indicator of mitochondrial permeability. However, Ag(+) was more efficient than Ag NPs at displacing Na(+) within embryonic Daphnia, based on inductively coupled plasma-mass spectroscopy (ICP-MS) analysis. The abnormalities in mitochondrial activity for Ag NP-exposed organisms suggest a nanoparticle-specific MOT, distinct from that induced by Ag ions. We propose that the MOT of each form of silver are complementary, and can act in synergy to produce a greater toxic response overall.

  6. Mixture toxicity of flubendazole and fenbendazole to Daphnia magna.

    PubMed

    Puckowski, Alan; Stolte, Stefan; Wagil, Marta; Markiewicz, Marta; Łukaszewicz, Paulina; Stepnowski, Piotr; Białk-Bielińska, Anna

    2017-02-03

    Nowadays, residual amounts of many pharmaceuticals can be found in various environmental compartments including surface and ground waters, soils and sediments as well as biota. Even though they undergo degradability, their environmental discharge is relatively continuous, thus they may be regarded as quasi-persistent contaminants, and are also frequently regarded as emerging organic pollutants. Benzimidazoles, especially flubendazole (FLU) and fenbendazole (FEN), represent two anthelmintic drugs belonging to this group. Although their presence in environmental matrices has been reported, there is relatively little data concerning their (eco)toxicological impact. Furthermore, no data is available on their mixture toxicity. FLU and FEN have been found to have a strong impact on an environmentally important non-target organism - Daphnia magna. Moreover, these compounds are usually present in the environment as a part of pharmaceutical mixtures. Therefore, there is a need to evaluate their mixture toxicity, which was the main aim of this study. Single substance toxicity tests were carried out in parallel with mixture studies of FLU and FEN, with the application of two well established concepts of Concentration Addition (CA) and Independent Action (IA). As a result, both models (CA and IA) were found to underestimate the toxicity of mixtures, however CA yielded more accurate predictions.

  7. Oil sands process-affected water impairs feeding by Daphnia magna.

    PubMed

    Lari, Ebrahim; Steinkey, Dylan; Morandi, Garrett; Rasmussen, Joseph B; Giesy, John P; Pyle, Greg G

    2017-05-01

    Growth in extraction of bitumen from oil sands has raised concerns about influences of this industry on surrounding environments. Water clearance rate (a surrogate of feeding rate by Daphnia magna) in water containing D. magna exposed to oil sands process-affected water (OSPW) and its principal components, dissolved component (DC) and suspended particulate matter (SPM), was reduced to 72, 29, and 59% of controls, respectively. This study also examined several possible mechanisms for the observed changes algal cell density (i.e., feeding rate). There was no change in the digestive enzymes trypsin or amylase when D. magna were exposed to DC or SPM; however, exposure to total OSPW reduced trypsin activity. Mandible rolling or post-abdominal rejections, which are indicators of feeding and palatability of food, were not affected by any exposures to OSPW. Beating of thoracic limbs, which provides water flow toward the feeding groove, was reduced by exposure to SPM or total OSPW. Peristaltic activity was reduced by exposure to DC, which then might result in reduced digestion time in D. magna exposed to DC, SPM or whole OSPW. All treatments caused an increase in numbers of intact algae cells in the hindgut and excreted material. These results suggest that both DC and SPM affect feeding of D. magna by impairing actions of the digestive system, but most probably not by reducing rates of ingestion.

  8. Chronic toxicity of chlordane to Daphnia magna and Ceriodaphnia dubia: a comparative study.

    PubMed

    Manar, Rachid; Vasseur, Paule; Bessi, Hlima

    2012-02-01

    Chronic toxicity of chlordane, an organochlorine insecticide, was assessed on Ceriodaphnia dubia under standardized conditions of testing. Results were compared to Daphnia magna to determine the sensitivity of the two freshwater cladoceran species to this persistent organic pollutant (POP) and to explore the possibility of using the 7-day C. dubia test as an alternative to the 21-day D. magna test in chronic toxicity assessment of POPs. The NOEC-7d value of chlordane on reproduction of C. dubia (2.9 μg/L) was much higher than the NOEC-21d value of D. magna (0.18 μg/L), attesting that the 7-day test on C. dubia was less sensitive than the 21-day reproduction test on D. magna to chlordane. However, extending the period of exposure of C. dubia to chlordane from 7 to 14 days led to a NOEC-14d value similar to the NOEC-21d value in D. magna (0.18 μg/L). This study highlights the usefulness of prolonging the exposure time of the reproduction test in C. dubia from 7 to 14 days to increase the performances of the reproduction test on C. dubia for assessing chronic toxicity of POPs.

  9. Tertiary treatment for wastewater reuse based on the Daphnia magna filtration - comparison with conventional tertiary treatments.

    PubMed

    Serra, Teresa; Colomer, Jordi; Pau, Conxi; Marín, Maribel; Sala, Lluís

    2014-01-01

    Tertiary treatments are required to permit safe reuse of wastewater. The performance of a new biological tertiary treatment based on the filtration by a population of Daphnia magna was studied and compared with the performance of other conventional tertiary treatments such as coagulation-flocculation, settling tank, disc filtration, sand filtering and ultraviolet (UV) light. The analysis was based on the efficiency in the particle removal and Escherichia coli inactivation. The Daphnia magna treatment reduced the concentration of particles with diameters below 30 μm by 35%, depending on abiotic parameters such as water temperature and the hydraulic retention time (HRT). The Daphnia magna filtration increased with water temperature for water temperatures >20 °C, while it remained constant for water temperatures <20 °C. Lower HRTs induced the growth of the Daphnia magna population, maintaining the same water quality. Furthermore, the Daphnia magna treatment inactivated E. coli in 1.2 log units. This inactivation was six times larger than that obtained by the conventional macrofiltration systems analyzed, although lower than the inactivation attained by UV light, which ranged between 1.5 and 4 log units.

  10. The Daphnia magna role to predict the cadmium toxicity of sediment: Bioaccumlation and biomarker response.

    PubMed

    Li, Xiaomin; Peng, Weihua; Jiang, Yanyan; Duan, Yong; Ren, Jinqian; Liu, Yingying; Fan, Wenhong

    2017-04-01

    To evaluate Daphnia magna role to predict the Cd toxicity in contaminated sediment, the Cd accumulation, metallothionein (MT), and mortality of D. magna exposed to overlying water system or water-sediment coexistence system were measured. The mortality, Cd accumulation, and MT in D. magna increased with the increasing Cd content in sediment. The Cd accumulation and MT in D. magna exposed to the coexistence system were significantly higher than those exposed to the overlying water system because of the ingestion of Cd-containing sediments by D. magna. However, the mortality did not significantly differ in the two systems, suggesting that mortality was less sensitive than accumulation and MT. The Cd accumulation/MT index can explain why the two systems had the similar mortality but different Cd accumulation and MT. Not all the percentage composition of nonresidual fractions (e.g., exchangeable, carbonate bound, and organic bound phases) significantly correlated with the difference values of Cd accumulation and MT, as well as Cd accumulation/MT. However, these indexes increased with the percentage composition of the nonresidual fractions, indicating that the distribution of Cd chemical fractions is crucial for its bioavailability and biotoxicity.

  11. FAF and SufA: proteins of Finegoldia magna that modulate the antibacterial activity of histones.

    PubMed

    Murphy, Elizabeth C; Mohanty, Tirthankar; Frick, Inga-Maria

    2014-01-01

    Many bacterial pathogens have developed methods to overcome the defences of the host innate immune system. One such defence is the release of antimicrobial peptides (AMPs). Histones have been found to function as AMPs, in addition to their main biological function of packaging and organising DNA into nucleosomes. In this study, the Gram-positive anaerobic coccus Finegoldia magna was found to bind histones by Western blot and immunoprecipitation analysis. F. magna, which is normally a commensal of the skin and mucous membranes, is also known to act as an opportunistic pathogen and has been isolated from various clinical infection sites. It was found to bind to histones extracted from human skin epidermis through its surface and extracellular adhesion protein FAF. Through FAF binding, F. magna was protected from histone bactericidal activity. Furthermore, the histones were found to be degraded by SufA, a subtilisin-like extracellular serine protease of F. magna. Hence, the results of the present study will give more insight into how F. magna persists both as a commensal organism at the basement membrane of the skin and as an opportunistic pathogen during infection.

  12. Tools for quality control of fingerprint databases

    NASA Astrophysics Data System (ADS)

    Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

    2010-04-01

    Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

  13. DNA Fingerprinting in a Forensic Teaching Experiment

    ERIC Educational Resources Information Center

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  14. Chemical Fingerprinting Program for RSRM Critical Materials

    NASA Technical Reports Server (NTRS)

    McClennen, William H.; Fife, Dennis J.; Killpack, Michael O.; Golde, Rick P.; Cash, Steve (Technical Monitor)

    2002-01-01

    This viewgraph presentation provides information on the chemical fingerprinting of RSRM (Reusable Sold Rocket Motor) components. A chemical fingerprint can be used to identify a material, to differentiate it from similar looking materials, or lead to its source. It can also identify unexpected changes to a vendor or supplier's material, and monitor aging.

  15. Blind camera fingerprinting and image clustering.

    PubMed

    Bloy, Greg J

    2008-03-01

    Previous studies have shown how to "fingerprint" a digital camera given a set of images known to come from the camera. A clustering technique is proposed to construct such fingerprints from a mixed set of images, enabling identification of each image's source camera without any prior knowledge of source.

  16. Integrated fingerprinting in secure digital cinema projection

    NASA Astrophysics Data System (ADS)

    Delannay, Damien; Delaigle, Jean-Francois; Macq, Benoit M. M.; Quisquater, Jean-Jacques; Mas Ribes, Joan M.; Boucqueau, Jean M.; Nivart, Jean-Francois

    2001-12-01

    This paper describes the functional model of a combined conditional access and fingerprinting copyright (-or projectionright) protection system in a digital cinema framework. In the cinema industry, a large part of early movie piracy comes from copies made in the theater itself with a camera. The evolution towards digital cinema broadcast enables watermark based fingerprinting protection systems. Besides an appropriate fingerprinting technology, a number of well defined security/cryptographic tools are integrated in order to guaranty the integrity of the whole system. The requirements are two-fold: On one side, we must ensure that the media content is only accessible at exhibition time (under specific authorization obtained after an ad-hoc film rental agreement) and contains the related exhibition fingerprint. At the other end, we must prove our ability to retrieve the fingerprint information from an illegal copy of the media.

  17. Fingerprint Compression Based on Sparse Representation.

    PubMed

    Shao, Guangqi; Wu, Yanping; A, Yong; Liu, Xiao; Guo, Tiande

    2014-02-01

    A new fingerprint compression algorithm based on sparse representation is introduced. Obtaining an overcomplete dictionary from a set of fingerprint patches allows us to represent them as a sparse linear combination of dictionary atoms. In the algorithm, we first construct a dictionary for predefined fingerprint image patches. For a new given fingerprint images, represent its patches according to the dictionary by computing l(0)-minimization and then quantize and encode the representation. In this paper, we consider the effect of various factors on compression results. Three groups of fingerprint images are tested. The experiments demonstrate that our algorithm is efficient compared with several competing compression techniques (JPEG, JPEG 2000, and WSQ), especially at high compression ratios. The experiments also illustrate that the proposed algorithm is robust to extract minutiae.

  18. Prediction of acute toxicity of emerging contaminants on the water flea Daphnia magna by Ant Colony Optimization-Support Vector Machine QSTR models.

    PubMed

    Aalizadeh, Reza; von der Ohe, Peter C; Thomaidis, Nikolaos S

    2017-03-22

    According to the European REACH Directive, the acute toxicity towards Daphnia magna should be assessed for any industrial chemical with a market volume of more than 1 t/a. Therefore, it is highly recommended to determine the toxicity at a certain confidence level, either experimentally or by applying reliable prediction models. To this end, a large dataset was compiled, with the experimental acute toxicity values (pLC50) of 1353 compounds in Daphnia magna after 48 h of exposure. A novel quantitative structure-toxicity relationship (QSTR) model was developed, using Ant Colony Optimization (ACO) to select the most relevant set of molecular descriptors, and Support Vector Machine (SVM) to correlate the selected descriptors with the toxicity data. The proposed model showed high performance (QLOO(2) = 0.695, Rfitting(2) = 0.920 and Rtest(2) = 0.831) with low root mean square errors of 0.498 and 0.707 for the training and test set, respectively. It was found that, in addition to hydrophobicity, polarizability and summation of solute-hydrogen bond basicity affected toxicity positively, while minimum atom-type E-state of -OH influenced toxicity values in Daphnia magna inversely. The applicability domain of the proposed model was carefully studied, considering the effect of chemical structure and prediction error in terms of leverage values and standardized residuals. In addition, a new method was proposed to define the chemical space failure for a compound with unknown toxicity to avoid using these prediction results. The resulting ACO-SVM model was successfully applied on an additional evaluation set and the prediction results were found to be very accurate for those compounds that fall inside the defined applicability domain. In fact, compounds commonly found to be difficult to predict, such as quaternary ammonium compounds or organotin compounds were outside the applicability domain, while five representative homologues of LAS (non-ionic surfactants) were, on average

  19. Toxicity of aqueous C70-gallic acid suspension in Daphnia magna.

    PubMed

    Seda, Brandon C; Ke, Pu-Chun; Mount, Andrew S; Klaine, Stephen J

    2012-01-01

    The present study assessed the toxic effects of stable aqueous colloidal suspensions of gallic-acid-stabilized C(70) fullerene on Daphnia magna. The suspensions were stabilized through noncovalent surface modification with gallic acid. In addition to whole-organism responses, changes in antioxidative processes in D. magna were quantified. Acute toxicity was observed with 96LC50 for C(70) -gallic acid of 0.4 ± 0.1 mg/L C(70) . Daphnia magna fecundity was significantly reduced in 21-d bioassays at C(70) -gallic aqcid concentrations below quantifiable limits. Antioxidant enzyme activities of glutathione peroxidase and superoxide dismutase as well as lipid peroxidation suggested that exposed organisms experienced oxidative stress. Microscopic techniques used to determine cellular toxicity via apoptosis proved unsuccessful.

  20. Annotation of the Daphnia magna nuclear receptors: comparison to Daphnia pulex.

    PubMed

    Litoff, Elizabeth J; Garriott, Travis E; Ginjupalli, Gautam K; Butler, LaToya; Gay, Claudy; Scott, Kiandra; Baldwin, William S

    2014-11-15

    Most nuclear receptors (NRs) are ligand-dependent transcription factors crucial in homeostatic physiological responses or environmental responses. We annotated the Daphnia magna NRs and compared them to Daphnia pulex and other species, primarily through phylogenetic analysis. Daphnia species contain 26 NRs spanning all seven gene subfamilies. Thirteen of the 26 receptors found in Daphnia species phylogenetically segregate into the NR1 subfamily, primarily involved in energy metabolism and resource allocation. Some of the Daphnia NRs, such as RXR, HR96, and E75 show strong conservation between D. magna and D. pulex. Other receptors, such as EcRb, THRL-11 and RARL-10 have diverged considerably and therefore may show different functions in the two species. Curiously, there is an inverse association between the number of NR splice variants and conservation of the LBD. Overall, D. pulex and D. magna possess the same NRs; however not all of the NRs demonstrate high conservation indicating the potential for a divergence of function.

  1. Correlation between heavy metal acute toxicity values in Daphnia magna and fish

    SciTech Connect

    Khangarot, B.S.; Ray, P.K.

    1987-04-01

    In the toxicant bioassays, invertebrates with special reference to aquatic arthropod species have been of recent interest as test models due to the need for developing nonmammalian tests system. The cladoceran Daphnia magna bioassays have several practical advantages. D. magna has been used as a useful test species and its sensitivity to environmental pollutants have been recognized as a general representative of other freshwater zooplankton species. The objectives of this study were to determine the acute toxicity of various heavy metals to Daphnia magna for 48 h of exposure and to compare these values with the existing LC50 values for rainbow trout (Salmo gairdneri); which is commonly used as a test animal in aquatic bioassay studies.

  2. A comparison of the toxicity of 30 reference chemicals to Daphnia magna and Daphnia pulex

    SciTech Connect

    Lilius, H.; Haestbacka, T.; Isomaa, B.

    1995-12-01

    To determine whether significant differences exist in the sensitivity of different Daphnia species to toxicants, the acute toxicity of the first 30 MEIC (multicenter evaluation of in vitro cytotoxicity) reference chemicals was determined in two species of Daphnia: D. magna and D. pulex. Correlation and regression analysis of the EC50 data for immobilization showed a very good concordance (r = 0.97, slope = 1.02). A comparison between the EC50 data obtained for D. magna by two laboratories independently for the 50 MEIC chemicals also showed a good concordance (r = 0.93, slope = 0.91). In both comparisons the regression line did not differ significantly from the regression line for a 1:1 regression. The authors conclude that their study, including a set of reference chemicals, indicates that is no difference in the overall sensitivity of the two Daphnia species and the two clones of D. magna.

  3. In vivo biodegradation of colloidal quantum dots by a freshwater invertebrate, Daphnia magna.

    PubMed

    Kwon, Dongwook; Kim, Min Jung; Park, Chansik; Park, Jaehong; Choi, Kyungho; Yoon, Tae Hyun

    2012-06-15

    Impacts of planktonic invertebrate, Daphnia magna, on the speciation of colloidal quantum dots (QD) were investigated using fluorescence spectromicroscopic technique. Well-dispersed (GA/TOPO)QD were prepared by forming a supramolecular assembly of hydrophobic (TOPO)QD with biomacromolecules (i.e., Gum Arabic, GA). Biological degradation of this nanomaterial was monitored by fluorescence spectromicroscopic methods. Our study confirmed the major uptake pathway of manufactured nanomaterials and in vivo biodegradation processes in a well-known toxicity test organism, D. magna. In addition, we also found that D. magna can induce significant deterioration of aquatic media by releasing fragments of partially degraded QD colloids. These biological processes may significantly change the predicted toxicities of nanomaterials in aquatic environments. Thus, we propose that the impacts of aquatic living organisms on the environmental fate of manufactured nanomaterials (MNs) should be carefully taken into account when assessing the risk of MNs to the environment and human health.

  4. [Studying intermediatory regulation of heart rhythm using Daphnia magna as the alternative test object].

    PubMed

    Podosinovikova, N P; Beliaev, V A; Dolgo-Saburov, V B

    2009-01-01

    A functional test using Daphnia magna Straus hydrobionts is proposed for studying the role of intermediatory relationships in the heart rate (HR) regulation. It is established that the M-cholinomimetic carbamylcholine increases for two hours and decreases after 24 hours the HR in D. magna. Caffeine (a nonselective antagonist of adenosine receptors) potentiates the action of carbamylcholine during the first hour and then ceases to influence the drug effect. Caffeine normalizes the HR rate D magna, which was decreased by the cholinolytic atropine and the beta-adrenolytic atenolol. The possibilities of using the proposed test for the investigation of intermediatory relationships in the HR regulation, rapid analysis of the cardiothropic action of xenobiotics, and the primary screening of drugs for the pharmacological correction of HR disturbances are discussed.

  5. [Final thermal preference in parthenogenetic females of Daphnia magna Straus (Crustacea: Cladocera) acclimated to various temperatures].

    PubMed

    Verbitskiĭ, V B; Verbitskaia, T I

    2011-01-01

    The final thermal preference (FTP) range in parthenogenetic females of cladoceran Daphnia magna was assessed by "acute" and "chronic" methods. The first method included 4-month acclimation to different temperatures in the range of 14.2 +/- 0.7 to 27.1 +/- 0.3 degrees C; the "chronic" method was characterized by long-term acclimation to +20 degrees C. Two ranges of FTP were found for D. magna, 13.3-15.4 degrees C and 20.2-26.2 degrees C. The thermal preference ofdaphnids and the temperature of acclimation were correspondingly linearly. The range of FTP was independent of the season. The food-searching activity of D. magna rose in April, when the FTP range increased, and the FTP was less pronounced.

  6. Encoding protein-ligand interaction patterns in fingerprints and graphs.

    PubMed

    Desaphy, Jérémy; Raimbaud, Eric; Ducrot, Pierre; Rognan, Didier

    2013-03-25

    We herewith present a novel and universal method to convert protein-ligand coordinates into a simple fingerprint of 210 integers registering the corresponding molecular interaction pattern. Each interaction (hydrophobic, aromatic, hydrogen bond, ionic bond, metal complexation) is detected on the fly and physically described by a pseudoatom centered either on the interacting ligand atom, the interacting protein atom, or the geometric center of both interacting atoms. Counting all possible triplets of interaction pseudoatoms within six distance ranges, and pruning the full integer vector to keep the most frequent triplets enables the definition of a simple (210 integers) and coordinate frame-invariant interaction pattern descriptor (TIFP) that can be applied to compare any pair of protein-ligand complexes. TIFP fingerprints have been calculated for ca. 10,000 druggable protein-ligand complexes therefore enabling a wide comparison of relationships between interaction pattern similarity and ligand or binding site pairwise similarity. We notably show that interaction pattern similarity strongly depends on binding site similarity. In addition to the TIFP fingerprint which registers intermolecular interactions between a ligand and its target protein, we developed two tools (Ishape, Grim) to align protein-ligand complexes from their interaction patterns. Ishape is based on the overlap of interaction pseudoatoms using a smooth Gaussian function, whereas Grim utilizes a standard clique detection algorithm to match interaction pattern graphs. Both tools are complementary and enable protein-ligand complex alignments capitalizing on both global and local pattern similarities. The new fingerprint and companion alignment tools have been successfully used in three scenarios: (i) interaction-biased alignment of protein-ligand complexes, (ii) postprocessing docking poses according to known interaction patterns for a particular target, and (iii) virtual screening for bioisosteric

  7. Development of Quantitative Structure-Activity Relationship Models for Predicting Chronic Toxicity of Substituted Benzenes to Daphnia Magna.

    PubMed

    Fan, Deling; Liu, Jining; Wang, Lei; Yang, Xianhai; Zhang, Shenghu; Zhang, Yan; Shi, Lili

    2016-05-01

    The chronic toxicity of anthropogenic molecules such as substituted benzenes to Daphnia magna is a basic eco-toxicity parameter employed to assess their environmental risk. As the experimental methods are laborious, costly, and time-consuming, development in silico models for predicting the chronic toxicity is vitally important. In this study, on the basis of five molecular descriptors and 48 compounds, a quantitative structure-property relationship model that can predict the chronic toxicity of substituted benzenes were developed by employing multiple linear regressions. The correlation coefficient (R (2)) and root-mean square error (RMSE) for the training set were 0.836 and 0.390, respectively. The developed model was validated by employing 10 compounds tested in our lab. The R EXT (2) and RMSE EXT for the validation set were 0.736 and 0.490, respectively. To further characterizing the toxicity mechanism of anthropogenic molecules to Daphnia, comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) models were developed.

  8. Slowflow fingerprints of urban hydrology

    NASA Astrophysics Data System (ADS)

    Schwartz, Stuart S.; Smith, Brennan

    2014-07-01

    Urban streamflow is commonly characterized by increased peak discharges and runoff volumes. Slowflow integrates altered storage and transit times affecting urban recharge and drainage, resulting in a highly variable indeterminate urban slowflow response. This study introduces the use of multiple baseflow metrics to characterize and interpret the dominant processes driving urban slowflow response. Slowflow characteristics derived from USGS streamflow records are used to quantify the patterns of hydrologic alteration across the rural-to-urban landuse gradient in the Piedmont watersheds of the Baltimore Ecosystem Study (BES), an NSF Urban Long Term Ecological Research (LTER) site in the Baltimore Metropolitan area. We interpret multimetric slowflow response from a top-down perspective, learning from data, in order to draw dominant process inferences from observed slowflow. When characterized by a single slowflow metric such as the baseflow index, urban slowflow response can exhibit equifinality and is not reliably predicted a priori. Multimetric analysis quantifies distinct differences in urban slowflow response, framing testable hypotheses and refined experimental designs to elucidate the dominant processes driving urban slowflow. Multimetric fingerprinting offers a consistent framework for interpreting urban slowflow response, constrained by the equifinality of single slowflow metrics and the inherent limitations on process inferences that can be drawn from gauged streamflow alone. Heterogeneity of observed slowflow belies the simple paradigm of a single consistent type of urban slowflow response. In contrast, we suggest a conceptual typology of urban slowflow response, framing a conceptual mixing model of dominant process endpoints that shape the slowflow fingerprints of urban hydrology.

  9. FROG - Fingerprinting Genomic Variation Ontology

    PubMed Central

    Bhardwaj, Anshu

    2015-01-01

    Genetic variations play a crucial role in differential phenotypic outcomes. Given the complexity in establishing this correlation and the enormous data available today, it is imperative to design machine-readable, efficient methods to store, label, search and analyze this data. A semantic approach, FROG: “FingeRprinting Ontology of Genomic variations” is implemented to label variation data, based on its location, function and interactions. FROG has six levels to describe the variation annotation, namely, chromosome, DNA, RNA, protein, variations and interactions. Each level is a conceptual aggregation of logically connected attributes each of which comprises of various properties for the variant. For example, in chromosome level, one of the attributes is location of variation and which has two properties, allosomes or autosomes. Another attribute is variation kind which has four properties, namely, indel, deletion, insertion, substitution. Likewise, there are 48 attributes and 278 properties to capture the variation annotation across six levels. Each property is then assigned a bit score which in turn leads to generation of a binary fingerprint based on the combination of these properties (mostly taken from existing variation ontologies). FROG is a novel and unique method designed for the purpose of labeling the entire variation data generated till date for efficient storage, search and analysis. A web-based platform is designed as a test case for users to navigate sample datasets and generate fingerprints. The platform is available at http://ab-openlab.csir.res.in/frog. PMID:26244889

  10. DNA fingerprints come to court

    SciTech Connect

    Not Available

    1988-04-15

    DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person.

  11. Phototoxicity and chronic toxicity of methyl paraben and 1,2-hexanediol in Daphnia magna.

    PubMed

    Lee, Jiyun; Park, Nayeon; Kho, Younglim; Lee, Kiyoung; Ji, Kyunghee

    2017-01-01

    Parabens are used as antimicrobial preservatives in consumer products. Exposure to methylparaben (MP) has been associated with adverse health outcomes, therefore, an alternative compound, 1,2-hexanediol (1,2-H), has been applied for cosmetics. In the present study, the phototoxicity of MP and 1,2-H, as well as the toxic effect caused by chronic exposure, were investigated using Daphnia magna. The 48 h acute toxicity tests with D. magna were conducted under indoor or ultraviolet (UV) light irradiation conditions, i.e., exposure to 4 h/d sunlight. Changes in the transcription of genes related to oxidative stress were determined in D. magna juveniles, to investigate the underlying mechanism of phototoxicity. The 21 d chronic toxicity tests of MP and 1,2-H were performed under indoor light irradiation. Exposure to MP under environmental level of UV light was more detrimental to D. magna. Transcripts of catalase and glutathione-S-transferase genes in D. magna was significantly increased by co-exposure to MP and UV light. After 21 d of chronic exposure to MP and 1,2-H, the reproduction no-observed effect concentrations for D. magna were 1 and >10 mg/L, respectively. The present study showed that exposure to UV could magnify the toxicity of MP on daphnids. Although acute and chronic toxicities of 1,2-H were generally lower than those of MP, its effects on other aquatic organisms should not be ignored. Further studies are needed to identify other mechanisms of MP phototoxicity.

  12. A Study on the D. magna and V. fischeri Toxicity Relationship of Industrial Wastewater from Korea

    NASA Astrophysics Data System (ADS)

    Pyo, S.; Lee, S.; Chun Sang, H.; Park, T. J.; Kim, M. S.

    2015-12-01

    It is well known that high concentration of TDS (total dissolved solid) in industrial effluent gives rise to the toxicity to the Daphnia magna toxicity test. D. magna is vulnerable to relatively low TDS concentration showing the 24-hr EC50 of Salinity 0.6% (as the sea salt concentration). Recently, standard mandatory toxicity testing using Daphnia magna has been used to monitor industrial effluent toxicity according to Korea standard method (Acute Toxicity Test Method of the Daphnia magna Straus (Cladocera, Crustacea), ES 04704. 1a) under regulation. Since only one acute toxicity testing is applied in the present, we are trying to introduce microbial battery for more complete toxicity assessment. In this study, the acute toxicities between daphnids and microbes were compared. The results of D. magna and Vibrio fischeri toxicity test from 165 industrial wastewater effluents showed high positive correlation. In addition, the possibility of predicting daphnia toxicity from the bacterial toxicity data amounts to 92.6% if we consider salinity effect (>5ppt) together. From this study, we found that the V. fischeri toxicity test is a powerful battery tool to assess the industrial wastewater toxicity. Here, we suggest that luminescent bacteria toxicity test be useful not only for complete toxicity assessment which can't be obtained by daphnia toxicity testing only but also for the reduction cost, time, and labor in the Korean society. Keywords : D. magna, V. fischeri, Industrial waste water, battery test Acknowledgement This research was supported by a grant (15IFIP-B089908-02) from Plant Research Program funded by Ministry of Land, Infrastructure and Transport of Korean government

  13. Exploring methods for compositional and particle size analysis of noble metal nanoparticles in Daphnia magna.

    PubMed

    Krystek, Petra; Brandsma, Sicco; Leonards, Pim; de Boer, Jacob

    2016-01-15

    The identification and quantification of the bioaccumulation of noble metal engineered nanoparticles (ENPs) by aquatic organisms is of great relevance to understand the exposure and potential toxicity mechanisms of nanoscale materials. Four analytical scenarios were investigated in relation to various sized and composed noble metal (gold (Au), platinum (Pt) and silver (Ag)) ENPs during acute, short-term exposure of Daphnia (D.) magna. Next to the total elemental quantification of absorbed ENPs by D. magna, especially information on the size and particle distribution of ENPs in D. magna is of relevance. Dissolution of the exposed biological material prior to measurement by asymmetric flow field flow fractionation coupled to inductively coupled plasma mass spectrometry (AF4-ICPMS) is challenging because the ENPs must stay stable regarding to particle size and composition. Next to dissolution of exposed D. magna by tetra methyl ammonium hydroxide (TMAH), a new enzymatic dissolution approach was explored by using trypsin. The presence of various sized and composed ENPs has been confirmed by AF4-ICPMS but the chosen dissolution medium was crucial for the results. TMAH and trypsin led to comparable results for medium-sized (50nm) noble metals ENPs in exposed D. magna. But it was also shown that the dissolution of biological materials with smaller (<5nm) ENPs led to different results in particle size and elemental concentration depending on the selected dissolution medium. A significant uptake of Au and Pt ENPs by D. magna or adsorption to particles occurred because only 1-5% of the exposed ENPs remained in the exposure medium.

  14. Development of an NMR microprobe procedure for high-throughput environmental metabolomics of Daphnia magna.

    PubMed

    Nagato, Edward G; Lankadurai, Brian P; Soong, Ronald; Simpson, André J; Simpson, Myrna J

    2015-09-01

    Nuclear magnetic resonance (NMR) is the primary platform used in high-throughput environmental metabolomics studies because its non-selectivity is well suited for non-targeted approaches. However, standard NMR probes may limit the use of NMR-based metabolomics for tiny organisms because of the sample volumes required for routine metabolic profiling. Because of this, keystone ecological species, such as the water flea Daphnia magna, are not commonly studied because of the analytical challenges associated with NMR-based approaches. Here, the use of a 1.7-mm NMR microprobe in analyzing tissue extracts from D. magna is tested. Three different extraction procedures (D2O-based buffer, Bligh and Dyer, and acetonitrile : methanol : water) were compared in terms of the yields and breadth of polar metabolites. The D2O buffer extraction yielded the most metabolites and resulted in the best reproducibility. Varying amounts of D. magna dry mass were extracted to optimize metabolite isolation from D. magna tissues. A ratio of 1-1.5-mg dry mass to 40 µl of extraction solvent provided excellent signal-to-noise and spectral resolution using (1)H NMR. The metabolite profile of a single daphnid was also investigated (approximately 0.2 mg). However, the signal-to-noise of the (1)H NMR was considerably lower, and while feasible for select applications would likely not be appropriate for high-throughput NMR-based metabolomics. Two-dimensional NMR experiments on D. magna extracts were also performed using the 1.7-mm NMR probe to confirm (1)H NMR metabolite assignments. This study provides an NMR-based analytical framework for future metabolomics studies that use D. magna in ecological and ecotoxicity studies.

  15. Effect of the lipid regulator Gemfibrozil in the Cladocera Daphnia magna at different temperatures.

    PubMed

    Salesa, Beatriz; Ferrando, María D; Villarroel, María J; Sancho, Encarna

    2017-02-23

    In the present study, an ecotoxicological approach to the evaluation of Gemfibrozil (GEM) as an emerging organic pollutant was done. In order to assess its toxicity, tests were conducted using the cladocera Daphnia magna. Experiments were carried out at 22°C and 28°C. EC50, feeding behavior, and chronic toxicity tests (21 days) were evaluated in D. magna exposed to GEM as well as cholesterol levels at 21-day chronic exposure. D. magna GEM EC50 values (24 h) in our experimental conditions were 148.75 and 116.24 mg L(-1) at 22°C and 28°C, respectively. Test concentrations of 0.1, 0.5, 1.0, 5.0 and 7.5 mg L(-1) were selected for subacute and chronic experiments. Subacute short-term test (feeding study) was assessed after exposure to the toxicant. Filtration and ingestion rates of D. magna exposed animals did not show any significant difference (P > 0.05) with respect to control daphniids neither at 22°C nor at 28°C. Therefore, GEM test concentrations used in the present study did not reduce feeding behavior in D. magna. Temperature increased from 22°C to 28°C, which resulted in a decrease of the daphniids reproductive parameters such as brood size and number of young per female. Other parameters as longevity were not affected. The GEM concentrations used in the chronic test with D. magna did not affect daphniids longevity but some reproductive parameters as number of young per female or brood size were affected. Finally, a significant decreased in cholesterol levels was found in those animals exposed to the highest toxicant concentrations. More studies must be done to determine the possible implications of GEM in aquatic fauna and to derive its possible effects on the environment.

