New class of compounds have very low vapor pressures

NASA Technical Reports Server (NTRS)

Angell, C. A.; Gruen, D. M.

1967-01-01

Magnesium hexahydrate tetrachlorometallates are 50-volume-percent water, have a high melting point and possess a low vapor pressure. These new compounds are relatively noncorrosive, thermally stable, and water soluble but not hygroscopic. They may have potential applications as cooling fluids.

Characterization of sonicated natural zeolite/ferric chloride hexahydrate by infrared spectroscopy

NASA Astrophysics Data System (ADS)

Prasetyo, T. A. B.; Soegijono, B.

2018-03-01

The characteristics of sonicated Bayah natural zeolite with and without ferric chloride hexahydrate solution using infrared method has been studied. High intensity ultrasonic waves were exposed to the samples for 40 min, 80 min and 120 min. Infra red spectra analysis was conducted to evaluate zeolite vibrational spectrum contributions, namely, the vibrations from the framework of the zeolite, from the charge-balancing cations, and from the relatively isolated groups, such as the surface OH groups and their behavior after sonication process. An addition of FeCl3.6H2O and sonication process on natural zeolite improved secondary building units link by forming oxygen bridges and also close relationship with duration of applied high intensity ultrasonic process. Longer ultrasonic process resulted in more increment of O-H absorbance.

21 CFR 184.1426 - Magnesium chloride.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Magnesium chloride. 184.1426 Section 184.1426 Food... Specific Substances Affirmed as GRAS § 184.1426 Magnesium chloride. (a) Magnesium chloride (MgC12·6H2O, CAS... mineral bischofite. It is prepared by dissolving magnesium oxide, hydroxide, or carbonate in aqueous...

21 CFR 184.1426 - Magnesium chloride.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Magnesium chloride. 184.1426 Section 184.1426 Food... Specific Substances Affirmed as GRAS § 184.1426 Magnesium chloride. (a) Magnesium chloride (MgC12·6H2O, CAS... mineral bischofite. It is prepared by dissolving magnesium oxide, hydroxide, or carbonate in aqueous...

21 CFR 184.1426 - Magnesium chloride.

Code of Federal Regulations, 2011 CFR

2011-04-01

... mineral bischofite. It is prepared by dissolving magnesium oxide, hydroxide, or carbonate in aqueous... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Magnesium chloride. 184.1426 Section 184.1426 Food... Specific Substances Affirmed as GRAS § 184.1426 Magnesium chloride. (a) Magnesium chloride (MgC12·6H2O, CAS...

21 CFR 184.1426 - Magnesium chloride.

Code of Federal Regulations, 2010 CFR

2010-04-01

... mineral bischofite. It is prepared by dissolving magnesium oxide, hydroxide, or carbonate in aqueous... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Magnesium chloride. 184.1426 Section 184.1426 Food... Specific Substances Affirmed as GRAS § 184.1426 Magnesium chloride. (a) Magnesium chloride (MgC12·6H2O, CAS...

Making MgO/SiO2 Glasses By The Sol-Gel Process

NASA Technical Reports Server (NTRS)

Bansal, Narottam P.

1989-01-01

Silicon dioxide glasses containing 15 mole percent magnesium oxide prepared by sol-gel process. Not made by conventional melting because ingredients immiscible liquids. Synthesis of MgO/SiO2 glass starts with mixing of magnesium nitrate hexahydrate with silicon tetraethoxide, both in alcohol. Water added, and transparent gel forms. Subsequent processing converts gel into glass. Besides producing glasses of new composition at lower processing temperatures, sol-gel method leads to improved homogeneity and higher purity.

21 CFR 184.1426 - Magnesium chloride.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Magnesium chloride. 184.1426 Section 184.1426 Food... GRAS § 184.1426 Magnesium chloride. (a) Magnesium chloride (MgC12·6H2O, CAS Reg. No. 7786-30-3) is a... prepared by dissolving magnesium oxide, hydroxide, or carbonate in aqueous hydrochloric acid solution and...

Efficacy of magnesium chloride in the treatment of Hailey-Hailey disease: from serendipity to evidence of its effect on intracellular Ca(2+) homeostasis.

PubMed

Borghi, Alessandro; Rimessi, Alessandro; Minghetti, Sara; Corazza, Monica; Pinton, Paolo; Virgili, Annarosa

2015-01-01

Hailey-Hailey disease (HHD), also known as familial benign chronic pemphigus, is a rare autosomal dominant inherited intraepidermal blistering genodermatosis. Mutations in the ATP2C1 gene encoding for the Golgi secretory pathway Ca(2+) /Mn(2+) -ATPasi protein 1 (SPCA1) affect the processing of desmosomal components and the epidermal suprabasal cell-cell adhesion by deregulating the keratinocyte cytosolic Ca(2+) concentration. We report the unexpected, dramatic, and persistent clinical improvement of the skin lesions of a patient affected with longstanding HHD with daily intake of a solution containing magnesium chloride hexahydrate (MgCl2 ). We investigated the effect of MgCl2 on the intracellular Ca(2+) homeostasis and on the activity of particular Ca(2+) -effectors in HeLa cells transfected with chimeric aequorins (cytAEQ, mtAEQ, erAEQ and GoAEQ) targeted to different subcellular compartments (cytosol, mitochondria, endoplasmic reticulum, and Golgi, respectively). Experimental investigations on HeLa cells showed the effect of MgCl2 on the function of Ca(2+) -extrusor systems, resulting in increased cytosolic and mitochondrial Ca(2+) levels, without altering the mechanisms of intraluminal Ca(2+) -filling and Ca(2+) -release of stores. Based on our clinical observation and experimental results, it can be hypothesized that MgCl2 could act as an inhibitor of the Ca(2+) -extruding activity in keratinocytes favoring intracellular Ca(2+) -disponibility and Ca(2+) -dependent mechanisms in desmosome assembly. This may represent the molecular basis of the good response of the HHD clinical features with MgCl2 solution in the patient described. © 2014 The International Society of Dermatology.

Sol-gel synthesis of magnesium oxide-silicon dioxide glass compositions

NASA Technical Reports Server (NTRS)

Bansal, Narottam P.

1988-01-01

MgO-SiO2 glasses containing up to 15 mol pct MgO, which could not have been prepared by the conventional glass melting method due to the presence of stable liquid-liquid immiscibility, were synthesized by the sol-gel technique. Clear and transparent gels were obtained from the hydrolysis and polycondensation of silicon tetraethoxide (TEOS) and magnesium nitrate hexahydrate when the water/TEOS mole ratio was four or more. The gelling time decreased with increase in magnesium content, water/TEOS ratio, and reaction temperature. Magnesium nitrate hexahydrate crystallized out of the gels containing 15 and 20 mol pct MgO on slow drying. This problem was partially alleviated by drying the gels quickly at higher temperatures. Monolithic gel samples were prepared using glycerol as the drying control additive. The gels were subjected to various thermal treatments and characterized by several methods. No organic groups could be detected in the glasses after heat treatments to approx. 800 C, but trace amounts of hydroxyl groups were still present. No crystalline phase was found from X-ray diffraction in the gel samples to approx. 890 C. At higher temperatures, alpha quartz precipitated out as the crystalline phase in gels containing up to 10 mol pct MgO. The overall activation energy for gel formation in 10MgO-90SiO2 (mol pct) system for water/TEOS mole ratio of 7.5 was calculated to be 58.7 kJ/mol.

EPR and optical studies of Cu2+ ions doped in magnesium potassium phosphate hexahydrate single crystals

NASA Astrophysics Data System (ADS)

Kripal, Ram; Shukla, Santwana

2011-03-01

An electron paramagnetic resonance (EPR) study of Cu2+-doped magnesium potassium phosphate is performed at liquid nitrogen temperature (LNT; 77 K). Two magnetically non-equivalent sites for Cu2+ are observed. The spin Hamiltonian parameters are determined with the fitting of spectra to a rhombic symmetry crystalline field. The ground state wavefunction is also determined. The g-anisotropy is evaluated and compared with the experimental value. With the help of an optical study, the nature of the bonding in the complex is discussed.

Concentration determination of methyl magnesium chloride and other Grignard reagents by potentiometric titration with in-line characterization of reaction species by FTIR spectroscopy.

PubMed

Chen, Yadan; Wang, Tao; Helmy, Roy; Zhou, George X; LoBrutto, Rosario

2002-07-01

A potentiometric titration method for methyl magnesium chloride and other Grignard reagents based on the reaction with 2-butanol in THF has been developed and validated. The method employs a commercially available platinum electrode, using an electrolyte compatible with non-aqueous solvents. Well-defined titration curves were obtained, along with excellent method precision. The endpoint was precisely determined based on the first derivative of the titration curve. Different solvents such as THF, diethyl ether and methylene chloride provided similar results with regard to sharpness of the endpoint and method precision. The method was applied to a wide array of Grignard reagents including methyl magnesium bromide, ethyl magnesium chloride, propyl magnesium chloride, vinyl magnesium chloride, phenyl magnesium chloride, and benzyl magnesium chloride with similar precision and accuracy. Application of in-line FTIR was demonstrated for in situ monitoring of the titration reaction, allowing characterization of the reaction species. An authentic spectrum of the MeMgCl-THF complex was obtained using spectral subtraction and the vibrational absorbance bands were identified. FTIR also provided an alternative for detecting the titration endpoint, and the titration results so obtained, provided a cross-validation of the accuracy of the potentiometric titration.

Factors influencing the mechanism of surfactant catalyzed reaction of vitamin C-ferric chloride hexahydrate system

NASA Astrophysics Data System (ADS)

Farrukh, Muhammad Akhyar; Kauser, Robina; Adnan, Rohana

2013-09-01

The kinetics of vitamin C by ferric chloride hexahydrate has been investigated in the aqueous ethanol solution of basic surfactant viz. octadecylamine (ODA) under pseudo-first order conditions. The critical micelle concentration (CMC) of surfactant was determined by surface tension measurement. The effect of pH (2.5-4.5) and temperature (15-35°C) in the presence and absence of surfactant were investigated. Activation parameters, Δ E a, Δ H #, Δ S #, Δ G ≠, for the reaction were calculated by using Arrhenius and Eyring plot. Surface excess concentration (Γmax), minimum area per surfactant molecule ( A min), average area occupied by each molecule of surfactant ( a), surface pressure at the CMC (Πmax), Gibb's energy of micellization (Δ G M°), Gibb's energy of adsorption (Δ G ad°), were calculated. It was found that the reaction in the presence of surfactant showed faster oxidation rate than the aqueous ethanol solution. Reaction mechanism has been deduced in the presence and absence of surfactant.

Wound healing effect of bioactive ion released from Mg-smectite.

PubMed

Sasaki, Yu; Sathi, Gulsan Ara; Yamamoto, Osamu

2017-08-01

Bioactive ions like Mg 2+ and Si 4+ have been known as promotion factors of tissue regeneration. In the present work, Mg-smectite, consisting of Mg 2+ and Si 4+ ions, was synthesized by a solution process, and evaluated for the efficiency of the powder on wound healing in rats. White precipitates were obtained by mixing a magnesium chloride hexahydrate solution and a sodium silicate hexahydrate solution at room temperature. The precipitates mixed with a NaOH aqueous solution were subjected to hydrothermal reaction, and finally crystalline Mg-smectite powder was obtained. The crystal and molecular structure of Mg-smectite was identified by X-ray diffractometry (XRD) and Fourier-transform infrared spectroscopy (FT-IR). The synthesized material was determined to be crystalline Mg-smectite. The amount of Mg 2+ and Si 4+ ions released from Mg-smectite in physiological saline was analyzed by inductively coupled plasma mass spectroscopy (ICP-MS). The total amount of Si 4+ ion released from Mg-smectite was greater than that of Mg 2+ ion. To evaluate the wound healing effect of Mg-smectite, Mg-smectite powder was applied to a full-thickness surgical wound reaching the subcutaneous tissue in the rat's abdomen. At 1 and 2weeks, skin tissue was collected and subjected to histological analysis. The results for skin regeneration showed no significant difference in wound size between the control and Mg-smectite group. However, it was found that the neovascularization, collagen deposition, and maturation were notedly accelerated by applying Mg-smectite powder in comparison with the control. Mg-smectite can then be hypothesized to stimulate the regeneration of skin tissue by releasing Mg 2+ and Si 4+ ions. These results suggested that Mg-smectite could offer great potential as a wound dressing material. Copyright © 2017 Elsevier B.V. All rights reserved.

Sol-Gel synthesis of MgO-SiO2 glass compositions having stable liquid-liquid immiscibility

NASA Technical Reports Server (NTRS)

Bansal, Narottam P.

1987-01-01

MgO-SiO2 glasses containing up to 15 mol % MgO, which could not have been prepared by the conventional glass melting method due to the presence of stable liquid-liquid immiscibility, were synthesized by the sol-gel technique. Clear and transparent gels were obtained from the hydrolysis and polycondensation of silicon tetraethoxide (TEOS) and magnesium nitrate hexahydrate when the water/TEOS mole ratio was four or more. The gelling time decreased with increase in magnesium content, water/TEOS ratio, and reaction temperature. Magnesium nitrate hexahydrate crystallized out of the gels containing 15 and 20 mol % MgO on slow drying. This problem was partially alleviated by drying the gels quickly at higher temperatures. Monolithic gel samples were prepared using glycerol as the drying control additive. The gels were subjected to various thermal treatments and characterized by several methods. No organic groups could be detected in the glasses after heat treatments to approx. 800 C, but trace amounts of hydroxyl groups were still present. No crystalline phase was found from X-ray diffraction in the gel samples to approx. 890 C. At higher temperatures, alpha quartz precipitated out as the crystalline phase in gels containing up to 10 mol % MgO. The overall activation energy for gel formation in 10MgO-90SiO2 (mol %) system for water/TEOS mole ratio of 7.5 was calculated to be 58.7 kJ/mol.

PRODUCTION OF ACTINIDE METAL

DOEpatents

Knighton, J.B.

1963-11-01

A process of reducing actinide oxide to the metal with magnesium-zinc alloy in a flux of 5 mole% of magnesium fluoride and 95 mole% of magnesium chloride plus lithium, sodium, potassium, calcium, strontium, or barium chloride is presented. The flux contains at least 14 mole% of magnesium cation at 600-- 900 deg C in air. The formed magnesium-zinc-actinide alloy is separated from the magnesium-oxide-containing flux. (AEC)

Crystal Analysis of Multi Phase Calcium Phosphate Nanoparticles Containing Different amount of Magnesium

NASA Astrophysics Data System (ADS)

Gozalian, Afsaneh; Behnamghader, Ali Asghar; Moshkforoush, Arash

In this study, Mg doped hydroxyapatite [(Ca, Mg)10(PO4)6(OH)2] and β-tricalcium phosphate nanoparticles were synthesized via sol gel method. Triethyl phosphite, calcium nitrate tetrahydrate and magnesium nitrate hexahydrate were used as P, Ca and Mg precursors. The ratio of (Ca+Mg)/P and the amount of magnesium (x) were kept constant at 1.67 and ranging x = 0 up to 3 in molecular formula of Ca10-xMgx (PO4)6(OH)2, respectively. Phase composition and chemical structure were performed using X-ray Diffraction (XRD) and Fourier Transform Infrared Spectroscopy (FT-IR). Phase percentages, crystallite size, degree of crystallinity and lattice parameters were investigated. The presence of magnesium led to form the Mg doped tricalcium phosphate (β-TCMP) and Mg doped hydroxyapatite (Mg-HA). Based on the results of this study, lattice parameters, degree of crystallinity and crystallite size decreased with magnesium content. In addition, with increasing magnesium content, the amount of CaO phase decreased whereas the amount of MgO phase increased significantly. Obtained results can be used for new biomaterials design.

Vaginal Calculus in a Woman With Mixed Urinary Incontinence and Vaginal Mesh Exposure.

PubMed

Winkelman, William D; Rabban, Joseph T; Korn, Abner P

2016-01-01

Vaginal calculi are extremely rare and are most commonly encountered in the setting of an urethrovaginal or vesicovaginal fistula. We present a case of a 72-year-old woman with mixed urinary incontinence and vaginal mesh exposure incidentally found to have a large vaginal calculus. We removed the calculus surgically and analyzed the components. Results demonstrated the presence of ammonium-magnesium phosphate hexahydrate and carbonate apatite.

Degradation of magnesium and its alloys: dependence on the composition of the synthetic biological media.

PubMed

Mueller, Wolf-Dieter; de Mele, Monica Fernández Lorenzo; Nascimento, Maria Lucia; Zeddies, Miriam

2009-08-01

Magnesium and its alloys are highly degradable metals that are potentially useful as biomaterials, especially in orthopaedic and cardiovascular applications. However, the in vivo corrosion has proved to be too high. Because of the complexity of in vivo conditions, a careful study of the corrosion of magnesium in synthetic solutions that simulate the in vivo environment is necessary as a first approach to predict the actual in vivo situation. The aim of this work was to evaluate the influence of the electrolyte composition on the corrosion behavior of magnesium and two Mg-alloys in synthetic biological media. Pure magnesium and its alloys (AZ31 and LAE442) were employed in the experiments. Electrochemical potentiodynamic polarization curves were recorded in sodium chloride and PBS electrolytes with different chloride ion and albumin concentration. Optical and SEM observations complemented by EDX analysis were made. The results showed that magnesium corrosion is localized in chloride- and albumin-containing buffer solutions. They also showed that the chloride concentration and the presence of buffer and protein strongly affect the electrochemical behavior of magnesium and magnesium alloys.

Chemistry and Spectroscopy of Frozen Chloride Salts on Icy Bodies

NASA Astrophysics Data System (ADS)

Johnson, P. V.; Thomas, E. C.; Hodyss, R. P.; Vu, T. H.; Choukroun, M.

2016-12-01

Understanding the habitability of Europa's ocean is of great interest to astrobiology and is the focus of missions currently being considered to explore Europa. Currently, our best means of constraining the subsurface ocean composition and its subsequent habitability is by further study of Europa's surface chemical composition. Analysis of existing (and future) remote sensing data is limited by the availability of spectral libraries of candidate materials under relevant conditions (temperature, thermal/radiation history, etc.). Geochemical predictions of Europa's ocean composition suggest that chloride salts are likely to exist on the surface of Europa as well as other ocean worlds. We have conducted a study of frozen chloride-salt brines prepared at temperatures, pressures and radiation conditions (UV) in order to simulate conditions on the surface of Europa and other airless bodies. Hydration states of various chloride salts as a function of temperature were determined using Raman spectroscopy. Near IR reflectance spectra of identically prepared samples were measured to provide reference spectra of the identified hydrated salts. We find that the freezing of NaCl at temperatures ranging from 80 K to 233 K forms hydrohalite. In contrast, KCl hydrates are not formed from the freezing of KCl brines. In addition, a stable hexahydrate forms from the freezing of MgCl2 solutions, while a hexahydrate, a tetrahydrate, and a dihydrate, form upon freezing of CaCl2 solutions. Salts were observed to dehydrated with increasing temperatures, leading to a succession of hydration states in the case of CaCl2. Irradiation with vacuum ultraviolet light was observed to lead to dehydration as well.

Chemistry and Spectroscopy of Frozen Chloride Salts on Icy Bodies

NASA Astrophysics Data System (ADS)

Johnson, Paul; Thomas, Elena C.; Hodyss, Robert; Vu, Tuan; Choukroun, Mathieu

2016-10-01

Currently, our understanding of the chemical composition of Europa's surface is our best means of inferring constraints on the subsurface ocean composition and its subsequent habitability. The bulk of our knowledge of Europa surface chemistry can be traced to near infrared spectra recorded by the Near Infrared Mapping Spectrometer on the Galileo spacecraft. However, the usefulness of this and other remote sensing data is limited by the availability of spectral libraries of candidate materials under relevant conditions (temperature, thermal/radiation history, etc.). Chloride salts are expected to exist on the surface of Europa, and other icy bodies, based on geochemical predictions of the ocean composition. In order to help improve our understanding of Europa's surface composition, we have conducted a study of frozen chloride-salt brines prepared under simulated Europa surface conditions (vacuum, temperature, and UV irradiation) using both near IR and Raman spectroscopies. Specifically, Raman spectroscopy was used to determine the hydration states of various chloride salts as a function of temperature. Near IR spectroscopy of identically prepared samples was used to provide reference reflectance spectra of the identified hydrated salts. Our results indicate that at temperatures ranging from 80 K to 233 K, hydrohalite is formed from the freezing of NaCl brines, while the freezing of KCl solutions does not form KCl hydrates. In addition, the freezing of MgCl2 solutions forms a stable hexahydrate, and the freezing of CaCl2 solutions forms a hexahydrate, a tetrahydrate, and a dihydrate. Dehydration of the salts was observed as temperatures were increased, leading to a succession of hydration states in the case of CaCl2.

Hydration energies and structures of alkaline earth metal ions, M2+(H2O)n, n = 5-7, M = Mg, Ca, Sr, and Ba.

PubMed

Rodriguez-Cruz, S E; Jockusch, R A; Williams, E R

1999-09-29

The evaporation of water from hydrated alkaline earth metal ions, produced by electrospray ionization, was studied in a Fourier transform mass spectrometer. Zero-pressure-limit dissociation rate constants for loss of a single water molecule from the hydrated divalent metal ions, M(2+)(H(2)O)(n) (M = Mg, Ca, and Sr for n = 5-7, and M = Ba for n = 4-7), are measured as a function of temperature using blackbody infrared radiative dissociation. From these values, zero-pressure-limit Arrhenius parameters are obtained. By modeling the dissociation kinetics using a master equation formalism, threshold dissociation energies (E(o)) are determined. These reactions should have a negligible reverse activation barrier; therefore, E(o) values should be approximately equal to the binding energy or hydration enthalpy at 0 K. For the hepta- and hexahydrated ions at low temperature, binding energies follow the trend expected on the basis of ionic radii: Mg > Ca > Sr > Ba. For the hexahydrated ions at high temperature, binding energies follow the order Ca > Mg > Sr > Ba. The same order is observed for the pentahydrated ions. Collisional dissociation experiments on the tetrahydrated species result in relative dissociation rates that directly correlate with the size of the metals. These results indicate the presence of two isomers for hexahydrated magnesium ions: a low-temperature isomer in which the six water molecules are located in the first solvation shell, and a high-temperature isomer with the most likely structure corresponding to four water molecules in the inner shell and two water molecules in the second shell. These results also indicate that the pentahydrated magnesium ions have a structure with four water molecules in the first solvation shell and one in the outer shell. The dissociation kinetics for the hexa- and pentahydrated clusters of Ca(2+), Sr(2+), and Ba(2+) are consistent with structures in which all the water molecules are located in the first solvation shell.

40 CFR Table 3 to Subpart Ttttt of... - Initial Compliance With Emission Limits

Code of Federal Regulations, 2011 CFR

2011-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium...), did not exceed 200 lbs/hr. 2. Each magnesium chloride storage bin scrubber stack a. The average mass flow of hydrochloric acid from the control system applied to the magnesium chloride storage bins...

40 CFR Table 3 to Subpart Ttttt of... - Initial Compliance With Emission Limits

Code of Federal Regulations, 2010 CFR

2010-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium...), did not exceed 200 lbs/hr. 2. Each magnesium chloride storage bin scrubber stack a. The average mass flow of hydrochloric acid from the control system applied to the magnesium chloride storage bins...

40 CFR Table 3 to Subpart Ttttt of... - Initial Compliance With Emission Limits

Code of Federal Regulations, 2013 CFR

2013-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium...), did not exceed 200 lbs/hr. 2. Each magnesium chloride storage bin scrubber stack a. The average mass flow of hydrochloric acid from the control system applied to the magnesium chloride storage bins...

40 CFR Table 3 to Subpart Ttttt of... - Initial Compliance With Emission Limits

Code of Federal Regulations, 2012 CFR

2012-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium...), did not exceed 200 lbs/hr. 2. Each magnesium chloride storage bin scrubber stack a. The average mass flow of hydrochloric acid from the control system applied to the magnesium chloride storage bins...

Intradermal administration of magnesium sulphate and magnesium chloride produces hypesthesia to mechanical but hyperalgesia to heat stimuli in humans

PubMed Central

Ushida, Takahiro; Iwatsu, Osamu; Shimo, Kazuhiro; Tetsunaga, Tomoko; Ikeuchi, Masahiko; Ikemoto, Tatsunori; Arai, Young-Chang P; Suetomi, Katsutoshi; Nishihara, Makoto

2009-01-01

Background Although magnesium ions (Mg2+) are known to display many similar features to other 2+ charged cations, they seem to have quite an important and unique role in biological settings, such as NMDA blocking effect. However, the role of Mg2+ in the neural transmission system has not been studied as sufficiently as calcium ions (Ca2+). To clarify the sensory effects of Mg2+ in peripheral nervous systems, sensory changes after intradermal injection of Mg2+ were studied in humans. Methods Magnesium sulphate, magnesium chloride and saline were injected into the skin of the anterior region of forearms in healthy volunteers and injection-induced irritating pain ("irritating pain", for short), tactile sensation, tactile pressure thresholds, pinch-pain changes and intolerable heat pain thresholds of the lesion were monitored. Results Flare formation was observed immediately after magnesium sulphate or magnesium chloride injection. We found that intradermal injections of magnesium sulphate and magnesium chloride transiently caused irritating pain, hypesthesia to noxious and innocuous mechanical stimulations, whereas secondary hyperalgesia due to mechanical stimuli was not observed. In contrast to mechanical stimuli, intolerable heat pain-evoking temperature was significantly decreased at the injection site. In addition to these results, spontaneous pain was immediately attenuated by local cooling. Conclusion Membrane-stabilizing effect and peripheral NMDA-blocking effect possibly produced magnesium-induced mechanical hypesthesia, and extracellular cation-induced sensitization of TRPV1 channels was thought to be the primary mechanism of magnesium-induced heat hyperalgesia. PMID:19715604

PRODUCTION OF PLUTONIUM METAL

DOEpatents

Lyon, W.L.; Moore, R.H.

1961-01-17

A process is given for producing plutonium metal by the reduction of plutonium chloride, dissolved in alkali metal chloride plus or minus aluminum chloride, with magnesium or a magnesium-aluminum alloy at between 700 and 800 deg C and separating the plutonium or plutonium-aluminum alloy formed from the salt.

Forced-flow chromatographic determination of calcium and magnesium with continuous spectrophotometric detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arguello, M.D.

1977-12-01

Modifications to the forced-flow chromatograph include a flow-through pH monitor to continuously monitor the pH of the final effluent and an active low-pass filter to eliminate noise in the spectrophotometric detector. All separations are performed using partially sulfonated XAD-2 as the ion exchanger. Elution of calcium and magnesium is accomplished using ammonium chloride and ethylenediammonium chloride solutions. Calcium and magnesium are detected by means of Arsenazo I and PAR-ZnEDTA color-forming reagents. Other metal ions are detected by means of PAR and Chromazurol S color-forming reagents. Calcium and magnesium distribution coefficients on partially sulfonated XAD-2 as functions of ammonium chloride andmore » ethylenediammonium chloride concentration are given together with distribution coefficients of other metal ions. Methods for the selective elution of interfering metal ions prior to the elution of calcium and magnesium are described. Beryllium and aluminum are selectively eluted with sulfosalicylic acid. Those elements forming anionic chloride complexes are selectively eluted with HCl-acetone. Nickel is selectively eluted with HCl-acetone-dimethylglyoxime. Synthetic samples containing calcium and magnesium, both alone and in combination with alkali metals, strontium, barium, beryllium, aluminum, transition metals, and rare earths, are analyzed. Hard water samples are analyzed for calcium and magnesium and the results compared to those obtained by EDTA titration, atomic absorption spectroscopy, and plasma emission spectroscopy. Several clinical serum samples are analyzed for calcium and magnesium and the results compared to those obtained by atomic absorption spectroscopy.« less

ELECTRODEPOSITION OF NICKEL ON URANIUM

DOEpatents

Gray, A.G.

1958-08-26

A method is described for preparing uranium objects prior to nickel electroplating. The process consiats in treating the surface of the uranium with molten ferric chloride hexahydrate, at a slightiy elevated temperature. This treatment etches the metal surface providing a structure suitable for the application of adherent electrodeposits and at the same time plates the surface with a thin protective film of iron.

Solvation of magnesium dication: molecular dynamics simulation and vibrational spectroscopic study of magnesium chloride in aqueous solutions.

PubMed

Callahan, Karen M; Casillas-Ituarte, Nadia N; Roeselová, Martina; Allen, Heather C; Tobias, Douglas J

2010-04-22

Magnesium dication plays many significant roles in biochemistry. While it is available to the environment from both ocean waters and mineral salts on land, its roles in environmental and atmospheric chemistry are still relatively unknown. Several pieces of experimental evidence suggest that contact ion pairing may not exist at ambient conditions in solutions of magnesium chloride up to saturation concentrations. This is not typical of most ions. There has been disagreement in the molecular dynamics literature concerning the existence of ion pairing in magnesium chloride solutions. Using a force field developed during this study, we show that contact ion pairing is not energetically favorable. Additionally, we present a concentration-dependent Raman spectroscopic study of the Mg-O(water) hexaaquo stretch that clearly supports the absence of ion pairing in MgCl(2) solutions, although a transition occurring in the spectrum between 0.06x and 0.09x suggests a change in solution structure. Finally, we compare experimental and calculated observables to validate our force field as well as two other commonly used magnesium force fields, and in the process show that ion pairing of magnesium clearly is not observed at higher concentrations in aqueous solutions of magnesium chloride, independent of the choice of magnesium force field, although some force fields give better agreement to experimental results than others.

Electrolytic Deposition and Diffusion of Lithium onto Magnesium-9 Wt Pct Yttrium Bulk Alloy in Low-Temperature Molten Salt of Lithium Chloride and Potassium Chloride

NASA Astrophysics Data System (ADS)

Dong, Hanwu; Wu, Yaoming; Wang, Lidong; Wang, Limin

2009-10-01

The electrolytic deposition and diffusion of lithium onto bulk magnesium-9 wt pct yttrium alloy cathode in molten salt of 47 wt pct lithium chloride and 53 wt pct potassium chloride at 693 K were investigated. Results show that magnesium-yttrium-lithium ternary alloys are formed on the surface of the cathodes, and a penetration depth of 642 μm is acquired after 2 hours of electrolysis at the cathodic current density of 0.06 A·cm-2. The diffusion of lithium results in a great amount of precipitates in the lithium containing layer. These precipitates are the compound of Mg41Y5, which arrange along the grain boundaries and hinder the diffusion of lithium, and solid solution of yttrium in magnesium. The grain boundaries and the twins of the magnesium-9 wt pct yttrium substrate also have negative effects on the diffusion of lithium.

Influence of an Antiperspirant on Foot Blister Incidence during Cross-Country Hiking

DTIC Science & Technology

1999-11-01

blisters also increases. Therefore reducing Moisture may reduce blister incidence during physical activity. Objective: We examined whether an antiperspirant ...that used either an antiperspirant (20% aluminum chloride hexahydrate in anhydrous ethyl alcohol) or placebo (anhydrous ethyl alcohol) preparation...blisters before and after. Results: Because of dropouts, the final sample size was 667 cadets with 328 in the antiperspirant group and 339 in the

One-step electrodeposition process to fabricate corrosion-resistant superhydrophobic surface on magnesium alloy.

PubMed

Liu, Qin; Chen, Dexin; Kang, Zhixin

2015-01-28

A simple, one-step method has been developed to construct a superhydrophobic surface by electrodepositing Mg-Mn-Ce magnesium plate in an ethanol solution containing cerium nitrate hexahydrate and myristic acid. Scanning electron microscopy, energy-dispersive X-ray spectroscopy, X-ray photoelectron spectroscopy, and Fourier transform infrared spectroscopy were employed to characterize the surfaces. The shortest electrodeposition time to obtain a superhydrophobic surface was about 1 min, and the as-prepared superhydrophobic surfaces had a maximum contact angle of 159.8° and a sliding angle of less than 2°. Potentiodynamic polarization and electrochemical impedance spectroscopy measurements demonstrated that the superhydrophobic surface greatly improved the corrosion properties of magnesium alloy in 3.5 wt % aqueous solutions of NaCl, Na2SO4, NaClO3, and NaNO3. Besides, the chemical stability and mechanical durability of the as-prepared superhydrophobic surface were also examined. The presented method is rapid, low-cost, and environmentally friendly and thus should be of significant value for the industrial fabrication of anticorrosive superhydrophobic surfaces and should have a promising future in expanding the applications of magnesium alloys.

Effects of extracellular magnesium on the differentiation and function of human osteoclasts.

PubMed

Wu, Lili; Luthringer, Bérengère J C; Feyerabend, Frank; Schilling, Arndt F; Willumeit, Regine

2014-06-01

Magnesium-based implants have been shown to influence the surrounding bone structure. In an attempt to partially reveal the cellular mechanisms involved in the remodelling of magnesium-based implants, the influence of increased extracellular magnesium content on human osteoclasts was studied. Peripheral blood mononuclear cells were driven towards an osteoclastogenesis pathway via stimulation with receptor activator of nuclear factor kappa-B ligand and macrophage colony-stimulating factor for 28 days. Concomitantly, the cultures were exposed to variable magnesium concentrations (from either magnesium chloride or magnesium extracts). Osteoclast proliferation and differentiation were evaluated based on cell metabolic activity, total protein content, tartrate-resistant acid phosphatase activity, cathepsin K and calcitonin receptor immunocytochemistry, and cellular ability to form resorption pits. While magnesium chloride first enhanced and then opposed cell proliferation and differentiation in a concentration-dependent manner (peaking between 10 and 15mM magnesium chloride), magnesium extracts (with lower magnesium contents) appeared to decrease cell metabolic activity (≈50% decrease at day 28) while increasing osteoclast activity at a lower concentration (twofold higher). Together, the results indicated that (i) variations in the in vitro extracellular magnesium concentration affect osteoclast metabolism and (ii) magnesium extracts should be used preferentially in vitro to more closely mimic the in vivo environment. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Fluid Bed Dehydration of Magnesium Chloride

NASA Astrophysics Data System (ADS)

Adham, K.; Lee, C.; O'Keefe, K.

Molten salt electrolysis of MgCl2 is commonly used for the production of magnesium metal. However, the electrolysis feed must be completely dry with minimum oxygen content. Therefore, complete dehydration of the MgCl2 brine or the hydrated prill is a required process, which is very challenging because of the ease of thermal degradation due to hydrolysis of magnesium chloride.

MgCl 2 : The Key Ingredient to Improve Chloride Containing Electrolytes for Rechargeable Magnesium-Ion Batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Baofei; Huang, Jinhua; Sa, Niya

The effect of MgCl2 on a series of chloride containing magnesium electrolytes was investigated. In the presence of extra MgCl2, the electrochemical properties of Grignard reagents (RMgCl, R = Ph, Et, iPr) were significantly improved, and the advance of MgCl2 was further demonstrated in Mg-Mo6S8 rechargeable batteries with improved capacities and much smaller over-potentials. MgCl2 was then further proven to be powerful reagent to improve the performance of well-established strong Lewis acid derived magnesium electrolytes including the “all-phenyl” complex (APC) and alkoxide-based magnesium electrolytes. The results suggest that MgCl2 salt is a very important species to benefit all chloride containingmore » electrolytes for rechargeable magnesium-ion batteries.« less

Phase Transformation, Surface Morphology and Dielectric Property of P(VDF-HFP)/MgCl2·6H2O Nanocomposites

NASA Astrophysics Data System (ADS)

Yuennan, J.; Sukwisute, P.; Boripet, B.; Muensit, N.

2017-09-01

Nanocomposite piezoelectric films based on the blend of poly(vinylidenefluoride-hexafluoropropylene) (PVDF-HFP) and magnesium chloride hexahydrate (MgCl2•6H2O) have been investigated in this work. The films incorporated with 0.5 wt% MgCl2•6H2O were prepared using a solution casting technique and uniaxially stretched at various ratios from 2 to 6 times in order to characterize phase transformation, surface morphology and dielectric behaviour. The piezoelectric β phase transformation and crystallinity of the stretched films were identified by Fourier transform infrared spectroscopy (FTIR) and X-ray diffraction (XRD). A scanning electron microscopy (SEM) was conducted to observe the surface microstructure and porosity. The frequency dependence of dielectric properties was also measured by LCR meter at room temperature. The stretched films show the larger the stretching ratio, the greater the microdefects appearance. This leads to a decrease of dielectric constant with stretching ratio. Nevertheless, the P(VDF-HFP) nanocomposites with stretching ratio of 4 times display a higher β phase fraction of 90% than the unstretched films. Thus, this result points out that the β phase transformation of the composite films can be enhanced by mechanically stretching process.

[Antiperspirants for the therapy of focal hyperhidrosis].

PubMed

Streker, M; Kerscher, M

2012-06-01

In Europe often no clear distinction is made between deodorant and antiperspirant. Particularly in Germany, the labeling "deo" is used for both. Only antiperspirants are capable of influencing the activity of eccrine sweat glands. In the treatment of focal hyperhidrosis, the use of aluminum chloride solutions represents the first choice. The efficacy is well documented in a variety of studies. Subjective side effects include pruritus and - less often - irritant dermatitis, which can be treated symptomatically and usually does not require discontinuation of the treatment. Rare variants of focal hyperhidrosis like auriculotemporal syndrome, Ross syndrome and nevus sudoriferus also are suitable for treatment with topical aluminum chloride hexahydrate solutions.

The unexpected discovery of the Mg(HMDS) 2 /MgCl 2 complex as a magnesium electrolyte for rechargeable magnesium batteries

DOE PAGES

Liao, Chen; Sa, Niya; Key, Baris; ...

2015-02-02

We developed a unique class of non-Grignard, aluminum-free magnesium electrolytes based on a simple mixture of magnesium compounds: magnesium hexamethyldisilazide (Mg(HMDS) 2) and magnesium chloride (MgCl 2).

Thermophysical Properties of Matter - The TPRC Data Series. Volume 6. Specific Heat - Nonmetallic Liquids and Gases

DTIC Science & Technology

1970-01-01

dlcarbide (Cr5C2) Heptachromium tricarbide (CrTCj) Chromium chlorides: CrCl2 CrClj Chromium dichloride (CrC^) Chromium trichloride (CrC...methane (see Propane) Dysprosia (see Dysprosium oxide) Dysprosium Dysprosium trichloride hexahydrate (DyClj-6HjO) Dysprosium oxide (DyjOj...Dysprosium sesquioxide (see Dysprosium oxide) Didysprosium trioxide (see Dysprosium oxide) Erbia (see Erbium oxide) Erbium Erbium trichloride

The Influence of Antiperspirants on Foot-Blister Incidence Following Road Marching.

DTIC Science & Technology

1997-04-01

The influence of antiperspirants on foot blister incidence during road marching was examined in 1,130 cadets from the U.S. Military Academy, West...Point, New York. Cadets were separated into two groups that received either an antiperspirant or placebo preparation, and the study was double blinded...The antiperspirant was a commercially available substance consisting of 20% aluminum chloride hexahydrate in anhydrous ethyl alcohol. The placebo was

Quantitative comparison of topical aluminum salt solution efficacy for management of sweating: a randomized, controlled trial.

PubMed

Swary, Jillian H; West, Dennis P; Kakar, Rohit; Ortiz, Sara; Schaeffer, Matthew R; Veledar, Emir; Alam, Murad

2015-12-01

There is a lack of studies objectively comparing the efficacy of topical antiperspirants in reducing sweat. To objectively and quantitatively compare the efficacy of two aluminum salt solutions for the reduction of induced sweating. A subject, rater, and statistician-blinded, randomized, controlled trial. Nineteen subjects were exposed to a standardized heat challenge for 3 h. Topical agent A (20% aluminum chloride hexahydrate) was randomized to either axilla, and topical agent B (1% aluminum acetate) assigned to the contralateral side. A sauna suit induced sweating during three 30-min heat intervals: (1) with no study agents (pre); (2) with both study agents, one on each side; and (3) after the agents were washed off (post). Sweat levels were measured by securing Whatman(®) filter paper to each axilla and measuring the paper weight after each heat interval. The difference in paper weight following each heat interval between Study Agent A and Study Agent B was measured by a gravimetric scale. Topical agent A had a significantly greater effect at reducing axillary sweating than B (P = 0.0002). In a sweating simulation, 20% aluminum chloride hexahydrate quantitatively and objectively appeared to reduce sweat more effectively than 1% aluminum acetate. © 2015 Wiley Periodicals, Inc.

The impact of sulphate and magnesium on chloride binding in Portland cement paste

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Weerdt, K., E-mail: klaartje.d.weerdt@ntnu.no; SINTEF Building and Infrastructure, Trondheim; Orsáková, D.

2014-11-15

The effect of magnesium and sulphate present in sea water on chloride binding in Portland cement paste was investigated. Ground well hydrated cement paste was exposed to MgCl{sub 2}, NaCl, NaCl + MgCl{sub 2}, MgSO{sub 4} + MgCl{sub 2} and artificial sea water solutions with a range of concentrations at 20 °C. Chloride binding isotherms are determined and pH of the solutions were measured. A selection of samples was examined by SEM-EDS to identify phase changes upon exposure. The experimental data were compared with calculations of a thermodynamic model. Chloride binding from sea water was similar to chloride binding formore » NaCl solutions. The magnesium content in the sea water lead to a slight decrease in pH, but this did not result in a notable increase in chloride binding. The sulphate present in sea water reduces both chloride binding in C–S–H and AFm phases, as the C–S–H incorporates more sulphates instead of chlorides, and part of the AFm phases converts to ettringite.« less

Surface aspects of pitting and stress corrosion cracking

NASA Technical Reports Server (NTRS)

Truhan, J. S., Jr.; Hehemann, R. F.

1977-01-01

The pitting and stress corrosion cracking of a stable austenitic stainless steel in aqueous chloride environments were investigated using a secondary ion mass spectrometer as the primary experimental technique. The surface concentration of hydrogen, oxygen, the hydroxide, and chloride ion, magnesium or sodium, chromium and nickel were measured as a function of potential in both aqueous sodium chloride and magnesium chloride environments at room temperature and boiling temperatures. It was found that, under anodic conditions, a sharp increase in the chloride concentration was observed to occur for all environmental conditions. The increase may be associated with the formation of an iron chloride complex. Higher localized chloride concentrations at pits and cracks were also detected with an electron microprobe.

REDUCTION OF FLUORIDE TO METAL

DOEpatents

Carlson, O.N.; Schmidt, F.A.; Spedding, F.H.

1960-08-30

A process is given for making yttrium metal by reducing yttrium fluoride with calcium plus magnesium. Calcium is added in an excess of from 10 to 20% and magnesium in a quantity to yield a magnesium--yttrium alloy containing from 12 to 25% magnesium when the reaction mass is heated in an inert atmosphere at from 900 to 1106 deg C, but preferably above the melting point of the alloy. Calcium chloride may be added so as to obtain a less viscous slag containing from 30 to 60% calcium chloride. After removal of the slag the alloy is vacuum-heated at about 1100 deg C for volatilization of the magnesium and calcium.

Hydration Energies and Structures of Alkaline Earth Metal Ions, M2+ (H2O)n, n = 5–7, M = Mg, Ca, Sr, and Ba

PubMed Central

Rodriguez-Cruz, Sandra E.; Jockusch, Rebecca A.

2005-01-01

The evaporation of water from hydrated alkaline earth metal ions, produced by electrospray ionization, was studied in a Fourier transform mass spectrometer. Zero-pressure-limit dissociation rate constants for loss of a single water molecule from the hydrated divalent metal ions, M2+(H2O)n (M = Mg, Ca, and Sr for n = 5–7, and M = Ba for n = 4–7), are measured as a function of temperature using blackbody infrared radiative dissociation. From these values, zero-pressure-limit Arrhenius parameters are obtained. By modeling the dissociation kinetics using a master equation formalism, threshold dissociation energies (Eo) are determined. These reactions should have a negligible reverse activation barrier; therefore, Eo values should be approximately equal to the binding energy or hydration enthalpy at 0 K. For the hepta- and hexahydrated ions at low temperature, binding energies follow the trend expected on the basis of ionic radii: Mg > Ca > Sr > Ba. For the hexahydrated ions at high temperature, binding energies follow the order Ca > Mg > Sr > Ba. The same order is observed for the pentahydrated ions. Collisional dissociation experiments on the tetrahydrated species result in relative dissociation rates that directly correlate with the size of the metals. These results indicate the presence of two isomers for hexahydrated magnesium ions: a low-temperature isomer in which the six water molecules are located in the first solvation shell, and a high-temperature isomer with the most likely structure corresponding to four water molecules in the inner shell and two water molecules in the second shell. These results also indicate that the pentahydrated magnesium ions have a structure with four water molecules in the first solvation shell and one in the outer shell. The dissociation kinetics for the hexa- and pentahydrated clusters of Ca2+, Sr2+, and Ba2+ are consistent with structures in which all the water molecules are located in the first solvation shell. PMID:16429612

In Vivo Recording of Neural and Behavioral Correlates of Anesthesia Induction, Reversal, and Euthanasia in Cephalopod Molluscs.

PubMed

Butler-Struben, Hanna M; Brophy, Samantha M; Johnson, Nasira A; Crook, Robyn J

2018-01-01

Cephalopod molluscs are among the most behaviorally and neurologically complex invertebrates. As they are now included in research animal welfare regulations in many countries, humane and effective anesthesia is required during invasive procedures. However, currently there is no evidence that agents believed to act as anesthetics produce effects beyond immobility. In this study we demonstrate, for the first time, that two of the most commonly used agents in cephalopod general anesthesia, magnesium chloride and ethanol, are capable of producing strong and reversible blockade of afferent and efferent neural signal; thus they are genuine anesthetics, rather than simply sedating agents that render animals immobile but not insensible. Additionally, we demonstrate that injected magnesium chloride and lidocaine are effective local anesthetic agents. This represents a considerable advance for cephalopod welfare. Using a reversible, minimally invasive recording procedure, we measured activity in the pallial nerve of cuttlefish ( Sepia bandensis ) and octopus ( Abdopus aculeatus, Octopus bocki ), during induction and reversal for five putative general anesthetic and two local anesthetic agents. We describe the temporal relationship between loss of behavioral responses (immobility), loss of efferent neural signal (loss of "consciousness") and loss of afferent neural signal (anesthesia) for general anesthesia, and loss of afferent signal for local anesthesia. Both ethanol and magnesium chloride were effective as bath-applied general anesthetics, causing immobility, complete loss of behavioral responsiveness and complete loss of afferent and efferent neural signal. Cold seawater, diethyl ether, and MS-222 (tricaine) were ineffective. Subcutaneous injection of either lidocaine or magnesium chloride blocked behavioral and neural responses to pinch in the injected area, and we conclude that both are effective local anesthetic agents for cephalopods. Lastly, we demonstrate that a standard euthanasia protocol-immersion in isotonic magnesium chloride followed by surgical decerebration-produced no behavioral response and no neural activity during surgical euthanasia. Based on these data, we conclude that both magnesium chloride and ethanol can function as general anesthetic agents, and lidocaine and magnesium chloride can function as local anesthetic agents for cephalopod molluscs.

In Vivo Recording of Neural and Behavioral Correlates of Anesthesia Induction, Reversal, and Euthanasia in Cephalopod Molluscs

PubMed Central

Butler-Struben, Hanna M.; Brophy, Samantha M.; Johnson, Nasira A.; Crook, Robyn J.

2018-01-01

Cephalopod molluscs are among the most behaviorally and neurologically complex invertebrates. As they are now included in research animal welfare regulations in many countries, humane and effective anesthesia is required during invasive procedures. However, currently there is no evidence that agents believed to act as anesthetics produce effects beyond immobility. In this study we demonstrate, for the first time, that two of the most commonly used agents in cephalopod general anesthesia, magnesium chloride and ethanol, are capable of producing strong and reversible blockade of afferent and efferent neural signal; thus they are genuine anesthetics, rather than simply sedating agents that render animals immobile but not insensible. Additionally, we demonstrate that injected magnesium chloride and lidocaine are effective local anesthetic agents. This represents a considerable advance for cephalopod welfare. Using a reversible, minimally invasive recording procedure, we measured activity in the pallial nerve of cuttlefish (Sepia bandensis) and octopus (Abdopus aculeatus, Octopus bocki), during induction and reversal for five putative general anesthetic and two local anesthetic agents. We describe the temporal relationship between loss of behavioral responses (immobility), loss of efferent neural signal (loss of “consciousness”) and loss of afferent neural signal (anesthesia) for general anesthesia, and loss of afferent signal for local anesthesia. Both ethanol and magnesium chloride were effective as bath-applied general anesthetics, causing immobility, complete loss of behavioral responsiveness and complete loss of afferent and efferent neural signal. Cold seawater, diethyl ether, and MS-222 (tricaine) were ineffective. Subcutaneous injection of either lidocaine or magnesium chloride blocked behavioral and neural responses to pinch in the injected area, and we conclude that both are effective local anesthetic agents for cephalopods. Lastly, we demonstrate that a standard euthanasia protocol—immersion in isotonic magnesium chloride followed by surgical decerebration—produced no behavioral response and no neural activity during surgical euthanasia. Based on these data, we conclude that both magnesium chloride and ethanol can function as general anesthetic agents, and lidocaine and magnesium chloride can function as local anesthetic agents for cephalopod molluscs. PMID:29515454

Mild and efficient strontium chloride hexahydrate-catalyzed conversion of ketones and aldehydes into corresponding gem-dihydroperoxides by aqueous H2O2.

PubMed

Azarifar, Davood; Khosravi, Kaveh; Soleimanei, Fatemeh

2010-03-08

SrCl2 x 6 H2O has been shown to act as an efficient catalyst for the conversion of aldehydes or ketones into the corresponding gem-dihydroperoxides (DHPs) by treatment with aqueous H2O2 (30%) in acetonitrile. The reactions proceed under mild and neutral conditions at room temperature to afford good to excellent yields of product.

Fast kinetics of magnesium monochloride cations in interlayer-expanded titanium disulfide for magnesium rechargeable batteries

DOE PAGES

Yoo, Hyun Deog; Liang, Yanliang; Dong, Hui; ...

2017-08-24

Magnesium rechargeable batteries potentially offer high-energy density, safety, and low cost due to the ability to employ divalent, dendrite-free, and earth-abundant magnesium metal anode. Despite recent progress, further development remains stagnated mainly due to the sluggish scission of magnesium-chloride bond and slow diffusion of divalent magnesium cations in cathodes. Here in this paper we report a battery chemistry that utilizes magnesium monochloride cations in expanded titanium disulfide. Combined theoretical modeling, spectroscopic analysis, and electrochemical study reveal fast diffusion kinetics of magnesium monochloride cations without scission of magnesium-chloride bond. The battery demonstrates the reversible intercalation of 1 and 1.7 magnesium monochloridemore » cations per titanium at 25 and 60 °C, respectively, corresponding to up to 400 mAh g -1 capacity based on the mass of titanium disulfide. The large capacity accompanies with excellent rate and cycling performances even at room temperature, opening up possibilities for a variety of effective intercalation hosts for multivalent-ion batteries.« less

Influence of corrosive solutions on microhardness and chemistry of magnesium oxide /001/ surfaces

NASA Technical Reports Server (NTRS)

Ishigaki, H.; Miyoshi, K.; Buckley, D. H.

1982-01-01

X-ray photoelectron spectroscopy analyses and hardness experiments were conducted on cleaved magnesium oxide /001/ surfaces. The magnesium oxide bulk crystals were cleaved to specimen size along the /001/ surface, and indentations were made on the cleaved surface in corrosive solutions containing HCl, NaOH, or HNO3 and in water without exposing the specimen to any other environment. The results indicated that chloride (such as MgCl2) and sodium films are formed on the magnesium oxide surface as a result of interactions between an HCl-containing solution and a cleaved magnesium oxide surface. The chloride films soften the magnesium oxide surface. In this case microhardness is strongly influenced by the pH value of the solution. The lower the pH, the lower the microhardness. Sodium films, which are formed on the magnesium oxide surface exposed to an NaOH containing solution, do not soften the magnesium oxide surface.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoo, Hyun Deog; Liang, Yanliang; Dong, Hui

Magnesium rechargeable batteries potentially offer high-energy density, safety, and low cost due to the ability to employ divalent, dendrite-free, and earth-abundant magnesium metal anode. Despite recent progress, further development remains stagnated mainly due to the sluggish scission of magnesium-chloride bond and slow diffusion of divalent magnesium cations in cathodes. Here in this paper we report a battery chemistry that utilizes magnesium monochloride cations in expanded titanium disulfide. Combined theoretical modeling, spectroscopic analysis, and electrochemical study reveal fast diffusion kinetics of magnesium monochloride cations without scission of magnesium-chloride bond. The battery demonstrates the reversible intercalation of 1 and 1.7 magnesium monochloridemore » cations per titanium at 25 and 60 °C, respectively, corresponding to up to 400 mAh g -1 capacity based on the mass of titanium disulfide. The large capacity accompanies with excellent rate and cycling performances even at room temperature, opening up possibilities for a variety of effective intercalation hosts for multivalent-ion batteries.« less

Macroscopic and microscopic variation in recovered magnesium phosphate materials: implications for phosphorus removal processes and product re-use.

PubMed

Massey, Michael S; Ippolito, James A; Davis, Jessica G; Sheffield, Ron E

2010-02-01

Phosphorus (P) recovery and re-use will become increasingly important for water quality protection and sustainable nutrient cycling as environmental regulations become stricter and global P reserves decline. The objective of this study was to examine and characterize several magnesium phosphates recovered from actual wastewater under field conditions. Three types of particles were examined including crystalline magnesium ammonium phosphate hexahydrate (struvite) recovered from dairy wastewater, crystalline magnesium ammonium phosphate hydrate (dittmarite) recovered from a food processing facility, and a heterogeneous product also recovered from dairy wastewater. The particles were analyzed using "wet" chemical techniques, powder X-ray diffraction (XRD), and scanning electron microscopy in conjunction with energy dispersive X-ray spectroscopy (SEM-EDS). The struvite crystals had regular and consistent shape, size, and structure, and SEM-EDS analysis clearly showed the struvite crystals as a surface precipitate on calcium phosphate seed material. In contrast, the dittmarite crystals showed no evidence of seed material, and were not regular in size or shape. The XRD analysis identified no crystalline magnesium phosphates in the heterogeneous product and indicated the presence of sand particles. However, magnesium phosphate precipitates on calcium phosphate seed material were observed in this product under SEM-EDS examination. These substantial variations in the macroscopic and microscopic characteristics of magnesium phosphates recovered under field conditions could affect their potential for beneficial re-use and underscore the need to develop recovery processes that result in a uniform, consistent product.

Special topical approach to the treatment of acne. Suppression of sweating with aluminum chloride in an anhydrous formulation.

PubMed

Hurley, H J; Shelley, W B

1978-12-01

A new topical approach to acne treatment--the use of aluminum chloride hexahydrate in anhydrous ethanol (ACAE)--was studied in 141 patients. Using sequential treatment schedules, paired comparison techniques, and various concentrations of ACAE, we established maximal efficacy with minimal local irritation for the 6.25% strength solution. Clinical efficacy and lack of toxicity of this formulation were confirmed by the additional clinical study of 65 patients. The antiperspirant and antibacterial actions of 6.25% ACAE solution were then verified on acne skin areas. It is postulated that the clinical improvement in acne that follows the topical use of ACAE results from one or both of these actions.

Mechanism of sodium chloride in promoting reduction of high-magnesium low-nickel oxide ore

PubMed Central

Zhou, Shiwei; Wei, Yonggang; Li, Bo; Wang, Hua; Ma, Baozhong; Wang, Chengyan

2016-01-01

Sodium chloride has been proved that it is an effective promoter for the reduction of high-magnesium, low-nickel oxide ore. The aim of current work is to clarify the promotion behavior of sodium chloride in the roasting reduction process. The influence of moisture on the reduction of ore in the presence of sodium chloride is studied to get clear comprehension of promotion process. In the presence of moisture, the HCl is produced by pyrohydrolysis of sodium chloride for chlorinating nickel and iron oxides, moreover, interactions between metallic oxides and sodium chloride are also a way for chlorination at high temperature (>802 °C); subsequently, the metal chloride would be reduced by reductant. In the absence of moisture, the magnetic separation results show that the recoveries of iron and nickel have a significant increase; moreover, olivine structure would be destroyed gradually with the increase of roasting temperature in the action of sodium chloride, and the sodium chloride existed in high-magnesium, low-nickel oxide ore could make the NiO isolate from NiO-bearing minerals. The NiO reacts with Fe2O3 at high temperature to form NiFe2O4, which is conductive to the formation of Ni-Fe alloy during the reduction process. PMID:27374991

Mechanism of sodium chloride in promoting reduction of high-magnesium low-nickel oxide ore.

PubMed

Zhou, Shiwei; Wei, Yonggang; Li, Bo; Wang, Hua; Ma, Baozhong; Wang, Chengyan

2016-07-04

Sodium chloride has been proved that it is an effective promoter for the reduction of high-magnesium, low-nickel oxide ore. The aim of current work is to clarify the promotion behavior of sodium chloride in the roasting reduction process. The influence of moisture on the reduction of ore in the presence of sodium chloride is studied to get clear comprehension of promotion process. In the presence of moisture, the HCl is produced by pyrohydrolysis of sodium chloride for chlorinating nickel and iron oxides, moreover, interactions between metallic oxides and sodium chloride are also a way for chlorination at high temperature (>802 °C); subsequently, the metal chloride would be reduced by reductant. In the absence of moisture, the magnetic separation results show that the recoveries of iron and nickel have a significant increase; moreover, olivine structure would be destroyed gradually with the increase of roasting temperature in the action of sodium chloride, and the sodium chloride existed in high-magnesium, low-nickel oxide ore could make the NiO isolate from NiO-bearing minerals. The NiO reacts with Fe2O3 at high temperature to form NiFe2O4, which is conductive to the formation of Ni-Fe alloy during the reduction process.

Polyanthraquinone-Based Organic Cathode for High-Performance Rechargeable Magnesium-Ion Batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Baofei; Huang, Jinhua; Feng, Zhenxing

2016-05-09

Two anthraquinone-based polymers aiming at improving the capacity and voltage of magnesium ion batteries, were synthesized and characterized. The excellent battery cycling performance was demonstrated with the electrolyte consisting of magnesium bis(hexamethyldisilazide) and magnesium chloride.

Comparison of reactivity to a metallic disc and 2% aluminium salt in 366 children, and reproducibility over time for 241 young adults with childhood vaccine-related aluminium contact allergy.

PubMed

Gente Lidholm, Anette; Inerot, Annica; Gillstedt, Martin; Bergfors, Elisabet; Trollfors, Birger

2018-07-01

An aluminium hydroxide-adsorbed pertussis toxoid vaccine was studied in 76 000 children in the 1990s in Gothenburg, Sweden. Long-lasting itchy subcutaneous nodules at the vaccination site were seen in 745 participants. Of 495 children with itchy nodules who were patch tested for aluminium allergy, 377 were positive. In 2007-2008, 241 of the positive children were retested. Only in one third were earlier positive results reproduced. To further describe patch test reactions to different aluminium compounds in children with vaccine-induced aluminium allergy. Positive patch test results for metallic aluminium (empty Finn Chamber) and aluminium chloride hexahydrate 2% petrolatum (pet.) were analysed in 366 children with vaccine-induced persistent itching nodules tested in 1998-2002. Of those, 241 were tested a second time (2007-2008), and the patch test results of the two aluminium preparations were analysed. Patch testing with aluminium chloride hexahydrate 2% pet. is a more sensitive way to diagnose aluminium contact allergy than patch testing with metallic aluminium. A general decrease in the strength of reactions to both aluminium preparations in 241 children tested twice was observed. Aluminium contact allergy can be diagnosed by patch testing without using metallic aluminium. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Durability of high performance concrete in magnesium brine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tumidajski, P.J.; Chan, G.W.

1996-04-01

The durability of six concretes exposed to magnesium brine was monitored for 24 months. These concretes incorporated ground granulated blast furnace slag, silica fume, and fly ash. The Young`s moduli, chloride penetrations, and median pore diameters were measured. There was a cyclic nature to these properties due to the complicated interaction of hydration with magnesium, chloride and sulfate attack. Mineral admixtures, in combination with a long initial cure, provided the most durable concrete. Concrete with 65% slag had the best overall durability to the brines tested.

46 CFR 151.50-34 - Vinyl chloride (vinyl chloride monomer).

Code of Federal Regulations, 2010 CFR

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Vinyl chloride (vinyl chloride monomer). 151.50-34... chloride (vinyl chloride monomer). (a) Copper, aluminum, magnesium, mercury, silver, and their alloys shall... equipment that may come in contact with vinyl chloride liquid or vapor. (b) Valves, flanges, and pipe...

The effects of saxitoxin and tetrodotoxin on nerve conduction in the presence of lithium ions and of magnesium ions

PubMed Central

Evans, M. H.

1969-01-01

1. It has been shown that nerve fibres from rat cauda equina will conduct action potentials after immersion in saline in which lithium chloride is substituted for sodium chloride. 2. Both saxitoxin and tetrodotoxin inhibit lithium-generated action potentials. The concentration of toxin needed to inhibit the lithium-generated action potentials is similar to that needed to inhibit sodium-generated action potentials. 3. If magnesium chloride is added to the saline to give a concentration of 10-15 mM there is usually a slight fall in amplitude of the compound action potential. Saxitoxin and tetrodotoxin now inhibit the action potential to a greater degree than in the absence of magnesium ions. PMID:5789802

46 CFR 151.50-34 - Vinyl chloride (vinyl chloride monomer).

Code of Federal Regulations, 2011 CFR

2011-10-01

... 46 Shipping 5 2011-10-01 2011-10-01 false Vinyl chloride (vinyl chloride monomer). 151.50-34 Section 151.50-34 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... chloride (vinyl chloride monomer). (a) Copper, aluminum, magnesium, mercury, silver, and their alloys shall...