  16. Free ionic nickel accumulation and localization in the freshwater zooplankter, Daphnia magna

    SciTech Connect

    Hall, T.M.

    1982-01-01

    The processes which lead to the accumulation of free ionic nickel (radioactive) from solution by Daphnia magna were studied and incorporated into a model which describes accummulation at different concentrations. Adsorption proved to be a relatively small component of nickel accummulation. The accummulation rate eventually approached zero, which represented an equilibrium between uptake and loss of nickel. However, elimination experiments did reveal a pool of relatively static nickel. The appearance and distribution of nickel within five body parts (body fluid, carapace, gut, filtering appendages, and eggs) of D. magna supported the accummulation data and added to the understanding of the pathways of nickel through the organism.

  17. Reproducibility of a life-cycle toxicity test with Daphnia magna

    SciTech Connect

    Parkhurst, B.R.; Forte, J.L.; Wright, G.P.

    1981-01-01

    Standardized chronic life-cycle toxicity testing procedures for aquatic species are described. The reproducibility of chronic toxicity and points using the static-renewal method with Daphnia magna are investigated. The objectives were to determine if the lowest rejected concentrations tested (LRCTs) obtained for six different toxicity criteria in static-renewal tests with acridine were reproducible over time and to determine the relative sensitivity and variability of the toxicity criteria. Two of the six toxicity criteria, numbers of young per brood and the young produced per female, were found to be reliable and sensitive for estimating the LRCT for acridine to D. magna. (RJC)

  18. Effect of vertebrate and invertebrate kairomones on the life history of Daphnia magna Straus (Crustacea: Branchiopoda).

    PubMed

    Chakri, Khemissa; Touati, Laïd; Alfarhan, Ahmed H; Al-Rasheid, Khaled A S; Samraoui, Boudjéma

    2010-01-01

    The history of selection of Daphnia magna populations living in North African temporary ponds may differ from populations inhabiting permanent ponds. Laboratory experiments were conducted to examine the effect of fish Gambusia holbrooki and invertebrate Notonecta glauca kairomones on the life history traits of the freshwater Cladocera Daphnia magna Straus. With fish kairomones, Daphnia reproduced early and had a significantly smaller size at first reproduction (SFR) and a smaller size of neonates compared to control. In contrast, daphnids reared in water treated with Notonecta glauca had no effect on the age at first reproduction but females were also smaller and produced smaller neonates.

  19. Acute toxicity of the herbicide bromoxynil to Daphnia magna

    USGS Publications Warehouse

    Buhl, Kevin J.; Hamilton, Steven J.; Schmulbach, James C.

    1993-01-01

    The acute toxicities of technical-grade bromoxynil octanoate (BO) and two commercial formulations, Buctril® and Bronate®, to < 24-h-old neonate Daphnia magna (Straus) were determined in soft, hard, and oligosaline water. In addition, effects of life stage, feeding, aging the herbicide, and exposure duration on BO toxicity to daphnids were investigated. Regardless of formulation, life stage, and water quality, BO was found to be extremely to highly toxic to daphnids in standard tests; 48-h EC50 values ranged from 41 to 161 m̈g/L. Bromoxynil octanoate was the most toxic to neonates in soft water and the least toxic in hard water. The acute toxicities of the three bromoxynil herbicides to a given age group of daphnids were similar within the same water type. Overall, neonates and 7-d-old adults were more sensitive than 14- or 15-d-old adults to each herbicide. Feeding daphnids during the toxicity test significantly decreased BO toxicity compared to not feeding them. Aging BO (as Buctril) in hard water decreased its toxicity, and the rate of deactivation was rapid, with an estimated half-life of biological activity of 13 h. Daphnids immobilized by exposures to toxic BO concentrations for ≤ 6 h recovered their mobility, whereas exposures of 18 and 24 h to BO produced toxic effects in daphnids similar to those exposed for 48 h. These results indicated that standard continuous exposure tests may not adequately predict the acute toxicity of BO to freshwater animals in the field.

  20. Uncovering Cryptic Asexuality in Daphnia magna by RAD Sequencing.

    PubMed

    Svendsen, Nils; Reisser, Celine M O; Dukić, Marinela; Thuillier, Virginie; Ségard, Adeline; Liautard-Haag, Cathy; Fasel, Dominique; Hürlimann, Evelin; Lenormand, Thomas; Galimov, Yan; Haag, Christoph R

    2015-11-01

    The breeding systems of many organisms are cryptic and difficult to investigate with observational data, yet they have profound effects on a species' ecology, evolution, and genome organization. Genomic approaches offer a novel, indirect way to investigate breeding systems, specifically by studying the transmission of genetic information from parents to offspring. Here we exemplify this method through an assessment of self-fertilization vs. automictic parthenogenesis in Daphnia magna. Self-fertilization reduces heterozygosity by 50% compared to the parents, but under automixis, whereby two haploid products from a single meiosis fuse, the expected heterozygosity reduction depends on whether the two meiotic products are separated during meiosis I or II (i.e., central vs. terminal fusion). Reviewing the existing literature and incorporating recombination interference, we derive an interchromosomal and an intrachromosomal prediction of how to distinguish various forms of automixis from self-fertilization using offspring heterozygosity data. We then test these predictions using RAD-sequencing data on presumed automictic diapause offspring of so-called nonmale producing strains and compare them with "self-fertilized" offspring produced by within-clone mating. The results unequivocally show that these offspring were produced by automixis, mostly, but not exclusively, through terminal fusion. However, the results also show that this conclusion was only possible owing to genome-wide heterozygosity data, with phenotypic data as well as data from microsatellite markers yielding inconclusive or even misleading results. Our study thus demonstrates how to use the power of genomic approaches for elucidating breeding systems, and it provides the first demonstration of automictic parthenogenesis in Daphnia.

  1. Comparative toxicity of leachates from 52 textiles to Daphnia magna.

    PubMed

    Dave, Göran; Aspegren, Pia

    2010-10-01

    The environmental aspects of textiles are very complex and include production, processing, transport, usage, and recycling. Textiles are made from a variety of materials and can contain a large number of chemicals. Chemicals are used during production of fibres, for preservation and colouring and they are released during normal wear and during washing. The aim of this study was to investigate the release to water of toxic chemicals from various textiles. Altogether 52 samples of textiles made from cotton (21), linen (4), cotton and linen (7), cellulose (3), synthetic fibres (7), cotton and synthetic fibres (8) and wool (2). Seven were eco-labelled. All textiles were cut into squares and placed into Petri dishes with 50 ml ISO test medium in a concentration series (4-256 cm(2)/50 ml) and tested for acute toxicity to Daphnia magna. Estimated EC50s were converted into weight/volume, and 48-h EC50s ranged between <1 and >182 g/L. It was not possible to detect any difference between fibre type and toxicity (ANOVA), but a significantly higher toxicity was found for printed versus unprinted cotton and cotton/linen textiles, while the opposite was found for synthetic textiles. Eco-labelled products were evenly distributed on a toxicity scale, which means that eco-labelling in its present form does not necessarily protect users or the environment from exposure to toxic chemicals. Therefore, the results from the present study suggest that bioassays and toxicity tests should become an integrated part of textile environmental quality control programs.

  2. Detection of a novel arginine vasopression defect by dideoxy fingerprinting

    SciTech Connect

    Krishnamani, M.R.S.; Phillips, J.A. III; Copeland, K.C. Univ. of Vermont College of Medicine, Burlington, VT )

    1993-09-01

    Autosomal dominant neurohypophyseal diabetes insipidus is a familial form of diabetes insipidus. This disorder is associated with variable levels of arginine vasopressin (AVP) and diabetes insipidus of varying severity, which responds to exogenous AVP. To determine the molecular basis of autosomal dominant neurohypophyseal diabetes insipidus, the AVP genes of members of a large kindred were analyzed. A new method, called dideoxy fingerprinting, was used to detect an AVP mutation that was characterized by DNA sequencing. The novel defect found changes the last codon of the AVP signal peptide from alanine to threonine, which should perturb cleavage of mature AVP from its precursor protein and inhibit its secretion or action. 18 refs., 3 figs.

  3. DNA fingerprinting. The future of forensic dentistry--a review.

    PubMed

    Diwaker, N R; Rajeshwari; Rao, B

    2001-01-01

    Forensic dental identification is at technological cross roads. The incidence of dental restorations, the mainstay of radiographic dental investigations, have declined. Whereas molecular biology laboratory procedures are rapidly increasing in efficiency and availability. With new typing techniques forensic scientists can characterize individuals at the fundamental level of their DNA, and variations between individuals at this level can be used to discriminated between them. The anatomical location of teeth and the extent to which teeth may suffer environmental changes and still provide useful DNA material has propelled forensic odontology. The techniques of DNS fingerprinting, the role of teeth as a source of DNA material and its feasibility is discussed in relatively simple terms.

  4. Fingerprints of polycyclic aromatic hydrocarbons (PAHs) in infrared absorption spectroscopy.

    PubMed

    Tommasini, Matteo; Lucotti, Andrea; Alfè, Michela; Ciajolo, Anna; Zerbi, Giuseppe

    2016-01-05

    We have analyzed a set of 51 PAHs whose structures have been hypothesized from mass spectrometry data collected on samples extracted from carbon particles of combustion origin. We have obtained relationships between infrared absorption signals in the fingerprint region (mid-IR) and the chemical structures of PAHs, thus proving the potential of IR spectroscopy for the characterization of the molecular structure of aromatic combustion products. The results obtained here for the spectroscopic characterization of PAHs can be also of interest in Materials Science and Astrophysics.

  5. DNA fingerprinting in zoology: past, present, future.

    PubMed

    Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

    2014-02-03

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

  6. DNA fingerprinting of jute germplasm by RAPD.

    PubMed

    Hossain, Mohammad Belayat; Haque, Samiul; Khan, Haseena

    2002-07-31

    The genotype characteristic of cultivars was investigated, along with varieties of both of the jute species, Corchorus olitorius and Corchorus capsularis, in the germplasm collection at the Bangladesh Jute Research Institute (BJRI). DNA fingerprinting was generated for 9 different varieties and 12 accessions of jute cultivars by using random amplified polymorphic DNA (RAPD). A total of 29 arbitrary oligonucleotide primers were screened. Seven primers gave polymorphism within the varieties, and 6 primers detected polymorphism within the accessions that were tested. A dendrogram was engendered from these data, and this gave a distinct clustering of the cultivated species of jute. Therefore, we generated RAPD markers, which are species-specific. These primers can distinguish between C. olitorius and C. capsularis. From the dendrogram that we generated between the various members of these two species, we found the existing genetic classification that agrees with our molecular marking data. A different dendrogram showed that jute accessions could be clustered into three groups. These data will be invaluable in the conservation and utilization of the genetic pool in the germplasm collection.

  7. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  8. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  9. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  10. 8 CFR 236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 236.5 Section... to Order of Removal § 236.5 Fingerprints and photographs. Every alien 14 years of age or older... by service of a notice to appear shall be fingerprinted and photographed. Such fingerprints...

  11. Fingerprint Minutiae from Latent and Matching Tenprint Images

    National Institute of Standards and Technology Data Gateway

    NIST Fingerprint Minutiae from Latent and Matching Tenprint Images (PC database for purchase)   NIST Special Database 27 contains latent fingerprints from crime scenes and their matching rolled fingerprint mates. This database can be used to develop and test new fingerprint algorithms, test commercial and research AFIS systems, train latent examiners, and promote the ANSI/NIST file format standard.

  12. Mated Fingerprint Card Pairs 2 (MFCP2)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs 2 (MFCP2) (PC database for purchase)   NIST Special Database 14 is being distributed for use in development and testing of automated fingerprint classification and matching systems on a set of images which approximate a natural horizontal distribution of the National Crime Information Center (NCIC) fingerprint classes. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  13. Errors in spectral fingerprints and their effects on climate fingerprinting accuracy in the solar spectrum

    NASA Astrophysics Data System (ADS)

    Jin, Zhonghai; Sun, Moguo

    2017-02-01

    Using the Earth's reflected solar spectrum for climate change fingerprinting is an emerging research area. The spectral fingerprinting approach directly retrieves the changes in climate variables from the mean spectral data averaged across large space and time scales. To investigate this fingerprinting concept, we use ten years of satellite data to simulate the monthly and annual mean reflected solar spectra and the associated spectral fingerprints for different regions over the ocean. The interannual variations in the spectral data are derived and attributed to the interannual variations in the relevant climate variables. The fingerprinting retrieved changes in climate variables are then compared with the actual underlying variable changes from the observational data to evaluate the fingerprinting retrieval accuracy. Two important errors related to the fingerprinting approach, the nonlinearity error and the averaging error in the mean fingerprints, and their impact on the retrieval accuracy, are investigated. It is found that the averaging error increases but the nonlinearity error decreases as the region size increases. The averaging error has minimal effect on the fingerprinting retrieval accuracy in small regions but has more of an impact in large regions. In comparison, the effect of nonlinearity error on the retrieval accuracy decreases as the region size increases. It is also found that the fingerprinting retrieval accuracy is more sensitive to the nonlinearity error than to the averaging error. In addition, we compare the fingerprinting accuracy between using the monthly mean data and the annual mean data. The results show that on average higher retrieval accuracy is achieved when the annual mean data are used for the fingerprinting retrieval.

  14. The effect of lead from sediment bioturbation by Lumbriculus variegatus on Daphnia magna in the water column.

    PubMed

    Blankson, Emmanuel R; Klerks, Paul L

    2016-12-01

    The present study investigated the bioavailability and potential toxicity to Daphnia magna of lead released to the water column due to bioturbation by Lumbriculus variegatus. Experiments used microcosms with Pb-spiked sediment, with or without worms in the sediment, and with D. magna present in the water column. The daphniids were allowed free movement or were restricted to flow-through containers, in order to assess the influence of their direct contact with the contaminated sediment. A control group consisted of D. magna in clean moderately hard reconstituted water. At the end of the 12-day experiment, D. magna survival, reproduction, biomass, and Pb-bioaccumulation were determined. Water column turbidity and Pb levels were quantified to assess their influence on the Pb toxicity and bioaccumulation. The bioturbation by L. variegatus increased Pb levels and turbidity in the water column. While this resulted in an increased Pb bioaccumulation by the D. magna, the water column Pb levels and the Pb bioaccumulation were insufficient to bring about toxic effects for the survival, reproduction, and biomass of the daphniids. Contact of D. magna with the sediment resulted in an increase in their Pb bioaccumulation, with water turbidity and Pb data, suggesting that these crustaceans also acted as bioturbators. The increase in Pb bioaccumulation in D. magna as a consequence of bioturbation by L. variegatus demonstrates the potential for bioturbation to enhance contaminant toxicity to organisms in the water column, though this potential appeared relatively low in the case of lead.

  15. The detection of drugs of abuse in fingerprints using Raman spectroscopy I: latent fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-02-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in latent fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were studied in both sweat-rich and sebum-rich latent fingerprints. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in latent fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in sweat-rich latent fingerprints were of a similar quality to spectra that obtained from the substances under normal sampling conditions. Interfering Raman bands arising from latent fingerprint material were present in the spectra obtained from the substances in sebum-rich fingerprints. These bands did not prevent identification of the substances and could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in latent fingerprints was visually locating the substance in the fingerprint in order to obtain a Raman spectrum.

  16. Exploring the role of quantum chemical descriptors in modeling acute toxicity of diverse chemicals to Daphnia magna.

    PubMed

    Reenu; Vikas

    2015-09-01

    Various quantum-mechanically computed molecular and thermodynamic descriptors along with physico-chemical, electrostatic and topological descriptors are compared while developing quantitative structure-activity relationships (QSARs) for the acute toxicity of 252 diverse organic chemicals towards Daphnia magna. QSAR models based on the quantum-chemical descriptors, computed with routinely employed advanced semi-empirical and ab-initio methods, along with the electron-correlation contribution (CORR) of the descriptors, are analyzed for the external predictivity of the acute toxicity. The models with reliable internal stability and external predictivity are found to be based on the HOMO energy along with the physico-chemical, electrostatic and topological descriptors. Besides this, the total energy and electron-correlation energy are also observed as highly reliable descriptors, suggesting that the intra-molecular interactions between the electrons play an important role in the origin of the acute toxicity, which is in fact an unexplored phenomenon. The models based on quantum-chemical descriptors such as chemical hardness, absolute electronegativity, standard Gibbs free energy and enthalpy are also observed to be reliable. A comparison of the robust models based on the quantum-chemical descriptors computed with various quantum-mechanical methods suggests that the advanced semi-empirical methods such as PM7 can be more reliable than the ab-initio methods which are computationally more expensive.

  17. Monte Carlo-based quantitative structure-activity relationship models for toxicity of organic chemicals to Daphnia magna.

    PubMed

    Toropova, Alla P; Toropov, Andrey A; Veselinović, Aleksandar M; Veselinović, Jovana B; Leszczynska, Danuta; Leszczynski, Jerzy

    2016-11-01

    Quantitative structure-activity relationships (QSARs) for toxicity of a large set of 758 organic compounds to Daphnia magna were built up. The simplified molecular input-line entry system (SMILES) was used to represent the molecular structure. The Correlation and Logic (CORAL) software was utilized as a tool to develop the QSAR models. These models are built up using the Monte Carlo method and according to the principle "QSAR is a random event" if one checks a group of random distributions in the visible training set and the invisible validation set. Three distributions of the data into the visible training, calibration, and invisible validation sets are examined. The predictive potentials (i.e., statistical characteristics for the invisible validation set of the best model) are as follows: n = 87, r(2)  = 0.8377, root mean square error = 0.564. The mechanistic interpretations and the domain of applicability of built models are suggested and discussed. Environ Toxicol Chem 2016;35:2691-2697. © 2016 SETAC.

  18. Acute toxicity assessment of camphor in biopesticides by using Daphnia magna and Danio rerio

    PubMed Central

    Yim, Eun-Chae; Kim, Hyeon-Joe; Kim, Seong-Jun

    2014-01-01

    Objectives An ecofriendly alternative to chemical pesticides is bio-pesticides, which are derived from natural sources. The interest in bio-pesticides is based on the disadvantages associated with chemical pesticides. Methods We conducted acute toxicity assessments of camphor, a major component of bio-pesticides, by using Daphnia magna (D. magna) as well as assessed the morphological abnormalities that occurred in Danio rerio (D. rerio) embryos. Results The median effective concentration of camphor on D. magna after 48 hours was 395.0 μM, and the median lethal concentration on D. rerio embryos after 96 hours was 838.6 μM. The no observed effect concentration and predicted no effect concentration of camphor on D. magna, which was more sensitive than D. rerio, were calculated as 55.2 μM and 3.95 μM, respectively. Morphological abnormalities in D. rerio embryos exposed to camphor increased over time. Coagulation, delayed hatching, yolk sac edema, pericardial edema, and pigmentation of embryos mainly appeared between 24 and 48 hours. Further, symptoms of scoliosis and head edema occurred after 72 hours. In addition, bent tails, ocular defects and collapsed symptoms of fertilized embryonic tissue were observed after 96 hours. Conclusions The camphor toxicity results suggest that continuous observations on the ecosystem are necessary to monitor toxicity in areas where biological pesticides containing camphor are sprayed. PMID:25234414

  19. Quantification of differentially expressed genes in Daphnia magna exposed to rubber wastewater.

    PubMed

    Jo, Hun-Je; Jung, Jinho

    2008-09-01

    In this study, differentially expressed genes (DEGs) were investigated in Daphnia magna exposed to rubber wastewater using an annealing control primer (ACP)-based polymerase chain reaction (PCR) and real-time PCR. Among three identified DEGs, two genes (DEG1 and DEG2) were up-regulated, and DEG1 expression was well-correlated to a logarithm of rubber wastewater concentration (r2=0.971, p<0.0001). In addition, DEG1 expression in D. magna exposed to rubber wastewater was strongly correlated with that of D. magna exposed to Zn (r2=0.9513, p<0.05), suggesting that the induction of DEG1 was caused by Zn, which is the dominant toxicant in rubber wastewater. In addition, DEG1 expression was more sensitive to toxicants than immobility, which is the conventional endpoint in toxicity tests using D. magna. The lowest observed effect concentrations (LOEC) determined using immobility tests were 2.5% for rubber wastewater and 1.6mgl(-1) for Zn. In contrast, a significant increase in DEG1 expression was observed at exposure concentrations of as low as 0.6% rubber wastewater and 0.2mgl(-1) Zn. These results indicate that DEG1 is a sensitive and quantitative biomarker of water and wastewater containing Zn.

  20. The Role of Secure Knowledge in Enabling Year 7 to Write Essays on Magna Carta

    ERIC Educational Resources Information Center

    King, Mark

    2015-01-01

    Setting out to teach Magna Carta to the full attainment range in Year 7, Mark King decided to choose a question that reflected real scholarly debates and also to ensure that pupils held enough knowledge in long-term memory to be able to think about that question meaningfully. As he gradually prepared his pupils to produce their own causation…

  1. Genetic variation in the cellular response of Daphnia magna (Crustacea: Cladocera) to its bacterial parasite

    PubMed Central

    Auld, Stuart K. J. R.; Scholefield, Jennifer A.; Little, Tom J.

    2010-01-01

    Linking measures of immune function with infection, and ultimately, host and parasite fitness is a major goal in the field of ecological immunology. In this study, we tested for the presence and timing of a cellular immune response in the crustacean Daphnia magna following exposure to its sterilizing endoparasite Pasteuria ramosa. We found that D. magna possesses two cell types circulating in the haemolymph: a spherical one, which we call a granulocyte and an irregular-shaped amoeboid cell first described by Metchnikoff over 125 years ago. Daphnia magna mounts a strong cellular response (of the amoeboid cells) just a few hours after parasite exposure. We further tested for, and found, considerable genetic variation for the magnitude of this cellular response. These data fostered a heuristic model of resistance in this naturally coevolving host–parasite interaction. Specifically, the strongest cellular responses were found in the most susceptible hosts, indicating resistance is not always borne from a response that destroys invading parasites, but rather stems from mechanisms that prevent their initial entry. Thus, D. magna may have a two-stage defence—a genetically determined barrier to parasite establishment and a cellular response once establishment has begun. PMID:20534618

  2. Basilar impression associated with impacted cisterna magna, spastic paraparesis and distress of balance: case report.

    PubMed

    Gonçalves da Silva, José Alberto; de Almeida Holanda, Maurus Marques; do Desterro Leiros, Maria; Melo, Luiz Ricardo Santiago; de Araújo, Antônio Fernandes; de Almeida, Everardo Bandeira

    2006-09-01

    We report on a 48 years-old man with basilar impression without syringohydromyelia, in which the cisterna magna was impacted by the cerebellar tonsils. Six months after posterior fossa decompression there was the disappearance of nuchal rigidity, vertigo, spastic paraparesis and improvement of balance. Nevertheless hyperreflexia and diminished pallesthesia of the lower limbs persisted.

  3. Three-dimensional analysis of the swimming behavior of Daphnia magna exposed to nanosized titanium dioxide.

    PubMed

    Noss, Christian; Dabrunz, André; Rosenfeldt, Ricki R; Lorke, Andreas; Schulz, Ralf

    2013-01-01

    Due to their surface characteristics, nanosized titanium dioxide particles (nTiO2) tend to adhere to biological surfaces and we thus hypothesize that they may alter the swimming performance and behavior of motile aquatic organisms. However, no suitable approaches to address these impairments in swimming behavior as a result of nanoparticle exposure are available. Water fleas Daphnia magna exposed to 5 and 20 mg/L nTiO2 (61 nm; polydispersity index: 0.157 in 17.46 mg/L stock suspension) for 96 h showed a significantly (p<0.05) reduced growth rate compared to a 1-mg/L treatment and the control. Using three-dimensional video observations of swimming trajectories, we observed a treatment-dependent swarming of D. magna in the center of the test vessels during the initial phase of the exposure period. Ensemble mean swimming velocities increased with increasing body length of D. magna, but were significantly reduced in comparison to the control in all treatments after 96 h of exposure. Spectral analysis of swimming velocities revealed that high-frequency variance, which we consider as a measure of swimming activity, was significantly reduced in the 5- and 20-mg/L treatments. The results highlight the potential of detailed swimming analysis of D. magna for the evaluation of sub-lethal mechanical stress mechanisms resulting from biological surface coating and thus for evaluating the effects of nanoparticles in the aquatic environment.

  4. Development and validation of a Daphnia magna four-day survival and growth test method

    EPA Science Inventory

    Zooplankton are an important part of the aquatic ecology of all lakes and streams. As a result, numerous methods have been developed to assess the quality of waterbodies using various zooplankton species. Included in these is the freshwater species Daphnia magna. Current test me...

  5. [Lifetime of hydrobionts Daphnia magna in a noncontact-activated water].

    PubMed

    Iksanova, T I; Stekhin, A A; Iakovleva, G V; Kamentskaia, D B

    2015-01-01

    The article is devoted to the study of the influence of non-contact activated water on the lifetime and replicative function of aquatic organisms Daphnia magna, belonging to a highly organized animal organisms. There was established the proportional relationship between the concentration of hydrogen peroxide (in the anion-radical form) and the duration of aquatic lifetime of hydrobionts. In a non contact activated water media with values of redox -potential (Eh)~130mV (against Eh = 213mV--in the control) the lifetime of hydrobionts Daphnia magna is shown to increase in average up to 9 days and reaches 34 days (as 25 days in the control). Replicative junction activated in the aquatic environment does not change, but there was noted a delay in the time of dropping by 7 days in average. Noted regularities in the change in the lifetime of aquatic organisms Daphnia magna in aquatic activated environments are interpreted on the basis of the dependence of the proliferative activity of cells on the concentration of hydrogen peroxide in water. The obtained data on lifetime of Daphnia magna in activated electron-donor environments can serve as proof of the hygienic safety and biological activity of physically-activated (non-contact) drinking water.

  6. Growth of Daphnia magna exposed to mixtures of chemicals with diverse modes of action

    SciTech Connect

    Deneer, J.W.; Seinen, W.; Hermens, J.L.

    1988-02-01

    Concentrations causing inhibition of growth of Daphnia magna after 16 days of exposure were determined for nine chemicals that presumably act through different modes of action. The joint toxic effect of a mixture of these chemicals is found to be nonadditive.

  7. Impact of imidacloprid on Daphnia magna under different food quality regimes.

    PubMed

    Ieromina, Oleksandra; Peijnenburg, Willie J G M; de Snoo, Geert; Müller, Jutta; Knepper, Thomas P; Vijver, Martina G

    2014-03-01

    Aquatic ecosystems are characterized by fluctuating conditions that have direct effects on aquatic communities but also indirect influences such as changing the toxicity of chemicals. Because the effect of food quality on pesticide toxicity has rarely been studied, in the present study Daphnia magna juveniles supplied with 4 different food quality levels were exposed to a range of imidacloprid concentrations for 21 d. Food quality was expressed as carbon:phosphorus ratios of algae Pseudokirchneriella subcapitata (C:P 35, C:P 240, C:P 400, and C:P 1300). Survival, growth rates, and reproduction of D. magna were monitored, and the combined effects of imidacloprid exposure and the phosphorus content of algae were analyzed. A stronger effect on survival was observed at the P-deficient diet (C:P 1300), confirmed by lower 10% effect concentration (EC10) values at days 7, 9, 15, and 21 compared with diets with higher phosphorus contents. Similarly, the growth rate was reduced when D. magna were supplied with algae of low phosphorus content at imidacloprid exposure conditions. The highest reproductive output was observed for D. magna fed the optimal phosphorus diet (C:P 240), both at control and exposed conditions. Poor food quality increased the sensitivity of nontarget species to pesticide exposure, potentially leading to an underestimation of adverse effects on aquatic communities in the field.

  8. Bioaccumulation and oxidative stress in Daphnia magna exposed to arsenite and arsenate.

    PubMed

    Fan, Wenhong; Ren, Jinqian; Li, Xiaomin; Wei, Chaoyang; Xue, Feng; Zhang, Nan

    2015-11-01

    Arsenic pollution and its toxicity to aquatic organisms have attracted worldwide attention. The bioavailability and toxicity of arsenic are highly related to its speciation. The present study investigated the differences in bioaccumulation and oxidative stress responses in an aquatic organism, Daphnia magna, induced by 2 inorganic arsenic species (As(III) and As(V)). The bioaccumulation of arsenic, Na(+) /K(+) -adenosine triphosphatase (ATPase) activity, reactive oxygen species (ROS) content, total superoxide dismutase (SOD) activity, total antioxidative capability, and malondialdehyde content in D. magna were determined after exposure to 500 µg/L of arsenite and arsenate for 48 h. The results showed that the oxidative stress and antioxidative process in D. magna exposed to arsenite and arsenate could be divided into 3 phases, which were antioxidative response, oxidation inhibition, and antioxidative recovery. In addition, differences in bioaccumulation, Na(+) /K(+) -ATPase activity, and total SOD activity were also found in D. magna exposed to As(III) and As(V). These differences might have been the result of the high affinity of As(III) with sulfhydryl groups in enzymes and the structural similarity of As(V) to phosphate. Therefore, arsenate could be taken up by organisms through phosphate transporters, could substitute for phosphate in biochemical reactions, and could lead to a change in the bioaccumulation of arsenic and activity of enzymes. These characteristics were the possible reasons for the different toxicity mechanisms in the oxidative stress process of arsenite and arsenate.

  9. Synthesis, characterization and toxicological evaluation of Cr₂O₃ nanoparticles using Daphnia magna and Aliivibrio fischeri.

    PubMed

    Puerari, Rodrigo Costa; da Costa, Cristina H; Vicentini, Denice S; Fuzinatto, Cristiane F; Melegari, Silvia P; Schmidt, Éder C; Bouzon, Zenilda L; Matias, William G

    2016-06-01

    Chromium III oxide (Cr2O3) nanoparticles (NPs) are used in pigments for ceramics, dyes, paints and cosmetics. However, few studies addressing the toxic potential of these NPs have been reported in the literature. Thus, this research aimed to evaluate the acute and chronic effects of Cr2O3 NPs through acute toxicity tests with Daphnia magna and Aliivibrio fischeri and chronic toxicity tests with Daphnia magna. Cr2O3 NPs were synthesized by the sol-gel method and characterized through TEM, X-Ray diffraction (XRD), zeta potential (ZP) and surface area analysis. In the acute toxicity tests the EC(50,48h) value obtained with D. magna was 6.79 mg L(-1) and for A. fischeri the EC(50,15min) value was 16.10 mg L(-1) and the EC(50,30min) value was 12.91 mg L(-1). Regarding the chronic toxicity tests with D. magna, effects on longevity (OEC=1.00 mg L(-1)), reproduction (OEC=1.00 mg L(-1)) and growth (OEC=0.50 mg L(-1)) were observed. On the SEM and TEM images, ultrastructural alterations in the organelles of exposed organisms were also observed. Thus, toxicological studies with NPs are of great importance in order to reduce the risk of environmental contamination.

  10. Virulence arsenal of the most pathogenic species among the Gram-positive anaerobic cocci, Finegoldia magna.

    PubMed

    Boyanova, Lyudmila; Markovska, Rumyana; Mitov, Ivan

    2016-12-01

    This review focuses on the virulence arsenal of the most pathogenic species among Gram positive anaerobic cocci, Finegoldia magna according to recently published data from 2012 to 2016. Virulence factors like sortase dependent pili and F. magna adhesion factor (FAF) facilitate the start of the infection. Albumin binding protein (PAB) enhances F. magna survival. FAF, subtilisin-like extracellular serine protease (SufA) and superantigen protein L protect the bacteria from factors of innate defense system. SufA, capsule and tissue-destroying enzymes provide a deep penetration or spread of the infections and the protein L is associated with infection severity. Biofilm production results in infection chronification and complicated treatment as well as to persistence of multi-species biofilms. Resistance rates to quinolones (13.0->70%) and clindamycin (0-40.0%) are important, and resistance to penicillins (<4%), chloramphenicol (7.0%) and metronidazole (<7%) has been reported. F. magna should not be overlooked when present in monoinfections or mixed infections in humans.

  11. Production of male neonates in Daphnia magna (Cladocera, Crustacea) exposed to juvenile hormones and their analogs.

    PubMed

    Oda, Shigeto; Tatarazako, Norihisa; Watanabe, Hajime; Morita, Masatoshi; Iguchi, Taisen

    2005-12-01

    We exposed the water flea Daphnia magna (Cladocera, Crustacea) to either juvenile hormone I (JH I), juvenile hormone II (JH II), or the juvenile hormone-mimicking insecticides kinoprene, hydroprene, epofenonane, or fenoxycarb. By 21-day reproduction tests, we investigated the effects on the number of neonates born per female and the offspring sex ratio. All six chemicals induced D. magna to produce male neonates; the male sex ratio of the offspring increased as the chemical concentration increased. EC50 values for production of male neonates were estimated as 400 (JH I), 410 (JH II), 190 (kinoprene), 2.9 (hydroprene), 64 (epofenonane), and 0.92 (fenoxycarb) microg/l. The number of neonates produced was reduced with all chemicals at the concentrations investigated. At the EC50 for male production, five of the six chemicals reduced the reproductive rate to less than 50%; the exception was epofenonane, which caused only a slight reduction in reproductive rate. These results were similar to those obtained for five juvenoids studied previously, one of which was studied here again. There are now 10 chemical substances--all juvenile hormones or their analogs-that are known to induce D. magna to produce male neonates. This suggests that juvenile hormone is involved in initiating male production followed by sexual reproduction in D. magna, and probably in most cladocerans that exhibit cyclic parthenogenesis.

  12. SALINITY TOLERANCE OF DAPHNIA MAGNA AND POTENTIAL USE FOR ESTUARINE SEDIMENT TOXICITY TESTS

    EPA Science Inventory

    Daphnia magna Straus, a common organism used for freshwater sediment toxicity tests, was evaluated to determine its tolerance to salinity and suitability for tests with estuarine water and sediments. Daphnids were exposed for 2 to 21 days to salinity in a variety of water-only te...

  13. EFFECTIVE CONCENTRATIONS OF 6 CONTAMINANTS TO LEMMA MINOR, PIMEPHALES PROMELA, DAPHNIA MAGNA, AND CERIODAPHNIA DUBIA

    EPA Science Inventory

    The research presented here resulted in EC50 and LOEC values for the contaminants copper, cadmium, diazinon, atrazine, and cyanide to the species Lemna Minor, Pimephales promelas, Daphnia magna, and Ceriodaphnia dubia. Observed values were used as benchmarks for assessing the se...

  14. Daphnia magna transcriptome by RNA-Seq across 12 environmental stressors

    PubMed Central

    Orsini, Luisa; Gilbert, Donald; Podicheti, Ram; Jansen, Mieke; Brown, James B.; Solari, Omid Shams; Spanier, Katina I.; Colbourne, John K.; Rush, Douglas; Decaestecker, Ellen; Asselman, Jana; De Schamphelaere, Karel A.C.; Ebert, Dieter; Haag, Christoph R.; Kvist, Jouni; Laforsch, Christian; Petrusek, Adam; Beckerman, Andrew P.; Little, Tom J.; Chaturvedi, Anurag; Pfrender, Michael E.; De Meester, Luc; Frilander, Mikko J.

    2016-01-01

    The full exploration of gene-environment interactions requires model organisms with well-characterized ecological interactions in their natural environment, manipulability in the laboratory and genomic tools. The waterflea Daphnia magna is an established ecological and toxicological model species, central to the food webs of freshwater lentic habitats and sentinel for water quality. Its tractability and cyclic parthenogenetic life-cycle are ideal to investigate links between genes and the environment. Capitalizing on this unique model system, the STRESSFLEA consortium generated a comprehensive RNA-Seq data set by exposing two inbred genotypes of D. magna and a recombinant cross of these genotypes to a range of environmental perturbations. Gene models were constructed from the transcriptome data and mapped onto the draft genome of D. magna using EvidentialGene. The transcriptome data generated here, together with the available draft genome sequence of D. magna and a high-density genetic map will be a key asset for future investigations in environmental genomics. PMID:27164179

  15. Gas Chromatography/Atmospheric Pressure Chemical Ionization Tandem Mass Spectrometry for Fingerprinting the Macondo Oil Spill.

    PubMed

    Lobodin, Vladislav V; Maksimova, Ekaterina V; Rodgers, Ryan P

    2016-07-05

    We report the first application of a new mass spectrometry technique (gas chromatography combined to atmospheric pressure chemical ionization tandem mass spectrometry, GC/APCI-MS/MS) for fingerprinting a crude oil and environmental samples from the largest accidental marine oil spill in history (the Macondo oil spill, the Gulf of Mexico, 2010). The fingerprinting of the oil spill is based on a trace analysis of petroleum biomarkers (steranes, diasteranes, and pentacyclic triterpanes) naturally occurring in crude oil. GC/APCI enables soft ionization of petroleum compounds that form abundant molecular ions without (or little) fragmentation. The ability to operate the instrument simultaneously in several tandem mass spectrometry (MS/MS) modes (e.g., full scan, product ion scan, reaction monitoring) significantly improves structural information content and sensitivity of analysis. For fingerprinting the oil spill, we constructed diagrams and conducted correlation studies that measure the similarity between environmental samples and enable us to differentiate the Macondo oil spill from other sources.

  16. Chemical characterization of components in fingerprints

    SciTech Connect

    Jarboe, S.G.; Asano, K.G.; Buchanan, M.V.; Bohanan, A.

    1997-12-31

    Investigations into the chemical composition of fingerprints were initiated after it was observed that the latent fingerprints of children disappear more rapidly from surfaces than those of adults. Initial work included the use of GUMS for the identification of compounds present in fingerprints. The relative concentrations of fatty acids and alkyl esters in children and adults appear to contribute to the higher rate of disappearance of prints from the younger subjects. The presence of alkyl esters is linked to sebaceous excretions originating from the face, which increase markedly after puberty. This work has been expanded to include characterization of other classes of components, including amino acids and triacylglycerols. This research is part of an ongoing project to identify various components of fingerprints and explore possible clinical and forensic applications. Through large sampling pools, trends that can indicate personal characteristics (i.e., gender, age), habits (smoking, drug use), and health-related issues (diabetes) are being investigated.

  17. 75 FR 12803 - Fingerprint Submission Requirements Rule

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-17

    ...Notice of the Compact Council's establishment of a process for initiating noncriminal justice criminal history record checks during times of emergencies and disasters under the authority of the Fingerprint Submission Requirements Rule, title 28 Code of Federal Regulations (CFR), part...

  18. Defining the Crystallographic Fingerprint of Extraterrestrial Treasures

    NASA Astrophysics Data System (ADS)

    Forman, L. V.; Bland, P. A.; Timms, N. E.; Daly, L.; Benedix, G. K.; Trimby, P. W.

    2016-08-01

    An approach to determine the crystallographic fingerprint of chondritic matrix grains, which is complimentary to the geochemical signature commonly identified to constrain some aspects of the petrogenesis of a sample.

  19. Dual Resolution Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Dual Resolution Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  20. Forensic Identification of Gender from Fingerprints.

    PubMed

    Huynh, Crystal; Brunelle, Erica; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2015-11-17

    In the past century, forensic investigators have universally accepted fingerprinting as a reliable identification method, which relies mainly on pictorial comparisons. Despite developments to software systems in order to increase the probability and speed of identification, there has been limited success in the efforts that have been made to move away from the discipline's absolute dependence on the existence of a prerecorded matching fingerprint. Here, we have revealed that an information-rich latent fingerprint has not been used to its full potential. In our approach, the content present in the sweat left behind-namely the amino acids-can be used to determine physical such as gender of the originator. As a result, we were able to focus on the biochemical content in the fingerprint using a biocatalytic assay, coupled with a specially designed extraction protocol, for determining gender rather than focusing solely on the physical image.

  1. Influence of food, aquatic humus, and alkalinity on methylmercury uptake by Daphnia magna

    SciTech Connect

    Monson, B.A.; Brezonik, P.L.

    1999-03-01

    Six-day-old Daphnia magna were exposed to low concentrations of methylmercury (MeHg) in synthetic freshwater and synthetic food. Uptake kinetics were determined in 24- to 72-h experiments, measuring both the loss of Hg from water and accumulation in D. magna. Dose-uptake response was linear for MeHg concentrations up to 4.0 ng/L; an initial concentration of 2.0 ng/L was used when other factors were varied. Concentrations of total Hg and MeHg in water and D. magna were measured in treatments with varied hardness and alkalinity, aquatic humus (AH), and food spiked with MeHg versus water spiked with MeHg. Uptake rate coefficients were derived from two versions of a first-order, two-compartment model. The first version assumed constant MeHg concentration; the second accounted for changing MeHg concentration in water over time. Both models accounted for a nonzero starting concentration of MeHg in plankton. Fitted rate coefficients were higher for the second model than the first: the uptake coefficient (k{sub u}) was nine times higher; the depuration coefficient (k{sub d}) was twice as high. Assuming a constant MeHg concentration for a one-time spike thus underestimated the rate coefficient. The source of MeHg was compared by exposing D. magna for 48 h to MeHg at 2 ng/L in food or water. Daphnia magna accumulated significantly more inorganic Hg (i.e., Hg{sup 2+}) from spiked food than from spiked water, but accumulation of MeHg was the same from both sources. A similar response was found when D. magna were exposed to a lake water extraction of AH at concentrations of C at 3 and 10 mg/L. At the higher AH concentration, total Hg in daphnids was higher, but MeHg was lower, suggesting that AH was a source of inorganic Hg but reduced the bioavailability of MeHg. Exposure of D. magna to MeHg at 2 ng/L in hard or soft water adjusted to pH 6.7 showed no significant difference in MeHg uptake, supporting an argument that hardness and alkalinity per se do not affect MeHg uptake by

  2. Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

    PubMed

    Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

    2008-01-01

    Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

  3. Petroleum fingerprinting: Dating a gasoline release

    SciTech Connect

    Johnson, M.D.; Morrison, R.D.

    1996-09-01

    Dating a gasoline releases is particularly important in situations involving a contaminated gasoline service station. Often the station begins under the control of a major oil company, and as it ages and deteriorates it may be operated by a series of smaller operators. When facing a claim for contamination, often operators blame former operators. Fingerprinting is one of several successful methods used to date petroleum releases on contaminated sites. The topics covered in this article are inventory reconciliation; reverse groundwater modeling; hydrocarbon fingerprinting.

  4. On the statistics of the "genetic fingerprint".

    PubMed

    Ritter, H

    1991-01-01

    In analogy to the polygene determined morphological features, the DNA-fingerprint is also not suitable for statistical processing. Statements about the individuality are merely speculative. Frequencies of genes cannot be found, since it is impossible to determine which combinations of bands belong to one gene locus. Hence the DNA fingerprint enables the recognition of exclusions from paternity; it does not, however, allow a statistical analysis, no matter which method be employed.

  5. Fingerprinting ordered diffractions in multiply diffracted waves

    NASA Astrophysics Data System (ADS)

    Meles, Giovanni Angelo; Curtis, Andrew

    2014-09-01

    We show how to `fingerprint' individual diffractors inside an acoustic medium using interrogative wave energy from arrays of sources and receivers. For any recorded multiply diffracted wave observed between any source and any receiver, the set of such fingerprints is sufficient information to identify all diffractors involved in the corresponding diffraction path, and the sequential order in which diffractors are encountered. The method herein thus decomposes complex, multiply diffracted wavefields into constituent, single-diffraction interactions.

  6. Rapid changes in water hardness and alkalinity: Calcite formation is lethal to Daphnia magna.

    PubMed

    Bogart, Sarah J; Woodman, Samuel; Steinkey, Dylan; Meays, Cindy; Pyle, Greg G

    2016-07-15

    There is growing concern that freshwater ecosystems may be negatively affected by ever-increasing anthropogenic inputs of extremely hard, highly alkaline effluent containing large quantities of Ca(2+), Mg(2+), CO3(2-), and HCO3(-) ions. In this study, the toxicity of rapid and extreme shifts in water hardness (38-600mg/L as CaCO3) and alkalinity (30-420mg/L as CaCO3) to Daphnia magna was tested, both independently and in combination. Within these ranges, where no precipitation event occurred, shifts in water hardness and/or alkalinity were not toxic to D. magna. In contrast, 98-100% of D. magna died within 96h after exposure to 600mg/L as CaCO3 water hardness and 420mg/L as CaCO3 alkalinity (LT50 of 60h with a 95% CI of 54.2-66.0h). In this treatment, a CaCO3 (calcite) precipitate formed in the water column which was ingested by and thoroughly coated the D. magna. Calcite collected from a mining impacted stream contained embedded organisms, suggesting field streams may also experience similar conditions and possibly increased mortality as observed in the lab tests. Although further investigation is required to determine the exact fate of aquatic organisms exposed to rapid calcite precipitation in the field, we caution that negative effects may occur more quickly or at lower concentrations of water hardness and alkalinity in which we observed effects in D. magna, because some species, such as aquatic insects, are more sensitive than cladocerans to changes in ionic strength. Our results provide evidence that both calcite precipitation and the major ion balance of waters should be managed in industrially affected ecosystems and we support the development of a hardness+alkalinity guideline for the protection of aquatic life.

  7. Bioaccumulation of silver in Daphnia magna: Waterborne and dietary exposure to nanoparticles and dissolved silver.

    PubMed

    Ribeiro, Fabianne; Van Gestel, Cornelis A M; Pavlaki, Maria D; Azevedo, Sofia; Soares, Amadeu M V M; Loureiro, Susana

    2017-01-01

    Silver nanoparticles (Ag-NP) are incorporated into commercial products as antimicrobial agents, which potentiate their emission to the environment. The toxicity of Ag-NP has been associated with the release of Ag ions (Ag(+)), which are more toxic to aquatic organisms than Ag-NP. In this study, a toxicokinetics approach was applied to compare the potential of Daphnia magna to accumulate Ag from either Ag-NP or AgNO3 through different exposure routes: a) water, b) diet and c) water and diet. A one-compartment kinetics model was applied to describe the development of Ag body concentrations over time and derive uptake (k1w; k1d) and elimination (k2) rate constants. Under water-only exposure, AgNO3 induced higher Ag uptake rate constants and bioconcentration factors when compared to Ag-NP. For dietary exposure, no differences in Ag concentrations in D. magna, along with the kinetics parameters, were found for both Ag forms. Simultaneous water and dietary exposures to Ag-NP induced higher Ag concentrations in D. magna compared to AgNO3. In this combined exposure, uptake from water explains most for the increase in Ag body concentration in D. magna for Ag-NP exposure, whereas uptake from the diet was the major contributor for the increase in Ag concentration in D. magna under AgNO3 exposure. Biomagnification was not observed for any of the exposure routes applied in this study, neither for Ag-NP nor for AgNO3.

  8. Enhancement of toxic effects of phenanthrene to Daphnia magna due to the presence of suspended sediment.

    PubMed

    Zhang, Xiaotian; Xia, Xinghui; Dong, Jianwei; Bao, Yimeng; Li, Husheng

    2014-06-01

    In the present work, the influences of suspended sediment (SPS) on the toxic effects of phenanthrene (PHE), one kind of polycyclic aromatic hydrocarbons, to Daphnia magna was studied using a dialysis bag simulation system, which equalized the freely dissolved concentration of PHE between outside the dialysis bag in the presence of SPS and inside the dialysis bag in the absence of SPS. The immobilization and total superoxide dismutase (T-SOD) activity of Daphnia magna caused by PHE (0-0.8 mg L(-1)) were investigated under the influence of different SPS concentrations (0, 1, 3, 5 g L(-1)) during a 96 h-exposure. The results showed that, compared to the absence of SPS, the presence of SPS (1-5 g L(-1)) increased the immobilization of Daphnia magna by 1.6-2.7 times when the freely dissolved concentration of PHE was identical in both systems. The inhibition of T-SOD activity of Daphnia magna by PHE was significantly greater in the presence of SPS than in the absence of SPS (p<0.01). This infers that the PHE sorbed on SPS might be bioavailable and enhanced the toxic effect of PHE to Daphnia magna. The bioavailable fraction of PHE sorbed on SPS ranged from 10.1% to 22.7%, and the contribution of PHE sorbed on SPS to the immobilization caused by total PHE in the exposure system increased with SPS concentration, with the contribution ratio increasing from 36.7% to 57.7% when SPS concentration increased from 1 to 5 g L(-1). This study suggests that only considering the concentrations of hydrophobic organic compounds in the water phase may underestimate their toxicity; and the hydrophobic organic compounds sorbed on SPS should not be ignored in assessment of water quality and the establishment of water quality standard in the future.

  9. Behavioral responses of juvenile Daphnia magna after exposure to glyphosate and glyphosate-copper complexes.

    PubMed

    Hansen, Lone Rykær; Roslev, Peter

    2016-10-01

    Glyphosate (N-(phosphonomethyl)glycine) is the active ingredient in a range of popular broad-spectrum herbicide formulations. Glyphosate is a chelating agent that can form stable complexes with divalent metal ions including Cu(II). Little is known about the bioavailability and ecotoxicity of glyphosate-Cu(II) complexes to aquatic organisms. In this study, we used video tracking and behavior analysis to investigate sublethal effects of binary mixtures of glyphosate and Cu(II) to juvenile D. magna. Behavioral responses were quantified for individual D. magna after 24h and 48h exposure to glyphosate and glyhosate-Cu(II) mixtures. Sublethal concentrations resulted in decreases in swimming velocity, acceleration speed, and distance moved whereas inactive time of D. magna increased. Distance moved and inactive time were the most responsive parameters to glyphosate and glyphosate-Cu(II) exposure. On a molar basis, glyphosate-Cu(II) complexes appeared more toxic to D. magna than glyphosate alone. The 48h EC50 for glyphosate and glyphosate-Cu(II) determined from swimming distance were 75.2μM and 8.4μM, respectively. In comparison, traditional visual observation of mobility resulted in 48h EC50 values of 52.8μM and 25.5μM for glyphosate and glyphosate-Cu(II), respectively. The behavioral responses indicated that exposure of D. magna to mixtures of glyphosate and Cu(II) attenuated acute metal toxicity but increased apparent glyphosate toxicity due to complexation with Cu(II). The study suggests that glyphosate is a likely mediator of aquatic metal toxicity, and that video tracking provides an opportunity for quantitative studies of sublethal effects of pesticide complexes.

  10. Probabilistic ecological hazard assessment of parabens using Daphnia magna and Pimephales promelas.

    PubMed

    Dobbins, Laura L; Usenko, Sascha; Brain, Richard A; Brooks, Bryan W

    2009-12-01

    Parabens are common antimicrobial agents found in thousands of pharmaceuticals and personal care products. Parabens are introduced into aquatic ecosystems from wastewater treatment plant effluents and have been detected in surface waters in the low microgram per liter range. Although these compounds display low toxicity in mammals, paraben toxicity to aquatic organisms has not been investigated. Standardized acute and subchronic endpoints in larval fish (Pimephales promelas) and cladoceran (Daphnia magna) models were examined for seven different parabens (methyl-, ethyl-, isopropyl-, propyl-, isobutyl-, butyl-, benzylparaben), which encompassed a range of log P values. Paraben 48 h median lethal concentration values (LC50) ranged from 4.0 to 24.6 mg/L in D. magna and 3.3 to >160.0 mg/L in fathead minnow. Growth and reproduction in D. magna had lowest-observed-effect concentrations (LOECs) ranging from 0.12 to 9.0 mg/L and 1.5 to 6.0 mg/L, respectively. Fathead minnow growth was adversely affected at levels ranging from 1.0 to 25.0 mg/L. Aquatic toxicity of the parabens was inversely related to lipophilicity, suggesting that responses using standardized endpoints resulted from narcosis. Utilizing toxicity benchmark concentrations (e.g., LC50s, LOECs) for each compound, chemical toxicity distributions, a probabilistic hazard assessment technique, were developed to assess the probabilities of detecting parabens that elicit a response at or below a given concentration. For the responses assessed in the present study, the 5th centile values (the concentration at which 5% of parabens elicit a response) ranged from 15 microg/L to 2.43 mg/L, with D. magna growth eliciting the lowest 5th centile value and acute D. magna mortality eliciting the highest. The distributions demonstrated that at environmentally relevant concentrations in developed countries there is limited acute or subchronic aquatic hazard of parabens to the organisms and responses examined.

  11. Fingerprint composition and aging: A literature review.

    PubMed

    Cadd, Samuel; Islam, Meez; Manson, Peter; Bleay, Stephen

    2015-07-01

    Fingerprints have a key role in criminal investigations and are the most commonly used form of evidence worldwide. Significant gaps remain however, in the understanding of fingerprint chemistry, including enhancement reaction mechanisms and the effect of environmental variables and time on composition. Determining the age of a fingerprint is also a relatively unexplored area. A successful method, with reliable and quantitative estimates, would have numerous advantages. Previous unreliable methods have predominantly focused on enhancement success based on physical and chemical changes. This review explores variations in composition due to donor characteristics and environmental variables, and identifies gaps for further research. We also present a qualitative and quantitative summary of the effect of time on composition. Kinetics are presented where known, with summary schematics for reaction mechanisms. Previous studies exploring methods for determining the age of a fingerprint are also discussed, including their advantages and disadvantages. Lastly we propose a potentially more accurate and reliable methodology for determining fingerprint age based on quantitative kinetic changes to the composition of a fingerprint over time.

  12. Quantifying the limits of fingerprint variability.

    PubMed

    Fagert, Michael; Morris, Keith

    2015-09-01

    The comparison and identification of fingerprints are made difficult by fingerprint variability arising from distortion. This study seeks to quantify both the limits of fingerprint variability when subject to heavy distortion, and the variability observed in repeated inked planar impressions. A total of 30 fingers were studied: 10 right slant loops, 10 plain whorls, and 10 plain arches. Fingers were video recorded performing several distortion movements under heavy deposition pressure: left, right, up, and down translation of the finger, clockwise and counter-clockwise torque of the finger, and planar impressions. Fingerprint templates, containing 'true' minutiae locations, were created for each finger using 10 repeated inked planar impressions. A minimal amount of variability, 0.18mm globally, was observed for minutiae in repeated inked planar impressions. When subject to heavy distortion minutiae can be displaced by upwards of 3mm and their orientation altered by as much as 30° in relation to their template positions. Minutiae displacements of 1mm and 10° changes in orientation are readily observed. The results of this study will allow fingerprint examiners to identify and understand the degree of variability that can be reasonably expected throughout the various regions of fingerprints.

  13. Diagnostic Oligonucleotide Microarray Fingerprinting of Bacillus Isolates

    SciTech Connect

    Chandler, Darrell P.; Alferov, Oleg; Chernov, Boris; Daly, Don S.; Golova, Julia; Perov, Alexander N.; Protic, Miroslava; Robison, Richard; Shipma, Matthew; White, Amanda M.; Willse, Alan R.

    2006-01-01

    A diagnostic, genome-independent microbial fingerprinting method using DNA oligonucleotide microarrays was used for high-resolution differentiation between closely related Bacillus strains, including two strains of Bacillus anthracis that are monomorphic (indistinguishable) via amplified fragment length polymorphism fingerprinting techniques. Replicated hybridizations on 391-probe nonamer arrays were used to construct a prototype fingerprint library for quantitative comparisons. Descriptive analysis of the fingerprints, including phylogenetic reconstruction, is consistent with previous taxonomic organization of the genus. Newly developed statistical analysis methods were used to quantitatively compare and objectively confirm apparent differences in microarray fingerprints with the statistical rigor required for microbial forensics and clinical diagnostics. These data suggest that a relatively simple fingerprinting microarray and statistical analysis method can differentiate between species in the Bacillus cereus complex, and between strains of B. anthracis. A synthetic DNA standard was used to understand underlying microarray and process-level variability, leading to specific recommendations for the development of a standard operating procedure and/or continued technology enhancements for microbial forensics and diagnostics.

  14. Privacy protection schemes for fingerprint recognition systems

    NASA Astrophysics Data System (ADS)

    Marasco, Emanuela; Cukic, Bojan

    2015-05-01

    The deployment of fingerprint recognition systems has always raised concerns related to personal privacy. A fingerprint is permanently associated with an individual and, generally, it cannot be reset if compromised in one application. Given that fingerprints are not a secret, potential misuses besides personal recognition represent privacy threats and may lead to public distrust. Privacy mechanisms control access to personal information and limit the likelihood of intrusions. In this paper, image- and feature-level schemes for privacy protection in fingerprint recognition systems are reviewed. Storing only key features of a biometric signature can reduce the likelihood of biometric data being used for unintended purposes. In biometric cryptosystems and biometric-based key release, the biometric component verifies the identity of the user, while the cryptographic key protects the communication channel. Transformation-based approaches only a transformed version of the original biometric signature is stored. Different applications can use different transforms. Matching is performed in the transformed domain which enable the preservation of low error rates. Since such templates do not reveal information about individuals, they are referred to as cancelable templates. A compromised template can be re-issued using a different transform. At image-level, de-identification schemes can remove identifiers disclosed for objectives unrelated to the original purpose, while permitting other authorized uses of personal information. Fingerprint images can be de-identified by, for example, mixing fingerprints or removing gender signature. In both cases, degradation of matching performance is minimized.

  15. Iodometric and Molecular Detection of ESBL Production Among Clinical Isolates of E. coli Fingerprinted by ERIC-PCR: The First Egyptian Report Declares the Emergence of E. coli O25b-ST131clone Harboring blaGES.

    PubMed

    El-Badawy, Mohamed F; Tawakol, Wael M; Maghrabi, Ibrahim A; Mansy, Moselhy S; Shohayeb, Mohamed M; Ashour, Mohammed S

    2017-01-18

    The extensive use of β-lactam antibiotics has led to emergence and spread of extended-spectrum β-lactamases (ESBLs). This study was conducted to investigate the prevalence of 7 different ESBL genes (blaTEM, blaSHV, blaCTX-M, blaVEB, blaPER, blaGES, and blaOXA-10) and O25b-ST131 high-risk clone among 61 clinical isolates of Escherichia coli. Also, one broad-spectrum β-lactamase (blaOXA-1) was investigated. This study was also constructed to evaluate iodometric overlay method in detection of ESBL production. Phenotypic identification of E. coli isolates using API 20E revealed 18 distinct biotypes. DNA fingerprinting using enterobacterial repetitive intergenic consensus polymerase chain reaction (ERIC-PCR) differentiated all isolates into 2 main phylogenetic groups with 60 distinct genetic profiles. Elevated values of minimal inhibitory concentration (MIC)50 and MIC90 for third- and fourth-generation cephalosporins were observed. Phenotypic tests revealed that 85.24% of isolates were ESBL producers. The incidence rates of blaTEM, blaSHV, blaCTX-M, blaGES, blaOXA-1, and blaOXA-10 among E. coli ESBL producer phenotype were 69.23%, 25%, 96.15%, 3.85%, 11.54%, and 48%, respectively. On the other hand, blaVEB and blaPER were not detected. Sequencing of blaTEM and blaSHV revealed that blaTEM-214 and blaSHV-11 were the most prevalent variants. Group characterization of blaCTX-M revealed that blaCTX-M-1 was the most prevalent group of blaCTX-M family. It was found that 30.77% of E. coli ESBL producers belonged to O25b-ST131 clone harboring blaCTX-M-15. This study concluded that iodometric overlay method was 100% sensitive in detection of ESBL production. To our knowledge, this is the first Egyptian study that declares the emergence of E. coli O25b-ST131 harboring blaGES.

  16. Toward Surface-Enhanced Raman Imaging of Latent Fingerprints

    SciTech Connect

    Connatser, Raynella M; Prokes, Sharka M.; Glembocki, Orest; Schuler, Rebecca A.; Gardner, Charles W.; Lewis Sr, Samuel Arthur; Lewis, Linda A

    2010-01-01

    Exposure to light or heat, or simply a dearth of fingerprint material, renders some latent fingerprints undetectable using conventional methods. We begin to address such elusive fingerprints using detection targeting photo- and thermally stable fingerprint constituents: surface-enhanced Raman spectroscopy (SERS). SERS can give descriptive vibrational spectra of amino acids, among other robust fingerprint constituents, and good sensitivity can be attained by improving metal-dielectric nanoparticle substrates. With SERS chemical imaging, vibrational bands intensities recreate a visual of fingerprint topography. The impact of nanoparticle synthesis route, dispersal methodology-deposition solvent, and laser wavelength are discussed, as are data from enhanced vibrational spectra of fingerprint components. SERS and Raman chemical images of fingerprints and realistic contaminants are shown. To our knowledge, this represents the first SERS imaging of fingerprints. In conclusion, this work progresses toward the ultimate goal of vibrationally detecting latent prints that would otherwise remain undetected using traditional development methods.

  17. Toward surface-enhanced Raman imaging of latent fingerprints.

    PubMed

    Connatser, R Maggie; Prokes, Sharka M; Glembocki, Orest J; Schuler, Rebecca L; Gardner, Charles W; Lewis, Samuel A; Lewis, Linda A

    2010-11-01

    Exposure to light or heat, or simply a dearth of fingerprint material, renders some latent fingerprints undetectable using conventional methods. We begin to address such elusive fingerprints using detection targeting photo- and thermally stable fingerprint constituents: surface-enhanced Raman spectroscopy (SERS). SERS can give descriptive vibrational spectra of amino acids, among other robust fingerprint constituents, and good sensitivity can be attained by improving metal-dielectric nanoparticle substrates. With SERS chemical imaging, vibrational bands' intensities recreate a visual of fingerprint topography. The impact of nanoparticle synthesis route, dispersal methodology-deposition solvent, and laser wavelength are discussed, as are data from enhanced vibrational spectra of fingerprint components. SERS and Raman chemical images of fingerprints and realistic contaminants are shown. To our knowledge, this represents the first SERS imaging of fingerprints. In conclusion, this work progresses toward the ultimate goal of vibrationally detecting latent prints that would otherwise remain undetected using traditional development methods.

  18. The detection of drugs of abuse in fingerprints using Raman spectroscopy II: cyanoacrylate-fumed fingerprints

    NASA Astrophysics Data System (ADS)

    Day, Joanna S.; Edwards, Howell G. M.; Dobrowski, Steven A.; Voice, Alison M.

    2004-07-01

    This paper describes the application of Raman spectroscopy to the detection of exogenous substances in cyanoacrylate-fumed fingerprints. The scenario considered was that of an individual handling a substance and subsequently depositing a contaminated fingerprint. These fingerprints were enhanced by cyanoacrylate fuming, a process in which a layer of white cyanoacrylate polymer is deposited on the fingerprint material, enabling visual detection. Five drugs of abuse (codeine phosphate, cocaine hydrochloride, amphetamine sulphate, barbital and nitrazepam) and five non-controlled substances of similar appearance, which may be used in the adulteration of drugs of abuse (caffeine, aspirin, paracetamol, starch and talc), were used. The substances studied could be clearly distinguished using their Raman spectra and were all successfully detected in cyanoacrylate-fumed fingerprints. Photobleaching was necessary to reduce the fluorescence background in the spectra of some substances. Raman spectra obtained from the substances in cyanoacrylate-fumed fingerprints were of a similar quality to spectra obtained from the substances under normal sampling conditions, however, interfering Raman bands arising from the cyanoacrylate polymer were present in the spectra. In most cases the only interfering band was the CN stretching mode of the polymer, and there were no cases where the interfering bands prevented identification of the substances. If necessary, the interfering bands could be successfully removed by spectral subtraction. The most difficult aspect of the detection of these substances in cyanoacrylate-fumed fingerprints was visually locating the substance in the fingerprint beneath the polymer layer in order to obtain a Raman spectrum.

  19. Dental DNA fingerprinting in identification of human remains.

    PubMed

    Girish, Kl; Rahman, Farzan S; Tippu, Shoaib R

    2010-07-01

    The recent advances in molecular biology have revolutionized all aspects of dentistry. DNA, the language of life yields information beyond our imagination, both in health or disease. DNA fingerprinting is a tool used to unravel all the mysteries associated with the oral cavity and its manifestations during diseased conditions. It is being increasingly used in analyzing various scenarios related to forensic science. The technical advances in molecular biology have propelled the analysis of the DNA into routine usage in crime laboratories for rapid and early diagnosis. DNA is an excellent means for identification of unidentified human remains. As dental pulp is surrounded by dentin and enamel, which forms dental armor, it offers the best source of DNA for reliable genetic type in forensic science. This paper summarizes the recent literature on use of this technique in identification of unidentified human remains.

  20. Iron-Tolerant Cyanobacteria: Ecophysiology and Fingerprinting

    NASA Technical Reports Server (NTRS)

    Brown, I. I.; Mummey, D.; Lindsey, J.; McKay, D. S.

    2006-01-01

    Although the iron-dependent physiology of marine and freshwater cyanobacterial strains has been the focus of extensive study, very few studies dedicated to the physiology and diversity of cyanobacteria inhabiting iron-depositing hot springs have been conducted. One of the few studies that have been conducted [B. Pierson, 1999] found that cyanobacterial members of iron depositing bacterial mat communities might increase the rate of iron oxidation in situ and that ferrous iron concentrations up to 1 mM significantly stimulated light dependent consumption of bicarbonate, suggesting a specific role for elevated iron in photosynthesis of cyanobacteria inhabiting iron-depositing hot springs. Our recent studies pertaining to the diversity and physiology of cyanobacteria populating iron-depositing hot springs in Great Yellowstone area (Western USA) indicated a number of different isolates exhibiting elevated tolerance to Fe(3+) (up to 1 mM). Moreover, stimulation of growth was observed with increased Fe(3+) (0.02-0.4 mM). Molecular fingerprinting of unialgal isolates revealed a new cyanobacterial genus and species Chroogloeocystis siderophila, an unicellular cyanobacterium with significant EPS sheath harboring colloidal Fe(3+) from iron enriched media. Our preliminary data suggest that some filamentous species of iron-tolerant cyanobacteria are capable of exocytosis of iron precipitated in cytoplasm. Prior to 2.4 Ga global oceans were likely significantly enriched in soluble iron [Lindsay et al, 2003], conditions which are not conducive to growth of most contemporary oxygenic cyanobacteria. Thus, iron-tolerant CB may have played important physiological and evolutionary roles in Earths history.

  1. Social Media Fingerprints of Unemployment

    PubMed Central

    Llorente, Alejandro; Garcia-Herranz, Manuel; Cebrian, Manuel; Moro, Esteban

    2015-01-01

    Recent widespread adoption of electronic and pervasive technologies has enabled the study of human behavior at an unprecedented level, uncovering universal patterns underlying human activity, mobility, and interpersonal communication. In the present work, we investigate whether deviations from these universal patterns may reveal information about the socio-economical status of geographical regions. We quantify the extent to which deviations in diurnal rhythm, mobility patterns, and communication styles across regions relate to their unemployment incidence. For this we examine a country-scale publicly articulated social media dataset, where we quantify individual behavioral features from over 19 million geo-located messages distributed among more than 340 different Spanish economic regions, inferred by computing communities of cohesive mobility fluxes. We find that regions exhibiting more diverse mobility fluxes, earlier diurnal rhythms, and more correct grammatical styles display lower unemployment rates. As a result, we provide a simple model able to produce accurate, easily interpretable reconstruction of regional unemployment incidence from their social-media digital fingerprints alone. Our results show that cost-effective economical indicators can be built based on publicly-available social media datasets. PMID:26020628

  2. X-ray and electron microscopy studies on the biodistribution and biomodification of iron oxide nanoparticles in Daphnia magna.