Pharmacokinetic Modeling of Trivalent and Hexavalent Chromium Based on Ingestion and Inhalation of Soluble Chromium Compounds.

DTIC Science & Technology

1991-12-01

34 0-0-° AD-A256 238 - DTIC 7 ELECTE A S OCTI 6 1992 R CM S PHARMACOKINETIC MODELING OF T TRIVALENT AND HEXAVALENT CHROMIUM R BASED ON INGESTION AND...or inhalation of trivalent or hexavalent soluble chromium compounds. The research described herein began in June 1990 and was completed in December... trivalent and hexavalent chromium compounds, chromic chloride-hexahydrate and sodium dichromate, respectively (Table I). An inhalation control group was

Polarization analysis of holographic gratings recorded in organic conductive material

NASA Astrophysics Data System (ADS)

Fontanilla-Urdaneta, R.; Hernández-Garay, M. P.; Olivares-Pérez, A.; Páez-Trujillo, G.; Fuentes-Tapia, I.

2007-09-01

This work presents experimental results of intensity changes by polarization conditions at the resultant diffraction patters. The substrate used as retarder plate was a commercial transparency film for use with plain paper copier (3M-PP2900 TM). The conductive material composition was introduce to dichromated poly(vinyl alcohol) by adding a metallic salt as nickel(II) chloride hexahydrate. Some electro-optical characteristics of organic conductive material that are used in the holographic gratings storage specifically when applied voltage.

Analysis of the Effects of Calcium or Magnesium on Voltage-Clamp Currents in Perfused Squid Axons Bathed in Solutions of High Potassium

PubMed Central

Rojas, Eduardo; Taylor, Robert E.; Atwater, Illani; Bezanilla, Francisco

1969-01-01

Isolated axons from the squid, Dosidicus gigas, were internally perfused with potassium fluoride solutions. Membrane currents were measured following step changes of membrane potential in a voltage-clamp arrangement with external isosmotic solution changes in the order: potassium-free artificial seawater; potassium chloride; potassium chloride containing 10, 25, 40 or 50, mM calcium or magnesium; and potassium-free artificial seawater. The following results suggest that the currents measured under voltage clamp with potassium outside and inside can be separated into two components and that one of them, the predominant one, is carried through the potassium system. (a) Outward currents in isosmotic potassium were strongly and reversibly reduced by tetraethylammonium chloride. (b) Without calcium or magnesium a progressive increase in the nontime-dependent component of the currents (leakage) occurred. (c) The restoration of calcium or magnesium within 15–30 min decreases this leakage. (d) With 50 mM divalent ions the steady-state current-voltage curve was nonlinear with negative resistance as observed in intact axons in isosmotic potassium. (e) The time-dependent components of the membrane currents were not clearly affected by calcium or magnesium. These results show a strong dependence of the leakage currents on external calcium or magnesium concentration but provide no support for the involvement of calcium or magnesium in the kinetics of the potassium system. PMID:5823216

Analysis of the effects of calcium or magnesium on voltage-clamp currents in perfused squid axons bathed in solutions of high potassium.

PubMed

Rojas, E; Taylor, R E; Atwater, I; Bezanilla, F

1969-10-01

Isolated axons from the squid, Dosidicus gigas, were internally perfused with potassium fluoride solutions. Membrane currents were measured following step changes of membrane potential in a voltage-clamp arrangement with external isosmotic solution changes in the order: potassium-free artificial seawater; potassium chloride; potassium chloride containing 10, 25, 40 or 50, mM calcium or magnesium; and potassium-free artificial seawater. The following results suggest that the currents measured under voltage clamp with potassium outside and inside can be separated into two components and that one of them, the predominant one, is carried through the potassium system. (a) Outward currents in isosmotic potassium were strongly and reversibly reduced by tetraethylammonium chloride. (b) Without calcium or magnesium a progressive increase in the nontime-dependent component of the currents (leakage) occurred. (c) The restoration of calcium or magnesium within 15-30 min decreases this leakage. (d) With 50 mM divalent ions the steady-state current-voltage curve was nonlinear with negative resistance as observed in intact axons in isosmotic potassium. (e) The time-dependent components of the membrane currents were not clearly affected by calcium or magnesium. These results show a strong dependence of the leakage currents on external calcium or magnesium concentration but provide no support for the involvement of calcium or magnesium in the kinetics of the potassium system.

Electroplating of the superconductive boride MgB2 from molten salts

NASA Astrophysics Data System (ADS)

Abe, Hideki; Yoshii, Kenji; Nishida, Kenji; Imai, Motoharu; Kitazawa, Hideaki

2005-02-01

An electroplating technique of the superconductive boride MgB2 onto graphite substrates is reported. Films of MgB2 with a thickness of tens micrometer were fabricated on the planar and curved surfaces of graphite substrates by means of electrolysis on a mixture of magnesium chloride, potassium chloride, sodium chloride, and magnesium borate fused at 600 °C under an Ar atmosphere. The electrical resistivity and magnetization measurements revealed that the electroplated MgB2 films undergo a superconducting transition with the critical temperature (Tc) of 36 K.

Influence of an antiperspirant on foot blister incidence during cross-country hiking.

PubMed

Knapik, J J; Reynolds, K; Barson, J

1998-08-01

Rubbing moist skin results in higher frictional forces than rubbing very dry skin. As friction increases, the probability of activity-related blisters also increases. Therefore reducing moisture may reduce blister incidence during physical activity. We examined whether an antiperspirant can reduce foot blisters during hiking. In a double-blind study, cadets attending the US Military Academy were separated into two groups that used either an antiperspirant (20% aluminum chloride hexahydrate in anhydrous ethyl alcohol) or placebo (anhydrous ethyl alcohol) preparation. Cadets were told to apply preparations to their feet for 5 consecutive nights. On day 6, cadets completed a 21-km hike, and their feet were examined for blisters before and after. Because of dropouts, the final sample size was 667 cadets with 328 in the antiperspirant group and 339 in the placebo group. There was a high rate of noncompliance with the treatment schedule: Cadets used the preparations from 0 to 5 nights before the hike. For cadets using the preparations at least 3 nights before the hike (n=269), the incidence of foot blisters was 21% for the antiperspirant group and 48% for the placebo group (P < 0.01). However, reports of skin irritation were 57% for the antiperspirant group and 6% for the placebo group (P < 0.01). A 20% solution of aluminum chloride hexahydrate in anhydrous ethyl alcohol may be effective in reducing foot blisters during hiking; however, the side effect of skin irritation should be considered and preventive measures studied to reduce this irritation.

Sputtering ultra-small Pt on nanographitic flakes deposited by electrophoresis for ethanol electro oxidation

NASA Astrophysics Data System (ADS)

Daryakenari, Ahmad Ahmadi; Daryakenari, Mohammad Ahmadi; Omidvar, Hamid

2018-01-01

To acquire highly efficient and cost-effective fuel cells, numerous research works have been carried out to the development low cost and excellent performance of electrocatalysts. In this paper, a solution-based electrophoretic deposition (EPD) technique for fabrication of Pt-based catalyst layers is studied. Nanographitic flake coatings used as catalyst support for sputtered platinium (Pt) were fabricated via the electrophoretic deposition (EPD) of dispersed nanographitic flakes in isopropyl alcohol. Magnesium nitrate hexahydrate (MNH) was used as an additive binder in the EPD process. Subsequently, the platinium particles were deposited by a direct sputtering on the fabricated nanographitic flake coatings.

The Effect of Mars-relevant Minerals on the Water Uptake of Magnesium Perchlorate and Implications for the Near-surface of Mars

NASA Astrophysics Data System (ADS)

Primm, Katherine; Gough, Raina; Rivera-Valentin, Edgard G.; Tolbert, Margaret

2017-10-01

The water uptake and release by hygroscopic salts such as perchlorate has been well studied in the decade since they were first discovered on the surface of Mars. However, there have been few studies on the effect of the insoluble regolith minerals on this well documented interaction of perchlorate and water vapor. In this work, we investigate the effect that two insoluble Mars-relevant minerals, montmorillonite and Mojave Mars Simulant (MMS), have on the water uptake (deliquescence), ice formation, and recrystallization (efflorescence) of pure magnesium perchlorate. We studied mixtures of equal parts (by mass) magnesium perchlorate hexahydrate and either montmorillonite or MMS. Although montmorillonite and MMS are insoluble minerals that may serve as nuclei for either ice nucleation or salt efflorescence, we find that these minerals did not affect any of the phase transitions of magnesium perchlorate. The salt-mineral mixture behaved like pure magnesium perchlorate in all cases, with stable deliquescence as well as metastable brine supersaturation and supercooling observed. Experiments were performed in both N2 and CO2 atmospheres, with no detectable difference. We use data from the Rover Environmental Monitoring Station instrument on MSL and from the Thermal and Electrical Conductivity Probe instrument on Phoenix, as well as modeling of the shallow subsurface near the rover and lander, to determine the likelihood of liquid water and water ice at Gale Crater and the Phoenix landing site.

Precision and bias of selected analytes reported by the National Atmospheric Deposition Program and National Trends Network, 1983; and January 1980 through September 1984

USGS Publications Warehouse

Schroder, L.J.; Bricker, A.W.; Willoughby, T.C.

1985-01-01

Blind-audit samples with known analyte concentrations have been prepared by the U.S. Geological Survey and distributed to the National Atmospheric Deposition Program 's Central Analytical Laboratory. The difference between the National Atmospheric Deposition Program and National Trends Network reported analyte concentrations and known analyte concentrations have been calculated, and the bias has been determined. Calcium, magnesium , sodium, and chloride were biased at the 99-percent confidence limit; potassium and sulfate were unbiased at the 99-percent confidence limit, for 1983 results. Relative-percent differences between the measured and known analyte concentration for calcium , magnesium, sodium, potassium, chloride, and sulfate have been calculated for 1983. The median relative percent difference for calcium was 17.0; magnesium was 6.4; sodium was 10.8; potassium was 6.4; chloride was 17.2; and sulfate was -5.3. These relative percent differences should be used to correct the 1983 data before user-analysis of the data. Variances have been calculated for calcium, magnesium, sodium, potassium, chloride, and sulfate determinations. These variances should be applicable to natural-sample analyte concentrations reported by the National Atmospheric Deposition Program and National Trends Network for calendar year 1983. (USGS)

Influence of aggressive ions on the degradation behavior of biomedical magnesium alloy in physiological environment.

PubMed

Xin, Yunchang; Huo, Kaifu; Tao, Hu; Tang, Guoyi; Chu, Paul K

2008-11-01

Various electrochemical approaches, including potentiodynamic polarization, open circuit potential evolution and electrochemical impedance spectroscopy (EIS), are employed to investigate the degradation behavior of biomedical magnesium alloy under the influence of aggressive ions, such as chloride, phosphate, carbonate and sulfate, in a physiological environment. The synergetic effects and mutual influence of these ions on the degradation behavior of Mg are revealed. Our results demonstrate that chloride ions can induce porous pitting corrosion. In the presence of phosphates, the corrosion rate decreases and the formation of pitting corrosion is significantly delayed due to precipitation of magnesium phosphate. Hydrogen carbonate ions are observed to stimulate the corrosion of magnesium alloy during the early immersion stage but they can also induce rapid passivation on the surface. This surface passivation behavior mainly results from the fast precipitation of magnesium carbonate in the corrosion product layer that can subsequently inhibit pitting corrosion completely. Sulfate ions are also found to stimulate magnesium dissolution. These results improve our understanding on the degradation mechanism of surgical magnesium in the physiological environment.

Diffraction efficiency study of holographic gratings in dichromated poly(vinyl alcohol) NiCl II•6H IIO doped

NASA Astrophysics Data System (ADS)

Fontanilla-Urdaneta, R. C.; Hernández-Garay, M. P.; Olivares-Pérez, A.; Páez-Trujillo, G.; Fuentes-Tapia, I.

2008-02-01

Experimental results to the saturation and diffraction efficiency from holographic gratings are presented in this investigation. The experiments were carried out during real time holographic gratings formation. Dichromated poly(vinyl alcohol) was doped with nickel(II) chloride hexahydrate and it is used like optical material. The influence of the hologram parameters to get the maximum diffraction efficiency is studied at room conditions. This study contributes to get more information about the behavior of this material for holographic gratings recording.

40 CFR 63.9882 - What parts of my plant does this subpart cover?

Code of Federal Regulations, 2010 CFR

2010-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium... affected sources are each new and existing primary magnesium refining facility. (b) This subpart covers emissions from each spray dryer stack, magnesium chloride storage bins scrubber stack, melt/reactor system...

40 CFR 63.9882 - What parts of my plant does this subpart cover?

Code of Federal Regulations, 2012 CFR

2012-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium... affected sources are each new and existing primary magnesium refining facility. (b) This subpart covers emissions from each spray dryer stack, magnesium chloride storage bins scrubber stack, melt/reactor system...

40 CFR 63.9882 - What parts of my plant does this subpart cover?

Code of Federal Regulations, 2014 CFR

2014-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium... affected sources are each new and existing primary magnesium refining facility. (b) This subpart covers emissions from each spray dryer stack, magnesium chloride storage bins scrubber stack, melt/reactor system...

40 CFR 63.9882 - What parts of my plant does this subpart cover?

Code of Federal Regulations, 2011 CFR

2011-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium... affected sources are each new and existing primary magnesium refining facility. (b) This subpart covers emissions from each spray dryer stack, magnesium chloride storage bins scrubber stack, melt/reactor system...

40 CFR 63.9882 - What parts of my plant does this subpart cover?

Code of Federal Regulations, 2013 CFR

2013-07-01

... CATEGORIES (CONTINUED) National Emissions Standards for Hazardous Air Pollutants for Primary Magnesium... affected sources are each new and existing primary magnesium refining facility. (b) This subpart covers emissions from each spray dryer stack, magnesium chloride storage bins scrubber stack, melt/reactor system...

Influence of mineral oil and additives on microhardness and surface chemistry of magnesium oxide (001) surface

NASA Technical Reports Server (NTRS)

Miyoshi, K.; Shigaki, H.; Buckley, D. H.

1982-01-01

X-ray photoelectron spectroscopy analyses and hardness experiments were conducted with cleaved magnesium oxide /001/ surfaces. The magnesium oxide bulk crystals were cleaved into specimens along the /001/ surface, and indentations were made on the cleaved surface in laboratory air, in nitrogen gas, or in degassed mineral oil with and without an additive while not exposing specimen surface to any other environment. The various additives examined contained sulfur, phosphorus, chlorine, or oleic acid. The sulfur-containing additive exhibited the highest hardness and smallest dislocation patterns evidencing plastic deformation; the chlorine-containing additive exhibited the lowest hardness and largest dislocation patterns evidencing plastic deformation. Hydrocarbon and chloride (MgCl2) films formed on the magnesium oxide surface. A chloride film was responsible for the lowest measured hardness.

Cloning, expression, purification, crystallization and X-ray crystallographic analysis of recombinant human C1ORF123 protein.

PubMed

Rahaman, Siti Nurulnabila A; Mat Yusop, Jastina; Mohamed-Hussein, Zeti-Azura; Ho, Kok Lian; Teh, Aik-Hong; Waterman, Jitka; Ng, Chyan Leong

2016-03-01

C1ORF123 is a human hypothetical protein found in open reading frame 123 of chromosome 1. The protein belongs to the DUF866 protein family comprising eukaryote-conserved proteins with unknown function. Recent proteomic and bioinformatic analyses identified the presence of C1ORF123 in brain, frontal cortex and synapses, as well as its involvement in endocrine function and polycystic ovary syndrome (PCOS), indicating the importance of its biological role. In order to provide a better understanding of the biological function of the human C1ORF123 protein, the characterization and analysis of recombinant C1ORF123 (rC1ORF123), including overexpression and purification, verification by mass spectrometry and a Western blot using anti-C1ORF123 antibodies, crystallization and X-ray diffraction analysis of the protein crystals, are reported here. The rC1ORF123 protein was crystallized by the hanging-drop vapor-diffusion method with a reservoir solution comprised of 20% PEG 3350, 0.2 M magnesium chloride hexahydrate, 0.1 M sodium citrate pH 6.5. The crystals diffracted to 1.9 Å resolution and belonged to an orthorhombic space group with unit-cell parameters a = 59.32, b = 65.35, c = 95.05 Å. The calculated Matthews coefficient (VM) value of 2.27 Å(3) Da(-1) suggests that there are two molecules per asymmetric unit, with an estimated solvent content of 45.7%.

A Double-Blind Placebo-Controlled Crossover Trial of Intravenous Magnesium Sulfate for Foscarnet-Induced Ionized Hypocalcemia and Hypomagnesemia in Patients with AIDS and Cytomegalovirus Infection

PubMed Central

Huycke, Mark M.; Naguib, M. Tarek; Stroemmel, Mathias M.; Blick, Kenneth; Monti, Katherine; Martin-Munley, Sarah; Kaufman, Chris

2000-01-01

Foscarnet (trisodium phosphonoformate hexahydrate) is an antiviral agent used to treat cytomegalovirus disease in immunocompromised patients. One common side effect is acute ionized hypocalcemia and hypomagnesemia following intravenous administration. Foscarnet-induced ionized hypomagnesemia might contribute to ionized hypocalcemia by impairing excretion of preformed parathyroid hormone (PTH) or by producing target organ resistance. Prevention of ionized hypomagnesemia following foscarnet administration could blunt the development of ionized hypocalcemia. To determine whether intravenous magnesium ameliorates the decline in ionized calcium and/or magnesium following foscarnet infusions, MgSO4 at doses of 1, 2, and 3 g was administered in a double-blind, placebo-controlled, randomized, crossover trial to 12 patients with AIDS and cytomegalovirus disease. Overall, increasing doses of MgSO4 reduced or eliminated foscarnet-induced acute ionized hypomagnesemia. Supplementation, however, had no discernible effect on foscarnet-induced ionized hypocalcemia despite significant increases in serum PTH levels. No dose-related, clinically significant adverse events were found, suggesting that intravenous supplementation with up to 3 g of MgSO4 was safe in this chronically ill population. Since parenteral MgSO4 did not alter foscarnet-induced ionized hypocalcemia or symptoms associated with foscarnet, routine intravenous supplementation for patients with normal serum magnesium levels is not recommended during treatment with foscarnet. PMID:10898688

A Comparison of the Greenhouse Impacts of Magnesium Produced By Electrolytic and Pidgeon Processes

NASA Astrophysics Data System (ADS)

Ramakrishnan, Subramania; Koltun, Paul

With a focus on the global warming impact, this paper deals with the cradle-to-gate life cycle study of the following two practical production systems for producing magnesium ingots: (i) Magnesite ore is processed using the Australian Magnesium process to produce anhydrous magnesium chloride, which is then electrolysed to produce magnesium; and (ii) Dolomite ore is calcined to produce magnesium oxide, which is then thermally reduced with ferrosilicon using the Pidgeon process, based on the current practice used in China for magnesium production

Precursor preparation for Ca-Al layered double hydroxide to remove hexavalent chromium coexisting with calcium and magnesium chlorides

NASA Astrophysics Data System (ADS)

Zhong, Lihua; He, Xiaoman; Qu, Jun; Li, Xuewei; Lei, Zhiwu; Zhang, Qiwu; Liu, Xinzhong

2017-01-01

Al(OH)3 and Ca(OH)2 powders are co-ground to prepare a precursor which hydrates into a layered double hydroxide (LDH) phase by agitation in aqueous solution with target hexavalent chromium (Cr(VI)) at room temperature, to achieve an obvious improvement in removal efficiency of Cr(VI) through an easy incorporation into the structure. Although the prepared precursor transforms into LDH phases also when agitated in the solutions of calcium and magnesium chlorides, it incorporates Cr(VI) preferentially to the chloride salts when they coexist. The adsorption isotherm and kinetic studies show that the phenomena occurring on the Al-Ca precursor fit a pseudo-second-order kinetics with a Langmuir adsorption capacity of 59.45 mg/g. Besides, characterizations of the prepared precursor and the samples after adsorption are also performed by X-ray diffraction (XRD), Fourier transform infrared (FT-IR), Transmission electron microscope (TEM) to understand the reason of the preferential incorporation of Cr(VI) to the coexisting chloride salts during the LDH phase formation. Ca-Al precursor (C3A) was agitated in a hexavalent chromium (Cr(VI)) solution to form Al-Ca-CrO4 LDH product. Ca-Al-CrO4 LDH phase occurred preferentially to Ca-Al-MCl2 LDH phases in the solutions of calcium and magnesium chlorides, it incorporates Cr(VI) preferentially to the chloride salts when they coexist.

Properties of NiO thin films deposited by chemical spray pyrolysis using different precursor solutions

NASA Astrophysics Data System (ADS)

Cattin, L.; Reguig, B. A.; Khelil, A.; Morsli, M.; Benchouk, K.; Bernède, J. C.

2008-07-01

NiO thin films have been deposited by chemical spray pyrolysis using a perfume atomizer to grow the aerosol. The influence of the precursor, nickel chloride hexahydrate (NiCl 2·6H 2O), nickel nitrate hexahydrate (Ni(NO 3) 2·6H 2O), nickel hydroxide hexahydrate (Ni(OH) 2·6H 2O), nickel sulfate tetrahydrate (NiSO 4·4H 2O), on the thin films properties has been studied. In the experimental conditions used (substrate temperature 350 °C, precursor concentration 0.2-0.3 M, etc.), pure NiO thin films crystallized in the cubic phase can be achieved only with NiCl 2 and Ni(NO 3) 2 precursors. These films have been post-annealed at 425 °C for 3 h either in room atmosphere or under vacuum. If all the films are p-type, it is shown that the NiO films conductivity and optical transmittance depend on annealing process. The properties of the NiO thin films annealed under room atmosphere are not significantly modified, which is attributed to the fact that the temperature and the environment of this annealing is not very different from the experimental conditions during spray deposition. The annealing under vacuum is more efficient. This annealing being proceeded in a vacuum no better than 10 -2 Pa, it is supposed that the modifications of the NiO thin film properties, mainly the conductivity and optical transmission, are related to some interaction between residual oxygen and the films.

Effects of calcium magnesium acetate on small lentic environments in interior Alaska

DOT National Transportation Integrated Search

1986-08-01

The use of deicing compounds on winter roads has become an accepted practice for snow and ice removal in northern areas. The most commonly employed compounds have been the chloride salts sodium chloride (NaCl) and calcium chloride (CaCl(2)). The appl...

Recovery of phosphorous from industrial waste water by oxidation and precipitation.

PubMed

Ylmén, Rikard; Gustafsson, Anna M K; Camerani-Pinzani, Caterina; Steenari, Britt-Marie

2017-07-03

This paper describes the development of a method for recovery of phosphorous from one of the waste waters at an Akzo Nobel chemical plant in Ale close to Göteborg. It was found that it is possible to transform the phosphorous in the waste water to a saleable product, i.e. a slowly dissolving fertilizer. The developed process includes oxidation of phosphite to phosphate with hydrogen peroxide and heat. The phosphate is then precipitated as crystalline struvite (ammonium magnesium phosphate) by the addition of magnesium chloride. The environmental impacts of the new method were compared with those of the current method using life cycle assessment. It was found that the methodology developed in this project was an improvement compared with the current practice regarding element resource depletion and eutrophication. However, the effect on global warming would be greater with the new method. There could however be several ways to decrease the global warming effect. Since most of the carbon dioxide emissions come from the production of magnesium chloride from carbonates, changing to utilization of a magnesium chloride from desalination of seawater or from recycling of PVC would decrease the carbon footprint significantly.

Improved Enumeration of Streptomyces spp. on a Starch Casein Salt Medium

PubMed Central

Mackay, Shirley J.

1977-01-01

Well-formed Streptomyces colonies were counted more rapidly when a starch casein medium containing antibiotics was supplemented with either magnesium chloride or additional sodium chloride. Images PMID:848946

Hyperhidrosis plantaris - a randomized, half-side trial for efficacy and safety of an antiperspirant containing different concentrations of aluminium chloride.

PubMed

Streker, Meike; Reuther, Tilmann; Hagen, Linda; Kerscher, Martina

2012-02-01

Primary focal hyperhidrosis plantaris can cause impairment in social, physical, leisure and occupational activities. Topical treatment with aluminium chloride is the first-line treatment. The aim of this trial was to evaluate efficacy and safety of two different concentrations of aluminium chloride hexa-hydrate (12.5%, 30%) for 6 weeks. 20 volunteers with hyperhidrosis plantaris were included. Efficacy was evaluated using a clinical rating scale of the hyperhidrosis level and qualitative assessments including Minor's (iodine-starch) test and a standardized sniff test. Furthermore a patient questionnaire and measurements of skin surface pH were done to evaluate the subjective assessments and side effects. The hyperhidrosis level significantly decreased in both concentrations. There were no differences in tolerability regarding the skin surface pH and the patient questionnaires. In addition the hidrotic areas decreased after application of both products and the sniff test improved. Topical application of an antiperspirant containing aluminium chloride reduced sweat production in plantar hyperhidrosis significantly. As both 12.5% and 30% were efficacious and safe, we would recommend 12.5% for outpatient treatment. © The Author • Journal compilation © Blackwell Verlag GmbH, Berlin.

Effects of transdermal magnesium chloride on quality of life for patients with fibromyalgia: a feasibility study.

PubMed

Engen, Deborah J; McAllister, Samantha J; Whipple, Mary O; Cha, Stephen S; Dion, Liza J; Vincent, Ann; Bauer, Brent A; Wahner-Roedler, Dietlind L

2015-09-01

Fibromyalgia is a syndrome characterized by chronic pain, fatigue, depression, and sleep disturbances. Its primary cause is unclear. Several studies have reported decreased intracellular magnesium levels in patients with fibromyalgia and have found negative correlation between magnesium levels and fibromyalgia symptoms. To gather preliminary data on whether transdermal magnesium can improve quality of life for women who have fibromyalgia. This is a patient questionnaires and survey in a fibromyalgia clinic at a tertiary medical center. Forty female patients with the diagnosis of fibromyalgia were enrolled. Each participant was provided a spray bottle containing a transdermal magnesium chloride solution and asked to apply 4 sprays per limb twice daily for 4 weeks. Participants were asked to complete the Revised Fibromyalgia Impact Questionnaire, SF-36v2 Health Survey, and a quality-of-life analog scale at baseline, week 2, and week 4. Questionnaire and survey scores, evaluated through intent-to-treat and per-protocol analyses. Twenty-four patients completed the study (mean [SD] age, 57.2 [7.6] years; white, 95%; mean body mass index, 31.3 kg/m2). With intention-to-treat analysis, Revised Fibromyalgia Impact Questionnaire subscale and total scores were significantly improved at week 2 and week 4 (total score, P=0.001). Per-protocol analysis results were similar: all subscales of the Revised Fibromyalgia Impact Questionnaire were significantly improved at week 2 and week 4 (total score, P=0.001). This pilot study suggests that transdermal magnesium chloride applied on upper and lower limbs may be beneficial to patients with fibromyalgia. ClinicalTrials.gov.ldentifier NCT01968772.

The effects of magnesium on potassium transport in ferret red cells.

PubMed Central

Flatman, P W

1988-01-01

1. The magnesium dependence of net and isotopic (using 86Rb as tracer) potassium transport was measured in fed ferret red cells. Bumetanide (0.1 mM) was used to dissect total flux into two components: bumetanide sensitive and bumetanide resistant. 2. Increasing the external magnesium concentration from zero (added) to 2 mM stimulated bumetanide-sensitive uptake by 16% but inhibited the bumetanide-resistant component by about 20%. 3. Ionophore A23187 was used to control internal magnesium concentration. A23187 was usually present in the cells during measurement of isotopic fluxes but was washed away before measurement of net fluxes. The magnesium-buffering characteristics of fed ferret red cells were assessed during these experiments. The cytoplasm acts as a high-capacity, low-affinity magnesium buffer over most of the range. Some high-affinity binding was seen in the presence of A23187 and 2 mM-EDTA. 4. A23187 itself slightly inhibits bumetanide-sensitive potassium transport. 5. Bumetanide-sensitive potassium transport is strongly dependent on the concentration of internal ionized magnesium. Transport is 35% maximal at 10(-7) M and increases up to the maximal rate at 1.3 mM. Further increase in ionized magnesium concentration to 3.5 mM has no additional effect. The curve relating activity to magnesium concentration is steepest at the physiological magnesium concentration. The effects of changing magnesium concentration are fully reversible. 6. Reduction of internal ionized magnesium concentration to 10(-7) M with A23187 and EDTA approximately doubles bumetanide-resistant potassium transport. 7. Bumetanide-sensitive fluxes occur via the sodium-potassium-chloride co-transport system under the conditions used. Results described in this paper thus suggest that internal magnesium may be an important physiological controller of sodium-potassium-chloride co-transport activity. PMID:3137332

Studies on topical antiperspirant control of axillary hyperhidrosis.

PubMed

Shelley, W B; Hurley, H J

1975-01-01

Axillary hyperhidrotics is reviewed from the standpoint of anatomical factors, physiological mechanisms and the history of methods of control. Anhydrous aluminum chloride and anhydrous zirconium tetrachloride are shown to be superior topical agents for partial control of axillary sweating when applied as a powder or in anhydrous nonreactive vehicles. Complete anhidrosis as demonstrated by sustained garment armpit dryness could be achieved in hyperhidrotics within 48 hours by the following trinary antiperspirant system: (1) a saturated solution of aluminum chloride hexahydrate or zirconyl chloride in absolute ethanol or isopropyl alcohol, (2) application to the dry axilla at times of sleep or other prolonged non-sweating period, (3) water vapor occlusion of area for 6 to 8 hours by means of Saran wrap. The hypothesis is presented that metallic antiperspirants act by reflux entrance into the terminal intraepidermal eccrine duct, slowly combining with the intraductal keratin, to produce a fibrillar contraction (super contraction) of keratin and hence functional closure, not histologically evident. This altered keratin is shed weeks later, with the consequent return of ductal patency and sweating.

Corrosion in Magnesium and a Magnesium Alloy

NASA Astrophysics Data System (ADS)

Akavipat, Sanay

Magnesium and a magnesium alloy (AZ91C) have been ion implanted over a range of ions energies (50 to 150 keV) and doses (1 x 10('16) to 2 x 10('17) ions/cm('2)) to modify the corrosion properties of the metals. The corrosion tests were done by anodic polarization in chloride -free and chloride-containing aqueous solutions of a borated -boric acid with a pH of 9.3. Anodic polarization measurements showed that some implantations could greatly reduce the corrosion current densities at all impressed voltages and also increased slightly the pitting potential, which indicated the onset of the chloride attack. These improvements in corrosion resistance were caused by boron implantations into both types of samples. However, iron implantations were found to improve only the magnesium alloy. To study the corrosion in more detail, Scanning Auger Microprobe Spectrometer (SAM), Scanning Electron Microscope (SEM) with an X-ray Energy Spectrometry (XES) attachment, and Transmission Electron Microscope (TEM) measurements were used to analyze samples before, after, and at various corrosion stages. In both the unimplanted pure magnesium and AZ91C samples, anodic polarization results revealed that there were three active corrosion stages (Stages A, C, and E) and two passivating stages (Stages B and D). Examination of Stages A and B in both types of samples showed that only a mild, generalized corrosion had occurred. In Stage C of the TD samples, a pitting breakdown in the initial oxide film was observed. In Stage C of the AZ91C samples, galvanic and intergranular attack around the Mg(,17)Al(,12) intermetallic islands and along the matrix grain boundaries was observed. Stage D of both samples showed the formation of a thick, passivating oxygen containing, probably Mg(OH)(,2) film. In Stage E, this film was broken down by pits, which formed due to the presence of the chloride ions in both types of samples. Stages A through D of the unimplanted samples were not seen in the boron or iron implanted samples. Instead one low current density passivating stage was formed, which was ultimately broken down by the chloride attack. It is believed that the implantation of boron modified the initial surface film to inhibit corrosion, whereas the iron implantation modified the intermetallic (Mg(,17)Al(,12)) islands to act as sacrificial anodes.

DESCRIPTIVE ANALYSIS OF DIVALENT SALTS

PubMed Central

YANG, HEIDI HAI-LING; LAWLESS, HARRY T.

2005-01-01

Many divalent salts (e.g., calcium, iron, zinc), have important nutritional value and are used to fortify food or as dietary supplements. Sensory characterization of some divalent salts in aqueous solutions by untrained judges has been reported in the psychophysical literature, but formal sensory evaluation by trained panels is lacking. To provide this information, a trained descriptive panel evaluated the sensory characteristics of 10 divalent salts including ferrous sulfate, chloride and gluconate; calcium chloride, lactate and glycerophosphate; zinc sulfate and chloride; and magnesium sulfate and chloride. Among the compounds tested, iron compounds were highest in metallic taste; zinc compounds had higher astringency and a glutamate-like sensation; and bitterness was pronounced for magnesium and calcium salts. Bitterness was affected by the anion in ferrous and calcium salts. Results from the trained panelists were largely consistent with the psychophysical literature using untrained judges, but provided a more comprehensive set of oral sensory attributes. PMID:16614749

Cloning, expression, purification, crystallization and X-ray crystallographic analysis of recombinant human C1ORF123 protein

PubMed Central

Rahaman, Siti Nurulnabila A.; Mat Yusop, Jastina; Mohamed-Hussein, Zeti-Azura; Ho, Kok Lian; Teh, Aik-Hong; Waterman, Jitka; Ng, Chyan Leong

2016-01-01

C1ORF123 is a human hypothetical protein found in open reading frame 123 of chromosome 1. The protein belongs to the DUF866 protein family comprising eukaryote-conserved proteins with unknown function. Recent proteomic and bioinformatic analyses identified the presence of C1ORF123 in brain, frontal cortex and synapses, as well as its involvement in endocrine function and polycystic ovary syndrome (PCOS), indicating the importance of its biological role. In order to provide a better understanding of the biological function of the human C1ORF123 protein, the characterization and analysis of recombinant C1ORF123 (rC1ORF123), including overexpression and purification, verification by mass spectrometry and a Western blot using anti-C1ORF123 antibodies, crystallization and X-ray diffraction analysis of the protein crystals, are reported here. The rC1ORF123 protein was crystallized by the hanging-drop vapor-diffusion method with a reservoir solution comprised of 20% PEG 3350, 0.2 M magnesium chloride hexahydrate, 0.1 M sodium citrate pH 6.5. The crystals diffracted to 1.9 Å resolution and belonged to an orthorhombic space group with unit-cell parameters a = 59.32, b = 65.35, c = 95.05 Å. The calculated Matthews coefficient (V M) value of 2.27 Å3 Da−1 suggests that there are two molecules per asymmetric unit, with an estimated solvent content of 45.7%. PMID:26919524

Evaluation of an alternative deicing chemical vs. conventional sodium chloride.

DOT National Transportation Integrated Search

2004-07-01

A research project was initiated to evaluate the performance and cost effectiveness of a proprietary, pre-blended, : roadway-deicing chemical on New Hampshire highways. The evaluated material is a patented blend of sodium chloride, liquid : magnesium...

Effect of various electrolytes upon cardiac and skeletal musculature

PubMed Central

Selye, H.; Bajusz, E.

1959-01-01

In rats kept on a low-potassium diet that contains only maintenance levels of magnesium, cardiac necroses and muscular cramps were readily induced by the oral administration of sodium perchlorate or disodium hydrogen phosphate. The precipitation of these cardiac and skeletal muscle changes by sodium chlorate was prevented by the prophylactic administration of either potassium or magnesium chlorides. The protective effect of these chlorides against the cardiotoxic and convulsive effects of disodium hydrogen phosphate has already been demonstrated by our earlier experiments. Sodium sulphate produced cardiac necroses in rats maintained on the same diet, and both potassium and magnesium chlorides had a prophylactic action. Unlike sodium perchlorate, however, sodium sulphate produced no muscular cramps under these conditions. Equimolecular amounts of sodium given in the form of sodium chloride (instead of sodium perchlorate, sodium sulphate, or disodium hydrogen phosphate) did not cause cardiac necroses or muscular cramps in rats maintained on the potassium-deficient diet. As the same three sodium salts, namely the perchlorate, the sulphate, and the hydrogen phosphate, produced cardiac necroses in rats sensitized by either a potassium-deficient diet or by certain corticoids, it seems that the anion must play a decisive rôle, since equivalent amounts of NaCl are ineffective. PMID:13651583

Evaluation of Deicer Impacts on Pervious Concrete Specimens (Phase II)

DOT National Transportation Integrated Search

2018-05-01

This research examined the chemical degradation of pervious concrete due to calcium chloride or magnesium chloride deicers. The project consisted of Phase I, Phase IIa, and Phase IIb. Phase I was previous work where a testing protocol was developed t...

Nano-Structured Magnesium Oxide Coated Iron Ore: Its Application to the Remediation of Wastewater Containing Lead.

PubMed

Nagarajah, Ranjini; Jang, Min; Pichiah, Saravanan; Cho, Jongman; Snyder, Shane A

2015-12-01

Magnetically separable nano-structured magnesium oxide coated iron ore (IO(MgO)) was prepared using environmentally benign chemicals, such as iron ore (IO), magnesium(II) nitrate hexahydrate [Mg(NO3)2 x 6H2O] and urea; via an easy and fast preparation method. The lO(MgO) was characterized using X-ray diffraction (XRD), field-emission scanning electron microscopy (FE-SEM), energy-dispersive X-ray spectroscopy (EDS) and alternating gradient magnetometer (AGM) analyses. The isotherm and kinetic studies indicated that lO(MgO) has a comparably higher Langmuir constant (K(L), 1.69 L mg(-1)) and maximum sorption capacity (33.9 mg g(-1)) for lead (Pb) than other inorganic media. Based on MgO amount, the removal capacity of Pb by IO(MgO) was 2,724 mg Pb (g MgO)(-1), which was higher than that (1,980 mg g(-1)) for flowerlike magnesium oxide nanostructures reported by Cao et al. The kinetics, FE-SEM, elemental mapping and XRD results revealed that the substitution followed by precipitation was identified as the mechanism of Pb removal and plumbophyllite (Pb2Si4O10 x H2O) was the precipitated phase of Pb. A leaching test revealed that IOMgO) had negligible concentrations of leached Fe at pH 4-9. Since the base material, IO, is cheap and easily available, lO(MgO) could be produced in massive amounts and used for remediation of wastewater containing heavy metals, applying simple and fast magnetic separation.

Deicing chemicals as source of constituents of highway runoff

USGS Publications Warehouse

Granato, G.E.

1996-01-01

The dissolved major and trace constituents of deicing chemicals as a source of constituents in highway runoff must be quantified for interpretive studies of highway runoff and its effects on surface water and groundwater. Dissolved constituents of the deicing chemicals-sodium chloride, calcium chloride, and premix (a mixture of sodium and calcium chloride)-were determined by analysis of salt solutions created in the laboratory and are presented as mass ratios to chloride. Deicing chemical samples studied are about 98 and 97 percent pure sodium chloride and calcium chloride, respectively: however, each has a distinct major and trace ion constituent signature. The greatest impurity in sodium chloride road sail samples was sulfate, followed by calcium, potassium, bromide, vanadium, magnesium, fluoride, and other constituents with a ratio to chloride of less than 0.0001 by mass. The greatest impurity in the calcium chloride road salt samples was sodium, followed by potassium, sulfate, bromide, silica, fluoride. strontium, magnesium, and other constituents with a ratio to chloride of less than 0.0001 by mass. Major constituents of deicing chemicals in highway runoff may account for a substantial source of annual chemical loads. Comparison of estimated annual loads and first flush concentrations of deicing chemical constituents in highway runoff with those reported in the literature indicate that although deicing chemicals are not a primary source of trace constituents, they are not a trivial source, either. Therefore, deicing chemicals should be considered as a source of many major and trace constituents in highway and urban runoff.

Characterization of crystalline structures in Opuntia ficus-indica.

PubMed

Contreras-Padilla, Margarita; Rivera-Muñoz, Eric M; Gutiérrez-Cortez, Elsa; del López, Alicia Real; Rodríguez-García, Mario Enrique

2015-01-01

This research studies the crystalline compounds present in nopal (Opuntia ficus-indica) cladodes. The identification of the crystalline structures was performed using X-ray diffraction, scanning electron microscopy, mass spectrometry, and Fourier transform infrared spectroscopy. The crystalline structures identified were calcium carbonate (calcite) [CaCO3], calcium-magnesium bicarbonate [CaMg(CO3)2], magnesium oxide [MgO], calcium oxalate monohydrate [Ca(C2O4)•(H2O)], potassium peroxydiphosphate [K4P2O8] and potassium chloride [KCl]. The SEM images indicate that calcite crystals grow to dipyramidal, octahedral-like, prismatic, and flower-like structures; meanwhile, calcium-magnesium bicarbonate structures show rhombohedral exfoliation and calcium oxalate monohydrate is present in a drusenoid morphology. These calcium carbonate compounds have a great importance for humans because their bioavailability. This is the first report about the identification and structural analysis of calcium carbonate and calcium-magnesium bicarbonate in nopal cladodes, as well as the presence of magnesium oxide, potassium peroxydiphosphate and potassium chloride in these plants. The significance of the study of the inorganic components of these cactus plants is related with the increasing interest in the potential use of Opuntia as a raw material of products for the food, pharmaceutical, and cosmetic industries.

Investigation of corrosion behavior of biodegradable magnesium alloys using an online-micro-flow capillary flow injection inductively coupled plasma mass spectrometry setup with electrochemical control

NASA Astrophysics Data System (ADS)

Ulrich, A.; Ott, N.; Tournier-Fillon, A.; Homazava, N.; Schmutz, P.

2011-07-01

The development of biodegradable metallic materials designed for implants or medical stents is new and is one of the most interesting new fields in material science. Besides biocompatibility, a detailed understanding of corrosion mechanisms and dissolution processes is required to develop materials with tailored degradation behavior. The materials need to be sufficiently stable as long as they have to fulfill their medical task. However, subsequently they should dissolve completely in a controlled manner in terms of maximum body burden. This study focuses on the elemental and time resolved dissolution processes of a magnesium rare earth elements alloy which has been compared to pure magnesium with different impurity level. The here described investigations were performed using a novel analytical setup based on a micro-flow capillary online-coupled via a flow injection system to a plasma mass spectrometer. Differences in element-specific and time-dependent dissolution were monitored for various magnesium alloys in contact with sodium chloride or mixtures of sodium and calcium chloride as corrosive media. The dissolution behavior strongly depends on bulk matrix elements, secondary alloying elements and impurities, which are usually present even in pure magnesium.

Magnesium compounds

USGS Publications Warehouse

Kramer, D.A.

2004-01-01

Dead-burned and caustic-calcined magnesias were recovered from seawater by Premier Chemicals in Florida; from well brines in Michigan by Dow Chemical, Martin Marietta Magnesia Specialties, and Rohm & Haas; and from magnesite in Nevada by Premier Chemicals. Reilly Industries and Great Salt Lake Minerals recovered magnesium chloride brines from the Great Salt Lake in Utah.

Magnesium Bisamide-Mediated Halogen Dance of Bromothiophenes.

PubMed

Yamane, Yoshiki; Sunahara, Kazuhiro; Okano, Kentaro; Mori, Atsunori

2018-03-16

A magnesium bisamide-mediated halogen dance of bromothiophenes is described. The thienylmagnesium species generated in situ is more stable than the corresponding thienyllithium species, which was applied to trap the transient anion species with several electrophiles, such as allyl iodide, phenyl isocyanate, and tributylstannyl chloride. The utility of the magnesium bisamide-mediated halogen dance is useful in the concise synthesis of a medicinally advantageous compound via a one-pot, ester-directed halogen dance/Negishi cross coupling.

Modulation of enzyme catalytic properties and biosensor calibration parameters with chlorides: studies with glucose oxidase.

PubMed

Kagan, Margarita; Kivirand, Kairi; Rinken, Toonika

2013-09-10

We studied the modulation of calibration parameters of biosensors, in which glucose oxidase was used for bio-recognition, in the presence of different chlorides by following the transient phase dynamics of oxygen concentration with an oxygen optrode. The mechanism of modulation was characterized with the changes of the glucose oxidase catalytic constant and oxygen diffusion constant. The modulation of two biosensor calibration parameters were studied: the maximum calculated signal change was amplified for about 20% in the presence of sodium and magnesium chlorides; the value of the kinetic parameter decreased along with the addition of salts and increased only at sodium chloride concentrations over 0.5 mM. Besides glucose bioassay, the amplification of calibration parameters was also studied in cascaded two-enzyme lactose biosensor, where the initial step of lactose bio-recognition, the β-galactosidase - catalyzed lactose hydrolysis, was additionally accelerated by magnesium ions. Copyright © 2013 Elsevier Inc. All rights reserved.

Contamination of lithium heparin blood by K2-ethylenediaminetetraacetic acid (EDTA): an experimental evaluation.

PubMed

Lima-Oliveira, Gabriel; Salvagno, Gian Luca; Danese, Elisa; Brocco, Giorgio; Guidi, Gian Cesare; Lippi, Giuseppe

2014-01-01

The contamination of serum or lithium heparin blood with ethylenediaminetetraacetic acid (EDTA) salts may affect accuracy of some critical analytes and jeopardize patient safety. The aim of this study was to evaluate the effect of lithium heparin sample contamination with different amounts of K2EDTA. Fifteen volunteers were enrolled among the laboratory staff. Two lithium heparin tubes and one K2EDTA tube were collected from each subject. The lithium-heparin tubes of each subject were pooled and divided in 5 aliquots. The whole blood of K2EDTA tube was then added in scalar amount to autologous heparinised aliquots, to obtained different degrees of K2EDTA blood volume contamination (0%; 5%; 13%; 29%; 43%). The following clinical chemistry parameters were then measured in centrifuged aliquots: alanine aminotranspherase (ALT), bilirubin (total), calcium, chloride, creatinine, iron, lactate dehydrogenase (LD), lipase, magnesium, phosphate, potassium, sodium. A significant variation starting from 5% K2EDTA contamination was observed for calcium, chloride, iron, LD, magnesium (all decreased) and potassium (increased). The variation of phosphate and sodium (both increased) was significant after 13% and 29% K2EDTA contamination, respectively. The values of ALT, bilirubin, creatinine and lipase remained unchanged up to 43% K2EDTA contamination. When variations were compared with desirable quality specifications, the bias was significant for calcium, chloride, LD, magnesium and potassium (from 5% K2EDTA contamination), sodium, phosphate and iron (from 29% K2EDTA contamination). The concentration of calcium, magnesium, potassium, chloride and LD appears to be dramatically biased by even modest K2EDTA contamination (i.e., 5%). The values of iron, phosphate, and sodium are still reliable up to 29% K2EDTA contamination, whereas ALT, bilirubin, creatinine and lipase appear overall less vulnerable towards K2EDTA contamination.

A METHOD OF PREPARING URANIUM DIOXIDE

DOEpatents

Scott, F.A.; Mudge, L.K.

1963-12-17

A process of purifying raw, in particular plutonium- and fission- products-containing, uranium dioxide is described. The uranium dioxide is dissolved in a molten chloride mixture containing potassium chloride plus sodium, lithium, magnesium, or lead chloride under anhydrous conditions; an electric current and a chlorinating gas are passed through the mixture whereby pure uranium dioxide is deposited on and at the same time partially redissolved from the cathode. (AEC)

Magneto-optical investigation of MgSO3·6H2O with polarized light

NASA Astrophysics Data System (ADS)

Petkova, P.

2017-10-01

The crystals of magnesium sulphite hexahydrate (MgSO3·6H2O) belong to point group C3 (no center of symmetry). They possess gyrotropy and nonlinear optical properties. The refractive index no and ne, the angle of Faraday rotation φ(λ), the Verdet constant V(λ), the magneto-optic anomaly factor γ(λ) and the density of oscillators N of MgSO3·6H2O single crystals have been studied in the present work. The investigations were carried out in the spectral range 300 - 800 nm with linear polarized light E ⃗ ⊥ c ̅ , E ⃗ | | c ̅ (c ̅ is the optical axis of MgSO3·6H2O) propagated in the direction (10 1 ̅ 0) .

Prediction of Physical Properties of Nanofiltration Membranes for Neutral and Charged Solutes

EPA Science Inventory

Two commercial nanofiltration (NF) membranes viz., NF 300 MWCO and NF 250 MWCO were used for neutral and charged solute species viz., glucose, sodium chloride and magnesium chloride to investigate their rejection rates using Donnan steric pore model (DSPM) and DSPM-dielectric exc...

Preparation of biocompatible magnetite-carboxymethyl cellulose nanocomposite: characterization of nanocomposite by FTIR, XRD, FESEM and TEM.

PubMed

Habibi, Neda

2014-10-15

The preparation and characterization of magnetite-carboxymethyl cellulose nano-composite (M-CMC) material is described. Magnetite nano-particles were synthesized by a modified co-precipitation method using ferrous chloride tetrahydrate and ferric chloride hexahydrate in ammonium hydroxide solution. The M-CMC nano-composite particles were synthesized by embedding the magnetite nanoparticles inside carboxymethyl cellulose (CMC) using a freshly prepared mixture of Fe3O4 with CMC precursor. Morphology, particle size, and structural properties of magnetite-carboxymethyl cellulose nano-composite was accomplished using X-ray powder diffraction (XRD), transmission electron microscopy (TEM), Fourier transformed infrared (FTIR) and field emission scanning electron microscopy (FESEM) analysis. As a result, magnetite nano-particles with an average size of 35nm were obtained. The biocompatible Fe3O4-carboxymethyl cellulose nano-composite particles obtained from the natural CMC polymers have a potential range of application in biomedical field. Copyright © 2014 Elsevier B.V. All rights reserved.

Thermal reactive hazards of HMX with contaminants.

PubMed

Peng, Deng-Jr; Chang, Cheng-Ming; Chiu, Miin

2004-10-18

In the past, many unexpected runaway accidents occurred in manufacturing processes, involving volatile chemical and explosive storage and transportation. Incompatible product reactions of high explosives must be carefully considered using loss prevention strategies for thermal hazards risk analysis. High explosive reactions vary via environmental changes, contact materials, or process situations, such as onset temperature and shifts in reaction type when high explosives are in contact with contaminants. Therefore, the manufacture and handling of high explosives require the utmost in safety and loss prevention. HMX (cyclotetramethyene tetranitramine) is one kind of high explosive widely used around the world which is stable with high detonation strength properties. In this study, the influences of contaminants on HMX are investigated. The studied contaminants include ferrous chloride tetrahydrate, ferric chloride hexahydrate, acetone solution, acetic acid, and nitric acid. DSC thermal curves and incompatible reaction kinetic evaluations were preformed using iron, chlorine and acid. Organic acetone solution has lesser effects on HMX. Hopefully, this study will lead to improved thermal hazards risk analysis and reduce accidents.

Magnesium compounds

USGS Publications Warehouse

Kramer, D.A.

2010-01-01

Seawater and natural brines accounted for about 40 percent of U.S. magnesium compounds production in 2009. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties from well brines in Michigan. Caustic-calcined magnesia was recovered from seawater by Premier Chemicals in Florida, from well brines in Michigan by Martin Marietta and from magnesite in Nevada by Premier Chemicals. Intrepid Potash-Wendover, and Great Salt Lake Minerals Corp. recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from seawater by SPI Pharma in Delaware and Premier Chemicals in Florida, and by Martin Marietta from its operation mentioned above.

Magnesium compounds

USGS Publications Warehouse

Kramer, D.A.

2011-01-01

Seawater and natural brines accounted for about 54 percent of U.S. magnesium compounds production in 2010. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties from well brines in Michigan. Caustic-calcined magnesia was recovered from seawater by Premier Magnesia in Florida, from well brines in Michigan by Martin Marietta and from magnesite in Nevada by Premier Magnesia. Intrepid Potash-Wendover and Great Salt Lake Minerals Corp. recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from seawater by SPI Pharma in Delaware and Premier Magnesia in Florida, and by Martin Marietta from its operation mentioned above.

Corrosion resistant properties of polyaniline acrylic coating on magnesium alloy

NASA Astrophysics Data System (ADS)

Sathiyanarayanan, S.; Azim, S. Syed; Venkatachari, G.

2006-12-01

The performance of the paint coating based on acrylic-polyaniline on magnesium alloy ZM 21 has been studied by electrochemical impedance spectroscopy in 0.5% NaCl solution. The polyaniline was prepared by chemical oxidative method of aniline with ammonium persulphate in phosphoric acid medium. The phosphate-doped polyaniline was characterized by FTIR and XRD methods. Acrylic paint containing the phosphate-doped polyaniline was prepared and coated on magnesium ZM 21 alloy. The coating was able to protect the magnesium alloy and no base metal dissolution was noted even after 75 days exposure to sodium chloride solution.

Concentrating molasses distillery wastewater using biomimetic forward osmosis (FO) membranes.

PubMed

Singh, N; Petrinic, I; Hélix-Nielsen, C; Basu, S; Balakrishnan, M

2018-03-01

Treatment of sugarcane molasses distillery wastewater is challenging due to the presence of complex phenolic compounds (melanoidins and polyphenols) having antioxidant properties. Due to zero liquid discharge regulations, Indian distilleries continue to explore effective treatment options. This work examines the concentration of distillery wastewater by forward osmosis (FO) using aquaporin biomimetic membranes and magnesium chloride hexahydrate (MgCl 2 .6H 2 O) as draw solution. The operational parameters viz. feed solution and draw solution flow rate and draw solution concentration were optimized using 10% v/v melanoidins model feed solution. This was followed by trials with distillery wastewater. Under the conditions of this work, feed and draw flow rates of 1 L/min and draw solution concentration of 2M MgCl 2 .6H 2 O for melanoidins model solution and 3M MgCl 2 .6H 2 O for distillery wastewater were optimal for maximum rejection. Rejection of 90% melanoidins, 96% antioxidant activity and 84% COD was obtained with melanoidins model feed, with a corresponding water flux of 6.3 L/m 2 h. With as-received distillery wastewater, the rejection was similar (85-90%) to the melanoidins solution, but the water flux was lower (2.8 L/m 2 h). Water recovery from distillery wastewater over 24 h study period was higher with FO (70%) than reported for RO (35-45%). Repeated use of the FO membrane over five consecutive 24 h cycles with fresh feed and draw solutions and periodic cleaning showed consistent average water flux and rejection of the feed constituents. Copyright © 2017 Elsevier Ltd. All rights reserved.

Cathodic Deposition of Mg(OH)2 Coatings on Pure mg in Three mg Salts Aqueous Solutions

NASA Astrophysics Data System (ADS)

Yongjun, Zhang; Xiaomeng, Pei; Shugong, Jia

Film-forming effects of cathodic deposition on pure Mg substrate at constant DC in aqueous solutions of magnesium nitrate (Mg(NO3)2ṡ6H2O), magnesium chloride (MgCl2ṡ6H2O) and magnesium sulfate (MgSO4ṡ7H2O) respectively were investigated systematically. Typical processes were studied by potentiodynamic cathodic polarization and galvanostatic polarization and typical samples were analyzed by SEM and XRD. The results indicate that the depositing efficiency is not only the highest but stablest, and deposited coatings show the best uniformity with Mg(NO3)2ṡ6H2O solution employed as depositing medium and applied current density ≥1.0mA cm-2. Cathodic deposition leads to regular mass loss of Mg substrate. The cathodic polarization curve of pure Mg in magnesium nitrate solution shows more obvious pseudo-passivation, several Tafel regions with different slopes appearing before diffusion-limited current density region, and oxygen consumption is the major cathodic reduction reaction under specified current density. However, hydrogen evolution reaction is dominant in both Mg chloride and Mg sulfate solutions. The deposition coatings are all composed of continuous and uniform mesh-like “basic layer” adjacent to substrate and discrete distributed snowball-like particles on the microscopic scale. The phase compositions are all crystal Mg(OH)2, and the coatings deposited in Mg chloride solution have (011) preferred orientation.

Humane studies of octopuses get a boost

NASA Astrophysics Data System (ADS)

Staaf, Danna

2018-04-01

Because of their complex brains, cephalopods enjoy the same protections as vertebrate animals in laboratory experiments in the European Union, New Zealand, and some Australian states. As a result, researchers have to use anesthesia in cephalopod studies that can cause pain. Most use either ethanol or magnesium chloride for this purpose because they immobilize cephalopods quickly and the animals soon recover without lasting effects. But until now it was unclear whether these compounds actually take away pain or just paralyze the animals. Now, a new study in three species suggests that both ethanol and magnesium chloride suppress pain signals in cephalopods, reassuring researchers they are compliant with the law and treating their subjects humanely.

Optical parameters and dispersion behavior of potassium magnesium chloride sulfate single crystals doped with Co+2 ions

NASA Astrophysics Data System (ADS)

Abu El-Fadl, A.; Abd-Elsalam, A. M.

2018-05-01

Single crystals of potassium magnesium chloride sulfate (KMCS) doped with cobalt ions were grown by slow cooling method. Powder XRD study confirmed the monoclinic structure of the grown crystals. The functional group vibrations were checked through FTIR spectroscopy measurements. In optical studies, the absorbance behavior of the crystals and their optical energy gap were established by Tauc plot. The refractive index, the extinction coefficient and other optical constants were calculated for the grown crystals. The normal dispersion of the refractive index was analyzed according to single oscillator Sellmeier's model. The Urbach's rule was applied to analyze the localized states density in the forbidden gap.

Formation of liquid water at low temperatures via the deliquescence of calcium chloride: Implications for Antarctica and Mars

NASA Astrophysics Data System (ADS)

Gough, R. V.; Chevrier, V. F.; Tolbert, M. A.

2016-10-01

There is significant interest in the potential existence of even small amounts of liquid brine on current Mars. It has been proposed that aqueous solutions could form on Mars via the deliquescence of hygroscopic salts in contact with atmospheric water vapor, and these hygroscopic salts have recently been detected in recurring slope linae (RSL). While past work has largely focused on perchlorate species, another Mars-relevant salt that has a low eutectic temperature and may be deliquescent is calcium chloride, CaCl2. This salt may be linked to RSL formation on Mars, and deliquescence of CaCl2 is also known to be responsible for the only terrestrial RSL analog features known thus far: water tracks in the McMurdo Dry Valleys. Here we use Raman microscopy to monitor the low-temperature (223-273 K) deliquescence (solid to aqueous phase transition) and efflorescence (aqueous to solid phase transition) of two hydration states of CaCl2, the dihydrate and the hexahydrate. We find the deliquescence relative humidity (DRH) decreases with decreasing hydration state and with increasing temperature. Average DRH values over the temperature range studied are 15.8±3.5% RH for the dihydrate and 63.3±12.5% RH for the hexahydrate, making this salt at least as deliquescent as many perchlorate salts. A remarkable property of CaCl2 is its ability to persist as metastable, supersaturated brine. Once an aqueous solution was formed, efflorescence (recrystallization) of the liquid did not occur until single-digit RH values were reached (3.9±2.4% RH on average). We show that temperature and relative humidity conditions in the martian subsurface are sufficient to allow deliquescence of CaCl2, and the resulting brines may persist for over half of a martian sol. Therefore, this salt could play a role in RSL formation, the martian water cycle, and have implications for the potential habitability of Mars.

Magnesium compounds

USGS Publications Warehouse

Kramer, D.A.

2012-01-01

Seawater and natural brines accounted for about 57 percent of magnesium compounds produced in the United States in 2011. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties LLC from well brines in Michigan. Caustic-calcined magnesia was recovered from seawater by Premier Magnesia LLC in Florida, from well brines in Michigan by Martin Marietta and from magnesite in Nevada by Premier Magnesia. Intrepid Potash Wendover LLC and Great Salt Lake Minerals Corp. recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from seawater by SPI Pharma Inc. in Delaware and Premier Magnesia in Florida, and by Martin Marietta from its brine operation in Michigan.

Precursor preparation for Ca-Al layered double hydroxide to remove hexavalent chromium coexisting with calcium and magnesium chlorides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhong, Lihua; He, Xiaoman; Qu, Jun

Al(OH){sub 3} and Ca(OH){sub 2} powders are co-ground to prepare a precursor which hydrates into a layered double hydroxide (LDH) phase by agitation in aqueous solution with target hexavalent chromium (Cr(VI)) at room temperature, to achieve an obvious improvement in removal efficiency of Cr(VI) through an easy incorporation into the structure. Although the prepared precursor transforms into LDH phases also when agitated in the solutions of calcium and magnesium chlorides, it incorporates Cr(VI) preferentially to the chloride salts when they coexist. The adsorption isotherm and kinetic studies show that the phenomena occurring on the Al-Ca precursor fit a pseudo-second-order kineticsmore » with a Langmuir adsorption capacity of 59.45 mg/g. Besides, characterizations of the prepared precursor and the samples after adsorption are also performed by X-ray diffraction (XRD), Fourier transform infrared (FT-IR), Transmission electron microscope (TEM) to understand the reason of the preferential incorporation of Cr(VI) to the coexisting chloride salts during the LDH phase formation. - Graphical abstract: Activated Ca-Al hydroxides (C{sub 3}A) transformed into Ca-Al-OH compound when agitated in water. Ca-Al precursor (C{sub 3}A) was agitated in a hexavalent chromium (Cr(VI)) solution to form Al-Ca-CrO{sub 4} LDH product. Ca-Al-CrO{sub 4} LDH phase occurred preferentially to Ca-Al-MCl{sub 2} LDH phases in the solutions of calcium and magnesium chlorides, it incorporates Cr(VI) preferentially to the chloride salts when they coexist. - Highlights: • Activated Ca-Al hydroxides transformed into LDH when agitated in water with some inorganic substances. • Hexavalent Cr was incorporated in the LDH structure at high adsorption capacity. • Ca-Al-Cr LDH phase occurred preferentially to Ca-Al-MCl{sub 2} LDH phases with coexistence. • The prepared Ca-Al hydroxides had high performance as adsorbent even with high salinity of the solution.« less

The simultaneous removal of calcium, magnesium and chloride ions from industrial wastewater using magnesium-aluminum oxide.