    PubMed

    Kwon, Dongwook; Nho, Hyun Woo; Yoon, Tae Hyun

    2014-10-01

    Biodistribution and biomodification of iron oxide (Fe3O4 and α-Fe2O3) nanoparticles (NPs) in a well-known toxicity test organism, Daphnia magna (D. magna), were investigated using transmission electron microscopy (TEM) and scanning transmission X-ray microscopy (STXM). In addition to the morphological changes in the gut tissues of D. magna, biodistribution and biomodification of iron oxide NPs in the digestive tract of D. magna were also monitored in this study. Upon exposures to both iron oxide NPs, unique morphological changes (e.g., irregular shaped microvilli, epithelial cell protrusion, and dilatation of cytoplasmic inclusion) in the gut tissues of D. magna were observed along with bacterial colonization of the gut lumen. However, despite their heavy accumulations in the digesitive tract, TEM and STXM images confirmed us that both Fe3O4 and α-Fe2O3 NPs were not penetrating into the gut tissues of D. magna. Moreover, for the Fe3O4 NPs in direct contact with the gut microvilli of D. magna, slight but significant spectral changes were observed in their Fe L-edge X-ray absorption near edge structure (XANES) spectra, which indicated that there were biomodifications of Fe3O4 NPs, probably involving oxidative dissolution of Fe3O4 NPs followed by rapid precipitation of ferric oxide or hydroxide. However, no significant changes were observed in the Fe L-edge XANES spectra of the α-Fe2O3 NPs present in the gut lumen of D. magna. These X-ray and electron microscopic observations confirmed us that, despite similarities in core sizes and chemical compositions, NPs with different crystalline phase and dissolution rates can interact quite differently with their local environment, may result in different biodistribution and cause completely dissimilar toxicities.

  3. Activity-relevant similarity values for fingerprints and implications for similarity searching

    PubMed Central

    Jasial, Swarit; Hu, Ye; Vogt, Martin; Bajorath, Jürgen

    2016-01-01

    A largely unsolved problem in chemoinformatics is the issue of how calculated compound similarity relates to activity similarity, which is central to many applications. In general, activity relationships are predicted from calculated similarity values. However, there is no solid scientific foundation to bridge between calculated molecular and observed activity similarity. Accordingly, the success rate of identifying new active compounds by similarity searching is limited. Although various attempts have been made to establish relationships between calculated fingerprint similarity values and biological activities, none of these has yielded generally applicable rules for similarity searching. In this study, we have addressed the question of molecular versus activity similarity in a more fundamental way. First, we have evaluated if activity-relevant similarity value ranges could in principle be identified for standard fingerprints and distinguished from similarity resulting from random compound comparisons. Then, we have analyzed if activity-relevant similarity values could be used to guide typical similarity search calculations aiming to identify active compounds in databases. It was found that activity-relevant similarity values can be identified as a characteristic feature of fingerprints. However, it was also shown that such values cannot be reliably used as thresholds for practical similarity search calculations. In addition, the analysis presented herein helped to rationalize differences in fingerprint search performance. PMID:27127620

  4. Comparative toxicity of rac- and S-tebuconazole to Daphnia magna.

    PubMed

    Qi, Su Z; Chen, Xiao F; Liu, Yong; Jiang, Jia Z; Wang, Cheng J

    2015-01-01

    Tebuconazole is a chiral triazole fungicide used as raceme in a variety of agricultural applications. Earlier studies showed that tebuconazole is toxic to many non-target aquatic organisms but relative data for tebuconazole enantiomers are lacking. Thus, goal of this study was to evaluate and compare the toxicity of rac- and S-tebuconazole with Daphnia magna at both acute and chronic levels according to Organization for Economic Cooperation and Development (OECD) guidelines 202 and 211 respectively, to provide some guidelines for optimizing chiral pesticides application and management. The exposure concentrations were 0.1, 0.5, 1, 2, 4, 8, 10 mg L(-1) for both rac- and S-tebuconazole and their 48-h EC(50) values to D. magna were 3.53 (3.32-3.78) and 2.74 (2.33-3.10) mg L(-1) respectively, indicating that these both are medium toxic to D. magna with no significant toxicity difference at acute level. In chronic test, <24-h old D. magna were exposed to 0.01, 0.05, 0.10, 0.20, and 0.40 mg L(-1) of rac- and S-tebuconazole with one blank and one solvent control for 21 days according to OECD guideline 211. Four developmental (molting rate, days to the 1st and 3rd brood, and body length) and five reproductive (size of the 1st and 3rd brood, number of broods, and number of neonates) parameters for each D. magna were determined. Results showed that both rac- and S-tebuconazole significantly reduced the reproduction and impacted the development of D. magna at concentrations of 0.05 mg L(-1) or higher. Furthermore, S-tebuconazole was more toxic than raceme, and the difference between effects on the same parameters induced by rac- and S-tebuconazole was statistically significant. These results demonstrated that the chronic toxicity of S-tebuconazole might be underestimated in general use, and further studies should focus more on the biological behaviors of enantiomers and not just the raceme of tebuconazole and other chiral pesticides in the environment.

  5. Linear solvation energy relationships for toxicity of selected organic chemicals to Daphnia pulex and Daphnia magna

    USGS Publications Warehouse

    Passino, Dora R.M.; Hickey, James P.; Frank, Anthony M.

    1988-01-01

    In the Laurentian Great Lakes, more than 300 contaminants have been identified in fish, other biota, water, and sediment. Current hazard assessment of these chemicals by the National Fisheries Research Center-Great Lakes is based on their toxicity, occurrence in the environment, and source. Although scientists at the Center have tested over 70 chemicals with the crustacean Daphnia pulex, the number of experimental data needed to screen the huge array of chemicals in the Great Lakes exceeds the practical capabilities of conducting bioassays. This limitation can be partly circumvented, however, by using mathematical models based on quantitative structure-activity relationships (QSAR) to provide rapid, inexpensive estimates of toxicity. Many properties of chemicals, including toxicity, bioaccumulation and water solubility are well correlated and can be predicted by equations of the generalized linear solvation energy relationships (LSER). The equation we used to model solute toxicity is Toxicity = constant + mVI/100 + s (π* + dδ) + bβm + aαm where VI = intrinsic (Van der Waals) molar volume; π* = molecular dipolarity/polarizability; δ = polarizability 'correction term'; βm = solute hydrogen bond acceptor basicity; and αm = solute hydrogen bond donor acidity. The subscript m designates solute monomer values for α and β. We applied the LSER model to 48-h acute toxicity data (measured as immobilization) for six classes of chemicals detected in Great Lakes fish. The following regression was obtained for Daphnia pulex (concentration = μM): log EC50 = 4.86 - 4.35 VI/100; N = 38, r2 = 0.867, sd = 0.403 We also used the LSER modeling approach to analyze to a large published data set of 24-h acute toxicity for Daphnia magna; the following regression resulted, for eight classes of compounds (concentration = mM): log EC50 = 3.88 - 4.52 VI/100 - 1.62 π* + 1.66 βm - 0.916 αm; N = 62, r2 = 0.859, sd = 0.375 In addition we developed computer software that identifies

  6. Quantitative structure-activity relationship analysis of acute toxicity of diverse chemicals to Daphnia magna with whole molecule descriptors.

    PubMed

    Moosus, M; Maran, U

    2011-10-01

    Quantitative structure-activity relationship analysis and estimation of toxicological effects at lower-mid trophic levels provide first aid means to understand the toxicity of chemicals. Daphnia magna serves as a good starting point for such toxicity studies and is also recognized for regulatory use in estimating the risk of chemicals. The ECOTOX database was queried and analysed for available data and a homogenous subset of 253 compounds for the endpoint LC50 48 h was established. A four-parameter quantitative structure-activity relationship was derived (coefficient of determination, r (2) = 0.740) for half of the compounds and internally validated (leave-one-out cross-validated coefficient of determination, [Formula: see text] = 0.714; leave-many-out coefficient of determination, [Formula: see text] = 0.738). External validation was carried out with the remaining half of the compounds (coefficient of determination for external validation, [Formula: see text] = 0.634). Two of the descriptors in the model (log P, average bonding information content) capture the structural characteristics describing penetration through bio-membranes. Another two descriptors (energy of highest occupied molecular orbital, weighted partial negative surface area) capture the electronic structural characteristics describing the interaction between the chemical and its hypothetic target in the cell. The applicability domain was subsequently analysed and discussed.

  7. DNA fingerprinting in botany: past, present, future

    PubMed Central

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined “Fingerprint News” was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on “DNA fingerprinting: approaches and applications”. Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting (“the past”) was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as “DNA fingerprinting in the present”, and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA

  8. DNA fingerprinting in botany: past, present, future.

    PubMed

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-03

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  9. Infrared Spectroscopic Imaging of Latent Fingerprints and Associated Forensic Evidence

    PubMed Central

    Chen, Tsoching; Schultz, Zachary D.; Levin, Ira W.

    2011-01-01

    Fingerprints reflecting a specific chemical history, such as exposure to explosives, are clearly distinguished from overlapping, and interfering latent fingerprints using infrared spectroscopic imaging techniques and multivariate analysis. PMID:19684917

  10. Solving the Mystery of Fading Fingerprints with London Dispersion Forces.

    ERIC Educational Resources Information Center

    Kimbrough, Doris R.; DeLorenzo, Ronald

    1998-01-01

    Focuses on the kidnapping of a child whose fingerprints were not found inside the crime vehicle. Discusses the investigation that followed and led to knowledge of the differences between the fingerprints of children and adults. (DDR)

  11. Localized Dictionaries Based Orientation Field Estimation for Latent Fingerprints.

    PubMed

    Xiao Yang; Jianjiang Feng; Jie Zhou

    2014-05-01

    Dictionary based orientation field estimation approach has shown promising performance for latent fingerprints. In this paper, we seek to exploit stronger prior knowledge of fingerprints in order to further improve the performance. Realizing that ridge orientations at different locations of fingerprints have different characteristics, we propose a localized dictionaries-based orientation field estimation algorithm, in which noisy orientation patch at a location output by a local estimation approach is replaced by real orientation patch in the local dictionary at the same location. The precondition of applying localized dictionaries is that the pose of the latent fingerprint needs to be estimated. We propose a Hough transform-based fingerprint pose estimation algorithm, in which the predictions about fingerprint pose made by all orientation patches in the latent fingerprint are accumulated. Experimental results on challenging latent fingerprint datasets show the proposed method outperforms previous ones markedly.

  12. Multiplexed Imaging of Trace Residues in a Single Latent Fingerprint.

    PubMed

    Zhang, Yuyan; Zhou, Wen; Xue, Yang; Yang, Jie; Liu, Dingbin

    2016-12-20

    The development of highly sensitive, selective, nondestructive, and multiplexed imaging modalities is essential for latent fingerprint (LFP) identification and fingerprint residues detection. Herein, we present a versatile strategy to identify LFPs and to probe the multiple trace residues in a single LFP simultaneously. With the purpose of achieving high sensitivity, we for the first time introduced a polydopamine (PDA)-triggered Au growth method to prepare superbright and multiplex surface-enhanced Raman scattering (SERS) tags, which were endowed with high selectivity by conjugating with specific antibodies. In combination with a rapid Raman mapping technique, the sensitivity of the SERS probes was down to picogram scale and all the three levels of LFP features can be clearly seen. More significantly, the multiplexed imaging of diverse residues in a single LFP provides more accurate information than that using monochromatic imaging of individuals alone. The high analytical figures of merit enable this approach great promise for use in the fields ranging from chemical detection to molecular imaging.

  13. Male meiosis in Crustacea: synapsis, recombination, epigenetics and fertility in Daphnia magna.

    PubMed

    Gómez, Rocío; Van Damme, Kay; Gosálvez, Jaime; Morán, Eugenio Sánchez; Colbourne, John K

    2016-09-01

    We present the first detailed cytological study of male meiosis in Daphnia (Crustacea: Branchiopoda: Cladocera)-an aquatic microcrustacean with a cyclical parthenogenetic life cycle. Using immunostaining of the testes in Daphnia magna for baseline knowledge, we characterized the different stages of meiotic division and spermiogenesis in relation to the distribution of proteins involved in synapsis, early recombination events and sister chromatid cohesion. We also studied post-translational histone modifications in male spermatocytes, in relation to the dynamic chromatin progression of meiosis. Finally, we applied a DNA fragmentation test to measure sperm quality of D. magna, with respect to levels of inbreeding. As a proxy for fertility, this technique may be used to assess the reproductive health of a sentinel species of aquatic ecosystems. Daphnia proves to be a model species for comparative studies of meiosis that is poised to improve our understanding of the cytological basis of sexual and asexual reproduction.

  14. Environmental effects of dredging. Use of daphnia magna to predict consequences of bioaccumulation

    SciTech Connect

    1987-03-01

    Results reported herein represent a portion of the laboratory research evaluating the relationship between mercury and cadmium tissue residues and biological effects in the freshwater crustacean, Daphnia magna (commonly known as the water flea). Procedures presented here for a 28-day Daphnia magna toxicity test could be used in screening for water-column toxicity resulting from open-water disposal of a specific dredged material. As a part of its regulatory and dredging programs, the U. S. Army Corps of Engineers often conducts, or requires to be conducted, an assessment of the potential for bioaccumulation of environmental contaminants from sediment scheduled for dredging and open-water disposal. There is, at present, no generally accepted guidance available to aid in the interpretation of the biological consequences of bioaccumulation. To provide an initial basis for such guidance, the Environmental Laboratory is conducting both literature database analyses and experimental laboratory studies as part of the Long-Term Effects of Dredging Operations (LEDO) Program.

  15. Rapid toxicity screening tests for aquatic biota. 1. Methodology and experiments with Daphnia magna

    SciTech Connect

    Janssen, C.R.; Persoone, G. )

    1993-04-01

    A promising new and rapid toxicity screening test was developed, the concept and principles of which are presented. The method consists of visual observation of in vivo inhibition of an enzymatic process, using a fluorescent substrate. Juvenile Daphnia magna was exposed to a toxicant dilution series for 1 h, after which the substrate was added and the enzymatic inhibition was observed visually, using a long-wave UV light. The 1-h EC50 results of 11 pure compounds are presented and compared to the conventional 24- and 48-h Daphnia magna EC50s. All 1-h fluorescence EC50s were of the same order of magnitude and correlated very well with the 24- and 48-h EC50s. The sensitivity and reproducibility of this cost-effective screening test were compared to those of the Microtox[reg sign] test. The scope for application and the potential of this new rapid toxicity screening test are evaluated.

  16. Sublethal Effects of Chlorine-Free Kraft Mill Effluents on Daphnia magna.

    PubMed

    Chamorro, Soledad; López, Daniela; Brito, Pablina; Jarpa, Mayra; Piña, Benjamin; Vidal, Gladys

    2016-12-01

    The implementation of elemental chlorine-free (ECF) bleaching methods has drastically reduced the aquatic toxicity of Kraft mill effluents during the last decade. However, the residual toxicity of Kraft mill effluents is still a potential concern for the environment, even when subjected to secondary wastewater treatment. The aim of this study is characterize potential sublethal effects of ECF Kraft mill effluents using Daphnia magna as model species. D. magna exposed towards increasing concentration of ECF Kraft mill effluent showed a significant, dose-dependent reduction in feeding. Conversely, post-feeding assay, life history, and allometric growth analyses showed stimulatory, rather than inhibitory effects in exposed animals at low concentrations, while high concentrations of ECF Kraft mill effluents reduced their reproductive output. These results suggest a hormetic effect in which moderate concentrations of the effluent had a stimulatory effect with higher concentrations causing inhibition in some variables.

  17. Multigenerational contaminant exposures produce non-monotonic, transgenerational responses in Daphnia magna.

    PubMed

    Kimberly, David A; Salice, Christopher J

    2015-12-01

    Generally, ecotoxicologists rely on short-term tests that assume populations to be static. Conversely, natural populations may be exposed to the same stressors for many generations, which can alter tolerance to the same (or other) stressors. The objective of this study was to improve our understanding of how multigenerational stressors alter life history traits and stressor tolerance. After continuously exposing Daphnia magna to cadmium for 120 days, we assessed life history traits and conducted a challenge at higher temperature and cadmium concentrations. Predictably, individuals exposed to cadmium showed an overall decrease in reproductive output compared to controls. Interestingly, control D. magna were the most cadmium tolerant to novel cadmium, followed by those exposed to high cadmium. Our data suggest that long-term exposure to cadmium alter tolerance traits in a non-monotonic way. Because we observed effects after one-generation removal from cadmium, transgenerational effects may be possible as a result of multigenerational exposure.

  18. Audio fingerprint extraction for content identification

    NASA Astrophysics Data System (ADS)

    Shiu, Yu; Yeh, Chia-Hung; Kuo, C. C. J.

    2003-11-01

    In this work, we present an audio content identification system that identifies some unknown audio material by comparing its fingerprint with those extracted off-line and saved in the music database. We will describe in detail the procedure to extract audio fingerprints and demonstrate that they are robust to noise and content-preserving manipulations. The main feature in the proposed system is the zero-crossing rate extracted with the octave-band filter bank. The zero-crossing rate can be used to describe the dominant frequency in each subband with a very low computational cost. The size of audio fingerprint is small and can be efficiently stored along with the compressed files in the database. It is also robust to many modifications such as tempo change and time-alignment distortion. Besides, the octave-band filter bank is used to enhance the robustness to distortion, especially those localized on some frequency regions.

  19. Image and video fingerprinting: forensic applications

    NASA Astrophysics Data System (ADS)

    Lefebvre, Frédéric; Chupeau, Bertrand; Massoudi, Ayoub; Diehl, Eric

    2009-02-01

    Fighting movie piracy often requires automatic content identification. The most common technique to achieve this uses watermarking, but not all copyrighted content is watermarked. Video fingerprinting is an efficient alternative solution to identify content, to manage multimedia files in UGC sites or P2P networks and to register pirated copies with master content. When registering by matching copy fingerprints with master ones, a model of distortion can be estimated. In case of in-theater piracy, the model of geometric distortion allows the estimation of the capture location. A step even further is to determine, from passive image analysis only, whether different pirated versions were captured with the same camcorder. In this paper we present three such fingerprinting-based forensic applications: UGC filtering, estimation of capture location and source identification.

  20. Fingerprinting Communication and Computation on HPC Machines

    SciTech Connect

    Peisert, Sean

    2010-06-02

    How do we identify what is actually running on high-performance computing systems? Names of binaries, dynamic libraries loaded, or other elements in a submission to a batch queue can give clues, but binary names can be changed, and libraries provide limited insight and resolution on the code being run. In this paper, we present a method for"fingerprinting" code running on HPC machines using elements of communication and computation. We then discuss how that fingerprint can be used to determine if the code is consistent with certain other types of codes, what a user usually runs, or what the user requested an allocation to do. In some cases, our techniques enable us to fingerprint HPC codes using runtime MPI data with a high degree of accuracy.

  1. Chemical Fingerprinting of Materials Developed Due to Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    Instrumental chemical analysis methods are developed and used to chemically fingerprint new and modified External Tank materials made necessary by changing environmental requirements. Chemical fingerprinting can detect and diagnose variations in material composition. To chemically characterize each material, fingerprint methods are selected from an extensive toolbox based on the material's chemistry and the ability of the specific methods to detect the material's critical ingredients. Fingerprint methods have been developed for a variety of materials including Thermal Protection System foams, adhesives, primers, and composites.

  2. Life history and biology of Fascioloides magna (Trematoda) and its native and exotic hosts

    PubMed Central

    Malcicka, Miriama

    2015-01-01

    Host–parasite interactions are model systems in a wide range of ecological and evolutionary fields and may be utilized for testing numerous theories and hypotheses in terms of both applied and fundamental research. For instance, they are important in terms of studying coevolutionary arms races, species invasions, and in economic terms the health of livestock and humans. Here, I present a comprehensive description of the life history, biogeography, and biology of the giant liver fluke, Fascioloides magna, and both its intermediate and definitive hosts. F. magna is native to North America where it uses several species of freshwater snails (Lymnaeidae) as intermediate hosts and four main species of ungulates as definitive hosts. The fluke has also been introduced into parts of Europe where it is now established in two lymnaeid snail species and three ungulate species. This study gives a comprehensive description of different developmental stages of the fluke in its two host classes, as well as detailed notes on historical and present distributions of F. magna in North America and Europe as well as in its snail and deer hosts (with range maps provided). Aberrant and dead-end hosts are also discussed in detail, and descriptive phylogenies are provided for all of the organisms. I briefly discuss how F. magna represents a model example of multiple-level ecological fitting, a phenomenon not yet described in the empirical literature. Lastly, I explore possible future scenarios for fluke invasion in Europe, where it is currently expanding its range. PMID:25897378

  3. Bioaccumulation of perfluoroalkyl substances by Daphnia magna in water with different types and concentrations of protein.

    PubMed

    Xia, Xinghui; Rabearisoa, Andry H; Jiang, Xiaoman; Dai, Zhineng

    2013-10-01

    Perfluoroalkyl substances (PFASs) are sometimes regarded as proteinophilic compounds, however, there is no research report about the effect of environmental protein on the bioaccumulation of PFASs in waters. In the present study we investigated influences of protein on the bioaccumulation of six kinds of PFASs by Daphnia magna in water; it included perfluorooctane sulfonate, perfluorooctanoic acid, perfluorononanoic acid, perfluorodecanoic acid, perfluoroundecanoic acid, and perfluorododecanoic acid. Two types of protein including bovine albumin from animal and soy peptone from plant were compared and the effects of protein concentration were investigated. Both types of protein at high concentrations (10 and 20 mg L(-1)) suppressed the bioaccumulation of PFASs. When protein concentration increased from 0 to 20 mg L(-1), the decreasing ratios of the PFAS body burden (35.3-52.9%) in Daphnia magna induced by bovine albumin were significantly higher than those (22.0-36.6%) by soy peptone. The dialysis bag experiment results showed that the binding of PFASs to protein followed the Freundlich isotherm, suggesting it is not a linear partitioning process but an adsorption-like process. The partition coefficients of PFASs between bovine albumin and water were higher compared to soy peptone; this resulted in higher reducing rates of freely dissolved concentrations of PFASs with increasing bovine albumin concentration, leading to a stronger suppression of PFAS bioaccumulation. However, the presence of both types of protein with a low concentration (1 mg L(-1)) enhanced the bioaccumulation of PFASs. Furthermore, the water-based bioaccumulation factor based on the freely dissolved concentrations of PFASs even increased with and the depuration rate constants of PFASs from Daphnia magna decreased with protein concentration, suggesting that protein would not only reduce the bioavailable concentrations and uptake rates of PFASs but also lower the elimination rates of PFASs in

  4. Effects of algal food quality on sexual reproduction of Daphnia magna.

    PubMed

    Choi, Jong-Yun; Kim, Seong-Ki; La, Geung-Hwan; Chang, Kwang-Hyeon; Kim, Dong-Kyun; Jeong, Keon-Young; Park, Min S; Joo, Gea-Jae; Kim, Hyun-Woo; Jeong, Kwang-Seuk

    2016-05-01

    The objective of our study was to investigate sexual reproduction of Daphnia magna associated with mating behaviors and hatching rates, according to different algal food sources. Since a diatom is known to contain more abundant long-chain poly unsaturated fatty acids (PUFAs), we hypothesized that the diatom-consuming D. magna would exhibit more successful reproduction rates. Upon the hypothesis, we designed three experiments using two algal species, a green alga (Chlorella vulgaris) and a diatom (Stephanodiscus hantzschii). From the results, we found that the mating frequency and copulation duration increased in the treatment with S. hantzschii, resulting in a significant increase of hatching rates of resting eggs. In the other two repetitive mating strategies (e.g., one female vs. multiple males, and one male vs. multiple females), we found that the hatching rates of resting eggs were greater in the S. hantzschii treatment. In addition to the mating strategy, male body size significantly increased in the diatom treatment, hence average diameter of penis was also statistically different among the treatments (greater diameter in the S. hantzschii treatment). To examine the effect of algal food quality, we estimated quantity of fatty acids in the two algal species. Our result showed that S. hantzschii had a higher proportion of long-chain PUFAs than C. vulgaris. Furthermore, a stable isotope analysis revealed that carbon and nitrogen originated from S. hantzschii were more assimilated to D. magna. In summary, our study manifested that diatom consumption of D. magna leads to more successful sexual reproduction. We then discussed how the diatom consumption of zooplankton influences food web dynamics in a freshwater ecosystem.

  5. A comparison of the response of Simocephalus mixtus (Cladocera) and Daphnia magna to contaminated freshwater sediments.

    PubMed

    Martínez-Jerónimo, Fernando; Cruz-Cisneros, Jade Lizette; García-Hernández, Leonardo

    2008-09-01

    The southeast region of Mexico is characterized by intensive oil industry activities carried out by the national public enterprise Petróleos Mexicanos (PEMEX). The freshwater lagoon "El Limón", located in the municipality of Macuspana, state of Tabasco, Mexico, has received over 40 years discharges of untreated waste waters from the Petrochemical Complex "Ciudad PEMEX", located on the border of the lagoon. To assess the toxicity of the sediments and, hence, to obtain information on the biological effects of these contaminating discharges, the cladoceran Simocephalus mixtus was used as a test organism in acute (48h) and chronic (12d) toxicity assays. For comparison purposes, bioassays were also conducted with the reference cladoceran Daphnia magna. The sediments of this lagoon contain important amounts of metals and hydrocarbons that have been accumulated over time; however, the acute tests only registered reduced lethal effects on the test organisms (maxima of 10% and 17% mortality for D. magna and S. mixtus, respectively). This may be due to low bioavailability of the pollutants present in the sediments. On the other hand, partial or total inhibition and delay in the start of reproduction, reduction in clutch sizes, reduced survival, as well as reduction in the size of adults and offspring were recorded in the chronic assays. The most evident chronic effects were found in S. mixtus; in this species, reproduction was inhibited up to 72%, whereas D. magna was only affected by 24%. We determined that S. mixtus is a more sensitive test organism than D. magna to assess whole-sediment toxicity in tropical environments, and that chronic exposure bioassays are required for an integrated sediment evaluation. The sediments from "El Limón" lagoon induced chronic intoxication responses and, therefore, remediation measures are urgently needed to recover environmental conditions suitable for the development of its aquatic biota.

  6. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    PubMed Central

    2011-01-01

    Background Daphnia (Crustacea: Cladocera) plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP) marker development. Results We developed three expressed sequence tag (EST) libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47%) of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna. PMID:21668940

  7. Silver Nanowire Exposure Results in Internalization and Toxicity to Daphnia Magna

    PubMed Central

    Scanlan, Leona D.; Reed, Robert B.; Loguinov, Alexandre V.; Antczak, Philipp; Tagmount, Abderrahmane; Aloni, Shaul; Nowinski, Daniel Thomas; Luong, Pauline; Tran, Christine; Karunaratne, Nadeeka; Pham, Don; Lin, Xin Xin; Falciani, Francesco; Higgins, Chris P.; Ranville, James F.; Vulpe, Chris D.; Gilbert, Benjamin

    2013-01-01

    Nanowires (NWs), high-aspect-ratio nanomaterials, are increasingly used in technological materials and consumer products and may have toxicological characteristics distinct from nanoparticles. We carried out a comprehensive evaluation of the physico-chemical stability of four silver nanowires (AgNWs) of two sizes and coatings and their toxicity to Daphnia magna. Inorganic aluminum-doped silica coatings were less effective than organic poly(vinyl pyrrolidone) coatings at preventing silver oxidation or Ag+ release and underwent a significant morphological transformation within one-hour following addition to low ionic strength Daphnia growth media. All AgNWs were highly toxic to D. magna but less toxic than ionic silver. Toxicity varied as a function of AgNW dimension, coating and solution chemistry. Ag+ release in the media could not account for observed AgNW toxicity. Single-particle inductively coupled plasma mass spectrometry (spICPMS) distinguished and quantified dissolved and nanoparticulate silver in microliter-scale volumes of Daphnia magna hemolymph with a limit of detection of approximately 10 ppb. The silver levels within the hemolymph of Daphnia exposed to both Ag+ and AgNW met or exceeded the initial concentration in the growth medium, indicating effective accumulation during filter feeding. Silver-rich particles were the predominant form of silver in hemolymph following exposure to both AgNWs and Ag+. Scanning electron microscopy (SEM) imaging of dried hemolymph found both AgNWs and silver precipitates that were not present in the AgNW stock or the growth medium. Both organic and inorganic coatings on the AgNW were transformed during ingestion or absorption. Pathway, gene ontology and clustering analyses of gene expression response indicated effects of AgNWs distinct from ionic silver on Daphnia magna. PMID:24099093

  8. How reliable are data for the ecotoxicity of trivalent chromium to Daphnia magna?

    PubMed

    Ponti, Benedetta; Bettinetti, Roberta; Dossi, Carlo; Vignati, Davide Anselmo Luigi

    2014-10-01

    Risk assessments from the European Union and the World Health Organization report values for acute and chronic toxicity of Cr(III) to Daphnia magna in the range of 0.6 mg/L to 111 mg/L and 0.047 mg/L to 3.4 mg/L, respectively. To understand whether factors other than the use of different test media and data reporting contribute to this variability, the authors tested the acute (48-h) and chronic (21-d) toxicities of Cr(III) to D. magna according to Organisation for Economic Co-operation and Development (OECD) methods. Filterable (0.45-µm) chromium concentrations were measured at 0 h, 6 h, 24 h, and 48 h, the latter value corresponding to the total duration of the acute tests and to the interval between medium renewals in chronic tests. In highly alkaline media (4.9 meq/L), Cr concentrations decreased rapidly below the analytical detection limit, and no toxicity was observed. In less alkaline media (approximately 0.8 meq/L), the decrease in filterable Cr concentrations was inversely proportional to the quantity of added Cr(III). The authors concluded that existing data likely underestimate the ecotoxicity of Cr(III) to D. magna. A reliable assessment of the hazard of Cr(III) to D. magna must consider that exposure concentrations can decrease markedly from the beginning to the end of a test and that medium alkalinity strongly influences the outcome of laboratory toxicity tests.

  9. Energy allocation in Daphnia magna exposed to xenobiotics: A biochemical approach

    SciTech Connect

    Coen, W.M. De; Janssen, C.R.; Persoone, G.

    1995-12-31

    A new approach to sublethal aquatic toxicity testing based on a biochemical assessment of the energy budget of Daphnia magna was developed and evaluated. With this method energy consumption (E{sub c}) is estimated by measuring the electron transport activity based on the calorimetric measurement of a tetrazolium salt reduction. Total available energy (E{sub a}) is assessed by measuring the lipid, protein and sugar content of the test organism using calorimetric methods. E{sub a} {minus} E{sup c} can subsequently be calculated and represents the ``surplus`` energy available for growth and reproduction. D. magna neonates were exposed to cadmium and 2,4-dichlorophenoxy acetic acid for 4 days after which the electron transport activity and the total lipid, protein and sugar content of the test organisms were determined. Using the enthalpy of combustion of the different macromolecular groups and converting the oxygen consumption into oxyenthalpic equivalents, an estimation of the total energy budget of the test organisms was made. Additionally, the age specific survival and reproduction and the growth of D. magna populations exposed to the same sublethal concentrations was assessed in 21 day life table experiments. Energy allocation patterns of stressed D. magna obtained with the new biochemical approach were similar to those obtained with the conventional Scope for Growth determinations. Although more research is needed, comparison between the suborganismal (biochemical) and supraorganismal (life table) endpoints indicate that the proposed short-term assay based on energy allocation could be used to predict long-term effects on the survival, growth and reproduction of daphnids.

  10. Chronic effects of contaminated sediment on Daphnia magna and Chironomus tentans

    SciTech Connect

    Nebeker, A.V.; Onjukka, S.T.; Cairns, M.A.

    1988-10-01

    Chronic tests were conducted with Daphnia magna (cladoceran) and Chironomus tentans (midge) to determine their usefulness as test organisms for chronic sediment assays, and to estimate the potential long-term impact of contaminated freshwater sediments and contaminated Superfund site soils on freshwater invertebrates. These two species have been used successfully in acute sediment tests, and have been shown to be useful in chronic tests in water--only bioassays.

  11. Reduced cadmium accumulation and toxicity in Daphnia magna under carbon nanotube exposure.

    PubMed

    Liu, Jie; Wang, Wen-Xiong

    2015-12-01

    With increasing application and commercial production, carbon nanotubes (CNTs) will inevitably be released into aquatic environments and affect the transport and toxicity of toxic metals in ecosystems. The present study examined how CNTs affected the biokinetics and toxicity of a toxic metal, cadmium (Cd), in the freshwater zooplankton Daphnia magna. The authors quantified the dissolved uptake and the 50% lethal concentration (LC50, 48 h and 72 h) of Cd in daphnids in the presence of functionalized multiwalled nanotubes (F-CNTs) with different lengths (10-30 µm vs 0.5-2 µm) and concentrations (4 mg/L and 8 mg/L). Compared with the control treatment without CNTs, both CNTs slowed down the accumulation rate of Cd in D. magna over 8 h of exposure and further reduced the accumulation thereafter. Mechanisms for the reduced Cd uptake were mainly related to the influences of CNTs on the physiological activity of daphnids. The LC50 of D. magna in the presence of Cd and shorter CNTs was almost the same as that of the control group without CNTs. However, the LC50 of the groups with normal CNTs was significantly higher than that of the control group (i.e., F-CNTs decreased Cd toxicity significantly). Meanwhile, CNTs also decreased the tolerance of D. magna to Cd. The present study suggests that different physical properties of CNTs, such as length, need to be considered in the environmental risk assessment of CNTs.

  12. Evaluation of the ultrasonic method for solubilizing Daphnia magna before liquid scintillation counting

    SciTech Connect

    Dauble, D.D.; Hanf, R.W. Jr.; Carlile, D.W.

    1984-11-01

    Adult Daphnia magna were exposed to /sup 14/C-labeled phenol and tissues analyzed for /sup 14/C uptake by three methods: (1) tissue solubilizer, (2) tissue solubilizer plus sonication, and (3) sonication alone. Analysis by liquid scintillation counting revealed that measurements of total activity among treatments were not significantly different (..cap alpha.. less than or equal to 0.10) at two count levels. Sonicated samples showed less variation than tissue samples that were solubilized. 5 references, 1 table.

  13. Development of miniaturized acute toxicity tests for Daphnia magna and Pimephales promelas

    SciTech Connect

    Powell, R.L.; Kimerle, R.A.; Moser, E.M.; McKee, M.J.

    1995-12-31

    Standard EPA methods for conducting static, 48-hour, acute toxicity tests using Daphnia magna and Pimephales promelas (fathead minnows) can be miniaturized to successfully yield accurate LC50/EC50 values. The screening procedure involves exposing the test organisms to 1 mL of test solution, in test chambers which consist of the wells on 48-well microliter plates. Toxicity of the microliter plates and solvent, DO concentration, organism biomass to test solution ratio, partitioning of the chemicals and dilution of the test solution during transfer of the test organisms were examined. Survival and exposure were not significantly altered using non-standard test chambers. Toxicity of linear alkylbenzene sulfonate (LAS), pentachlorophenol (PCP), kepone, and sodium lauryl sulfate (SLS) was determined using D. magna and fathead minnows. Serial dilutions were made and 1 mL aliquots pipetted into the wells. Daphnia magna, < 24 hours old, and newly hatched fathead minnows, were transferred into the wells, twenty individuals per concentration, one per well. Dose-response curves were established for all test compounds. LC50/EC50`s values obtained using miniaturized methods strongly correlated with those obtained using standard EPA procedures. The tests were repeated a number of times with coefficient of variances for D. magna ranging from 10% with kepone to 64% with SLS. For fathead minnows CVs ranged from 0% with PCP to 23% with kepone. It was concluded that current methods can be miniaturized, yet still provide accurate information regarding toxicity for compounds in limited supply. This method may also be amenable to effluent testing i.e. TIE fractions. Other benefits include reducing the amount of equipment and space needed to conduct a test and the time involved.

  14. Silver nanowire exposure results in internalization and toxicity to Daphnia magna.

    PubMed

    Scanlan, Leona D; Reed, Robert B; Loguinov, Alexandre V; Antczak, Philipp; Tagmount, Abderrahmane; Aloni, Shaul; Nowinski, Daniel Thomas; Luong, Pauline; Tran, Christine; Karunaratne, Nadeeka; Pham, Don; Lin, Xin Xin; Falciani, Francesco; Higgins, Christopher P; Ranville, James F; Vulpe, Chris D; Gilbert, Benjamin

    2013-12-23

    Nanowires (NWs), high-aspect-ratio nanomaterials, are increasingly used in technological materials and consumer products and may have toxicological characteristics distinct from nanoparticles. We carried out a comprehensive evaluation of the physicochemical stability of four silver nanowires (AgNWs) of two sizes and coatings and their toxicity to Daphnia magna . Inorganic aluminum-doped silica coatings were less effective than organic poly(vinyl pyrrolidone) coatings at preventing silver oxidation or Ag(+) release and underwent a significant morphological transformation within 1 h following addition to low ionic strength Daphnia growth media. All AgNWs were highly toxic to D. magna but less toxic than ionic silver. Toxicity varied as a function of AgNW dimension, coating, and solution chemistry. Ag(+) release in the media could not account for observed AgNW toxicity. Single-particle inductively coupled plasma mass spectrometry distinguished and quantified dissolved and nanoparticulate silver in microliter-scale volumes of Daphnia magna hemolymph with a limit of detection of approximately 10 ppb. The silver levels within the hemolymph of Daphnia exposed to both Ag(+) and AgNW met or exceeded the initial concentration in the growth medium, indicating effective accumulation during filter feeding. Silver-rich particles were the predominant form of silver in hemolymph following exposure to both AgNWs and Ag(+). Scanning electron microscopy imaging of dried hemolymph found both AgNWs and silver precipitates that were not present in the AgNW stock or the growth medium. Both organic and inorganic coatings on the AgNW were transformed during ingestion or absorption. Pathway, gene ontology, and clustering analyses of gene expression response indicated effects of AgNWs distinct from ionic silver on Daphnia magna .

  15. Chronic effects of contaminated sediment on Daphnia magna and Chironomus tentans (journal version)

    SciTech Connect

    Nebeker, A.V.; Onjukka, S.T.; Cairns, M.A.

    1988-01-01

    Chronic tests were conducted with Daphnia magna (cladoceran) and Chironomus tentans (midge) to determine their usefulness as test organisms for chronic sediment assays, and to estimate the potential long-term impact of contaminated freshwater sediments and contaminated Superfund-site soils on freshwater invertebrates. These two species were used successfully in acute sediment tests and were shown to be useful in chronic tests in water.

  16. Toxicity of silver and titanium dioxide nanoparticle suspensions to the aquatic invertebrate, Daphnia magna.

    PubMed

    Das, Pranab; Xenopoulos, Marguerite A; Metcalfe, Chris D

    2013-07-01

    The purpose of this study was to investigate the 48 h acute toxicity of capped silver nanoparticles (AgNPs), and capped and uncapped titanium dioxide (nTiO₂) to Daphnia magna neonates. In addition, a 24 days chronic toxicity study was performed for D. magna exposed to uncapped nTiO₂ to evaluate effects on growth, reproduction and survival. The 48 h median lethal concentrations (LC₅₀) for carboxy-functionalized capped AgNPs and uncapped nTiO₂ were 2.75 μg/L and 7.75 mg/L, respectively. In contrast, no mortalities were observed for Daphnia exposed to carboxy-functionalized capped nTiO₂ at concentrations up to 30 mg/L. In the chronic toxicity experiment with uncapped nTiO₂, the growth, reproduction and survival of D. magna were significantly (p < 0.05) reduced at concentrations ranging from 4.5 to 7.5 mg/L. Growth and reproduction were reduced by 35 % and 93 %, respectively in the treatments at the highest uncapped nTiO₂ concentration (7.5 mg/L). Time to first reproduction was delayed by 2-3 days in D. magna and the test organisms produced only 1-2 broods over 24 days exposure to the highest concentration of uncapped nTiO₂. Overall, the results from the present study indicate that exposures of aquatic invertebrates to nanoparticles could have important ecological effects on lower trophic levels in aquatic ecosystems.

  17. Toxicity identification evaluation of anaerobically treated swine slurry: a comparison between Daphnia magna and Raphanus sativus.

    PubMed

    Villamar, Cristina A; Silva, Jeannette; Bay-Schmith, Enrique; Vidal, Gladys

    2014-01-01

    Anaerobic digestion does not efficiently reduce ionic compounds present in swine slurry, which could present a potential risk to aquatic ecosystems (surface runoff) and terrestrial ambient (irrigation). The objective of this study was to evaluate the ecotoxicological characteristics of anaerobically treated swine slurry using acute and chronic (epicotyl elongation) toxicity tests with Daphnia magna and Raphanus sativus and identification of suspected toxic compounds using the Toxicity Identification Evaluation (TIE) method. The evaluation was performed in three phases: physicochemical characterization of the slurry; acute/chronic toxicity testing with Daphnia magna and Raphanus sativus for each fraction of the TIE (cation and anion exchange columns, activated carbon, pH modification/aeration and EDTA) and identification of suspected toxic compounds. The anaerobically treated slurry contained concentrations of ammonium of 1,072 mg L(-1), chloride of 815 mg L(-1) and metals below 1 mg L(-1) with a D. magna acute toxicity (48h-LC50) of 5.3% and R. sativus acute toxicity (144h-LC50) of 48.1%. Epicotyl elongation of R. sativus was inhibited at concentrations above 25% (NOEC). The cation exchange reduced the toxicity and free ammonia by more than 90% for both bio-indicators. Moreover, this condition stimulated the epicotyl growth of R. sativus between 10% and 37%. In conclusion, the main compound suspected of causing acute toxicity in D. magna and acute/chronic toxicity in R. sativus is the ammonium. The findings suggest the need the ammonium treatment prior to the agricultural reuse of swine slurry given the high risk to contaminate the aquatic environment by runoff and toxicity of sensitive plants.

  18. Morphological evidence of mechanoreceptive gravity perception in a water flea - Daphnia magna

    NASA Technical Reports Server (NTRS)

    Meyers, D. G.

    1985-01-01

    Hair-like structures or setae located in the basal membrane of the swimming antennae of the water flea, D. magna, were observed by scanning electron microscopy and compared to mechanoreceptors in the Higher Order Crustacea. Similarities in anatomy, size, attachment, number, length, and orientation support the hypothesis that the setae are rheoceptive mechanoreceptors which mediate gravity perception through deflection by water currents during the sink phase of hop-and-sink swimming behavior.

  19. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 2 2012-07-01 2012-07-01 false Interpretation of fingerprint submission requirements. 901.2 Section 901.2 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a)...

  20. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 2 2013-07-01 2013-07-01 false Interpretation of fingerprint submission requirements. 901.2 Section 901.2 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a)...

  1. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 2 2011-07-01 2011-07-01 false Interpretation of fingerprint submission requirements. 901.2 Section 901.2 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a)...

  2. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 2 2014-07-01 2014-07-01 false Interpretation of fingerprint submission requirements. 901.2 Section 901.2 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a)...

  3. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 8 Aliens and Nationality 1 2014-01-01 2014-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  4. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  5. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  6. 8 CFR 1236.5 - Fingerprints and photographs.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local...

  7. 28 CFR 901.2 - Interpretation of fingerprint submission requirements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Interpretation of fingerprint submission requirements. 901.2 Section 901.2 Judicial Administration NATIONAL CRIME PREVENTION AND PRIVACY COMPACT COUNCIL FINGERPRINT SUBMISSION REQUIREMENTS § 901.2 Interpretation of fingerprint submission requirements. (a) Article V of the Compact...

  8. Fingerprint Ridge Count: A Polygenic Trait Useful in Classroom Instruction.

    ERIC Educational Resources Information Center

    Mendenhall, Gordon; And Others

    1989-01-01

    Describes the use of the polygenic trait of total fingerprint ridge count in the classroom as a laboratory investigation. Presents information on background of topic, fingerprint patterns which are classified into three major groups, ridge count, the inheritance model, and activities. Includes an example data sheet format for fingerprints. (RT)

  9. Digital Video of Live-Scan Fingerprint Data

    National Institute of Standards and Technology Data Gateway

    NIST Digital Video of Live-Scan Fingerprint Data (PC database for purchase)   NIST Special Database 24 contains MPEG-2 (Moving Picture Experts Group) compressed digital video of live-scan fingerprint data. The database is being distributed for use in developing and testing of fingerprint verification systems.

  10. 22 CFR 41.105 - Supporting documents and fingerprinting.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Supporting documents and fingerprinting. 41.105... and fingerprinting. (a) Supporting documents—(1) Authority to require documents. The consular officer... through NATO-4 or NATO-6. (b) Fingerprinting. Every applicant for a nonimmigrant visa must...

  11. 22 CFR 41.105 - Supporting documents and fingerprinting.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 22 Foreign Relations 1 2014-04-01 2014-04-01 false Supporting documents and fingerprinting. 41.105... and fingerprinting. (a) Supporting documents—(1) Authority to require documents. The consular officer... through NATO-4 or NATO-6. (b) Fingerprinting. Every applicant for a nonimmigrant visa must...

  12. 22 CFR 41.105 - Supporting documents and fingerprinting.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Supporting documents and fingerprinting. 41.105... and fingerprinting. (a) Supporting documents—(1) Authority to require documents. The consular officer... through NATO-4 or NATO-6. (b) Fingerprinting. Every applicant for a nonimmigrant visa must...

  13. Chemical Fingerprinting of Materials Developed Due To Environmental Issues

    NASA Technical Reports Server (NTRS)

    Smith, Doris A.; McCool, A. (Technical Monitor)

    2000-01-01

    This paper presents viewgraphs on chemical fingerprinting of materials developed due to environmental issues. Some of the topics include: 1) Aerospace Materials; 2) Building Blocks of Capabilities; 3) Spectroscopic Techniques; 4) Chromatographic Techniques; 5) Factors that Determine Fingerprinting Approach; and 6) Fingerprinting: Combination of instrumental analysis methods that diagnostically characterize a material.

  14. DNA fingerprinting in forensics: past, present, future

    PubMed Central

    2013-01-01

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting. PMID:24245688

  15. DNA fingerprinting in forensics: past, present, future.

    PubMed

    Roewer, Lutz

    2013-11-18

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting.

  16. Fingerprint image enhancement by differential hysteresis processing.

    PubMed

    Blotta, Eduardo; Moler, Emilce

    2004-05-10

    A new method to enhance defective fingerprints images through image digital processing tools is presented in this work. When the fingerprints have been taken without any care, blurred and in some cases mostly illegible, as in the case presented here, their classification and comparison becomes nearly impossible. A combination of spatial domain filters, including a technique called differential hysteresis processing (DHP), is applied to improve these kind of images. This set of filtering methods proved to be satisfactory in a wide range of cases by uncovering hidden details that helped to identify persons. Dactyloscopy experts from Policia Federal Argentina and the EAAF have validated these results.

  17. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.

    PubMed

    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely

    2014-08-01

    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna.

  18. Chronic toxicity of silver nitrate to Ceriodaphnia dubia and Daphnia magna, and potential mitigating factors.

    PubMed

    Naddy, Rami B; Gorsuch, Joseph W; Rehner, Anita B; McNerney, Gina R; Bell, Russell A; Kramer, James R

    2007-08-15

    We investigated the chronic toxicity of Ag, as silver nitrate, using two freshwater aquatic cladoceran species, Ceriodaphnia dubia and Daphnia magna, to generate data for the development of a chronic ambient water quality criterion for Ag. Preliminary studies with C. dubia showed variable results which were related to the equilibration time between food and silver. Follow-up testing was conducted using a 3h equilibration time, which stabilized dissolved Ag concentrations and the toxicity of Ag(+). Results with C. dubia conducted individually (1 per cup, n=10) and in mass (30 per chamber, n=2) gave similar results once similar standardized equilibration times were used. The maximum acceptable toxicant concentration (MATC) of Ag to C. dubia and D. magna was 9.61 and 3.00microg dissolved Ag/L, respectively. The chronic toxicity of Ag(+) to C. dubia was also evaluated in the presence of: (1) dissolved organic carbon (DOC) and (2) sulfide. The addition of DOC (0.4mg/L) resulted in a approximately 50% decrease in toxicity while the addition of sulfide (75.4nM) deceased toxicity by 42%. Whole-body Ag concentration in D. magna was positively correlated with increased levels of Ag exposure, however; we observed a non-statistical decrease in whole-body Na levels, an estimator of sodium homeostasis.

  19. Synergistic mitotoxicity of chloromethanes and fullerene C60 nanoaggregates in Daphnia magna midgut epithelial cells.

    PubMed

    Seke, Mariana; Markelic, Milica; Morina, Arian; Jovic, Danica; Korac, Aleksandra; Milicic, Dragana; Djordjevic, Aleksandar

    2016-12-03

    Adsorption of non-polar compounds by suspended fullerene nanoaggregates (nC60) may enhance their toxicity and affect the fate, transformation, and transport of non-polar compounds in the environment. The potential of stable fullerene nanoaggregates as contaminant carriers in aqueous systems and the influence of chloromethanes (trichloromethane and dichloromethane) were studied on the midgut epithelial cells of Daphnia magna by light and electron microscopy. The size and shape of fullerene nanoaggregates were observed and measured using dynamic light scattering, transmission electron microscopy, and low vacuum scanning electron microscopy. The nC60 in suspension appeared as a bulk of aggregates of irregular shape with a surface consisting of small clumps 20-30 nm in diameter. The presence of nC60 aggregates was confirmed in midgut lumen and epithelial cells of D. magna. After in vivo acute exposure to chloromethane, light and electron microscopy revealed an extensive cytoplasmic vacuolization with disruption and loss of specific structures of D. magna midgut epithelium (mitochondria, endoplasmic reticulum, microvilli, peritrophic membrane) and increased appearance of necrotic cells. The degree of observed changes depended on the type of treatment: trichloromethane (TCM) induced the most notable changes, whereas fullerene nanoaggregates alone had no negative effects. Transmission electron microscopy also indicated increased lysosomal degradation and severe peroxidative damages of enterocyte mitochondria following combined exposure to chloromethane and fullerene nanoaggregates. In conclusion, the adsorption of chloromethane by fullerene nanoaggregates enhances their toxicity and induces peroxidative mitochondrial damage in midgut enterocytes.

  20. Multigenerational effects and DNA alterations of QDs-Indolicidin on Daphnia magna.

    PubMed

    Maselli, Valeria; Siciliano, Antonietta; Giorgio, Antonella; Falanga, Annarita; Galdiero, Stefania; Guida, Marco; Fulgione, Domenico; Galdiero, Emilia

    2017-02-24

    The complex QDs-Indolicidin (QDs-Ind) has been previously shown to be a good antimicrobial system with a low acute toxicity on Daphnia magna (D. magna). However, multigenerational effects caused by exposure to QDs-Ind and after subsequent recovery are still unknown. In this study, we performed multigenerational exposure tests and we evaluated individual fitness, population growth, DNA alteration, expression of Dhb (haemoglobin), Vtg (vitellogenin), CYP4 (cytochrome P450s CYP4 family), and CYP314 (cytochrome P450s mitochondrial family 314) genes on three generation of D. magna. Results showed that the total amount of eggs produced per female and total number of brood per female and body lengths were significantly decreased, Dhb, CYP4 were upregulated while Vtg was down-regulated except at reproduction days when it was slightly up-regulated under QDs-Ind exposure. Random Amplification of Polymorphic DNA (RAPD) method has proven to be useful to qualitative assess of DNA damage during generation and to underline modification in somatic or germinal cells. The results of the study suggest that effects of chronic exposure cannot be ignored.

  1. Mechanisms of action of selective serotonin reuptake inhibitors in Daphnia magna.

    PubMed

    Campos, Bruno; Piña, Benjamín; Barata C, Carlos

    2012-03-06

    Selective serotonin reuptake inhibitors (SSRI) are known to increase offspring production in Daphnia magna. This study tested the hypothesis that the increase of serotonin postsynaptic activity by SSRI changes the perception of the food environment and switches life-history responses toward higher food level: females reproduced earlier, producing more but smaller offspring. D. magna reproduction tests, respiration, feeding, and survival-starvation assays and studies of lipids, proteins, and carbohydrate levels of unexposed and exposed females to the SSRI fluoxetine and fluvoxamine and the 5-HT serotonin receptor antagonist cyproheptadine were conducted. Factorial life-history experiments and reproductive assays showed that exposure to SSRI increased juvenile development rate, clutch size, and decrease offspring size at low and intermediate levels of food rations. These effects were reversed by the presence of cyproheptadine, indicating that 5-HT function was essential to the SSRI effects on Daphnia and linking them to the pharmacological effects of SSRI in humans. Respirometry and survival assays and biochemical analyses of lipids, proteins and carbohydrate levels showed that exposure to SSRI increased oxygen consumption rates and decreased carbohydrate levels in adult females. These changes did not affect survival under starving conditions, but they significantly affected the capacity of the exposed animals to survive under anoxic conditions. These results suggest that SSRI increased aerobic catabolism in D. magna making exposed individuals apparently more able to exploit food resources under normoxic conditions, but at the cost of being more sensitive to low oxygen levels, a common situation in natural environments.

  2. Assessment of the effects of the carbamazepine on the endogenous endocrine system of Daphnia magna.

    PubMed

    Oropesa, A L; Floro, A M; Palma, P

    2016-09-01

    In the present study, the endocrine activity of the antiepileptic pharmaceutical carbamazepine (CBZ) in the crustacean Daphnia magna was assessed. To assess the hormonal activity of the drug, we exposed maternal daphnids and embryos to environmental relevant concentrations of CBZ (ranging from 10 to 200 μg/L) and to mixtures of CBZ with fenoxycarb (FEN; 1 μg/L). Chronic exposure to CBZ significantly decreased the reproductive output and the number of molts of D. magna at 200 μg/L. This compound induced the production of male offspring (12 ± 1.7 %), in a non-concentration-dependent manner, acting as a weak juvenile hormone analog. Results showed that this substance, at tested concentrations, did not antagonize the juvenoid action of FEN. Further, CBZ has shown to be toxic to daphnid embryos through maternal exposure interfering with their normal gastrulation and organogenesis stages but not producing direct embryo toxicity. These findings suggest that CBZ could act as an endocrine disruptor in D. magna as it decreases the reproductive output, interferes with sex determination, and causes development abnormality in offspring. Therefore, CBZ could directly affect the population sustainability.

  3. Hard X-ray nanoprobe investigations of the subtissue metal distributions within Daphnia magna.

    PubMed

    De Samber, B; De Schamphelaere, K A C; Janssen, C R; Vekemans, B; De Rycke, R; Martinez-Criado, G; Tucoulou, R; Cloetens, P; Vincze, L

    2013-07-01

    The unique potential of nanoscale elemental imaging of major/minor and trace-level elemental distributions within thin biological tissue sections of the ecotoxicological model organism Daphnia magna is demonstrated by synchrotron radiation nano-X-ray fluorescence (nano-XRF). The applied highly specialized sample preparation method, coupled with the high spatial resolution (∼180 nm) and high X-ray photon flux (6 × 10(11) photons/s) available at the European Synchrotron Radiation Facility (ESRF) ID22NI beamline proved to be critical for the high-quality visualization of (trace-)metal distributions on the submicron level within the target structures of interest. These include the branchial sacs on the thoracic appendages (epipodites) of D. magna, which are osmoregulatory regions where ion exchange occurs. For the main element of interest (Zn), detection limits of 0.7 ppm (3 ag) was reached in fast-scanning mode using an acquisition time of 0.3 s/pixel. As demonstrated, synchrotron radiation nano-XRF revealed the elemental distributions of Ca, Fe, and Zn within this osmoregulatory region on the submicron scale, aiding the exploration of possible detoxification mechanisms of Zn within D. magna at the subtissue level.

  4. Effects of the artificial sweetener sucralose on Daphnia magna and Americamysis bahia survival, growth and reproduction.

    PubMed

    Huggett, D B; Stoddard, K I

    2011-10-01

    The artificial sweetener sucralose has been detected in municipal wastewater effluent and surface waters at concentrations ranging from ng/L to low μg/L. Few chronic ecotoxicological data are available in the peer reviewed literature with respect to sucralose. To address this data gap, 21 d Daphnia magna and 28 d Americamysis bahia (mysid shrimp) studies were conducted to assess the effects of sucralose on the survival, growth and reproduction of these organisms. Concentrations ⩽1800mg/L resulted in no statistically significant reduction in D. magna survival or reproduction. Survival, growth and reproduction of mysid shrimp were unaffected by ⩽93mg/L sucralose. The no observable effect concentration (NOEC) and lowest observable effect concentration (LOEC) for the D. magna study were 1800 and >1800mg/L, respectively. The NOEC and LOEC for the mysid study were 93 and >93mg/L, respectively. Collectively, these data suggest that the concentrations of sucralose detected in the environment are well below those required to elicit chronic effects in freshwater or marine invertebrates.

  5. Silver nanoparticle toxicity to Daphnia magna is a function of dissolved silver concentration.

    PubMed

    Newton, Kim M; Puppala, Hema L; Kitchens, Christopher L; Colvin, Vicki L; Klaine, Stephen J

    2013-10-01

    The most persistent question regarding the toxicity of silver nanoparticles (AgNPs) is whether this toxicity is due to the nanoparticles themselves or the silver ions (Ag(+)) they release. The present study investigates the role of surface coating and the presence of dissolved organic carbon on the toxicity of AgNPs to Daphnia magna and tests the hypothesis that the acute toxicity of AgNPs is a function of dissolved Ag produced by nanoparticle dissolution. Toxicity of silver nitrate (AgNO3) and AgNPs with surface coatings-gum arabic (AgGA), polyethylene glycol (AgPEG), and polyvinylpyrrolidone (AgPVP)-at 48 h was assessed in US Environmental Protection Agency moderately hard reconstituted water alone and augmented with Suwannee River dissolved organic carbon (DOC). As expected, AgNO3 was the most toxic to D. magna and AgPVPs were the least toxic. In general, Suwannee River DOC presence reduced the toxicity of AgNO3, AgGAs, and AgPEG, while the toxicity of AgPVPs was unaffected. The measured dissolved Ag concentrations for all AgNPs and AgNO3 at the 48-h median lethal concentration in moderately hard reconstituted water were similar. The presence of Suwannee River DOC decreased the ratio of measured dissolved Ag to measured total Ag concentration. These results support the hypothesis that toxicity of AgNPs to D. magna is a function of dissolved Ag concentration from these particles.

  6. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    SciTech Connect

    Redman, R.S.; Rodriguez, R.J. Univ. of Washington, Seattle, WA . Dept. of Botany); Clifton, D.R.; Morrel, J.; Brown, G. ); Freeman, S. . Dept. of Plant Pathology)

    1999-02-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) plant-defense response were investigated in anthracnose-resistant and-susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1-colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  7. Cohorts and populations in chronic toxicity studies with Daphnia magna: a cadmium example

    SciTech Connect

    van Leeuwen, C.J.; Luttmer, W.J.; Griffioen, P.S.

    1985-02-01

    Two semistatic life table experiments with Daphnia magna were carried out on reconstituted and Lake Ijssel water. The nontoxic concentrations for cadmium with respect to the intrinsic rate of natural increase, derived from age-specific survival and fecundity were 1 and 3.2 micrograms/liter, respectively. Body length appeared to be a sensitive parameter. A third intermittent-flow experiment was started with small, exponentially growing populations. These populations had a stable age distribution, were composed of cohorts of different ages and showed an almost perfect logistic growth. Cadmium was shown to reduce the upper numerical limit (carrying capacity) for D. magna and was inversely related to this parameter: log Y = 2.85 -0.20 log (Cd); r = -0.99. A nontoxic concentration could not be established. Based on the background concentration of cadmium, a freshwater quality criterion of 0.1 microgram/liter is proposed. The results are used to discuss several shortcomings of the current methods. Finally it is stated that the introduction of the concepts of population dynamics in reproduction tests with D. magna is a realistic step towards ecotoxicology.

  8. Identification of multiple steroid hydroxylases in Daphnia magna and their modulation by xenobiotics

    SciTech Connect

    Baldwin, W.S.; LeBlanc, G.A. . Dept. of Toxicology)

    1994-07-01

    Steroid hydroxylase activities were characterized in Daphnia magna and evaluated for potential use as biomarkers of xenobiotic exposure. Microsomes prepared from Daphnia magna generated as single NADPH-dependent metabolite of [[sup 14]C] testosterone. However, intact daphnids excreted at least 10 polar metabolites of [[sup 14]C] testosterone into the test medium. Six of these metabolites were identified as 2[alpha]-, 16[beta]-, 6[beta]-, 6[alpha]-, 7[alpha]-, and 15[alpha]-[[sup 14]C]hydroxytestosterone. The unidentified metabolites are also presumed to be hydroxylated products of testosterone, based on their relative migrations during TLC. The inefficient metabolism of [[sup 14]C] testosterone during the in vitro microsomal incubations may have been due to the release of P450 inhibitors during microsome preparation. Exposure of daphnids to the P450 modulators phenobarbital, [beta]-naphthoflavone, piperonyl butoxide, and malathion differentially inhibited the steroid hydroxylase activities. Results from this study indicate that Daphnia magna expresses several P450 enzymes and that these enzymes are differentially modulated by xenobiotic exposure. Steroid hydroxylase activities may serve not only as a biomarker of toxicant exposure, but also as a predictor of toxicant effects involving perturbations of steroid hormone homeostasis.

  9. The influence of benthic fish bioturbation on cadmium bioavailability to Daphnia magna

    SciTech Connect

    Wall, S.B.; Isely, J.J.; La Point, T.W.

    1994-12-31

    The authors are interested in how benthic fish bioturbation of contaminated sediments influences bioaccumulation into planktonic and, ultimately, nektonic organisms. They performed a series of exposures with cadmium-spiked sediment, 1 {mu}g/g nominal concentration, and koi carp Cyprinus carpio. Daphnia magna were placed in exposure aquaria with and without carp for six days and bioaccumulation after 48 h was measured. Preliminary results indicate that carp increased total suspended solids from 0.0 mg/L to 44.4 mg/L and mean total cadmium water concentrations, 1.4 {mu}g/L and 2.8 {mu}g/L, without and with fish, respectively. However, body burdens of Daphnia magna did not reflect the water concentration trend. Mean Cd residues of daphnids exposed without fish, 9.377 {mu}g/g, were not statistically different from those in the with-fish exposure, 8.348 {mu}g/g. Similarity in daphnid body burdens was probably due to cadmium binding with suspended sediment particles and dissolved organic carbon in the exposure chambers, therefore minimizing Cd bioavailability to D. magna. The present focus is on determining the bioavailable cadmium concentration.

  10. Shape and Charge of Gold Nanomaterials Influence Survivorship, Oxidative Stress and Moulting of Daphnia magna

    PubMed Central

    Nasser, Fatima; Davis, Adam; Valsami-Jones, Eugenia; Lynch, Iseult

    2016-01-01

    Engineered nanomaterials (ENMs) are materials with at least one dimension between 1–100 nm. The small size of ENMs results in a large surface area to volume ratio, giving ENMs novel characteristics that are not traditionally exhibited by larger bulk materials. Coupled with large surface area is an enormous capacity for surface functionalization of ENMs, e.g., with different ligands or surface changes, leading to an almost infinite array of variability of ENMs. Here we explore the effects of various shaped (spheres, rods) and charged (negative, positive) gold ENMs on Daphnia magna (D. magna) in terms of survival, ENM uptake and production of reactive oxygen species (ROS), a key factor in oxidative stress responses. We also investigate the effects of gold ENMs binding to the carapace of D. magna and how this may induce moulting inhibition in addition to toxicity and stress. The findings suggest that ENM shape and surface charge play an important role in determining ENM uptake and toxicity. PMID:28335350

  11. Toxicity Thresholds for Diclofenac, Acetaminophen and Ibuprofen in the Water Flea Daphnia magna.

    PubMed

    Du, Juan; Mei, Cheng-Fang; Ying, Guang-Guo; Xu, Mei-Ying

    2016-07-01

    Non-steroid anti-inflammatory drugs (NSAIDs) have been frequently detected in aquatic ecosystem and posed a huge risk to non-target organisms. The aim of this study was to evaluate the toxic effects of three typical NSAIDs, diclofenac (DFC), acetaminophen (APAP) and ibuprofen (IBP), toward the water flea Daphnia magna. All three NSAIDs showed remarkable time-dependent and concentration-dependent effects on D. magna, with DFC the highest and APAP the lowest toxic. Survival, growth and reproduction data of D. magna from all bioassays were used to determine the LC10 and LC50 (10 % lethal and median lethal concentrations) values of NSAIDs, as well as the EC10 and EC50 (10 % effect and median effect concentrations) values. Concentrations for the lethal and sublethal toxicity endpoints were mainly in the low ppm-range, of which reproduction was the most sensitive one, indicating that non-target organisms might be adversely affected by relevant ambient low-level concentrations of NSAIDs after long-time exposures.

  12. Influence of suspended solids on acute toxicity of carbofuran to Daphnia magna: I. Interactive effects.

    PubMed

    Herbrandson, Carl; Bradbury, Steven P; Swackhamer, Deborah L

    2003-05-29

    This study explored the effects on Daphnia magna from exposure to the pesticide carbofuran in combination with stress from suspended solids exposure. Our objective was to assess whether suspended solids affects the toxicodynamic response of D. magna to carbofuran. A series of laboratory experiments was performed where animals were exposed to carbofuran concentrations ranging from 0 to 160 microg/l in combination with suspended solids concentrations ranging from 0 to 10000 mg/l. In the absence of suspended solids, effects of carbofuran were dose dependent and resulted in an EC(50) of 92 microg/l. Exposure to suspended solids, up to extreme levels that may be encountered in the environment and in the absence of carbofuran, showed no measurable toxicity. When D. magna were exposed to a constant carbofuran concentration, the numbers of affected organisms increased with increasing suspended solids concentrations. At a suspended solids concentration of 1000 mg/l, the EC(50) for carbofuran was reduced by half to 45 microg/l. The relationship between the toxicity of carbofuran (microg/l) and the concentration of suspended solids (mg/l) can be described with the following equation: carbofuran EC(50)=72 exp(-0.00014 [suspended solids]). An analysis of the data indicates that this relationship is consistent with a potentiated toxicity mechanism rather than an additive model.