PubMed

Hamidi, Roya; Kahforoushan, Davood; Fatehifar, Esmaeil

2013-01-01

In this article, a method for simultaneous removal of calcium, magnesium and chloride by using Mg0.80Al0.20O1.10 as a Magnesium-Aluminum oxide (Mg‒Al oxide) was investigated. Mg‒Al oxide obtained by thermal decomposition of the Mg-Al layered double hydroxide (Mg-Al LDH). The synthesized Mg‒Al oxide were characterized with respect to nitrogen physicosorption, X-ray diffraction (XRD) and field emission scan electron microscopy (FESEM) morphology. Due to high anion-exchange capacity of Mg‒Al oxide, it was employed in simultaneously removal of Cl(-), Mg(+2) and Ca(+2) from distiller waste of a sodium carbonate production factory. For this purpose, experiments were designed to evaluate the effects of quantity of Mg‒Al oxide, temperature and time on the removal process. The removal of Cl(-), Mg(+2) and Ca(+2) from wastewater was found 93.9%, 93.74% and 93.25% at 60°C after 0.5 h, respectively. Results showed that the removal of Cl(-), Mg(+2) and Ca(+2) by Mg‒Al oxide increased with increasing temperature, time and Mg‒Al oxide quantity.

Knockdown of SLC41A1 magnesium transporter promotes mineralization and attenuates magnesium inhibition during osteogenesis of mesenchymal stromal cells.

PubMed

Tsao, Yu-Tzu; Shih, Ya-Yi; Liu, Yu-An; Liu, Yi-Shiuan; Lee, Oscar K

2017-02-21

Magnesium is essential for numerous physiological functions. Magnesium exists mostly in bone and the amount is dynamically regulated by skeletal remodeling. Accelerating bone mass loss occurs when magnesium intake is insufficient; whereas high magnesium could lead to mineralization defects. However, the underlying magnesium regulatory mechanisms remain elusive. In the present study, we investigated the effects of high extracellular magnesium concentration on osteogenic differentiation of mesenchymal stromal/stem cells (MSCs) and the role of magnesium transporter SLC41A1 in the mineralization process. Murine MSCs derived from the bone marrow of BALB/c mouse or commercially purchased human MSCs were treated with osteogenic induction medium containing 5.8 mM magnesium chloride and the osteogenic differentiation efficiency was compared with that of MSCs in normal differentiation medium containing 0.8 mM magnesium chloride by cell morphology, gene expression profile of osteogenic markers, and Alizarin Red staining. Slc41a1 gene knockdown in MSCs was performed by siRNA transfection using Lipofectamine RNAiMAX, and the differentiation efficiency of siRNA-treated MSCs was also assessed. High concentration of extracellular magnesium ion inhibited mineralization during osteogenic differentiation of MSCs. Early osteogenic marker genes including osterix, alkaline phosphatase, and type I collagen were significantly downregulated in MSCs under high concentration of magnesium, whereas late marker genes such as osteopontin, osteocalcin, and bone morphogenetic protein 2 were upregulated with statistical significance compared with those in normal differentiation medium containing 0.8 mM magnesium. siRNA treatment targeting SLC41A1 magnesium transporter, a member of the solute carrier family with a predominant Mg 2+ efflux system, accelerated the mineralization process and ameliorated the inhibition of mineralization caused by high concentration of magnesium. High concentration of magnesium significantly upregulated Dkk1 gene expression and the upregulation was attenuated after the Slc41a1 gene was knocked down. Immunofluorescent staining showed that Slc41a1 gene knockdown promoted the translocation of phosphorylated β-catenin into nuclei. In addition, secreted MGP protein was elevated after Slc41a1 was knocked down. High concentration of extracellular magnesium modulates gene expression of MSCs during osteogenic differentiation and inhibits the mineralization process. Additionally, we identified magnesium transporter SLC41A1 that regulates the interaction of magnesium and MSCs during osteogenic differentiation. Wnt signaling is suggested to be involved in SLC41A1-mediated regulation. Tissue-specific SLC41A1 could be a potential treatment for bone mass loss; in addition, caution should be taken regarding the role of magnesium in osteoporosis and the design of magnesium alloys for implantation.

Contamination of lithium heparin blood by K2-ethylenediaminetetraacetic acid (EDTA): an experimental evaluation

PubMed Central

Lima-Oliveira, Gabriel; Salvagno, Gian Luca; Danese, Elisa; Brocco, Giorgio; Guidi, Gian Cesare; Lippi, Giuseppe

2014-01-01

Introduction: The contamination of serum or lithium heparin blood with ethylenediaminetetraacetic acid (EDTA) salts may affect accuracy of some critical analytes and jeopardize patient safety. The aim of this study was to evaluate the effect of lithium heparin sample contamination with different amounts of K2EDTA. Materials and methods: Fifteen volunteers were enrolled among the laboratory staff. Two lithium heparin tubes and one K2EDTA tube were collected from each subject. The lithium-heparin tubes of each subject were pooled and divided in 5 aliquots. The whole blood of K2EDTA tube was then added in scalar amount to autologous heparinised aliquots, to obtained different degrees of K2EDTA blood volume contamination (0%; 5%; 13%; 29%; 43%). The following clinical chemistry parameters were then measured in centrifuged aliquots: alanine aminotranspherase (ALT), bilirubin (total), calcium, chloride, creatinine, iron, lactate dehydrogenase (LD), lipase, magnesium, phosphate, potassium, sodium. Results: A significant variation starting from 5% K2EDTA contamination was observed for calcium, chloride, iron, LD, magnesium (all decreased) and potassium (increased). The variation of phosphate and sodium (both increased) was significant after 13% and 29% K2EDTA contamination, respectively. The values of ALT, bilirubin, creatinine and lipase remained unchanged up to 43% K2EDTA contamination. When variations were compared with desirable quality specifications, the bias was significant for calcium, chloride, LD, magnesium and potassium (from 5% K2EDTA contamination), sodium, phosphate and iron (from 29% K2EDTA contamination). Conclusions: The concentration of calcium, magnesium, potassium, chloride and LD appears to be dramatically biased by even modest K2EDTA contamination (i.e., 5%). The values of iron, phosphate, and sodium are still reliable up to 29% K2EDTA contamination, whereas ALT, bilirubin, creatinine and lipase appear overall less vulnerable towards K2EDTA contamination. PMID:25351354

Feasibility and antihypertensive effect of replacing regular salt with mineral salt -rich in magnesium and potassium- in subjects with mildly elevated blood pressure

PubMed Central

2011-01-01

Background High salt intake is linked to hypertension whereas a restriction of dietary salt lowers blood pressure (BP). Substituting potassium and/or magnesium salts for sodium chloride (NaCl) may enhance the feasibility of salt restriction and lower blood pressure beyond the sodium reduction alone. The aim of this study was to determine the feasibility and effect on blood pressure of replacing NaCl (Regular salt) with a novel mineral salt [50% sodium chloride and rich in potassium chloride (25%), magnesium ammonium potassium chloride, hydrate (25%)] (Smart Salt). Methods A randomized, double-blind, placebo-controlled study was conducted with an intervention period of 8-weeks in subjects (n = 45) with systolic (S)BP 130-159 mmHg and/or diastolic (D)BP 85-99 mmHg. During the intervention period, subjects consumed processed foods salted with either NaCl or Smart Salt. The primary endpoint was the change in SBP. Secondary endpoints were changes in DBP, daily urine excretion of sodium (24-h dU-Na), potassium (dU-K) and magnesium (dU-Mg). Results 24-h dU-Na decreased significantly in the Smart Salt group (-29.8 mmol; p = 0.012) and remained unchanged in the control group: resulting in a 3.3 g difference in NaCl intake between the groups. Replacement of NaCl with Smart Salt resulted in a significant reduction in SBP over 8 weeks (-7.5 mmHg; p = 0.016). SBP increased (+3.8 mmHg, p = 0.072) slightly in the Regular salt group. The difference in the change of SBP between study groups was significant (p < 0.002). Conclusions The substitution of Smart Salt for Regular salt in subjects with high normal or mildly elevated BP resulted in a significant reduction in their daily sodium intake as well as a reduction in SBP. Trial Registration ISRCTN: ISRCTN01739816 PMID:21888642

Electrolytic conditioning of a magnesium aluminum chloride complex for reversible magnesium deposition

DOE PAGES

Barile, Christopher J.; Barile, Elizabeth C.; Zavadil, Kevin R.; ...

2014-12-04

We describe in this report the electrochemistry of Mg deposition and dissolution from the magnesium aluminum chloride complex (MACC). The results define the requirements for reversible Mg deposition and definitively establish that voltammetric cycling of the electrolyte significantly alters its composition and performance. Elemental analysis, scanning electron microscopy, and energy-dispersive X-ray spectroscopy (SEM-EDS) results demonstrate that irreversible Mg and Al deposits form during early cycles. Electrospray ionization-mass spectrometry (ESI-MS) data show that inhibitory oligomers develop in THF-based solutions. These oligomers form via the well-established mechanism of a cationic ring-opening polymerization of THF during the initial synthesis of the MACC andmore » under resting conditions. In contrast, MACC solutions in 1,2-dimethoxyethane (DME), an acyclic solvent, do not evolve as dramatically at open circuit potential. Furthermore, we propose a mechanism describing how the conditioning process of the MACC in THF improves its performance by both tuning the Mg:Al stoichiometry and eliminating oligomers.« less

Effects of Cations on Corrosion of Inconel 625 in Molten Chloride Salts

NASA Astrophysics Data System (ADS)

Zhu, Ming; Ma, Hongfang; Wang, Mingjing; Wang, Zhihua; Sharif, Adel

2016-04-01

Hot corrosion of Inconel 625 in sodium chloride, potassium chloride, magnesium chloride, calcium chloride and their mixtures with different compositions is conducted at 900°C to investigate the effects of cations in chloride salts on corrosion behavior of the alloy. XRD, SEM/EDS were used to analyze the compositions, phases, and morphologies of the corrosion products. The results showed that Inconel 625 suffers more severe corrosion in alkaline earth metal chloride molten salts than alkaline metal chloride molten salts. For corrosion in mixture salts, the corrosion rate increased with increasing alkaline earth metal chloride salt content in the mixture. Cations in the chloride molten salts mainly affect the thermal and chemical properties of the salts such as vapor pressure and hydroscopicities, which can affect the basicity of the molten salt. Corrosion of Inconel 625 in alkaline earth metal chloride salts is accelerated with increasing basicity.

Hygroscopic salts and the potential for life on Mars.

PubMed

Davila, Alfonso F; Duport, Luis Gago; Melchiorri, Riccardo; Jänchen, Jochen; Valea, Sergio; de Los Rios, Asunción; Fairén, Alberto G; Möhlmann, Diedrich; McKay, Christopher P; Ascaso, Carmen; Wierzchos, Jacek

2010-01-01

Hygroscopic salts have been detected in soils in the northern latitudes of Mars, and widespread chloride-bearing evaporitic deposits have been detected in the southern highlands. The deliquescence of hygroscopic minerals such as chloride salts could provide a local and transient source of liquid water that would be available for microorganisms on the surface. This is known to occur in the Atacama Desert, where massive halite evaporites have become a habitat for photosynthetic and heterotrophic microorganisms that take advantage of the deliquescence of the salt at certain relative humidity (RH) levels. We modeled the climate conditions (RH and temperature) in a region on Mars with chloride-bearing evaporites, and modeled the evolution of the water activity (a(w)) of the deliquescence solutions of three possible chloride salts (sodium chloride, calcium chloride, and magnesium chloride) as a function of temperature. We also studied the water absorption properties of the same salts as a function of RH. Our climate model results show that the RH in the region with chloride-bearing deposits on Mars often reaches the deliquescence points of all three salts, and the temperature reaches levels above their eutectic points seasonally, in the course of a martian year. The a(w) of the deliquescence solutions increases with decreasing temperature due mainly to the precipitation of unstable phases, which removes ions from the solution. The deliquescence of sodium chloride results in transient solutions with a(w) compatible with growth of terrestrial microorganisms down to 252 K, whereas for calcium chloride and magnesium chloride it results in solutions with a(w) below the known limits for growth at all temperatures. However, taking the limits of a(w) used to define special regions on Mars, the deliquescence of calcium chloride deposits would allow for the propagation of terrestrial microorganisms at temperatures between 265 and 253 K, and for metabolic activity (no growth) at temperatures between 253 and 233 K.

Fat-soluble vitamin and mineral comparisons between zoo-based and free-ranging koalas (Phascolarctos cinereus).

PubMed

Schmidt, Debra A; Pye, Geoffrey W; Hamlin-Andrus, Chris C; Ellis, William A; Bercovitch, Fred B; Ellersieck, Mark R; Chen, Tai C; Holick, Michael F

2013-12-01

As part of a health investigation on koalas at San Diego Zoo, serum samples were analyzed from 18 free-ranging and 22 zoo-based koalas, Phascolarctos cinereus. Serum concentrations of calcium, chloride, cobalt, copper, iron, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, sodium, zinc, and vitamins A, E, and 25(OH)D3 were quantified. Calcium, chloride, molybdenum, selenium, and vitamin E concentrations were significantly higher in zoo-based koalas than in free-ranging koalas, whereas magnesium, manganese, phosphorus, and zinc concentrations were significantly higher in the free-ranging koalas. No significant differences were found between genders. The results from this study will help to establish a starting point for determining target circulating nutrient concentrations in koalas.

Catalytic Biomineralization of Fluorescent Calcite by the Thermophilic Bacterium Geobacillus thermoglucosidasius▿

PubMed Central

Yoshida, Naoto; Higashimura, Eiji; Saeki, Yuichi

2010-01-01

The thermophilic Geobacillus bacterium catalyzed the formation of 100-μm hexagonal crystals at 60°C in a hydrogel containing sodium acetate, calcium chloride, and magnesium sulfate. Under fluorescence microscopy, crystals fluoresced upon excitation at 365 ± 5, 480 ± 20, or 545 ± 15 nm. X-ray diffraction indicated that the crystals were magnesium-calcite in calcite-type calcium carbonate. PMID:20851984

Magnesium degradation products: effects on tissue and human metabolism.

PubMed

Seitz, J-M; Eifler, R; Bach, Fr-W; Maier, H J

2014-10-01

Owing to their mechanical properties, metallic materials present a promising solution in the field of resorbable implants. The magnesium metabolism in humans differs depending on its introduction. The natural, oral administration of magnesium via, for example, food, essentially leads to an intracellular enrichment of Mg(2+) . In contrast, introducing magnesium-rich substances or implants into the tissue results in a different decomposition behavior. Here, exposing magnesium to artificial body electrolytes resulted in the formation of the following products: magnesium hydroxide, magnesium oxide, and magnesium chloride, as well as calcium and magnesium apatites. Moreover, it can be assumed that Mg(2+) , OH(-) ions, and gaseous hydrogen are also present and result from the reaction for magnesium in an aqueous environment. With the aid of physiological metabolic processes, the organism succeeds in either excreting the above mentioned products or integrating them into the natural metabolic process. Only a burst release of these products is to be considered a problem. A multitude of general tissue effects and responses from the Mg's degradation products is considered within this review, which is not targeting specific implant classes. Furthermore, common alloying elements of magnesium and their hazardous potential in vivo are taken into account. © 2013 Wiley Periodicals, Inc.

Preparation and Degradation of Polysilylenes

DTIC Science & Technology

1991-05-02

Grignard reagent formation from Mg and alkyl iodides in comparison with less reactive alkyl chlorides 2 3 . Electron transfer to the chlorides occur at...stoichiometric balance of reagents and nearly complete conversions (e.g. DPN-100 at 99% conversion in a homogeneous polycondensation with exact stoichiometric...the magnesium surface, whereas alkyl iodides accept electrons through Ŝ. larger distance and could not efficiently form organomagneslum reagents but

Salivary analytes in patients with oral squamous cell carcinoma.

PubMed

Fuchs, Petra Nola; Rogić, Dunja; Vidović-Juras, Danica; Susić, Mato; Milenović, Aleksandar; Brailo, Vlaho; Boras, Vanja Vucićević

2011-06-01

Literature data indicates that measurement of certain salivary constituents might serve as a useful diagnostic/prognostic tool in the patients with oral squamous cell carcinoma (OSCC). In 24 patients with OSCC (60 +/- 2.5 yrs) and in 24 controls (24 +/- 3.7 yrs) we have determined levels of salivary magnesium, calcium, copper, chloride, phosphate, potassium, sodium, total proteins and amylase. Sodium, potassium and chloride were determined by indirect potentiometry whereas copper, magnesium and phosphate were determined by atomic absorption spectrophotometry. Total proteins were determined by pyrogalol colorimetric method. Amylase levels were determined by continued colorimetric method. Statistical analysis was performed by use of chi2 test and Spearman's correlation test. The results of this study indicate that the concentrations of sodium and chloride were significantly elevated in patients with OSCC when compared to the controls. However, level of total protein was significantly decreased when compared to the healthy controls. Furthermore, there was a negative correlation between alcohol consumption and total protein concentration in patients with oral carcinoma. We might conclude that in patients with OSCC increased salivary sodium and chloride might reflect their overall dehydration status due to alcohol consumption rather than consequence of OSCC itself.

Bacillus stearothermophilus sporulation response to different composition media.

PubMed

Penna, T C; Machoshvili, I A; Taqueda, M E; Ferraz, C A

1998-01-01

To evaluate the effectiveness of 11 commonly used ingredients to improve Bacillus stearothermophilus ATCC 7953 sporulation, with high spore yields in a short period of incubation, 32 composition media were set up by a fractional factorial 2IV11-6 design at two levels: D-glucose (0.018-0.25%), L-glutamic acid (0.040-0.10%), yeast extract (0.050-0.40%), peptone (0.30-0.50%), sodium chloride (0.001-1.0%), magnesium sulfate (0.001-0.20%), ammonium phosphate (0.010-0.035%), potassium phosphate monobasic (0.050-0.25%), calcium chloride (0.001-0.05%), ferrous sulfate (0.0003-0.002%), manganese sulfate (0.001-0.50%). The largest variation on Log10 CFU response took place due to sodium chloride main effect, by changing it from low to high levels. Magnesium sulfate, calcium chloride, and ferrous sulfate were split and exerted no detectable main effect influence on sporulation. Setting up two 16 runs for sodium chloride effect, in each of which the remainder levels were kept constant, other components contribution was studied. At low sodium chloride, best average 7.25 Log10 CFU yielded by fastening yeast extract and peptone at high level, and remainders at low level. Considering high level of sodium chloride, peptone, yeast extract and ammonium phosphate kept at high level and remainders at low level confirmed the best sporulation yield. Adjusted models evidenced a strong influence of joint yeast/peptone effect, associated to ammonium phosphate contributing positively. The reduced incubation period from 15 days to 3-6 days at 62 degrees C was attained for all 32 experimental runs.

Improving halide-containing magnesium-ion electrolyte performance via sterically hindered alkoxide ligands

NASA Astrophysics Data System (ADS)

Nist-Lund, Carl A.; Herb, Jake T.; Arnold, Craig B.

2017-09-01

While homoleptic magnesium dialkoxides (MgR2, R = alkoxide) have shown promise as precursors for magnesium-ion electrolytes, the effect of ligand steric bulk on the performance of electrolytes based on these compounds is not fully understood. Increasing steric hindrance, studied via R groups with additional phenyl moieties, produces electrolytes with sequentially lower deposition overpotentials (less than -90 mV), higher purity Mg deposits (ca. 100% Mg), and lower overall cell impedances. The two largest alkoxide ligands show consistent cycling behavior and low stripping and plating overpotentials over 200 constant-current plating/stripping cycles. A deep-red visual change and the presence of large solubilized magnesium particulates above 450 nm in size is observed in an electrolyte containing magnesium bis(triphenylmethoxide) and aluminum chloride in contact with an abraded magnesium anode. Further morphological and impedance characterization show that this electrolyte system rapidly activates the magnesium metal anode surface to produce low overpotentials and, as such, is a candidate for further investigation.

Influence of magnesia-to-phosphate molar ratio on microstructures, mechanical properties and thermal conductivity of magnesium potassium phosphate cement paste with large water-to-solid ratio

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Biwan, E-mail: xubiwan@gmail.com; Ma, Hongyan, E-mail: mhy1103@gmail.com; Li, Zongjin

2015-02-15

This paper describes the influence of the magnesia-to-phosphate (M/P) molar ratios ranging from 4 to 12, on the properties and microstructures of magnesium potassium phosphate cement (MKPC) pastes with a large water-to-solid ratio (w/s) of 0.50. The setting behavior, compressive strength, tensile bonding strength and thermal conductivity of the MKPC pastes, were investigated. The results show that an increase in the M/P ratio can slow down the setting reaction, and clearly degrade the mechanical strengths, but clearly improve the thermal conductivity of MKPC pastes. Furthermore, micro-characterizations including X-ray diffraction, scanning electron microscopy and thermogravimetric analysis, on the MKPC pastes revealmore » that a lower M/P ratio can facilitate better crystallization of the resultant magnesium potassium phosphate hexahydrate (MKP) and a denser microstructure. Moreover, strong linear correlations are found between the mechanical strengths and the MKP-to-space ratio, and between thermal conductivity and the volume ratio of the unreacted magnesia to the MKP. - Highlights: • Increase of M/P molar ratio causes clear mechanical degradations on MKPC pastes. • Thermal conductivity of MKPC pastes is improved with increase of M/P molar ratio. • Lower M/P ratio leads to better MKP crystallization and denser microstructure. • Strengths of MKPC pastes are linearly correlated to the MKP-to-space ratios. • Thermal conductivity is affected by the volume ratio of unreacted magnesia to MKP.« less

An extended chemical analysis of gallstone.

PubMed

Chandran, P; Kuchhal, N K; Garg, P; Pundir, C S

2007-09-01

Chemical composition of gall stones is essential for aetiopathogensis of gallstone disease. We have reported quantitative chemical analysis of total cholesterol bilirubin, calcium, iron and inorganic phosphate in 120 gallstones from haryana. To extend this chemical analysis of gall stones by studying more cases and by analyzing more chemical constituents. A quantitative chemical analysis of total cholesterol, total bilirubin, fatty acids, triglycerides, phospholipids, bile acids, soluble proteins, sodium potassium, magnesium, copper, oxalate and chlorides of biliary calculi (52 cholesterol, 76 mixed and 72 pigment) retrieved from surgical operation of 200 patients from Haryana state was carried out. Total cholesterol as the major component and total bilirubin, phospholipids, triglycerides, bile acids, fatty acids (esterified), soluble protein, calcium, magnesium, iron, copper, sodium, potassium, inorganic phosphate, oxalate and chloride as minor components were found in all types of calculi. The cholesterol stones had higher content of total cholesterol, phospholipids, fatty acids (esterified), inorganic phosphate and copper compared to mixed and pigment stones. The mixed stones had higher content of iron and triglycerides than to cholesterol and pigment stones. The pigment stones were richer in total bilirubin, bile acids, calcium, oxalate, magnesium, sodium, potassium, chloride and soluble protein compared to cholesterol and mixed stones. Although total cholesterol was a major component of cholesterol, mixed and pigment gall stone in Haryana, the content of most of the other lipids, cations and anions was different in different gall stones indicating their different mechanism of formation.

[Infrared spectrophotometry for crystalline composition of staghorn calculi].

PubMed

Ma, Kai; Huang, Xiao-bo; Xu, Qing-quan; Li, Jian-xing; Xiong, Liu-lin; Yang, Bo; Ye, Xiong-jun; Chen, Liang; Wang, Xiao-feng; Na, Yan-qun

2010-11-30

To provide theoretic rationales for treatment and prevention of staghorn calculi by analyzing stone composition and studying the relationship between stone and urinary tract infections. The clinical data of 51 staghorn calculi patients were analyzed retrospectively. The stone compositions were studied by infrared spectrophotometry. Six types of stone compositions were obtained. There were calcium oxalate monohydrate, calcium oxalate dehydrate, carbonate apatite, magnesium ammonium phosphate hexahydrate, uric acid and L-cystine. The majority of stones were of mixed compositions, pure stones were found in 15 cases (29.4%). Among all stones, calcium oxalate stones were found in 41 cases (80.4%) and uric stones in 10 cases (19.6%). Infectious stones were found in 26 cases (51.0%). Urinary tract infections were found in 40 (78.4%) patients and positive urine/stone culture was detected in 33 (64.7%) patients. With multiple crystalline compositions and etiological factors, the staghorn calculi are closely correlated with urinary tract infections.

IUPAC-NIST Solubility Data Series. 95. Alkaline Earth Carbonates in Aqueous Systems. Part 2. Ca

NASA Astrophysics Data System (ADS)

Vanderdeelen, Jan

2012-06-01

The alkaline earth carbonates are an important class of minerals. This article is part of a volume in the IUPAC-NIST Solubility Data Series that compiles and critically evaluates solubility data of the alkaline earth carbonates in water and in simple aqueous electrolyte solutions. Part 1 outlined the procedure adopted in this volume, and presented the beryllium and magnesium carbonates. Part 2, the current paper, compiles and critically evaluates the solubility data of calcium carbonate. The chemical forms included are the anhydrous CaCO3 types calcite, aragonite, and vaterite, the monohydrate monohydrocalcite (CaCO3. H2O), the hexahydrate ikaite (CaCO3.6H2O), and an amorphous form. The data were analyzed with two model variants, and thermodynamic data of each form consistent with each of the models and with the CODATA key values for thermodynamics are presented.

Synthesis of Improved Polyester Resins.

DTIC Science & Technology

1979-07-05

p-phenylene bis(magnesium bromide) dispersed in 70 ml of hexane was added over a period of one hour. Residual Grignard reagent was washed from the...was prepared from p-phenylenedi(phenylphosphonyl chloride) (PPPC). The PPPC monomer was made from the p-phenylene bis(magnesium bromide) Grignard ...phenylphosphonyl dichloride removal. On cooling, the product was a viscous glassy liquid. It weighed 12.5 grams (113 percent based on 8g of Grignard

A Study of Magnesium-Base Metallic Systems and Development of Principles for Creation of Corrosion-Resistant Magnesium Alloys

NASA Astrophysics Data System (ADS)

Mukhina, I. Yu.

2014-11-01

The effect of 26 alloying elements on the corrosion resistance of high-purity magnesium in a 0.5-n solution of sodium chloride and in a humid atmosphere (0.005 n) is studied. The Mg - Li, Mg - Ag, Mg - Zn, Mg - Cu, Mg - Gd, Mg - Al, Mg - Zr, Mg - Mn and other binary systems, which present interest as a base for commercial or perspective castable magnesium alloys, are studied. The characteristics of corrosion resistance of the binary alloys are analyzed in accordance with the group and period of the Mendeleev's periodic law. The roles of the electrochemical and volume factors and of the factor of the valence of the dissolved element are determined.

Mechanistic characterization of chloride interferences in electrothermal atomization systems

USGS Publications Warehouse

Shekiro, J.M.; Skogerboe, R.K.; Taylor, Howard E.

1988-01-01

A computer-controlled spectrometer with a photodiode array detector has been used for wavelength and temperature resolved characterization of the vapor produced by an electrothermal atomizer. The system has been used to study the chloride matrix interference on the atomic absorption spectrometric determination of manganese and copper. The suppression of manganese and copper atom populations by matrix chlorides such as those of calcium and magnesium is due to the gas-phase formation of an analyte chloride species followed by the diffusion of significant fractions of these species from the atom cell prior to completion of the atomization process. The analyte chloride species cannot be formed when matrix chlorides with metal-chloride bond dissociation energies above those of the analyte chlorides are the principal entitles present. The results indicate that multiple wavelength spectrometry used to obtain temperature-resolved spectra is a viable tool in the mechanistic characterization of interference effects observed with electrothermal atomization systems. ?? 1988 American Chemical Society.

Energy, Power & Interconnect Technologies Division Overview

DTIC Science & Technology

2010-02-26

Indiana University, Bloomington, IN, February 26, 2010 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...Battery Expertise Alkaline (Sealed/Vented) Lithium (Reserve/Active) Thermal Aluminum-Oxygen (Air) Cadmium -Oxygen (Air) Carbon-Zinc Mercury- Cadmium M Zi...Iron Nickel- Cadmium Nickel-Hydrogen Oxyhalide Polymer Sulfur Dioxide Sulfuryl Chloride Thionyl Chloride V di P t id um con o a su e Magnesium/Vanadium

Precipitation and Solubility of Calcium Hydrogenurate Hexahydrate

PubMed Central

Babić-Ivančić, V.; Füredi-Milhofer, H.; Brničević, N.; Marković, M.

1992-01-01

Solid phases formed in the quaternary system: uric acid—calcium hydroxide —hydrochloric acid—water aged for 2 months at 310 K were studied to determine conditions for calcium hydrogenurate hexahydrate, Ca(C5H3N4O)2 · 6H2O precipitation. The precipitates were identified by chemical and thermogravimetric analyses, x-ray powder diffraction, infrared spectroscopy, light microscopy, and scanning electron microscopy. In the precipitation diagram the concentration region in which calcium hydrogenurate hexahydrate precipitated as a single solid phase was established. The solubility of calcium hydrogenurate hexahydrate was investigated in the pH range from 6.2 to 10.1 at different temperatures. The total soluble and ionic concentration of calcium (atomic absorption spectroscopy and Ca-selective electrode), total urate concentration (spectrophotometry), and pH were determined in equilibrated solutions. The data are presented in the form of tables and chemical potential diagrams. By using these data the thermodynamic solubility products of calcium hydrogenurate hexahydrate, Ks = a(Ca2+) · a2(C5H3N4O3−), were determined: pKs=10.12±0.07at288K,pKs=9.81±0.09at298K,pKs=9.28±0.04at310K,andpKs=9.01±0.03at318K.The formation of calcium hydrogenurate hexahydrate crystals in urinary tract of patients with pathologically high concentrations of calcium and urates (hypercalciuria and hyperuricosiuria) is possible. PMID:28053438

Evaluation of Methylene Chloride Emission Control Technologies at Anniston Army Depot

DTIC Science & Technology

2007-03-01

processes to paint stripping at ANAD. Substrate damage, residual compressive stresses , and the volume of hazardous waste should all be investigated...or supported on hooks , and lowered into the salt bath. After stripping, the items are removed and rinsed with water for cooling and removal of resid...ity to stress corrosion. b. 6000 series aluminum: Silicon and magnesium in approxi- mate proportions to form magnesium silicide, thus making them

Electrolytes

MedlinePlus

... Chloride Magnesium Phosphorus Potassium Sodium Electrolytes can be acids, bases, or salts. They can be measured by different ... Saunders; 2013:464-467. DuBose TD. Disorders of acid-base balance. In: Skorecki K, Chertow GM, Marsden PA, ...

Magnesium compounds

USGS Publications Warehouse

Kramer, D.A.

2007-01-01

Seawater and natural brines accounted for about 52 percent of U.S. magnesium compounds production in 2006. Dead-burned magnesia was produced by Martin Marietta Magnesia Specialties from well brines in Michigan. Caustic-calcined magnesia was recovered from sea-water by Premier Chemicals in Florida; from well brines in Michigan by Martin Marietta and Rohm and Haas; and from magnesite in Nevada by Premier Chemicals. Intrepid Potash-Wendover and Great Salt Lake Minerals recovered magnesium chloride brines from the Great Salt Lake in Utah. Magnesium hydroxide was produced from brucite by Applied Chemical Magnesias in Texas, from seawater by SPI Pharma in Delaware and Premier Chemicals in Florida, and by Martin Marietta and Rohm and Haas from their operations mentioned above. About 59 percent of the magnesium compounds consumed in the United States was used for refractories that are used mainly to line steelmaking furnaces. The remaining 41 percent was consumed in agricultural, chemical, construction, environmental and industrial applications.

Single-crystal growth, structure refinement and the properties of Bis(glycine) Strontium Chloride

NASA Astrophysics Data System (ADS)

Balaji, S. R.; Balu, T.; Rajasekaran, T. R.

2018-02-01

Single crystals of Bis (glycine) Strontium Chloride (BGSC) were grown by means of slow evaporation process by using analar grade Glycine and Strontium Chloride Hexahydrate as a parent compound from its aqueous solution at room temperature. The final chemical composition, [{{Sr}}{({{{C}}}2{{{H}}}5{{{NO}}}2)}2{{{Cl}}}2].{{{H}}}4{{{O}}}3+{{{H}}}8{{{O}}}3, formed were metallic light colorless block, about the size of 28 mm × 9 mm × 8 mm. A single-crystal x-ray diffraction study revealed an ordered superstructure with orthorhombic symmetry that could be assigned to the space group Pbcn. The structure in BGSC, revealed in the electron density distribution was analyzed by the direct methods (SHELXS-2014) and refined by least squares full matrix method (SHELXL-2014). The crystal structure, including anisotropic atomic displacement parameters for each atom and isotropic atomic displacement parameters for hydrogen atom, was refined to R1 = 0.0395, wR2 = 0.0776 using 1097 independent reflections. The FTIR spectrum of BGSC confirms the protonation of amino groups and the different molecular groups present in BGSC vibrate in different modes. Reverse Indentation Size Effect (RISE) was revealed in BGSC in the micro-hardness analysis using Vicker’s micro-hardness analysis. DTA and DSC results ruled out the possibility of structural change independent of mass change. The AFM studies shows fine nano size fiber like structure of the grown crystals.

Electrochemical Properties and Speciation in Mg(HMDS)2-Based Electrolytes for Magnesium Batteries as a Function of Ethereal Solvent Type and Temperature.

PubMed

Merrill, Laura C; Schaefer, Jennifer L

2017-09-19

Magnesium batteries are a promising alternative to lithium-ion batteries due to the widespread abundance of magnesium and its high specific volumetric energy capacity. Ethereal solvents such as tetrahydrofuran (THF) are commonly used for magnesium-ion electrolytes due to their chemical compatibility with magnesium metal, but the volatile nature of THF is a concern for practical application. Herein, we investigate magnesium bis(hexamethyldisilazide) plus aluminum chloride (Mg(HMDS) 2 -AlCl 3 ) electrolytes in THF, diglyme, and tetraglyme at varying temperature. We find that, despite the higher thermal stability of the glyme-based electrolytes, THF-based electrolytes have better reversibility at room temperature. Deposition/stripping efficiency is found to be a strong function of temperature. Diglyme-based Mg(HMDS) 2 -AlCl 3 electrolytes are found to not exchange as quickly as THF and tetraglyme, stabilizing AlCl 2 + and facilitating undesired aluminum deposition. Raman spectroscopy, 27 Al NMR, and mass spectrometry are used to identify solution speciation.

Hydration and Ion Pairing in Aqueous Mg2+ and Zn2+ Solutions: Force-Field Description Aided by Neutron Scattering Experiments and Ab Initio Molecular Dynamics Simulations.

PubMed

Duboué-Dijon, Elise; Mason, Philip E; Fischer, Henry E; Jungwirth, Pavel

2018-04-05

Magnesium and zinc dications possess the same charge and have an almost identical size, yet they behave very differently in aqueous solutions and play distinct biological roles. It is thus crucial to identify the origins of such different behaviors and to assess to what extent they can be captured by force-field molecular dynamics simulations. In this work, we combine neutron scattering experiments in a specific mixture of H 2 O and D 2 O (the so-called null water) with ab initio molecular dynamics simulations to probe the difference in the hydration structure and ion-pairing properties of chloride solutions of the two cations. The obtained data are used as a benchmark to develop a scaled-charge force field for Mg 2+ that includes electronic polarization in a mean field way. We show that using this electronic continuum correction we can describe aqueous magnesium chloride solutions well. However, in aqueous zinc chloride specific interaction terms between the ions need to be introduced to capture ion pairing quantitatively.

Asteroidal water within fluid inclusion-bearing halite in an H5 chondrite, Monahans (1998)

NASA Technical Reports Server (NTRS)

Zolensky, M. E.; Bodnar, R. J.; Gibson, E. K. Jr; Nyquist, L. E.; Reese, Y.; Shih, C. Y.; Wiesmann, H.

1999-01-01

Crystals of halite and sylvite within the Monahans (1998) H5 chondrite contain aqueous fluid inclusions. The fluids are dominantly sodium chloride-potassium chloride brines, but they also contain divalent cations such as iron, magnesium, or calcium. Two possible origins for the brines are indigenous fluids flowing within the asteroid and exogenous fluids delivered into the asteroid surface from a salt-containing icy object.

Migration of alternative de-icers in unsaturated zone of aquifers--in vitro study.

PubMed

Hellstén, P; Nystén, T

2003-01-01

The migration of organic de-icers in the shallow aquifers typical in Finland is not well known and we need to find solutions to minimise the negative impacts of de-icing on groundwater quality. The objective of the MIDAS project is to find de-icers which have the least harmful impacts on groundwater quality. Migration of sodium chloride as a tracer and five alternative de-icers in aquifers was studied. The alternative de-icers were calcium chloride, magnesium chloride, calcium-magnesium-acetate, potassium acetate and potassium formate. The research consists of leaching of heavy metals from roadsides in the area of Highway 1 in southern Finland; an in vitro study, which represented the full length of winter at low temperatures; and the subsequent on-going field research in south-eastern Finland. So far, in our studies potassium formate caused fewer changes to the quality of the infiltrated water than the chlorides and acetates. After finishing the on-going research the results will be used to choose a preferred de-icer from the existing chemicals and for the development of new less harmful de-icers. The information will be used mainly in Scandinavia and North America where the hydrogeological conditions are similar to those in Finland.

Phase Transformations and Metallization of Magnesium Oxide at High Pressure and Temperature

NASA Astrophysics Data System (ADS)

McWilliams, R. Stewart; Spaulding, Dylan K.; Eggert, Jon H.; Celliers, Peter M.; Hicks, Damien G.; Smith, Raymond F.; Collins, Gilbert W.; Jeanloz, Raymond

2012-12-01

Magnesium oxide (MgO) is representative of the rocky materials comprising the mantles of terrestrial planets, such that its properties at high temperatures and pressures reflect the nature of planetary interiors. Shock-compression experiments on MgO to pressures of 1.4 terapascals (TPa) reveal a sequence of two phase transformations: from B1 (sodium chloride) to B2 (cesium chloride) crystal structures above 0.36 TPa, and from electrically insulating solid to metallic liquid above 0.60 TPa. The transitions exhibit large latent heats that are likely to affect the structure and evolution of super-Earths. Together with data on other oxide liquids, we conclude that magmas deep inside terrestrial planets can be electrically conductive, enabling magnetic field-producing dynamo action within oxide-rich regions and blurring the distinction between planetary mantles and cores.

Formation of a Spinel Coating on AZ31 Magnesium Alloy by Plasma Electrolytic Oxidation

NASA Astrophysics Data System (ADS)

Sieber, Maximilian; Simchen, Frank; Scharf, Ingolf; Lampke, Thomas

2016-03-01

Plasma electrolytic oxidation (PEO) is a common means for the surface modification of light metals. However, PEO of magnesium substrates in dilute electrolytes generally leads to the formation of coatings consisting of unfavorable MgO magnesium oxide. By incorporation of electrolyte components, the phase constitution of the oxide coatings can be modified. Coatings consisting exclusively of MgAl2O4 magnesium-aluminum spinel are produced by PEO in an electrolyte containing hydroxide, aluminate, and phosphate anions. The hardness of the coatings is 3.5 GPa on Martens scale on average. Compared to the bare substrate, the coatings reduce the corrosion current density in dilute sodium chloride solution by approx. one order of magnitude and slightly shift the corrosion potential toward more noble values.

Stopped-flow studies of changes in fluorescence of 8-anilino-1-naphthalene sulfonic acid caused by magnesium and salt binding to yeast enolase.

PubMed

Brewer, J M

1976-12-11

Stopped-flow studies of magnesium and salt (potassium chloride and acetate) effects on yeast enolase were carried out by following 8-anilino-1-naphthalenesulfonic acid fluorescence changes. The fluorescence changes appear to be largely caused by subunit association and dissociation, though there is evidence in some reactions for large changes in fluorescence occurring within the dead time of the stopped-flow measurements. These data are combined with measurements of initial enzyme activity after incubation in various solvents with or without magnesium to obtain subunit association and dissociation rates. From these, it is concluded that magnesium and the salts act by directly changing the affinities of the subunits for each other, apparently by producing a rapid change in protein conformation.

Adsorption properties of cationic rhodamine B dye onto metals chloride-activated castor bean residue carbons.

PubMed

Zhi, Lee Lin; Zaini, Muhammad Abbas Ahmad

2017-02-01

This work was aimed to evaluate the feasibility of castor bean residue based activated carbons prepared through metals chloride activation. The activated carbons were characterized for textural properties and surface chemistry, and the adsorption data of rhodamine B were established to investigate the removal performance. Zinc chloride-activated carbon with specific surface area of 395 m 2 /g displayed a higher adsorption capacity of 175 mg/g. Magnesium chloride and iron(III) chloride are less toxic and promising agents for composite chemical activation. The adsorption data obeyed Langmuir isotherm and pseudo-second-order kinetics model. The rate-limiting step in the adsorption of rhodamine B is film diffusion. The positive values of enthalpy and entropy indicate that the adsorption is endothermic and spontaneous at high temperature.

Influence of the chloride ion concentration on the corrosion of high-purity Mg, ZE41 and AZ91 in buffered Hank's solution.

PubMed

Taltavull, C; Shi, Z; Torres, B; Rams, J; Atrens, A

2014-02-01

This research studied the influence of the chloride ion concentration on the corrosion behaviour of high-purity magnesium (Mg) and two Mg alloys in Hank's solution, using hydrogen evolution and weight loss. A buffer based on CO2 and NaHCO3 was used to maintain the pH constant. The corrosion behaviour was governed by a partially protective surface film, and film breakdown by the chloride ions. The carbonated calcium phosphate layer that formed in Hank's solution was important in determining the protective properties of the surface film.

Method for locating metallic nitride inclusions in metallic alloy ingots

DOEpatents

White, Jack C.; Traut, Davis E.; Oden, Laurance L.; Schmitt, Roman A.

1992-01-01

A method of determining the location and history of metallic nitride and/or oxynitride inclusions in metallic melts. The method includes the steps of labeling metallic nitride and/or oxynitride inclusions by making a coreduced metallic-hafnium sponge from a mixture of hafnium chloride and the chloride of a metal, reducing the mixed chlorides with magnesium, nitriding the hafnium-labeled metallic-hafnium sponge, and seeding the sponge to be melted with hafnium-labeled nitride inclusions. The ingots are neutron activated and the hafnium is located by radiometric means. Hafnium possesses exactly the proper metallurgical and radiochemical properties for this use.

MgO NPs synthesis, capping and enhanced free radical effect on the bacteria and its cell morphology

NASA Astrophysics Data System (ADS)

Kushwaha, Amisha; Bagchi, T.

2018-05-01

Magnesium Oxide Nanoparticles (MgO NPs) commonly known as Magnesia is a white powder, hygroscopic material. MgO NPs were synthesized through four methods Co-precipitation method (Co-PM), Solution combustion (S-CoM) and Sol-gel method with starch (So-GSM) and CTAB (So-GCM), classified as template dependent and template independent method using magnesium nitrate hexahydrate (Mg(NO3).6H2O) as the precursor and comparative analysis was done through DLS. The order of hydrodynamic diameters of four different synthesis method of MgO NPs is Co-PM LA-MgO NPs> MgO NPs responding.

Dehydration of Uranyl Nitrate Hexahydrate to Uranyl Nitrate Trihydrate under Ambient Conditions as Observed via Dynamic Infrared Reflectance Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Timothy J.; Sweet, Lucas E.; Meier, David E.

2015-05-22

the hexahydrate [UO 2(NO 3) 2(H 2O) 6] (UNH) and the trihydrate [UO 2(NO 3) 2(H 2O) 3] (UNT) forms. Their stabilities depend on both relative humidity and temperature. Both phases have previously been studied by infrared transmission spectroscopy, but the data were limited by both instrumental resolution and the ability to prepare the samples as pellets without desiccating them. We report time-resolved infrared (IR) measurements using an integrating sphere that allow us to observe the transformation from the hexahydrate to the trihydrate simply by flowing dry nitrogen gas over the sample. Hexahydrate samples were prepared and confirmed via knownmore » XRD patterns, then measured in reflectance mode. The hexahydrate has a distinct uranyl asymmetric stretch band at 949.0 cm -1 that shifts to shorter wavelengths and broadens as the sample dehydrates and recrystallizes to the trihydrate, first as a blue edge shoulder but ultimately resulting in a doublet band with reflectance peaks at 966 and 957 cm -1. The data are consistent with transformation from UNH to UNT since UNT has two non-equivalent UO 2 2+ sites. The dehydration of UO 2(NO 3) 2(H 2O) 6 to UO 2(NO 3) 2(H 2O) 3 is both a morphological and structural change that has the lustrous lime green crystals changing to the dull greenish yellow of the trihydrate. Crystal structures and phase transformation were confirmed theoretically using DFT calculations and experimentally via microscopy methods. Both methods showed a transformation with two distinct sites for the uranyl cation in the trihydrate, as opposed to a single crystallographic site in the hexahydrate.« less

Water quality assessment of the Eastern Iowa Basins: Basic water chemistry of rivers and streams, 1996-98

USGS Publications Warehouse

Barnes, Kimberlee K.

2001-01-01

Basic water-quality differences related to physiographic differences and seasonality were evident in streams and rivers in the Eastern Iowa Basins. Of the three major landforms, water samples from sites within the Des Moines Lobe, the youngest landform in the study area, had significantly higher median concentrations of calcium (85 mg/L), magnesium (28 mg/L), sulfate (28 mg/L), fluoride (0.31 mg/L), and silica (16 mg/L). The Des Moines Lobe region is calcium magnesium bicarbonate-rich due to the Paleozoic source rocks (limestones and shales) in the bedrock. Water samples from sites within the Southern Iowa Drift Plain had higher median concentrations of sodium (12 mg/L), potassium (3.2 mg/L), and chloride (21 mg/L). Concentrations also varied according to the time of year. Grouping the data into four seasonal periods, water samples collected during the months of October, November, and December, had higher median concentrations of calcium, magnesium, and chloride, then samples collected during other quarters of the year. Water quality in the streams during this low-flow period (October through December) is representative of that in the contributing aquifers.

Design and fabrication of enhanced corrosion resistance Zn-Al layered double hydroxides films based anion-exchange mechanism on magnesium alloys

NASA Astrophysics Data System (ADS)

Zhou, Meng; Yan, Luchun; Ling, Hao; Diao, Yupeng; Pang, Xiaolu; Wang, Yanlin; Gao, Kewei

2017-05-01

Layered double hydroxides (LDHs) with brucite-like layer structure and the facile exchangeability of intercalated anions had attracted tremendous interest in many fields because of their great importance for both fundamental studies and practical applications. Herein zinc-aluminum layered double hydroxides (Zn-Al LDHs) films intercalated with nitrate anions on the magnesium alloy substrate were designed and fabricated via a facile hydrothermal crystallization method. In order to obtain better corrosion resistance, chloride and vanadate anions were intercalated into the LDHs interlayers via the anion-exchange reaction. X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy and scanning electronic microscopy (SEM) were used to examine structure, composition and morphology of the Zn-Al-NO3 LDHs, Zn-Al-Cl LDHs and Zn-Al-VOx LDHs films. The corrosion resistance of the Zn-Al LDHs with different anion films was estimated by the electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization measurement. EIS and polarization curves measurements revealed that the magnesium alloy could be effectively protected by the Zn-Al-Cl LDHs and Zn-Al-VOx LDHs films due to the blocking effect of chloride anions and the control-release ability of vanadate anions.

Regulation of Chloroplastic Carbonic Anhydrase 1

PubMed Central

Porter, Michael A.; Grodzinski, Bernard

1983-01-01

It was previously reported that magnesium ion inhibited carbonic anhydrase (Bamberger and Avron 1975 Plant Physiol 56: 481-485). Studies with partially purified carbonic anhydrase from spinach (Spinacia oleracea L.) chloroplasts show that the effect was the result of the chloride counterion and not the magnesium ion. Enzyme activity was reduced 50% upon addition of 3 to 10 millimolar MgCl2 or KCl while all additions of MgSO4 between 0.3 and 10 millimolar were mildly stimulatory. PMID:16663052

Superposition model analysis of zero field splitting for Mn2+ in some host single crystals

NASA Astrophysics Data System (ADS)

Bansal, R. S.; Ahlawat, P.; Bharti, M.; Hooda, S. S.

2013-07-01

The Newman superposition model has been used to investigate the substitution of Mn2+ for Zn2+ site in ammonium tetra flurozincate dihydrate and for Co2+ site in cobalt ammonium phosphate hexahydrate and cobalt potassium phosphate hexahydrate single crystals. The calculated values of zero field splitting parameter b 2 0 at room temperature fit the experimental data with average intrinsic parameters overline{b}2 (F) = -0.0531 cm-1 for fluorine and overline{b}2 (O) = -0.0280 cm-1 for oxygen, taken t 2 = 7 for Mn2+ doped in ammonium tetra fluorozincate dihydrate single crystals. The values of overline{b}2 determined for Mn2+ doped in cobalt ammonium phosphate hexahydrate are -0.049 cm-1 for site I and -0.045 cm-1 for site II and in cobalt pottasium phosphate hexahydrate single crystals it is found to be overline{b}2 = -0.086 cm-1. We find close agreement between theoretical and experimental values of b 2 0.

21 CFR 177.1650 - Polysulfide polymer-polyepoxy resins.

Code of Federal Regulations, 2011 CFR

2011-04-01

...(2-chloroethyl) formal Bis(dichloropropyl) formal Cross-linking agent. Butyl alcohol Solvent. Carbon black (channel process) Chlorinated paraffins Cross-linking agent. Epoxidized linseed oil Epoxidized... monobutyl ether Solvent. Magnesium chloride Methyl isobutyl ketone Solvent. Naphthalene sulfonic acid...

40 CFR 63.9942 - What definitions apply to this subpart?

Code of Federal Regulations, 2014 CFR

2014-07-01

... metal alloys from natural sources of magnesium chloride such as sea water or water from the Great Salt... gases exhausted from gas turbines. Wet scrubber means a device that contacts an exhaust gas with a...

40 CFR 63.9942 - What definitions apply to this subpart?

Code of Federal Regulations, 2012 CFR

2012-07-01

... metal alloys from natural sources of magnesium chloride such as sea water or water from the Great Salt... gases exhausted from gas turbines. Wet scrubber means a device that contacts an exhaust gas with a...

40 CFR 63.9942 - What definitions apply to this subpart?

Code of Federal Regulations, 2011 CFR

2011-07-01

... metal alloys from natural sources of magnesium chloride such as sea water or water from the Great Salt... gases exhausted from gas turbines. Wet scrubber means a device that contacts an exhaust gas with a...

40 CFR 63.9942 - What definitions apply to this subpart?

Code of Federal Regulations, 2010 CFR

2010-07-01

... metal alloys from natural sources of magnesium chloride such as sea water or water from the Great Salt... gases exhausted from gas turbines. Wet scrubber means a device that contacts an exhaust gas with a...

40 CFR 63.9942 - What definitions apply to this subpart?

Code of Federal Regulations, 2013 CFR

2013-07-01

... metal alloys from natural sources of magnesium chloride such as sea water or water from the Great Salt... gases exhausted from gas turbines. Wet scrubber means a device that contacts an exhaust gas with a...

Laboratory studies of the low-temperature deliquescence of calcium chloride salts: Relevance to aqueous solutions on Mars and in the Antarctic Dry Valleys

NASA Astrophysics Data System (ADS)

Gough, R. V.; Chevrier, V.; Tolbert, M. A.

2013-12-01

There is significant interest in the possible existence of liquid water on current Mars. This water would likely exist as a brine in order to be stable on Mars today. It has been proposed that soil salts could form aqueous solutions through either the melting of ice by low-eutectic salts, or by the deliquescence of hygroscopic salts present in the Martian soil. The focus thus far has largely been on perchlorate species, which can melt ice at temperatures as low as 206 K and can deliquesce at relative humidity values as low as 38% RH. A Mars-relevant salt that has been neglected thus far is calcium chloride (CaCl2). Calcium has been reported to be an abundant cation at the Phoenix landing site and Mars Science Laboratory instruments have recently identified calcium as well. Simulations suggest subsurface CaCl2 is an ideal candidate to produce brines with seasonality consistent with observed recurring slope lineae (RSL) (Chevrier et al., 2012). Finally, the only terrestrial site where RSL-like features have been observed (near Don Juan Pond in the Antarctic Dry Valleys) contains abundant CaCl2. These seasonal slope streaks are thought to form when CaCl2 in the soil deliquesces due to contact with atmospheric water vapor (Dickson et al., 2013). It is important to understand how this CaCl2 interacts with water vapor at low temperatures relevant to Mars and the Martian analog sites. Here we use a Raman microscope and environmental cell to monitor the low-temperature (223 - 273 K) deliquescence (solid to aqueous phase transition) and efflorescence (aqueous to solid phase transition) of three hydration states of CaCl2 (dihydrate, tetrahydrate, hexahydrate). We have found that the deliquescence relative humidity (DRH) increases with increasing hydration state, which is an expected result. Average DRH values over the temperature range studied are 20.0 × 2.6% RH for the dihydrate, 31.8 × 6.3% RH for the tetrahydrate and 60.7 × 1.6% RH for the hexahydrate. Once the aqueous solution has formed, efflorescence (recrystallization) of the salt is kinetically hindered and supersaturated solutions can exist at humidities far below the DRH. Regardless of temperature or initial hydration state of the solid salt, we do not observe efflorescence of the aqueous solutions to occur until single digit RH values are reached. We show here that calcium chloride is at least as deliquescent as many perchlorate salts, and that solutions of calcium chloride are even more difficult to recrystallize once a brine solution has formed. These experimental results will assist with interpretation of observations of deliquescence in the Antarctic Dry Valleys and will help us understand potential liquid water formation on Mars. In addition to formation of brines through melting, deliquescence of salts such as CaCl2 is a reasonable mechanism for formation of aqueous solutions on current Mars.

Solubility of some alkali and alkaline earth chlorides in water at moderate temperatures

USGS Publications Warehouse

Clynne, M.A.; Potter, R.W.

1979-01-01

Solubilities for the binary systems, salt-H2O, of the chlorides of lithium, rubidium, cesium, magnesium, calcium, strontium, and barium from near 0??C to the saturated boiling point are reported. The experimental data and coefficients of an equation for a smoothed curve describing each system are listed in the tables. The data are improvements on those previously reported in the literature, having a precision on the average of ??0.09%.

Molecular dynamics simulation, ab initio calculation, and size-selected anion photoelectron spectroscopy study of initial hydration processes of calcium chloride.

PubMed

He, Zhili; Feng, Gang; Yang, Bin; Yang, Lijiang; Liu, Cheng-Wen; Xu, Hong-Guang; Xu, Xi-Ling; Zheng, Wei-Jun; Gao, Yi Qin

2018-06-14

To understand the initial hydration processes of CaCl 2 , we performed molecular simulations employing the force field based on the theory of electronic continuum correction with rescaling. Integrated tempering sampling molecular dynamics were combined with ab initio calculations to overcome the sampling challenge in cluster structure search and refinement. The calculated vertical detachment energies of CaCl 2 (H 2 O) n - (n = 0-8) were compared with the values obtained from photoelectron spectra, and consistency was found between the experiment and computation. Separation of the Cl-Ca ion pair is investigated in CaCl 2 (H 2 O) n - anions, where the first Ca-Cl ionic bond required 4 water molecules, and both Ca-Cl bonds are broken when the number of water molecules is larger than 7. For neutral CaCl 2 (H 2 O) n clusters, breaking of the first Ca-Cl bond starts at n = 5, and 8 water molecules are not enough to separate the two ion pairs. Comparing with the observations on magnesium chloride, it shows that separating one ion pair in CaCl 2 (H 2 O) n requires fewer water molecules than those for MgCl 2 (H 2 O) n . Coincidentally, the solubility of calcium chloride is higher than that of magnesium chloride in bulk solutions.

Molecular dynamics simulation, ab initio calculation, and size-selected anion photoelectron spectroscopy study of initial hydration processes of calcium chloride

NASA Astrophysics Data System (ADS)

He, Zhili; Feng, Gang; Yang, Bin; Yang, Lijiang; Liu, Cheng-Wen; Xu, Hong-Guang; Xu, Xi-Ling; Zheng, Wei-Jun; Gao, Yi Qin

2018-06-01

To understand the initial hydration processes of CaCl2, we performed molecular simulations employing the force field based on the theory of electronic continuum correction with rescaling. Integrated tempering sampling molecular dynamics were combined with ab initio calculations to overcome the sampling challenge in cluster structure search and refinement. The calculated vertical detachment energies of CaCl2(H2O)n- (n = 0-8) were compared with the values obtained from photoelectron spectra, and consistency was found between the experiment and computation. Separation of the Cl—Ca ion pair is investigated in CaCl2(H2O)n- anions, where the first Ca—Cl ionic bond required 4 water molecules, and both Ca—Cl bonds are broken when the number of water molecules is larger than 7. For neutral CaCl2(H2O)n clusters, breaking of the first Ca—Cl bond starts at n = 5, and 8 water molecules are not enough to separate the two ion pairs. Comparing with the observations on magnesium chloride, it shows that separating one ion pair in CaCl2(H2O)n requires fewer water molecules than those for MgCl2(H2O)n. Coincidentally, the solubility of calcium chloride is higher than that of magnesium chloride in bulk solutions.

Performance evaluation of household water treatment systems used in Kerman for removal of cations and anions from drinking water

NASA Astrophysics Data System (ADS)

Malakootian, Mohammad; Amirmahani, Najmeh; Yazdanpanah, Ghazal; Nasiri, Alireza; Asadipour, Ali; Ebrahimi, Ahmad; Darvish Moghaddam, Sodaif

2017-12-01

Increased awareness in society of the consequences of contaminants in drinking water has created a demand for household water treatment systems, which provide higher quality water, to spread. The aim of this study was to evaluate the performance of household water treatment systems used in Kerman for the removal of cations and anions. Various brands of home water treatment devices commonly used in Kerman were selected, with one device chosen from each brand for study. In cases in which the devices were used extensively, samples were selected with filters that had been changed in proper time, based on the device's operational instructions. The samples were selected from homes in the center and four geographical directions of Kerman. Then, sampling was conducted in three stages of input and output water of each device. For each of the samples, parameters were measured, such as chloride, sulfate, bicarbonate, calcium, magnesium, hardness, sodium, nitrate and nitrite (mg/L), temperature (°C), and pH. The average removal efficiency of different parameters by 14 brands in Kerman, which include chloride ions, sulfate, bicarbonate, calcium, magnesium, sodium, nitrites, nitrates, and total hardness, was obtained at 68.48, 85, 67, 61.21, 78.97, 80.24, 32.59, 66.83, and 69.38%, respectively. The amount of sulfate, bicarbonate, chloride, calcium, magnesium, hardness, sodium, and nitrate in the output water of household water treatment systems was less than the input water of these devices, but nitrite concentration in the output of some devices was more than the input water and showed a significant difference ( p > 0.05).

The role of bound potassium ions in the hydrolysis of low concentrations of adenosine triphosphate by preparations of membrane fragments from ox brain cerebral cortex

PubMed Central

Goldfarb, P. S. G.; Rodnight, R.

1970-01-01

1. The intrinsic Na+, K+, Mg2+ and Ca2+ contents of a preparation of membrane fragments from ox brain were determined by emission flame photometry. 2. Centrifugal washing of the preparation with imidazole-buffered EDTA solutions decreased the bound Na+ from 90±20 to 24±12, the bound K+ from 27±3 to 7±2, the bound Mg2+ from 20±2 to 3±1 and the bound calcium from 8±1 to <1nmol/mg of protein. 3. The activities of the Na++K++Mg2+-stimulated adenosine triphosphatase and the Na+-dependent reaction forming bound phosphate were compared in the unwashed and washed preparations at an ATP concentration of 2.5μm (ATP/protein ratio 12.5pmol/μg). 4. The Na+-dependent hydrolysis of ATP as well as the plateau concentration of bound phosphate and the rate of dephosphorylation were decreased in the washed preparation. The time-course of formation and decline of bound phosphate was fully restored by the addition of 2.5μm-magnesium chloride and 2μm-potassium chloride. Addition of 2.5μm-magnesium chloride alone fully restored the plateau concentration of bound phosphate, but the rate of dephosphorylation was only slightly increased. Na+-dependent ATP hydrolysis was partly restored with 2.5μm-magnesium chloride; addition of K+ in the range 2–10μm-potassium chloride then further restored hydrolysis but not to the control rate. 5. Pretreatment of the washed preparation at 0°C with 0.5nmol of K+/mg of protein so that the final added K+ in the reaction mixture was 0.1μm restored the Na+-dependent hydrolysis of ATP and the time-course of the reaction forming bound phosphate. 6. The binding of [42K]potassium chloride by the washed membrane preparation was examined. Binding in a solution containing 10nmol of K+/mg of protein was linear over a period of 20min and was inhibited by Na+. Half-maximal inhibition of 42K+-binding required a 100-fold excess of sodium chloride. 7. It was concluded (a) that a significant fraction of the apparent Na+-dependent hydrolysis of ATP observed in the unwashed preparation is due to activation by bound K+ and Mg2+ of the Na++K++Mg2+-stimulated adenosine triphosphatase system and (b) that the enzyme system is able to bind K+ from a solution of 0.5μm-potassium chloride. PMID:4250237

Magnesium status and the effect of magnesium supplementation in feline hypertrophic cardiomyopathy.