  13. Adaptation to environmental stress in Daphnia magna simultaneously exposed to a xenobiotic.

    PubMed

    Coors, Anja; Hammers-Wirtz, Monika; Ratte, Hans Toni

    2004-07-01

    In standardized ecotoxicological testing chemicals are investigated under optimal conditions for the test organisms despite the fact that environmental factors such as predation pressure and food availability are important parameters regulating natural populations. Food limitation and predator presence can induce shifts in life-history traits in various Daphnia species, especially trade-offs in reproductive biomass allocation. These adaptive responses are thought to ensure survival of the population in a highly variable environment. A xenobiotic dispersant (used in textile dyeing processes) also shifted the biomass allocation of Daphnia magna. To assess whether the dispersant could hinder D. magna adaptation to varying environmental conditions, we conducted experiments with food level and presence of Chaoborus larvae as environmental factors and simultaneous exposure to the dispersant. At low food level and in presence of the predator, D. magna produced fewer but larger sized neonates, regardless of dispersant exposure. The dispersant shifted biomass allocation towards more but smaller sized offspring in all experiments. However, the adaptive response to the environmental factors and the dispersant effect cancelled each other out in that they induced independently from each other opposite shifts in biomass allocation. In summary, the dispersant exposure resulted not in an inhibition of the adaptive response but in a reduction of the value of the response. Our study with this model substance demonstrates that xenobiotics can affect the adaptation of organisms to environmental stress which can result in effects likely to be overlooked in standardized testing.

  14. Toxicity of two types of silver nanoparticles to aquatic crustaceans Daphnia magna and Thamnocephalus platyurus.

    PubMed

    Blinova, Irina; Niskanen, Jukka; Kajankari, Paula; Kanarbik, Liina; Käkinen, Aleksandr; Tenhu, Heikki; Penttinen, Olli-Pekka; Kahru, Anne

    2013-05-01

    Although silver nanoparticles (NPs) are increasingly used in various consumer products and produced in industrial scale, information on harmful effects of nanosilver to environmentally relevant organisms is still scarce. This paper studies the adverse effects of silver NPs to two aquatic crustaceans, Daphnia magna and Thamnocephalus platyurus. For that, silver NPs were synthesized where Ag is covalently attached to poly(vinylpyrrolidone) (PVP). In parallel, the toxicity of collargol (protein-coated nanosilver) and AgNO₃ was analyzed. Both types of silver NPs were highly toxic to both crustaceans: the EC50 values in artificial freshwater were 15-17 ppb for D. magna and 20-27 ppb for T. platyurus. The natural water (five different waters with dissolved organic carbon from 5 to 35 mg C/L were studied) mitigated the toxic effect of studied silver compounds up to 8-fold compared with artificial freshwater. The toxicity of silver NPs in all test media was up to 10-fold lower than that of soluble silver salt, AgNO₃. The pattern of the toxic response of both crustacean species to the silver compounds was almost similar in artificial freshwater and in natural waters. The chronic 21-day toxicity of silver NPs to D. magna in natural water was at the part-per-billion level, and adult mortality was more sensitive toxicity test endpoint than the reproduction (the number of offspring per adult).

  15. Uptake and effects of microplastic textile fibers on freshwater crustacean Daphnia magna.

    PubMed

    Jemec, Anita; Horvat, Petra; Kunej, Urban; Bele, Marjan; Kržan, Andrej

    2016-12-01

    Microplastic fibers (MP) from textile weathering and washing are increasingly being recognized as environmental pollutants. The majority of studies on the bioavailability and effects of microplastic focused on small polystyrene spherical plastic particles, while less data are available for fibers and for other materials besides polystyrene. We investigated the ingestion and effects of ground polyethylene terephthalate (PET) textile microfibers (length range: 62-1400 μm, width 31-528 μm, thickness 1-21.5 μm) on the freshwater zooplankton crustacean Daphnia magna after a 48 h exposure and subsequent 24 h of recovery in MP free medium and algae. The majority of ingested fibers by D. magna were around 300 μm, but also some very large twisted MP fibers around 1400 μm were found inside the gut. Exposure to these fibers results in increased mortality of daphnids after 48 h only in the case where daphnids were not pre-fed with algae prior to experiment, but no effect was found when daphnids were fed before the experiments. Regardless of the feeding regime, daphnids were not able to recover from MP exposure after additional 24 h incubation period in a MP free medium with algae. The uptake and effects of PET textile MP on D. magna are presented here for the first time.

  16. Annotation of the Daphnia magna nuclear receptors: Comparison to Daphnia pulex

    PubMed Central

    Litoff, Elizabeth J; Garriott, Travis E.; Ginjupalli, Gautam K.; Butler, LaToya; Gay, Claudy; Scott, Kiandra; Baldwin, William S.

    2014-01-01

    Most Nuclear Receptors (NRs) are ligand-dependent transcription factors crucial in homeostatic physiological responses or environmental responses. We annotated the D. magna NRs and compared them to D. pulex and other species, primarily through phylogenetic analysis. Daphnia species contain 26 NRs spanning all seven gene subfamilies. Thirteen of the 26 receptors found in Daphnia species phylogenetically segregate into the NR1 subfamily, primarily involved in energy metabolism and resource allocation. Some of the Daphnia NRs, such as RXR, HR96, and E75 show strong conservation between D. magna and D. pulex. Other receptors, such as EcRb, THRL-11 and RARL-10 have diverged considerably and therefore may show different functions in the two species. Curiously, there is an inverse association between the number of NR splice variants and conservation of the LBD. Overall, D. pulex and D. magna possess the same NRs; however not all of the NRs demonstrate high conservation indicating the potential for a divergence of function. PMID:25239664

  17. Biochemical analysis of plant protection afforded by a nonpathogenic endophytic mutant of Colletotrichum magna

    USGS Publications Warehouse

    Redman, R.S.; Freeman, S.; Clifton, D.R.; Morrel, J.; Brown, G.; Rodriguez, R.J.

    1999-01-01

    A nonpathogenic mutant of Colletotrichum magna (path-1) was previously shown to protect watermelon (Citrullus lanatus) and cucumber (Cucumis sativus) seedlings from anthracnose disease elicited by wild-type C. magna. Disease protection was observed in stems of path-1-colonized cucurbits but not in cotyledons, indicating that path-1 conferred tissue-specific and/or localized protection. Plant biochemical indicators of a localized and systemic (peroxidase, phenylalanine ammonia-lyase, lignin, and salicylic acid) 'plant-defense' response were investigated in anthracnose-resistant and -susceptible cultivars of cucurbit seedlings exposed to four treatments: (1) water (control), (2) path-1 conidia, (3) wild-type conidia, and (4) challenge conditions (inoculation into path-1 conidia for 48 h and then exposure to wild-type conidia). Collectively, these analyses indicated that disease protection in path-1 colonized plants was correlated with the ability of these plants to mount a defense response more rapidly and to equal or greater levels than plants exposed to wild-type C. magna alone. Watermelon plants colonized with path-1 were also protected against disease caused by Colletotrichum orbiculare and Fusarium oxysporum. A model based on the kinetics of plant-defense activation is presented to explain the mechanism of path-1-conferred disease protection.

  18. Silver Coating for High-Mass-Accuracy Imaging Mass Spectrometry of Fingerprints on Nanostructured Silicon.

    PubMed

    Guinan, Taryn M; Gustafsson, Ove J R; McPhee, Gordon; Kobus, Hilton; Voelcker, Nicolas H

    2015-11-17

    Nanostructure imaging mass spectrometry (NIMS) using porous silicon (pSi) is a key technique for molecular imaging of exogenous and endogenous low molecular weight compounds from fingerprints. However, high-mass-accuracy NIMS can be difficult to achieve as time-of-flight (ToF) mass analyzers, which dominate the field, cannot sufficiently compensate for shifts in measured m/z values. Here, we show internal recalibration using a thin layer of silver (Ag) sputter-coated onto functionalized pSi substrates. NIMS peaks for several previously reported fingerprint components were selected and mass accuracy was compared to theoretical values. Mass accuracy was improved by more than an order of magnitude in several cases. This straightforward method should form part of the standard guidelines for NIMS studies for spatial characterization of small molecules.

  19. A fluorescence-based hydrolytic enzyme activity assay for quantifying toxic effects of Roundup® to Daphnia magna.

    PubMed

    Ørsted, Michael; Roslev, Peter

    2015-08-01

    Daphnia magna is a widely used model organism for aquatic toxicity testing. In the present study, the authors investigated the hydrolytic enzyme activity of D. magna after exposure to toxicant stress. In vivo enzyme activity was quantified using 15 fluorogenic enzyme probes based on 4-methylumbelliferyl or 7-amino-4-methylcoumarin. Probing D. magna enzyme activity was evaluated using short-term exposure (24-48 h) to the reference chemical K2 Cr2 O7 or the herbicide formulation Roundup®. Toxicant-induced changes in hydrolytic enzyme activity were compared with changes in mobility (International Organization for Standardization standard 6341). The results showed that hydrolytic enzyme activity was quantifiable as a combination of whole body fluorescence of D. magna and the fluorescence of the surrounding water. Exposure of D. magna to lethal and sublethal concentrations of Roundup resulted in loss of whole body enzyme activity and release of cell constituents, including enzymes and DNA. Roundup caused comparable inhibition of mobility and alkaline phosphatase activity with median effective concentration values at 20 °C of 8.7 mg active ingredient (a.i.)/L to 11.7 mg a.i./L. Inhibition of alkaline phosphatase activity by Roundup was lowest at 14 °C and greater at 20 °C and 26 °C. The results suggest that the fluorescence-based hydrolytic enzyme activity assay (FLEA assay) can be used as an index of D. magna stress. Combining enzyme activity with fluorescence measurements may be applied as a simple and quantitative supplement for toxicity testing with D. magna.

  20. [ABO blood grouping of fingerprint by means of immunohistochemical procedure].

    PubMed

    Lin, Z; Ohshima, T; Takayasu, T; Nagano, T; Jia, J

    1993-04-01

    For the purpose of ABO-blood typing on fingerprints, the detection of blood group substances in fingerprints attached on nitrocellulose filter or paper was performed immunohistochemically using avidin-biotin-peroxidase complex (ABC) method. At first, it was fundamentally tested whether ABO-blood typing could be specifically performed for the fingerprints of known ABO blood group, being made experimentally on nitrocellulose filter or paper, and the effect of fixation and paper quality for the detection was also examined. And, ABO-typing was carried out using transferred fingerprints from a slide glass to a nitrocellulose filter. Moreover, using a fingerprint of unknown ABO-type, serially repetitive blood typing (three times) was compared to individually performed grouping (three tests) after dividing a single fingerprint into three parts. In addition, the method of serial ABO-blood typing after the morphological detection of fingerprints by ninhydrine was also considered. As results, according to primary antibodies applied, ABH activities were specifically detected in the fingerprints on nitrocellulose filter and paper. For the fixation procedure of very minute blood group substances to paper, heat fixation was the most effective and methanol fixation was also available. The intensity of immunostaining of fingerprints decreased according to the deterioration of paper quality used. And, the transferred fingerprints on nitrocellulose filter were also specifically typed. Serially repetitive blood typing (anti-B-->anti-A-->anti-H) was possible to fingerprints on nitrocellulose filter, but it gave poor results to those on paper. To overcome this difficulty, after being detected morphologically by ninhydrine, iodine or aluminium powder and decolored thereafter, a fingerprint on paper was divided into three parts and specific blood typing was possible. As for the double blind test to fingerprints on paper, 22 out of 35 fingerprints were specifically typed and the rate of

  1. A cancellable and fuzzy fingerprint scheme for mobile computing security

    NASA Astrophysics Data System (ADS)

    Yang, Wencheng; Xi, Kai; Li, Cai

    2012-09-01

    Fingerprint recognition provides an effective user authentication solution for mobile computing systems. However, as a fingerprint template protection scheme, fingerprint fuzzy vault is subject to cross-matching attacks, since the same finger might be registered for various applications. In this paper, we propose a fingerprint-based biometric security scheme named the cancellable and fuzzy fingerprint scheme, which combines a cancellable non-linear transformation with the client/server version of fuzzy vault, to address the cross-matching attack in a mobile computing system. Experimental results demonstrate that our scheme can provide reliable and secure protection to the mobile computing system while achieving an acceptable matching performance.

  2. Eliminate background interference from latent fingerprints using ultraviolet multispectral imaging

    NASA Astrophysics Data System (ADS)

    Huang, Wei; Xu, Xiaojing; Wang, Guiqiang

    2014-02-01

    Fingerprints are the most important evidence in crime scene. The technology of developing latent fingerprints is one of the hottest research areas in forensic science. Recently, multispectral imaging which has shown great capability in fingerprints development, questioned document detection and trace evidence examination is used in detecting material evidence. This paper studied how to eliminate background interference from non-porous and porous surface latent fingerprints by rotating filter wheel ultraviolet multispectral imaging. The results approved that background interference could be removed clearly from latent fingerprints by using multispectral imaging in ultraviolet bandwidth.

  3. Use of SSR markers for DNA fingerprinting and diversity analysis of Pakistani sugarcane (Saccharum spp. hybrids) cultivars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In recent years SSR markers have been used widely for genetic analysis. The objective of this study was to use an SSR-based marker system to develop the molecular fingerprints and analyze the genetic relationship of sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers wer...

  4. Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

    PubMed

    Ishii, Satoshi; Sadowsky, Michael J

    2009-04-01

    A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

  5. Chemical imaging of latent fingerprints by mass spectrometry based on laser activated electron tunneling.

    PubMed

    Tang, Xuemei; Huang, Lulu; Zhang, Wenyang; Zhong, Hongying

    2015-03-03

    Identification of endogenous and exogenous chemicals contained in latent fingerprints is important for forensic science in order to acquire evidence of criminal identities and contacts with specific chemicals. Mass spectrometry has emerged as a powerful technique for such applications without any derivatization or fluorescent tags. Among these techniques, MALDI (Matrix Assisted Laser Desorption Ionization) provides small beam size but has interferences with MALDI matrix materials, which cause ion suppressions as well as limited spatial resolution resulting from uneven distribution of MALDI matrix crystals with different sizes. LAET (Laser Activated Electron Tunneling) described in this work offers capabilities for chemical imaging through electron-directed soft ionization. A special film of semiconductors has been designed for collection of fingerprints. Nanoparticles of bismuth cobalt zinc oxide were compressed on a conductive metal substrate (Al or Cu sticky tape) under 10 MPa pressure. Resultant uniform thin films provide tight and shining surfaces on which fingers are impressed. Irradiation of ultraviolet laser pulses (355 nm) on the thin film instantly generates photoelectrons that can be captured by adsorbed organic molecules and subsequently cause electron-directed ionization and fragmentation. Imaging of latent fingerprints is achieved by visualization of the spatial distribution of these molecular ions and structural information-rich fragment ions. Atomic electron emission together with finely tuned laser beam size improve spatial resolution. With the LAET technique, imaging analysis not only can identify physical shapes but also reveal endogenous metabolites present in females and males, detect contacts with prohibited substances, and resolve overlapped latent fingerprints.

  6. Optical security verification for blurred fingerprints

    NASA Astrophysics Data System (ADS)

    Soon, Boon Y.; Karim, Mohammad A.; Alam, Mohammad S.

    1998-12-01

    Optical fingerprint security verification is gaining popularity, as it has the potential to perform correlation at the speed of light. With advancement in optical security verification techniques, authentication process can be almost foolproof and reliable for financial transaction, banking, etc. In law enforcement, when a fingerprint is obtained from a crime scene, it may be blurred and can be an unhealthy candidate for correlation purposes. Therefore, the blurred fingerprint needs to be clarified before it is used for the correlation process. There are a several different types of blur, such as linear motion blur and defocus blur, induced by aberration of imaging system. In addition, we may or may not know the blur function. In this paper, we propose the non-singularity inverse filtering in frequency/power domain for deblurring known motion-induced blur in fingerprints. This filtering process will be incorporated with the pow spectrum subtraction technique, uniqueness comparison scheme, and the separated target and references planes method in the joint transform correlator. The proposed hardware implementation is a hybrid electronic-optical correlator system. The performance of the proposed system would be verified with computer simulation for both cases: with and without additive random noise corruption.

  7. Compression of gray-scale fingerprint images

    NASA Astrophysics Data System (ADS)

    Hopper, Thomas

    1994-03-01

    The FBI has developed a specification for the compression of gray-scale fingerprint images to support paperless identification services within the criminal justice community. The algorithm is based on a scalar quantization of a discrete wavelet transform decomposition of the images, followed by zero run encoding and Huffman encoding.

  8. Peptide Mass Fingerprinting of Egg White Proteins

    ERIC Educational Resources Information Center

    Alty, Lisa T.; LaRiviere, Frederick J.

    2016-01-01

    Use of advanced mass spectrometry techniques in the undergraduate setting has burgeoned in the past decade. However, relatively few undergraduate experiments examine the proteomics tools of protein digestion, peptide accurate mass determination, and database searching, also known as peptide mass fingerprinting. In this experiment, biochemistry…

  9. Discrimination among Panax species using spectral fingerprinting

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Spectral fingerprints of samples of three Panax species (P. quinquefolius L., P. ginseng, and P. notoginseng) were acquired using UV, NIR, and MS spectrometry. With principal components analysis (PCA), all three methods allowed visual discrimination between all three species. All three methods wer...

  10. Ultrasonic fingerprinting by phased array transducer

    NASA Astrophysics Data System (ADS)

    Sednev, D.; Kataeva, O.; Abramets, V.; Pushenko, P.; Tverdokhlebova, T.

    2016-06-01

    Increasing quantity of spent nuclear fuel that must be under national and international control requires a novel approach to safeguard techniques and equipment. One of the proposed approaches is utilize intrinsic features of casks with spent fuel. In this article an application of a phased array ultrasonic method is considered. This study describes an experimental results on ultrasonic fingerprinting of austenitic steel seam weld.

  11. Fingerprints for fruit and nut crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We in horticulture should be more aware of the identity of the plants that we use. We appreciate scientists who can determine species and cultivars with their botanical knowledge and keen powers of observation. However, sometimes plant identity is more than meets the eye. Fingerprints serve as a hi...

  12. Piezoelectric micromachined ultrasonic transducers for fingerprint sensing

    NASA Astrophysics Data System (ADS)

    Lu, Yipeng

    Fingerprint identification is the most prevalent biometric technology due to its uniqueness, universality and convenience. Over the past two decades, a variety of physical mechanisms have been exploited to capture an electronic image of a human fingerprint. Among these, capacitive fingerprint sensors are the ones most widely used in consumer electronics because they are fabricated using conventional complementary metal oxide semiconductor (CMOS) integrated circuit technology. However, capacitive fingerprint sensors are extremely sensitive to finger contamination and moisture. This thesis will introduce an ultrasonic fingerprint sensor using a PMUT array, which offers a potential solution to this problem. In addition, it has the potential to increase security, as it allows images to be collected at various depths beneath the epidermis, providing images of the sub-surface dermis layer and blood vessels. Firstly, PMUT sensitivity is maximized by optimizing the layer stack and electrode design, and the coupling coefficient is doubled via series transduction. Moreover, a broadband PMUT with 97% fractional bandwidth is achieved by utilizing a thinner structure excited at two adjacent mechanical vibration modes with overlapping bandwidth. In addition, we proposed waveguide PMUTs, which function to direct acoustic waves, confine acoustic energy, and provide mechanical protection for the PMUT array. Furthermore, PMUT arrays were fabricated with different processes to form the membrane, including front-side etching with a patterned sacrificial layer, front-side etching with additional anchor, cavity SOI wafers and eutectic bonding. Additionally, eutectic bonding allows the PMUT to be integrated with CMOS circuits. PMUTs were characterized in the mechanical, electrical and acoustic domains. Using transmit beamforming, a narrow acoustic beam was achieved, and high-resolution (sub-100 microm) and short-range (~1 mm) pulse-echo ultrasonic imaging was demonstrated using a steel

  13. The Prediction of Biological Activity Using Molecular Connectivity Indices.

    DTIC Science & Technology

    1986-04-23

    toxicities of 15 organotin compounds against Daphnia magna . -18- This study confirmed that molecular topology can be employed to model the behavior...parameter correlation of the toxicity of polycyclic aromatic hydrocarbons in Daphnia Pulex with 0XV: -log LC50 = 0.5346 OXV - 7.004 (r = 0.9972, n...CRC Press, Boca Raton, Florida, * 1983, chap. 4, pp. 105-140. 8. L.B. Kier and L.H. Hall, Molecular Connectivity in Chemistry and Drug * Research

  14. Fingerprint indexing based on minutiae-dependent statistical codes

    NASA Astrophysics Data System (ADS)

    Iloanusi, Ogechukwu N.; Osuagwu, Charles C.

    2014-07-01

    Methods based on minutiae matching have been extensively used in fingerprint recognition because minutiae can be reliably extracted from poor quality and noisy fingerprints. However, structures have to be defined due to minutiae displacements and irreproducibility. Some of the structures, though very efficient, incur large computational complexities. In this article, a feature vector of statistically based values derived from the minutiae pattern in a fingerprint is proposed for indexing fingerprints using the incremental search retrieval method. The proposed indexing technique in combination with the incremental retrieval method proves to have an added advantage over certain minutiae-based structures, especially when the minutiae points are numerous in a fingerprint. The feature vector for a fingerprint requires negligible storage resources and, consequently, the computational time in the retrieval of a candidate list for a query fingerprint is very little.

  15. Analysis of Fingerprint Image to Verify a Person

    NASA Astrophysics Data System (ADS)

    Jahankhani, Hossein; Mohid, Maktuba

    Identification and authentication technologies are increasing day by day to protect people and goods from crime and terrorism. This paper is aimed to discuss fingerprint technology in depth and analysis of fingerprint image. Verify a person with a highlight on fingerprint matching. Some fingerprint matching algorithms are analysed and compared. The outcomes of the analysis has identified some major issues or factors of fingerprinting, which are location, rotation, clipping, noise, non-linear distortion sensitiveness/ insensitiveness properties, computational cost and accuracy level of fingerprint matching algorithms. Also a new fingerprint matching algorithm proposed in this research work. The proposed algorithm has used Euclidean distance, angle difference, type as matching parameters instead of specific location parameter (like, x or y coordinates), which makes the algorithm location and rotation insensitive. The matching of local neighbourhoods at each stage makes the algorithm non-linear distortion insensitive.

  16. Chromosomal assignment of human DNA fingerprint sequences by simultaneous hybridization to arbitrarily primed PCR products from human/rodent monochromosome cell hybrids

    SciTech Connect

    Yasuda, Jun; Sekiya, Takao; Navarro, J.M.

    1996-05-15

    We have developed a technique for the simultaneous chromosomal assignment of multiple human DNA sequences from DNA fingerprints obtained by the arbitrarily primed polymerase chain reaction (AP-PCR). Radioactively labeled human AP-PCR products are hybridized to DNA fingerprints generated with the same arbitrary primer from human/rodent monochromosome cell hybrids after electroblotting to a nylong membrane. Human-specific hybridization bands in the human/rodent fingerprints unambiguously determine their chromosome of origin. We named this method simultaneous hybridization of arbitrarily primed PCR DNA fingerprinting products (SHARP). Using this approach, we determined the chromosomal origins of most major bands of human AP-PCR fingerprints obtained with two arbitrary primers. Altogether, the chromosomal localization of near 50 DNA fragments, comprehensive of all human chromosomes except chromosomes 21 and Y, was achieved in this simple manner. Chromosome assignment of fingerprint bands is essential for molecular karyotyping of cancer by AP-PCR DNA fingerprinting. The SHARP method provides a convenient and powerful tool for this purpose. 23 refs., 3 figs., 2 tabs.

  17. The genetic basis of resistance and matching-allele interactions of a host-parasite system: The Daphnia magna-Pasteuria ramosa model.

    PubMed

    Bento, Gilberto; Routtu, Jarkko; Fields, Peter D; Bourgeois, Yann; Du Pasquier, Louis; Ebert, Dieter

    2017-02-21

    Negative frequency-dependent selection (NFDS) is an evolutionary mechanism suggested to govern host-parasite coevolution and the maintenance of genetic diversity at host resistance loci, such as the vertebrate MHC and R-genes in plants. Matching-allele interactions of hosts and parasites that prevent the emergence of host and parasite genotypes that are universally resistant and infective are a genetic mechanism predicted to underpin NFDS. The underlying genetics of matching-allele interactions are unknown even in host-parasite systems with empirical support for coevolution by NFDS, as is the case for the planktonic crustacean Daphnia magna and the bacterial pathogen Pasteuria ramosa. We fine-map one locus associated with D. magna resistance to P. ramosa and genetically characterize two haplotypes of the Pasteuria resistance (PR-) locus using de novo genome and transcriptome sequencing. Sequence comparison of PR-locus haplotypes finds dramatic structural polymorphisms between PR-locus haplotypes including a large portion of each haplotype being composed of non-homologous sequences resulting in haplotypes differing in size by 66 kb. The high divergence of PR-locus haplotypes suggest a history of multiple, diverse and repeated instances of structural mutation events and restricted recombination. Annotation of the haplotypes reveals striking differences in gene content. In particular, a group of glycosyltransferase genes that is present in the susceptible but absent in the resistant haplotype. Moreover, in natural populations, we find that the PR-locus polymorphism is associated with variation in resistance to different P. ramosa genotypes, pointing to the PR-locus polymorphism as being responsible for the matching-allele interactions that have been previously described for this system. Our results conclusively identify a genetic basis for the matching-allele interaction observed in a coevolving host-parasite system and provide a first insight into its molecular basis.

  18. The genetic basis of resistance and matching-allele interactions of a host-parasite system: The Daphnia magna-Pasteuria ramosa model

    PubMed Central

    Fields, Peter D.; Bourgeois, Yann; Du Pasquier, Louis; Ebert, Dieter

    2017-01-01

    Negative frequency-dependent selection (NFDS) is an evolutionary mechanism suggested to govern host-parasite coevolution and the maintenance of genetic diversity at host resistance loci, such as the vertebrate MHC and R-genes in plants. Matching-allele interactions of hosts and parasites that prevent the emergence of host and parasite genotypes that are universally resistant and infective are a genetic mechanism predicted to underpin NFDS. The underlying genetics of matching-allele interactions are unknown even in host-parasite systems with empirical support for coevolution by NFDS, as is the case for the planktonic crustacean Daphnia magna and the bacterial pathogen Pasteuria ramosa. We fine-map one locus associated with D. magna resistance to P. ramosa and genetically characterize two haplotypes of the Pasteuria resistance (PR-) locus using de novo genome and transcriptome sequencing. Sequence comparison of PR-locus haplotypes finds dramatic structural polymorphisms between PR-locus haplotypes including a large portion of each haplotype being composed of non-homologous sequences resulting in haplotypes differing in size by 66 kb. The high divergence of PR-locus haplotypes suggest a history of multiple, diverse and repeated instances of structural mutation events and restricted recombination. Annotation of the haplotypes reveals striking differences in gene content. In particular, a group of glycosyltransferase genes that is present in the susceptible but absent in the resistant haplotype. Moreover, in natural populations, we find that the PR-locus polymorphism is associated with variation in resistance to different P. ramosa genotypes, pointing to the PR-locus polymorphism as being responsible for the matching-allele interactions that have been previously described for this system. Our results conclusively identify a genetic basis for the matching-allele interaction observed in a coevolving host-parasite system and provide a first insight into its molecular basis

  19. Acute toxicity of parabens and their chlorinated by-products with Daphnia magna and Vibrio fischeri bioassays.

    PubMed

    Terasaki, Masanori; Makino, Masakazu; Tatarazako, Norihisa

    2009-04-01

    The acute toxicity of 21 parabens and their chlorinated derivatives was investigated by means of two toxicity bioassays: Daphnia magna immobilization test and the inhibition of bioluminescence of Vibrio fischeri. The median effective concentration (EC(50)) values of the tested parabens ranged from 2.2 to 62 mg l(-1) in the D. magna test and from 0.0038 to 5.9 mg l(-1) in the V. fischeri test at 15 min after exposure. The toxicity of dichlorinated methyl- and n-propylparaben, the most commonly used preservatives in cosmetics, toward D. magna was 3.9- and 2.8-fold that of their corresponding parent compounds. Toxicity toward D. magna showed a linear relationship with log P, indicating that toxicity increases with increasing hydrophobicity. On the other hand, the correlations of toxicity toward V. fischeri with hydrophobicity and with the degree of chlorination were poor. In addition, the results of the present study indicated that the V. fischeri test was more sensitive than the D. magna test for the determination of the acute toxicity of parabens. A complete assessment of the ecological and toxicological risks of parabens may require the examination of chlorinated parabens as well as the parent pollutants, as described in the present study.

  20. The response of European Daphnia magna Straus and Australian Daphnia carinata King to changes in geomagnetic field.

    PubMed

    Krylov, Viacheslav V; Bolotovskaya, Irina V; Osipova, Elena A

    2013-03-01

    This study investigates the effects of lifelong exposure to reversed geomagnetic and zero geomagnetic fields (the latter means absence of geomagnetic field) on the life history of Daphnia carinata King from Australia and Daphnia magna Straus from Europe. Considerable deviation in the geomagnetic field from the usual strength, leads to a decrease in daphnia size and life span. Reduced brood sizes and increased body length of neonates are observed in D. magna exposed to unusual magnetic background. The most apparent effects are induced by zero geomagnetic field in both species of Daphnia. A delay in the first reproduction in zero geomagnetic field is observed only in D. magna. No adaptive maternal effects to reversed geomagnetic field are found in a line of D. magna maintained in these magnetic conditions for eight generations. Integrally, the responses of D. magna to unusual geomagnetic conditions are more extensive than that in D. carinata. We suggest that the mechanism of the effects of geomagnetic field reversal on Daphnia may be related to differences in the pattern of distribution of the particles that have a magnetic moment, or to moving charged organic molecules owing to a change in combined outcome and orientation of the geomagnetic field and Earth's gravitational field. The possibility of modulation of self-oscillating processes with changes in geomagnetic field is also discussed.

  1. β-N-methylamino-L-alanine (BMAA) uptake by the animal model, Daphnia magna and subsequent oxidative stress.

    PubMed

    Esterhuizen-Londt, Maranda; Wiegand, Claudia; Downing, Tim G

    2015-06-15

    β-N-methylamino-l-alanine (BMAA), produced by cyanobacteria, is a neurotoxin implicated in Amyotrophic lateral sclerosis/Parkinsonism dementia complex (ALS/PDC). BMAA concentrations in cyanobacteria are lower than those thought to be necessary to result in neurological damage thus bioaccumulation or biomagnification is required to achieve concentrations able to cause neurodegeneration. Many cyanobacteria produce BMAA and uptake routes into the food web require examination. In this study we investigate the uptake of BMAA by adult phytoplanktivorus Daphnia magna via exposure to dissolved pure BMAA and BMAA containing cyanobacteria, as well as the subsequent oxidative stress response in the daphnia. Free BMAA and protein-associated BMAA were quantified by LC-MS/MS. Dissolved BMAA was taken up and was found as free BMAA in D. magna. No protein-associated BMAA was detected in D. magna after a 24-h exposure period. No BMAA was detectable in D. magna after exposure to BMAA containing cyanobacteria. BMAA inhibited the oxidative stress defence and biotransformation enzymes within 24-h exposure in the tested Daphnia and could therefore impair the oxidant status and the capability of detoxifying other substances in D. magna.

  2. Toxicity and genotoxicity of the quaternary ammonium compound benzalkonium chloride (BAC) using Daphnia magna and Ceriodaphnia dubia as model systems.

    PubMed

    Lavorgna, Margherita; Russo, Chiara; D'Abrosca, Brigida; Parrella, Alfredo; Isidori, Marina

    2016-03-01

    The toxicity and genotoxicity of the cationic surfactant benzalkonium chloride (BAC) were studied using Daphnia magna and Ceriodaphnia dubia as model systems. Acute and chronic toxicity testing were performed according to the international standard guidelines and the genotoxicity was detected through the comet assay on cells from whole organisms in vivo exposed. Acute effects occurred at concentrations in the order of tens of μg/L in D. magna and hundreds of μg/L in C. dubia. Chronic effects were found at one order of magnitude less than short-term effects maintaining the same difference in sensitivity between D. magna and C. dubia. BAC induced relevant DNA damage, in both cladocerans; the lowest adverse effect levels were 0.4 and 4 ng/L for D. magna and C. dubia, respectively. As these effective concentrations are far lower than BAC occurrence in surface waters (units of μg/L) a concerning environmental risk cannot be excluded. The findings of this study showed that D. magna and C. dubia, could be used as model organisms to detect acute and chronic toxicity as well as genotoxicity at the whole organism level.

  3. The effect of hardness on the stability of citrate-stabilized gold nanoparticles and their uptake by Daphnia magna.

    PubMed

    Lee, Byung-Tae; Ranville, James F

    2012-04-30

    The stability and uptake by Daphnia magna of citrate-stabilized gold nanoparticles (AuNPs) in three different hardness-adjusted synthetic waters were investigated. Negatively charged AuNPs were found to aggregate and settle in synthetic waters within 24 h. Sedimentation rates depended on initial particle concentrations of 0.02, 0.04, and 0.08 nM AuNPs. Hardness of the synthetic waters affected the aggregation of AuNPs and is explained by the compression of diffuse double layer of AuNPs due to the increasing ionic strength. The fractal dimension of AuNPs in the reaction-limited regime of synthetic waters averaged 2.228±0.126 implying the rigid structures of aggregates driven by the collision of small particles with the growing aggregates. Four-day old D. magna accumulated more than 90% of AuNPs in 0.04 nM AuNP suspensions without any observed mortality. Exposure to pre-aggregated AuNP for 48 h in hard water did not show any significant difference in uptake, suggesting D. magna can also ingest settled AuNP aggregates. D. magna exposed to AuNPs shed their exoskeleton whereas the control did not generate any molts over 48 h. This implies that D. magna removed AuNPs on their exoskeleton by producing molts to decrease any adverse effects of adhered AuNPs.

  4. Fingerprinting antioxidative activities in plants

    PubMed Central

    Saleh, Livia; Plieth, Christoph

    2009-01-01

    Background A plethora of concurrent cellular activities is mobilised in the adaptation of plants to adverse environmental conditions. This response can be quantified by physiological experiments or metabolic profiling. The intention of this work is to reduce the number of metabolic processes studied to a minimum of relevant parameters with a maximum yield of information. Therefore, we inspected 'summary parameters' characteristic for whole classes of antioxidative metabolites and key enzymes. Results Three bioluminescence assays are presented. A horseradish peroxidase-based total antioxidative capacity (TAC) assay is used to probe low molecular weight antioxidants. Peroxidases are quantified by their luminol converting activity (LUPO). Finally, we quantify high molecular weight superoxide anion scavenging activity (SOSA) using coelenterazine. Experiments with Lepidium sativum L. show how salt, drought, cold, and heat influence the antioxidative system represented here by TAC, LUPO, SOSA, catalase, and glutathione reductase (GR). LUPO and SOSA run anti-parallel under all investigated stress conditions suggesting shifts in antioxidative functions rather than formation of antioxidative power. TAC runs in parallel with GR. This indicates that a majority of low molecular weight antioxidants in plants is represented by glutathione. Conclusion The set of assays presented here is capable of characterising antioxidative activities in plants. It is inexpensive, quick and reproducible and delivers quantitative data. 'Summary parameters' like TAC, LUPO, and SOSA are quantitative traits which may be promising for implementation in high-throughput screening for robustness of novel mutants, transgenics, or breeds. PMID:19171044

  5. Evaluation of a novel method based on amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) for typing strains of vancomycin-resistant Enterococcus faecium.

    PubMed

    Krawczyk, Beata; Lewandowski, Krzysztof; Bronk, Marek; Samet, Alfred; Myjak, Przemysław; Kur, Józef

    2003-03-01

    In the search for an effective DNA-typing technique for use in hospital epidemiology, the performance and convenience of a novel assay based on the fingerprinting of bacterial genomes by amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting) was tested. A large number of vancomycin-resistant Enterococcus faecium (VREM) isolates from haematological ward patients of the Clinical Hospital in Gdańsk were examined. We found that ADSRRS fingerprinting analysis is a rapid method that offers good discriminatory power. The method demonstrated also excellent reproducibility. The usefulness of the ADSRRS fingerprinting method for molecular typing was compared with pulsed field gel electrophoresis (PFGE) method, which is currently considered the gold standard for molecular typing of isolates recovered from patients and the environment in the course of investigation and control of nosocomial outbreaks. Clustering of ADSRRS fingerprinting data matched pulsed field gel electrophoresis data. The features of ADSRRS fingerprinting technique is discussed in comparison with conventional methods. Data presented here demonstrate the complexity of the epidemiological situation concerning VREM that may occur in a single medical ward.

  6. Bioavailability and toxicity of trace metals to the cladoceran Daphnia magna in relation to cadmium exposure history

    NASA Astrophysics Data System (ADS)

    Guan, Rui

    The cladoceran Daphnia magna is widely used in freshwater bioassessments and ecological risk assessments. This study designed a series of experiments employing radiotracer methodology to quantify the trace metals (mainly Cd and Zn) biokinetics in D. magna under different environmental and biological conditions and to investigate the influences of different Cd exposure histories on the bioavailability and toxicity of trace metals to D. magna. A bioenergetic-based kinetic model was finally applied in predicting the Cd accumulation dynamics in D. magna and the model validity under non-steady state was assessed. Cd assimilation was found in this study to be influenced by the food characteristics (e.g., metal concentration in food particles), the metal exposure history of the animals, and the genetic characteristics. Some of these influences could be interpreted by the capacity and/or competition of those metal binding sites within the digestive tract and/or the detoxifying proteins metallothionein (MT). My study demonstrated a significant induction of MT in response to Cd exposure and it was the dominant fraction in sequestering the internal nonessential trace metals in D. magna. The ratio of Cd body burden to MT might better predict the Cd toxicity on the digestion systems of D. magna than the Cd tissue burden alone within one-generational exposure to Cd. It was found that metal elimination (rate constant and contribution of different release routes) was independent of the food concentration and the dietary metal concentration, implying that the elimination may not be metabolically controlled. The incorporation of the bioenergetic-based kinetic model, especially under non-steady state, is invaluable in helping to understand the fate of trace metals in aquatic systems and potential environmental risks. The dependence of biokinetic parameters on environmental factors rather than on genotypes implies a great potential of using biokinetics in inter-laboratory comparisons.

  7. Toxic effect of selenium on the zooplankton, Daphnia magna and Daphnia pulicaria, in water and the food source (Chlamydomonas reinhardtii)

    SciTech Connect

    Boyum, K.W.

    1984-01-01

    Acute and chronic toxicity experiments were performed on the zooplankton, Daphnia magna and Daphnia pulicaria, to investigate the toxicity of selenium on these aquatic invertebrates. The acute 48 h LC/sub 50/ of sodium selenate for Daphnia magna and Daphnia pulicaria were 1.01 and 0.25 mg Se/1, respectively. The 48 h LC/sub 50/ of sodium selenite for D. magna and D. pulicaria were 0.45 and 0.006 mg Se/1, respectively. Chronic 28-day toxicity tests were performed on D. magna at 0.05, 0.10, 0.50, and 1.00 mg Se/1 as sodium selenate in the water and with two food types. One food type was algae raised in clean Lake Michigan water and the second treatment was algae raised in media with selenium concentrations corresponding to those in the water cited above. When compared to Daphnia fed selenium-free algae, D. magna fed selenium-laden algae had greater survival, a greater number of offspring produced, and a greater intrinsic growth rate, r, at the toxicant concentration in the water of 0.05, 0.10, and 0.50 mg Se/1. These parameters were, however, lower than those observed in the controls. Uptake of /sup 75/Se as sodium selenate in D. magna was reduced in the presence of selenium-laden algae and DL-selenomethionine, while L-methionine increased the uptake of /sup 75/Se. Selenium bound to an amino acid such as Dl-selenomethionine or organically bound within an algal food source appears to be preferentially incorporated thereby reducing the uptake of inorganic forms from the water.

  8. Population level effects of multiwalled carbon nanotubes in Daphnia magna exposed to pulses of triclocarban.

    PubMed

    Simon, Anne; Preuss, Thomas G; Schäffer, Andreas; Hollert, Henner; Maes, Hanna M

    2015-08-01

    Due to the rapid increase of carbon nanotubes (CNT) applications and their inevitable release into the aquatic environment, CNT may interact with and further influence the fate and transport of other pollutants such as triclocarban (TCC). TCC is a high-production-volume chemical that is widely used as an antimicrobial agent, is continually released into the aquatic environment, and is biologically active and persistent. In the present study, the population test with Daphnia magna was performed over 93 days. Different treatments were examined: (a) control, (b) solvent control, (c) 1 mg CNT/L from the beginning, (d) 1 mg CNT/L as of day 14, (e) control with a 2-day pulse of 25 µg TCC/L on day 14, 41 µg TCC/L (day 54), and 61 µg TCC/L (day 68) and (f) same pulses of TCC with co-exposure to 1 mg CNT/L. Significant changes in all three size classes were observed as a result of the long-term exposure to 1 mg CNT/L. Increasing in number of neonates, and decreasing in number of juveniles and adults were observed. Moreover, daphnids were significantly smaller when they were exposed to MWCNT. The exposure with TCC led to size-dependent mortality in Daphnia magna populations and a subsequent recovery. Lower toxicity of TCC was observed, with the presence of MWCNT in the medium. The reported effects of TCC on population level were compared to the output of an individual-based Daphnia magna population model, in order to verify the model predictions with laboratory data.

  9. Validation of a two-generational reproduction test in Daphnia magna: An interlaboratory exercise.

    PubMed

    Barata, Carlos; Campos, Bruno; Rivetti, Claudia; LeBlanc, Gerald A; Eytcheson, Stephanie; McKnight, Stephanie; Tobor-Kaplon, Marysia; de Vries Buitenweg, Selinda; Choi, Suhyon; Choi, Jinhee; Sarapultseva, Elena I; Coutellec, Marie-Agnès; Coke, Maïra; Pandard, Pascal; Chaumot, Arnaud; Quéau, Hervé; Delorme, Nicolas; Geffard, Olivier; Martínez-Jerónimo, Fernando; Watanabe, Haruna; Tatarazako, Norihisa; Lopes, Isabel; Pestana, João L T; Soares, Amadeu M V M; Pereira, Cecilia Manuela; De Schamphelaere, Karel

    2017-02-01

    Effects observed within one generation disregard potential detrimental effects that may appear across generations. Previously we have developed a two generation Daphnia magna reproduction test using the OECD TG 211 protocol with a few amendments, including initiating the second generation with third brood neonates produced from first generation individuals. Here we showed the results of an inter-laboratory calibration exercise among 12 partners that aimed to test the robustness and consistency of a two generation Daphnia magna reproduction test. Pyperonyl butoxide (PBO) was used as a test compound. Following experiments, PBO residues were determined by TQD-LC/MS/MS. Chemical analysis denoted minor deviations of measured PBO concentrations in freshly prepared and old test solutions and between real and nominal concentrations in all labs. Other test conditions (water, food, D. magna clone, type of test vessel) varied across partners as allowed in the OECD test guidelines. Cumulative fecundity and intrinsic population growth rates (r) were used to estimate "No observed effect concentrations "NOEC using the solvent control as the control treatment. EC10 and EC-50 values were obtained regression analyses. Eleven of the twelve labs succeeded in meeting the OECD criteria of producing >60 offspring per female in control treatments during 21days in each of the two consecutive generations. Analysis of variance partitioning of cumulative fecundity indicated a relatively good performance of most labs with most of the variance accounted for by PBO (56.4%) and PBO by interlaboratory interactions (20.2%), with multigenerational effects within and across PBO concentrations explaining about 6% of the variance. EC50 values for reproduction and population growth rates were on average 16.6 and 20.8% lower among second generation individuals, respectively. In summary these results suggest that the proposed assay is reproducible but cumulative toxicity in the second generation cannot

  10. Thermal tolerance in the keystone species Daphnia magna -a candidate gene and an outlier analysis approach.

    PubMed

    Jansen, M; Geerts, A N; Rago, A; Spanier, K I; Denis, C; De Meester, L; Orsini, L

    2017-02-01

    Changes in temperature have occurred throughout Earth's history. However, current warming trends exacerbated by human activities impose severe and rapid loss of biodiversity. Although understanding the mechanisms orchestrating organismal response to climate change is important, remarkably few studies document their role in nature. This is because only few systems enable the combined analysis of genetic and plastic responses to environmental change over long time-spans. Here, we characterize genetic and plastic responses to temperature increase in the aquatic keystone grazer Daphnia magna combining a candidate gene and an outlier analysis approach. We capitalize on the short generation time of our species, facilitating experimental evolution, and the production of dormant eggs enabling the analysis of long term response to environmental change through a resurrection ecology approach. We quantify plasticity in the expression of 35 candidate genes in D. magna populations resurrected from a lake that experienced changes in average temperature over the past century and from experimental populations differing in thermal tolerance isolated from a selection experiment. By measuring expression in multiple genotypes from each of these populations in control and heat treatments we assess plastic responses to extreme temperature events. By measuring evolutionary changes in gene expression between warm and cold adapted populations we assess evolutionary response to temperature changes. Evolutionary response to temperature increase is also assessed via an outlier analysis using EST-linked microsatellite loci. This study provides the first insights into the role of plasticity and genetic adaptation in orchestrating adaptive responses to environmental change in D. magna This article is protected by copyright. All rights reserved.

  11. Fish bioturbation of cadmium-contaminated sediments: Factors affecting Cd availability to Daphnia magna

    SciTech Connect

    Wall, S.B.; La Point, T.W.; Isely, J.J.

    1996-03-01

    Benthic fish bioturbation of contaminated sediments is thought to enhance exposure and, potentially, bioaccumulation into planktonic organisms. Exposures were conducted with cadmium-spiked sediment, 1.0 mg/kg nominal concentrations, and koi carp (Cyprinus carpio). Daphnia magna were placed in aquaria with and without fish for 6 d and Cd bioaccumulation was measured every 48 h. Koi carp bioturbation increased mean total suspended solids (TSS) in two trials from 0.001 mg/L to 44.4 mg/L and 19.2 mg/L to 762.4 mg/L. Mean aqueous Cd concentrations increased from1.4 {micro}g/L to 2.8 {micro}g/L, and from 1.6 {micro}g/L to 13.2 {micro}g/L. Cadmium binding capacity increased from 28.9 {micro}g/L to 169.8 {micro}g/L in with-fish treatments when compared to controls. However, Daphnia magna body burdens did not increase. Mean Cd residues of daphnids exposed with fish, 9.2 {micro}g/g, were not statistically different from without-fish exposures, 8.0 {micro}g/g. Body burdens slightly decreased in the first trial after the with-fish treatment, 9.4 {micro}g/g to 8.3 {micro}g/g. Fish size was partially correlated with TSS and aqueous Cd concentrations and TSS positively correlated with binding capacity. Because increased TSS in the with-fish treatment resulted in increased binding capacity, it is probable that cadmium bioavailability decreased. Although koi carp were capable of remobilizing Cd from sediment, Cd bioaccumulation into Daphnia magna was not significant.

  12. Aminomethylphosphonic acid has low chronic toxicity to Daphnia magna and Pimephales promelas.

    PubMed

    Levine, Steven L; von Mérey, Georg; Minderhout, Tui; Manson, Philip; Sutton, Peter

    2015-06-01

    Aminomethylphosphonic acid (AMPA) is the simplest member of a class of compounds known as aminomethylenephosphonates and the only environmental metabolite measured in significant amounts during the degradation of the herbicide glyphosate in soil. However, there are additional sources of AMPA in the environment, originating from organic phosphonates which are used in water treatment to inhibit scale formation and corrosion. Like glyphosate, AMPA has low acute toxicity to aquatic animals, and the no-observed-adverse effect concentration (NOAEC) obtained from a fish full-life cycle study for glyphosate was determined to be 26 mg/L. However, the chronic toxicity of AMPA to aquatic animals has not been evaluated before. The purpose of the present study was to assess the potential for chronic toxicity of AMPA to fathead minnow (Pimephales promelas) and Daphnia magna. Chronic toxicity to P. promelas was evaluated in a fish early-life stage study. The primary endpoints were larval survival, growth, and development. The NOAEC for P. promelas was determined to be 12 mg/L, the highest concentration tested. The chronic toxicity to D. magna was evaluated in a Daphnia reproduction test. The primary endpoints were survival, growth, and reproduction. The no-observed-effect concentration for D. magna was determined to be 15 mg/L. Conservatively predicted environmental surface water concentrations for AMPA from typical foliar agricultural application rates and values from surface water monitoring programs are 100 to 1000 times less than the NOAEC values from both studies. Consequently, there is a large and highly protective margin of safety between realistic environmental exposures to AMPA and chronic toxicity to aquatic vertebrates and invertebrates.

  13. Evaluation of ecotoxicological effects of drugs on Daphnia magna using different enzymatic biomarkers.

    PubMed

    Oliveira, Laira L D; Antunes, Sara C; Gonçalves, Fernando; Rocha, Odete; Nunes, Bruno

    2015-09-01

    The increasing occurrence of pharmaceutical drugs in the aquatic environment is cause of concern, due to the possibility of toxic phenomena in non-target species, including oxidative stress and neurotoxicity. The present study aimed to assess the acute effect of four widely used therapeutic agents: acetaminophen (analgesic), chlorpromazine (antipsychotic), diclofenac (anti-inflammatory) and propranolol (antihypertensive), in the cladoceran species Daphnia magna. Considering the involvement of the mentioned compounds in the impairment of cholinesterasic activity and modifications in cellular redox systems, the purpose of this study was to analyze their effects on biomarkers of neuronal regulation, such as total cholinesterases (ChEs), and enzymatic oxidative stress defense, including as catalase (CAT), glutathione-S-transferases (GSTs), and total and selenium-dependent glutathione-peroxidase (total GPx; Se-GPx) activities. Exposure to acetaminophen caused a significant inhibition of AChE and Se-GPx activities in D. magna relative to the control. Among the biomarkers of oxidative stress, only the activity of CAT was significantly altered in concentration of 0.001mg L(-1) of chlorpromazine, which was not always consistent with the literature. Diclofenac caused a significant inhibition of AChE and Se-dependent GPx, and also in total GPx activities. Propranolol was responsible for a significant decrease in the activity of the latter two enzymes, and also a slight increase of GSTs activity. The results indicated that the exposure to all the tested compounds induced alterations on the cellular redox status in the studied species. In addition, acetaminophen and diclofenac were shown to have the capability of interfering with D. magna neurotransmission, through the inhibition of ChEs. Our data enlighten the need for more research on the ecological consequences of pharmaceuticals in non-target organisms.

  14. Comparison of nanosilver and ionic silver toxicity in Daphnia magna and Pimephales promelas.

    PubMed

    Hoheisel, Sarah M; Diamond, Steve; Mount, David

    2012-11-01

    The increasing use of nanosilver in consumer products and the likelihood of environmental exposure warrant investigation into the toxicity of nanosilver to aquatic organisms. A series of studies were conducted comparing the potency of nanosilver to ionic silver (Ag(+)) at acute and sublethal levels using two test organisms (Daphnia magna and Pimephales promelas). The 48-h D. magna median lethal concentration (LC50) of multiple sizes (10, 20, 30, and 50 nm) of commercially prepared nanosilver (nanoComposix) ranged from 4.31 to 30.36 µg total Ag L(-1) with increasing toxicity associated with decreasing particle size. A strong relationship between estimated specific particle surface area and acute toxicity was observed. Nanosilver suspensions (10 nm) treated with cation exchange resin to reduce the concentration of Ag(+) associated with it were approximately equally toxic to D. magna compared to untreated nanosilver (48-h LC50s were 2.15 and 2.79 µg total Ag L(-1), respectively). The 96-h LC50 and 7-d sublethal 20% effective concentrations (EC20s) for P. promelas were 89.4 and 46.1 µg total Ag L(-1), respectively, for 10 nm nanosilver and 4.70 and 1.37 µg total Ag L(-1), respectively, for Ag(+); the resulting ratios of 96-h LC50 to 7-d EC20 were not significantly different for nanosilver and ionic silver. Overall, these studies did not provide strong evidence that nanosilver either acts by a different mechanism of toxicity than ionic silver, or is likely to cause acute or lethal toxicity beyond that which would be predicted by mass concentration of total silver. This in turn suggests that regulatory approaches based on the toxicity of ionic silver to aquatic life would not be underprotective for environmental releases of nanosilver.

  15. Land use, genetic diversity and toxicant tolerance in natural populations of Daphnia magna.

    PubMed

    Coors, Anja; Vanoverbeke, Joost; De Bie, Tom; De Meester, Luc

    2009-10-19

    Provided that gene flow is not too high, selection by local environmental conditions in heterogeneous landscapes can lead to genetic adaptation of natural populations to their local habitat. Pollution with anthropogenic toxicants may create pronounced environmental gradients that impose strong local selection pressures. Toxic contaminants may also directly impact genetic structure in natural populations by exhibiting genotoxicity or by causing population declines resulting in genetic bottlenecks. Using populations of Daphnia magna established from the dormant egg banks of ponds located in a landscape dominated by anthropogenic impact, we aimed at detecting evidence for local adaptation to environmental contamination. We explored the relationship between land use around the 10 investigated ponds, population genetic diversity as measured by neutral genetic markers (polymorphic allozymes) and the tolerance of the populations originating from these ponds to acute lethal effects of two model toxicants, the pesticide carbaryl and the metal potassium dichromate. Genetic diversity of the populations as observed by neutral markers tended to be negatively impacted by agricultural land use intensity (Spearman rank correlation, R=-0.614, P=0.059), indicating that genetic bottlenecks may have resulted from anthropogenic impact. We experimentally observed differences in susceptibility to both carbaryl and potassium dichromate among the studied pond populations of D. magna (analysis of deviance, P<0.001). Because the experimental design excluded the possibility of physiological adaptation of the test animals to the toxicants, we conclude that the differences in susceptibility must have a genetic basis. Moreover, carbaryl tolerance levels of the populations tended to increase with increasing agricultural land use intensity as described by ranked percentage of land coverage with cereal and corn crop in the proximity of the ponds (Spearman rank correlation, R=0.602, P=0

  16. FBI compression standard for digitized fingerprint images

    NASA Astrophysics Data System (ADS)

    Brislawn, Christopher M.; Bradley, Jonathan N.; Onyshczak, Remigius J.; Hopper, Thomas

    1996-11-01

    The FBI has formulated national standards for digitization and compression of gray-scale fingerprint images. The compression algorithm for the digitized images is based on adaptive uniform scalar quantization of a discrete wavelet transform subband decomposition, a technique referred to as the wavelet/scalar quantization method. The algorithm produces archival-quality images at compression ratios of around 15 to 1 and will allow the current database of paper fingerprint cards to be replaced by digital imagery. A compliance testing program is also being implemented to ensure high standards of image quality and interchangeability of data between different implementations. We will review the current status of the FBI standard, including the compliance testing process and the details of the first-generation encoder.

  17. Reference Device-Assisted Adaptive Location Fingerprinting

    PubMed Central

    Wu, Dongjin; Xia, Linyuan

    2016-01-01

    Location fingerprinting suffers in dynamic environments and needs recalibration from time to time to maintain system performance. This paper proposes an adaptive approach for location fingerprinting. Based on real-time received signal strength indicator (RSSI) samples measured by a group of reference devices, the approach applies a modified Universal Kriging (UK) interpolant to estimate adaptive temporal and environmental radio maps. The modified UK can take the spatial distribution characteristics of RSSI into account. In addition, the issue of device heterogeneity caused by multiple reference devices is further addressed. To compensate the measuring differences of heterogeneous reference devices, differential RSSI metric is employed. Extensive experiments were conducted in an indoor field and the results demonstrate that the proposed approach not only adapts to dynamic environments and the situation of changing APs’ positions, but it is also robust toward measuring differences of heterogeneous reference devices. PMID:27258284

  18. Maximum Likelihood Reconstruction for Magnetic Resonance Fingerprinting

    PubMed Central

    Zhao, Bo; Setsompop, Kawin; Ye, Huihui; Cauley, Stephen; Wald, Lawrence L.

    2017-01-01

    This paper introduces a statistical estimation framework for magnetic resonance (MR) fingerprinting, a recently proposed quantitative imaging paradigm. Within this framework, we present a maximum likelihood (ML) formalism to estimate multiple parameter maps directly from highly undersampled, noisy k-space data. A novel algorithm, based on variable splitting, the alternating direction method of multipliers, and the variable projection method, is developed to solve the resulting optimization problem. Representative results from both simulations and in vivo experiments demonstrate that the proposed approach yields significantly improved accuracy in parameter estimation, compared to the conventional MR fingerprinting reconstruction. Moreover, the proposed framework provides new theoretical insights into the conventional approach. We show analytically that the conventional approach is an approximation to the ML reconstruction; more precisely, it is exactly equivalent to the first iteration of the proposed algorithm for the ML reconstruction, provided that a gridding reconstruction is used as an initialization. PMID:26915119

  19. Chromatographic fingerprint analysis of Pycnogenol dietary supplements.

    PubMed

    Chen, Pei; Song, Fenhong; Lin, Long-Ze

    2009-01-01

    The bark of maritime pine (Pinus pinaster Aiton) has been widely used as a remedy for various degenerative diseases. A standard high-performance liquid chromatographic (HPLC) procedure for Pycnogenol analysis is a method specified in the United States Pharmacopeia (USP) monograph, which requires measurement of peak areas and identification of four components of the extract: caffeic acid, catechin, ferulic acid, and taxifolin. In this study, a fingerprint analysis using an HPLC method based on the USP monograph has been developed to provide additional qualitative information for the analysis of Pycnogenol-containing dietary supplements (PDS). Twelve commercially available PDS samples were purchased and analyzed along with a standard Pycnogenol extract. Their chromatographic fingerprints were analyzed using principal component analysis. The results showed that two of the samples were not consistent with the standard reference Pycnogenol extract. One contained other active ingredients in addition to Pycnogenol, and the other may have resulted from a quality control issue in manufacturing.

  20. Transmission fingerprints in quasiperiodic dielectric multilayers

    NASA Astrophysics Data System (ADS)

    Vasconcelos, M. S.; Albuquerque, E. L.

    1999-05-01

    We investigate the optical transmission fingerprints in structures that exhibit deterministic disorders. A class of models that has attracted particular attention in this context are the quasiperiodic dielectric multilayers that obey a substitutional sequence. These substitutional sequence are characterized by the nature of their Fourier spectrum, which can be dense pure point (Fibonacci sequences), singular continuous (Thue-Morse and double-period sequences), and absolutely continuous (Rudin-Shapiro sequence). We use a transfer-matrix approach to derive the optical transmission coefficients. Numerical results are presented to illustrate the self-similar aspect of the spectra, as well as to show the optical fingerprint through a return map of the transmission coefficients.

  1. Chemotherapy and Fingerprint Loss: Beyond Cosmetic

    PubMed Central

    2012-01-01

    Hand–foot syndrome (HFS) is a common adverse reaction to several chemotherapy drugs. Focus has been on the clinically relevant sequelae associated with this condition, with fingerprint loss receiving little attention. We report the case of a 53-year old male patient with terminal metastatic adenocarcinoma of the rectum involving the liver and lungs who developed grade 3 HFS while on capecitabine therapy. This resulted in his inability to process required government papers as a result of the loss of his fingerprints, imposing significant inconvenience and frustration on a person severely challenged by his deteriorating health. We believe clinicians should pay more attention to this possible outcome that can add additional stress in the lives of patients whose quality of life is already severely compromised. PMID:22298801

  2. Development and sensitivity of a 12-h laboratory test with Daphnia magna Straus based on avoidance of pulp mill effluents.

    PubMed

    Rosa, R; Moreira-Santos, M; Lopes, I; Picado, A; Mendonça, E; Ribeiro, R

    2008-11-01

    Studies on avoidance of contaminants by aquatic organisms verified that such behavior may have crucial ecological implications. Yet, avoidance tests have not been considered in ecological risk assessments. This study aimed at developing a short-term test with Daphnia magna Straus based on avoidance of pulp mill effluents and at comparing its sensitivity to the standard 21 d D. magna reproduction test. The avoidance effective dilution values (12 h EDil20 and EDil50) were as sensitive as the 21 d EDil20 and EDil50 values for reproduction. Therefore, this easily standardizable short-term test can be recommended as a valuable complementary tool in ecological risk assessments.

  3. Comparison of ethanol toxicity to Daphnia magna and Ceriodaphnia dubia tested at two different temperatures: static acute toxicity test results

    SciTech Connect

    Takahashi, I.T.; Cowgill, U.M.; Murphy, P.G.

    1987-08-01

    Ethanol is a commonly used solvent in toxicity testing, yet there are few studies in the literature devoted to its toxicity to zooplankton. The purpose of this study was to compare the response of Daphnia magna Straus 1820 and Ceriodaphnia dubia J. Richard 1894 to ethanol. Two temperatures were selected because most toxicity data involving D. magna has been carried out at 20/sup 0/C while all discussions concerning C. dubia appear to relate to temperatures oscillating around 25/sup 0/C. Thus, the response of these two organisms to ethanol was examined at 20/sup 0/C and at 24/sup 0/C.r

  4. A case of Finegoldia magna (formerly Peptostreptococcus magnus) infection mimicking disseminated malignancy.

    PubMed

    Basu, Pallavi; Williams, Anwen; O'Brien, Matthew T; Brouns, Mattheus; Edwards, Paul

    2016-12-01

    A 44-year-old alcoholic (and therefore immunocompromised) hospital cleaner presented with general malaise, weight loss, and erythematous skin nodules. Computed tomography scanning revealed a neck mass invading the thyroid gland, pulmonary infiltrates, liver lesions, and deposits on the anterior abdominal wall, consistent with disseminated malignancy. However, tissue diagnosis showed a necro-inflammatory process with no evidence of malignancy. Microscopy and culture of samples failed to detect any infectious pathogen, but after an extended incubation period, Finegoldia magna was isolated. This case study illustrates the importance of tissue diagnosis in suspected disseminated malignancy and raises the risk of acquiring the rarer bacteria amongst hospital staff.

  5. The relationship of total copper 48-h LC50s to Daphnia magna dry weight

    SciTech Connect

    Lazorchak, J.M. ); Waller, W.T. )

    1993-05-01

    A study was conducted with Daphnia magna to determine the effect of neonate weight loss or lack of weight gain on experimentally derived copper 48-h LC50s. Standard unfed tests as well as algal-fed (Selenastrum capricornutum) tests were used to look at weight loss and gain. No significant relationship was found between amount of weight loss and copper LC50s. However, dry weight of unfed and algal-fed control organisms could be used to predict total copper LC50s.

  6. Usefulness of the lipid index for biouptake studies with Daphnia magna

    SciTech Connect

    Dauble, D.D.; Klopfer, D.C.; Carlile, D.W.; Hanf, R.W.

    1984-04-01

    Adult Daphnia magna were starved and monitored for lipid content and brood production. Mean lipid index values declined for 72 hours to less than 50% of 24 hour values. Number of hatched young was inversely related to lipid storage and ovary production. Uptake kinetics of /sup 14/C-labelled quinoline was compared between two daphnid test groups with mean lipid scores of 5.4 and 2.8, respectively. Total /sup 14/C counts were significantly higher for the high lipid group at 8 hour. Our studies indicated that lipid reserves of daphnid test populations can be routinely monitored as an indicator of environmental stress.

  7. Effect of nutrient limitation of cyanobacteria on protease inhibitor production and fitness of Daphnia magna.

    PubMed

    Schwarzenberger, Anke; Sadler, Thomas; Von Elert, Eric

    2013-10-01

    Herbivore-plant interactions have been well studied in both terrestrial and aquatic ecosystems as they are crucial for the trophic transfer of energy and matter. In nutrient-rich freshwater ecosystems, the interaction between primary producers and herbivores is to a large extent represented by Daphnia and cyanobacteria. The occurrence of cyanobacterial blooms in lakes and ponds has, at least partly, been attributed to cyanotoxins, which negatively affect the major grazer of planktonic cyanobacteria, i.e. Daphnia. Among these cyanotoxins are the widespread protease inhibitors. These inhibitors have been shown (both in vitro and in situ) to inhibit the most important group of digestive proteases in the gut of Daphnia, i.e. trypsins and chymotrypsins, and to reduce Daphnia growth. In this study we grew cultures of the cyanobacterium Microcystis sp. strain BM25 on nutrient-replete, N-depleted or P-depleted medium. We identified three different micropeptins to be the cause for the inhibitory activity of BM25 against chymotrypsins. The micropeptin content depended on nutrient availability: whereas N limitation led to a lower concentration of micropeptins per biomass, P limitation resulted in a higher production of these chymotrypsin inhibitors. The altered micropeptin content of BM25 was accompanied by changed effects on the fitness of Daphnia magna: a higher content of micropeptins led to lower IC50 values for D. magna gut proteases and vice versa. Following expectations, the lower micropeptin content in the N-depleted BM25 caused higher somatic growth of D. magna. Therefore, protease inhibitors can be regarded as a nutrient-dependent defence against grazers. Interestingly, although the P limitation of the cyanobacterium led to a higher micropeptin content, high growth of D. magna was observed when they were fed with P-depleted BM25. This might be due to reduced digestibility of P-depleted cells with putatively thick mucilaginous sheaths. These findings indicate that

  8. Acute and chronic toxicity of buprofezin on Daphnia magna and the recovery evaluation.

    PubMed

    Liu, Yong; Qi, Suzhen; Zhang, Wen; Li, Xuefeng; Qiu, Lihong; Wang, Chengju

    2012-11-01

    The toxic effects of buprofezin on Daphnia magna after both chronic and acute exposures were evaluated according to OECD guidelines. A 48-h acute exposure of buprofezin resulted in daphnid immobility at an EC(50) of 0.44 mg/L. In a 14 days chronic exposure of buprofezin (0, 0.025, 0.05, 0.10 and 0.15 mg/L), the development and reproduction of daphnids were all significantly affected and the body length was more sensitive than other observed parameters. However, the adverse effects of buprofezin on parental daphnids can be passed on to their offspring and cannot be recovered in a short time.

  9. Rapidly Probing Antibacterial Activity of Graphene Oxide by Mass Spectrometry-based Metabolite Fingerprinting

    PubMed Central

    Zhang, Ning; Hou, Jian; Chen, Suming; Xiong, Caiqiao; Liu, Huihui; Jin, Yulong; Wang, Jianing; He, Qing; Zhao, Rui; Nie, Zongxiu

    2016-01-01

    Application of nanomaterials as anti-bacteria agents has aroused great attention. To investigate the antibacterial activity and antibacterial mechanism of nanomaterials from a molecular perspective is important for efficient developing of nanomaterial antibiotics. In the current work, a new mass spectrometry-based method was established to investigate the bacterial cytotoxicity of graphene oxide (GO) by the metabolite fingerprinting of microbes. The mass spectra of extracted metabolites from two strains DH5α and ATCC25922 were obtained before and after the incubation with nanomaterials respectively. Then principal component analysis (PCA) of these spectra was performed to reveal the relationship between the metabolism disorder of microbes and bactericidal activity of GO. A parameter “D” obtained from PCA scores was proposed that is capable to quantitatively evaluate the antibacterial activity of GO in concentration and time-dependent experiments. Further annotation of the fingerprinting spectra shows the variabilities of important metabolites such as phosphatidylethanolamine, phosphatidylglycerol and glutathione. This metabolic perturbation of E. coli indicates cell membrane destruction and oxidative stress mechanisms for anti-bacteria activity of graphene oxide. It is anticipated that this mass spectrometry-based metabolite fingerprinting method will be applicable to other antibacterial nanomaterials and provide more clues as to their antibacterial mechanism at molecular level. PMID:27306507

  10. DNA fingerprinting; a biotechnology in business.

    PubMed

    Debenham, P G

    1991-01-01

    Since its discovery by Professor Alec Jeffreys, first published in 1985, DNA fingerprinting has never been far from the headlines. Cellmark, as the leading commercial DNA fingerprinting enterprise, has had the challenge of establishing its business in this high profile environment. The challenge for such a business has had three elements. Firstly and primarily to establish a laboratory system that consistently provides results to the highest standards possible. Secondly to communicate the science to its broad customer base which ranges from the general public to the experts of legal, scientific and governmental systems. Then finally there is the challenge of setting up the business in the context of the volatile, venture-capital based biotechnology market where the requirements for assured quality spar with those for cut prices. Given this backdrop it is not surprising that DNA fingerprinting has had its detractors, yet the consensus of opinion is that this technology has become a near routine business with the challenges effectively met and the success that was hoped for.