PubMed

Freeman, L M; Brown, D J; Smith, F W; Rush, J E

1997-07-01

Magnesium deficiency has been associated with the development of cardiovascular disease in several species. Cats may be predisposed to alterations in magnesium status because of recent changes in the composition of commercial feline diets. The purposes of this study were 1) to examine the dietary history of cats with hypertrophic cardiomyopathy (HCM), 2) to study magnesium status of cats with HCM compared to normal cats, and 3) to determine the effects of magnesium supplementation in cats with HCM. In part 1 of the study, diets of 65 cats with HCM were examined retrospectively. Forty of the 45 cats for which diets could be determined (89%) ate a diet designed to be magnesium-restricted and/or to produce an acidic urine. In part 2 of the study, 10 cats with HCM were compared to 10 healthy control cats for serum creatinine and magnesium; urine creatinine and magnesium, urine specific gravity and pH, and fractional excretion of magnesium. Urine creatinine and specific gravity were higher in control cats than in cats with HCM. No other differences were found between the 2 groups. In part 3, cats with HCM were supplemented with either 210 mg magnesium chloride (n = 15) or 210 mg lactose (n = 15) for 12 wk. No differences between the 2 groups were found for changes in either magnesium status or echocardiographic parameters. However, the 30 cats with HCM, as a group, did show significant improvements in measures of cardiac hypertrophy over the 12-week period. This was likely the result of treatment with other medications, rather than the magnesium supplementation. The results of this study suggest that cats with HCM are likely to be fed magnesium-restricted diets, but that they do not appear to have altered magnesium status compared to healthy controls.

Dielectric studies on struvite urinary crystals, a gateway to the new treatment modality for urolithiasis

NASA Astrophysics Data System (ADS)

Rajan, Reshma; Raj, N. Arunai Nambi; Madeswaran, S.; Babu, D. Rajan

2015-09-01

Struvite or magnesium ammonium phosphate hexahydrate (MAPH) are biological crystals, found in the kidney, which are formed due to the infection caused by urea splitting bacteria in the urinary tract. The struvite crystals observe different morphologies and were developed using single diffusion gel growth technique. The crystalline nature and its composition were studied from different characterization techniques like X-ray Diffraction (XRD) and FTIR. The dielectric behavior of the developed crystal was studied by varying temperature and at different frequencies. The parameters like dielectric constant, dielectric loss, ac conductivity, ac resistivity, impedance and admittance of the struvite crystals were calculated. The studies proved that the dielectric loss or dissipation heat is high in lower frequencies at normal body temperature, which develops a plasma state in the stones and in turn leads to the disintegration of urinary stones. The dielectric nature of the stones leads to the dielectric therapy, which will be a gateway for future treatment modality for urolithiasis.

In Situ Detection of Chlorine Dioxide (C1O2) in the Radiolysis of Perchlorates and Implications for the Stability of Organics on Mars

NASA Astrophysics Data System (ADS)

Góbi, Sándor; Bergantini, Alexandre; Kaiser, Ralf I.

2016-12-01

Magnesium perchlorate hexahydrate (Mg(ClO4)2 · 6H2O) samples were exposed to energetic electrons to investigate the products of the decomposition of perchlorates in the Martian soil and to infer their role in the degradation of organics on Mars. The samples were monitored online and in situ via infrared spectroscopy as well as electron impact (EI-QMS) and reflectron time-of-flight mass spectrometry coupled with single photon ionization (PI-ReTOF-MS). Our study reveals that besides chlorates ({{{ClO}}3}-) and molecular oxygen (O2), the chlorine dioxide radical (ClO2) was observed online and in situ for the first time as a radiolysis product of solid perchlorates. Chlorine dioxide, which is used on Earth as a strong oxidizing agent in water disinfection and bleaching, represents a proficient oxidizer—potentially more powerful than molecular oxygen—to explain the lack of abundant organics in the Martian soil.

Renal geology (quantitative renal stone analysis) by 'Fourier transform infrared spectroscopy'.

PubMed

Singh, Iqbal

2008-01-01

To prospectively determine the precise stone composition (quantitative analysis) by using infrared spectroscopy in patients with urinary stone disease presenting to our clinic. To determine an ideal method for stone analysis suitable for use in a clinical setting. After routine and a detailed metabolic workup of all patients of urolithiasis, stone samples of 50 patients of urolithiasis satisfying the entry criteria were subjected to the Fourier transform infrared spectroscopic analysis after adequate sample homogenization at a single testing center. Calcium oxalate monohydrate and dihydrate stone mixture was most commonly encountered in 35 (71%) followed by calcium phosphate, carbonate apatite, magnesium ammonium hexahydrate and xanthine stones. Fourier transform infrared spectroscopy allows an accurate, reliable quantitative method of stone analysis. It also helps in maintaining a computerized large reference library. Knowledge of precise stone composition may allow the institution of appropriate prophylactic therapy despite the absence of any detectable metabolic abnormalities. This may prevent and or delay stone recurrence.

IUPAC-NIST Solubility Data Series. 95. Alkaline Earth Carbonates in Aqueous Systems. Part 2. Ca

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Visscher, Alex; Vanderdeelen, Jan; Department of Applied Analytical and Physical Chemistry, Faculty of Bioscience Engineering, Ghent University, B-9000 Ghent

The alkaline earth carbonates are an important class of minerals. This article is part of a volume in the IUPAC-NIST Solubility Data Series that compiles and critically evaluates solubility data of the alkaline earth carbonates in water and in simple aqueous electrolyte solutions. Part 1 outlined the procedure adopted in this volume, and presented the beryllium and magnesium carbonates. Part 2, the current paper, compiles and critically evaluates the solubility data of calcium carbonate. The chemical forms included are the anhydrous CaCO{sub 3} types calcite, aragonite, and vaterite, the monohydrate monohydrocalcite (CaCO{sub 3}{center_dot} H{sub 2}O), the hexahydrate ikaite (CaCO{sub 3}{center_dot}6H{submore » 2}O), and an amorphous form. The data were analyzed with two model variants, and thermodynamic data of each form consistent with each of the models and with the CODATA key values for thermodynamics are presented.« less

Salt equivalence and temporal dominance of sensations of different sodium chloride substitutes in butter.

PubMed

de Souza, Vanessa Rios; Freire, Tassyana Vieira Marques; Saraiva, Carla Gonçalves; de Deus Souza Carneiro, João; Pinheiro, Ana Carla Marques; Nunes, Cleiton Antônio

2013-08-01

Studies indicate a positive association between dietary salt intake and some diseases, which has promoted the tendency to reduce the sodium in foods. The objective of this study was to determine the equivalent amount of different sodium chloride replacements required to promote the same degree of ideal saltiness in butter and to study the sensory profile of sodium chloride and the substitutes using the analysis of Temporal Dominance of Sensations (TDS). Using the magnitude estimation method, it was determined that the potencies of potassium chloride, monosodium glutamate and potassium phosphate relative to the 1% sodium chloride in butter are 83·33, 31·59 and 33·32, respectively. Regarding the sensory profile of the tested salt substitutes, a bitter taste was perceived in the butter with potassium chloride, a sour taste was perceived in the butter with potassium phosphate and sweet and umami tastes were dominant in the butter with monosodium glutamate. Of all the salt substitutes tested calcium lactate, potassium lactate, calcium chloride and magnesium chloride were impractical to use in butter.

Simulation of methylene blue adsorption by salts-treated beech sawdust in batch and fixed-bed systems.

PubMed

Batzias, F A; Sidiras, D K

2007-10-01

Batch and column kinetics of methylene blue adsorption on calcium chloride, zinc chloride, magnesium chloride and sodium chloride treated beech sawdust were simulated, using untreated beech sawdust as control, in order to explore its potential use as a low-cost adsorbent for wastewater dye removal. The adsorption capacity, estimated according to Freundlich's model, the Langmuir constant K(L) and the adsorption capacity coefficient values, determined using the Bohart and Adams' bed depth service model indicate that salts treatment enhanced the adsorption properties of the original material. Since sawdust is an industrial waste/byproduct and the salts used can be recovered as spent liquids from various chemical operations, this process of adsorbent upgrading/modification might be considered to take place within an 'Industrial Ecology' framework.

Persistent Skin Reactions and Aluminium Hypersensitivity Induced by Childhood Vaccines.

PubMed

Salik, Elaha; Løvik, Ida; Andersen, Klaus E; Bygum, Anette

2016-11-02

There is increasing awareness of reactions to vaccination that include persistent skin reactions. We present here a retrospective investigation of long-lasting skin reactions and aluminium hypersensitivity in children, based on medical records and questionnaires sent to the parents. In the 10-year period 2003 to 2013 we identified 47 children with persistent skin reactions caused by childhood vaccinations. Most patients had a typical presentation of persisting pruritic subcutaneous nodules. Five children had a complex diagnostic process involving paediatricians, orthopaedics and plastic surgeons. Two patients had skin biopsies performed from their skin lesions, and 2 patients had the nodules surgically removed. Forty-two children had a patch-test performed with 2% aluminium chloride hexahydrate in petrolatum and 39 of them (92%) had a positive reaction. The persistent skin reactions were treated with potent topical corticosteroids and disappeared slowly. Although we advised families to continue vaccination of their children, one-third of parents omitted or postponed further vaccinations.

Exploring 3D non-interpenetrated metal-organic framework with malonate-bridged Co(II) coordination polymer: structural elucidation and theoretical study

NASA Astrophysics Data System (ADS)

Hossain, Anowar; Mandal, Tripti; Mitra, Monojit; Manna, Prankrishna; Bauzá, Antonio; Frontera, Antonio; Seth, Saikat Kumar; Mukhopadhyay, Subrata

2017-12-01

A Co(II)-based coordination polymer with tetranuclear cobalt(II)-malonate cluster has been easily generated by aqueous medium self-assembly from Cobalt(II) chloride hexahydrate and malonic acid. The structure exhibits a non-interpenetrating, highly undulating two-dimensional (2D) bi-layer network with (4,4) topology. The crystal structure is composed of infinite interdigitated 2D metal-organic bi-layers which extended to an intricate 3D framework through the interbilayer hydrogen bonds. We have studied energetically by means of Density Functional Theory (DFT) calculations the H-bonding interactions that connect the 2D metal-organic bi-layers. The finite theoretical models have been used to compute conventional O‒H•••O and unconventional C‒H•••O interactions which plays a key role to build 3D architecture.

Quality of drinking water from the agricultural area treated with pitcher water filters

PubMed

Królak, Elżbieta; Raczuk, Jolanta; Sakowicz, Danuta; Biardzka, Elżbieta

Home methods of drinking water treatment through filtration have recently become quite popular. The aim of the study was to compare chemical composition of unfiltered water with water filtered in households with pitcher water filters. Obtained results were discussed in view of the effect of analysed chemical components of water on human health. Water samples were taken from water works supplies and from home dug wells from the agricultural area. Unfiltered water and water filtered through filters filled with active carbon and ion-exchanging resin and placed in a pitcher were analysed. Electrolytic conductivity, pH, hardness and the concentrations of calcium, magnesium, nitrate, phosphate and chloride ions were determined in water samples. Results of analyses were statistically processed. As a result of water filtration, the concentration of phosphates significantly increased and the concentrations of calcium, magnesium, electrolytic conductivity and pH decreased. No changes were noted in the concentration of chloride ions. Filtering water decreased the concentration of nitrates in dug wells samples. Using water purification devices is justified in the case of water originating from home dug wells contaminated with nitrates when, at the same time, consumers’ diet is supplemented with calcium and magnesium. Filtration of water from water works supplies, controlled by sanitary inspection seems aimless.

Laboratory and in-situ reductions of soluble phosphorus in swine waste slurries.

PubMed

Burns, R T; Moody, L B; Walker, F R; Raman

2001-11-01

Laboratory and field experiments were conducted using magnesium chloride (MgCl2) to force the precipitation of struvite (MgNH4PO4 x 6H2O) and reduce the concentration of soluble phosphorus (SP) in swine waste. In laboratory experiments, reductions of SP of 76% (572 to 135 mg P l(-1)) were observed in raw swine manure after addition of magnesium chloride (MgCl2) at a rate calculated to provide a 1.6:1 molar ratio of magnesium (Mg) to total phosphorus. Adjusting the pH of the treated manure to pH 9.0 with sodium hydroxide (NaOH) increased SP reduction to 91% (572 to 50 mg P l(-1)). X-ray diffraction of the precipitate recovered from swine waste slurry treated only with MgCl2 confirmed the presence ofstruvite. The molar N:P:Mg ratio of the recovered precipitate was 1:1.95:0.24, suggesting that compounds in addition to struvite were formed. In a field experiment conducted in a swine manure holding pond, a 90% reduction in SP concentration was observed in approximately 140,000 l of swine manure slurry treated before land application with 2,000 l MgCl2 (64% solution) at ambient slurry temperatures ranging from 5 to 10 degrees C.

Bone regeneration capacity of magnesium phosphate cements in a large animal model.

PubMed

Kanter, Britta; Vikman, Anna; Brückner, Theresa; Schamel, Martha; Gbureck, Uwe; Ignatius, Anita

2018-03-15

Magnesium phosphate minerals have captured increasing attention during the past years as suitable alternatives for calcium phosphate bone replacement materials. Here, we investigated the degradation and bone regeneration capacity of experimental struvite (MgNH 4 PO 4 ·6H 2 O) forming magnesium phosphate cements in two different orthotopic ovine implantation models. Cements formed at powder to liquid ratios (PLR) of 2.0 and 3.0 g ml -1 were implanted into trabecular bone using a non-load-bearing femoral drill-hole model and a load-bearing tibial defect model. After 4, 7 and 10 months the implants were retrieved and cement degradation and new bone formation was analyzed by micro-computed tomography (µCT) and histomorphometry. The results showed cement degradation in concert with new bone formation at both defect locations. Both cements were almost completely degraded after 10 months. The struvite cement formed with a PLR of 2.0 g ml -1 exhibited a slightly accelerated degradation kinetics compared to the cement with a PLR of 3.0 g ml -1 . Tartrat-resistant acid phosphatase (TRAP) staining indicated osteoclastic resorption at the cement surface. Energy dispersive X-ray analysis (EDX) revealed that small residual cement particles were mostly accumulated in the bone marrow in between newly formed bone trabeculae. Mechanical loading did not significantly increase bone formation associated with cement degradation. Concluding, struvite-forming cements might be promising bone replacement materials due to their good degradation which is coupled with new bone formation. Recently, the interest in magnesium phosphate cements (MPC) for bone substitution increased, as they exhibit high initial strength, comparably elevated degradation potential and the release of valuable magnesium ions. However, only few in vivo studies, mostly including non-load-bearing defects in small animals, have been performed to analyze the degradation and regeneration capability of MPC derived compounds. The present study examined the in vivo behavior of magnesiumammoniumphosphate hexahydrate (struvite) implants with different porosity in both mechanically loaded and non-loaded defects of merino sheep. For the first time, the effect of mechanical stimuli on the biological outcome of this clinically relevant replacement material is shown and directly compared to the conventional unloaded defect situation in a large animal model. Copyright © 2018 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Effect of Different Formulations of Magnesium Chloride Used As Anesthetic Agents on the Performance of the Isolated Heart of Octopus vulgaris.

PubMed

Pugliese, Chiara; Mazza, Rosa; Andrews, Paul L R; Cerra, Maria C; Fiorito, Graziano; Gattuso, Alfonsina

2016-01-01

Magnesium chloride (MgCl 2 ) is commonly used as a general anesthetic in cephalopods, but its physiological effects including those at cardiac level are not well-characterized. We used an in vitro isolated perfused systemic heart preparation from the common octopus, Octopus vulgaris , to investigate: (a) if in vivo exposure to MgCl 2 formulations had an effect on cardiac function in vitro and, if so, could this impact recovery and (b) direct effects of MgCl 2 formulations on cardiac function. In vitro hearts removed from animals exposed in vivo to 3.5% MgCl 2 in sea water (20 min) or to a mixture of MgCl 2 + ethanol (1.12/1%; 20 min) showed cardiac function (heart rate, stroke volume, cardiac output) comparable to hearts removed from animals killed under hypothermia. However, 3.5% MgCl 2 (1:1, sea water: distilled water, 20 min) produced a significant impairment of the Frank-Starling response as did 45 min exposure to the MgCl 2 + ethanol mixture. Perfusion of the isolated heart with MgCl 2 ± ethanol formulations produced a concentration-related bradycardia (and arrest), a decreased stroke volume and cardiac output indicating a direct effect on the heart. The cardiac effects of MgCl 2 are discussed in relation to the involvement of magnesium, sodium, chloride, and calcium ions, exposure time and osmolality of the formulations and the implications for the use of various formulations of MgCl 2 as anesthetics in octopus. Overall, provided that the in vivo exposure to 3.5% MgCl 2 in sea water or to a mixture of MgCl 2 + ethanol is limited to ~20 min, residual effects on cardiac function are unlikely to impact post-anesthetic recovery.

49 CFR 176.84 - Other requirements for stowage and segregation for cargo vessels and passenger vessels.

Code of Federal Regulations, 2014 CFR

2014-10-01

...” flammable liquids. 29 Stow “away from” ammonium compounds. 30 Stow “away from” animal or vegetable oils. 31... vegetable oils. 55 Stow “separated from” ammonia. 56 Stow “separated from” ammonium compounds. 57 Stow... hexahydrate solution, uranium metal hexahydrate solution, uranium metal pyrophoric and thorium metal...

49 CFR 176.84 - Other requirements for stowage and segregation for cargo vessels and passenger vessels.

Code of Federal Regulations, 2013 CFR

2013-10-01

...” flammable liquids. 29 Stow “away from” ammonium compounds. 30 Stow “away from” animal or vegetable oils. 31... vegetable oils. 55 Stow “separated from” ammonia. 56 Stow “separated from” ammonium compounds. 57 Stow... hexahydrate solution, uranium metal hexahydrate solution, uranium metal pyrophoric and thorium metal...

Recovery of ammonia and phosphate minerals from swine wastewater using gas-permeable membranes

USDA-ARS?s Scientific Manuscript database

Gas-permeable membrane technology is useful to recover ammonia from liquid manures. In this study, phosphorus (P) recovery via magnesium chloride precipitation was enhanced by combining it with ammonia recovery through gas-permeable membranes. Anaerobically digested swine effluent containing approx...

Soil salination indicators

USDA-ARS?s Scientific Manuscript database

Salts are naturally present in soils, and many salt elements are essential nutrients for plants. The most common soluble salts in soil include major cations of sodium (Na+), magnesium (Mg2+), calcium (Ca2+), potassium (K+), and anions of chloride (Cl-), sulfate (SO42-), bicarbonate (HCO3-) and carbo...

Hydro-geochemistry and application of water quality index (WQI) for groundwater quality assessment, Anna Nagar, part of Chennai City, Tamil Nadu, India

NASA Astrophysics Data System (ADS)

Krishna kumar, S.; Logeshkumaran, A.; Magesh, N. S.; Godson, Prince S.; Chandrasekar, N.

2015-12-01

In the present study, the geochemical characteristics of groundwater and drinking water quality has been studied. 24 groundwater samples were collected and analyzed for pH, electrical conductivity, total dissolved solids, carbonate, bicarbonate, chloride, sulphate, nitrate, calcium, magnesium, sodium, potassium and total hardness. The results were evaluated and compared with WHO and BIS water quality standards. The studied results reveal that the groundwater is fresh to brackish and moderately high to hard in nature. Na and Cl are dominant ions among cations and anions. Chloride, calcium and magnesium ions are within the allowable limit except few samples. According to Gibbs diagram, the predominant samples fall in the rock-water interaction dominance and evaporation dominance field. The piper trilinear diagram shows that groundwater samples are Na-Cl and mixed CaMgCl type. Based on the WQI results majority of the samples are falling under excellent to good category and suitable for drinking water purposes.

Size distribution of ions in atmospheric aerosols

NASA Astrophysics Data System (ADS)

Krivácsy, Z.; Molnár, Á.

The aim of this paper is to present data about the concentration and size distribution of ions in atmospheric aerosol under slightly polluted urban conditions in Hungary. Concentration of inorganic cations (ammonium, sodium, potassium, calcium, magnesium), inorganic anions (sulfate, nitrate, chloride, carbonate) and organic acids (oxalic, malonic, succinic, formic and acetic acid) for 8 particle size range between 0.0625 and 16 μm were determined. As was the case for ammonium, sulfate and nitrate, the organic acids were mostly found in the fine particle size range. Potassium and chloride were rather uniformly distributed between fine and coarse particles. Sodium, calcium, magnesium and carbonate were practically observed in the coarse mode. The results obtained for the summer and the winter half-year were also compared. The mass concentrations were recalculated in equivalents, and the ion balance was found to be reasonable in most cases. Measurement of the pH of the aerosol extracts indicates that the aerosol is acidic in the fine mode, but alkaline in the coarse particle size range.

Effects of Variations in Salt-Spray Conditions on the Corrosion Mechanisms of an AE44 Magnesium Alloy

DOE PAGES

Martin, Holly J.; Horstemeyer, M. F.; Wang, Paul T.

2010-01-01

The understanding of how corrosion affects magnesium alloys is of utmost importance as the automotive and aerospace industries have become interested in the use of these lightweight alloys. However, the standardized salt-spray test does not produce adequate corrosion results when compared with field data, due to the lack of multiple exposure environments. This research explored four test combinations through three sets of cycles to determine how the corrosion mechanisms of pitting, intergranular corrosion, and general corrosion were affected by the environment. Of the four test combinations, Humidity-Drying was the least corrosive, while the most corrosive test condition was Salt Spray-Humidity-Drying.more » The differences in corrosivity of the test conditions are due to the various reactions needed to cause corrosion, including the presence of chloride ions to cause pit nucleation, the presence of humidity to cause galvanic corrosion, and the drying phase which trapped chloride ions beneath the corrosion by-products.« less

Development and prototype testing of MgCl 2 /graphite foam latent heat thermal energy storage system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Dileep; Yu, Wenhua; Zhao, Weihuan

Composites of graphite foam infiltrated with a magnesium chloride phase-change material have been developed as high-temperature thermal energy storage media for concentrated solar power applications. This storage medium provides a high thermal energy storage density, a narrow operating temperature range, and excellent heat transfer characteristics. In this study, experimental investigations were conducted on laboratory-scale prototypes with magnesium chloride/graphite foam composite as the latent heat thermal energy storage system. Prototypes were designed and built to monitor the melt front movement during the charging/discharging tests. A test loop was built to ensure the charging/discharging of the prototypes at temperatures > 700 degreesmore » C. Repeated thermal cycling experiments were carried out on the fabricated prototypes, and the experimental temperature profiles were compared to the predicted results from numerical simulations using COMSOL Multiphysics software. Experimental results were found to be in good agreement with the simulations to validate the thermal models.« less

ZM-21 magnesium alloy corrosion properties and cryogenic to elevated temperature mechanical properties

NASA Technical Reports Server (NTRS)

Montana, J. W.; Nelson, E. E.

1972-01-01

The mechanical properties of bare ZM-21 magnesium alloy flat tensile specimens were determined for test temperatures of +400 F, +300 F, +200 F, +80 F, 0 F, -100 F, -200 F, and -320 F. The ultimate tensile and yield strengths of the material increased with decreasing temperature with a corresponding reduction in elongation values. Stress corrosion tests performed under: (1) MSFC atmospheric conditions; (2) 95% relative humidity; and (3) submerged in 100 ppm chloride solution for 8 weeks indicated that the alloy is not susceptible to stress corrosion. The corrosion tests indicated that the material is susceptible to attack by crevice corrosion in high humidity and chemical type attack by chloride solution. Atmospheric conditions at MSFC did not produce any adverse effects on the material, probably due to the rapid formation of a protective oxide coating. In both the mechanical properties and the stress corrosion evaluations the test specimens which were cut transverse to the rolling direction had superior properties when compared to the longitudinal properties.

A copper(II) paddle-wheel structure of tranexamic acid: di-chloro-tetra-kis-[μ-4-(ammonio-meth-yl)cyclo-hexane-1-carboxyl-ato-O,O']dicopper(II) dichloride hexa-hydrate.

PubMed

Altaf, Muhammad; Stoeckli-Evans, Helen

2017-10-01

Tranexamic acid [systematic name: trans -4-(amino-meth-yl)cyclo-hexane-1-carb-oxy-lic acid], is an anti-fibrinolytic amino acid that exists as a zwitterion [ trans -4-(ammonio-meth-yl)cyclo-hexane-1-carboxyl-ate] in the solid state. Its reaction with copper chloride leads to the formation of a compound with a copper(II) paddle-wheel structure that crystallizes as a hexa-hydrate, [Cu 2 Cl 2 (C 8 H 15 NO 2 ) 4 ] 2+ ·2Cl - ·6H 2 O. The asymmetric unit is composed of a copper(II) cation, two zwitterionic tranexamic acid units, a coordinating Cl - anion and a free Cl - anion, together with three water mol-ecules of crystallization. The whole structure is generated by inversion symmetry, with the Cu⋯Cu axle of the paddle-wheel dication being located about a center of symmetry. The cyclo-hexane rings of the zwitterionic tranexamic acid units have chair conformations. The carboxyl-ate groups that bridge the two copper(II) cations are inclined to one another by 88.4 (8)°. The copper(II) cation is ligated by four carboxyl-ate O atoms in the equatorial plane and by a Cl - ion in the axial position. Hence, it has a fivefold O 4 Cl coordination sphere with a perfect square-pyramidal geometry and a τ 5 index of zero. In the crystal, the paddle-wheel dications are linked by a series of N-H⋯Cl hydrogen bonds, involving the coordinating and free Cl - ions, forming a three-dimensional network. This network is strengthened by a series of N-H⋯O water , O water -H⋯Cl and O water -H⋯O hydrogen bonds.

Microbial Growth in the Magnesium- Chloride - Sodium- Sulphate Ion System: Implications for Habitability in Terrestrial and Extraterrestrial Salts

NASA Astrophysics Data System (ADS)

Loudon, C. M.; Aka, S.; Cockell, C. S.

2017-12-01

Icy moons in the outer solar system are key targets in the search for extra-terrestrial life as there is evidence that they harbour subsurface oceans. Observational evidence of icy moons such as Europa suggest that these likely brine oceans should be composed of chloride and sulphate salts. The effects of the ions that compose these salts on biology and how the interactions between them can create geochemical and geophysical barriers to life are poorly understood. Here we present an in depth study of four microorganisms grown in solutions with varying combinations of the magnesium- chloride- sodium- sulphate ions. We find that the ion composition of the brine solution can have a large effect on growth. Whilst the water activity must be permissible for growth we found that this alone could not predict the effects of the ions on growth, chaotropic effects and ion specific effects influenced by the specific physiology of organisms are also evident. For this reason we conclude that simply knowing which salts are present on icy moons is not sufficient information to determine their potential habitibility. A full sample of any brine ocean would need to be studied to fully determine the potential for biology on these outer solar system satellites.

Electrochemical cell

DOEpatents

Kaun, Thomas D.

1984-01-01

An improved secondary electrochemical cell is disclosed having a negative electrode of lithium aluminum, a positive electrode of iron sulfide, a molten electrolyte of lithium chloride and potassium chloride, and the combination that the fully charged theoretical capacity of the negative electrode is in the range of 0.5-1.0 that of the positive electrode. The cell thus is negative electrode limiting during discharge cycling. Preferably, the negative electrode contains therein, in the approximate range of 1-10 volume % of the electrode, an additive from the materials of graphitized carbon, aluminum-iron alloy, and/or magnesium oxide.

Electrochemical cell

DOEpatents

Kaun, T.D.

An improved secondary electrochemical cell is disclosed having a negative electrode of lithium aluminum, a positive electrode of iron sulfide, a molten electrolyte of lithium chloride and potassium chloride, and the combination that the fully charged theoretical capacity of the negative electrode is in the range of 0.5 to 1.0 that of the positive electrode. The cell thus is negative electrode limiting during discharge cycling. Preferably, the negative electrode contains therein, in the approximate range of 1 to 10 volume % of the electrode, an additive from the materials of graphitized carbon, aluminum-iron alloy, and/or magnesium oxide.

Lightweight Passive Microclimate Cooling Device

DTIC Science & Technology

1993-03-01

rabrication. No consideration was given to weight. We have examined alternate methods of construction of the backpack and cylinder assembly and thin...13 Figure 7. Water Adsorption on Magnesium Chloride ........... 14 Figure 8. Cylinder Assembly ................................ 20...Figure 9. Backpack Assembly ............................... 21 Figure 10. Unwrapped Vest ................................... 22 Figure 11. Adsorption

Effects of calcium magnesium acetate, a road deicer, on the lentic environment in interior Alaska, interim report

DOT National Transportation Integrated Search

1985-03-01

The application of chloride deicing salts to roadways has increased dramatically in recent years due to public demand for safer winter driving conditions. Unfortunately, these salts create adverse effects such as corrosion of vehicles and bridge stru...

Precipitation and streamwater chemistry in an undisturbed watershed in southeast Alaska.

Treesearch

John D. Stednick

1981-01-01

Water chemistry samples have been taken from streamflow since 1976 and precipitation since 1978 in Indian River, an undisturbed watershed on Chichagof Island in Southeast Alaska. Volume weighted concentrations of total nitrogen, ammonium nitrogen, nitrate nitrogen, total phosphorus, orthophosphate, sulfate sulfur, chloride, bicarbonate, silica, calcium, magnesium,...

Strategies to prepare and use functionalized organometallic reagents.

PubMed

Klatt, Thomas; Markiewicz, John T; Sämann, Christoph; Knochel, Paul

2014-05-16

Polyfunctional zinc and magnesium organometallic reagents occupy a central position in organic synthesis. Most organic functional groups are tolerated by zinc organometallic reagents, and Csp(2)-centered magnesium organometallic reagents are compatible with important functional groups, such as the ester, aryl ketone, nitro, cyano, and amide functions. This excellent chemoselectivity gives zinc- and magnesium-organometallic reagents a central position in modern organic synthesis. Efficient and general preparations of these organometallic reagents, as well as their most practical and useful reactions, are presented in this Perspective. As starting materials, a broad range of organic halides (iodides, bromides, and also to some extent chlorides) can be used for the direct insertion of magnesium or zinc powder; the presence of LiCl very efficiently promotes such insertions. Alternatively, aromatic or heterocyclic bromides also undergo a smooth bromine-magnesium exchange when treated with i-PrMgCl·LiCl. Alternative precursors of zinc and magnesium reagents are polyfunctionalized aryl and heteroaryl molecules, which undergo directed metalations with sterically hindered TMP bases (TMP = 2,2,6,6-tetramethylpiperide) of magnesium and zinc. This powerful C-H functionalization method gives access to polyfunctional heterocyclic zinc and magnesium reagents, which undergo efficient reactions with numerous electrophiles. The compatibility of the strong TMP-bases with BF3·OEt2 (formation of frustrated Lewis pairs) dramatically increases the scope of these metalations, giving for example, a practical access to magnesiated pyridines and pyrazines, which can be used as convenient building blocks for the preparation of biologically active molecules.

Geologic map showing springs rich in carbon dioxide or or chloride in California

USGS Publications Warehouse

Barnes, Ivan; Irwin, William P.; Gibson, H.A.

1975-01-01

Carbon dioxide- and chloride-rich springs occur in all geologic provinces in California, but are most abundant in the Coast Ranges and the Great Valley. The carbon-dioxide-rich springs issue mainly from Franciscan terrane; they also are rich in boron and are of the metamorphic type (White, 1957). Based on isotopic data, either the carbon dioxide or the water, or both, may be of metamorphic origin. Because of high magnesium values, the water of many of the carbon-dioxide-rich springs is thought to have passed through serpentinite. The chloride-rich waters are most common in rocks of the Great Valley sequence. Nearly all are more dilute than present-day sea water. The similarity in isotopic compositions of the metamorphic carbon-dioxide-rich water and the chloride-rich water may indicate a similar extent of water-rock interaction.

Potential Evaporite Biomarkers from the Dead Sea

NASA Technical Reports Server (NTRS)

Morris, Penny A.; Wentworth, Susan J.; Thomas-Keprta, Kathie; Allen, Carlton C.; McKay, David S.

2001-01-01

The Dead Sea is located on the northern branch of the African-Levant Rift systems. The rift system, according to one model, was formed by a series of strike slip faults, initially forming approximately two million years ago. The Dead Sea is an evaporite basin that receives freshwater from springs and from the Jordan River. The Dead Sea is different from other evaporite basins, such as the Great Salt Lake, in that it possesses high concentrations of magnesium and has an average pH of 6.1. The dominant cation in the Great Salt Lake is sodium, and the pH is 7.7. Calcium concentrations are also higher in the Dead Sea than in the Great Salt Lake. Both basins are similar in that the dominant anion is chlorine and the salinity levels are approximately 20 %. Other common cations that have been identified from the waters of the Dead Sea and the Great Salt Lake include sodium and potassium. A variety of Archea, Bacteria, and a single genus of a green algal, Dunaliella, has been described from the Dead Sea. Earlier studies concentrated on microbial identification and analysis of their unique physiology that allows them to survive in this type of extreme environment. Potential microbial fossilization processes, microbial fossils, and the metallic ions associated with fossilization have not been studied thoroughly. The present study is restricted to identifying probable microbial morphologies and associated metallic ions. XRD (X Ray Diffraction) analysis indicates the presence of halite, quartz, and orthoclase feldspar. In addition to these minerals, other workers have reported potassium chloride, magnesium bromide, magnesium chloride, calcium chloride, and calcium sulfate. Halite, calcium sulfate, and orthoclase were examined in this report for the presence of microbes, microbially induced deposits or microbial alteration. Neither the gypsum nor the orthoclase surfaces possesses any obvious indications of microbial life or fossilization. The sand-sized orthoclase particles are weathered with 122 extensive fan-shaped mineral deposits. The gypsum deposits are associated with halite minerals and also exhibit extensive weathering. Halite minerals represent the only substrates that have probable rod-shaped microbial structures with long, filamentous, apical extensions. EDS (energy dispersive x-ray) analysis of the putative microbes indicates elevated calcium levels that are enriched with magnesium. The rod-shaped structures exhibit possible fossilization stages. Rhombohedralshaped minerals of magnesium-enriched calcium carbonate are deposited on the microbial surfaces, and eventually coat the entire microbial surface. The sodium chloride continues to crystallize on nearby halite surface and even crystallizes on the fossilized microbial remains. The putative fossils are found exclusively on halite surfaces, and all contained elevated levels of calcium magnesium cations. Both of these metallic cations are associated with microbial activity and fossilization. Their morphological diversity is low in comparison with the reported living Dead Sea microbial population. If we examine the fossil record for multicellular organisms, fossilization rates are lower for soft-bodied organisms than for those possessing hard parts, i.e. shells, bones. For example, smaller, single celled organisms would have a smaller chance of fossilization; their fossilized shapes could be mistaken for abiotic products. Another consideration is that dead organisms in the water column are probably utilized as a food source by other microbes before fossilization processes are completed. This may be an important consideration as we attempt to model and interpret ancient microbial environments either on Earth or on Mars.

Effects of environment on microhardness of magnesium oxide

NASA Technical Reports Server (NTRS)

Ishigaki, H.; Buckley, D. H.

1982-01-01

Micro-Vickers hardness measurements of magnesium oxide single crystals were conducted in various environments. These environments included air, nitrogen gas, water, mineral oil with or without various additives, and aqueous solutions with various pH values. Indentations were made on the (100) plane with the diagonals of the indentation in the (100) direction. The results indicate that a sulfur containing additve in mineral oil increased hardness, a chlorine containing additive in mineral oil decreased hardness, and aqueous solutions of hydrogen chloride decreased hardness. Other environments were found to have little effect on hardness. Mechanically polished surfaces showed larger indentation creep than did as-cleaved surfaces.

Thermal Energy Storage Material Comprising Mixtures of Sodium, Potassium and Magnesium Chlorides.

DTIC Science & Technology

This invention pertains generally to the storage of thermal energy and in particular to such storage as latent heat of fusion in a ternary eutectic ... salt mixture. Storage of thermal energy has gained great importance since the increased interest in the use of solar energy. On account of the

Clearcutting affects stream chemistry in the White Mountains of New Hampshire

Treesearch

C. Wayne Martin; Robert S. Pierce; Gene E. Likens; F. Herbert Bormann; F. Herbert Bormann

1986-01-01

Commercial clearcutting of northern hardwood forests changed the chemistry of the streams that drained from them. By the second year after cutting, specific conductance doubled, nitrate increased tenfold, calcium tripled, and sodium, magnesium, and potassium doubled. Chloride and ammonium did not change; sulfate decreased. Concentrations of most ions returned to...

Quality of major ion and total dissolved solids data from groundwater sampled by the National Water-Quality Assessment Program, 1992–2010

USGS Publications Warehouse

Gross, Eliza L.; Lindsey, Bruce D.; Rupert, Michael G.

2012-01-01

Field blank samples help determine the frequency and magnitude of contamination bias, and replicate samples help determine the sampling variability (error) of measured analyte concentrations. Quality control data were evaluated for calcium, magnesium, sodium, potassium, chloride, sulfate, fluoride, silica, and total dissolved solids. A 99-percent upper confidence limit is calculated from field blanks to assess the potential for contamination bias. For magnesium, potassium, chloride, sulfate, and fluoride, potential contamination in more than 95 percent of environmental samples is less than or equal to the common maximum reporting level. Contamination bias has little effect on measured concentrations greater than 4.74 mg/L (milligrams per liter) for calcium, 14.98 mg/L for silica, 4.9 mg/L for sodium, and 120 mg/L for total dissolved solids. Estimates of sampling variability are calculated for high and low ranges of concentration for major ions and total dissolved solids. Examples showing the calculation of confidence intervals and how to determine whether measured differences between two water samples are significant are presented.

Effects of Mg{sup 2+}, Co{sup 2+}, and Hg{sup 2+} on the nucleus and nucleolus in root tip cells of allium cepa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, D.; Jiang, W.; Wang, W.

Metal toxicity in plants has been known for a long time. Much importance has increasingly been attached to the problems of metal pollution with the development of modern industry and agriculture. If metals in plants are accumulated to a large extent, it might seriously affect them. The cytological effects of cobalt and mercury have been studied in Allium cepa by documentation of c-mitosis. Also, the quantification of chromosome aberration in Vicia faba root-tip cells treated by magnesium sulphate and in Allium cepa by metyl mercury chloride and mercuric chloride has been reported. Cytological research on the poisoning effects of Mg,more » Co and Hg on the nuclei and nucleoli in root-tip cells of plants has hardly been reported. The aim of this study was to determine the effects of different concentrations of magnesium, cobalt and mercury ions on root growth, and on the nuclei and nucleoli of root tip cells of Allium-cepa. 20 refs., 3 figs.« less

URANIUM PURIFICATION PROCESS

DOEpatents

Winters, C.E.

1957-11-12

A method for the preparation of a diethyl ether solution of uranyl nitrate is described. Previously the preparation of such ether solutions has been difficult and expensive, since crystalline uranyl nitrate hexahydrate dissolves very slowly in ether. An improved method for effecting such dissolution has been found, and it comprises adding molten uranyl nitrate hexahydrate at a temperature of 65 to 105 deg C to the ether while maintaining the temperature of the ether solvent below its boiling point.

Sodium relations in desert plants: 7. Effects of sodium chloride on Atriplex polycarpa and Atriplex canescens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallace, A.; Romney, E.M.; Mueller, R.T.

1982-07-01

Atriplex canescens (Pursh) Nutt. ssp. canescens (Caligonum c. Pursh.) and Atriplex polycarpa (Torr.) Wats. (Obione p. Torr.) plants were grown in Yolo loam soil in a glasshouse with different levels of sodium salts. Both species tolerated concentrations of salt equivalent to seawater, using either NaCl or Na/sub 2/SO/sub 4/. Vegetative yields were sightly higher with chloride, particularly with stems of A. polycarpa; SO/sub 4//sup 2 -/ decreased calcium and magnesium concentrations. Atriplex canescens leaves contained less Na, total cations, Cl, S, and Si, but more N than did those of A. polycarpa. The A. polycarpa would have high concentrations ormore » organic acids in leaves. Chloride decreased N concentrations in leaves of A. polycarpa.« less

One-pot Synthesis and Surface Modification of Fe3O4 Nanoparticles Using Polyvinyl Alcohol by Coprecipitation and Ultrasonication Methods

NASA Astrophysics Data System (ADS)

Nugraha, Aditya D.; Wulandari, Ika O.; Hutami Rahayu, L. B.; Riva'i, Imam; Santojo, D. J. Djoko H.; Sabarudin, Akhmad

2018-01-01

Among the various substances developed through nanoparticles, iron oxide (Fe3O4) nanoparticle is one of the substances that have been widely used in various fields such as industry, agriculture, biotechnology and biomedicine. The synthesis of Fe3O4 nanoparticle can be carried out by two methods, consist of chemical and mechanical synthesis methods. Coprecipitation is one of the most commonly used methods for chemical synthesis. Fe3O4 compounds are easily oxidized because they are amphoteric. To avoid the continuous oxidation process, chemical modification process should be carried out with the addition of a solution of polyvinyl alcohol (PVA). In this study, PVA-coated Fe3O4 nanoparticles were synthesized by in-situ coprecipitation and ultrasonication methods through direct mixing (one-pot synthesis) of the iron (II) chloride tetrahydrate (FeCl2.4H2O), iron (III) chloride hexahydrate (FeCl3.6H2O), and PVA under alkaline condition. The effects of addition amount of NH3solution (by adjusting its flow rate using automated syringe pump) and PVA concentration were gently studied. Interaction of PVA with Fe3O4 nanoparticle was identified by infrared spectroscopy whereas lattice parameters and crystallite sizes of the synthesized Fe3O4 nanoparticles and PVA-coated Fe3O4 nanoparticles were assessed by X-ray diffraction (XRD).

Preparation and Characterization of Hydroxyapatite Coating on AZ31 Mg Alloy for Implant Applications

PubMed Central

Salman, S. A.; Kuroda, K.; Okido, M.

2013-01-01

Magnesium alloys as biodegradable metal implants in orthopaedic research received a lot of interest in recent years. They have attractive biological properties including being essential to human metabolism, biocompatibility, and biodegradability. However, magnesium can corrode too rapidly in the high-chloride environment of the physiological system, loosing mechanical integrity before the tissue has sufficiently healed. Hydroxyapatite (HAp) coating was proposed to decrease the corrosion rate and improve the bioactivity of magnesium alloy. Apatite has been cathodically deposited on the surface of Mg alloy from solution that composed of 3 mM Ca(H2PO4)2 and 7 mM CaCl2 at various applied potentials. The growing of HAp was confirmed on the surface of the coatings after immersion in SBF solution for 7 days. The coating obtained at −1.4 V showed higher corrosion resistance with bioactive behaviors. PMID:23533371

The effect of magnesium ion concentration on the fibrocartilage regeneration potential of goat costal chondrocytes.

PubMed

Hagandora, Catherine K; Tudares, Mauro A; Almarza, Alejandro J

2012-03-01

Magnesium has recently been explored as a potential biomaterial for degradable orthopedic implants but its effect on fibrocartilage remains unknown. The objective of this study was to assess the effect of high concentrations of magnesium ions on the matrix production of goat costal fibrochondrocytes in vitro. Cells were cultured using a scaffoldless approach with media containing magnesium chloride (MgCl(2)) or magnesium sulfate (MgSO(4)) at concentrations of 20, 50, and 100 mM in addition to the baseline magnesium concentration of 0.8 mM MgSO(4). At 4 weeks, there were no significant differences in compressive tangent modulus and total matrix production between constructs cultured in 20 mM Mg(2+) and the 0.8 mM Mg(2+) control (435 ± 47 kPa). There was a significant decrease in compressive tangent modulus compared to the 0.8 mM Mg(2+) constructs in the 50 mM MgCl(2) and MgSO(4) groups, while the 100 mM groups were not mechanically testable (p < 0.05). The collagen and glycosaminoglycan (GAG) content of the 50 and 100 mM MgCl(2) and MgSO(4) constructs was significantly lower than the control (6.9 ± 0.5% and 16.5 ± 1.3% per dry weight, respectively) (p < 0.05). The results show that goat costal fibrochondrocytes exhibit a high degree of resiliency to magnesium ion concentrations up to 20 mM in vitro.

Phase-change materials aid in heat recovery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parkinson, G.

1979-07-16

Research into a wide range of compounds which absorb heat during fusion and then release it as they cool and solidify is being encouraged by the U.S. Department of Energy, which has budgeted $18 million for thermal energy storage systems for 1980, about half of it for systems using phase-change materials. Pipe Systems Inc. is marketing a low-temperature thermal-energy storage system which uses Dow Chemical Co.'s calcium chloride hexahydrate material. Systems based on Glauber's salt, i.e., sodium sulfate decahydrate, are sold by Architectural Research Corp., Valmont Energy Systems Inc., and Solar Inc.; and F. Addison Products Co. sells a systemmore » based on paraffin wax. These low-temperature systems are suitable for space heating. Applications for systems which release heat at up to 1500/sup 0/F include hot water for domestic use, industrial process heat, and solar thermal electric power generation. The specific research and development under way at various organizations are discussed.« less

Cuboid Ni2 P as a Bifunctional Catalyst for Efficient Hydrogen Generation from Hydrolysis of Ammonia Borane and Electrocatalytic Hydrogen Evolution.

PubMed

Du, Yeshuang; Liu, Chao; Cheng, Gongzhen; Luo, Wei

2017-11-16

The design of high-performance catalysts for hydrogen generation is highly desirable for the upcoming hydrogen economy. Herein, we report the colloidal synthesis of nanocuboid Ni 2 P by the thermal decomposition of nickel chloride hexahydrate (NiCl 2 ⋅6 H 2 O) and trioctylphosphine. The obtained nanocuboid Ni 2 P was characterized by using powder X-ray diffraction, transmission electron microscopy, energy-dispersive X-ray spectroscopy, X-ray photoelectron spectroscopy, and inductively coupled plasma atomic emission spectroscopy. For the first time, the as-synthesized nanocuboid Ni 2 P is used as a bifunctional catalyst for hydrogen generation from the hydrolysis of ammonia borane and electrocatalytic hydrogen evolution. Owing to the strong synergistic electronic effect between Ni and P, the as-synthesized Ni 2 P exhibits catalytic performance that is superior to its counterpart without P doping. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Facing up to the imperceptible perspiration. Modulatory influences by diabetic neuropathy, physical exercise and antiperspirant.

PubMed

Xhauflaire-Uhoda, Emmanuelle; Mayeux, Géraldine; Quatresooz, Pascale; Scheen, André; Piérard, Gérald E

2011-11-01

Sweating is variably altered by physical exercise, diabetic neuropathy and antiperspirants. Skin temperature, skin surface water loss (SSWL), the Corneometer(®) average capacitance (CMAC) and skin capacitance mapping (SCM) were measured before and after moderate physical exercise in 20 healthy subjects. The effect of 5% aluminium chloride hexahydrate (ACH) in a water solution was similarly tested. The same assessments were performed in 20 diabetic patients at rest. Diabetic neuropathy appeared at rest as an increased (compensatory) SCM on the forearms without obvious modification on the hypohidrotic legs. On ACH sites after exercise, SCM revealed both a lowered number of active sweat glands and a lighter stratum corneum (SC) (dryness). In addition, CMAC and SSWL were decreased on ACH sites at rest and at completion of exercise. In diabetic neuropathy, the compensatory hyperhidrosis is more easily disclosed than the hypohidrosis. ACH affects both sweat excretion and the SC hydration. © 2011 John Wiley & Sons A/S.

A flexible ligand-based wavy layered metal-organic framework for lithium-ion storage.

PubMed

An, Tiance; Wang, Yuhang; Tang, Jing; Wang, Yang; Zhang, Lijuan; Zheng, Gengfeng

2015-05-01

A substantial challenge for direct utilization of metal-organic frameworks (MOFs) as lithium-ion battery anodes is to maintain the rigid MOF structure during lithiation/delithiation cycles. In this work, we developed a flexible, wavy layered nickel-based MOF (C20H24Cl2N8Ni, designated as Ni-Me4bpz) by a solvothermal approach of 3,3',5,5'-tetramethyl-4,4'-bipyrazole (H2Me4bpz) with nickel(II) chloride hexahydrate. The obtained MOF materials (Ni-Me4bpz) with metal azolate coordination mode provide 2-dimensional layered structure for Li(+) intercalation/extraction, and the H2Me4bpz ligands allow for flexible rotation feature and structural stability. Lithium-ion battery anodes made of the Ni-Me4bpz material demonstrate excellent specific capacity and cycling performance, and the crystal structure is well preserved after the electrochemical tests, suggesting the potential of developing flexible layered MOFs for efficient and stable electrochemical storage. Copyright © 2015 Elsevier Inc. All rights reserved.

Melting temperature and enthalpy variations of phase change materials (PCMs): a differential scanning calorimetry (DSC) analysis

NASA Astrophysics Data System (ADS)

Sun, Xiaoqin; Lee, Kyoung Ok; Medina, Mario A.; Chu, Youhong; Li, Chuanchang

2018-06-01

Differential scanning calorimetry (DSC) analysis is a standard thermal analysis technique used to determine the phase transition temperature, enthalpy, heat of fusion, specific heat and activation energy of phase change materials (PCMs). To determine the appropriate heating rate and sample mass, various DSC measurements were carried out using two kinds of PCMs, namely N-octadecane paraffin and calcium chloride hexahydrate. The variations in phase transition temperature, enthalpy, heat of fusion, specific heat and activation energy were observed within applicable heating rates and sample masses. It was found that the phase transition temperature range increased with increasing heating rate and sample mass; while the heat of fusion varied without any established pattern. The specific heat decreased with the increase of heating rate and sample mass. For accuracy purpose, it is recommended that for PCMs with high thermal conductivity (e.g. hydrated salt) the focus will be on heating rate rather than sample mass.

Extracellular oxygen concentration mapping with a confocal multiphoton laser scanning microscope and TCSPC card

NASA Astrophysics Data System (ADS)

Hosny, Neveen A.; Lee, David A.; Knight, Martin M.

2010-02-01

Extracellular oxygen concentrations influence cell metabolism and tissue function. Fluorescence Lifetime Imaging Microscopy (FLIM) offers a non-invasive method for quantifying local oxygen concentrations. However, existing methods show limited spatial resolution and/or require custom made systems. This study describes a new optimised approach for quantitative extracellular oxygen detection, providing an off-the-shelf system with high spatial resolution and an improved lifetime determination over previous techniques, while avoiding systematic photon pile-up. Fluorescence lifetime detection of an oxygen sensitive fluorescent dye, tris(2,2'-bipyridyl)ruthenium(II) chloride hexahydrate [Ru(bipy)3]2+, was measured using a Becker&Hickl time-correlated single photon counting (TCSPC) card with excitation provided by a multi-photon laser. This technique was able to identify a subpopulation of isolated chondrocyte cells, seeded in three-dimensional agarose gel, displaying a significant spatial oxygen gradient. Thus this technique provides a powerful tool for quantifying spatial oxygen gradients within three-dimensional cellular models.

Surface effects of corrosive media on hardness, friction, and wear of materials

NASA Technical Reports Server (NTRS)

Miyoshi, K.; Buckley, D. H.; Rengstorff, G. W. P.; Ishigaki, H.

1985-01-01

Hardness, friction, and wear experiments were conducted with magnesium oxide exposed to various corrosive media and also with elemental iron and nickel exposed to water and NaOH. Chlorides such as MgCl2 and sodium containing films were formed on cleaved magnesium oxide surfaces. The MgCl2 films softened the magnesium oxide surfaces and caused high friction and great deformation. Hardness was strongly influenced by the pH value of the HCl-containing solution. The lower the pH, the lower the microhardness. Neither the pH value of nor the immersion time in NaOH containing, NaCl containing, and HNO3 containing solutions influenced the microhardness of magnesium oxide. NaOH formed a protective and low friction film on iron surfaces. The coefficient of friction and the wear for iron were low at concentrations of NaOH higher than 0.01 N. An increase in NaOH concentration resulted in a decrease in the concentration of ferric oxide on the iron surface. It took less NaOH to form a protective, low friction film on nickel than on iron.

Comparison of magnesium sulfate and sodium sulfate for removal of water from pesticide extracts of foods.

PubMed

Schenck, Frank J; Callery, Patrick; Gannett, Peter M; Daft, Jonathan R; Lehotay, Steven J

2002-01-01

Water-miscible solvents, such as acetone and acetonitrile, effectively extract both polar and nonpolar pesticide residues from nonfatty foods. The addition of sodium chloride to the resulting acetonitrile-water or acetone-water extract (salting out) results in the separation of the water from the organic solvent. However, the organic solvent layer (pesticide extract) still contains some residual water, which can adversely affect separation procedures that follow, such as solid-phase extraction and/or gas chromatography. Drying agents, such as sodium sulfate or magnesium sulfate, are used to remove the water from the organic extracts. In the present study, we used nuclear magnetic resonance spectroscopy to study the composition of the phases resulting from salting out and to compare the effectiveness of sodium sulfate and magnesium sulfate as drying agents. The study showed that considerable amounts of water remained in the organic phase after phase separation. Sodium sulfate was a relatively ineffective drying agent, removing little or no residual water from the organic solvent. Magnesium sulfate proved to be a much more effective drying agent.

Geochemical characteristics of the San Miguel aquifer, Baja California, Mexico.

NASA Astrophysics Data System (ADS)

Tostado-Plascencia, Miriam; Rosas-Elguera, Jose; Kretzschmar, Thomas

2010-05-01

The valley of San Miguel, located in the state of Baja California, Mexico, is an important region because of the wine industry. It is therefore important to know groundwater characteristics. Two aquifers can be recognized in the San Miguel basin, first one is in fractured granitic rocks (in the upper part of the basin, called UB) and other is free-type in detritc sediments (in the lower part of the basin, close to the sea, called LB). The water temperature ranges between 25°C y 11°C without significant variations along the year. The conductivity increases with the water temperature and decreases in February when the temperature is lower. The pH of the waters in UB is between 8.5 and 6.5 but in the LB is in the range of 6.8 to 7.3. Our data show that Na, Mg, and HCO3- concentrations decrease during the rainy season due to ion exchange. According to the Stiff diagrams the waters of the LB are classified as sodium chloride. In the UB the water classification includes calcium and magnesium bicarbonate, magnesium chloride, and few calcium chloride and sodium chloride. The saturation indexes of the waters suggest that the mineral phases which can be present are: K-feldspar, gibbsite, albite, quartz, calcite, aragonite, gypsum, and magnesite. Because of SI>0 then the first four phases can precipitate but the SI of magnesite and gypsum is negative thus the can be dissolved. Finally, calcite and aragonite are in equilibrium due to they are close to zero. Our results suggest that the aquifers of the San Miguel basin do not show evidence of saline intrusion.

Groundwater quality assessment in the village of Lutfullapur Nawada, Loni, District Ghaziabad, Uttar Pradesh, India.

PubMed

Singh, Vinod K; Bikundia, Devendra Singh; Sarswat, Ankur; Mohan, Dinesh

2012-07-01

The groundwater quality for drinking, domestic and irrigation in the village Lutfullapur Nawada, Loni, district Ghaziabad, U.P., India, has been assessed. Groundwater samples were collected, processed and analyzed for temperature, pH, conductivity, salinity, total alkalinity, carbonate alkalinity, bicarbonate alkalinity, total hardness, calcium hardness, magnesium hardness, total solids, total dissolved solids, total suspended solids, nitrate-nitrogen, chloride, fluoride, sulfate, phosphate, silica, sodium, potassium, calcium, magnesium, total chromium, cadmium, copper, iron, nickel, lead and zinc. A number of groundwater samples showed levels of electrical conductivity (EC), alkalinity, chloride, calcium, sodium, potassium and iron exceeding their permissible limits. Except iron, the other metals (Cr, Cd, Cu, Ni, Pb, and Zn) were analyzed below the permissible limits. The correlation matrices for 28 variables were performed. EC, salinity, TS and TDS had significant positive correlations among themselves and also with NO (3) (-) , Cl(-), alkalinity, Na(+), K(+), and Ca(2+). Fluoride was not significantly correlated with any of the parameters. NO (3) (-) was significantly positively correlated with Cl(-), alkalinity, Na(+), K(+) and Ca(2+). Chloride also correlated significantly with alkalinity, Na(+), K(+) and Ca(2+). Sodium showed a strong and positive correlation with K(+) and Ca(2+). pH was negatively correlated with most of the physicochemical parameters. This groundwater is classified as a normal sulfate and chloride type. Base-exchange indices classified 73% of the groundwater sources as the Na(+)-SO (4) (2-) type. The meteoric genesis indices demonstrated that 67% of groundwater sources belong to a deep meteoric water percolation type. Hydrochemical groundwater evaluations revealed that most of the groundwaters belong to the Na(+)-K(+)-Cl(-)-SO (4) (2-) type followed by Na(+)-K(+)-HCO (3) (-) type. Salinity, chlorinity and SAR indices indicated that majority of groundwater samples can be considered suitable for irrigation purposes.

The effect of lithium on electrolyte transport by the in situ choroid plexus of the cat.

PubMed Central

Reed, D J; Yen, M H

1980-01-01

1. The effects of lithium on electrolyte transport were studied by using the cat choroid plexus isolated in a chamber in situ. 2. Lithium infused intravenously to produce plasma lithium concentrations up to 5 m-equiv/l. caused an increase in plasma magnesium with no effect on the concentration of magnesium in the chamber fluid. 3. When 22NaCl was infused intravenously the chamber fluid/plasma ratio of 22Na was nearly 1 in the first 30 min sample and at the steady state it was significantly greater than 1. 4. When lithium chloride (1.5 m-equiv/l.) or potassium chloride (6.6 m-equiv/l.) was added to the chamber at the start of a collection period with plasma 22Na in the steady state, the 22Na content of the chamber fluid promptly increased 118 and 68%, respectively, above the control value with no increase in secretory rate. 5. The addition of ouabain to the chamber fluid, in addition to the lithium chloride or potassium chloride, tended to stimulate or have no significant effect on 22Na uptake at a concentration of 10(-5) M and to reduce it as well as the secretory rate at 10(-3) M. 6. The date are compatible with there being two functionally separate sodium transport systems in the choroid plexus. One transports sodium accompanied by an anion and water to provide the fluid secreted into the chamber (c.s.f.) and the other operates primarily to regulate the potassium concentration of the c.s.f. by pumping potassium out in exchange for sodium. 7. Lithium can be transported by both systems to a limited extent and the presence of lithium in the c.s.f. stimulates the sodium-potassium regulating pump. PMID:7252869

Infiltration from an impoundment for coal‐bed natural gas, Powder River Basin, Wyoming: Evolution of water and sediment chemistry

USGS Publications Warehouse

Healy, Richard W.; Rice, Cynthia A.; Bartos, Timothy T.; P. McKinley, Michael

2008-01-01

Development of coal‐bed natural gas (CBNG) in the Powder River Basin, Wyoming, has increased substantially in recent years. Among environmental concerns associated with this development is the fate of groundwater removed with the gas. A preferred water‐management option is storage in surface impoundments. As of January 2007, permits for more than 4000 impoundments had been issued within Wyoming. A study was conducted on changes in water and sediment chemistry as water from an impoundment infiltrated the subsurface. Sediment cores were collected prior to operation of the impoundment and after its closure and reclamation. Suction lysimeters were used to collect water samples from beneath the impoundment. Large amounts of chloride (12,300 kg) and nitrate (13,500 kg as N), most of which accumulated naturally in the sediments over thousands of years, were released into groundwater by infiltrating water. Nitrate was more readily flushed from the sediments than chloride. If sediments at other impoundment locations contain similar amounts of chloride and nitrate, impoundments already permitted could release over 48 × 106 kg of chloride and 52 × 106 kg of nitrate into groundwater in the basin. A solute plume with total dissolved solid (TDS) concentrations at times exceeding 100,000 mg/L was created in the subsurface. TDS concentrations in the plume were substantially greater than those in the CBNG water (about 2300 mg/L) and in the ambient shallow groundwater (about 8000 mg/L). Sulfate, sodium, and magnesium are the dominant ions in the plume. The elevated concentrations are attributed to cation‐exchange‐enhanced gypsum dissolution. As gypsum dissolves, calcium goes into solution and is exchanged for sodium and magnesium on clays. Removal of calcium from solution allows further gypsum dissolution.

The calcium content of human erythrocytes

PubMed Central

Harrison, D. G.; Long, C.

1968-01-01

1. The calcium content of human erythrocytes, after removal of the buffy coat and washing free from plasma with isotonic sodium chloride, has been determined by atomic absorption spectrophotometry. The mean value found for normal subjects was 0·634 μg/ml. of packed erythrocytes (0·0158 μg-atom/ml.). The corresponding values for magnesium and zinc were 79·7 and 20·1 μg/ml., respectively. 2. The calcium is considered to be mostly and perhaps exclusively located in the erythrocyte membrane, since, after osmotic haemolysis, the same amount was found in the ghost cells as was present in the erythrocytes from which they were prepared. By contrast, magnesium and zinc, which are essentially intracellular, were lost to the extent of about 96 and 92%, respectively. 3. About 90% of the calcium was removed from erythrocytes by washing with isotonic sodium chloride containing 5 mM ethylenediaminetetraacetate (EDTA), or other complexing agents of high stability constant for calcium. A small fraction of the magnesium but none of the zinc was removed by this treatment. 4. Other complexing agents of lower stability constant removed somewhat less calcium from the erythrocytes. Citrate was totally ineffective. 5. The buffy coat had a high calcium content, but this could not be removed by washing with EDTA. 6. Calcium was also determined in trichloroacetic acid extracts of ghost cells after ashing and treatment with bis-(o-hydroxyphenylimino)-ethane and measuring the red complex spectrophotometrically. The values obtained confirmed the atomic absorption measurements. PMID:4972779

40 CFR Table 1 to Subpart Ttttt of... - Emission Limits

Code of Federal Regulations, 2013 CFR

2013-07-01

... the following . . . 1. Each spray dryer stack a. You must not cause to be discharged to the atmosphere... discharged to the atmosphere any gases that contain hydrochloric acid in excess of 200 lbs/hr. 2. Each magnesium chloride storage bins scrubber stack a. You must not cause to be discharged to the atmosphere any...

40 CFR Table 1 to Subpart Ttttt of... - Emission Limits

Code of Federal Regulations, 2014 CFR

2014-07-01

... the following . . . 1. Each spray dryer stack a. You must not cause to be discharged to the atmosphere... discharged to the atmosphere any gases that contain hydrochloric acid in excess of 200 lbs/hr. 2. Each magnesium chloride storage bins scrubber stack a. You must not cause to be discharged to the atmosphere any...

40 CFR Table 1 to Subpart Ttttt of... - Emission Limits

Code of Federal Regulations, 2011 CFR

2011-07-01

... the following . . . 1. Each spray dryer stack a. You must not cause to be discharged to the atmosphere... discharged to the atmosphere any gases that contain hydrochloric acid in excess of 200 lbs/hr. 2. Each magnesium chloride storage bins scrubber stack a. You must not cause to be discharged to the atmosphere any...

40 CFR Table 1 to Subpart Ttttt of... - Emission Limits

Code of Federal Regulations, 2012 CFR

2012-07-01

... the following . . . 1. Each spray dryer stack a. You must not cause to be discharged to the atmosphere... discharged to the atmosphere any gases that contain hydrochloric acid in excess of 200 lbs/hr. 2. Each magnesium chloride storage bins scrubber stack a. You must not cause to be discharged to the atmosphere any...

40 CFR Table 1 to Subpart Ttttt of... - Emission Limits

Code of Federal Regulations, 2010 CFR

2010-07-01

... the following . . . 1. Each spray dryer stack a. You must not cause to be discharged to the atmosphere... discharged to the atmosphere any gases that contain hydrochloric acid in excess of 200 lbs/hr. 2. Each magnesium chloride storage bins scrubber stack a. You must not cause to be discharged to the atmosphere any...

The Water Softener-A Relevant, Unifying Example of Many Common Chemical Principles and Calculations.

ERIC Educational Resources Information Center

Fulkrod, John E.

1985-01-01

Determining the pounds of sodium chloride needed for a water softener to replace all the calcium/magnesium ions in a month's water supply for a typical local household is used as an exercise to integrate several chemistry concepts. The solution to this problem and suggestions for related laboratory experiments are offered. (JN)

ELUTION OF URANIUM VALUES FROM ION EXCHANGE RESINS

DOEpatents

Kennedy, R.H.

1959-11-24

A process is described for eluting complex uranium ions absorbed on ion exchange resins. The resin is subjected to the action of an aqueous eluting solution contuining sulfuric acid and an alkali metal, ammonium, or magnesium chloride or nitrate, the elution being carried out until the desired amount of the uranium is removed from the resin.

46 CFR Table 2 to Part 153 - Cargoes Not Regulated Under Subchapters D or O of This Chapter When Carried in Bulk on Non...

Code of Federal Regulations, 2012 CFR

2012-10-01

... Category 2-Amino-2-hydroxymethyl-1,3-propanediol solution III Ammonium hydrogen phosphate solution D...) D Ammonium phosphate, Urea solution, see also Urea, Ammonium phosphate solution D Ammonium..., Magnesium nitrate, Potassium chloride solution III Caramel solutions III Chlorinated paraffins (C14-C17...

Effect of pulverized fuel ash and CO{sub 2} curing on the water resistance of magnesium oxychloride cement (MOC)

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Pingping; Poon, Chi Sun, E-mail: cecspoon@polyu.edu.hk; Tsang, Daniel C.W.

This paper presents a study on the use of pulverized fuel ash (PFA) to improve the water resistance of magnesium oxychloride cement (MOC). Strength retention coefficients and volume stability were tested to evaluate the water resistance of MOC, in which the addition of PFA resulted in a remarkable improvement. The characterization of hydration products before and after water immersion was carried out using quantitative X-ray diffraction (QXRD), thermogravimetric (TG), Fourier-transformed infrared spectroscopy (FTIR) and scanning electron microscope (SEM). With the Q-XRD analysis, it was shown that the addition of PFA could result in the great increase of the amount ofmore » amorphous phase during air curing. This amorphous gel was identified as a mixture of magnesium-chloride-silicate-hydrate gel (M-Cl-S-H gel) and magnesium-chloride-hydrate gel (M-Cl-H gel) by elemental mapping scanning. It suggested that PFA could not only react with MOC to form M-Cl-S-H gel, but also change the morphology of magnesium oxychloride. The generation of insoluble M-Cl-S-H gel and M-Cl-H gel and densification of the microstructure contributed to the improvement of the water resistance of MOC. The MOC mortar expanded during air curing due to the hydration of excess MgO. Water immersion led to more expansion of MOC mortar as a result of the continuously hydration of excess MgO and the formation of Mg(OH){sub 2}. Adding PFA could increase the expansion of MOC mortar during air curing, which may because the amorphous gel could remain more water and benefit to the hydration of MgO. While, the addition of PFA could decrease the expansion of cement mortar during water immersion perhaps due to the reduction of the content of excess MgO and the insoluble amorphous-gel-layer that protect the MgO from hydration. Moreover, CO{sub 2} curing could further improve the performance of the PFA-blended MOC due to the formation of a higher content of amorphous gel.« less

Further aspects of ochratoxin A-cation interactions: complex formation with zinc ions and a novel analytical application of ochratoxin A-magnesium interaction in the HPLC-FLD system.

PubMed

Poór, Miklós; Kuzma, Mónika; Matisz, Gergely; Li, Yin; Perjési, Pál; Kunsági-Máté, Sándor; Kőszegi, Tamás

2014-04-10

Ochratoxin A (OTA) is a mycotoxin produced by different Aspergillus and Penicillium species. Since its mechanism of action is not fully understood yet, it is important to gain further insight into different interactions of OTA at the molecular level. OTA is found worldwide in many foods and drinks. Moreover, it can also be detected in human and animal tissues and body fluids, as well. Therefore, the development of highly sensitive quantitative methods for the determination of OTA is of utmost importance. OTA most likely forms complexes with divalent cations, both in cells and body fluids. In the present study, the OTA-zinc interaction was investigated and compared to OTA-magnesium complex formation using fluorescence spectroscopy and molecular modeling. Our results show that zinc(II) ion forms a two-fold higher stable complex with OTA than magnesium(II) ion. In addition, based on the enhanced fluorescence emission of OTA in its magnesium-bound form, a novel RP-HPLC-fluorescence detector (FLD) method was also established. Our results highlight that the application of magnesium chloride in alkaline eluents results in an approximately two-fold increase in sensitivity using the HPLC-FLD technique.

Influence of calcium, magnesium, or potassium ions on the formation and stability of emulsions prepared using highly hydrolyzed whey proteins.

PubMed

Ramkumar, C; Singh, H; Munro, P A; Singh, A M

2000-05-01

Oil-in-water emulsions (4 wt % soy oil) containing 4 wt % whey protein hydrolysate (WPH) (27% degree of hydrolysis) and different levels of calcium, magnesium, or potassium chloride were prepared in a two-stage homogenizer. Other emulsions containing 4 wt % WPH but including 0.35 wt % hydroxylated lecithin and different levels of the above minerals were similarly prepared. The formation and stability of these emulsions were determined by measuring oil droplet size distributions using laser light scattering and by confocal scanning laser microscopy and a gravity creaming test. Both lecithin-free and lecithin-containing emulsions showed no change in droplet size distributions with increasing concentration of potassium in the range 0-37.5 mM. In contrast, the diameter of emulsion droplets increased with increasing calcium or magnesium concentration >12.5 mM. Emulsions containing hydroxylated lecithin were more sensitive to the addition of calcium or magnesium than the lecithin-free emulsions. Storage of emulsions at 20 degrees C for 24 h further increased the diameter of droplets and resulted in extensive creaming in emulsions containing >25 mM calcium or magnesium. It appears that both flocculation and coalescence processes were involved in the destabilization of emulsions induced by the addition of divalent cations.

GRAPHITE PRODUCTION UTILIZING URANYL NITRATE HEXAHYDRATE CATALYST

DOEpatents

Sheinberg, H.; Armstrong, J.R.; Schell, D.H.

1964-03-10

ABS>The graphitizing of a mixture composed of furfuryl alcohol binder and uranyl nitrate hexahydrate hardener and the subsequent curing, baking, and graphitizing with pressure being initially applied prior to curing are described. The pressure step may be carried out by extrusion, methyl cellulose being added to the mixture before the completion of extrusion. Uranium oxide may be added to the graphitizable mixture prior to the heating and pressure steps. The graphitizable mixture may consist of discrete layers of different compositions. (AEC)

Calcium and nitrogen balance, experiment M007

NASA Technical Reports Server (NTRS)

Whedon, G. D.; Lutwak, L.; Neuman, W. F.; Lachance, P. A.

1971-01-01

The collection of data on the response of the skeletal and muscular systems to 14-day space flights was evaluated for loss of calcium, nitrogen, and other metabolically related elements. Considerable interindividual variability was demonstrated in all experimental factors that were measured. Calcium balance became less positive and urinary phosphate excretion increased substantially in flight despite a reduction in phosphate intake. Patterns of excretion of magnesium, sodium, potassium, and chloride were different for each subject, and, in part, could be correlated with changes in adrenocortical steroid production. The principal hormonal change was a striking decrease during flight in the urinary excretion of 17-hydroxycortocosteroids. Dermal losses of calcium, magnesium, sulfate, and phosphate were insignificant during all three phases.

Influence of Zeolite Coating on the Corrosion Resistance of AZ91D Magnesium Alloy

PubMed Central

Banerjee, P. Chakraborty; Woo, Ren Ping; Grayson, Sam Matthew; Majumder, Amrita; Raman, R. K. Singh

2014-01-01

The protective performance of zeolite coating on AZ91D magnesium alloy was evaluated using potentiodynamic polarisation and electrochemical impedance spectroscopy (EIS) in 0.1 M sodium chloride solution (NaCl). Electrical equivalent circuit (EEC) was developed based upon hypothetical corrosion mechanisms and simulated to correspond to the experimental data. The morphology and the chemical nature of the coating were characterized by scanning electron microscopy (SEM) and X-ray diffraction (XRD) analysis. Post corrosion morphologies of the zeolite coated and the uncoated AZ91D alloy were investigated using SEM. The corrosion resistance of the zeolite coated specimen was at least one order of magnitude higher than the uncoated specimen. PMID:28788178

Influence of Zeolite Coating on the Corrosion Resistance of AZ91D Magnesium Alloy.

PubMed

Banerjee, P Chakraborty; Woo, Ren Ping; Grayson, Sam Matthew; Majumder, Amrita; Raman, R K Singh

2014-08-22

The protective performance of zeolite coating on AZ91D magnesium alloy was evaluated using potentiodynamic polarisation and electrochemical impedance spectroscopy (EIS) in 0.1 M sodium chloride solution (NaCl). Electrical equivalent circuit (EEC) was developed based upon hypothetical corrosion mechanisms and simulated to correspond to the experimental data. The morphology and the chemical nature of the coating were characterized by scanning electron microscopy (SEM) and X-ray diffraction (XRD) analysis. Post corrosion morphologies of the zeolite coated and the uncoated AZ91D alloy were investigated using SEM. The corrosion resistance of the zeolite coated specimen was at least one order of magnitude higher than the uncoated specimen.

Study on structural, morphological, optical and thermal properties of guanidine carbonate doped nickel sulfate hexahydrate crystal.

PubMed

Silambarasan, A; Rajesh, P; Ramasamy, P

2015-01-05

The single crystal of guanidine carbonate doped nickel sulfate hexahydrate was grown from solution for ultraviolet filters. The single crystal XRD confirms that the grown single crystal belongs to the tetragonal system with the space group of P4₁2₁2. The crystallinity of the grown crystal was estimated by powder X-ray diffraction studies. The optical transmission and thermal stability of as-grown guanidine carbonate doped nickel sulfate single crystals have been studied. The optical transmission spectrum demonstrates the characteristics of ultraviolet filters. The TG/DTA studies confirm the thermal properties of grown crystals. Thermo-gravimetric analysis showed that the dehydration temperature of the guanidine carbonate doped nickel sulfate crystal is about 100 °C, which is much higher than that of pure nickel sulfate hexahydrate (NSH) crystals which is 72 °C. The growth behaviors and dislocation density were detected under the high resolution XRD and etching studies respectively. Copyright © 2014 Elsevier B.V. All rights reserved.

Magnetism in (Semi)Conducting Macrocycles of pi conjugated Polymers

DTIC Science & Technology

2016-12-09

wise and avoiding a break in the continuity of the macrocycle. As a first criterion we tested the continuity of the electron orbitals over the...magnesium chloride) and post polymerization functionalization by a Sonogashira coupling reaction is required (scheme 2). Scheme 2: Synthetic...Sonogashira post - polymerization chain end functionalization and B isotopic model of the different population present in the final batch

Investigating aquifer contamination and groundwater quality in eastern Terai region of Nepal.

PubMed

Mahato, Sanjay; Mahato, Asmita; Karna, Pankaj Kumar; Balmiki, Nisha

2018-05-21

This study aims at assessing the groundwater quality of the three districts of Eastern Terai region of Nepal viz. Morang, Jhapa, Sunsari using physicochemical characteristics and statistical approach so that possible contamination of water reservoir can be understood. pH, temperature, conductivity, turbidity, color, total dissolved solids, fluorides, ammonia, nitrates, chloride, total hardness, calcium hardness, calcium, magnesium, total alkalinity, iron, manganese, arsenic have to be analyzed to know the present status of groundwater quality. Results revealed that the value of analyzed parameters were within the acceptable limits for drinking water recommended by World Health Organization except for pH, turbidity, ammonia and iron. As per Nepal Drinking Water Quality Standards, fluoride and manganese too were not complying with the permissible limit. Electrical conductivity, total dissolved solids, chloride, total hardness, calcium hardness, manganese, and total alkalinity show good positive correlation with major water quality parameters. Calcium, magnesium, total hardness, calcium hardness and total alkalinity greatly influences total dissolved solids and electrical conductivity. ANOVA, Tukey, and clustering highlight the significance of three districts. Groundwater can be considered safe, but there is always a chance of contamination through chemical wastes in the heavily industrialized area of Morang and Sunsari Industrial corridor.

Effect of Hydration State of Martian Perchlorate Salts on their Decomposition Temperatures during Thermal Extraction

NASA Astrophysics Data System (ADS)

Royle, S. H.; Montgomery, W.; Kounaves, S. P.; Sephton, M. A.

2017-12-01

A number of missions to Mars have analyzed the composition of surface samples using thermal extraction techniques. The temperatures of decomposition have been used as diagnostic information for the materials present. One material of great current interest is perchlorate, a relatively recently discovered component of Mars surface geochemistry that leads to deleterious effects on organic matter during thermal extraction. Knowledge of the thermal decomposition behavior of perchlorate salts is essential for mineral identification and possible avoidance of confounding interactions with organic matter. We have performed a series of stepped pyrolysis experiments on samples of magnesium perchlorate hydrate which were dehydrated to various extents - as confirmed by XRD and FTIR analysis. Our data reveal that the hydration state of magnesium perchlorate has a significant effect on decomposition temperature, with differing temperature releases of oxygen corresponding to different perchlorate hydration states. We find that the peak temperature of oxygen release increases from 500 to 600°C as the proportion of the tetrahydrate form in the sample increases and the hexahydrate form decreases. It was known previously that cation chemistry can affect the temperature of oxygen release and now our work shows that the hydration state of these salts can lead to similar variations. Consequently, incorrect identification of perchlorate species may occur if hydration state is not taken into account and a mixture of metastable hydration states (of one type of perchlorate) may be mistaken for a mixture of perchlorate salts. Our findings are important for Mars as the hydration state of salts in the regolith may change throughout the Martian year due to large variations in humidity and temperature.

Comparative Performance of Three Magnesium Compounds on Thermal Degradation Behavior of Red Gum Wood.

PubMed

Wu, Yiqiang; Yao, Chunhua; Hu, Yunchu; Zhu, Xiaodan; Qing, Yan; Wu, Qinglin

2014-01-24

The effect of basic magnesium carbonate (BMC), magnesium hydroxide (MH), and magnesium chloride hydrate (MCH) on thermal degradation of red gum wood was studied using cone calorimetry, Thermogravimetric-differential scanning calorimetry (TG-DSC) analysis, and X-ray diffraction (XRD) characterization. The results showed common fire retardation actions of the three compounds by releasing incombustible gas and/or water vapor to dilute combustible gas in the flaming zone, and by converting to MgO, which had a satisfactory protective wall effect on the wood. Individually, BMC absorbed heat from the wood at the pre-decomposition stage and, thus, slowed down wood pyrolysis process. It slightly increased the char yield by charring in both the charring stage and the char calcination stage. MH lost water at about 270 °C, close to the temperature at which wood thermally degraded. MH rendered wood char quickly, and the compact char layer impeded further carbonization and burning of inner wood. MCH promoted charring with Mg 2+ as a Lewis acid, and increased wood char yield. MCH also released Cl· free radical and HCl at 167 °C, which easily coordinated with combustion reaction radical, and slowed down, even inhibited, the combustion chain reaction.

Comparative Performance of Three Magnesium Compounds on Thermal Degradation Behavior of Red Gum Wood

PubMed Central

Wu, Yiqiang; Yao, Chunhua; Hu, Yunchu; Zhu, Xiaodan; Qing, Yan; Wu, Qinglin

2014-01-01

The effect of basic magnesium carbonate (BMC), magnesium hydroxide (MH), and magnesium chloride hydrate (MCH) on thermal degradation of red gum wood was studied using cone calorimetry, Thermogravimetric-differential scanning calorimetry (TG-DSC) analysis, and X-ray diffraction (XRD) characterization. The results showed common fire retardation actions of the three compounds by releasing incombustible gas and/or water vapor to dilute combustible gas in the flaming zone, and by converting to MgO, which had a satisfactory protective wall effect on the wood. Individually, BMC absorbed heat from the wood at the pre-decomposition stage and, thus, slowed down wood pyrolysis process. It slightly increased the char yield by charring in both the charring stage and the char calcination stage. MH lost water at about 270°C, close to the temperature at which wood thermally degraded. MH rendered wood char quickly, and the compact char layer impeded further carbonization and burning of inner wood. MCH promoted charring with Mg2+ as a Lewis acid, and increased wood char yield. MCH also released Cl· free radical and HCl at 167°C, which easily coordinated with combustion reaction radical, and slowed down, even inhibited, the combustion chain reaction. PMID:28788480

Impact of the release rate of magnesium ions in multiple emulsions (water-in-oil-in-water) containing BSA on the resulting physical properties and microstructure of soy protein gel.

PubMed

Zhu, Qiaomei; Zhao, Ling; Zhang, Hui; Saito, Masayoshi; Yin, Lijun

2017-04-01

The objective of present study was to prepare multiple water-in-oil-in-water (W/O/W) emulsions that exhibit different release rates of magnesium ions; and assess their utility as coagulants in improving tofu quality. W/O/W emulsions containing bovine serum albumin (BSA) and magnesium chloride (MgCl 2 ) were developed for controlled release applications. An increasing BSA concentration led to an increase in viscosity and droplet size of W/O/W double emulsions, as well as a decreased release rate of encapsulated Mg 2+ from emulsions. The gelation process of soy protein was simulated by conducting dynamic viscoelastic measurements. The rate constant (k) and saturated storage modulus (G' sat ) values of soy protein gel decreased as BSA concentration increased, suggesting that BSA could slow the release of magnesium ions from double emulsions. Confocal laser scanning microscopy (CLSM) results showed that increased concentration of BSA created a more homogeneous microstructure of soy protein gels with smaller pores within the gel network structure. Copyright © 2016 Elsevier Ltd. All rights reserved.

Synthesis and characterization of struvite nano particles

NASA Astrophysics Data System (ADS)

Rathod, K. R.; Jogiya, B. V.; Chauhan, C. K.; Joshi, M. J.

2015-06-01

Struvite, Ammonium Magnesium Phosphate Hexahydrate [(AMPH) - (NH4)MgPO4.6(H2O)], is one of the fascinating inorganic phosphate minerals. Struvite is one of the components of the urinary stones. Struvite occurs as crystallites in urine and grows as a type of kidney stone. In this study, struvite nano particles were synthesized by wet chemical technique. The aqueous solutions containing dissolved Mg(CH3COO)2.4H2O and (NH4)H2PO4 mixed at the Mg/P molar ratio of 1.00. The synthesized struvite nano particles were characterized by XRD, FT-IR, Thermal Analysis and TEM. From XRD, crystal structure of the nano particle was found to be orthorhombic and crystalline size was found to be within 11 to 26 nm. The FT-IR spectrum for the struvite nano particles confirmed the presence of a water molecule and metal-oxygen stretching vibration, O-H stretching and bending, N-H bending and stretching, P-O bending and stretching vibrations. The Thermal Analysis was carried out from room temperature to 900°C. From TEM analysis, particle size was 23 to 30 nm. All the results were compared with bulk struvite.

STABILIZATION OF PERTUSSIS VACCINE IN THE PRESENCE OF BENZETHONIUM CHLORIDE

PubMed Central

Olson, B. H.; Eldering, Grace; Graham, Bernice

1964-01-01

Olson, B. H. (Division of Laboratories, Michigan Department of Health, Lansing), Grace Eldering, and Bernice Graham. Stabilization of pertussis vaccine in the presence of benzethonium chloride. J. Bacteriol. 87:543–546. 1964.—Data are presented showing that pertussis vaccine preserved with benzethonium chloride (BC; Phemerol) was inactivated during storage. BC-preserved vaccine stored at 37 C showed no measurable mouse-protective potency at 16 weeks. That stored at 0 to 4 C lost approximately 80% of its potency within 1 year. Treatment of pertussis vaccines with aluminum, calcium, magnesium, choline, or dl-lysine before the addition of the BC prevented its uptake by the cells. Pertussis vaccines pretreated with 0.004 m Ca++ or 0.0004 m Al+++ retained 70% of the initial potency after 42 weeks of storage at 37 C. Similar vaccines showed no loss of protective antigens when stored for 1 year at 0 to 4 C. PMID:14127568

The distribution of lithium, sodium and magnesium in rat brain and plasma after various periods of administration of lithium in the diet.

PubMed Central

Bond, P A; Brooks, B A; Judd, A

1975-01-01

1 The tissue solubilizer Soluene-100 provides an efficient and easy means of preparing small amounts of rat tissue for cation analysis. 2 Administration of lithium ions to rats for two days to 42 days by the addition of lithium chloride to the diet at a concentration of 30 mmol/kg dry weight results in (a) the uniform distribution of lithium throughout the brain at a concentration comparable to that found in plasma; (b) decrease in the brain sodium concentration: (c) a decrease in brain magnesium concentration and an increase in plasma magnesium concentration; (d)no change in brain water content. 3 The inclusion of LiCl in the diet at a concentration of 30 mmol/kg dry food gives consistent and predictable plasma and brain levels of lithium in the rat without the occurrence of serious side effects over periods of up to 42 days. PMID:1148484

Incorporation of layered double nanomaterials in thin film nanocomposite nanofiltration membrane for magnesium sulphate removal

NASA Astrophysics Data System (ADS)

Hanis Tajuddin, Muhammad; Yusof, Norhaniza; Salleh, Wan Norharyati Wan; Fauzi Ismail, Ahmad; Hanis Hayati Hairom, Nur; Misdan, Nurasyikin

2018-03-01

Thin film nanocomposite (TFN) membrane with copper-aluminium layered double hydroxides (LDH) incorporated into polyamide (PA) selective layer has been prepared for magnesium sulphate salt removal. 0, 0.05, 0.1, 0.15, 0.2 wt% of LDH were dispersed in the trimesoyl chloride (TMC) in n-hexane as organic solution and embedded into PA layer during interfacial polymerization with piperazine. The fabricated membranes were further characterized to evaluate its morphological structure and membrane surface hydrophilicity. The TFN membranes performance were evaluated with divalent salt magnesium sulphate (MgSO4) removal and compared with thin film composite (TFC). The morphological structures of TFN membranes were altered and the surface hydrophilicity were enhanced with addition of LDH. Incorporation of LDH has improved the permeate water flux by 82.5% compared to that of TFC membrane with satisfactory rejection of MgSO4. This study has experimentally validated the potential of LDH to improve the divalent salt separation performance for TFN membranes.

[Two cases of tetany in the horse (author's transl)].

PubMed

Meijer, P

1982-05-01

Two cases of tetany in the horse are reported. The two patients were thoroughbreds. One was eight and the other thirteen years old. The mares were in heat and were brought to the service (stud) station to be mated. Both patients were nursing a foal. One was a four-week-old foal and the other was seven weeks old. The calcium level of the serum had dropped in the two patients, to 4.0 mg and 5.4 per ml. respectively. The magnesium level was 1.0 mg and 1.9 mg per 100 ml. respectively. The animals responded satisfactorily to intravenous infusion of calcium borogluconate and magnesium chloride. One of the mares was also give 10 1. of physiological saline a few times.

Electro Processing Research

NASA Technical Reports Server (NTRS)

1982-01-01

Electroprocessing which is concerned with fluid dynamics of the electroreduction process to determine how it may be modified to improve the quality of the deposit was studied. Experimental techniques are used in this research. These techniques include laser Schlieren photography, laser Doppler velocimetry, and frequency spectrum analysis. Projects involve fluid flow studies of zinc plating in aqueous and molten salt electrolytes, study of cell design for magnesium chlorides electrolysis, digital signal analysis of manganese electrodeposition in molten chlorides, and electroplating of molybdenum from low melting salts. It is anticipated that the use of refractory metals as constructed materials in engineering will increase. Their electrodeposition from molten salt electrolytes is important in the extraction metallurgy of refractory metals.

Mineral of the month: potash

USGS Publications Warehouse

Searls, James P.

2005-01-01

In 1807, Sir Humphrey Davy discovered a metal during the electrolysis of potassium hydroxide; he named the metal potassium because it came from potash recovered from wood ashes. The four types of potash are the water-soluble compounds potassium chloride, potassium sulfate, potassium-magnesium sulfate and potassium nitrate. The early uses of potash were in glass and soap manufacturing, as a diuretic, and another form was used in gunpowder.

Curing and Characterization of Siloxanecarbonate Polymers

DTIC Science & Technology

1980-01-01

to 93 percent yields of p-bromophenol-Z-tetrahydropyranyl ether. The Grignard reagent made from the protected phenol in tetrahydrofuran was added to...iodomethane and heating. When all of the magnesium appeared to have been consumed, the resulting Grignard reagent was added via a double-tipped needle...7-dichlorooctamethyltetrasiloxane via the Grignard reaction. Workup of the reaction product with aqueous ammonium chloride solution kept the molecule

Annual variations in chemical composition of atmospheric precipitation, eastern North Carolina and southeastern Virginia

USGS Publications Warehouse

Fisher, Donald W.

1967-01-01

A 2-year study of precipitation composition over eastern North Carolina and southeastern Virginia has been completed. Chemical analyses were made of the major ions in monthly rainfall samples from each of 12 sampling locations. Areal and seasonal distributions were determined for chloride, calcium, magnesium, sodium, potassium, sulfate, and nitrate. Annual changes in loads and in geographical distribution of sulfate and of nitrate are small. Yearly rainfall sulfate loads amount to approximately 7 tons per square mile, whereas deposition of nitrate is about 2 tons per square mile per year in the interior of the network and less near the coast. Areal patterns of chloride content are consistent with the assumption that the ocean is the only major source of rainfall chloride in the area. Chloride loads were 2.1 and 1.8 tons per square mile per year; the difference can be attributed to meteorological conditions. Cation concentrations in network precipitation appear to depend on localized sources, probably soil dust. Annual loads of the major cations are approximately 2 tons per square mile of calcium, 1.8 tons per square mile of sodium, 0.5 ton per square mile of magnesium, and 0.3 ton per square mile of potassium; considerable year-to-year differences were noted in these values. Bicarbonate and hydrogen ion in network rainfall are closely related to the relative concentrations of sulfate and calcium. Apparently, reaction of an acidic sulfur-containing aerosol with an alkaline calcium source is one of the principal controls on precipitation alkalinity and pH. Ions in precipitation contribute substantially to the quality of surface water in the network area. Comparisons between precipitation input and stream export of ions for four North Carolina rivers show that rainfall sulfate is equal to sulfate discharged, whereas nitrate in rain slightly exceeds stream nitrate. Contributions of cations to the streams by way of precipitation range from about 20 percent for potassium to almost 50 percent for calcium. Chloride deposited by precipitation amounts to about one-fourth of the stream load. Additions of manufactured salt may account for much of the remainder of the surface-water load.

Mineral composition and rates of flow of effluent from the distal ileum of liquid-fed calves

PubMed Central

Smith, R. H.

1966-01-01

1. Liquid-fed calves (aged 1½-4 months) examined more than five weeks after inserting a re-entrant fistula into the distal ileum, of normal sodium and potassium status and without abnormal gut infection, showed mean emergence rates from the ileum for sodium, potassium and water of 2·3 m-mole/hr, 0·38 m-mole/hr and 21 g/hr respectively after 16 hr fasting. 2. Sodium and potassium emergence rates changed little when the residues from a milk or glucose-solution feed arrived at the distal ileum. When magnesium chloride was added to a glucose-solution feed an increase sometimes occurred but only in association with decreased small-intestine transit time. 3. Widely differing sodium and potassium intakes had no appreciable direct effect on their emergence rates. Continued feeding of a diet deficient in either ion, however, altered the calf's metabolism and led to appropriate changes in the sodium/potassium ratio of ileal effluent. These changes were not simulated by injecting adrenal cortex hormones. The ratio also decreased when ileal effluent was allowed to discharge for several weeks without being returned to the colon. It was abnormally high in samples obtained less than five weeks after inserting cannulae. 4. An increase in sodium and potassium emergence rates, which often occurred spontaneously at about 3 months of age, appeared to be due to infection and was usually prevented by giving aureomycin orally. 5. Water emergence rate reflected changes in the emergence rates of osmotically effective constituents and isotonicity was maintained. In effluent after fasting, the cations involved were mainly sodium and potassium, and [Na] + [K] was approximately constant (mean 132 m-mole/l.). In effluent following feeds of milk or glucose, magnesium chloride solution, [Na] + [K] was depressed and [Na] + [K] + 1·5 [Mg] was approximately constant (mean 139 m-mole/l.). Magnesium behaved as it were mainly ionic. Calcium had no apparent osmotic effect and was probably insoluble. 6. Bicarbonate was the major anion in ileal effluent after a milk feed with smaller amounts of chloride, phosphate and some other unknown anion(s). PMID:5919555

Effect of Sn doping on structural, mechanical, optical and electrical properties of ZnO nanoarrays prepared by sol-gel and hydrothermal process

NASA Astrophysics Data System (ADS)

Agarwal, Manish Baboo; Sharma, Akash; Malaidurai, M.; Thangavel, R.

2018-05-01

Undoped and Sn doped Zinc oxide nanorods were prepared by two step process: initially growth of seed layers by sol-gel spin coating technique and then zinc oxide nanorods by hydrothermal process using the precursors zinc nitrate hexahydrate, hexamine and tin chloride. The effects on the electrical, optical, mechanical and structural properties for various Sn concentrations were studied. The crystalline phase determination from X-ray diffraction (XRD) confirms that Sn doped ZnO nanorods have hexagonal wurtzite structure. The variations of stress and strain with different doping concentration of Sn in ZnO nanorods were studied. The doping effect on electrical properties and optical bandgap is estimated by current voltage characteristics and absorbance spectra respectively. The surface morphology was studied with field emission scanning electron microscope (FESEM), which shows that the formation of hexagonal nanorods arrays with increasing Sn concentration. The calculated value of Young's modulus of elasticity (Y) for all the samples remains same. These results can be used in optoelectronic devices.

Laser treatment of primary axillary hyperhidrosis: a review of the literature.

PubMed

Cervantes, Jessica; Perper, Marina; Eber, Ariel E; Fertig, Raymond M; Tsatalis, John P; Nouri, Keyvan

2018-04-01

Hyperhidrosis o`ccurs when the body produces sweat beyond what is essential to maintain thermal homeostasis. The condition tends to occur in areas marked by high-eccrine density such as the axillae, palms, and soles and less commonly in the craniofacial area. The current standard of care is topical aluminum chloride hexahydrate antiperspirant (10-20%), but other treatments such as anticholinergics, clonidine, propranolol, antiadrenergics, injections with attenuated botulinum toxin, microwave technology, and surgery have been therapeutically implicated as well. Yet, many of these treatments have limited efficacy, systemic side effects, and may be linked with significant surgical morbidity, creating need for the development of new and effective therapies for controlling excessive sweating. In this literature review, we examined the use of lasers, particularly the Neodynium:Yttrium-Aluminum-Garnet (Nd:YAG) and diode lasers, in treating hyperhidrosis. Due to its demonstrated effectiveness and limited side effect profile, our review suggests that Nd:YAG laser may be a promising treatment modality for hyperhidrosis. Nevertheless, additional large, randomized controlled trials are necessary to confirm the safety and efficacy of this treatment option.

Performance traits and metabolic responses in goats (Capra hircus) supplemented with inorganic trivalent chromium.

PubMed

Haldar, Sudipto; Mondal, Souvik; Samanta, Saikat; Ghosh, Tapan Kumar

2009-11-01

The effects of supplemental chromium (Cr) as chromic chloride hexahydrate in incremental dose levels (0, 0.5, 1.0, and 1.5 mg/day for 240 days) on metabolism of nutrients and trace elements were determined in dwarf Bengal goats (Capra hircus, castrated males, average age 3 months, n = 24, initial mean body weight 6.4 +/- 0.22 kg). Live weight increased linearly (p < 0.05) with the level of supplemental Cr. Organic matter and crude protein digestibility, intake of total digestible nutrients, and retention of N (g/g N intake) increased (p < 0.05) in a dose-dependent linear manner. Serum cholesterol and tryacylglycerol concentrations changed inversely with the dose of supplemental Cr (p < 0.01). Supplemental Cr positively influenced retention of copper and iron (p < 0.05) causing linear increase (p < 0.01) in their serum concentrations. It was concluded that Cr supplementation may improve utilization of nutrients including the trace elements and may also elicit a hypolidemic effect in goats. However, further study with regards to optimization of dose is warranted.

Efficient conversion of brown grease produced by municipal wastewater treatment plant into biofuel using aluminium chloride hexahydrate under very mild conditions.

PubMed

Pastore, Carlo; Lopez, Antonio; Mascolo, Giuseppe

2014-03-01

Wastes produced by oil/water separation at the wastewater treatment plant of Bari West (Southern Italy) were taken, characterized and converted. About 12% of this material was composed of greases, mainly made of free fatty acids (50%) and soaps (34%), and was easily separable by the aqueous phase through a hot centrifugation. After chemical activation of this fatty fraction, a direct esterification was carried out under very mild conditions (320K and atmospheric pressure), converting more than 90% of the original free fatty acids into the respective methyl esters in less than 4h, by using AlCl3·6H2O. The activation energy correlated to the use of this catalyst was also calculated (Eaest=43.9kJmol(-1)). The very low cost of the biodiesel produced (0.45€L(-1)) and the associated relevant specific energy (5.02MJ kgFAMEs(-1)) make such a process a really sustainable and effective example of valorization of a waste. Copyright © 2013 Elsevier Ltd. All rights reserved.

One Step Synthesis of NiO Nanoparticles via Solid-State Thermal Decomposition at Low-Temperature of Novel Aqua(2,9-dimethyl-1,10-phenanthroline)NiCl2 Complex

PubMed Central

Barakat, Assem; Al-Noaimi, Mousa; Suleiman, Mohammed; Aldwayyan, Abdullah S.; Hammouti, Belkheir; Ben Hadda, Taibi; Haddad, Salim F.; Boshaala, Ahmed; Warad, Ismail

2013-01-01

[NiCl2(C14H12N2)(H2O)] complex has been synthesized from nickel chloride hexahydrate (NiCl2·6H2O) and 2,9-dimethyl-1,10-phenanthroline (dmphen) as N,N-bidentate ligand. The synthesized complex was characterized by elemental analysis, infrared (IR) spectroscopy, ultraviolet-visible (UV-vis) spectroscopy and differential thermal/thermogravimetric analysis (TG/DTA). The complex was further confirmed by single crystal X-ray diffraction (XRD) as triclinic with space group P-1. The desired complex, subjected to thermal decomposition at low temperature of 400 ºC in an open atmosphere, revealed a novel and facile synthesis of pure NiO nanoparticles with uniform spherical particle; the structure of the NiO nanoparticles product was elucidated on the basis of Fourier transform infrared (FT-IR), UV-vis spectroscopy, TG/DTA, XRD, scanning electron microscopy (SEM), energy-dispersive X-ray spectrometry (EDXS) and transmission electron microscopy (TEM). PMID:24351867

Numerical and Experimental Analysis on Inorganic Phase Change Material Usage in Construction

NASA Astrophysics Data System (ADS)

Muthuvel, S.; Saravanasankar, S.; Sudhakarapandian, R.; Muthukannan, M.

2014-12-01

This work demonstrates the significance of Phase Change Material (PCM) in the construction of working sheds and product storage magazines in fireworks industries to maintain less temperature variation by passive cooling. The inorganic PCM, namely Calcium Chloride Hexahydrate (CCH) is selected in this study. First, the performance of two models with inbuilt CCH was analysed, using computational fluid dynamics. A significant change in the variation of inner wall temperature was observed, particularly during the working hours. This is mainly due to passive cooling, where the heat transfer from the surroundings to the room is partially used for the phase change from solid to liquid. The experiment was carried out by constructing two models, one with PCM packed in hollow brick walls and roof, and the other one as a conventional construction. The experimental results show that the temperature of the room got significantly reduced up to 7 °C. The experimental analysis results had good agreement with the numerical analysis results, and this reveals the advantage of the PCM in the fireworks industry construction.

High-Density Three-Dimension Graphene Macroscopic Objects for High-Capacity Removal of Heavy Metal Ions

PubMed Central

Li, Weiwei; Gao, Song; Wu, Liqiong; Qiu, Shengqiang; Guo, Yufen; Geng, Xiumei; Chen, Mingliang; Liao, Shutian; Zhu, Chao; Gong, Youpin; Long, Mingsheng; Xu, Jianbao; Wei, Xiangfei; Sun, Mengtao; Liu, Liwei

2013-01-01

The chemical vapor deposition (CVD) fabrication of high-density three-dimension graphene macroscopic objects (3D-GMOs) with a relatively low porosity has not yet been realized, although they are desirable for applications in which high mechanical and electrical properties are required. Here, we explore a method to rapidly prepare the high-density 3D-GMOs using nickel chloride hexahydrate (NiCl2·6H2O) as a catalyst precursor by CVD process at atmospheric pressure. Further, the free-standing 3D-GMOs are employed as electrolytic electrodes to remove various heavy metal ions. The robust 3D structure, high conductivity (~12 S/cm) and large specific surface area (~560 m2/g) enable ultra-high electrical adsorption capacities (Cd2+ ~ 434 mg/g, Pb2+ ~ 882 mg/g, Ni2+ ~ 1,683 mg/g, Cu2+ ~ 3,820 mg/g) from aqueous solutions and fast desorption. The current work has significance in the studies of both the fabrication of high-density 3D-GMOs and the removal of heavy metal ions. PMID:23821107

Magnesium sulphate at 30 to 34 weeks' gestational age: neuroprotection trial (MAGENTA)--study protocol.

PubMed

Crowther, Caroline A; Middleton, Philippa F; Wilkinson, Dominic; Ashwood, Pat; Haslam, Ross

2013-04-09

Magnesium sulphate is currently recommended for neuroprotection of preterm infants for women at risk of preterm birth at less than 30 weeks' gestation, based on high quality evidence of benefit. However there remains uncertainty as to whether these benefits apply at higher gestational ages.The aim of this randomised controlled trial is to assess whether giving magnesium sulphate compared with placebo to women immediately prior to preterm birth between 30 and 34 weeks' gestation reduces the risk of death or cerebral palsy in their children at two years' corrected age. Randomised, multicentre, placebo controlled trial. Women, giving informed consent, at risk of preterm birth between 30 to 34 weeks' gestation, where birth is planned or definitely expected within 24 hours, with a singleton or twin pregnancy and no contraindications to the use of magnesium sulphate.Trial entry & randomisation: Eligible women will be randomly allocated to receive either magnesium sulphate or placebo.Treatment groups: Women in the magnesium sulphate group will be administered 50 ml of a 100 ml infusion bag containing 8 g magnesium sulphate heptahydrate [16 mmol magnesium ions]. Women in the placebo group will be administered 50 ml of a 100 ml infusion bag containing isotonic sodium chloride solution (0.9%). Both treatments will be administered through a dedicated IV infusion line over 30 minutes.Primary study outcome: Death or cerebral palsy measured in children at two years' corrected age. 1676 children are required to detect a decrease in the combined outcome of death or cerebral palsy, from 9.6% with placebo to 5.4% with magnesium sulphate (two-sided alpha 0.05, 80% power, 5% loss to follow up, design effect 1.2). Given the magnitude of the protective effect in the systematic review, the ongoing uncertainty about benefits at later gestational ages, the serious health and cost consequences of cerebral palsy for the child, family and society, a trial of magnesium sulphate for women at risk of preterm birth between 30 to 34 weeks' gestation is both important and relevant for clinical practice globally. Australian New Zealand Clinical Trials Registry - ACTRN12611000491965.

Combining neuroprotective agents: effect of riluzole and magnesium in a rat model of thoracic spinal cord injury.

PubMed

Vasconcelos, Natália L; Gomes, Eduardo D; Oliveira, Eduarda P; Silva, Carlos J; Lima, Rui; Sousa, Nuno; Salgado, António J; Silva, Nuno A

2016-08-01

Damage to the spinal cord can result in irreversible impairments or complete loss of motor, sensory, and autonomic functions. Riluzole and magnesium have been widely investigated as neuroprotective agents in animal models of spinal cord injury. As these drugs protect the injured spinal cord through different mechanisms, we aimed to investigate if their neuroprotective efficacy could be cumulative. This study aimed to investigate the neuroprotective efficacy of combined administration of riluzole and magnesium chloride in a contusive model of thoracic spinal cord injury. An in vivo experiment was set using female Wistar Han rats that underwent a thoracic spinal cord contusion (T8) using a weight drop method. An hour after injury, animals were randomly distributed to receive (1) saline, (2) riluzole (2.50 mg/kg), (3) magnesium chloride (24.18 mg/kg) in a polyethylene glycol formulation, or (4) a combined treatment (riluzole and magnesium). Subsequent treatments were given in four intraperitoneal injections (spaced 12 hours apart). The Basso, Beattie, and Bresnahan locomotor rating scale, an activity box test, and a swimming test were used to evaluate behavioral recovery over a 4-week period. Histologic analysis of the spinal cords was performed to measure the extent and volume of the lesion, axonal preservation, serotonergic and glutamatergic fiber sparing, motor neuron survival, and inflammation. Our results show that only the riluzole treatment significantly improved behavioral recovery up to 4 weeks after injury when compared with saline controls (6.2±1.8), with animals achieving weight-supported stepping (9.1±1.2). Riluzole also promoted tissue sparing with significant differences achieved from 200 to 600 µm (caudally to the lesion epicenter), and reduced lesion volume, with animals presenting a significantly smaller lesion (3.23±0.26 mm(3)) when compared with the saline-treated group (4.74±0.80 mm(3)), representing a 32% decrease in lesion volume. Riluzole treatment induced significant axonal preservation, as well as serotonergic fiber sparing, caudally to the injury epicenter. Our results suggest that the combined treatment, although simultaneously targeting two excitotoxic-related mechanisms, did not further improve behavioral and histologic outcome when compared with riluzole given alone. Copyright © 2016 Elsevier Inc. All rights reserved.

Intrathecal magnesium sulfate does not reduce the ED50 of intrathecal hyperbaric bupivacaine for cesarean delivery in healthy parturients: a prospective, double blinded, randomized dose-response trial using the sequential allocation method.

PubMed

Xiao, Fei; Xu, Wenping; Feng, Ying; Fu, Feng; Zhang, Xiaomin; Zhang, Yinfa; Wang, Lizhong; Chen, Xinzhong

2017-01-17

Addition of intrathecal magnesium sulfate to local anesthetics has been reported to potentiate spinal anesthesia and prolong analgesia in parturients. The current study was to determine whether intrathecal magnesium sulfate would reduce the dose of hyperbaric bupivacaine in spinal anesthesia with bupivacaine and sufentanil for cesarean delivery. Sixty healthy parturients undergoing scheduled cesarean delivery were randomly assigned to receive spinal anesthesia with 0.5% hyperbaric bupivacaine and 5 μg sufentanil with either 0.9% sodium chloride (Control group) or 50% magnesium sulfate (50 mg) (Magnesium group). Effective anesthesia was defined as a bilateral T 5 sensory block level achieved within 10 min of intrathecal drug administration and no additional epidural anesthetic was required during surgery. Characteristic of spinal anesthesia and the incidence of side effects were observed. The ED 50 for both groups was calculated using the Dixon and Massey formula. There was no significant difference in the ED 50 of bupivacaine between the Magnesium group and the Control group (4.9 mg vs 4.7 mg) (P = 0.53). The duration of spinal anesthesia (183 min vs 148 min, P < 0.001) was longer, the consumption of fentanyl during the first 24 h postoperatively (343 μg vs 550 μg, P < 0.001) was lower in the Magnesium group than that in the Control group. Intrathecal magnesium sulfate (50 mg) did not reduce the dose requirement of intrathecal bupivacaine, but can extend the duration of spinal anesthesia with no obvious additional side effects. This study was registered with Chinese Clinical Trial Registry (ChiCTR) on 15 Jul. 2014 and was given a trial ID number ChiCTR-TRC- 14004954 .

Laboratory Evaluation of the Effects of 3-Chloride Compounds on the Geotechnical Properties of an Expansive Subgrade Soil

NASA Astrophysics Data System (ADS)

Radhakrishnan, G.; Anjan Kumar, M.; Raju, G. V. R. Prasada

2017-12-01

Expansive soils are known to be problematic due to their nature and behavior. These soils show volume changes due to changes in moisture content, which cause distortions to structures constructed on them. Relentless efforts are being made all over the world to find solution to the problems of expansive soils. In the case of flexible pavements, unless the subgrade is appropriately treated during the construction stage, the maintenance cost will increase substantially due to deterioration. There are many methods of stabilising expansive subgrade soils. Chemical stabilisation is one such technique employed in improving the engineering properties of the expansive soil. Investigations on chemical stabilization of expansive soils revealed that conventionally used lime could be replaced by the chloride compound chemicals because of their ready dissolvability in water, ease of mixing with soil and supply of sufficient cations for ready cation exchange. The main objective of this work is to study the effectiveness of three chloride compound chemicals, ammonium chloride (NH4Cl), magnesium chloride (MgCl2) and aluminum chloride (AlCl3) on the geotechnical properties of an expansive soil. The chemicals content up to 2% were added to the soil and its effect on the index limits, swell pressure, compaction characteristics as well as California bearing ratio are studied. It was observed that aluminum chloride chemical content has a significantly higher influence than the other two chemicals and it could be recognized as an effective chemical stabilizer.

Effect of Native Oxide Film on Commercial Magnesium Alloys Substrates and Carbonate Conversion Coating Growth and Corrosion Resistance

PubMed Central

Feliu, Sebastián; Samaniego, Alejandro; Bermudez, Elkin Alejandro; El-Hadad, Amir Abdelsami; Llorente, Irene; Galván, Juan Carlos

2014-01-01

Possible relations between the native oxide film formed spontaneously on the AZ31 and AZ61 magnesium alloy substrates with different surface finish, the chemistry of the outer surface of the conversion coatings that grows after their subsequent immersion on saturated aqueous NaHCO3 solution treatment and the enhancement of corrosion resistance have been studied. The significant increase in the amount of aluminum and carbonate compounds on the surface of the conversion coating formed on the AZ61 substrate in polished condition seems to improve the corrosion resistance in low chloride ion concentration solutions. In contrast, the conversion coatings formed on the AZ31 substrates in polished condition has little effect on their protective properties compared to the respective as-received surface. PMID:28788582

Effect of Native Oxide Film on Commercial Magnesium Alloys Substrates and Carbonate Conversion Coating Growth and Corrosion Resistance.

PubMed

Feliu, Sebastián; Samaniego, Alejandro; Bermudez, Elkin Alejandro; El-Hadad, Amir Abdelsami; Llorente, Irene; Galván, Juan Carlos

2014-03-28

Possible relations between the native oxide film formed spontaneously on the AZ31 and AZ61 magnesium alloy substrates with different surface finish, the chemistry of the outer surface of the conversion coatings that grows after their subsequent immersion on saturated aqueous NaHCO₃ solution treatment and the enhancement of corrosion resistance have been studied. The significant increase in the amount of aluminum and carbonate compounds on the surface of the conversion coating formed on the AZ61 substrate in polished condition seems to improve the corrosion resistance in low chloride ion concentration solutions. In contrast, the conversion coatings formed on the AZ31 substrates in polished condition has little effect on their protective properties compared to the respective as-received surface.

Partial compilation and revision of basic data in the WATEQ programs

USGS Publications Warehouse

Nordstrom, D. Kirk; Valentine, S.D.; Ball, J.W.; Plummer, Niel; Jones, B.F.

1984-01-01

Several portions of the basic data in the WATEQ series of computer programs (WATEQ, WATEQF, WATEQ2, WATEQ3, and PHREEQE) are compiled. The density and dielectric constant of water and their temperature dependence are evaluated for the purpose of updating the Debye-Huckel solvent parameters in the activity coefficient equations. The standard state thermodynamic properties of the Fe2+ and Fe3+ aqueous ions are refined. The main portion of this report is a comprehensive listing of aluminum hydrolysis constants, aluminum fluoride, aluminum sulfate, calcium chloride, magnesium chloride, potassium sulfate and sodium sulfate stability constants, solubility product constants for gibbsite and amorphous aluminum hydroxide, and the standard electrode potentials for Fe (s)/Fe2+(aq) and Fe2 +(aq)/Fe3+(aq). (USGS)

Architectural optimization of an epoxy-based hybrid sol-gel coating for the corrosion protection of a cast Elektron21 magnesium alloy

NASA Astrophysics Data System (ADS)

Murillo-Gutiérrez, N. V.; Ansart, F.; Bonino, J.-P.; Kunst, S. R.; Malfatti, C. F.

2014-08-01

An epoxy-based hybrid sol-gel coating was prepared in various architectural configurations has been studied for the corrosion protection of a cast Elektron21 magnesium alloy. The creation of a single layer of this coating presents defects consisting of macro-pores and protuberances, which opens access for corrosive species to reach the metallic substrate. These defects are suspected to result from the high reactivity of the substrate, as well as to the irregular topography of the substrate disrupted by the microstructure of the own magnesium alloy. Hence, a sol-gel coating in bilayer architecture is proposed, where the first layer would “inert” the surface of the magnesium substrate, and the second layer would cover the defects of the first layer and also thickening the coating. The morphological characteristics of the sol-gel coatings were analyzed by scanning electron microscopy (SEM), and their corrosion behavior was evaluated by OCP (open circuit potential) monitoring and electrochemical impedance spectroscopy (EIS) in chloride media. It is shown that both the architectural arrangement and the individual thickness of the first and second layers have an important influence on the anticorrosion performances of the protective system, just as much as its global thickness.

Evaluation of short-term effects of rare earth and other elements used in magnesium alloys on primary cells and cell lines.

PubMed

Feyerabend, Frank; Fischer, Janine; Holtz, Jakob; Witte, Frank; Willumeit, Regine; Drücker, Heiko; Vogt, Carla; Hort, Norbert

2010-05-01

Degradable magnesium alloys for biomedical application are on the verge of being used clinically. Rare earth elements (REEs) are used to improve the mechanical properties of the alloys, but in more or less undefined mixtures. For some elements of this group, data on toxicity and influence on cells are sparse. Therefore in this study the in vitro cytotoxicity of the elements yttrium (Y), neodymium (Nd), dysprosium (Dy), praseodymium (Pr), gadolinium (Gd), lanthanum (La), cerium (Ce), europium (Eu), lithium (Li) and zirconium (Zr) was evaluated by incubation with the chlorides (10-2000 microM); magnesium (Mg) and calcium (Ca) were tested at higher concentrations (200 and 50mM, respectively). The influence on viability of human osteosarcoma cell line MG63, human umbilical cord perivascular (HUCPV) cells and mouse macrophages (RAW 264.7) was determined, as well as the induction of apoptosis and the expression of inflammatory factors (TNF-alpha, IL-1alpha). Significant differences between the applied cells could be observed. RAW exhibited the highest and HUCPV the lowest sensitivity. La and Ce showed the highest cytotoxicity of the analysed elements. Of the elements with high solubility in magnesium alloys, Gd and Dy seem to be more suitable than Y. The focus of magnesium alloy development for biomedical applications should include most defined alloy compositions with well-known tissue-specific and systemic effects. Copyright (c) 2009 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

The Evaluation of Damage Effects on MgO Added Concrete with Slag Cement Exposed to Calcium Chloride Deicing Salt.

PubMed

Jang, Jae-Kyeong; Kim, Hong-Gi; Kim, Jun-Hyeong; Ryou, Jae-Suk

2018-05-14

Concrete systems exposed to deicers are damaged in physical and chemical ways. In mitigating the damage from CaCl₂ deicers, the usage of ground slag cement and MgO are investigated. Ordinary Portland cement (OPC) and slag cement are used in different proportions as the binding material, and MgO in doses of 0%, 5%, 7%, and 10% are added to the systems. After 28 days of water-curing, the specimens are immersed in 30% CaCl₂ solution by mass for 180 days. Compressive strength test, carbonation test, chloride penetration test, chloride content test, XRD analysis, and SEM-EDAX analysis are conducted to evaluate the damage effects of the deicing solution. Up to 28 days, plain specimens with increasing MgO show a decrease in compressive strength, an increase in carbonation resistance, and a decrease in chloride penetration resistance, whereas the S30- and S50- specimens show a slight increase in compressive strength, an increase in carbonation resistance, and a slight increase in chloride penetration resistance. After 180 days of immersion in deicing solution, specimens with MgO retain their compressive strength longer and show improved durability. Furthermore, the addition of MgO to concrete systems with slag cement induces the formation of magnesium silicate hydrate (M-S-H) phases.

Reconnaissance evaluation of contamination in the alluvial aquifer in the East Poplar oil field, Roosevelt County, Montana

USGS Publications Warehouse

Levings, G.W.

1984-01-01

Water moving from north to south in the alluvial aquifer of the Poplar River valley becomes contaminated with sodium chloride in the area underlain by the East Poplar oil fields. Four types of ground water were identified in the study area. Type 1 is sodium bicarbonate water. Type 2 is sodium chloride water with varying quantities of calcium and magnesium. Type 3 water contains sodium and chloride in significantly larger concentrations than Type 2. Type 4 water is the brine being injected into brine-disposal wells. Contamination of the alluvial aquifer is indicated by a brine-freshwater interface in the alluvium, by downstream increase in chloride concentration of the Poplar River, and by downstream change in water type of the Poplar River. Contamination also may be indicated by the distribution of iron and manganese concentrations in water from wells near a brine-disposal well. Possible sources of sodium chloride contamination in the alluvium are brine-disposal wells, pipelines, and storage or evaporation pits. The contamination can occur from leaks in the casing of disposal wells or in pipelines caused by the corrosive nature of the brine or from storage or evaporation pits that have been improperly sealed or have sustained tears in the sealing material. (USGS)

The influence of magnesium supplementation on concentrations of chosen bioelements and toxic metals in adult human hair. Magnesium and chosen bioelements in hair.

PubMed

Kozielec, Tadeusz; Sałacka, Anna; Karakiewicz, Beata

2004-09-01

The basic functions of bioelements in biological systems is widely known. Depletion of bioelements and excess of toxic elements lead to impairment of metabolism in the living organism. The existence of magnesium deficiencies in the adult and pediatric populations may cause increased accumulation of toxic metals including lead and cadmium. Prevention of adverse effects of toxic metals may include supplementation with some bioelements and vitamins. The aim of this study was to evaluate the influence of magnesium supplementation on concentrations of chosen bioelements and toxic metals in hair in the adult human population. The research was performed on 124 individuals (53 males and 71 females aged 19-72 years), inhabitants of the city of Szczecin. The concentrations of magnesium, zinc, copper, lead and cadmium were studied in hair. Measurements were performed using the inversion volt-amperometry method with application of an EDD-Tribo PC ETP volt-amperometer. Finally, the supplementation study enrolled 65 individuals with an increased concentration of lead. The studied individuals were divided into two groups: one treated group that enrolled 50 patients who were supplemented with magnesium and the control group that enrolled 15 persons receiving placebo. Finally, supplementation was completed by 32 individuals from the treated group and 10 individuals from the control group. Supplementation was performed using Slow-Mag-B6 preparation at the total daily dose of five tablets divided into 2-3 doses. One tablet contains 535 mg of magnesium chloride i.e. 64 mg of magnesium ions (5.26 mEgMg2) and 5 mg of vitamin B6. Supplementation was performed for a period of 3 months. The remaining individuals did not complete the supplementation due to various reasons; however, none of them resulted from the poor tolerance of the preparation or its adverse events. The results achieved underwent statistical analysis. The results of the study revealed a positive influence of supplementation on concentrations of magnesium and copper in the human body. Supplementation with magnesium caused a statistically significant decrease in concentrations of lead and cadmium. The above mentioned results indicate a positive influence of magnesium supplementation on the decrease of lead and cadmium hair content in the individuals studied.

A Magnesium-Activated Carbon Hybrid Capacitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoo, HD; Shterenberg, I; Gofer, Y

2013-12-11

Prototype cells of hybrid capacitor were developed, comprising activated carbon (AC) cloth and magnesium (Mg) foil as the positive and negative electrodes, respectively. The electrolyte solution included ether solvent (TBF) and a magnesium organo-halo-aluminate complex 0.25 M Mg2Cl3+-Ph2AlCl2-. In this solution Mg can be deposited/dissolved reversibly for thousands of cycles with high reversibility (100% cycling efficiency). The main barrier for integrating porous AC electrodes with this electrolyte solution was the saturation of the pores with the large ions in the AC prior to reaching the potential limit. This is due to the existence of bulky Mg and Al based ionicmore » complexes consisting Cl, alkyl or aryl (R), and THF ligands. This problem was resolved by adding 0.5 M of lithium chloride (LiCl), thus introducing smaller ionic species to the solution. This Mg hybrid capacitor system demonstrated a stable cycle performance for many thousands of cycles with a specific capacitance of 90 Fg(-1) for the AC positive electrodes along a potential range of 2.4 V. (C) 2014 The Electrochemical Society. All rights reserved.« less

Characterization of electrochemically deposited films from aqueous and ionic liquid cobalt precursors toward hydrogen evolution reactions

NASA Astrophysics Data System (ADS)

Dushatinski, Thomas; Huff, Clay; Abdel-Fattah, Tarek M.

2016-11-01

Electrodepositions of cobalt films were achieved using an aqueous or an ethylene glycol based non-aqueous solution containing choline chloride (vitamin B4) with cobalt chloride hexahydrate precursor toward hydrogen evolution reactions from sodium borohydride (NaBH4) as solid hydrogen feedstock (SHF). The resulting cobalt films had reflectivity at 550 nm of 2.2% for aqueously deposited films (ACoF) and 1.3% for non-aqueously deposited films (NCoF). Surface morphology studied by scanning electron microscopy showed a positive correlation between particle size and thickness. The film thicknesses were tunable between >100 μm and <300 μm for each film. The roughness (Ra) value measurements by Dektak surface profiling showed that the NCoF (Ra = 165 nm) was smoother than the ACoF (Ra = 418 nm). The NCoFs and ACoFs contained only α phase (FCC) crystallites. The NCoFs were crystalline while the ACoFs were largely amorphous from X-ray diffraction analysis. The NCoF had an average Vickers hardness value of 84 MPa as compared to 176 MPa for ACoF. The aqueous precursor has a single absorption maximum at 510 nm and the non-aqueous precursor had three absorption maxima at 630, 670, and 695 nm. The hydrogen evolution reactions over a 1 cm2 catalytic surface with aqueous NaBH4 solutions generated rate constants (K) = equal to 4.9 × 10-3 min-1, 4.6 × 10-3 min-1, and 3.3 × 10-3 min-1 for ACoF, NCoF, and copper substrate respectively.

Selections From Kung-Jen JIH-PAO (Source Span: 9 May-30 June 1961) Number 7 -Communist China.

DTIC Science & Technology

1961-08-17

sulphate Ammonium hydrogen carbonate Sodium borate Titaniüm-iron powder Sodium fluoride Silicon dioxide Barium chloride beryllium carbonate ...Vinzenstrasse, 22a :■ P. 0. Box 3521 Aachen, Germany Washington 7> B.C. , Institute de Sociologie Solvay Rue du Chatelain, k9 Brussels, Belgium State... Sodium nitrite Specifications Pure n industrial Boric Acid " A^ua ammonia " Magnesium sulphate Industrial Manganese tedroxide Pure

Design and Synthesis of Candidate Prophylactic and Therapeutic Compounds for Use in the Management of Organophosphorus Poisoning.