  11. AFLP fingerprinting for paternity testing in ducks.

    PubMed

    Huang, C-W; Cheng, Y-S; Rouvier, R; Yang, K-T; Wu, C-P; Huang, M-C

    2007-06-01

    1. The accuracy and reproducibility of AFLP fingerprinting was investigated in the duck (Anas Platyrhynchos), using a multicolour fluorescent labeling technique. The fluorescent labelling fragments were separated on a capillary electrophoresis-base ABI PRISM 3100 Genetic Analyzer. 2. A total of 337 AFLP peaks with 103 of them being polymorphic markers were generated by 16 sets consisting of EcoRI/TaqI primer pair combinations. The number and size range of AFLP polymorphisms detected per primer pair varied from 3 to 11 and 58 to 290 bp, respectively. About 30.6% (103/337) of AFLP peaks were detected polymorphisms, with an average of 6.4 polymorphic markers per primer pair. 3. The clear polymorphic peaks were amplified with EcoR+AC/Taq+AC primer combinations. The AFLP peaks showed high reproducibility. From the family testing, we found that the fingerprints of all the offspring were derived from one or other parent. Therefore, we conclude that AFLP fingerprinting might be a suitable method for duck paternity testing.

  12. Water content of latent fingerprints - Dispelling the myth.

    PubMed

    Kent, Terry

    2016-09-01

    Changing procedures in the handling of rare and precious documents in museums and elsewhere, based on assumptions about constituents of latent fingerprints, have led the author to an examination of available data. These changes appear to have been triggered by one paper using general biological data regarding eccrine sweat production to infer that deposited fingerprints are mostly water. Searching the fingerprint literature has revealed a number of reference works similarly quoting figures for average water content of deposited fingerprints of 98% or more. Whilst accurate estimation is difficult there is no evidence that the residue on fingers could be anything like 98% water, even if there were no contamination from sebaceous glands. Consideration of published analytical data of real fingerprints, and several theoretical considerations regarding evaporation and replenishment rates, indicates a probable initial average water content of a fingerprint, soon after deposition, of 20% or less.

  13. Rolled fingerprint construction using MRF-based nonrigid image registration.

    PubMed

    Kwon, Dongjin; Yun, Il Dong; Lee, Sang Uk

    2010-12-01

    This paper proposes a new rolled fingerprint construction approach incorporating a state-of-the-art nonrigid image registration method based upon a Markov random field (MRF) energy model. The proposed method finds dense correspondences between images from a rolled fingerprint sequence and warps the entire fingerprint area to synthesize a rolled fingerprint. This method can generate conceptually more accurate rolled fingerprints by preserving the geometric properties of the finger surface as opposed to ink-based rolled impressions and other existing rolled fingerprint construction methods. To verify the accuracy of the proposed method, various comparative experiments were designed to reveal differences among the rolled construction methods. The results show that the proposed method is significantly superior in various aspects compared to previous approaches.

  14. Enhancing security of fingerprints through contextual biometric watermarking.

    PubMed

    Noore, Afzel; Singh, Richa; Vatsa, Mayank; Houck, Max M

    2007-07-04

    This paper presents a novel digital watermarking technique using face and demographic text data as multiple watermarks for verifying the chain of custody and protecting the integrity of a fingerprint image. The watermarks are embedded in selected texture regions of a fingerprint image using discrete wavelet transform. Experimental results show that modifications in these locations are visually imperceptible and maintain the minutiae details. The integrity of the fingerprint image is verified through the high matching scores obtained from an automatic fingerprint identification system. There is also a high degree of visual correlation between the embedded images, and the extracted images from the watermarked fingerprint. The degree of similarity is computed using pixel-based metrics and human visual system metrics. The results also show that the proposed watermarked fingerprint and the extracted images are resilient to common attacks such as compression, filtering, and noise.

  15. 8-Bit Gray Scale Images of Fingerprint Image Groups

    National Institute of Standards and Technology Data Gateway

    NIST 8-Bit Gray Scale Images of Fingerprint Image Groups (PC database for purchase)   The NIST database of fingerprint images contains 2000 8-bit gray scale fingerprint image pairs. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  16. PLC Hardware Discrimination using RF-DNA fingerprinting

    DTIC Science & Technology

    2014-06-19

    PLC HARDWARE DISCRIMINATION USING RF- DNA FINGERPRINTING THESIS Bradley C. Wright, Civilian, USAF AFIT-ENG-T-14-J-12 DEPARTMENT OF THE AIR FORCE AIR...protection in the United States. AFIT-ENG-T-14-J-12 PLC HARDWARE DISCRIMINATION USING RF- DNA FINGERPRINTING THESIS Presented to the Faculty Department...DISCRIMINATION USING RF- DNA FINGERPRINTING Bradley C. Wright, B.S.E.E. Civilian, USAF Approved: /signed/ Maj Samuel J. Stone, PhD (Chairman) /signed/ Michael A

  17. Molecular fingerprinting of multidrug-resistant Salmonella enterica serotype Typhi.

    PubMed Central

    Hampton, M. D.; Ward, L. R.; Rowe, B.; Threlfall, E. J.

    1998-01-01

    For epidemiologic investigations, the primary subdivision of Salmonella Typhi is vi-phage typing; 106 Vi-phage types are defined. For multidrug-resistant strains the most common types have been M1 (Pakistan) and E1 (India, Pakistan, Bangladesh, and the Arabian Gulf); a strain untypable with the Vi phages has been responsible for a major epidemic in Tajikistan. Most often, isolates from the Indian subcontinent have been resistant to ampicillin, chloramphenicol, streptomycin, sulfonamides, tetracyclines, and trimethoprim; but in the 1997 Tajikistan outbreak, the epidemic strain was also resistant to ciprofloxacin. For multidrug-resistant strains, subdivision within phage type can be achieved by plasmid profile typing and pulsed-field gel electrophoresis. PMID:9621206

  18. Studies on Chromatographic Fingerprint and Fingerprinting Profile-Efficacy Relationship of Saxifraga stolonifera Meerb.

    PubMed

    Wu, Xing-Dong; Chen, Hua-Guo; Zhou, Xin; Huang, Ya; Hu, En-Ming; Jiang, Zheng-Meng; Zhao, Chao; Gong, Xiao-Jian; Deng, Qing-Fang

    2015-12-19

    This work investigated the spectrum-effect relationships between high performance liquid chromatography (HPLC) fingerprints and the anti-benign prostatic hyperplasia activities of aqueous extracts from Saxifraga stolonifera. The fingerprints of S. stolonifera from various sources were established by HPLC and evaluated by similarity analysis (SA), hierarchical clustering analysis (HCA) and principal component analysis (PCA). Nine samples were obtained from these 24 batches of different origins, according to the results of SA, HCA and the common chromatographic peaks area. A testosterone-induced mouse model of benign prostatic hyperplasia (BPH) was used to establish the anti-benign prostatic hyperplasia activities of these nine S. stolonifera samples. The model was evaluated by analyzing prostatic index (PI), serum acid phosphatase (ACP) activity, concentrations of serum dihydrotestosterone (DHT), prostatic acid phosphatase (PACP) and type II 5α-reductase (SRD5A2). The spectrum-effect relationships between HPLC fingerprints and anti-benign prostatic hyperplasia activities were investigated using Grey Correlation Analysis (GRA) and partial least squares regression (PLSR). The results showed that a close correlation existed between the fingerprints and anti-benign prostatic hyperplasia activities, and peak 14 (chlorogenic acid), peak 17 (quercetin 5-O-β-d-glucopyranoside) and peak 18 (quercetin 3-O-β-l-rhamno-pyranoside) in the HPLC fingerprints might be the main active components against anti-benign prostatic hyperplasia. This work provides a general model for the study of spectrum-effect relationships of S. stolonifera by combing HPLC fingerprints with a testosterone-induced mouse model of BPH, which can be employed to discover the principle components of anti-benign prostatic hyperplasia bioactivity.

  19. Comparative study of minutiae selection algorithms for ISO fingerprint templates

    NASA Astrophysics Data System (ADS)

    Vibert, B.; Charrier, C.; Le Bars, J.-M.; Rosenberger, C.

    2015-03-01

    We address the selection of fingerprint minutiae given a fingerprint ISO template. Minutiae selection plays a very important role when a secure element (i.e. a smart-card) is used. Because of the limited capability of computation and memory, the number of minutiae of a stored reference in the secure element is limited. We propose in this paper a comparative study of 6 minutiae selection methods including 2 methods from the literature and 1 like reference (No Selection). Experimental results on 3 fingerprint databases from the Fingerprint Verification Competition show their relative efficiency in terms of performance and computation time.

  20. Capturing the vital vascular fingerprint with optical coherence tomography.

    PubMed

    Liu, Gangjun; Chen, Zhongping

    2013-08-01

    Using fingerprints as a method to identify an individual has been accepted in forensics since the nineteenth century, and the fingerprint has become one of the most widely used biometric characteristics. Most of the modern fingerprint recognition systems are based on the print pattern of the finger surface and are not robust against spoof attaching. We demonstrate a novel vital vascular fingerprint system using Doppler optical coherence tomography that provides highly sensitive and reliable personal identification. Because the system is based on blood flow, which only exists in a livng person, the technique is robust against spoof attaching.

  1. Development of latent fingerprint by ZnO deposition.

    PubMed

    Yu, I-Heng; Jou, Shyankay; Chen, Chin-Min; Wang, Kuang-Chuan; Pang, Lei-Jang; Liao, Jeh Shane

    2011-04-15

    Vacuum metal deposition (VMD) utilizing sequential Au and Zn depositions has been an effective technique to develop latent fingerprint on plastic surfaces. A simplified vacuum deposition process was conducted to develop fingerprint in this study. While pure ZnO was thermally evaporated in a vacuum system, ZnO could condense on polyethylene terephthalate (PET) surface. Direct deposition of ZnO, without applying Au seeding, yielded normal development of latent fingerprint. The development of aged fingerprint by ZnO deposition was more effective than that by Au/Zn VMD.

  2. Retrieval of noisy fingerprint patterns using metric attractor networks.

    PubMed

    González, Mario; Dominguez, David; Rodríguez, Francisco B; Sánchez, Ángel

    2014-11-01

    This work experimentally analyzes the learning and retrieval capabilities of the diluted metric attractor neural network when applied to collections of fingerprint images. The computational cost of the network decreases with the dilution, so we can increase the region of interest to cover almost the complete fingerprint. The network retrieval was successfully tested for different noisy configurations of the fingerprints, and proved to be robust with a large basin of attraction. We showed that network topologies with a 2D-Grid arrangement adapt better to the fingerprints spatial structure, outperforming the typical 1D-Ring configuration. An optimal ratio of local connections to random shortcuts that better represent the intrinsic spatial structure of the fingerprints was found, and its influence on the retrieval quality was characterized in a phase diagram. Since the present model is a set of nonlinear equations, it is possible to go beyond the naïve static solution (consisting in matching two fingerprints using a fixed distance threshold value), and a crossing evolution of similarities was shown, leading to the retrieval of the right fingerprint from an apparently more distant candidate. This feature could be very useful for fingerprint verification to discriminate between fingerprints pairs.

  3. Mated Fingerprint Card Pairs (Volumes 1-5)

    National Institute of Standards and Technology Data Gateway

    NIST Mated Fingerprint Card Pairs (Volumes 1-5) (PC database for purchase)   The NIST database of mated fingerprint card pairs (Special Database 9) consists of multiple volumes. Currently five volumes have been released. Each volume will be a 3-disk set with each CD-ROM containing 90 mated card pairs of segmented 8-bit gray scale fingerprint images (900 fingerprint image pairs per CD-ROM). A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  4. Plain and Rolled Images from Paired Fingerprint Cards

    National Institute of Standards and Technology Data Gateway

    NIST Plain and Rolled Images from Paired Fingerprint Cards (PC database for purchase)   NIST Special Database 29 is being distributed for use in development and testing fingerprint matching systems. The data consist of 216 ten-print fingerprint card pairs with both the rolled and plains (from a bottom of the fingerprint card) scanned at 19.7 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  5. Supplemental Fingerprint Card Data (SFCD) for NIST Special Database 9

    National Institute of Standards and Technology Data Gateway

    Supplemental Fingerprint Card Data (SFCD) for NIST Special Database 9 (PC database for purchase)   NIST Special Database 10 (Supplemental Fingerprint Card Data for Special Database 9 - 8-Bit Gray Scale Images) provides a larger sample of fingerprint patterns that have a low natural frequency of occurrence and transitional fingerprint classes in NIST Special Database 9. The software is the same code used with NIST Special Database 4 and 9. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.

  6. Recovery of latent fingerprints and DNA on human skin.

    PubMed

    Färber, Doris; Seul, Andrea; Weisser, Hans-Joachim; Bohnert, Michael

    2010-11-01

    The project "Latent Fingerprints and DNA on Human Skin" was the first systematic research in Europe dealing with detection of fingerprints and DNA left by offenders on the skin of corpses. One thousand samples gave results that allow general statements on the materials and methods used. The tests were carried out according to a uniform trial structure. Fingerprints were deposited by natural donors on corpses. The latent fingerprints were treated with magnetic powder or black fingerprint powder. Afterward, they were lifted with silicone casting material (Isomark(®)) or gelatine foil. All lifts were swabbed to recover DNA. It was possible to visualize comparable and identifiable fingerprints on the skin of corpses (16%). In the same categories, magnetic powder (18.4%) yielded better results than black fingerprint powder (13.6%). The number of comparable and identifiable fingerprints decreased on the lifts (12.7%). Isomark(®) (14.9%) was the better lifting material in comparison with gelatine foil (10.1%). In one-third of the samples, DNA could be extracted from the powdered and lifted latents. Black fingerprint powder delivered the better result with a rate of 2.2% for full DNA profiles and profiles useful for exclusion in comparison with 1.8% for the magnetic powder traces. Isomark(®) (3.1%) yielded better results than gelatine foil (0.6%).

  7. Capacity and optimal collusion attack channels for Gaussian fingerprinting games

    NASA Astrophysics Data System (ADS)

    Wang, Ying; Moulin, Pierre

    2007-02-01

    In content fingerprinting, the same media covertext - image, video, audio, or text - is distributed to many users. A fingerprint, a mark unique to each user, is embedded into each copy of the distributed covertext. In a collusion attack, two or more users may combine their copies in an attempt to "remove" their fingerprints and forge a pirated copy. To trace the forgery back to members of the coalition, we need fingerprinting codes that can reliably identify the fingerprints of those members. Researchers have been focusing on designing or testing fingerprints for Gaussian host signals and the mean square error (MSE) distortion under some classes of collusion attacks, in terms of the detector's error probability in detecting collusion members. For example, under the assumptions of Gaussian fingerprints and Gaussian attacks (the fingerprinted signals are averaged and then the result is passed through a Gaussian test channel), Moulin and Briassouli1 derived optimal strategies in a game-theoretic framework that uses the detector's error probability as the performance measure for a binary decision problem (whether a user participates in the collusion attack or not); Stone2 and Zhao et al. 3 studied average and other non-linear collusion attacks for Gaussian-like fingerprints; Wang et al. 4 stated that the average collusion attack is the most efficient one for orthogonal fingerprints; Kiyavash and Moulin 5 derived a mathematical proof of the optimality of the average collusion attack under some assumptions. In this paper, we also consider Gaussian cover signals, the MSE distortion, and memoryless collusion attacks. We do not make any assumption about the fingerprinting codes used other than an embedding distortion constraint. Also, our only assumptions about the attack channel are an expected distortion constraint, a memoryless constraint, and a fairness constraint. That is, the colluders are allowed to use any arbitrary nonlinear strategy subject to the above

  8. Variation in amino acid and lipid composition of latent fingerprints.

    PubMed

    Croxton, Ruth S; Baron, Mark G; Butler, David; Kent, Terry; Sears, Vaughn G

    2010-06-15

    The enhancement of latent fingerprints, both at the crime scene and in the laboratory using an array of chemical, physical and optical techniques, permits their use for identification. Despite the plethora of techniques available, there are occasions when latent fingerprints are not successfully enhanced. An understanding of latent fingerprint chemistry and behaviour will aid the improvement of current techniques and the development of novel ones. In this study the amino acid and fatty acid content of 'real' latent fingerprints collected on a non-porous surface was analysed by gas chromatography-mass spectrometry. Squalene was also quantified in addition. Hexadecanoic acid, octadecanoic acid and cis-9-octadecenoic acid were the most abundant fatty acids in all samples. There was, however, wide variation in the relative amounts of each fatty acid in each sample. It was clearly demonstrated that touching sebum-rich areas of the face immediately prior to fingerprint deposition resulted in a significant increase in the amount of fatty acids and squalene deposited in the resulting 'groomed' fingerprints. Serine was the most abundant amino acid identified followed by glycine, alanine and aspartic acid. The significant quantitative differences between the 'natural' and 'groomed' fingerprint samples seen for fatty acids were not observed in the case of the amino acids. This study demonstrates the variation in latent fingerprint composition between individuals and the impact of the sampling protocol on the quantitative analysis of fingerprints.

  9. Increased risk of phosphorus limitation at higher temperatures for Daphnia magna.

    PubMed

    Persson, Jonas; Wojewodzic, Marcin Włodzimierz; Hessen, Dag Olav; Andersen, Tom

    2011-01-01

    Invertebrate herbivores frequently face growth rate constraints due to their high demands for phosphorus (P) and nitrogen (N). Temperature is a key modulator of growth rate, yet the interaction between temperature and P limitation on somatic growth rate is scarcely known. To investigate this interaction, we conducted a study on the somatic growth rate (SGR) of the cladoceran Daphnia magna, known to be susceptible to P-limitation. We determined the SGR across a broad range of dietary P content of algae (carbon (C):P ratios (125-790), and at different temperatures (10-25°C). There was a strong impact of both temperature and C:P ratio on the SGR of D. magna, and also a significant interaction between both factors was revealed. The negative effect of dietary C:P on growth rate was reduced with decreased temperature. We found no evidence of P limitation at lowest temperature, suggesting that enzyme kinetics or other measures of food quality overrides the demands for P to RNA and protein synthesis at low temperatures. These findings also indicate an increased risk of P limitation and thus reduced growth efficiency at high temperatures.

  10. Multigenerational effect of perfluorooctane sulfonate (PFOS) on the individual fitness and population growth of Daphnia magna.

    PubMed

    Jeong, Tae-Yong; Yuk, Min-Su; Jeon, Junho; Kim, Sang Don

    2016-11-01

    We investigated the multigenerational effect of PFOS to individual fitness (e.g., body weight, acetylcholinesterase and glutathione S-transferase) and population growth (e.g., offspring number and time to first brood) of Daphnia magna during continuous and discontinuous exposures. The intrinsic rate of population growth was also calculated. In the continuous exposure, population growth-related adverse effects were detected during all test periods, and the adverse effect tended to be weaker in later generations. On the other hand, individual fitness-related adverse effects were observed from F1 not in F0 and deteriorated as the generation number increased. These results imply that individual fitness worsens although the population growth is restored in later generations. Upon discontinuous exposure, a few but significant adverse effects were observed during the non-exposure period and highest effects were detected during the re-exposure period. This encourages the study of different exposure scenarios, which may result in unexpected and higher PFOS toxicity. Consequently, this study confirms adverse effects of PFOS to Daphnia magna in multigenerational period and supports reasons for studies linking individual fitness changes to population dynamics and covering diverse exposure scenarios to evaluate the risk of PFOS in a water environment.

  11. Silver nanoparticles and silver nitrate induce high toxicity to Pseudokirchneriella subcapitata, Daphnia magna and Danio rerio.

    PubMed

    Ribeiro, Fabianne; Gallego-Urrea, Julián Alberto; Jurkschat, Kerstin; Crossley, Alison; Hassellöv, Martin; Taylor, Cameron; Soares, Amadeu M V M; Loureiro, Susana

    2014-01-01

    Silver nanoparticles (AgNP) have gained attention over the years due to the antimicrobial function of silver, which has been exploited industrially to produce consumer goods that vary in type and application. Undoubtedly the increase of production and consumption of these silver-containing products will lead to the entry of silver compounds into the environment. In this study we have used Pseudokirchneriella subcapitata, Daphnia magna and Danio rerio as model organisms to investigate the toxicity of AgNP and AgNO₃ by assessing different biological endpoints and exposure periods. Organisms were exposed following specific and standardized protocols for each species/endpoints, with modifications when necessary. AgNP were characterized in each test-media by Transmission Electron Microscopy (TEM) and experiments were performed by Dynamic Light Scattering (DLS) to investigate the aggregation and agglomeration behavior of AgNP under different media chemical composition and test-period. TEM images of AgNP in the different test-media showed dissimilar patterns of agglomeration, with some agglomerates inside an organic layer, some loosely associated particles and also the presence of some individual particles. The toxicity of both AgNO₃ and AgNP differ significantly based on the test species: we found no differences in toxicity for algae, a small difference for zebrafish and a major difference in toxicity for Daphnia magna.

  12. Acute to chronic estimation of Daphnia magna toxicity within the QSAAR framework.

    PubMed

    Furuhama, A; Hayashi, T I; Tatarazako, N

    2016-10-21

    We constructed models for acute to chronic estimation of the Daphnia magna reproductive toxicities of chemical substances from their Daphnia magna acute immobilization toxicities. The models combined the acute toxicities with structural and physicochemical descriptors. We used multiregression analysis and selected the descriptors for the models by means of a genetic algorithm. Of the best 100 models (as indicated by the lack of fit score), 90% included the following descriptors: acute toxicity (i.e. an activity parameter), distribution coefficient (log D) and structural indicator variables that indicate the presence of -NH2 attached to aromatic carbon and the presence of a chlorine atom. We compared the predictive abilities of five of these quantitative structure-activity-activity relationship (QSAAR) acute to chronic estimation models with the predictive ability of a simple linear regression model. The comparison revealed that inclusion of structural and physicochemical descriptors such as those in QSAAR models can improve models for extrapolation from acute to chronic toxicity. Our results also provide a QSAAR framework that is expected to be useful for the further development of chronic toxicity estimation models.

  13. Effect of carbaryl (carbamate insecticide) on acetylcholinesterase activity of two strains of Daphnia magna (Crustacea, Cladocera).

    PubMed

    Toumi, Hela; Bejaoui, Mustapha; Touaylia, Samir; Burga Perez, Karen F; Ferard, Jean François

    2016-11-01

    The present study was designed to investigate the effect of carbaryl (carbamate insecticide) on the acetylcholinesterase activity in two strains (same clone A) of the crustacean cladoceran Daphnia magna. Four carbaryl concentrations (0.4, 0.9, 1.8 and 3.7 µg L(-1)) were compared against control AChE activity. Our results showed that after 48 h of carbaryl exposure, all treatments induced a significant decrease of AChE activities whatever the two considered strains. However, different responses were registered in terms of lowest observed effect concentrations (LOEC: 0.4 µg L(-1) for strain 1 and 0.9 µg L(-1) for strains 2) revealing differences in sensitivity among the two tested strains of D. magna. These results suggest that after carbaryl exposure, the AChE activity responses can be also used as a biomarker of susceptibility. Moreover, our results show that strain1 is less sensitive than strain 2 in terms of IC50-48 h of AChE activity. Comparing the EC50-48 h of standard ecotoxicity test and IC50-48 h of AChE inhibition, there is the same order of sensitivity with both strains.

  14. Predicting the toxicity of permethrin to Daphnia magna in water using SPME fibers.

    PubMed

    Harwood, Amanda D; Bunch, Aubrey R; Flickinger, Dallas L; You, Jing; Lydy, Michael J

    2012-04-01

    Multiple factors can influence bioavailability, which can make predictions of toxicity in natural systems difficult. The current study examined the potential use of solid-phase microextraction fibers as a matrix-independent approach to predict the toxicity of permethrin to Daphnia magna across various water sources, including a laboratory reconstituted water, two natural waters, and a modified natural water. Water source strongly affected the toxicity of permethrin as well as the concentration-response relationships. Although permethrin concentrations in the water were predictive of toxicity to D. magna for individual water sources, there was no relationship between permethrin concentrations among water sources and mortality. This indicated that compositional differences among water sources can greatly influence toxicity, suggesting that benchmarks established using reconstituted water may be overly conservative for some natural waters. In addition, although permethrin tissue residues were predictive of mortality for individual waters, the correlation among waters was not as clear. Finally, both 48-h and equilibrium-based SPME fiber concentrations adequately predicted toxicity independent of water properties. This demonstrated that bioavailability-based estimates provided a more accurate prediction of toxicity than water concentrations and that SPME fibers could be used in environmental monitoring as a rapid and accurate means of predicting toxicity in natural waters.

  15. The effect of temperature on the sensitivity of Daphnia magna to cyanobacteria is genus dependent.

    PubMed

    Hochmuth, Jennifer D; De Schamphelaere, Karel A C

    2014-10-01

    In the present study, the authors investigated the effects of 6 different genera of cyanobacteria on multiple endpoints of Daphnia magna in a 21-d life table experiment conducted at 3 different temperatures (15 °C, 19 °C, and 23 °C). The specific aims were to test if the effect of temperature on Daphnia's sensitivity to cyanobacteria differed among different cyanobacteria and if the rank order from most to least harmful cyanobacteria to Daphnia reproduction changed or remained the same across the studied temperature range. Overall, the authors observed a decrease in harmful effects on reproduction with increasing temperature for Microcystis, Nodularia, and Aphanizomenon, and an increase in harmful effects with increasing temperature for Anabaena and Oscillatoria. No effect of temperature was observed on Daphnia sensitivity to Cylindrospermopsis. Harmful effects of Microcystis and Nodularia on reproduction appear to be mirrored by a decrease in length. On the other hand, harmful effects of Anabaena, Aphanizomenon, and Oscillatoria on reproduction were correlated with a decrease in intrinsic rate of natural increase, which was matched by a later onset of reproduction in exposures to Oscillatoria. In addition, the results suggest that the cyanobacteria rank order of harmfulness may change with temperature. Higher temperatures may increase the sensitivity of D. magna to the presence of some cyanobacteria (Anabaena and Oscillatoria) in their diet, whereas the harmful effects of others (Microcystis, Nodularia, and Aphanizomenon) may be reduced by higher temperatures.

  16. Symbiotic bacteria contribute to increasing the population size of a freshwater crustacean, Daphnia magna.

    PubMed

    Peerakietkhajorn, Saranya; Tsukada, Koji; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2015-04-01

    The filter-feeding crustacean Daphnia is a key organism in freshwater ecosystems. Here, we report the effect of symbiotic bacteria on ecologically important life history traits, such as population dynamics and longevity, in Daphnia magna. By disinfection of the daphniid embryos with glutaraldehyde, aposymbiotic daphniids were prepared and cultured under bacteria-free conditions. Removal of bacteria from the daphniids was monitored by quantitative polymerase chain reaction for bacterial 16S rRNA gene. The population of aposymbiotic daphniids was reduced 10-folds compared with that of the control daphniids. Importantly, re-infection with symbiotic bacteria caused daphniids to regain bacteria and increase their fecundity to the level of the control daphniids, suggesting that symbiotic bacteria regulate Daphnia fecundity. To identify the species of symbiotic bacteria, 16S rRNA genes of bacteria in daphniids were sequenced. This revealed that 50% of sequences belonged to the Limnohabitans sp. of the Betaproteobacteria class and that the diversity of bacterial taxa was relatively low. These results suggested that symbiotic bacteria have a beneficial effect on D. magna, and that aposymbiotic Daphnia are useful tools in understanding the role of symbiotic bacteria in the environmental responses and evolution of their hosts.

  17. Rapid evolution of antioxidant defence in a natural population of Daphnia magna.

    PubMed

    Oexle, S; Jansen, M; Pauwels, K; Sommaruga, R; De Meester, L; Stoks, R

    2016-07-01

    Natural populations can cope with rapid changes in stressors by relying on sets of physiological defence mechanisms. Little is known onto what extent these physiological responses reflect plasticity and/or genetic adaptation, evolve in the same direction and result in an increased defence ability. Using resurrection ecology, we studied how a natural Daphnia magna population adjusted its antioxidant defence to ultraviolet radiation (UVR) during a period with increasing incident UVR reaching the water surface. We demonstrate a rapid evolution of the induction patterns of key antioxidant enzymes under UVR exposure in the laboratory. Notably, evolutionary changes strongly differed among enzymes and mainly involved the evolution of UV-induced plasticity. Whereas D. magna evolved a strong plastic up-regulation of glutathione peroxidase under UVR, it evolved a lower plastic up-regulation of glutathione S-transferase and superoxide dismutase and a plastic down-regulation of catalase. The differentially evolved antioxidant strategies were collectively equally effective in dealing with oxidative stress because they resulted in the same high levels of oxidative damage (to lipids, proteins and DNA) and lowered fitness (intrinsic growth rate) under UVR exposure. The lack of better protection against UVR may suggest that the UVR exposure did not increase between both periods. Predator-induced evolution to migrate to lower depths that occurred during the same period may have contributed to the evolved defence strategy. Our results highlight the need for a multiple trait approach when focusing on the evolution of defence mechanisms.

  18. Aquatic toxicity of nitrogen mustard to Ceriodaphina dubia, Daphnia magna, and Pimephales promelas.

    PubMed

    Lan, Cheng-Hang; Lin, Tser-Sheng; Peng, Chiung-Yu

    2005-06-01

    Investigation of toxicity of mustard compounds to aquatic organisms has been limited although their effects on terrestrial mammal species have been well studied. In this study, the 48-h LC50 values of nitrogen mustard (HN2) are reported for two aquatic invertebrate species (Daphnia magna and Ceriodaphnia dubia) and for one fish species (Pimephales promelas). Mean LC50 values to C. dubia, D. magna, and P. promela were 1.12, 2.52, and 98.86 mg/L, respectively. C. dubia was the species most sensitive to HN2. Seven-day lethal and sublethal tests with P. promelas and C. dubia were also conducted. In chronic tests, fathead minnow growth was significantly reduced by 2.50 mg/L HN2, while C. dubia reproduction was significantly affected by 7.81 mug/L HN2. These adverse effects on aquatic organisms caused by lower-level concentrations of HN2 indicate that a possible aquatic ecosystem disaster could occur either after a chemical spill or during chemical warfare.

  19. Surface binding of contaminants by algae: Consequences for lethal toxicity and feeding to Daphnia magna straus

    SciTech Connect

    Taylor, G. |; Baird, D.J.; Soares, A.M.V.M.

    1998-03-01

    Freshwater algae, as with all suspended particulate matter in the water column, exhibit a net negative charge resulting in an affinity for positively charged species, such as toxic metal cations, which will readily adsorb to algal cell surfaces. In this study, the adsorption of a representative toxic metal cadmium cation (Cd{sup 2+}) to a freshwater algal species, Chlorella vulgaris, was investigated using environmentally realistic concentrations of both. A further study of the effects of this particulate adsorption of Cd{sup 2+} on lethal toxicity and feeding in Daphnia magna was conducted. Two apparently contrasting effects were observed. For the D. magna feeding study, cell ingestion was inhibited, leading to reduced growth and reproduction. Experiments comparing the effect of algal-bound cadmium and dissolved forms of cadmium demonstrate that this inhibition is almost entirely due to the surface-bound fraction of ions. However, at concentrations of dissolved cadmium that are lethal to Daphnia, algal cells were found to reduce toxicity. Such findings indicate the importance of food ration in laboratory-based toxicity tests as well as the difficulty in predicting the environmental fate and effect of contaminants using such tests.

  20. Small RNA Sequencing Based Identification of MiRNAs in Daphnia magna.

    PubMed

    Ünlü, Ercan Selçuk; Gordon, Donna M; Telli, Murat

    2015-01-01

    Small RNA molecules are short, non-coding RNAs identified for their crucial role in post-transcriptional regulation. A well-studied example includes miRNAs (microRNAs) which have been identified in several model organisms including the freshwater flea and planktonic crustacean Daphnia. A model for epigenetic-based studies with an available genome database, the identification of miRNAs and their potential role in regulating Daphnia gene expression has only recently garnered interest. Computational-based work using Daphnia pulex, has indicated the existence of 45 miRNAs, 14 of which have been experimentally verified. To extend this study, we took a sequencing approach towards identifying miRNAs present in a small RNA library isolated from Daphnia magna. Using Perl codes designed for comparative genomic analysis, 815,699 reads were obtained from 4 million raw reads and run against a database file of known miRNA sequences. Using this approach, we have identified 205 putative mature miRNA sequences belonging to 188 distinct miRNA families. Data from this study provides critical information necessary to begin an investigation into a role for these transcripts in the epigenetic regulation of Daphnia magna.