DTIC Science & Technology

1985-01-01

resynthesis. The Grignard reagent , prepared from 4- chlorobromobenzene and magnesium metal, was treated with NN-diethyl-P- methylphosphonamidic chloride and the...ref. 26-28). Thus, diethylaminodichlorophosphine was treated with two equivalents of butyl Grignard reagent to give phosphinous amide 1 in 63% yield...compound following a general method developed by Ash Stevens Inc. for the synthesis of substituted aryl methylphosphinates. Thus, the Grignard reagent

High Energy Halogen Chemistry.

DTIC Science & Technology

1976-01-01

hydrochloric acid . The product was extracted with methylene chloride, dried over magnesium sulfate and distilled to give 65 5 (50$) of (3... hydrochloric acid and water was added to nake the solution turbid (l ml). After 30 rain, the product was distilled to give 1.5 g (£7$) of bis-(3...pressure. The residue was dissolved in 150 ml of absolute ethanol and 30 ml of 5$ hydrochloric acid was added slowly with cooling. The mixture was

Materials Evaluation. Part II. Development of Corrosion Inhibitors.

DTIC Science & Technology

1979-09-01

concentration upon the pitting behavior of Al 7075-T6 in an inhibited solution 46 24 Polarization behavior of 4340 steel 47 25 Polarization behavior of copper ...However, this combination itself was not effective in inhibiting the corrosion of high- strength aluminum alloys, copper , and other alloys used in...79 JUNE MONTHLY COMPOSITE COMPLETE ANALYSIS (Results expressed in milligrams per liter) Calcium Ca 61.60 Magnesium Mg 7.00 Sulfates S04 55.00 Chlorides

The adenosine triphosphate inhibition of the pyruvate kinase reaction and its dependence on the total magnesium ion concentration

PubMed Central

Holmsen, Holm; Storm, Eva

1969-01-01

1. The effects of ATP, PPi and EDTA on the skeletal-muscle pyruvate kinase reaction at various concentrations of magnesium (where `magnesium' refers to total Mg2+, both free and in the form of complexes) were investigated. The reaction rate was determined as the amount of pyruvate formed in a recorded time of incubation. 2. At 44mm-magnesium the Km values for ADP and phosphoenolpyruvate were unaltered by the presence of ATP up to 6·8mm in systems buffered with either tris–hydrochloric acid or glycylglycine–sodium hydroxide, but the Km values were different in these systems. The Km for one substrate was independent of the concentration of the second substrate. 3. At 10mm-magnesium in the tris–hydrochloric acid system ATP inhibited the reaction competitively with respect to ADP and phosphoenolpyruvate. In the glycylglycine–sodium hydroxide system the inhibition appeared to be non-competitive. At 10mm-magnesium the Km values were lower than at 44mm-magnesium and dependent on the system used. 4. In the tris–hydrochloric acid system the reaction rate rose with increasing magnesium concentration up to a maximum at a concentration 10–20 times that of ADP. Further increase inhibited the reaction and at 44mm-magnesium the rate was 25–50% of its maximum. This inhibition paralleled that produced by increasing trimethylammonium chloride concentrations and was not due to a specific effect of the Mg2+ ion. 5. In the presence of 6·8mm-ATP no reaction occurred below 4–6mm-magnesium, and further increase apparently abolished the inhibition as the reaction rate increased and became equal to those obtained in the absence of ATP at 10–25mm-magnesium. Further increase in magnesium concentration gave reaction rates that were slightly higher in the presence of ATP than in its absence. The maximal rate in the presence of ATP was distinctly lower than in its absence. When 6·8mm-PPi or 6·8mm-EDTA was present the variations in reaction rate with rising magnesium concentration were similar to that obtained in the presence of ATP below 6–8mm-magnesium but further increase in the magnesium concentration resulted in an increase in the rate up to a maximum comparable with that of the control. The effect of pure chelation was thus a displacement of the reaction maximum to higher magnesium concentrations without changing the maximal rate. When correction had been made for this effect, ATP gave inhibition at 44mm-magnesium that was competitive with respect to ADP (Ki 2·1×10−2m). This degree of inhibition is far less than was reported earlier and its importance for the mechanism of the pyruvate kinase reaction is discussed. PMID:4308294

Enhanced Microbial Survivability in Subzero Brines.

PubMed

Heinz, Jacob; Schirmack, Janosch; Airo, Alessandro; Kounaves, Samuel P; Schulze-Makuch, Dirk

2018-04-17

It is well known that dissolved salts can significantly lower the freezing point of water and thus extend habitability to subzero conditions. However, most investigations thus far have focused on sodium chloride as a solute. In this study, we report on the survivability of the bacterial strain Planococcus halocryophilus in sodium, magnesium, and calcium chloride or perchlorate solutions at temperatures ranging from +25°C to -30°C. In addition, we determined the survival rates of P. halocryophilus when subjected to multiple freeze/thaw cycles. We found that cells suspended in chloride-containing samples have markedly increased survival rates compared with those in perchlorate-containing samples. In both cases, the survival rates increase with lower temperatures; however, this effect is more pronounced in chloride-containing samples. Furthermore, we found that higher salt concentrations increase survival rates when cells are subjected to freeze/thaw cycles. Our findings have important implications not only for the habitability of cold environments on Earth but also for extraterrestrial environments such as that of Mars, where cold brines might exist in the subsurface and perhaps even appear temporarily at the surface such as at recurring slope lineae. Key Words: Brines-Halophile-Mars-Perchlorate-Subzero-Survival. Astrobiology 18, xxx-xxx.

Femtosecond laser lithotripsy: feasibility and ablation mechanism.

PubMed

Qiu, Jinze; Teichman, Joel M H; Wang, Tianyi; Neev, Joseph; Glickman, Randolph D; Chan, Kin Foong; Milner, Thomas E

2010-01-01

Light emitted from a femtosecond laser is capable of plasma-induced ablation of various materials. We tested the feasibility of utilizing femtosecond-pulsed laser radiation (lambda=800 nm, 140 fs, 0.9 mJ/pulse) for ablation of urinary calculi. Ablation craters were observed in human calculi of greater than 90% calcium oxalate monohydrate (COM), cystine (CYST), or magnesium ammonium phosphate hexahydrate (MAPH). Largest crater volumes were achieved on CYST stones, among the most difficult stones to fragment using Holmium:YAG (Ho:YAG) lithotripsy. Diameter of debris was characterized using optical microscopy and found to be less than 20 microm, substantially smaller than that produced by long-pulsed Ho:YAG ablation. Stone retropulsion, monitored by a high-speed camera system with a spatial resolution of 15 microm, was negligible for stones with mass as small as 0.06 g. Peak shock wave pressures were less than 2 bars, measured by a polyvinylidene fluoride (PVDF) needle hydrophone. Ablation dynamics were visualized and characterized with pump-probe imaging and fast flash photography and correlated to shock wave pressures. Because femtosecond-pulsed laser ablates urinary calculi of soft and hard compositions, with micron-sized debris, negligible stone retropulsion, and small shock wave pressures, we conclude that the approach is a promising candidate technique for lithotripsy.

Proteus mirabilis viability after lithotripsy of struvite calculi

NASA Astrophysics Data System (ADS)

Prabakharan, Sabitha; Teichman, Joel M. H.; Spore, Scott S.; Sabanegh, Edmund; Glickman, Randolph D.; McLean, Robert J. C.

2000-05-01

Urinary calculi composed of struvite harbor urease-producing bacteria within the stone. The photothermal mechanism of holmium:YAG lithotripsy is uniquely different than other lithotripsy devices. We postulated that bacterial viability of struvite calculi would be less for calculi fragmented with holmium:YAG irradiation compared to other lithotripsy devices. Human calculi of known struvite composition (greater than 90% magnesium ammonium phosphate hexahydrate) were incubated with Proteus mirabilis. Calculi were fragmented with no lithotripsy (controls), or shock wave, intracorporeal ultrasonic, electrohydraulic, pneumatic, holmium:YAG or pulsed dye laser lithotripsy. After lithotripsy, stone fragments were sonicated and specimens were serially plated for 48 hours at 38 C. Bacterial counts and the rate of bacterial sterilization were compared. Median bacterial counts (colony forming units per ml) were 8 X 106 in controls and 3 X 106 in shock wave, 3 X 107 in ultrasonic, 4 X 105 in electrohydraulic, 8 X 106 in pneumatic, 5 X 104 in holmium:YAG and 1 X 106 in pulsed dye laser lithotripsy, p less than 0.001. The rate of bacterial sterilization was 50% for holmium:YAG lithotripsy treated stones versus 0% for each of the other cohorts, p less than 0.01. P. mirabilis viability is less after holmium:YAG irradiation compared to other lithotripsy devices.

Corrosion Prevention of Steel Reinforcement in 7.5% NaCl Solution using Pure Magnesium Anode

NASA Astrophysics Data System (ADS)

Iyer Murthy, Yogesh; Gandhi, Sumit; Kumar, Abhishek

2018-03-01

The current work investigates the performance of pure Magnesium on corrosion prevention of steel reinforcements by way of sacrificial anoding. Two set of six steel reinforcements were tested for half-cell potential, weight loss, anode efficiency and tensile strength for each of the sacrificial anodes in a high chloride atmosphere of 7.5% NaCl in tap water. Significant reduction in weight of anode was observed during the initial 12 days. The reduction in weight of steel reinforcements tied with anodes was found to be negligible, while that of reinforcements without anodes was significantly higher. Five distinct zones of corrosion were observed during the test. The tensile strength of steel cathodically protected by Mg alloy anodes was found less affected. It could be concluded that pure Mg anode provides an effective way of corrosion mitigation.

Ground-water quality atlas of Wisconsin

USGS Publications Warehouse

Kammerer, Phil A.

1981-01-01

This report summarizes data on ground-water quality stored in the U.S. Geological Survey's computer system (WATSTORE). The summary includes water quality data for 2,443 single-aquifer wells, which tap one of the State's three major aquifers (sand and gravel, Silurian dolomite, and sandstone). Data for dissolved solids, hardness, alkalinity, calcium, magnesium, sodium, potassium, iron, manganese, sulfate, chloride, fluoride, and nitrate are summarized by aquifer and by county, and locations of wells for which data are available 1 are shown for each aquifer. Calcium, magnesium, and bicarbonate (the principal component of alkalinity) are the major dissolved constituents in Wisconsin's ground water. High iron concentrations and hardness cause ground-water quality problems in much of the State. Statewide ,summaries of trace constituent (selected trace metals; arsenic, boron, and organic carbon) concentrations show that these constituents impair water quality in only a few isolated wells.

RIGOR MORTIS AND THE INFLUENCE OF CALCIUM AND MAGNESIUM SALTS UPON ITS DEVELOPMENT.

PubMed

Meltzer, S J; Auer, J

1908-01-01

Calcium salts hasten and magnesium salts retard the development of rigor mortis, that is, when these salts are administered subcutaneously or intravenously. When injected intra-arterially, concentrated solutions of both kinds of salts cause nearly an immediate onset of a strong stiffness of the muscles which is apparently a contraction, brought on by a stimulation caused by these salts and due to osmosis. This contraction, if strong, passes over without a relaxation into a real rigor. This form of rigor may be classed as work-rigor (Arbeitsstarre). In animals, at least in frogs, with intact cords, the early contraction and the following rigor are stronger than in animals with destroyed cord. If M/8 solutions-nearly equimolecular to "physiological" solutions of sodium chloride-are used, even when injected intra-arterially, calcium salts hasten and magnesium salts retard the onset of rigor. The hastening and retardation in this case as well as in the cases of subcutaneous and intravenous injections, are ion effects and essentially due to the cations, calcium and magnesium. In the rigor hastened by calcium the effects of the extensor muscles mostly prevail; in the rigor following magnesium injection, on the other hand, either the flexor muscles prevail or the muscles become stiff in the original position of the animal at death. There seems to be no difference in the degree of stiffness in the final rigor, only the onset and development of the rigor is hastened in the case of the one salt and retarded in the other. Calcium hastens also the development of heat rigor. No positive facts were obtained with regard to the effect of magnesium upon heat vigor. Calcium also hastens and magnesium retards the onset of rigor in the left ventricle of the heart. No definite data were gathered with regard to the effects of these salts upon the right ventricle.

Surface buffing and its effect on chloride induced SCC of 304L austenitic stainless steel

NASA Astrophysics Data System (ADS)

kumar, Pandu Sunil; Ghosh Acharyya, Swati; Ramana Rao, S. V.; Kapoor, Komal

2018-02-01

The study focuses on the impact of buffing operation on the stress corrosion cracking (SCC) susceptibility of 304L austenitic stainless steel (SS). The SCC susceptibility of the buffed surfaces were determined by testing in boiling magnesium chloride (MgCl2) environment as per ASTM G 36. Test was conducted for 3hr, 9hr and 72hr to study the SCC susceptibility. Buffed surfaces were resistant to SCC even after 72hr of exposure to boiling MgCl2. The surface and cross section of the samples were examined for both before and after exposure to boiling MgCl2 and was characterized using optical microscopy. The study revealed that buffing operation induces compressive residual stresses on the surface, which helps in protecting the surface from SCC.

Thermal acidization and recovery process for recovering viscous petroleum

DOEpatents

Poston, Robert S.

1984-01-01

A thermal acidization and recovery process for increasing production of heavy viscous petroleum crude oil and synthetic fuels from subterranean hydrocarbon formations containing clay particles creating adverse permeability effects is described. The method comprises injecting a thermal vapor stream through a well bore penetrating such formations to clean the formation face of hydrocarbonaceous materials which restrict the flow of fluids into the petroleum-bearing formation. Vaporized hydrogen chloride is then injected simultaneously to react with calcium and magnesium salts in the formation surrounding the bore hole to form water soluble chloride salts. Vaporized hydrogen fluoride is then injected simultaneously with its thermal vapor to dissolve water-sensitive clay particles thus increasing permeability. Thereafter, the thermal vapors are injected until the formation is sufficiently heated to permit increased recovery rates of the petroleum.

Assessment of surface-water quantity and quality, Eagle River watershed, Colorado, 1947-2007

USGS Publications Warehouse

Williams, Cory A.; Moore, Jennifer L.; Richards, Rodney J.

2011-01-01

The spatial patterns for concentrations of trace metals (aluminum, cadmium, copper, iron, manganese, and zinc) indicate an increase in dissolved concentrations of these metals near historical mining areas in the Eagle River and several tributaries near Belden. In general, concentrations decrease downstream from mining areas. Concentrations typically are near or below reporting limits in Gore Creek and other tributaries within the watershed. Concentrations for trace elements (arsenic, selenium, and uranium) in the watershed usually are below the reporting limit, and no prevailing spatial patterns were observed in the data. Step-trend analysis and temporal-trend analysis provide evidence that remediation of historical mining areas in the upper Eagle River have led to observed decreases in metals concentrations in many surface-waters. Comparison of pre- and post-remediation concentrations for many metals indicates significant decreases in metals concentrations for cadmium, manganese, and zinc at sites downstream from the Eagle Mine Superfund Site. Some sites show order of magnitude reductions in median concentrations between these two periods. Evaluation of monotonic trends for dissolved metals concentrations show downward trends at numerous sites in, and downstream from, historic mining areas. The spatial pattern of nutrients shows lower concentrations on many tributaries and on the Eagle River upstream from Red Cliff with increases in nutrients downstream of major urban areas. Seasonal variations show that for many nutrient species, concentrations tend to be lowest May-June and highest January-March. The gradual changes in concentrations between seasons may be related to dilution effects from increases and decreases in streamflow. Upward trends in nutrients between the towns of Gypsum and Avon were detected for nitrate, orthophosphate, and total phosphorus. An upward trend in nitrite was detected in Gore Creek. No trends were detected in un-ionized ammonia within the ERW. Exceedances of State water-quality standards (nitrite, nitrate, and un-ionized ammonia) and levels higher than U.S. Environmental Protection Agency recommendations (total phosphorus) occur in several areas within the ERW. The majority of the exceedances are from comparisons to the U.S. Environmental Protection Agency total phosphorus recommendations. A positive correlation was observed between suspended sediment and total phosphorus. An upward trend in total dissolved solids in Gore Creek may be the result of increases in chloride salts. Highly significant trends were detected in sodium, potassium, and chloride with a significant upward trend in magnesium and a weakly significant upward trend in calcium. A quantitative analysis of the relative abundance of calcium, magnesium, sodium, and potassium to the available anions suggests that chloride salts likely are the source for the detected upward trends because chloride is the only commonly occurring anion with a trend in Gore Greek. A potential source for the observed chloride salts may be the chemical anti-icing and deicing products used during winter road maintenance in municipal areas and on Interstate-70. A downward trend in dissolved solids in the Eagle River between Gypsum and Avon may be contributing to the detected trend on the Eagle River at Gypsum. Significant downward trends were detected in specific ions such as calcium, magnesium, sulfate, and silica. Measures of total dissolved solids as well as comparisons to specific ions show that in water-quality samples within the ERW concentrations generally are lower in the headwaters, with increases downstream from Wolcott. Differences in concentrations likely result from increased abundance of salt-bearing geologic units downstream from Avon. Few sites had measured concentrations that exceeded the State standards for chloride.

MgF2-coated porous magnesium/alumina scaffolds with improved strength, corrosion resistance, and biological performance for biomedical applications.

PubMed

Kang, Min-Ho; Jang, Tae-Sik; Kim, Sung Won; Park, Hui-Sun; Song, Juha; Kim, Hyoun-Ee; Jung, Kyung-Hwan; Jung, Hyun-Do

2016-05-01

Porous magnesium (Mg) has recently emerged as a promising biodegradable alternative to biometal for bone ingrowth; however, its low mechanical properties and high corrosion rate in biological environments remain problematic. In this study, porous magnesium was implemented in a scaffold that closely mimics the mechanical properties of human bones with a controlled degradation rate and shows good biocompatibility to match the regeneration rate of bone tissue at the affected site. The alumina-reinforced Mg scaffold was produced by spark plasma sintering and coated with magnesium fluoride (MgF2) using a hydrofluoric acid solution to regulate the corrosion rate under physiological conditions. Sodium chloride granules (NaCl), acting as space holders, were leached out to achieve porous samples (60%) presenting an average pore size of 240 μm with complete pore interconnectivity. When the alumina content increased from 0 to 5 vol%, compressive strength and stiffness rose considerably from 9.5 to 13.8 MPa and from 0.24 to 0.40 GPa, respectively. Moreover, the biological response evaluated by in vitro cell test and blood test of the MgF2-coated porous Mg composite was enhanced with better corrosion resistance compared with that of uncoated counterparts. Consequently, MgF2-coated porous Mg/alumina composites may be applied in load-bearing biodegradable implants. Copyright © 2016 Elsevier B.V. All rights reserved.

Dielectric Constant and Loss Data Part 2

DTIC Science & Technology

1975-12-01

fluoride, single crystal, Melamine - formaldehyde resins , Columbia Univ., P.R.-75 IV-21,22,112; V-8,88 Manganese-magnesium ferrite, Melamine GMG, IV-2i...butylperoxy) Urea - formaldehyde resins , IV-23 hexane, P.R.-197 U.S. Army Engineering Research and War Dept., Picatinny Arsenal, see Dev. Lab., Fort...IV.-36 irradiated, P.R,-161 "Bakelite" polyvinyl chloride- "Amplifilm," IV-14; V-74 acetate, see "Vinylites" Axiiliine- formaldehyde resins , IV-21

Quality-assurance data for routine water analyses by the U.S. Geological Survey Laboratory in Troy, New York—July 1995 through June 1997

USGS Publications Warehouse

Lincoln, Tricia A.; Horan-Ross, Debra A.; McHale, Michael R.; Lawrence, Gregory B.

2005-01-01

Results from blind reference-sample analyses indicated that data-quality objectives were met by at least 90 percent of the calcium, pH, potassium, and sodium samples. Data-quality objectives were met by 77 percent of the chloride samples, 83 percent of the magnesium samples, and 80 percent of the sulfate samples. There is insufficient data to evaluate the specific conductance samples.

Statistical summaries of water-quality data for streams draining coal-mined areas, southeastern Kansas

USGS Publications Warehouse

Bevans, Hugh E.; Diaz, Arthur M.

1980-01-01

Summaries of descriptive statistics are compiled for 14 data-collection sites located on streams draining areas that have been shaft mined and strip mined for coal in Cherokee and Crawford Counties in southeastern Kansas. These summaries include water-quality data collected from October 1976 through April 1979. Regression equations relating specific conductance and instantaneous streamflow to concentrations of bicarbonate, sulfate, chloride, fluoride, calcium, magnesium, sodium, potassium, silica, and dissolved solids are presented.

Remedial Investigation Badger Army Ammunition Plant, Baraboo, Wisconsin. Volume 1. Text Sections 1 Through 12

DTIC Science & Technology

1993-04-01

VOCs (acetone [ACET], trichlorofluoromethane [CCL3F], methyl ethyl ketone [MEK]) sporadically detected at very low concentrations (< 1 parts per billion...associated with the site includes red pine ( Pinus resinosa), hickories, cedar (Thuja occidentalis), and American elm (Ulmus americana). Grasses and weedy...cd)pyrene ICDPYR iron FE lead PB magnesium MG *manganese MN mercury HG methylene chloride CH12CL2 methyl ethyl ketone or 2-butanone MIEK

PROCESS OF PREPARING URANIUM-IMPREGNATED GRAPHITE BODY

DOEpatents

Kanter, M.A.

1958-05-20

A method for the fabrication of graphite bodies containing uniformly distributed uranium is described. It consists of impregnating a body of graphite having uniform porosity and low density with an aqueous solution of uranyl nitrate hexahydrate preferably by a vacuum technique, thereafter removing excess aqueous solution from the surface of the graphite, then removing the solvent water from the body under substantially normal atmospheric conditions of temperature and pressure in the presence of a stream of dry inert gas, and finally heating the dry impregnated graphite body in the presence of inert gas at a temperature between 800 and 1400 d C to convert the uranyl nitrate hexahydrate to an oxide of uranium.

Hydrologic characteristics of surface-mined land reclaimed by sludge irrigation, Fulton County, Illinois

USGS Publications Warehouse

Patterson, G.L.; Fuentes, R.F.; Toler, L.G.

1982-01-01

Analyses of water samples collected at four stream-monitoring stations, in an area surface mined for coal and being reclaimed by sludge irrigation, show the principal metals are sodium, calcium, and magnesium and principal non-metals are chloride, sulfate, and bicarbonate. Comparing yearly mean chemical concentrations shows no changing trends since reclamation began, nor are there differences between stations upstream and downstream from the site. Yearly suspended-sediment loads and discharge relations upstream and downstream from the site also show no differences. Discharge hydrographs of two streams draining the site show a delayed response to precipitation due to the storage capacity of several upstream strip-mine lakes. The water-table surface generally follows the irregular topography. Monthly water-level fluctuations were dependent on the surface material (mined or unmined) and proximity to surface discharge. The largest fluctuations were in unmined land away from discharge while the smallest were in mined land near discharge. The water table is closer to the surface in unmined land. Analyses of water samples from 70 wells within or adjacent to the reclamation site showed no differences in water quality which could be attributed to sludge or supernatant application. Samples from wells in mined land, however, had higher concentrations of dissolved sulfate, calcium, magnesium, chloride, iron, zinc, and manganese than samples from wells in unmined land. (USGS)

Effects of Environmental Factors on Soluble Expression of a Humanized Anti-TNF-α scFv Antibody in Escherichia coli

PubMed Central

Sina, Mohammad; Farajzadeh, Davoud; Dastmalchi, Siavoush

2015-01-01

Purpose: The bacterial cultivation conditions for obtaining anti-TNF-α single chain variable fragment (scFv) antibody as the soluble product in E. coli was investigated. Methods: To avoid the production of inclusion bodies, the effects of lactose, IPTG, incubation time, temperature, shaking protocol, medium additives (Mg+2, sucrose), pH, osmotic and heat shocks were examined. Samples from bacterial growth conditions with promising results of soluble expression of GST-hD2 scFv were affinity purified and quantified by SDS-PAGE and image processing for further evaluation. Results: The results showed that cultivation in LB medium under induction by low concentrations of lactose and incubation at 10 °C led to partial solubilization of the expressed anti-TNF-α scFv (GST-hD2). Other variables which showed promising increase in soluble expression of GST-hD2 were osmotic shock and addition of magnesium chloride. Furthermore, addition of sucrose to medium suppressed the expression of scFv completely. The other finding was that the addition of sorbitol decreased the growth rate of bacteria. Conclusion: It can be concluded that low cultivation temperature in the presence of low amount of inducer under a long incubation time or addition of magnesium chloride are the most effective environmental factors studied for obtaining the maximum solubilization of GST-hD2 recombinant protein. PMID:26819916

Effects of Environmental Factors on Soluble Expression of a Humanized Anti-TNF-α scFv Antibody in Escherichia coli.

PubMed

Sina, Mohammad; Farajzadeh, Davoud; Dastmalchi, Siavoush

2015-11-01

The bacterial cultivation conditions for obtaining anti-TNF-α single chain variable fragment (scFv) antibody as the soluble product in E. coli was investigated. To avoid the production of inclusion bodies, the effects of lactose, IPTG, incubation time, temperature, shaking protocol, medium additives (Mg+2, sucrose), pH, osmotic and heat shocks were examined. Samples from bacterial growth conditions with promising results of soluble expression of GST-hD2 scFv were affinity purified and quantified by SDS-PAGE and image processing for further evaluation. The results showed that cultivation in LB medium under induction by low concentrations of lactose and incubation at 10 °C led to partial solubilization of the expressed anti-TNF-α scFv (GST-hD2). Other variables which showed promising increase in soluble expression of GST-hD2 were osmotic shock and addition of magnesium chloride. Furthermore, addition of sucrose to medium suppressed the expression of scFv completely. The other finding was that the addition of sorbitol decreased the growth rate of bacteria. It can be concluded that low cultivation temperature in the presence of low amount of inducer under a long incubation time or addition of magnesium chloride are the most effective environmental factors studied for obtaining the maximum solubilization of GST-hD2 recombinant protein.

Chemical stability study of vitamins thiamine, riboflavin, pyridoxine and ascorbic acid in parenteral nutrition for neonatal use

PubMed Central

2011-01-01

Background The objective of this work was to study the vitamins B1, B2, B6 and C stability in a pediatric formulation containing high amounts of calcium in the presence of organic phosphate, amino acids, glucose, sodium chloride, magnesium sulfate, pediatric vitamins and trace elements under different conditions using developed and validated analytical methods. Methods The study was carried out during 72 h with formulations packaged in recommended storage temperature (4°C) and 25°C, with and without photoprotection. Results The results showed that the methodologies used for assessing the chemical stability of vitamins B1, B2, B6 and C in the formulation were selective, linear, precise and accurate. The vitamins could be considered stable in the formulation during the three days of study if stored at 4°C. When stored at 25°C vitamin C presented instability after 48 h. Conclusion The pediatric formulation containing high amount of calcium in the presence of organic phosphate, amino acids, glucose, sodium chloride, magnesium sulphate, pediatric vitamins and trace elements packaged in bag-type trilaminate presented a shelf life of the 72 h, when maintained under refrigeration, between 2°C and 8°C. This shelf life was measured considering the vitamins studied. Further studies are needed including all the vitamins present in this formulation. PMID:21569609

Should pediatric parenteral nutrition be individualized?☆

PubMed Central

Freitas, Renata Germano Borges de Oliveira Nascimento; Nogueira, Roberto José Negrão; Saron, Margareth Lopes Galvão; Lima, Alexandre Esteves Souza; Hessel, Gabriel

2014-01-01

INTRODUCTION: Parenteral nutrition (PN) formulations are commonly individualized, since their standardization appears inadequate for the pediatric population. This study aimed to evaluate the nutritional state and the reasons for PN individualization in pediatric patients using PN, hospitalized in a tertiary hospital in Campinas, São Paulo. METHODS: This longitudinal study comprised patients using PN followed by up to 67 days. Nutritional status was classified according to the criteria established by the World Health Organization (WHO) (2006) and WHO (2007). The levels of the following elements in blood were analyzed: sodium, potassium, ionized calcium, chloride, magnesium, inorganic phosphorus, and triglycerides (TGL). Among the criteria for individualization, the following were considered undeniable: significant reduction in blood levels of potassium (<3mEq/L), sodium (<125mEq/L), magnesium (<1mEq/L), phosphorus (<1.5mEq/L), ionic calcium (<1mmol), and chloride (<90mEq/L), or any value above the references. RESULTS: Twelve pediatric patients aged 1 month to 15 years were studied (49 individualizations). Most patients were classified as malnourished. It was observed that 74/254 (29.2%) of examinations demanded individualized PN for indubitable reasons. CONCLUSION: The nutritional state of patients was considered critical in most cases. Thus, the individualization performed in the beginning of PN for energy protein adequacy was indispensable. In addition, the individualized PN was indispensable in at least 29.2% of PN for correction of alterations found in biochemical parameters. PMID:25510996

The Daily Consumption of Cola Can Determine Hypocalcemia: A Case Report of Postsurgical Hypoparathyroidism-Related Hypocalcemia Refractory to Supplemental Therapy with High Doses of Oral Calcium.

PubMed

Guarnotta, Valentina; Riela, Serena; Massaro, Marina; Bonventre, Sebastiano; Inviati, Angela; Ciresi, Alessandro; Pizzolanti, Giuseppe; Benvenga, Salvatore; Giordano, Carla

2017-01-01

The consumption of soft drinks is a crucial factor in determining persistent hypocalcemia. The aim of the study is to evaluate the biochemical mechanisms inducing hypocalcemia in a female patient with usual high consumption of cola drink and persistent hypocalcemia, who failed to respond to high doses of calcium and calcitriol supplementation. At baseline and after pentagastrin injection, gastric secretion (Gs) and duodenal secretion (Ds) samples were collected and calcium and total phosphorus (P tot ) concentrations were evaluated. At the same time, blood calcium, P tot , sodium, potassium, chloride, magnesium concentrations, and vitamin D were sampled. After intake of cola (1 L) over 180 min, Gs and Ds and blood were collected and characterized in order to analyze the amount of calcium and P tot or sodium, potassium, magnesium, and chloride ions, respectively. A strong pH decrease was observed after cola intake with an increase in phosphorus concentration. Consequently, a decrease in calcium concentration in Gs and Ds was observed. A decrease in calcium concentration was also observed in blood. In conclusion, we confirm that in patients with postsurgical hypoparathyroidism, the intake of large amounts of cola containing high amounts of phosphoric acid reduces calcium absorption efficiency despite the high doses of calcium therapy.

The Evaluation of Damage Effects on MgO Added Concrete with Slag Cement Exposed to Calcium Chloride Deicing Salt

PubMed Central

Jang, Jae-Kyeong; Kim, Hong-Gi; Kim, Jun-Hyeong

2018-01-01

Concrete systems exposed to deicers are damaged in physical and chemical ways. In mitigating the damage from CaCl2 deicers, the usage of ground slag cement and MgO are investigated. Ordinary Portland cement (OPC) and slag cement are used in different proportions as the binding material, and MgO in doses of 0%, 5%, 7%, and 10% are added to the systems. After 28 days of water-curing, the specimens are immersed in 30% CaCl2 solution by mass for 180 days. Compressive strength test, carbonation test, chloride penetration test, chloride content test, XRD analysis, and SEM-EDAX analysis are conducted to evaluate the damage effects of the deicing solution. Up to 28 days, plain specimens with increasing MgO show a decrease in compressive strength, an increase in carbonation resistance, and a decrease in chloride penetration resistance, whereas the S30- and S50- specimens show a slight increase in compressive strength, an increase in carbonation resistance, and a slight increase in chloride penetration resistance. After 180 days of immersion in deicing solution, specimens with MgO retain their compressive strength longer and show improved durability. Furthermore, the addition of MgO to concrete systems with slag cement induces the formation of magnesium silicate hydrate (M-S-H) phases. PMID:29758008

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren Limei; Schuchardt, Frank; Shen Yujun

An absorbent mixture of magnesium hydroxide (Mg(OH){sub 2}) and phosphoric acid (H{sub 3}PO{sub 4}) was added to compost mixtures of pig manure with cornstalk in different molar ratios (T1, 1:1; T2, 1:2; T3, 1:3) in order to examine its effect on controlling ammonia losses during composting. Based on the principle of struvite precipitation, and with an unamended trial as control (CK), an in-vessel composting experiment was conducted in fermenters (60 L with forced aeration) in which the absorbent mixture was added with proportions of 3.8%, 7.3% and 8.9% of dry weight for T1, T2 and T3, respectively. The results showedmore » that the total nitrogen loss was reduced from 35% to 12%, 5% and 1% of initial N mass, respectively. In the final compost, the total nitrogen content in T1, T2 and T3 was improved by 10, 14, 12 g kg{sup -1}, and NH{sub 4}{sup +}-N in T1, T2 and T3 was improved by 8, 9, and 10 g kg{sup -1}, respectively, compared with the unamended trial. The results of the germination index test showed that the maturity of treatment T2 was best among the four treatments in the final compost, followed by T1, CK and T3. The results of X-ray diffraction (XRD) confirmed the formation of magnesium ammonium phosphate hexahydrate (MgNH{sub 4}PO{sub 4}.6H{sub 2}O:MAP) in the T1, T2 and T3 compost. Based on these results, the adsorbent mixture of Mg(OH){sub 2} + H{sub 3}PO{sub 4} could control nitrogen loss effectively during composting via struvite crystallization. However, an excess of phosphoric acid (1:3) had a negative influence on composting properties. The pH value decreased which led to reduced microorganism activity, and which finally resulted in reduced biodegradation of the organic matter.« less

Interaction of metal ions and amino acids - Possible mechanisms for the adsorption of amino acids on homoionic smectite clays

NASA Technical Reports Server (NTRS)

Gupta, A.; Loew, G. H.; Lawless, J.

1983-01-01

A semiempirical molecular orbital method is used to characterize the binding of amino acids to hexahydrated Cu(2+) and Ni(2+), a process presumed to occur when they are adsorbed in the interlamellar space of homoionic smectite clays. Five alpha-amino acids, beta-alanine, and gamma-aminobutyric acid were used to investigate the metal ion and amino acid specificity in binding. It was assumed that the alpha, beta, and gamma-amino acids would bind as bidentate anionic ligands, forming either 1:1 or 1:2 six-coordinated five, six, and seven-membered-ring chelate complexes, respectively. Energies of complex formation, optimized geometries, and electron and spin distribution were determined; and steric constraints of binding of the amino acids to the ion-exchanged cations in the interlamellar spacing of a clay were examined. Results indicate that hexahydrated Cu(2+) forms more stable complexes than hexahydrated Ni(2+) with all the amino acids studied. However, among these amino acids, complex formation does not favor the adsorption of the biological subset. Calculated energetics of complex formation and steric constraints are shown to predict that 1:1 rather than 1:2 metal-amino acid complexes are generally favored in the clay.

Optical and structural properties of Al-doped ZnO thin films by sol gel process.

PubMed

Jun, Min-Chul; Koh, Jung-Hyuk

2013-05-01

Transparent conducting oxide (TCO) materials with high transmittance and good electrical conductivity have been attracted much attention due to the development of electronic display and devices such as organic light emitting diodes (OLEDs), and dye-sensitized solar cells (DSSCs). Aluminum doped zinc oxide thin films (AZO) have been well known for their use as TCO materials due to its stability, cost-effectiveness, good optical transmittance and electrical properties. Especially, AZO thin film, which have low resistivity of 2-4 x 10(-4) omega x cm which is similar to that of ITO films with wide band gap semiconductors. The AZO thin films were deposited on glass substrates by sol-gel spin-coating process. As a starting material, zinc acetate dihydrate (Zn(CH3COO)2 x 2H2O) and aluminum chloride hexahydrate (AlCl3 6H2O) were used. 2-methoxyethanol and monoethanolamine (MEA) were used as solvent and stabilizer, respectively. After deposited, the films were preheated at 300 degrees C on a hotplate and post-heated at 650 degrees C for 1.5 hrs in the furnace. We have studied the structural and optical properties as a function of Al concentration (0-2.5 mol.%).

Electroless Cu Plating on Anodized Al Substrate for High Power LED.

PubMed

Rha, Sa-Kyun; Lee, Youn-Seoung

2015-03-01

Area-selective copper deposition on screen printed Ag pattern/anodized Al/Al substrate was attempted using a neutral electroless plating processes for printed circuit boards (PCBs), according to a range of variation of pH 6.5-pH 8 at 70 °C. The utilized basic electroless solution consisted of copper(II) sulfate pentahydrate, sodium phosphinate monohydrate, sodium citrate tribasic dihydrate, ammonium chloride, and nickel(II) sulfate hexahydrate. The pH of the copper plating solutions was adjusted from pH 6.5 to pH 8 using NH4OH. Using electroless plating in pH 6.5 and pH 7 baths, surface damage to the anodized Al layer hardly occurred; the structure of the plated Cu-rich films was a typical fcc-Cu, but a small Ni component was co-deposited. In electroless plating at pH 8, the surface of the anodized Al layer was damaged and the Cu film was composed of a lot of Ni and P which were co-deposited with Cu. Finally, in a pH 7 bath, we can make a selectively electroless plated Cu film on a PCB without any lithography and without surface damage to the anodized Al layer.

Synthesis and Elucidation Structure of Tetrakis-diphenylaminecopper(II) Chloride Hexahydrate

NASA Astrophysics Data System (ADS)

Syaima, H.; Rahardjo, S. B.; Suciningrum, E.

2017-11-01

CuCl2·2H2O with diphenylamine formed a complex compound in 1:4-mole ratio of metal to the ligand in methanol. Its structural properties were investigated by employing metal content analysis by Atomic Absorption Spectroscopy (AAS), magnetic susceptibility, UV-vis and FTIR spectroscopy. The forming of the complex was indicated by shifting of UV-Vis spectra. The result of analysis Cu(II) in the complex showed empirical formula of the complex were Cu(diphenylamine)4Cl2(H2O)6. The electrical conductivity of complex showed the charge ratio of cation and anion = 2:1. Finally, the proposed formula of the complex was [Cu(diphenylamine)4]Cl2·6H2O. Based on infrared spectra, it was revealed that diphenylamine existed as monodentate bind to copper(II) through the functional group of N-H. The electronic spectral study of the complex showed three transition peaks on 861, 592, and 419 nm corresponding to the 2B1g → 2A1g, 2B1g → 2B2g dan 2B1g → 2Eg transitions. The complex was paramagnetic and indicated that ligands form square planar geometry around the Cu(II).

[Concentration of selected microelements in blood serum of rats exposed to the action of psilocin and phenylethylamine].

PubMed

Majdanik, Sławomir; Borowiak, Krzysztof; Brzezńska, Maria; Machoy-Mokrzyńska, Anna

2007-01-01

Natural hallucinogens (including Psilocybe mushrooms) became popular in Europe since the nineties. They have been in the focus of clinicians interest for years because of their biological effects. Mechanism of action of these hallucinogens, both Psilocin and Psilocibin, is based on the physiological structure similarity to human neurotransmitters as serotonin and catecholamines. One of the previous works indicated the possibility of the cardiotoxic action of the Psilocibin mushroom, effecting in anoxemic heart laesure. To verify the hypothesis of the Psilocibin-like myocardial damage wide experimental programme was designed. In the present work we introduce some results concerning magnesium, calcium, natrium, kalium and chloride plasma concentration in rats subjected subchronicly to psilocin and phenylethylamine. Basing on the obtained results, it can be stated that subchronic intoxication with natural hallucinogens may disturb magnesium balance without significantly effecting other microelements.

Rapid plasma quenching for the production of ultrafine metal and ceramic powders

NASA Astrophysics Data System (ADS)

Donaldson, Alan; Cordes, Ronald A.

2005-04-01

The rapid plasma quench concept used to produce ultrafine titanium hydride, magnesium, and aluminum powders involves the thermal dissociation of liquid reactants into gaseous components followed by rapid quenching of the products of the subject reaction to prevent back reactions. For example, in the case of titanium hydride powder production, titanium tetrachloride dissociates into titanium and chlorine atoms at 5,000 K. Expansion through a Delaval nozzle accelerates the gas to supersonic speed, cooling it very rapidly at rates as high as 710 K/s. Injected hydrogen reacts with condensed titanium particles to form titanium hydride and with the chlorine to form hydrogen chloride. Titanium powder has been produced at 20 kg/h in a continuous reactor. Costs are projected to be lower than the Kroll process at a sufficiently large scale. Magnesium and aluminum production based upon the rapid plasma quench concept are also discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muth, Thomas R; Yamamoto, Yukinori; Frederick, David Alan

ORNL undertook an investigation using gas tungsten arc (GTA) welding on consolidated powder metallurgy (PM) titanium (Ti) plate, to identify the causal factors behind observed porosity in fusion welding. Tramp element compounds of sodium and magnesium, residual from the metallothermic reduction of titanium chloride used to produce the titanium, were remnant in the starting powder and were identified as gas forming species. PM-titanium made from revert scrap where sodium and magnesium were absent, showed fusion weld porosity, although to a lesser degree. We show that porosity was attributable to hydrogen from adsorbed water on the surface of the powders priormore » to consolidation. The removal / minimization of both adsorbed water on the surface of titanium powder and the residues from the reduction process prior to consolidation of titanium powders, are critical to achieve equivalent fusion welding success similar to that seen in wrought titanium produced via the Kroll process.« less

Causal Factors of Weld Porosity in Gas Tungsten Arc Welding of Powder-Metallurgy-Produced Titanium Alloys

NASA Astrophysics Data System (ADS)

Muth, T. R.; Yamamoto, Y.; Frederick, D. A.; Contescu, C. I.; Chen, W.; Lim, Y. C.; Peter, W. H.; Feng, Z.

2013-05-01

An investigation was undertaken using gas tungsten arc (GTA) welding on consolidated powder metallurgy (PM) titanium (Ti) plate to identify the causal factors behind observed porosity in fusion welding. Tramp element compounds of sodium and magnesium, residual from the metallothermic reduction of titanium chloride used to produce the titanium, were remnant in the starting powder and were identified as gas-forming species. PM-titanium made from revert scrap, where sodium and magnesium were absent, showed fusion weld porosity, although to a lesser degree. We show that porosity was attributable to hydrogen from adsorbed water on the surface of the powders prior to consolidation. The removal and minimization of both adsorbed water on the surface of titanium powder and the residues from the reduction process prior to consolidation of titanium powders are critical for achieving equivalent fusion welding success similar to that seen in wrought titanium produced via the Kroll process.

Operating mechanisms of electrolytes in magnesium ion batteries: chemical equilibrium, magnesium deposition, and electrolyte oxidation.

PubMed

Kim, Dong Young; Lim, Younhee; Roy, Basab; Ryu, Young-Gyoon; Lee, Seok-Soo

2014-12-21

Since the early nineties there have been a number of reports on the experimental development of Mg electrolytes based on organo/amide-magnesium chlorides and their transmetalations. However, there are no theoretical papers describing the underlying operating mechanisms of Mg electrolytes, and there is no clear understanding of these mechanisms. We have therefore attempted to clarify the operating mechanisms of Mg electrolytes by studying the characteristics of Mg complexes, solvation, chemical equilibrium, Mg-deposition processes, electrolyte-oxidation processes, and oxidative degradation mechanism of RMgCl-based electrolytes, using ab initio calculations. The formation and solvation energies of Mg complexes highly depend on the characteristics of R groups. Thus, changes in R groups of RMgCl lead to changes in the equilibrium position and the electrochemical reduction and oxidation pathways and energies. We first provide a methodological scheme for calculating Mg reduction potential values in non-aqueous electrolytes and electrochemical windows. We also describe a strategy for designing Mg electrolytes to maximize the electrochemical windows and oxidative stabilities. These results will be useful not only for designing improved Mg electrolytes, but also for developing new electrolytes in the future.

Permeable Asphalt: A New Tool to Reduce Road Salt Contamination of Groundwater in Urban Areas.

PubMed

Dietz, Michael E; Angel, Derek R; Robbins, Gary A; McNaboe, Lukas A

2017-03-01

Chloride contamination of groundwater in urban areas due to deicing is a well-documented phenomenon in northern climates. The objective of this study was to evaluate the effects of permeable pavement on degraded urban groundwater. Although low impact development practices have been shown to improve stormwater quality, no infiltration practice has been found to prevent road salt chlorides from entering groundwater. The few studies that have investigated chlorides in permeable asphalt have involved sampling directly beneath the asphalt; no research has looked more broadly at surrounding groundwater conditions. Monitoring wells were installed upgradient and downgradient of an 860 m 2 permeable asphalt parking lot at the University of Connecticut (Storrs, Connecticut). Water level and specific conductance were measured continuously, and biweekly samples were analyzed for chloride. Samples were also analyzed for sodium (Na), calcium (Ca), and magnesium (Mg). Analysis of variance analysis indicated a significantly (p < 0.001) lower geometric mean Cl concentration downgradient (303.7 mg/L) as compared to upgradient (1280 mg/L). Concentrations of all alkali metals increased upgradient and downgradient during the winter months as compared to nonwinter months, indicating that cation exchange likely occurred. Despite the frequent high peaks of chloride in the winter months as well as the increases in alkali metals observed, monitoring revealed lower Cl concentrations downgradient than upgradient for the majority of the year. These results suggest that the use of permeable asphalt in impacted urban environments with high ambient chloride concentrations can be beneficial to shallow groundwater quality, although these results may not be generalizable to areas with low ambient chloride concentrations. © 2016, National Ground Water Association.

Hydrochemical facies and ground-water flow patterns in northern part of Atlantic Coastal Plain

USGS Publications Warehouse

Back, William

1966-01-01

Flow patterns of fresh ground water shown on maps and in cross sections have been deduced from available water-level data. These patterns are controlled by the distribution of the higher landmasses and by the depth to either bedrock or to the salt-water interface. The mapping of hydrochemical facies shows that at shallow depths within the Coastal Plain (less than about 200 ft) the calcium-magnesium cation facies generally predominates. The bicarbonate anion facies occurs within more of the shallow Coastal Plain sediments than does the sulfate or the chloride facies. In deeper formations, the sodium chloride character predominates. The lower dissolved-solids content of the ground water in New Jersey indicates less upward vertical leakage than in Maryland and Virginia, where the shallow formations contain solutions of higher concentration.

Water-quality data from a sludge disposal test site, St. Petersburg, Florida, November 1973-July 1977

USGS Publications Warehouse

Fernandez, Mario

1978-01-01

From November 1973 to July 1977, water samples were collected from wells to identify background water-quality conditions and to determine the effects on ground-water quality by St. Petersburg 's sludge-disposal operation (sod farm). Specific conductance and pH were determined in the field. Samples were collected for laboratory determination of selected nitrogen and phosphorus species, sodium, potassium, calcium, magnesium, chloride, trace metals, chemical and biochemical oxygen demand, and coliforms. (Woodard-USGS)

Preliminary evaluation of the ground-water-flow system in the Twin Cities Metropolitan area, Minnesota

USGS Publications Warehouse

Guswa, John H.; Siegel, Donald I.; Gillies, Daniel C.

1982-01-01

Areal distribution of calcium, sodium, sulfate, and chloride concentrations were analyzed to provide information on the hydrologic and geochemical relationships between aquifers. Ground water is generally of the calcium magnesium bicarbonate type. Concentration of dissolved solids in water from the Jordan Sandstone and Mount Simon-Hinckley aquifer generally decreases from southwest to northeast across the study area. This decrease probably reflects differences in the quality of recharge water and geochemical processes within the aquifers, such as ion exchange.

Effect of Concentration on the Electrochemistry and Speciation of the Magnesium Aluminum Chloride Complex Electrolyte Solution.

PubMed

See, Kimberly A; Liu, Yao-Min; Ha, Yeyoung; Barile, Christopher J; Gewirth, Andrew A

2017-10-18

Magnesium batteries offer an opportunity to use naturally abundant Mg and achieve large volumetric capacities reaching over four times that of conventional Li-based intercalation anodes. High volumetric capacity is enabled by the use of a Mg metal anode in which charge is stored via electrodeposition and stripping processes, however, electrolytes that support efficient Mg electrodeposition and stripping are few and are often prepared from highly reactive compounds. One interesting electrolyte solution that supports Mg deposition and stripping without the use of highly reactive reagents is the magnesium aluminum chloride complex (MACC) electrolyte. The MACC exhibits high Coulombic efficiencies and low deposition overpotentials following an electrolytic conditioning protocol that stabilizes species necessary for such behavior. Here, we discuss the effect of the MgCl 2 and AlCl 3 concentrations on the deposition overpotential, current density, and the conditioning process. Higher concentrations of MACC exhibit enhanced Mg electrodeposition current density and much faster conditioning. An increase in the salt concentrations causes a shift in the complex equilibria involving both cations. The conditioning process is strongly dependent on the concentration suggesting that the electrolyte is activated through a change in speciation of electrolyte complexes and is not simply due to the annihilation of electrolyte impurities. Additionally, the presence of the [Mg 2 (μ-Cl) 3 ·6THF] + in the electrolyte solution is again confirmed through careful analysis of experimental Raman spectra coupled with simulation and direct observation of the complex in sonic spray ionization mass spectrometry. Importantly, we suggest that the ∼210 cm -1 mode commonly observed in the Raman spectra of many Mg electrolytes is indicative of the C 3v symmetric [Mg 2 (μ-Cl) 3 ·6THF] + . The 210 cm -1 mode is present in many electrolytes containing MgCl 2 , so its assignment is of broad interest to the Mg electrolyte community.

SCC of 2304 Duplex Stainless Steel—Microstructure, Residual Stress and Surface Grinding Effects

PubMed Central

Zhou, Nian; Peng, Ru Lin; Schönning, Mikael; Pettersson, Rachel

2017-01-01

The influence of surface grinding and microstructure on chloride induced stress corrosion cracking (SCC) behavior of 2304 duplex stainless steel has been investigated. Grinding operations were performed both parallel and perpendicular to the rolling direction of the material. SCC tests were conducted in boiling magnesium chloride according to ASTM G36; specimens were exposed both without external loading and with varied levels of four-point bend loading. Residual stresses were measured on selected specimens before and after exposure using the X-ray diffraction technique. In addition, in-situ surface stress measurements subjected to four-point bend loading were performed to evaluate the deviation between the actual applied loading and the calculated values according to ASTM G39. Micro-cracks, initiated by grinding induced surface tensile residual stresses, were observed for all the ground specimens but not on the as-delivered surfaces. Loading transverse to the rolling direction of the material increased the susceptibility to chloride induced SCC. Grinding induced tensile residual stresses and micro-notches in the as-ground surface topography were also detrimental. PMID:28772582

SCC of 2304 Duplex Stainless Steel-Microstructure, Residual Stress and Surface Grinding Effects.

PubMed

Zhou, Nian; Peng, Ru Lin; Schönning, Mikael; Pettersson, Rachel

2017-02-23

The influence of surface grinding and microstructure on chloride induced stress corrosion cracking (SCC) behavior of 2304 duplex stainless steel has been investigated. Grinding operations were performed both parallel and perpendicular to the rolling direction of the material. SCC tests were conducted in boiling magnesium chloride according to ASTM G36; specimens were exposed both without external loading and with varied levels of four-point bend loading. Residual stresses were measured on selected specimens before and after exposure using the X-ray diffraction technique. In addition, in-situ surface stress measurements subjected to four-point bend loading were performed to evaluate the deviation between the actual applied loading and the calculated values according to ASTM G39. Micro-cracks, initiated by grinding induced surface tensile residual stresses, were observed for all the ground specimens but not on the as-delivered surfaces. Loading transverse to the rolling direction of the material increased the susceptibility to chloride induced SCC. Grinding induced tensile residual stresses and micro-notches in the as-ground surface topography were also detrimental.

Fabrication of a Functionalized Magnetic Bacterial Nanocellulose with Iron Oxide Nanoparticles

PubMed Central

Arias, Sandra L.; Shetty, Akshath R.; Senpan, Angana; Echeverry-Rendón, Mónica; Reece, Lisa M.; Allain, Jean Paul

2016-01-01

In this study, bacterial nanocellulose (BNC) produced by the bacteria Gluconacetobacter xylinus is synthesized and impregnated in situ with iron oxide nanoparticles (IONP) (Fe3O4) to yield a magnetic bacterial nanocellulose (MBNC). The synthesis of MBNC is a precise and specifically designed multi-step process. Briefly, bacterial nanocellulose (BNC) pellicles are formed from preserved G. xylinus strain according to our experimental requirements of size and morphology. A solution of iron(III) chloride hexahydrate (FeCl3·6H2O) and iron(II) chloride tetrahydrate (FeCl2·4H2O) with a 2:1 molar ratio is prepared and diluted in deoxygenated high purity water. A BNC pellicle is then introduced in the vessel with the reactants. This mixture is stirred and heated at 80 °C in a silicon oil bath and ammonium hydroxide (14%) is then added by dropping to precipitate the ferrous ions into the BNC mesh. This last step allows forming in situ magnetite nanoparticles (Fe3O4) inside the bacterial nanocellulose mesh to confer magnetic properties to BNC pellicle. A toxicological assay was used to evaluate the biocompatibility of the BNC-IONP pellicle. Polyethylene glycol (PEG) was used to cover the IONPs in order to improve their biocompatibility. Scanning electron microscopy (SEM) images showed that the IONP were located preferentially in the fibril interlacing spaces of the BNC matrix, but some of them were also found along the BNC ribbons. Magnetic force microscope measurements performed on the MBNC detected the presence magnetic domains with high and weak intensity magnetic field, confirming the magnetic nature of the MBNC pellicle. Young's modulus values obtained in this work are also in a reasonable agreement with those reported for several blood vessels in previous studies. PMID:27285589

Fabrication of a Functionalized Magnetic Bacterial Nanocellulose with Iron Oxide Nanoparticles.

PubMed

Arias, Sandra L; Shetty, Akshath R; Senpan, Angana; Echeverry-Rendón, Mónica; Reece, Lisa M; Allain, Jean Paul

2016-05-26

In this study, bacterial nanocellulose (BNC) produced by the bacteria Gluconacetobacter xylinus is synthesized and impregnated in situ with iron oxide nanoparticles (IONP) (Fe3O4) to yield a magnetic bacterial nanocellulose (MBNC). The synthesis of MBNC is a precise and specifically designed multi-step process. Briefly, bacterial nanocellulose (BNC) pellicles are formed from preserved G. xylinus strain according to our experimental requirements of size and morphology. A solution of iron(III) chloride hexahydrate (FeCl3·6H2O) and iron(II) chloride tetrahydrate (FeCl2·4H2O) with a 2:1 molar ratio is prepared and diluted in deoxygenated high purity water. A BNC pellicle is then introduced in the vessel with the reactants. This mixture is stirred and heated at 80 °C in a silicon oil bath and ammonium hydroxide (14%) is then added by dropping to precipitate the ferrous ions into the BNC mesh. This last step allows forming in situ magnetite nanoparticles (Fe3O4) inside the bacterial nanocellulose mesh to confer magnetic properties to BNC pellicle. A toxicological assay was used to evaluate the biocompatibility of the BNC-IONP pellicle. Polyethylene glycol (PEG) was used to cover the IONPs in order to improve their biocompatibility. Scanning electron microscopy (SEM) images showed that the IONP were located preferentially in the fibril interlacing spaces of the BNC matrix, but some of them were also found along the BNC ribbons. Magnetic force microscope measurements performed on the MBNC detected the presence magnetic domains with high and weak intensity magnetic field, confirming the magnetic nature of the MBNC pellicle. Young's modulus values obtained in this work are also in a reasonable agreement with those reported for several blood vessels in previous studies.

Speciation in the Fe(III)-Cl(I)-H2O System at 298.15 K, 313.15 K, and 333.15 K (25 °C, 40 °C, and 60 °C)

NASA Astrophysics Data System (ADS)

Jamett, Nathalie E.; Hernández, Pía C.; Casas, Jesús M.; Taboada, María E.

2018-02-01

This article presents the results on speciation of ferric iron generated by the dissolution of chemical reagent hydromolysite (ferric chloride hexahydrate, FeCl3:6H2O) in water at 298.15 K, 313.15 K, and 333.15 K (25 °C, 40 °C, and 60 °C). Experiments were performed with a thermoregulated system up to the equilibrium point, as manifested by solution pH. Solution samples were analyzed in terms of concentration, pH, and electrical conductivity. Measurements of density and refractive index were obtained at different temperatures and iron concentrations. A decrease of pH was observed with the increase in the amount of dissolved iron, indicating that ferric chloride is a strong electrolyte that reacts readily with water. Experimental results were modeled using the hydrogeochemical code PHREEQC in order to obtain solution speciation. Cations and neutral and anion complexes were simultaneously present in the system at the studied conditions according to model simulations, where dominant species included Cl-, FeCl2+, FeCl2 +, FeOHCl 2 0 , and H+. A decrease in the concentration of Cl- and Fe3+ ions took place with increasing temperature due to the association of Fe-Cl species. Standard equilibrium constants for the formation of FeOHCl 2 0 obtained in this study were log Kf0 = -0.8 ± 0.01 at 298.15 K (25 °C), -0.94 ± 0.02 at 313.15 K (40 °C), and -1.03 ± 0.01 at 333.15 K (60 °C).

Single crystal EPR and optical studies of paramagnetic ions doped zinc potassium phosphate hexahydrate--part I: Cu(II)--a case of orthorhombic symmetry.

PubMed

Sambasiva Rao, P; Rajendiran, T M; Venkatesan, R; Madhu, N; Chandrasekhar, A V; Reddy, B J; Reddy, Y P; Ravikumar, R V

2001-12-01

Single crystal electron paramagnetic resonance (EPR) studies on Cu(II) doped zinc potassium phosphate hexahydrate (ZPPH) were carried out at room temperature. The angular variation spectra in the three orthogonal planes indicate that the paramagnetic impurity has entered the lattice substitutionally in place of Zn(II) and the spin Hamiltonian parameters calculated from these spectra are g(xx) = 2.188, g(yy) = 2.032, g(zz) = 2.373, Axx = 50 G, Ayy = 65.0 G and Azz = 80 G. The g and A tensors were coincident and these values matched fairly well with the values obtained from powder spectrum. The bonding parameters have also been calculated.

Assessment of the quality of groundwater for drinking purposes in the Upper West and Northern regions of Ghana.

PubMed

Saana, Sixtus Bieranye Bayaa Martin; Fosu, Samuel Asiedu; Sebiawu, Godfred Etsey; Jackson, Napoleon; Karikari, Thomas

2016-01-01

Underground water is an important natural resource serving as a reliable source of drinking water for many people worldwide, especially in developing countries. Underground water quality needs to be given a primary research and quality control attention due to possible contamination. This study was therefore designed to determine the physico-chemical and bacteriological quality of borehole water in the Upper West and Northern regions of Ghana. The study was conducted in seven districts in Ghana (including six in the Upper West region and one in the Northern region). The bacterial load of the water samples was determined using standard microbiological methods. Physico-chemical properties including pH, total alkalinity, temperature, turbidity, true colour, total dissolved solids (TDS), electrical conductivity, total hardness, calcium hardness, magnesium hardness, total iron, calcium ion, magnesium ion, chloride ion, fluoride ion, aluminium ion, arsenic, ammonium ions, nitrate and nitrite concentrations were determined. The values obtained were compared with the World Health Organization (WHO) standards for drinking water. The recorded pH, total alkalinity and temperature ranges were 6.14-7.50, 48-240 mg/l and 28.8-32.8 °C, respectively. Furthermore, the mean concentrations of iron, calcium, magnesium, chloride, fluoride, aluminium, arsenic, ammonium, nitrate and nitrite were 0.06, 22.11, 29.84, 13.97, 0.00, 0.00, 0.00, 0.01, 2.09 and 0.26 mg/l, respectively. Turbidity, true colour, TDS and electrical conductivity of the water samples ranged from 0.13 to 105 NTU, 5 to 130 HU, 80.1 to 524 mg/l and 131 to 873 µS/cm, respectively. In addition, the mean total hardness value was found to be 178.07 mg/l whereas calcium hardness and magnesium hardness respectively were 55.28 and 122.79 mg/l. Only 14% of the water samples tested positive for faecal coliforms. The study revealed that only a few of the values for the bacteriological and physico-chemical parameters of the water samples were above the tolerable limits recommended by the WHO. This calls for regular monitoring and purification of boreholes to ensure good water quality.

Phosphates (V) recovery from phosphorus mineral fertilizers industry wastewater by continuous struvite reaction crystallization process.

PubMed

Hutnik, Nina; Kozik, Anna; Mazienczuk, Agata; Piotrowski, Krzysztof; Wierzbowska, Boguslawa; Matynia, Andrzej

2013-07-01

Continuous DT MSMPR (Draft Tube Mixed Suspension Mixed Product Removal) crystallizer was provided with typical wastewater from phosphorus mineral fertilizers industry (pH < 4, 0.445 mass % of PO4(3-), inorganic impurities presence), dissolved substrates (magnesium and ammonium chlorides) and solution alkalising the environment of struvite MgNH4PO4·6H2O reaction crystallization process. Research ran in constant temperature 298 K assuming stoichiometric proportions of substrates or 20% excess of magnesium ions. Influence of pH (8.5-10) and mean residence time (900-3600 s) on product size distribution, its chemical composition, crystals shape, size-homogeneity and process kinetics was identified. Crystals of mean size ca. 25-37 μm and homogeneity CV 70-83% were produced. The largest crystals, of acceptable homogeneity, were produced using 20% excess of magnesium ions, pH 9 and mean residence time 3600 s. Under these conditions nucleation rate did not exceed 9 × 10(7) 1/(s m(3)) according to SIG (Size Independent Growth) MSMPR kinetic model. Linear crystal growth rate was 4.27 × 10(-9) m/s. Excess of magnesium ions influenced struvite reaction crystallization process yield advantageously. Concentration of phosphate(V) ions decreased from 0.445 to 9.2 × 10(-4) mass %. This can be regarded as a very good process result. In product crystals, besides main component - struvite, all impurities from wastewater were detected analytically. Copyright © 2013 Elsevier Ltd. All rights reserved.

Adsorption of benzyldimethylhexadecylammonium chloride at the hydrophobic silica-water interface studied by total internal reflection Raman spectroscopy: effects of silica surface properties and metal salt addition.

PubMed

Grenoble, Zlata; Baldelli, Steven

2013-08-29

The adsorption of the cationic surfactant benzyldimethylhexadecylammonium (BDMHA(+)) chloride was studied at an octadecyltrichlorosilane (OTS)-monolayer-modified silica-water interface by Raman spectroscopy in total internal reflection (TIR) geometry. The present study demonstrates the capabilities of this spectroscopic technique to evaluate thermodynamic and kinetic BDMHA(+)Cl(-) adsorption properties at the hydrophobic silica surface. The surface coverage of BDMHA(+) decreased by 50% at the hydrophobic OTS-silica surface relative to the surface coverage on bare silica; the dominating driving mechanisms for surfactant adsorption were identified as hydrophobic effects and head group charge screening by the electrolyte counterions. Addition of magnesium metal salt (MgCl2) to the aqueous solution (∼ neutral pH) lowered the surface coverage and moderately increased the Langmuir adsorption constants relative to those of the pure surfactant. These trends were previously observed at the hydrophilic, negatively charged silica surface but with a smaller change in the Gibbs free energy of adsorption at the hydrophobic silica surface. The hydrophobic OTS-silica surface properties resulted in shorter times for the surfactant to reach steady-state adsorption conditions compared to the slow adsorption kinetics previously seen with the surfactant at the hydrophilic surface. Adsorption isotherms, based on Raman signal intensities from spectral analysis, were developed according to the Langmuir adsorption model for the pure surfactant at the OTS-silica-water interface; the modified Langmuir model was applied to the surfactant adsorption in the presence of 5, 10, 50, and 100 mM magnesium chloride. Spectral analysis of the Raman scattering intensities and geometric considerations suggests a hemimicelle-type surface aggregate as the most likely surfactant structure at the OTS-silica surface. The different kinetics observed at the hydrophilic versus the hydrophobic silica surface further indicate that the surface charge and potential influence the surfactant diffusion and kinetic rates of adsorption at the silica-water interface.

Aqueous corrosion of phosphide minerals from iron meteorites: a highly reactive source of prebiotic phosphorus on the surface of the early Earth.

PubMed

Pasek, Matthew A; Lauretta, Dante S

2005-08-01

We present the results of an experimental study of aqueous corrosion of Fe-phosphide under conditions relevant to the early Earth. The results strongly suggest that iron meteorites were an important source of reactive phosphorus (P), a requirement for the formation of P-based life. We further demonstrate that iron meteorites were an abundant source of phosphide minerals early in Earth history. Phosphide corrosion was studied in five different solutions: deionized water, deionized water buffered with sodium bicarbonate, deionized water with dissolved magnesium and calcium chlorides, deionized water containing ethanol and acetic acid, and deionized water containing the chlorides, ethanol, and acetic acid. Experiments were performed in the presence of both air and pure Ar gas to evaluate the effect of atmospheric chemistry. Phosphide corrosion in deionized water results in a metastable mixture of mixed-valence, P-bearing ions including pyrophosphate and triphosphate, key components for metabolism in modern life. In a pH-buffered solution of NaHCO(3), the condensed and reduced species diphosphonate is an abundant corrosion product. Corrosion in ethanol- and acetic acid-containing solutions yields additional P-bearing organic molecules, including acetyl phosphonate and a cyclic triphosphorus molecule. Phosphonate is a major corrosion product of all experiments and is the only P-bearing molecule that persists in solutions with high concentrations of magnesium and calcium chlorides, which suggests that phosphonate may have been a primitive oceanic source of P. The stability and reactivity of phosphonate and hypophosphite in solution were investigated to elucidate reaction mechanisms and the role of mineral catalysts on P-solution chemistry. Phosphonate oxidation is rapid in the presence of Fe metal but negligible in the presence of magnetite and in the control sample. The rate of hypophosphite oxidation is independent of reaction substrate.

Relevance of water quality index for groundwater quality evaluation: Thoothukudi District, Tamil Nadu, India

NASA Astrophysics Data System (ADS)

Singaraja, C.

2017-09-01

The present hydrogeochemical study was confined to the Thoothukudi District in Tamilnadu, India. A total of 100 representative water samples were collected during pre-monsoon and post-monsoon and analyzed for the major cations (sodium, calcium, magnesium and potassium) and anions (chloride, sulfate, bicarbonate, fluoride and nitrate) along with various physical and chemical parameters (pH, total dissolved salts and electrical conductivity). Water quality index rating was calculated to quantify the overall water quality for human consumption. The PRM samples exhibit poor quality in greater percentage when compared with POM due to dilution of ions and agricultural impact. The overlay of WQI with chloride and EC corresponds to the same locations indicating the poor quality of groundwater in the study area. Sodium (Na %), sodium absorption ratio (SAR), residual sodium carbonate (RSC), residual sodium bicarbonate, permeability index (PI), magnesium hazards (MH), Kelly's ratio (KR), potential salinity (PS) and Puri's salt index (PSI) and domestic quality parameters such as total hardness (TH), temporary, permanent hardness and corrosivity ratio (CR) were calculated. The majority of the samples were not suitable for drinking, irrigation and domestic purposes in the study area. In this study, the analysis of salinization/freshening processes was carried out through binary diagrams such as of mole ratios of {SO}_{ 4}^{ 2- } /Cl- and Cl-/EC that clearly classify the sources of seawater intrusion and saltpan contamination. Spatial diagram BEX was used to find whether the aquifer was in the salinization region or in the freshening encroachment region.

Absorption heat pump for space applications

NASA Technical Reports Server (NTRS)

Nguyen, Tuan; Simon, William E.; Warrier, Gopinath R.; Woramontri, Woranun

1993-01-01

In the first part, the performance of the Absorption Heat Pump (AHP) with water-sulfuric acid and water-magnesium chloride as two new refrigerant-absorbent fluid pairs was investigated. A model was proposed for the analysis of the new working pairs in a heat pump system, subject to different temperature lifts. Computer codes were developed to calculate the Coefficient of Performance (COP) of the system with the thermodynamic properties of the working fluids obtained from the literature. The study shows the potential of water-sulfuric acid as a satisfactory replacement for water-lithium bromide in the targeted temperature range. The performance of the AHP using water-magnesium chloride as refrigerant-absorbent pair does not compare well with those obtained using water-lithium bromide. The second part concentrated on the design and testing of a simple ElectroHydrodynamic (EHD) Pump. A theoretical design model based on continuum electromechanics was analyzed to predict the performance characteristics of the EHD pump to circulate the fluid in the absorption heat pump. A numerical method of solving the governing equations was established to predict the velocity profile, pressure - flow rate relationship and efficiency of the pump. The predicted operational characteristics of the EHD pump is comparable to that of turbomachinery hardware; however, the overall efficiency of the electromagnetic pump is much lower. An experimental investigation to verify the numerical results was conducted. The pressure - flow rate performance characteristics and overall efficiency of the pump obtained experimentally agree well with the theoretical model.

Analysis of serum and cerebrospinal fluid in clinically normal adult miniature donkeys.

PubMed

Mozaffari, A A; Samadieh, H

2013-09-01

To establish reference intervals for serum and cerebrospinal fluid (CSF) parameters in clinically healthy adult miniature donkeys. Experiments were conducted on 10 female and 10 male clinically normal adult miniature donkeys, randomly selected from five herds. Lumbosacral CSF collection was performed with the sedated donkey in the standing position. Cell analysis was performed immediately after the samples were collected. Blood samples were obtained from the jugular vein immediately after CSF sample collection. Sodium, potassium, glucose, urea nitrogen, total protein, calcium, chloride, phosphorous and magnesium concentrations were measured in CSF and serum samples. A paired t-test was used to compare mean values between female and male donkeys. The CSF was uniformly clear, colourless and free from flocculent material, with a specific gravity of 1.002. The range of total nucleated cell counts was 2-4 cells/μL. The differential white cell count comprised only small lymphocytes. No erythrocytes or polymorphonuclear cells were observed on cytological examination. Reference values were obtained for biochemical analysis of serum and CSF. Gender had no effect on any variables measured in serum or CSF (p>0.05). CSF analysis can provide important information in addition to that gained by clinical examination. CSF analysis has not previously been performed in miniature donkeys; this is the first report on the subject. In the present study, reference intervals for total nucleated cell count, total protein, glucose, urea nitrogen, sodium, potassium, chloride, calcium, phosphorous and magnesium concentrations of serum and CSF were determined for male and female miniature donkeys.

Bias and precision of selected analytes reported by the National Atmospheric Deposition Program and National Trends Network, 1984

USGS Publications Warehouse

Brooks, M.H.; Schroder, L.J.; Willoughby, T.C.

1987-01-01

The U.S. Geological Survey operated a blind audit sample program during 1974 to test the effects of the sample handling and shipping procedures used by the National Atmospheric Deposition Program and National Trends Network on the quality of wet deposition data produced by the combined networks. Blind audit samples, which were dilutions of standard reference water samples, were submitted by network site operators to the central analytical laboratory disguised as actual wet deposition samples. Results from the analyses of blind audit samples were used to calculate estimates of analyte bias associated with all network wet deposition samples analyzed in 1984 and to estimate analyte precision. Concentration differences between double blind samples that were submitted to the central analytical laboratory and separate analyses of aliquots of those blind audit samples that had not undergone network sample handling and shipping were used to calculate analyte masses that apparently were added to each blind audit sample by routine network handling and shipping procedures. These calculated masses indicated statistically significant biases for magnesium, sodium , potassium, chloride, and sulfate. Median calculated masses were 41.4 micrograms (ug) for calcium, 14.9 ug for magnesium, 23.3 ug for sodium, 0.7 ug for potassium, 16.5 ug for chloride and 55.3 ug for sulfate. Analyte precision was estimated using two different sets of replicate measures performed by the central analytical laboratory. Estimated standard deviations were similar to those previously reported. (Author 's abstract)

Factors Affecting the Plasticity of Sodium Chloride, Lithium Fluoride, and Magnesium Oxide Single Crystals. 1

NASA Technical Reports Server (NTRS)

Stearns, Carl A.; Pack, Ann E.; Lad, Robert A.

1959-01-01

A study was made of the relative magnitude of the effects of various factors on the ductility of single crystals of sodium chloride (NaCl), lithium fluoride (LiF), and magnesium oxide (MgO). Specimen treatments included water-polishing, varying cleavage rate, annealing, quenching, X-irradiation, surface coating, aging, and combinations of some of these treatments. The mechanical behavior of the crystals was studied in flexure and in compression, the latter study being performed at both constant strain rate and constant load. Etch-pit studies were carried out to provide some pertinent information on the results of pretreatment on the dislocation concentration and distribution in the vicinity of the surface. The load deformation curves for these ionic single crystals show an initial region of very low slope which proved to be due to anelastic deformation. The extent of initial anelastic deformation is modified by specimen pretreatment in a way that suggests that this deformation is the result of expansion of cleaved-in dislocation loops, which can contract on the removal of the stress. The effects of the various pretreatments on the load and deflection at fracture are in accord with the prediction one might make with regard to their effect on the nucleation of fatal surface cracks. For NaCl, increases in ductility are always accompanied by increases in strength. The creep constants for NaCl are a function of treatments which affect the bulk structure but are not a function of treatments which only affect the surface.

Color removal from dye-containing wastewater by magnesium chloride.

PubMed

Gao, Bao-Yu; Yue, Qin-Yan; Wang, Yan; Zhou, Wei-Zhi

2007-01-01

Color removal by MgCl(2) when treating synthetic waste containing pure dyes was studied. The color removal efficiency of MgCl(2)/Ca(OH)(2) was compared with that of Al(2)(SO(4))(3), polyaluminum chloride (PAC) and FeSO(4)/Ca(OH)(2). The mechanism of color removal by MgCl(2) was also investigated. The experimental results show that the color removal efficiency of MgCl(2) is related to the type of dye and depends on the pH of the waste and the dosage of the coagulants used. Treatment of waste containing reactive dye or dispersed dye with MgCl(2) yielded an optimum color removal ratio when the pH of the solution was equal to or above 12.0. For both the reactive and dispersed dye waste, MgCl(2)/Ca(OH)(2) was shown to be superior to MgCl(2)/NaOH, Al(2)(SO(4))(3), PAC and FeSO(4)/Ca(OH)(2) for color removal. A magnesium hydroxide precipitate formed at pH values greater than 12.0, which provided a large adsorptive surface area and a positive electrostatic surface charge, enabling it to remove the dyes through charge neutralization and an adsorptive coagulating mechanism. So, the MgCl(2)/Ca(OH)(2) system is a viable alternative to some of the more conventional forms of chemical treatment, especially for treating actual textile waste with high natural pH.

[Should pediatric parenteral nutrition be individualized?].

PubMed

Freitas, Renata Germano Borges de Oliveira Nascimento; Nogueira, Roberto José Negrão; Saron, Margareth Lopes Galvão; Lima, Alexandre Esteves Souza; Hessel, Gabriel

2014-12-01

Parenteral nutrition (PN) formulations are commonly individualized, since their standardization seem inadequate for the pediatric population. This study aimed to evaluate the nutritional state and the reasons for PN individualization in pediatric patients using PN hospitalized in a tertiary hospital in Campinas, São Paulo. This longitudinal study comprised patients using PN followed by up to 67 days. Nutritional status was classified according to the criteria established by the World Health Organization (WHO) (2006) and WHO (2007). The levels of the following elements on blood were analyzed: sodium, potassium, ionized calcium, chloride, magnesium, inorganic phosphorus and triglycerides (TGL). Among the criteria for individualization, were considered undeniable: significant reduction in blood levels of potassium (<3 mEq/L), sodium (<125 mEq/)L, magnesium (<1 mEq/L), phosphorus (<1.5 mEq/L), ionic calcium (<1 mmol) and chloride (<90 mEq/L) or any value above the references. Twelve pediatric patients aged 1 month to 15 years were studied (49 individualizations). Most patients were classified as malnourished. It was observed that 74/254 (29.2%) of examinations demanded individualized PN by indubitable reasons. The nutritional state of patients was considered critical in most cases. Thus, the individualization performed in the beginning of PN for energy protein adequacy was indispensable. In addition, the individualized PN was indispensable in at least 29.2% of PN for correction of alterations found in biochemical parameters. Copyright © 2014 Associação de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.

Mechanistic Studies on the Radiolytic Decomposition of Perchlorates on the Martian Surface

NASA Astrophysics Data System (ADS)

Turner, Andrew M.; Abplanalp, Matthew J.; Kaiser, Ralf I.

2016-04-01

Perchlorates—inorganic compounds carrying the perchlorate ion ({{ClO}}4{}-)—were discovered at the north polar landing site of the Phoenix spacecraft and at the southern equatorial landing site of the Curiosity Rover within the Martian soil at levels of 0.4-0.6 wt%. This study explores in laboratory experiments the temperature-dependent decomposition mechanisms of hydrated perchlorates—namely magnesium perchlorate hexahydrate (Mg(ClO4)2·6H2O)—and provides yields of the oxygen-bearing species formed in these processes at Mars-relevant surface temperatures from 165 to 310 K in the presence of galactic cosmic-ray particles (GCRs). Our experiments reveal that the response of the perchlorates to the energetic electrons is dictated by the destruction of the perchlorate ion ({{ClO}}4{}-) and the inherent formation of chlorates ({{ClO}}3{}-) plus atomic oxygen (O). Isotopic substitution experiments reveal that the oxygen is released solely from the perchlorate ion and not from the water of hydration (H2O). As the mass spectrometer detects only molecular oxygen (O2) and no atomic oxygen (O), atomic oxygen recombines to molecular oxygen within the perchlorates, with the overall yield of molecular oxygen increasing as the temperature drops from 260 to 160 K. Absolute destruction rates and formation yields of oxygen are provided for the planetary modeling community.

Identification of mineral compositions in some renal calculi by FT Raman and IR spectral analysis

NASA Astrophysics Data System (ADS)

Tonannavar, J.; Deshpande, Gouri; Yenagi, Jayashree; Patil, Siddanagouda B.; Patil, Nikhil A.; Mulimani, B. G.

2016-02-01

We present in this paper accurate and reliable Raman and IR spectral identification of mineral constituents in nine samples of renal calculi (kidney stones) removed from patients suffering from nephrolithiasis. The identified mineral components include Calcium Oxalate Monohydrate (COM, whewellite), Calcium Oxalate Dihydrate (COD, weddellite), Magnesium Ammonium Phosphate Hexahydrate (MAPH, struvite), Calcium Hydrogen Phosphate Dihydrate (CHPD, brushite), Pentacalcium Hydroxy Triphosphate (PCHT, hydroxyapatite) and Uric Acid (UA). The identification is based on a satisfactory assignment of all the observed IR and Raman bands (3500-400 cm- 1) to chemical functional groups of mineral components in the samples, aided by spectral analysis of pure materials of COM, MAPH, CHPD and UA. It is found that the eight samples are composed of COM as the common component, the other mineral species as common components are: MAPH in five samples, PCHT in three samples, COD in three samples, UA in three samples and CHPD in two samples. One sample is wholly composed of UA as a single component; this inference is supported by the good agreement between ab initio density functional theoretical spectra and experimental spectral measurements of both sample and pure material. A combined application of Raman and IR techniques has shown that, where the IR is ambiguous, the Raman analysis can differentiate COD from COM and PCHT from MAPH.

Identification of mineral compositions in some renal calculi by FT Raman and IR spectral analysis.

PubMed

Tonannavar, J; Deshpande, Gouri; Yenagi, Jayashree; Patil, Siddanagouda B; Patil, Nikhil A; Mulimani, B G

2016-02-05

We present in this paper accurate and reliable Raman and IR spectral identification of mineral constituents in nine samples of renal calculi (kidney stones) removed from patients suffering from nephrolithiasis. The identified mineral components include Calcium Oxalate Monohydrate (COM, whewellite), Calcium Oxalate Dihydrate (COD, weddellite), Magnesium Ammonium Phosphate Hexahydrate (MAPH, struvite), Calcium Hydrogen Phosphate Dihydrate (CHPD, brushite), Pentacalcium Hydroxy Triphosphate (PCHT, hydroxyapatite) and Uric Acid (UA). The identification is based on a satisfactory assignment of all the observed IR and Raman bands (3500-400c m(-1)) to chemical functional groups of mineral components in the samples, aided by spectral analysis of pure materials of COM, MAPH, CHPD and UA. It is found that the eight samples are composed of COM as the common component, the other mineral species as common components are: MAPH in five samples, PCHT in three samples, COD in three samples, UA in three samples and CHPD in two samples. One sample is wholly composed of UA as a single component; this inference is supported by the good agreement between ab initio density functional theoretical spectra and experimental spectral measurements of both sample and pure material. A combined application of Raman and IR techniques has shown that, where the IR is ambiguous, the Raman analysis can differentiate COD from COM and PCHT from MAPH. Copyright © 2015 Elsevier B.V. All rights reserved.

Soil salinization in different natural zones of intermontane depressions in Tuva

NASA Astrophysics Data System (ADS)

Chernousenko, G. I.; Kurbatskaya, S. S.

2017-11-01

Soil salinization features in semidesert, dry steppe, and chernozemic steppe zones within intermontane depressions in the central part of the Tuva Republic are discussed. Chernozems, chestnut soils, and brown desert-steppe soils of these zones are usually nonsaline. However, salinization of these zonal soils is possible in the case of the presence of salt-bearing parent materials (usually, the derivatives of Devonian deposits). In different natural zones of the intermontane depressions, salt-affected soils are mainly allocated to endorheic lake basins, where they are formed in places of discharge of mineral groundwater, and to river valleys. The composition and content of salts in the natural waters are dictated by the local hydrogeological conditions. The total content of dissolved solids in lake water varies from 1 to 370 g/L; the water is usually of the sulfate-chloride or chloride-sulfate salinity type; in some cases, soda-sulfate water is present. Soil salinity around the lakes is usually of the chloride-sulfate-sodium type; gypsum is often present in the profiles. Chloride salinization rarely predominates in this part of Tuva, because chlorides are easily leached off from the mainly coarse-textured soils. In some cases, the predominance of magnesium over sodium is observed in the composition of dissolved salts, which may be indicative of the cryogenic transformation of soil salts. Soda-saline soils are present in all the considered natural zones on minor areas. It is hardly possible to make unambiguous statements about the dominance of the particular type of salinity in the given natural zones. Zonal salinity patterns are weakly expressed in salinization of hydromorphic soils. However, a tendency for more frequent occurrence of soda-saline soils in steppe landscapes and chloride-sulfate salinization (often, with participation of gypsum) in the dry steppe and semidesert landscapes is observed.

Magnesium incorporated bentonite clay for defluoridation of drinking water.

PubMed

Thakre, Dilip; Rayalu, Sadhana; Kawade, Raju; Meshram, Siddharth; Subrt, J; Labhsetwar, Nitin

2010-08-15

Low cost bentonite clay was chemically modified using magnesium chloride in order to enhance its fluoride removal capacity. The magnesium incorporated bentonite (MB) was characterized by using XRD and SEM techniques. Batch adsorption experiments were conducted to study and optimize various operational parameters such as adsorbent dose, contact time, pH, effect of co-ions and initial fluoride concentration. It was observed that the MB works effectively over wide range of pH and showed a maximum fluoride removal capacity of 2.26 mgg(-1) at an initial fluoride concentration of 5 mg L(-1), which is much better than the unmodified bentonite. The experimental data fitted well into Langmuir adsorption isotherm and follows pseudo-first-order kinetics. Thermodynamic study suggests that fluoride adsorption on MB is reasonably spontaneous and an endothermic process. MB showed significantly high fluoride removal in synthetic water as compared to field water. Desorption study of MB suggest that almost all the loaded fluoride was desorbed ( approximately 97%) using 1M NaOH solution however maximum fluoride removal decreases from 95.47 to 73 (%) after regeneration. From the experimental results, it may be inferred that chemical modification enhances the fluoride removal efficiency of bentonite and it works as an effective adsorbent for defluoridation of water. Copyright 2010 Elsevier B.V. All rights reserved.

Time-Resolved Infrared Reflectance Studies of the Dehydration-Induced Transformation of Uranyl Nitrate Hexahydrate to the Trihydrate Form

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Timothy J.; Sweet, Lucas E.; Meier, David E.

Uranyl nitrate is a key species in the nuclear fuel cycle. However, this species is known to exist in different states of hydration, including the hexahydrate ([UO2(NO3)2(H2O)6] often called UNH), the trihydrate [UO2(NO3)2(H2O)3 or UNT], and in very dry environments the dihydrate form [UO2(NO3)2(H2O)2]. Their relative stabilities depend on both water vapor pressure and temperature. In the 1950s and 1960s the different phases were studied by infrared transmission spectroscopy, but were limited both by instrumental resolution and by the ability to prepare the samples for transmission. We have revisited this problem using time-resolved reflectance spectroscopy, which requires no sample preparationmore » and allows dynamic analysis while the sample is exposed to a flow of N2 gas. Samples of known hydration state were prepared and confirmed via X-ray diffraction patterns of known species. In reflectance mode the hexahydrate UO2(NO3)2(H2O)6 has a distinct uranyl asymmetric stretch band at 949.0 cm-1 that shifts to shorter wavelengths and broadens as the sample desiccates and recrystallizes to the trihydrate, first as a shoulder growing in on the blue edge but ultimately results in a doublet band with reflectance peaks at 966 and 957 cm-1. The data are consistent with transformation from UNH to UNT as UNT has two inequivalent UO22+ sites. The dehydration of UO2(NO3)2(H2O)6 to UO2(NO3)2(H2O)3 is both a structural and morphological change that has the lustrous lime green UO2(NO3)2(H2O)6 crystals changing to the matte greenish yellow of the trihydrate solid. The phase transformation and crystal structures were confirmed by density functional theory calculations and optical microscopy methods, both of which showed a transformation with two distinct sites for the uranyl cation in the trihydrate, with but one in the hexahydrate.« less

Time-resolved infrared reflectance studies of the dehydration-induced transformation of uranyl nitrate hexahydrate to the trihydrate form

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Timothy J.; Sweet, Lucas E.; Meier, David E.

2015-09-08

Uranyl nitrate is a key species in the nuclear fuel cycle. However, this species is known to exist in different states of hydration, including the hexahydrate ([UO 2(NO 3) 2(H 2O) 6] often called UNH), the trihydrate [UO 2(NO 3) 2(H 2O) 3 or UNT], and in very dry environments the dihydrate form [UO 2(NO 3) 2(H 2O) 2]. Their relative stabilities depend on both water vapor pressure and temperature. In the 1950s and 1960s, the different phases were studied by infrared transmission spectroscopy but were limited both by instrumental resolution and by the ability to prepare the samples formore » transmission. We have revisited this problem using time-resolved reflectance spectroscopy, which requires no sample preparation and allows dynamic analysis while the sample is exposed to a flow of N 2 gas. Samples of known hydration state were prepared and confirmed via X-ray diffraction patterns of known species. In reflectance mode the hexahydrate UO 2(NO 3) 2(H 2O) 6 has a distinct uranyl asymmetric stretch band at 949.0 cm –1 that shifts to shorter wavelengths and broadens as the sample desiccates and recrystallizes to the trihydrate, first as a shoulder growing in on the blue edge but ultimately results in a doublet band with reflectance peaks at 966 and 957 cm –1. The data are consistent with transformation from UNH to UNT as UNT has two inequivalent UO 2 2+ sites. The dehydration of UO 2(NO 3) 2(H 2O) 6 to UO 2(NO 3) 2(H 2O) 3 is both a structural and morphological change that has the lustrous lime green UO 2(NO 3) 2(H 2O) 6 crystals changing to the matte greenish yellow of the trihydrate solid. As a result, the phase transformation and crystal structures were confirmed by density functional theory calculations and optical microscopy methods, both of which showed a transformation with two distinct sites for the uranyl cation in the trihydrate, with only one in the hexahydrate.« less

Determination of water-soluble ions in soils from the dry valleys of Antarctica

NASA Technical Reports Server (NTRS)

Bustin, R.

1981-01-01

The soil chemistry of the dry valleys of Antarctica was studied. These valleys furnish a terrestrial analog for the surface of Mars. The abundance of the water-soluble ions magnesium, calcium, potassium, sodium chloride, and nitrate in soil samples was determined. All samples examined contained water-soluble salts reflecting the aridity of the area. Movement of salts to low-lying areas was verified. Upward ionic migration was evident in all core samples. Of all cations observed, sodium showed the greatest degree of migration.

Selective Methylmagnesium Chloride Mediated Acetylations of Isosorbide: A Route to Powerful Nitric Oxide Donor Furoxans.

PubMed

Kielty, Patrick; Smith, Dennis A; Cannon, Peter; Carty, Michael P; Kennedy, Michael; McArdle, Patrick; Singer, Richard J; Aldabbagh, Fawaz

2018-04-26

Isosorbide was functionalized with furoxan for the first time to give adducts that release nitric oxide up to 7.5 times faster than the commercial vasodilator, isosorbide-5-mononitrate (Is5N). The synthesis was facilitated by MeMgCl-mediated selective acetylation of isosorbide or selective deacetylation of isosorbide-2,5-diacetate, which was rationalized in terms of a more stable 5-alkoxide magnesium salt using DFT. Isosorbide-furoxans are safer to handle than Is5N due to greater thermal stability.

Metal Organic Framework-Metal Oxide Composites for Toxic Gas Adsorption and Sensing

DTIC Science & Technology

2014-05-01

zeolitic imidazolate framework Zn(NO3)2 zinc nitrate ZrCl4 zirconium chloride 21 SUMMARY Metal organic frameworks (MOFs) and metal oxide-MOF...performed better for the other gases and conditions. Compared to the standard adsorbents BPL carbon and zeolite 13X, the cobalt and magnesium MOF...g)24 and zeolite 5A (1.25 mmol/g),25 compared to 3.5 mmol/g for Ni-MOF-74, 4 mmol/g for Mg-MOF-74, and 6 mmol/g for Co-MOF-74. Mg-MOF-74 shows the

Data on snow chemistry of the Cascade-Sierra Nevada Mountains

USGS Publications Warehouse

Laird, L.B.; Taylor, Howard E.; Lombard, R.E.

1986-01-01

Snow chemistry data were measured for solutes found in snow core samples collected from the Cascade-Sierra Nevada Mountains from late February to mid-March 1983. The data are part of a study to assess geographic variations in atmospheric deposition in Washington, Oregon, and California. The constituents and properties include pH and concentrations of hydrogen ion, calcium, magnesium, sodium, potassium, chloride, sulfate, nitrate, fluoride, phosphate, ammonium, iron, aluminum, manganese, copper, cadmium, lead, and dissolved organic carbon. Concentrations of arsenic and bromide were below the detection limit. (USGS)

An analysis of the chemical and microbiological quality of ground water from boreholes and shallow wells in Zimbabwe

NASA Astrophysics Data System (ADS)

Moyo, N. A. G.

Groundwater from boreholes and shallow wells is a major source of drinking water in most rural areas of Zimbabwe. The quality of groundwater has been taken for granted and the status and the potential threats to groundwater quality have not been investigated on a large scale in Zimbabwe. A borehole and shallow well water quality survey was undertaken between January, 2009 and February, 2010 to determine the chemical and microbial aspects of drinking water in three catchment areas. Groundwater quality physico-chemical indicators used in this study were nitrates, chloride, water hardness, conductivity, alkalinity, total dissolved solids, iron, magnesium, manganese, potassium, calcium, fluoride, sulphates, sodium and pH. The microbiological indicators were total coliforms, faecal coliforms and heterotrophs. Principal component analysis (PCA) showed that most of the variation in ground water quality in all catchment areas is accounted for by Total Dissolved Solids (TDS), electrical conductivity (EC), sodium, bicarbonate and magnesium. The principal dissolved constituents in ground water are in the form of electrically charged ions. Nitrate is a significant problem as the World Health Organization recommended levels were exceeded in 36%, 37% and 22% of the boreholes in the Manyame, Mazowe and Gwayi catchment areas respectively. The nitrate levels were particularly high in commercial farming areas. Iron and manganese also exceeded the recommended levels. The probable source of high iron levels is the underlying geology of the area which is dominated by dolerites. Dolerites weather to give soils rich in iron and other mafic minerals. The high level of manganese is probably due to the lithology of the rock as well as mining activity in some areas. Water hardness is a problem in all catchment areas, particularly in the Gwayi catchment area where a value of 2550 mg/l was recorded in one borehole. The problems with hard water use are discussed. Chloride levels exceeded the recommended levels in a few areas under irrigation. Most of the chloride is probably from agricultural activity particularly the application of potassium chloride. Fluoride levels were particularly elevated in the Gwayi catchment area and this is because of the geology of the area. There was no evidence of microbial contamination in all the boreholes sampled as the total coliform, faecal coliforms, heterotrophs count was nil. However, severe microbial contamination was found in the wells especially those in clay areas.

Production, purification and characterization of halophilic organic solvent tolerant protease from marine crustacean shell wastes and its efficacy on deproteinization.

PubMed

Maruthiah, Thirumalai; Somanath, Beena; Jasmin, Jebamonydhas Vijila; Immanuel, Grasian; Palavesam, Arunachalam

2016-12-01

The quantum of marine fish wastes produced by fish processing industries has necessitated to search new methods for its disposal. Hence, this study is focused on production and purification of halophilic organic solvent tolerant protease (HOSP) from marine Alcaligenes faecalis APCMST-MKW6 using marine shell wastes as substrate. The candidate bacterium was isolated from the marine sediment of Manakudi coast and identified as A. faecalis APCMST-MKW6. The purified protease showed 16.39-fold purity, 70.34 U/mg specific activity with 21.67 % yield. The molecular weight of the purified alkaline protease was 49 kDa. This purified protease registered maximum activity at pH 9 and it was stable between pH 8-9 after 1.30 h of incubation. The optimum temperature registered was 60 °C and it was stable between 50 and 60 °C even after 1.30 h of incubation. This enzyme also showed maximum activity at 20 % NaCl concentration. Further, manganese chloride, magnesium chloride, calcium chloride and barium chloride influenced this enzyme activity remarkably and it was also found to be enhanced by many of the tested surfactants and solvents. The candidate bacterium effectively deproteinized the shrimp shell waste compared to the other tested crustaceans shell wastes and also attained maximum antioxidant activity.

TRPM7 is regulated by halides through its kinase domain

PubMed Central

Yu, Haijie; Zhang, Zheng; Lis, Annette; Penner, Reinhold; Fleig, Andrea

2013-01-01

Transient receptor potential melastatin 7 (TRPM7) is a divalent-selective cation channel fused to an atypical α-kinase. TRPM7 is a key regulator of cell growth and proliferation, processes accompanied by mandatory cell volume changes. Osmolarity-induced cell volume alterations regulate TRPM7 through molecular crowding of solutes that affect channel activity, including magnesium (Mg2+), Mg-nucleotides and a further unidentified factor. Here, we assess whether chloride and related halides can act as negative feedback regulators of TRPM7. We find that chloride and bromide inhibit heterologously expressed TRPM7 in synergy with intracellular Mg2+ ([Mg2+]i) and this is facilitated through the ATP-binding site of the channel’s kinase domain. The synergistic block of TRPM7 by chloride and Mg2+ is not reversed during divalent-free or acidic conditions, indicating a change in protein conformation that leads to channel inactivation. Iodide has the strongest inhibitory effect on TRPM7 at physiological [Mg2+]i. Iodide also inhibits endogenous TRPM7-like currents as assessed in MCF-7 breast cancer cells, where upregulation of SLC5A5 sodium-iodide symporter enhances iodide uptake and inhibits cell proliferation. These results indicate that chloride could be an important factor in modulating TRPM7 during osmotic stress and implicate TRPM7 as a possible molecular mechanism contributing to the anti-proliferative characteristics of intracellular iodide accumulation in cancer cells. PMID:23471296

Study to define and verify the personal oral hygiene requirements for extended manned space flight: Oral physiology and microbiology in Skylab manned space missions

NASA Technical Reports Server (NTRS)

Brown, L. R.

1975-01-01

Methods for metabolic fingerprinting of pathogenic oral bacteria were developed and the effects of Skylab missions on salivary electrolyte levels were studied. High resolution gas liquid chromatographic (GLC) and pyrolysis-GLC procedures were used to obtain metabolic profiles of closely related bacteria associated with dental caries and periodontal disease. It was found that the GLC procedures provide a practical and reproducible means of obtaining metabolic markers for identifying closely related strains of these organisms. Fractions of stimulated whole saliva samples from the prime and back-up crews of the three Skylab missions were used to measure salivary electrolyte concentrations. All the electrolytes previously reported as having increased in urine and feces during the missions were assessed. Sodium, potassium, calcium, magnesium, phosphorous and chloride were studied. A decrease in sodium and an increase in magnesium were observed, but the mineral imbalances attributable to the mission-related increases in urinary electrolytes were not detected.

Chemical treatment of wastewater from flue gas desulphurisation

NASA Astrophysics Data System (ADS)

Pasiecznik, Iwona; Szczepaniak, Włodzimierz

2017-11-01

The article presents results of laboratory tests of removing boron and arsenium from non-ideal solutions using double-layered magnesium/aluminium hydroxides (Mg/Al Double-Layered Hydroxide - DLH) produced with nitrate-chloride method. In research, wastewater from an installation for flue gas desulfurization was examined. Double-layered hydroxides are perfect absorbents for anionic compounds. The research proved high effectiveness of preparation with reference to arsenium, as well as confirmed the effect of presence of sulfatic and arsenate ions on the effectiveness of boron removal. On the basis of research on absorption kinetics a theoretical dose of DLH/NO3-Cl/M preparation was calculated and compared with a dose that ensures emimination of boron below the limit standarized by the national regulations. Application of double-layered magnesium/aluminium hydroxides for boron elimination from industrial wastewater requires significantly higher doses of preparation than those calculated in model investigations. It is due to the priority of removal of multivalent ions, such as sulfatic, arsenate or phosphate ions, by DLH/NO3-Cl/M.

The relative stress-corrosion-cracking susceptibility of candidate aluminum-lithium alloys for aerospace applications

NASA Technical Reports Server (NTRS)

Pizzo, P. P.

1982-01-01

Stress corrosion tests of Al-Li-Cu powder metallurgy alloys are described. Alloys investigated were Al-2.6% Li-1.4% and Al-2.6% Li-1.4% Cu-1.6% Mg. The base properties of the alloys were characterized. Process, heat treatment, and size/orientational effects on the tensile and fracture behavior were investigated. Metallurgical and electrochemical conditions are identified which provide reproducible and controlled parameters for stress corrosion evaluation. Preliminary stress corrosion test results are reported. Both Al-Li-Cu alloys appear more susceptible to stress corrosion crack initiation than 7075-T6 aluminum, with the magnesium bearing alloy being the most susceptible. Tests to determine the threshold stress intensity for the base and magnesium bearing alloys are underway. Twelve each, bolt loaded DCB type specimens are under test (120 days) and limited crack growth in these precracked specimens has been observed. General corrosion in the aqueous sodium chloride environment is thought to be obscuring results through crack tip blunting.

RENAL TUBULAR TRANSPORT OF INORGANIC DIVALENT IONS BY THE AGLOMERULAR MARINE TELEOST, LOPHIUS AMERICANUS

PubMed Central

Berglund, Fredrik; Forster, Roy P.

1958-01-01

A characterization was attempted of the mechanisms involved in the tubular transport of inorganic divalent ions by the aglomerular kidney of Lophius, attention being paid particularly to the possible existence of transport maxima (Tm) and to competition for transport among related substances undergoing tubular excretion. Excretory rates of divalent ions in non-treated fish during standard laboratory conditions paralleled spontaneous changes in urine flow. Tm rates of excretion were reached for magnesium, sulfate, and thiosulfate with corresponding plasma levels of 2 to 5, 5 to 17, and 4 to 12 µM/ml. respectively. Elevation of magnesium chloride levels in plasma markedly depressed calcium excretion; sodium thiosulfate similarly depressed sulfate excretion. Experimental observations suggest the existence of a transport system for divalent cations separate from another for divalent anions. Within each transport system the ion with the higher excretion rate depressed competitively transfer of the other ion. Neither system was influenced by probenecid (benemid) in doses which markedly depressed the simultaneous excretion rate of p-aminohippuric acid. PMID:13491814

Lactobacillus plantarum CCFM639 alleviates aluminium toxicity.

PubMed

Yu, Leilei; Zhai, Qixiao; Liu, Xiaoming; Wang, Gang; Zhang, Qiuxiang; Zhao, Jianxin; Narbad, Arjan; Zhang, Hao; Tian, Fengwei; Chen, Wei

2016-02-01

Aluminium (Al) is the most abundant metal in the earth's crust. Al exposure can cause a variety of adverse physiological effects in humans and animals. Our aim was to demonstrate that specific probiotic bacteria can play a special physiologically functional role in protection against Al toxicity in mice. Thirty strains of lactic acid bacteria (LAB) were tested for their aluminium-binding ability, aluminium tolerance, their antioxidative capacity, and their ability to survive the exposure to artificial gastrointestinal (GI) juices. Lactobacillus plantarum CCFM639 was selected for animal experiments because of its excellent performance in vitro. Forty mice were divided into four groups: control, Al only, Al plus CCFM639, and Al plus deferiprone (DFP). CCFM639 was administered at 10(9) CFU once daily for 10 days, followed by a single oral dose of aluminium chloride hexahydrate at 5.14 mg aluminium (LD50) for each mouse. The results showed that CCFM639 treatment led to a significant reduction in the mortality rates with corresponding decrease in intestinal aluminium absorption and in accumulation of aluminium in the tissues and amelioration of hepatic histopathological damage. This probiotic treatment also resulted in alleviation of hepatic, renal, and cerebral oxidative stress. The treatment of L. plantarum CCFM639 has potential as a therapeutic dietary strategy against acute aluminium toxicity.

Electrocatalytic H2 production from seawater over Co, N-codoped nanocarbons.

PubMed

Gao, Shuang; Li, Guo-Dong; Liu, Yipu; Chen, Hui; Feng, Liang-Liang; Wang, Yun; Yang, Min; Wang, Dejun; Wang, Shan; Zou, Xiaoxin

2015-02-14

One of the main barriers blocking sustainable hydrogen production is the use of expensive platinum-based catalysts to produce hydrogen from water. Herein we report the cost-effective synthesis of catalytically active, nitrogen-doped, cobalt-encased carbon nanotubes using inexpensive starting materials-urea and cobalt chloride hexahydrate (CoCl2·6H2O). Moreover, we show that the as-obtained nanocarbon material exhibits a remarkable electrocatalytic activity toward the hydrogen evolution reaction (HER); and thus it can be deemed as a potential alternative to noble metal HER catalysts. In particular, the urea-derived carbon nanotubes synthesized at 900 °C (denoted as U-CNT-900) show a superior catalytic activity for HER with low overpotential and high current density in our study. Notably also, U-CNT-900 has the ability to operate stably at all pH values (pH 0-14), and even in buffered seawater (pH 7). The possible synergistic effects between carbon-coated cobalt nanoparticles and the nitrogen dopants can be proposed to account for the HER catalytic activity of U-CNT-900. Given the high natural abundance, ease of synthesis, and high catalytic activity and durability in seawater, this U-CNT-900 material is promising for hydrogen production from water in industrial applications.

Single photon counting fluorescence lifetime detection of pericellular oxygen concentrations

NASA Astrophysics Data System (ADS)

Hosny, Neveen A.; Lee, David A.; Knight, Martin M.

2012-01-01

Fluorescence lifetime imaging microscopy offers a non-invasive method for quantifying local oxygen concentrations. However, existing methods are either invasive, require custom-made systems, or show limited spatial resolution. Therefore, these methods are unsuitable for investigation of pericellular oxygen concentrations. This study describes an adaptation of commercially available equipment which has been optimized for quantitative extracellular oxygen detection with high lifetime accuracy and spatial resolution while avoiding systematic photon pile-up. The oxygen sensitive fluorescent dye, tris(2,2'-bipyridyl)ruthenium(II) chloride hexahydrate [Ru(bipy)3]2+, was excited using a two-photon excitation laser. Lifetime was measured using a Becker & Hickl time-correlated single photon counting, which will be referred to as a TCSPC card. [Ru(bipy)3]2+ characterization studies quantified the influences of temperature, pH, cellular culture media and oxygen on the fluorescence lifetime measurements. This provided a precisely calibrated and accurate system for quantification of pericellular oxygen concentration based on measured lifetimes. Using this technique, quantification of oxygen concentrations around isolated viable chondrocytes, seeded in three-dimensional agarose gel, revealed a subpopulation of cells that exhibited significant spatial oxygen gradients such that oxygen concentration reduced with increasing proximity to the cell. This technique provides a powerful tool for quantifying spatial oxygen gradients within three-dimensional cellular models.

Single photon counting fluorescence lifetime detection of pericellular oxygen concentrations.

PubMed

Hosny, Neveen A; Lee, David A; Knight, Martin M

2012-01-01

Fluorescence lifetime imaging microscopy offers a non-invasive method for quantifying local oxygen concentrations. However, existing methods are either invasive, require custom-made systems, or show limited spatial resolution. Therefore, these methods are unsuitable for investigation of pericellular oxygen concentrations. This study describes an adaptation of commercially available equipment which has been optimized for quantitative extracellular oxygen detection with high lifetime accuracy and spatial resolution while avoiding systematic photon pile-up. The oxygen sensitive fluorescent dye, tris(2,2'-bipyridyl)ruthenium(II) chloride hexahydrate [Ru(bipy)(3)](2+), was excited using a two-photon excitation laser. Lifetime was measured using a Becker & Hickl time-correlated single photon counting, which will be referred to as a TCSPC card. [Ru(bipy)(3)](2+) characterization studies quantified the influences of temperature, pH, cellular culture media and oxygen on the fluorescence lifetime measurements. This provided a precisely calibrated and accurate system for quantification of pericellular oxygen concentration based on measured lifetimes. Using this technique, quantification of oxygen concentrations around isolated viable chondrocytes, seeded in three-dimensional agarose gel, revealed a subpopulation of cells that exhibited significant spatial oxygen gradients such that oxygen concentration reduced with increasing proximity to the cell. This technique provides a powerful tool for quantifying spatial oxygen gradients within three-dimensional cellular models.

[Efficacy of oral calcium and/or sodium phosphate in the prevention of parturient paresis in cows].

PubMed

Braun, U; Bryce, B; Liesegang, A; Hässig, M; Bleul, U

2008-07-01

The goal of this study was to investigate the efficacy of calcium chloride, sodium phosphate or a combination of these two substances administered orally immediately postpartum for the prevention of parturient paresis in cows. Thirty-two cows that had had parturient paresis at the previous calving, and in which serum biochemistry had shown hypocalcaemia and hypophosphataemia, were used in the study. The cows were transferred to the Department of Farm Animals, University of Zurich, five days before their expected due dates. On a randomized trial, the cows were given calcium chloride, sodium phosphate, both substances or no treatment (controls) via a stomach tube immediately postpartum and 12 hours later. The cows were monitored for 96 hours during which time blood was collected on a regular basis for the determination of total calcium, ionized calcium, inorganic phosphorus and magnesium concentrations. Of the 32 cows treated, 19 (59%) had parturient paresis and 13 (41%) did not. The incidence of parturient paresis did not differ significantly among the groups although there was a tendency for a lower incidence in cows treated with both calcium chloride and sodium phosphate. The various treatments had no apparent effect on serum calcium concentration. The concentration of inorganic phosphorus increased significantly in cows treated with sodium phosphate compared with the controls. The results of this study showed that cows treated with both calcium chloride and sodium phosphate orally tended to have a lower incidence of parturient paresis. Further investigation into multiple administrations of oral calcium chloride and sodium phosphate, started before parturition, for the prevention of parturient paresis is required.

Stimulation of cell division in the rat by NaCl, KCl, MgCl2, and CaCl2, and inhibition of the sodium chloride effect on the glandular stomach by ascorbic acid and beta-carotene.

PubMed

Lugli, S M; Lutz, W K

1999-01-01

Three questions associated with the stimulation of cell division by chloride salts have been investigated: (i) whether cations other than sodium show a similar effect, (ii) whether vitamins can have a preventive activity, and (iii) whether subchronic treatment with sodium chloride in the diet is also effective. Male Fischer 344 rats were given solutions of the chloride salts of sodium, potassium, magnesium, and calcium by oral gavage. Water was used for control. After 4 h, a 24-h osmotic minipump containing 5-bromo-2'-deoxyuridine was implanted subcutaneously. The forestomach and glandular stomach, as well as liver and bladder were analyzed immunohistochemically 24 h later for the proportion of cells in S phase as an indicator of the rate of replicative DNA synthesis. For both the forestomach and the glandular stomach, potassium was as potent as sodium, and the divalent cations Mg and Ca were even more potent on a molar basis. Supplementation of the diet with ascorbic acid (2 g/kg food) or beta-carotene (12.5 mg/kg food) for 1 week before gavage of the sodium chloride solution resulted in an inhibition of the stimulation of cell division. A putative tumor-chemopreventive activity of the two vitamins might therefore not only rely on their antioxidative properties but may include effects on the cell cycle. A 4-week treatment with a sodium chloride supplement in the diet (2% and 4% supplement) resulted in a significant stimulation of cell division not only in both parts of the stomach and in the bladder (with the 4% supplement) but also in the liver (even with the 2% supplement). Sodium-chloride-stimulated cell turnover therefore is a sustained effect.

Composition of minerals and trace elements at Mamasani thermal source: A possible preventive treatment for some skin diseases.

PubMed

Hamidizadeh, Nasrin; Simaeetabar, Shima; Handjani, Farhad; Ranjbar, Sara; Moghadam, Mohammad Gohari; Parvizi, Mohammad Mahdi

2017-01-01

Some skin diseases are incurable and modern medicine can only control them. In addition, alternative treatment remedies including balneotherapy can be effective in improving skin conditions. However, there are only a limited number of studies on particular mineral or trace elements of mineral sources that have been identified in Iran. In this respect, the amount of minerals and trace elements in Mamasani thermal source, Fars Province, Iran, was measured using electrochemical, titration, and spectrophotometric methods and evaluated. The amount of minerals and trace elements in Mamasani thermal source, Fars Province, Iran, was measured using electrochemical, titration, and spectrophotometric methods. The concentrations of natural gases such as H 2 S and NO 3 in Mamasani thermal source were measured to be 22.10 mg/L and 42.79 mg/L, respectively. The source also contained major ions such as chloride, sulfate, sodium, calcium, magnesium, potassium, and carbonate. Due to the high concentration of chloride, sulfate, and sodium ions in comparison with other major ions, the water source is also classified as sulfide water. The existing trace elements in this thermal water source are iron, zinc, copper, selenium, cobalt, chromium, boron, silisium, aluminum, magnesium, and molybdenum. We concluded that bathing in this source could be beneficial. As nitrate concentration is close to the highest standard concentration for drinking water, it can be used in chronic dermatitis, psoriasis, burns, and allergy. Furthermore, the antibacterial and antifungal effects of sulfur-containing water in this source can be helpful in the treatment of leg ulcers, tinea versicolor, tinea corporis, and tinea capitis.

Selective separation of phosphate and fluoride from semiconductor wastewater.

PubMed

Warmadewanthi, B; Liu, J C

2009-01-01

Hydrofluoric acid (HF) and phosphoric acid (H(3)PO(4)) are widely used in semiconductor industry for etching and rinsing purposes. Consequently, significant amount of wastewater containing phosphate and fluoride is generated. Selective separation of phosphate and fluoride from the semiconductor wastewater, containing 936 mg/L of fluoride, 118 mg/L of phosphate, 640 mg/L of sulfate, and 26.7 mg/L of ammonia, was studied. Chemical precipitation and flotation reactions were utilized in the two-stage treatment processes. The first-stage reaction involved the addition of magnesium chloride (MgCl(2)) to induce selective precipitation of magnesium phosphate. The optimal condition was pH 10 and molar ratio, [Mg(2 + )]/[(PO(4) (3-))], of 3:1, and 66.2% of phosphate was removed and recovered as bobierrite (Mg(3)(PO(4))(2).8H(2)O). No reaction was found between MgCl(2) and fluoride. Calcium chloride (CaCl(2)) was used in the second-stage reaction to induce precipitation of calcium fluoride and calcium phosphate. The optimum molar ratio, [Ca(2 + )]/[F(-)], was 0.7 at pH 10, and residual fluoride concentration of 10.7 mg/L and phosphate concentration of lower than 0.5 mg/L was obtained. Thermodynamic equilibrium was modeled with PHREEQC and compared with experimental results. Sodium dodecylsulfate (SDS) was an effective collector for subsequent solid-liquid removal via dispersed air flotation (DiAF). The study demonstrated that phosphate can be selectively recovered from the wastewater. Potential benefits include recovery of phosphate for reuse, lower required dosage of calcium for fluoride removal, and less amount of CaF(2) sludge.

Geochemistry of and radioactivity in ground water of the Highland Rim and Central Basin aquifer systems, Hickman and Maury counties, Tennessee

USGS Publications Warehouse

Hileman, G.E.; Lee, R.W.

1993-01-01

A reconnaissance of the geochemistry of and radioactivity in ground water from the Highland Rim and Central Basin aquifer systems in Hickman and Maury Counties, Tennessee, was conducted in 1989. Water in both aquifer systems typically is of the calcium or calcium magnesium bicarbonate type, but concentrations of calcium, magnesium, sodium, potassium, chloride, and sulfate are greater in water of the Central Basin system; differences in the concentrations are statistically significant. Dissolution of calcite, magnesium-calcite, dolomite, and gypsum are the primary geochemical processes controlling ground-water chemistry in both aquifer systems. Saturation-state calculations using the computer code WATEQF indicated that ground water from the Central Basin system is more saturated with respect to calcite, dolomite, and gypsum than water from the Highland Rim system. Geochemical environments within each aquifer system are somewhat different with respect to dissolution of magnesium-bearing minerals. Water samples from the Highland Rim system had a fairly constant calcium to magnesium molar ratio, implying congruent dissolution of magnesium-bearing minerals, whereas water samples from the Central Basin system had highly variable ratios, implying either incongruent dissolution or heterogeneity in soluble constituents of the aquifer matrix. Concentrations of radionuclides in water were low and not greatly different between aquifer systems. Median gross alpha activities were 0.54 picocuries per liter in water from each system; median gross beta activities were 1.1 and 2.3 picocuries per liter in water from the Highland Rim and Central Basin systems, respectively. Radon-222 concentrations were 559 and 422 picocuries per liter, respectively. Concentrations of gross alpha and radium in all samples were substantially less than Tennessee?s maximum permissible levels for community water-supply systems. The data indicated no relations between concentrations of dissolved radionuclides (uranium, radium-226, radium-228, radon-222, gross alpha, and gross beta) and any key indicators of water chemistry, except in water from the Highland Rim system, in which radon-222 was moderately related to pH and weakly related to dissolved magnesium. The only relation among radiochemical constituents indicated by the data was between radium-226 and gross alpha activity; this relation was indicated for water from both aquifer systems.

Thiopental and halothane dose-sparing effects of magnesium sulphate in dogs.

PubMed

Anagnostou, Tilemahos L; Savvas, Ioannis; Kazakos, George M; Raptopoulos, Dimitris; Ververidis, Haralabos; Roubies, Nikolaos

2008-03-01

To evaluate the effect of pre- and intraoperatively administered magnesium sulphate (MgSO(4)) on the induction dose of thiopental and of halothane for maintenance of anaesthesia in dogs undergoing ovariohysterectomy (OHE). Prospective, double-blind, randomized, placebo-controlled study. Forty-six healthy, ASA physical status 1 dogs, scheduled for elective OHE. The dogs were randomly assigned to receive a bolus of 50 mg kg(-1) MgSO(4) intravenously (IV), just before induction of anaesthesia, followed by a constant rate infusion (CRI) of 12 mg kg(-1) hour(-1) MgSO(4) intraoperatively (group Mg, n = 27) or a placebo bolus and CRI of 0.9% sodium chloride (NaCl) (group C, n = 19), approximately 30 minutes after premedication with acepromazine (0.05 mg kg(-1), intramuscularly, IM) and carprofen (4 mg kg(-1), subcutaneously, SC). Anaesthesia was induced with thiopental administered to effect and maintained with halothane in oxygen. End-tidal halothane (ET(hal)) was adjusted to achieve adequate depth of anaesthesia. Blood samples were obtained pre- and postoperatively for measurement of total serum magnesium concentration. The mean dose of thiopental was statistically lower (p < 0.0005) and the mean standardized ET(hal) concentration and end-tidal carbon dioxide partial pressure (Pe'CO(2)) areas under the curve were statistically smaller (p < 0.0005 and 0.014 respectively) in group Mg. Postoperatively the mean total serum magnesium concentration was statistically higher than the preoperative value (p < 0.0005) in group Mg, but not in group C. Nausea, associated with the MgSO(4) bolus injection, was observed in six dogs in group Mg, two of which vomited prior to induction of anaesthesia. Magnesium sulphate administration reduced the induction dose of thiopental and ET(hal) concentration for maintenance of anaesthesia in dogs undergoing OHE. Observed side effects were nausea and vomiting.

Presence and dehydration of ikaite, calcium carbonate hexahydrate, in frozen shrimp shell.

PubMed

Mikkelsen, A; Andersen, A B; Engelsen, S B; Hansen, H C; Larsen, O; Skibsted, L H

1999-03-01

Ikaite, calcium carbonate hexahydrate, has by means of X-ray diffraction analyses of frozen samples been identified as the mineral component of the white spots formed in the shell of frozen shrimp during storage. When the shrimp thaw and the shell material is dried and kept at room temperature, ikaite rapidly transforms into a mixture of anhydrous calcium carbonate forms. X-ray diffraction analyses and Raman spectra of synthetic ikaite as well as the dehydration product confirm the assignments, and the rate constant for dehydration is approximately 7 x 10(-)(4) s(-)(1) at ambient temperature. Differential scanning calorimetry showed that dehydration of synthetic ikaite is an entropy-driven, athermal process and confirms that a single first-order reaction is rate-determining. Ikaite is found to be stable in aqueous solution at temperatures below 5 degrees C and in the shell of frozen shrimps but decomposes on thawing to form anhydrous calcium carbonates.

Coal resources of New Mexico

USGS Publications Warehouse

Read, Charles Brian; Duffner, R.T.; Wood, G.H.; Zapp, A.D.

1950-01-01

A study of water quality degradation due to brine contamination was made in an area of about 1,700 sq mi in east-central Oklahoma. The study area coincides in part with the outcrop of the Vamoosa-Ada aquifer of Pennsylvanian age. Water samples collected from 180 wells completed in the Vamoosa-Ada aquifer and at 167 sites from streams draining the Vamoosa-Ada aquifer show scattered occurrences of water quality degradation by brine. Degradation of water quality by brine is indicated where: (1) chloride concentration is > or = to 400 mg/L; (2) bromide concentration is > or = 2 mg/L; (3) the ratio of sodium plus chloride to dissolved solids is > or = 0.64. Ratios of secondary importance that also indicate water quality degradation by brine in the area are: (1) a ratio of lithium to bromide < or = 0.01, when the chloride concentration is > or = 400 mg/L; (2) a sodium/chloride ratio of about 0.46; (3) a sodium/bromide ratio of about 92; and (4) a bromide/chloride ratio of about 0.0048. Values for bromide, lithium, strontium, dissolved solids, calcium, magnesium, sodium, chloride, and sulfate concentrations were subjected to analysis of variance based on use of the index values in partition data sets. The analysis of variance showed the significance of the indexes for all constituents except sulfate. The two most reliable brine indicators are chloride and bromide. Statistically, chloride is a slightly more reliable index than bromide. The developed indexes can be used to indicate water quality degradation by brine. Accuracy is improved if both indexes are used. When geophysical logs from 133 pairs of oil and gas wells were analyzed, data from 5 pairs of wells indicated a possible rise in the interface between fresh water and salt water in the Vamoosa-Ada aquifer. Therefore , any rise of the interface is local rather than regional. The criteria developed in this study indicate that brine has degraded water quality at 63 sites on streams draining the Vamoosa-Ada aquifer, at 15 water wells completed in the Vamoosa-Ada aquifer, and at 5 oil and gas wells penetrating the Vamoosa-Ada aquifer. (Author 's abstract)

Water-quality data of soil water from three watersheds, Shenandoah National Park, Virginia, 1999-2000

USGS Publications Warehouse

Rice, Karen C.; Maben, Suzanne W.; Webb, James R.

2001-01-01

Data on the chemical composition of soil-water samples were collected quarterly from three watersheds in Shenandoah National Park, Virginia, from September 1999 through July 2000. The soil-water samples were analyzed for specific conductance and concentrations of sodium, potassium, calcium, magnesium, ammonium, chloride, nitrate, sulfate, acid-neutralizing capacity, silica, and total monomeric aluminum. The soil-water data presented in this report can be used to support water-quality modeling of the response of streams to episodic acidification. Laboratory analytical data as well as laboratory quality-assurance information also are presented.

Complete regioselective addition of grignard reagents to pyrazine N-oxides, toward an efficient enantioselective synthesis of substituted piperazines.

PubMed

Andersson, Hans; Banchelin, Thomas Sainte-Luce; Das, Sajal; Gustafsson, Magnus; Olsson, Roger; Almqvist, Fredrik

2010-01-15

A conceptually new one-pot strategy for the synthesis of protected substituted piperazines via the addition of Grignard reagents to pyrazine N-oxides is presented. This strategy is high yielding (33-91% over three steps), step-efficient, and fast. The synthesized N,N-diprotected piperazines are convenient to handle and allow for orthogonal deprotection at either nitrogen for selective transformations. In addition, this is a synthetic route to enantiomerically enriched piperazines by using a combination of phenyl magnesium chloride and (-)-sparteine, which resulted in enantiomeric excesses up to 83%.

Microorganisms in the deposits of cold carbon mineral waters of the Russian Far East and their habitats

NASA Astrophysics Data System (ADS)

Kalitina, E. G.; Kharitonova, N. A.; Kuzmina, T. V.; Chelnokov, G. A.

2018-01-01

Study of the chemical composition of carbon mineral waters has shown the prevalence of calcium, magnesium and sodium among the cations, sulfate, nitrate and chloride ions among the anions, and ferric iron, strontium and manganese in the microelement composition. Results of the microbiological studies have revealed that carbon mineral waters contain various microorganisms that can transform the physical and chemical composition of mineral waters by interfering with geochemical cycles. The sanitary and microbiological properties of carbon mineral waters have been evaluated thus proving that the waters of Medvezhii (Shmakovskoe deposit) are microbiologically clean.

Quality of water from bedrock aquifers in the South Carolina Piedmont

USGS Publications Warehouse

Patterson, G.G.; Padgett, G.C.

1984-01-01

The geographic distributions of 12 common water-quality parameters of ground water from bedrock aquifers in the Piedmont physiographic province of South Carolina are presented in a series of maps. The maps are based on analyses by the South Carolina Department of Health and Environmental Control of water samples taken during the period 1972 to 1982 from 442 public and private wells developed in the Piedmont. In general, alkalinity, hardness, and concentrations of sodium, magnesium, and chloride were higher in the Carolina Slate Belt than they were in the other geologic belts of the Piedmont. (USGS)

Characterization of directionally solidified lead chloride

NASA Technical Reports Server (NTRS)

Singh, Narsingh Bahadur; Duval, W. M. B.; Rosenthal, B. N.

1988-01-01

A directionally solidified PbCl2 material was prepared and analyzed and subsequently used to grow single crystals. It was found that silicon, halogens, sulfur, magnesium, and phosphorus were the hardest impurities to remove by the single-pass directional freezing. Single crystals grown from the purified material displayed good scattering beam quality and showed no absorption peaks between 0.30 to 20 microns. Direct photographic observations of the solid-liquid interface at several G/V (denoting the temperature gradient and the translation velocity, respectively) ratio values showed that, as the G/V ratio decreased, the interface varied from a smooth convex surface to dendritic.

Molecular Engineering of Liquid Crystalline Polymers by Living Polymerization. 10. Influence of Molecular Weight on the Phase Transitions of Poly(Omega-((4-Cyano-4’-Biphenyl)oxy)alkyl Vinyl Ethers)s with Nonyl and Decanyl Alkyl Groups

DTIC Science & Technology

1990-10-16

washed with concentrated sulfuric acid , then with water, dried over anhydrous magnesium sulfate, refluxed over calcium hydride and freshly distilled...oxide, filtered, and fractionally distilled under reduced pressure. Trifluoromethane sulfonic acid (triflic acid , 98%, Aldrich) w s distilled under...flask. Then the flask was filled with argon, cooled to 0°C and the methylene chloride, dimethyl sulfide and triflic acid were added via a syringe. The

Phoenix's Wet Chemistry Lab

NASA Technical Reports Server (NTRS)

2008-01-01

This is an illustration of the analytical procedure of NASA's Phoenix Mars Lander's Wet Chemistry Lab (WCL) on board the Microscopy, Electrochemistry, and Conductivity Analyzer (MECA) instrument. By dissolving small amounts of soil in water, WCL can determine the pH, the abundance of minerals such as magnesium and sodium cations or chloride, bromide and sulfate anions, as well as the conductivity and redox potential.

The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

Phoenix's Wet Chemistry Lab

NASA Technical Reports Server (NTRS)

2008-01-01

This is an illustration of soil analysis on NASA's Phoenix Mars Lander's Wet Chemistry Lab (WCL) on board the Microscopy, Electrochemistry, and Conductivity Analyzer (MECA) instrument. By dissolving small amounts of soil in water, WCL will attempt to determine the pH, the abundance of minerals such as magnesium and sodium cations or chloride, bromide and sulfate anions, as well as the conductivity and redox potential.

The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

Physicochemical and adsorptive characteristics of activated carbons from waste polyester textiles utilizing MgO template method.

PubMed

Xu, Zhihua; Zhang, Daofang; Yuan, Zhihang; Chen, Weifang; Zhang, Tianqi; Tian, Danqi; Deng, Haixuan

2017-10-01

Activated carbons with high specific surface areas were produced, utilizing waste polyester textiles as carbon precursor by magnesium oxide (MgO) template method. Magnesium chloride (MgCl 2 ), magnesium citrate (MgCi), and MgO were employed as MgO precursors to prepare activated carbons (AC-MgCl 2 , AC-MgCi, and AC-MgO). Thermogravimetry-differential scanning calorimetry was conducted to investigate the pore-forming mechanism, and N 2 adsorption/desorption isotherms, XRD, SEM-EDS, TEM, FTIR and pH pzc were achieved to analyze physicochemical characteristics of the samples. The specific surface areas of AC-MgCl 2 (1173 m 2 /g) and AC-MgCi (1336 m 2 /g) were much higher than that of AC-MgO (450 m 2 /g), and the pores sizes of which were micro-mesoporous, mesoporous, and macropores, respectively, due to the formation of MgO crystal with different sizes. All activated carbons had abundant acidic oxygen groups. In addition, batch adsorption experiments were carried out to investigate the adsorptive characteristics of the prepared activated carbons toward Cr(VI). The adsorption kinetics fitted well with the pseudo-second order, and the adsorptive capacity of AC-MgCl 2 (42.55 mg/g) was higher than those of AC-MgCi (40.93 mg/g) and AC-MgO (35.87 mg/g).

Influence of artificial biological fluid composition on the biocorrosion of potential orthopedic Mg-Ca, AZ31, AZ91 alloys.

PubMed

Gu, X N; Zheng, Y F; Chen, L J

2009-12-01

The electrochemical behavior of potential orthopedic Mg-Ca, AZ31 and AZ91 alloys was studied in Hank's solution, Dulbecco's Modified Eagle's Medium (DMEM) and serum-containing medium (DMEM adding 10% fetal bovine serum (DMEM+FBS)) over a 7 day immersion period. The biocorrosion of the above three alloys for various immersion time intervals was investigated by linear polarization and electrochemical impedance spectroscopy (EIS). After 7 day immersion, potentiodynamic polarization tests were carried out and the surface morphologies of experimental samples were examined by scanning electron microscopy (SEM) observation complemented by energy-disperse spectrometer (EDS) analysis. It was shown that the corrosion of magnesium alloys was influenced by the composition of the solution. The results indicated that chloride ion could reduce the corrosion resistance and the hydrocarbonate ions could induce rapid surface passivation. The adsorbed amino acid on the experimental magnesium alloys' surface increased their polarization resistance and reduced current densities. The influence of the serum protein on corrosion was found to be associated with the magnesium alloy compositions. A Mg-Ca alloy exhibited an increased corrosion rate in the presence of serum protein. An AZ31 alloy showed an increased corrosion rate in DMEM+FBS in the initial 3 day immersion and the corrosion rate decreased thereafter. An AZ91 alloy, with high Al content, showed a reduced corrosion rate with the addition of FBS into DMEM.

Effect of simple solutes on the long range dipolar correlations in liquid water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baul, Upayan, E-mail: upayanb@imsc.res.in; Anishetty, Ramesh, E-mail: ramesha@imsc.res.in; Vemparala, Satyavani, E-mail: vani@imsc.res.in

2016-03-14

Intermolecular correlations in liquid water at ambient conditions have generally been characterized through short range density fluctuations described through the atomic pair distribution functions. Recent numerical and experimental results have suggested that such a description of order or structure in liquid water is incomplete and there exist considerably longer ranged orientational correlations in water that can be studied through dipolar correlations. In this study, using large scale classical, atomistic molecular dynamics simulations using TIP4P-Ew and TIP3P models of water, we show that salts such as sodium chloride (NaCl), potassium chloride (KCl), caesium chloride (CsCl), and magnesium chloride (MgCl{sub 2}) havemore » a long range effect on the dipolar correlations, which cannot be explained by the notion of structure making and breaking by dissolved ions. Observed effects are explained through orientational stratification of water molecules around ions and their long range coupling to the global hydrogen bond network by virtue of the sum rule for water. The observations for single hydrophilic solutes are contrasted with the same for a single methane (CH{sub 4}) molecule. We observe that even a single small hydrophobe can result in enhancement of long range orientational correlations in liquid water, contrary to the case of dissolved ions, which have been observed to have a reducing effect. The observations from this study are discussed in the context of hydrophobic effect.« less

Stream periphyton responses to mesocosm treatments of ...

EPA Pesticide Factsheets

A stream mesocosm experiment was designed to compare biotic responses among streams exposed to an equal excess specific conductivity target of 850 µS/cm relative to a control that was set for 200 µS/cm and three treatments comprised of different major ion contents. Each treatment and the control was replicated 4 times at the mesocosm scale (16 mesocosms total). The treatments were based on dosing the background mesocosm water, a continuous flow-through mixture of natural river water and reverse osmosis treated water, with stock salt solutions prepared from 1) a mixture of sodium chloride and calcium chloride (Na/Cl chloride), 2) sodium bicarbonate, and 3) magnesium sulfate. The realized average specific conductance over the first 28d of continuous dosing was 827, 829, and 847 µS/cm, for the chloride, bicarbonate, and sulfate based treatments, respectively, and did not differ significantly. The controls averaged 183 µS/cm. Here we focus on comparing stream periphyton communities across treatments based on measurements obtained from a Pulse-Amplitude Modulated (PAM) fluorometer. The fluorometer is used in situ and with built in algorithms distributes the total aerial algal biomass (µg/cm2) of the periphyton among cyanobacteria, diatoms, and green algae. A measurement is recorded in a matter of seconds and, therefore, many different locations can be measured with in each mesocosm at a high return frequency. Eight locations within each of the 1 m2 (0.3 m W x 3

Synthesis of Struvite using a Vertical Canted Reactor with Continuous Laminar Flow Process

NASA Astrophysics Data System (ADS)

Sutiyono, S.; Edahwati, L.; Muryanto, S.; Jamari, J.; Bayuseno, A. P.

2018-01-01

Struvite is a white crystalline that is chemically known as magnesium ammonium phosphorus hexahydrate (MgNH4PO4·6H2O). It can easily dissolve in acidic conditions and slightly soluble in neutral and alkaline conditions. In industry, struvite forms as a scale deposit on a pipe with hot flow fluid. However, struvite can be used as fertilizer because of its phosphate content. A vertical canted reactor is a promising technology for recovering phosphate levels in wastewater through struvite crystallization. The study was carried out with the vertical canted reactor by mixing an equimolar stock solution of MgCl2, NH4OH, and H3PO4 in 1: 1: 1 ratio. The crystallization process worked with the flow rate of three stock solution entering the reactor in the range of 16-38 ml/min, the temperature in the reactor is worked on 20°, 30°, and 40°C, while the incoming air rate is kept constant at 0.25 liters/min. Moreover, pH was maintained at a constant value of 9. The struvite crystallization process run until the steady state was reached. Then, the result of crystal precipitates was filtered and dried at standard temperature room for 48 hours. After that, struvite crystals were stored for the subsequent analysis by Scanning Electron Microscope (SEM) and XRD (X-Ray Diffraction) method. The use of canted reactor provided the high pure struvite with a prismatic crystal morphology.

A Key concept in Magnesium Secondary Battery Electrolytes.

PubMed

Bertasi, Federico; Hettige, Chaminda; Sepehr, Fatemeh; Bogle, Xavier; Pagot, Gioele; Vezzù, Keti; Negro, Enrico; Paddison, Stephen J; Greenbaum, Steve G; Vittadello, Michele; Di Noto, Vito

2015-09-21

A critical roadblock toward practical Mg-based energy storage technologies is the lack of reversible electrolytes that are safe and electrochemically stable. Here, we report on high-performance electrolytes based on 1-ethyl-3-methylimidazolium chloride (EMImCl) doped with AlCl3 and highly amorphous δ-MgCl2 . The phase diagram of the electrolytes reveals the presence of four thermal transitions that strongly depend on salt content. High-level density functional theory (DFT)-based electronic structure calculations substantiate the structural and vibrational assignment of the coordination complexes. A 3D chloride-concatenated dynamic network model accounts for the outstanding redox behaviour and the electric and magnetic properties, providing insight into the conduction mechanism of the electrolytes. Mg anode cells assembled using the electrolytes were cyclically discharged at a high rate (35 mA g(-1) ), exhibiting an initial capacity of 80 mA h g(-1) and a steady-state voltage of 2.3 V. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Topical methotrexate alters solute and water transport in the rat jejunum in vivo and rabbit ileum in vitro.

PubMed Central

Pinkerton, C R; Booth, I W; Milla, P J

1985-01-01

The topical effect of methotrexate (MTX) on small intestinal hexose and ion transport has been studied using an in vivo steady state jejunal perfusion technique in the rat, and short circuited rabbit terminal ileum in Ussing chambers in vitro. In rat jejunum, perfusion with MTX (1 mumol/l) caused significant reductions in water, sodium, and glucose absorption within 110 minutes of exposure. Fructose absorption was, however, unimpaired. The same concentration of MTX, when added to the mucosal side of distal rabbit ileum caused significant increases in transmucosal potential difference, short circuit current and the unidirectional flux of chloride from serosa to mucosa. In the presence of a subphysiological magnesium concentration (0.3 mmol/l), MTX resulted in the abolition of net sodium absorption and the conversion of net chloride absorption to secretion. We conclude that MTX has a topical effect on small intestinal transport which is independent of its effect on crypt cell kinetics. PMID:4018634

Ground-water quality and geochemistry, Carson Desert, western Nevada

USGS Publications Warehouse

Lico, Michael S.; Seiler, R.L.

1994-01-01

Aquifers in the Carson Desert are the primary source of drinking water, which is highly variable in chemical composition. In the shallow basin-fill aquifers, water chemistyr varies from a dilute calcium bicarbonate-dominated water beneath the irrigated areas to a saline sodium chloride- dominated water beneath unirrigated areas. Water samples from the shallow aquifers commonly have dissolved solids, chloride, magnesium, sulfate, arsenic, and manganese concentrations that exceed State of Nevada drinking-water standards. Water in the intermediante basin-fill aquifers is a dilute sodium bicarbonate type in the Fallon area and a distinctly more saline sodium chloride type in the Soda Lake-Upsal Hogback area. Dissolved solids, chloride, arsenic, fluoride, and manganese concen- trations commonly exceed drinking-water standards. The basalt aquifer contains a dilute sodium bicarbonate chloride water. Arsenic concentrations exceed standards in all sampled wells. The concen- trations of major constituents in ground water beneath the southern Carson Desert are the result of evapotranspiration and natural geochemical reactions with minerals derived mostly from igneous rocks. Water with higher concentrations of iron and manganese is near thermodynamic equilibrium with siderite and rhodochrosite and indicates that these elements may be limited by the solubility of their respective carbonate minerals. Naturally occurring radionuclides (uranium and radon-222) are present in ground water from the Carson Desert in concen- tratons higher than proposed drinking-water standards. High uranium concentrations in the shallow aquifers may be caused by evaporative concentration and the release of uranium during dissolution of iron and manganese oxides or the oxidation of sedimentary organic matter that typically has elevated uranium concentrations. Ground water in the Carson Desert does not appear to have be contaminated by synthetic organic chemicals.

Magnesium prevents phosphate-induced calcification in human aortic vascular smooth muscle cells.

PubMed

Louvet, Loïc; Büchel, Janine; Steppan, Sonja; Passlick-Deetjen, Jutta; Massy, Ziad A

2013-04-01

Vascular calcification (VC) is prevalent in patients suffering from chronic kidney disease. Factors promoting calcification include abnormalities in mineral metabolism, particularly high phosphate levels. Inorganic phosphate (Pi) is a classical inducer of in vitro VC. Recently, an inverse relationship between serum magnesium concentrations and VC has been reported. The present study aimed to investigate the effects of magnesium on Pi-induced VC at the cellular level using primary HAVSMC. Alive and fixed HAVSMC were assessed during 14 days in the presence of Pi with increasing concentrations of magnesium (Mg(2+)) chloride. Mineralization was measured using quantification of calcium, von Kossa and alizarin red stainings. Cell viability and secretion of classical VC markers were also assessed using adequate tests. Involvement of transient receptor potential melastatin (TRPM) 7 was assessed using 2-aminoethoxy-diphenylborate (2-APB) inhibitor. Co-incubation with Mg(2+) significantly decreased Pi-induced VC in live HAVSMC, no effect was found in fixed cells. At potent concentrations in Pi-induced HAVSMC, Mg(2+) significantly improved cell viability and restored to basal level increased secretions of osteocalcin and matrix gla protein, whereas a decrease in osteopontin secretion was partially restored. The block of TRPM7 with 2-APB at 10(-4) M led to the inefficiency of Mg(2+) to prevent VC. Increasing Mg(2+) concentrations significantly reduced VC, improved cell viability and modulated secretion of VC markers during cell-mediated matrix mineralization clearly pointing to a cellular role for Mg(2+) and 2-APB further involved TRPM7 and a potential Mg(2+) entry to exert its effects. Further investigations are needed to shed light on additional cellular mechanism(s) by which Mg(2+) is able to prevent VC.

The Skeletal Organic Matrix from Mediterranean Coral Balanophyllia europaea Influences Calcium Carbonate Precipitation

PubMed Central

Goffredo, Stefano; Vergni, Patrizia; Reggi, Michela; Caroselli, Erik; Sparla, Francesca; Levy, Oren; Dubinsky, Zvy; Falini, Giuseppe

2011-01-01

Scleractinian coral skeletons are made mainly of calcium carbonate in the form of aragonite. The mineral deposition occurs in a biological confined environment, but it is still a theme of discussion to what extent the calcification occurs under biological or environmental control. Hence, the shape, size and organization of skeletal crystals from the cellular level through the colony architecture, were attributed to factors as diverse as mineral supersaturation levels and organic mediation of crystal growth. The skeleton contains an intra-skeletal organic matrix (OM) of which only the water soluble component was chemically and physically characterized. In this work that OM from the skeleton of the Balanophyllia europaea, a solitary scleractinian coral endemic to the Mediterranean Sea, is studied in vitro with the aim of understanding its role in the mineralization of calcium carbonate. Mineralization of calcium carbonate was conducted by overgrowth experiments on coral skeleton and in calcium chloride solutions containing different ratios of water soluble and/or insoluble OM and of magnesium ions. The precipitates were characterized by diffractometric, spectroscopic and microscopic techniques. The results showed that both soluble and insoluble OM components influence calcium carbonate precipitation and that the effect is enhanced by their co-presence. The role of magnesium ions is also affected by the presence of the OM components. Thus, in vitro, OM influences calcium carbonate crystal morphology, aggregation and polymorphism as a function of its composition and of the content of magnesium ions in the precipitation media. This research, although does not resolve the controversy between environmental or biological control on the deposition of calcium carbonate in corals, sheds a light on the role of OM, which appears mediated by the presence of magnesium ions. PMID:21799830

Amelioration of myocardial ischemic reperfusion injury with Calendula officinalis.

PubMed

Ray, Diptarka; Mukherjee, Subhendu; Falchi, Mario; Bertelli, Aldo; Das, Dipak K

2010-12-01

Calendula officinalis of family Asteraceae, also known as marigold, has been widely used from time immemorial in Indian and Arabic cultures as an anti-inflammatory agent to treat minor skin wound and infections, burns, bee stings, sunburn and cancer. At a relatively high dose, calendula can lower blood pressure and cholesterol. Since inflammatory responses are behind many cardiac diseases, we sought to evaluate if calendula could be cardioprotective against ischemic heart disease Two groups of hearts were used: the treated rat hearts were perfused with calendula solution at 50 mM in KHB buffer (in mM: sodium chloride 118, potassium chloride 4.7, calcium chloride 1.7, sodium bicarbonate 25, potassium biphosphate 0.36, magnesium sulfate 1.2, and glucose 10) for 15 min prior to subjecting the heart to ischemia, while the control group was perfused with the buffer only. Calendula achieved cardioprotection by stimulating left ventricular developed pressure and aortic flow as well as by reducing myocardial infarct size and cardiomyocyte apoptosis. Cardioprotection appears to be achieved by changing ischemia reperfusion-mediated death signal into a survival signal by modulating antioxidant and anti-inflammatory pathways as evidenced by the activation of Akt and Bcl2 and depression of TNFα. The results further strengthen the concept of using natural products in degeneration diseases like ischemic heart disease.

[Application of in situ cryogenic Raman spectroscopy to analysis of fluid inclusions in reservoirs].

PubMed

Chen, Yong; Lin, Cheng-yan; Yu, Wen-quan; Zheng, Jie; Wang, Ai-guo

2010-01-01

Identification of salts is a principal problem for analysis of fluid inclusions in reservoirs. The fluid inclusions from deep natural gas reservoirs in Minfeng sub-sag were analyzed by in situ cryogenic Raman spectroscopy. The type of fluid inclusions was identified by Raman spectroscopy at room temperature. The Raman spectra show that the inclusions contain methane-bearing brine aqueous liquids. The fluid inclusions were analyzed at -180 degrees C by in situ cryogenic Raman spectroscopy. The spectra show that inclusions contain three salts, namely NaCl2, CaCl2 and MgCl2. Sodium chloride is most salt component, coexisting with small calcium chloride and little magnesium chloride. The origin of fluids in inclusions was explained by analysis of the process of sedimentation and diagenesis. The mechanism of diagenesis in reservoirs was also given in this paper. The results of this study indicate that in situ cryogenic Raman spectroscopy is an available method to get the composition of fluid inclusions in reservoirs. Based on the analysis of fluid inclusions in reservoirs by in situ cryogenic Raman spectroscopy with combination of the history of sedimentation and diagenesis, the authors can give important evidence for the type and mechanism of diagenesis in reservoirs.

The Dead Sea

NASA Technical Reports Server (NTRS)

2006-01-01

The Dead Sea is the lowest point on Earth at 418 meters below sea level, and also one of the saltiest bodies of water on Earth with a salinity of about 300 parts-per-thousand (nine times greater than ocean salinity). It is located on the border between Jordan and Israel, and is fed by the Jordan River. The Dead Sea is located in the Dead Sea Rift, formed as a result of the Arabian tectonic plate moving northward away from the African Plate. The mineral content of the Dead Sea is significantly different from that of ocean water, consisting of approximately 53% magnesium chloride, 37% potassium chloride and 8% sodium chloride. In the early part of the 20th century, the Dead Sea began to attract interest from chemists who deduced that the Sea was a natural deposit of potash and bromine. From the Dead Sea brine, Israel and Jordan produce 3.8 million tons potash, 200,000 tons elemental bromine, 45,000 tons caustic soda, 25, 000 tons magnesium metal, and sodium chloride. Both countries use extensive salt evaporation pans that have essentially diked the entire southern end of the Dead Sea.

With its 14 spectral bands from the visible to the thermal infrared wavelength region, and its high spatial resolution of 15 to 90 meters (about 50 to 300 feet), ASTER images Earth to map and monitor the changing surface of our planet.

ASTER is one of five Earth-observing instruments launched December 18, 1999, on NASA's Terra satellite. The instrument was built by Japan's Ministry of Economy, Trade and Industry. A joint U.S./Japan science team is responsible for validation and calibration of the instrument and the data products.

The broad spectral coverage and high spectral resolution of ASTER provides scientists in numerous disciplines with critical information for surface mapping, and monitoring of dynamic conditions and temporal change. Example applications are: monitoring glacial advances and retreats; monitoring potentially active volcanoes; identifying crop stress; determining cloud morphology and physical properties; wetlands evaluation; thermal pollution monitoring; coral reef degradation; surface temperature mapping of soils and geology; and measuring surface heat balance.

The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

Size: 18.5 by 48.1 kilometers (11.5 by 29.8 miles) Location: 31.4 degrees North latitude, 35.4 degrees East longitude Orientation: North at top Image Data: ASTER bands 3, 2, and 1 Original Data Resolution: 15 meters (49.2 feet) Dates Acquired: May 3, 2005

EXPERIMENTAL STUDIES ON INFLAMMATION

PubMed Central

Wolf, Elizabeth Pauline

1921-01-01

1. Wright's method for the study of chemotaxis of leucocytes in vitro, slightly modified, has been found to be most satisfactory in the estimation of the degree of chemotaxis of various substances, because it is possible to make an exact quantitative determination of the leucocytes that have migrated from the blood clot and adhere to the surfaces containing the tested substance. 2. The calcium ion is the only inorganic ion per se which is found to be positively chemotactic under the conditions of these experiments. It is markedly chemotactic in all concentrations and in all combinations, except the citrate. Here the negative chemotaxis of the citrate ion neutralizes the positive chemotaxis of the calcium ion, and neutrality of chemotactic effect results. 3. The sodium and magnesium ions themselves are neutral. Magnesium and sodium salts are dependent upon the negative ion with which the magnesium or sodium is combined for such positive or negative chemotaxis as is exhibited. All the phosphates of sodium, whether tri-, di-, or monobasic salts, are markedly positively chemotactic, and when combined with other reagents which are themselves neutral or negatively chemotactic, produce marked positive chemotaxis. The blood of a person who has taken phosphates either by mouth or intravenously shows a great increase in chemotaxis with sodium phosphate, with calcium chloride, and even with sodium chloride which is ordinarily neutral. 4. All potassium salts are negatively chemotactic. 5. Many substances act synergistically as regards chemotaxis; e.g., when strontium and magnesium salts are mixed there is a marked increase in chemotaxis. Sodium phosphate acts synergistically with calcium chloride. 6. Mercury salts fix the leucocytes in this method so that their influence on chemotaxis cannot be determined. 7. Morphine and morphine salts are positively chemotactic; this is contrary to the results obtained by others with different methods. 8. Substances which produce a very acute inflammation, such as cantharidin, histamine, or turpentine, are found to be positively chemotactic by this method, but substances, such as mustard gas, which produce a marked necrotizing effect are found to be negatively chemotactic, or neutral, though physiologically they would appear to be positively chemotactic. 9. All amino-acids and amines are positively chemotactic to a certain extent. It seems that the longer the carbon chain, the greater the degree of chemotaxis, though this is not absolute. Tyramine is one exception to this, for it causes a peculiar clumping of the cells, so that it is impossible to count the number adhering, and thus determine whether or not tyramine is positively chemotactic. 10. The time that the blood of animals is examined after eating makes a marked difference in the number of cells adhering, for shortly after eating, within 30 minutes, very many more cells will adhere to the agar than at a later time. 11. The blood of different species of animals reacts differently towards different reagents. The chemical composition of these agents seems to have nothing to do with this difference in reaction as far as we could determine. 12. With frozen serial sections it has been found that the depth of penetration of the leucocytes into the agar is proportional to the positive chemotaxis produced by the substance combined with the agar, as demonstrated by the number of leucocytes adherent to the walls of the test chambers. PMID:19868564

EXPERIMENTAL STUDIES ON INFLAMMATION : I. THE INFLUENCE OF CHEMICALS UPON THE CHEMOTAXIS OF LEUCOCYTES IN VITRO.

PubMed

Wolf, E P

1921-09-30

1. Wright's method for the study of chemotaxis of leucocytes in vitro, slightly modified, has been found to be most satisfactory in the estimation of the degree of chemotaxis of various substances, because it is possible to make an exact quantitative determination of the leucocytes that have migrated from the blood clot and adhere to the surfaces containing the tested substance. 2. The calcium ion is the only inorganic ion per se which is found to be positively chemotactic under the conditions of these experiments. It is markedly chemotactic in all concentrations and in all combinations, except the citrate. Here the negative chemotaxis of the citrate ion neutralizes the positive chemotaxis of the calcium ion, and neutrality of chemotactic effect results. 3. The sodium and magnesium ions themselves are neutral. Magnesium and sodium salts are dependent upon the negative ion with which the magnesium or sodium is combined for such positive or negative chemotaxis as is exhibited. All the phosphates of sodium, whether tri-, di-, or monobasic salts, are markedly positively chemotactic, and when combined with other reagents which are themselves neutral or negatively chemotactic, produce marked positive chemotaxis. The blood of a person who has taken phosphates either by mouth or intravenously shows a great increase in chemotaxis with sodium phosphate, with calcium chloride, and even with sodium chloride which is ordinarily neutral. 4. All potassium salts are negatively chemotactic. 5. Many substances act synergistically as regards chemotaxis; e.g., when strontium and magnesium salts are mixed there is a marked increase in chemotaxis. Sodium phosphate acts synergistically with calcium chloride. 6. Mercury salts fix the leucocytes in this method so that their influence on chemotaxis cannot be determined. 7. Morphine and morphine salts are positively chemotactic; this is contrary to the results obtained by others with different methods. 8. Substances which produce a very acute inflammation, such as cantharidin, histamine, or turpentine, are found to be positively chemotactic by this method, but substances, such as mustard gas, which produce a marked necrotizing effect are found to be negatively chemotactic, or neutral, though physiologically they would appear to be positively chemotactic. 9. All amino-acids and amines are positively chemotactic to a certain extent. It seems that the longer the carbon chain, the greater the degree of chemotaxis, though this is not absolute. Tyramine is one exception to this, for it causes a peculiar clumping of the cells, so that it is impossible to count the number adhering, and thus determine whether or not tyramine is positively chemotactic. 10. The time that the blood of animals is examined after eating makes a marked difference in the number of cells adhering, for shortly after eating, within 30 minutes, very many more cells will adhere to the agar than at a later time. 11. The blood of different species of animals reacts differently towards different reagents. The chemical composition of these agents seems to have nothing to do with this difference in reaction as far as we could determine. 12. With frozen serial sections it has been found that the depth of penetration of the leucocytes into the agar is proportional to the positive chemotaxis produced by the substance combined with the agar, as demonstrated by the number of leucocytes adherent to the walls of the test chambers.

Reference intervals for selected serum biochemistry analytes in cheetahs Acinonyx jubatus.

PubMed

Hudson-Lamb, Gavin C; Schoeman, Johan P; Hooijberg, Emma H; Heinrich, Sonja K; Tordiffe, Adrian S W

2016-02-26

Published haematologic and serum biochemistry reference intervals are very scarce for captive cheetahs and even more for free-ranging cheetahs. The current study was performed to establish reference intervals for selected serum biochemistry analytes in cheetahs. Baseline serum biochemistry analytes were analysed from 66 healthy Namibian cheetahs. Samples were collected from 30 captive cheetahs at the AfriCat Foundation and 36 free-ranging cheetahs from central Namibia. The effects of captivity-status, age, sex and haemolysis score on the tested serum analytes were investigated. The biochemistry analytes that were measured were sodium, potassium, magnesium, chloride, urea and creatinine. The 90% confidence interval of the reference limits was obtained using the non-parametric bootstrap method. Reference intervals were preferentially determined by the non-parametric method and were as follows: sodium (128 mmol/L - 166 mmol/L), potassium (3.9 mmol/L - 5.2 mmol/L), magnesium (0.8 mmol/L - 1.2 mmol/L), chloride (97 mmol/L - 130 mmol/L), urea (8.2 mmol/L - 25.1 mmol/L) and creatinine (88 µmol/L - 288 µmol/L). Reference intervals from the current study were compared with International Species Information System values for cheetahs and found to be narrower. Moreover, age, sex and haemolysis score had no significant effect on the serum analytes in this study. Separate reference intervals for captive and free-ranging cheetahs were also determined. Captive cheetahs had higher urea values, most likely due to dietary factors. This study is the first to establish reference intervals for serum biochemistry analytes in cheetahs according to international guidelines. These results can be used for future health and disease assessments in both captive and free-ranging cheetahs.

Interlaboratory comparability, bias, and precision for four laboratories measuring analytes in wet deposition, October 1983-December 1984

USGS Publications Warehouse

Brooks, Myron H.; Schroder, LeRoy J.; Willoughby, Timothy C.

1987-01-01

Four laboratories involved in the routine analysis of wet-deposition samples participated in an interlaboratory comparison program managed by the U.S. Geological Survey. The four participants were: Illinois State Water Survey central analytical laboratory in Champaign, Illinois; U.S. Geological Survey national water-quality laboratories in Atlanta, Georgia, and Denver, Colorado; and Inland Waters Directorate national water-quality laboratory in Burlington, Ontario, Canada. Analyses of interlaboratory samples performed by the four laboratories from October 1983 through December 1984 were compared.Participating laboratories analyzed three types of interlaboratory samples--natural wet deposition, simulated wet deposition, and deionized water--for pH and specific conductance, and for dissolved calcium, magnesium, sodium, sodium, potassium, chloride, sulfate, nitrate, ammonium, and orthophosphate. Natural wet-deposition samples were aliquots of actual wet-deposition samples. Analyses of these samples by the four laboratories were compared using analysis of variance. Test results indicated that pH, calcium, nitrate, and ammonium results were not directly comparable among the four laboratories. Statistically significant differences between laboratory results probably only were meaningful for analyses of dissolved calcium. Simulated wet-deposition samples with known analyte concentrations were used to test each laboratory for analyte bias. Laboratory analyses of calcium, magnesium, sodium, potassium, chloride, sulfate, and nitrate were not significantly different from the known concentrations of these analytes when tested using analysis of variance. Deionized-water samples were used to test each laboratory for reporting of false positive values. The Illinois State Water Survey Laboratory reported the smallest percentage of false positive values for most analytes. Analyte precision was estimated for each laboratory from results of replicate measurements. In general, the Illinois State Water Survey laboratory achieved the greatest precision, whereas the U.S. Geological Survey laboratories achieved the least precision.

Magnesium taurate prevents cataractogenesis via restoration of lenticular oxidative damage and ATPase function in cadmium chloride-induced hypertensive experimental animals.

PubMed

Choudhary, Rajesh; Bodakhe, Surendra H

2016-12-01

Previously we found that hypertension potentiates the risk the cataractogenesis. In the present study, we investigated the protective effects of magnesium taurate (MgT) on hypertension and associated lenticular damages against cadmium chloride (CdCl 2 )-induced hypertensive animals. Male Sprague-Dawley albino rats (150-180g) were assigned to five experimental groups (n=6). Among the five groups, normal group received 0.3% carboxymethyl cellulose (10ml/kg/day, p.o.). Hypertension control group received CdCl 2 (0.5mg/kg/day, i.p.). Tests and standard groups received MgT (3 and 6mg/kg/day, p.o.) and amlodipine (3mg/kg/day, p.o.) concurrently with CdCl 2 respectively , for six consecutive weeks. Blood pressure, heart rate, and eyes were examined biweekly, and pathophysiological parameters in serum and eye lenses were evaluated after six weeks of the experimental protocol. The chronic administration of MgT concurrently with CdCl 2 significantly restored the blood pressure, serum and lens antioxidants (CAT, SOD, GPx, and GSH), MDA level, and ions (Na + , K + , and Ca 2+ ). Additionally, MgT treatment led to significant increase in the lens proteins (total and soluble), Ca 2+ ATPase, and Na + K + ATPase activity as compared to hypertension control group. Ophthalmoscope observations indicated that MgT treatments delayed the progression of cataract against the hypertensive state. The study shows that MgT prevents the progression of cataractogenesis via restoration of blood pressure, lenticular oxidative damages, and lens ATPase functions in the hypertensive state. The results suggest that MgT supplement may play a beneficial role to manage hypertension and associated cataractogenesis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Relation of precipitation quality to storm type, and deposition of dissolved chemical constituents from precipitation in Massachusetts, 1983-85

USGS Publications Warehouse

Gay, F.B.; Melching, C.S.

1995-01-01

Precipitation samples were collected for 83 storms at a rural inland site in Princeton, Mass., and 73 storms at a rural coastal site in Truro, Mass., to examine the quality of precipitation from storms and relate quality to three storm types (oceanic cyclone, continental cyclone, and cold front). At the inland site, Princeton, ranked-means of precipitation depth, storm duration, specific conductance, and concentrations and loads of hydrogen, sulfate, aluminum, bromide, and copper ions were affected by storm type. At the coastal site, Truro, ranked means of precipitation depth, storm duration, and concentrations and loads of calcium, chloride, magnesium, potassium, and sodium ions were affected by storm type. Precipitation chemistry at the coastal site was 85 percent oceanic in orgin, whereas precipitation 72 kilometers inland was 60 percent hydrogen, nitrate, and sulfate ions, reflecting fossil-fuel combustion. Concentrations and loads for specific conductance and 9 chemical constituents on an annual and seasonal basis were determined from National Atmospheric Deposition Program data for spring 1983 through winter 1985 at Quabbin (rural, inland), Waltham (suburban, inland) and Truro (rural, coastal), Massachusetts. Concentrations of magnesium, potassium, sodium, and chloride concentrations were highest at the coast and much lower inland, with very little difference between Waltham and Quabbin. Loads of ammonium, nitrate, sulfate, and hydrogen are highest at Quabbin and are about equal at Waltham and Truro. About twice as much nitrate and hydrogen and about 35 percent more sulfate is deposited at Quabbin than at Waltham or Truro; this pattern indicates that the interior of Massachusetts receives more acidic precipitation than do the eastern or the coastal areas of Massachusetts.

Intermittent bolus injection versus continuous infusion of furosemide in normal adult greyhound dogs.

PubMed

Adin, Darcy B; Taylor, Aaron W; Hill, Richard C; Scott, Karen C; Martin, Frank G

2003-01-01

Several studies in human subjects have demonstrated greater diuresis with constant rate infusion (CRI) furosemide than intermittent bolus (IB) furosemide. This study was conducted to compare the diuretic efficacy of the same total dose of IB furosemide and CRI furosemide in 6 healthy, adult Greyhound dogs in a randomized crossover design with a 2-week washout period between treatments. For IB administration, dogs received 3 mg/kg at 0 and 4 hours. For CRI administration, dogs received a 0.66 mg/kg loading dose followed by 0.66 mg/kg/h over 8 hours. The same volume of fluid was administered for both methods. Urine output was quantified hourly. Urine electrolyte concentrations, urine specific gravity (USG), packed cell volume (PCV), total protein (TP), serum electrolyte concentrations, total carbon dioxide (TCO2), serum creatinine (sCr), and blood urea nitrogen (BUN) were determined every 2 hours. Urine production and water intake were greater (P < or = 0.05) for CRI than IB. Urine sodium and calcium losses were greater (P < 0.05) and urine potassium loss was less (P = 0.03) for CRI than IB, but there was no evidence of a difference between methods for urine magnesium and chloride losses. Serum chloride concentration was less (P < 0.001), sCr concentration greater (P = 0.04). TP greater (P = 0.01), and PCV greater (P = 0.003) for CRI than IB. No differences in USG, TCO2, BUN, or serum potassium, sodium, and magnesium concentrations were detected between methods. The same total dose of CRI furosemide resulted in more diuresis, natriuresis, and calciuresis and less kaliuresis than IB furosemide in these normal Greyhound dogs over 8 hours, suggesting that furosemide is a more effective diuretic when administered by CRI than by IB.

Biochemical profile of coconut water from coconut palms planted in an inland region.

PubMed

Vigliar, Renata; Sdepanian, Vera L; Fagundes-Neto, Ulysses

2006-01-01

To analyze the biochemical profile of coconut water from dwarf coconut palms planted in non-coastal regions, during the maturation period (sixth to ninth month). Eight of 15 coconut palms planted in a non-coastal region were selected by lots and their coconuts sent to a laboratory for extraction and analysis of the coconut water. Coconut water from a total of 45 coconuts, from the sixth to ninth months' maturity, were analyzed to measure glucose, electrolytes, total proteins and osmolarity and to identify the sugars contained. The analysis of coconut water from the sixth to ninth month did not find any differences in the median concentrations of sodium (3 mEq/L; 2 and 3), glucose (0.6 g/L; 0.3 and 17.3) or total proteins (9 g/L; 6 and 12), but detected a reduction in the concentration of potassium (64 mEq/L; 46 and 99), calcium (6.5 mmol/L; 5 and 8.5), magnesium (8 mmol/L; 3.9 and 9.8), chloride (38.5 mEq/L; 30 and 48.7) and osmolarity (419 mOsmol/L; 354 and 472). With relation to the sugars, identified by chromatography on paper, an increase was observed from the sixth to the ninth month in the concentration of fructose (68 mg/microL; 44 and 320) and glucose (299 mg/microL; 262 and 332) and in conjunction with a concentration of sucrose (340 mg/microL; 264 and 390). The biochemical profile of coconut water varied as the coconuts matured, observing reductions in the concentration of potassium, calcium, magnesium, chloride and osmolarity. Descending paper chromatography revealed an increase in the concentration of fructose and glucose and also a reduction in the concentration of sucrose.

Replacement of salt by a novel potassium- and magnesium-enriched salt alternative improves the cardiovascular effects of ramipril.

PubMed Central

Mervaala, E. M.; Paakkari, I.; Laakso, J.; Nevala, R.; Teräväinen, T. M.; Fyhrquist, F.; Vapaatalo, H.; Karppanen, H.

1994-01-01

1. The influence of salt (sodium chloride; NaCl) (an additional 6% in the diet) and that of a novel sodium-reduced, potassium-, magnesium-, and L-lysine-enriched salt alternative on the cardiovascular effects of ramipril was studied in stroke-prone spontaneously hypertensive rats in a 6-week study. The intake of sodium chloride was adjusted to the same level by adding the salt alternative at a 1.75 times higher amount than regular salt. 2. Salt produced a marked rise in blood pressure and induced cardiac hypertrophy and significant mortality, while the salt alternative neither increased blood pressure nor caused any mortality and produced less cardiac hypertrophy than salt. 3. Ramipril treatment at a daily dose of 3 mg kg-1 normalized blood pressure and prevented the development of cardiac hypertrophy of rats on control diet. These effects of ramipril were blocked by the addition of salt but were only slightly attenuated by the addition of the salt alternative. The mortality in the salt group was prevented by ramipril. 4. Responses of mesenteric arterial rings in vitro were examined at the end of the study. Salt, but not the salt alternative, increased vascular contractile responses to noradrenaline. Ramipril treatment improved the arterial relaxation responses to acetylcholine and to sodium nitroprusside. The vascular relaxation enhancing effect of ramipril was blocked by salt but only slightly attenuated by the salt alternative. 5. Ramipril treatment did not significantly increase plasma renin activity in the presence or in the absence of salt supplementation. The salt alternative did not cause hyperkalaemia, either alone or in combination with ramipril treatment.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8032605

Interaction between Bisphosphonates and Mineral Water: Study of Oral Risedronate Absorption in Rats.

PubMed

Itoh, Akihisa; Akagi, Yuuki; Shimomura, Hitoshi; Aoyama, Takao

2016-01-01

Bisphosphonates are antiosteoporotic agents prescribed for patients with osteoporosis. Drug package inserts for bisphosphonate supplements indicate that their bioavailability is reduced by high levels of metal cations (Ca(2+), Mg(2+), etc.). However, standards for these cations in water used for taking risedronate have not been defined. Here, we examined the effect of calcium and magnesium in mineral waters on the bioavailability of the third-generation bisphosphonate, risedronate, following oral administration in rats. As risedronate is unchanged and eliminated renally, risedronate absorption was estimated from the amount excreted in the urine. Risedronate was dissolved in mineral water samples and administered orally at 0.35 mg/kg. Urine samples were collected for 24 h after dosing. Risedronate was extracted from urine using ion-pair solid-phase cartridges and quantified by HPLC with UV detection (262 nm). Cumulative recovery of risedronate was calculated from the amount excreted in the urine. The 24-h recovery of risedronate from evian® (0.32±0.02% [mean±standard deviation (S.D.)], n=4) and Contrex(®) (0.22±0.05%) mineral waters was significantly lower than that from tap water (0.47±0.04%, p<0.01). Absorption of risedronate in calcium chloride and magnesium chloride aqueous solutions of the same hardness (822 mg/L) was 54% (0.27±0.04%) and 12% (0.51±0.08%) lower, respectively, compared with ultrapure water; suggesting that absorption of risedronate declines as the calcium concentration of mineral waters increases. Consumption of mineral waters containing high levels of calcium (80 mg/L or above), such as evian® and Contrex(®), is therefore not recommended when taking risedronate.

Composition of minerals and trace elements at Mamasani thermal source: A possible preventive treatment for some skin diseases

PubMed Central

Hamidizadeh, Nasrin; Simaeetabar, Shima; Handjani, Farhad; Ranjbar, Sara; Moghadam, Mohammad Gohari; Parvizi, Mohammad Mahdi

2017-01-01

INTRODUCTION: Some skin diseases are incurable and modern medicine can only control them. In addition, alternative treatment remedies including balneotherapy can be effective in improving skin conditions. However, there are only a limited number of studies on particular mineral or trace elements of mineral sources that have been identified in Iran. In this respect, the amount of minerals and trace elements in Mamasani thermal source, Fars Province, Iran, was measured using electrochemical, titration, and spectrophotometric methods and evaluated. MATERIALS AND METHODS: The amount of minerals and trace elements in Mamasani thermal source, Fars Province, Iran, was measured using electrochemical, titration, and spectrophotometric methods. RESULTS: The concentrations of natural gases such as H2S and NO3 in Mamasani thermal source were measured to be 22.10 mg/L and 42.79 mg/L, respectively. The source also contained major ions such as chloride, sulfate, sodium, calcium, magnesium, potassium, and carbonate. Due to the high concentration of chloride, sulfate, and sodium ions in comparison with other major ions, the water source is also classified as sulfide water. The existing trace elements in this thermal water source are iron, zinc, copper, selenium, cobalt, chromium, boron, silisium, aluminum, magnesium, and molybdenum. CONCLUSION: We concluded that bathing in this source could be beneficial. As nitrate concentration is close to the highest standard concentration for drinking water, it can be used in chronic dermatitis, psoriasis, burns, and allergy. Furthermore, the antibacterial and antifungal effects of sulfur-containing water in this source can be helpful in the treatment of leg ulcers, tinea versicolor, tinea corporis, and tinea capitis. PMID:29296611

Hydrogenase activity in the foodborne pathogen Campylobacter jejuni depends upon a novel ABC-type nickel transporter (NikZYXWV) and is SlyD-independent.

PubMed

Howlett, Robert M; Hughes, Bethan M; Hitchcock, Andrew; Kelly, David J

2012-06-01

Campylobacter jejuni is a human pathogen of worldwide significance. It is commensal in the gut of many birds and mammals, where hydrogen is a readily available electron donor. The bacterium possesses a single membrane-bound, periplasmic-facing NiFe uptake hydrogenase that depends on the acquisition of environmental nickel for activity. The periplasmic binding protein Cj1584 (NikZ) of the ATP binding cassette (ABC) transporter encoded by the cj1584c-cj1580c (nikZYXWV) operon in C. jejuni strain NCTC 11168 was found to be nickel-repressed and to bind free nickel ions with a submicromolar K(d) value, as measured by fluorescence spectroscopy. Unlike the Escherichia coli NikA protein, NikZ did not bind EDTA-chelated nickel and lacks key conserved residues implicated in metallophore interaction. A C. jejuni cj1584c null mutant strain showed an approximately 22-fold decrease in intracellular nickel content compared with the wild-type strain and a decreased rate of uptake of (63)NiCl(2). The inhibition of residual nickel uptake at higher nickel concentrations in this mutant by hexa-ammine cobalt (III) chloride or magnesium ions suggests that low-affinity uptake occurs partly through the CorA magnesium transporter. Hydrogenase activity was completely abolished in the cj1584c mutant after growth in unsupplemented media, but was fully restored after growth with 0.5 mM nickel chloride. Mutation of the putative metallochaperone gene slyD (cj0115) had no effect on either intracellular nickel accumulation or hydrogenase activity. Our data reveal a strict dependence of hydrogenase activity in C. jejuni on high-affinity nickel uptake through an ABC transporter that has distinct properties compared with the E. coli Nik system.

Dealloying, Microstructure and the Corrosion/Protection of Cast Magnesium Alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sieradzki, Karl; Aiello, Ashlee; McCue, Ian

The purpose of this project was to develop a greater understanding of micro-galvanic corrosion effects in cast magnesium alloys using both experimental and computational methods. Experimental accomplishments have been made in the following areas of interest: characterization, aqueous free-corrosion, atmospheric corrosion, ionic liquid dissolution, rate kinetics of oxide dissolution, and coating investigation. Commercial alloys (AZ91D, AM60, and AZ31B), binary-phase alloys (αMg-2at.%Al, αMg-5at.%Al, and Mg-8at.%Al), and component phases (Mg, Al, β-Mg, β-1%Zn, MnAl3) were obtained and characterized using energy dispersive spectroscopy (EDS), X-ray diffraction (XRD), and scanning electron microscopy (SEM). Full immersion in aqueous chloride was used to characterize the corrosionmore » behavior of alloys. Rotating disc electrodes (RDEs) were used to observe accelerated long-term corrosion behavior. Al surface redistribution for freely corroded samples was analyzed using SEM, EDS, and lithium underpotential deposition (Li UPD). Atmospheric corrosion was observed using contact angle evolution, overnight pH monitoring, and surface pH evolution studies. Ionic liquid corrosion characterization was performed using linear sweep voltammetry and potentiostatic dissolution in 150° choline chloride-urea (cc-urea). Two surface coatings were investigated: (1) Li-carbonate and (2) cc-urea. Li-carbonate coatings were characterized using X-ray photoelectron spectroscopy (XPS), SEM, and aqueous free corrosion potential monitoring. Hydrophobic cc-urea coatings were characterized using contact angle measurements and electrochemical impedance spectroscopy. Oxide dissolution rate kinetics were studied using inductively coupled plasma mass spectroscopy (ICP-MS). Computational accomplishments have been made through the development of Kinetic Monte Carlo (KMC) simulations which model time- and composition-dependent effects on the microstructure due to spatial redistribution of alloying elements during corrosion.« less

Surface properties of AZ91 magnesium alloy after PEO treatment using molybdate salts and low current densities

NASA Astrophysics Data System (ADS)

Pezzato, Luca; Brunelli, Katya; Napolitani, Enrico; Magrini, Maurizio; Dabalà, Manuele

2015-12-01

Plasma electrolytic oxidation (PEO) process is a recently developed electrochemical method used to produce on the surface of various metals oxide ceramic coatings that improve corrosion and wear properties of the substrate. In this work, PEO process was applied on AZ91 magnesium alloy using low current densities (0.05 A/cm2) and an alkaline solution of silicates with different concentrations of sodium molybdate (0.3-3 g/l). The effect of the low current densities of process and of molybdate salts on the corrosion resistance of the coatings was studied with potentiodynamic polarization tests and electrochemical impedance spectroscopy (EIS) in chloride and sulfate environment. The morphology, the phases and the chemical composition of the coatings were examined using a scanning electron microscope equipped with EDS, X-ray diffraction, secondary ion mass spectrometry and X-ray photoelectron spectroscopy. The corrosion properties of the PEO coated samples were remarkably improved if compared with the uncoated samples. The addition of sodium molybdate, in determinate conditions, had a positive effect on the characteristics of the coatings in terms of corrosion resistance.

Physicochemical characterization of mozzarella cheese wheys and stretchwaters in comparison with several other sweet wheys.

PubMed

Gernigon, G; Piot, M; Beaucher, E; Jeantet, R; Schuck, P

2009-11-01

To better understand the origins of the problems occurring during mozzarella cheese whey concentration, lactose crystallization, and spray-drying steps, a physicochemical characterization was achieved. For this purpose, mozzarella cheese wheys were sampled and their content in different compounds such as total nitrogen, noncasein nitrogen, nonprotein nitrogen, lactate, citrate, chloride, sulfate, phosphate anions, calcium, magnesium, potassium, sodium cations, and the sugars glucose and galactose were measured. In a second step, the results were compared with the corresponding content in cheddar cheese wheys, raclette cheese wheys, soft cheese wheys, and Swiss-type cheese wheys. At the end of this survey, it was shown that mozzarella cheese wheys were more concentrated in lactate and in minerals--especially phosphate, calcium, and magnesium--than the other cheese wheys and that they contained galactose. These constituents are known to be hygroscopic. Complementary surveys are now necessary to compare the hygroscopicity of galactose and lactate and discover whether the amounts of these compounds found in mozzarella cheese wheys are a factor in the problems encountered during the concentration, lactose crystallization, and spray-drying steps.

Synthesis, structural properties and catalytic activity of MgO-SnO2 nanocatalysts

NASA Astrophysics Data System (ADS)

Perveen, Hina; Farrukh, Muhammad Akhyar; Khaleeq-ur-Rahman, Muhammad; Munir, Badar; Tahir, Muhammad Ashraf

2015-01-01

Surfactant controlled synthesis of magnesium oxide-tin oxide (MgO-SnO2) nanocatalysts was carried out via the hydrothermal method. Concentration of sodium dodecyl sulfate (SDS) was varied while all other reaction conditions were kept constant same for this purpose. Furthermore, MgO-SnO2 nanocatalysts were also prepared by changing the precursor's concentration. These precursors are magnesium nitrate Mg(NO3)2 · 6H2O and tin chloride (SnCl4 · 5H2O). The influence of these reaction parameters on the sizes and morphology of the nanocatalysts were studied by using Fourier transform infrared (FTIR) spectroscopy, Scanning electron microscopy-Energy dispersive X-ray (SEM-EDX), Powder X-ray diffraction (XRD), Transmission electron microscopy and Thermo gravimetric analysis (TGA). The catalytic efficiency of MgO-SnO2 was checked against 2,4-dinitrophenylhydrazine (DNPH), which is an explosive compound. The nanocatalysts were found as a good catalyst to degrade the DNPH. Catalytic activity of nanocatalysts was observed up to 19.13% for the degradation DNPH by using UV-spectrophotometer.

Experimental evidence for a phase transition in magnesium oxide at exoplanet pressures

DOE PAGES

Coppari, F.; Smith, R. F.; Eggert, J. H.; ...

2013-09-22

Here, magnesium oxide, an important component of the Earth’s mantle, has been extensively studied in the pressure and temperature range found within the Earth. However,much less is known about its behavior under conditions appropriate for newly-discovered super-Earth planets, where pressures can exceed 1000 GPa (10 Mbar). It is widely believed that MgO will follow the rocksalt (B1) to cesium chloride (B2) transformation pathway commonly found for many alkali halides, alkaline earth oxides and various other ionic compounds. Static compression experiments have determined the structure of MgO to 250 GPa but have been unable to reach pressures necessary to induce themore » predicted transformation, resulting in large uncertainties regarding its properties under conditions relevant to super-Earths and other large planets. Here we report new dynamic x-ray diffraction measurements of ramp-compressed MgO to 900 GPa.We report evidence for the B2 phase beginning near 600 GPa, remaining stable on further compression to 900 GPa, the highest pressure diffraction data ever collected.« less

Water quality assessment of sacred glacial Lake Satopanth of Garhwal Himalaya, India

NASA Astrophysics Data System (ADS)

Sharma, Ramesh C.; Kumar, Rahul

2017-12-01

Satopanth Lake is a glacial lake, located at an altitude of 4600 m above sea level in Garhwal Himalaya of Uttarakhand state in India where an attempt was made to assess the water quality. A total of sixteen physico-chemical parameters including temperature, hardness, alkalinity, dissolved oxygen, conductivity, pH, calcium, magnesium, chlorides, nitrates, sulphates and phosphates were recorded during 2014 and 2015 between June and August in ice-free period. The mean values of pH ranged from 6.85 to 7.10; water temperature fluctuated from 0.1 to 0.3 °C; dissolved oxygen varied from 5.90 to 6.0 mg.L-1; free CO2 varied from 8.40 to 8.60 mg.L-1; total dissolved solids varied from 88.0 to 89.5 mg.L-1; calcium from 7.88 to 7.95 mg.L-1; magnesium from 0.53 to 0.66 mg.L-1. All the physico-chemical values were within the prescribed WHO/BIS limit for drinking water. Water Quality Index (WQI) calculated based on these parameters also revealed the excellent quality of lake water.

Facile solvothermal synthesis of mesostructured Fe3O4/chitosan nanoparticles as delivery vehicles for pH-responsive drug delivery and magnetic resonance imaging contrast agents.

PubMed

Zhao, Guanghui; Wang, Jianzhi; Peng, Xiaomen; Li, Yanfeng; Yuan, Xuemei; Ma, Yingxia

2014-02-01

We report a facile fabrication of a host-metal-guest coordination-bonding system in a mesostructured Fe3O4/chitosan nanoparticle that can act as a pH-responsive drug-delivery system. The mesostructured Fe3O4/chitosan was synthesized by a solvothermal approach with iron(III) chloride hexahydrate as a precursor, ethylene glycol as a reducing agent, ammonium acetate as a porogen, and chitosan as a surface-modification agent. Subsequently, doxorubicin (DOX), acting as a model drug (guest), was loaded onto the mesostructured Fe3O4/chitosan nanoparticles, with chitosan acting as a host molecule to form the NH2-Zn(II)-DOX coordination architecture. The release of DOX can be achieved through the cleavage of coordination bonds that are sensitive to variations in external pH under weakly acidic conditions. The pH-responsive nature of the nanoparticles was confirmed by in vitro releases and cell assay tests. Furthermore, the relaxation efficiency of the nanoparticles as high-performance magnetic resonance imaging contrast agents was also investigated. Experimental results confirm that the synthesized mesostructured Fe3O4/chitosan is a smart nanovehicle for drug delivery owing to both its pH-responsive nature and relaxation efficiency. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reduction of C Bonds Proceeds with Retention of Configuration: Stereochemical Investigation of the Heterogeneous Reduction by Dideuterium of (Homohypostrophene)Neopentyl(2-Norbornyl)Platinum(II) Complexes on Platinum Black.

DTIC Science & Technology

1991-04-23

ClIH16: C, 89.12; H, 10.88; Found: C, 88.85; H, 10.90. Synthesis of Grignard Reagents . Neopentylmagnesium chloride. Into a 500-mL round-bottomed flask... Grignard reagent several times using the following procedure. We placed 5.0 g (0.206 mol) of magnesium chips and a magnetic stir bar to a 200-mL round...Norbornylmagnesium bromide. This Grignard reagent was synthesized using a variation on established procedures. 58,60 We transferred under argon 50.0 mL (30.0 mmol

Synthesis and Evaluation of Strychnos Alkaloids as MDR Reversal Agents for Cancer Cell Eradication

DTIC Science & Technology

2014-01-01

followed by magnesium in MeOH to afford 11 in 75% yield (one-pot). Alkylation with (Z)-2-iodobutenyl bromide23 and acyla- tion with bromoacetyl chloride...eluting with MeOH/CH2Cl2 (0.4:9.6? 1:9). The material was washed with a solution of 25% aq NaOH (10 mL), which afforded 24 mg (71%) of Table 2...with MeOH/CH2Cl2 (0.4:9.6? 1:9). The material was washed with a solution of 25% aq NaOH (10 mL), which afforded 90 mg (86%) of 2 as yellow liquid

Analytical results for 544 water samples collected in the Attean Quartz Monzonite in the vicinity of Jackman, Maine

USGS Publications Warehouse

Ficklin, W.H.; Nowlan, G.A.; Preston, D.J.

1983-01-01

Water samples were collected in the vicinity of Jackman, Maine as a part of the study of the relationship of dissolved constituents in water to the sediments subjacent to the water. Each sample was analyzed for specific conductance, alkalinity, acidity, pH, fluoride, chloride, sulfate, phosphate, nitrate, sodium, potassium, calcium, magnesium, and silica. Trace elements determined were copper, zinc, molybdenum, lead, iron, manganese, arsenic, cobalt, nickel, and strontium. The longitude and latitude of each sample location and a sample site map are included in the report as well as a table of the analytical results.

Improvement of ion chromatography with ultraviolet photometric detection and comparison with conductivity detection for the determination of serum cations.

PubMed

Shintani, H

1985-05-31

Studies were made of the analytical conditions required for indirect photometric ion chromatography using ultraviolet photometric detection (UV method) for the determination of serum cations following a previously developed serum pre-treatment. The sensitivities of the conductivity detection (CD) and UV methods and the amounts of serum cations determined by both methods were compared. Attempts to improve the sensitivity of the conventional UV method are reported. It was found that the mobile phase previously reported by Small and Miller showed no quantitative response when more than 4 mM copper(II) sulphate pentahydrate was used. As a result, there was no significant difference in the amounts of serum cations shown by the CD and UV methods. However, by adding 0.5-5 mM cobalt(II) sulphate heptahydrate, nickel(II) sulphate hexahydrate, zinc(II) sulphate heptahydrate or cobalt(II) diammonium sulphate hexahydrate to 0.5-1.5 mM copper(II) sulphate pentahydrate, higher sensitivity and a quantitative response were attained.

Hybrid organic-inorganic coatings including nanocontainers for corrosion protection of magnesium alloy ZK30

NASA Astrophysics Data System (ADS)

Kartsonakis, I. A.; Koumoulos, E. P.; Charitidis, C. A.; Kordas, G.

2013-08-01

This study is focused on the fabrication, characterization, and application of corrosion protective coatings to magnesium alloy ZK30. Hybrid organic-inorganic coatings were synthesized using organic-modified silicates together with resins based on bisphenol A diglycidyl ether. Cerium molybdate nanocontainers (ncs) with diameter 100 ± 20 nm were loaded with corrosion inhibitor 2-mercaptobenzothiazole and incorporated into the coatings in order to improve their anticorrosion properties. The coatings were investigated for their anticorrosion and nanomechanical properties. The morphology of the coatings was examined by scanning electron microscopy. The composition was estimated by energy-dispersive X-ray analysis. The mechanical integrity of the coatings was studied through nanoindentation and nanoscratch techniques. Scanning probe microscope imaging of the coatings revealed that the addition of ncs creates surface incongruity; however, the hardness to modulus ratio revealed significant strengthening of the coating with increase of ncs. Studies on their corrosion behavior in 0.5 M sodium chloride solutions at room temperature were made using electrochemical impedance spectroscopy. Artificial defects were formatted on the surface of the films in order for possible self-healing effects to be evaluated. The results showed that the coated magnesium alloys exhibited only capacitive response after exposure to corrosive environment for 16 months. This behavior denotes that the coatings have enhanced barrier properties and act as an insulator. Finally, the scratched coatings revealed a partial recovery due to the increase of charge-transfer resistance as the immersion time elapsed.

Enhanced MFC power production and struvite recovery by the addition of sea salts to urine.

PubMed

Merino-Jimenez, Irene; Celorrio, Veronica; Fermin, David J; Greenman, John; Ieropoulos, Ioannis

2017-02-01

Urine is an excellent fuel for electricity generation in Microbial Fuel Cells (MFCs), especially with practical implementations in mind. Moreover, urine has a high content in nutrients which can be easily recovered. Struvite (MgNH 4 PO 4 ·6H 2 O) crystals naturally precipitate in urine, but this reaction can be enhanced by the introduction of additional magnesium. In this work, the effect of magnesium additives on the power output of the MFCs and on the catholyte generation is evaluated. Several magnesium sources including MgCl 2 , artificial sea water and a commercially available sea salts mixture for seawater preparation (SeaMix) were mixed with real fresh human urine in order to enhance struvite precipitation. The supernatant of each mixture was tested as a feedstock for the MFCs and it was evaluated in terms of power output and catholyte generation. The commercial SeaMix showed the best performance in terms of struvite precipitation, increasing the amount of struvite in the solid collected from 21% to 94%. Moreover, the SeaMix increased the maximum power performance of the MFCs by over 10% and it also changed the properties of the catholyte collected by increasing the pH, conductivity and the concentration of chloride ions. These results demonstrate that the addition of sea-salts to real urine is beneficial for both struvite recovery and electricity generation in MFCs. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Bromide, Chloride, and Sulfate Concentrations, and Specific Conductance, Lake Texoma, Texas and Oklahoma, 2007-08

USGS Publications Warehouse

Baldys, Stanley

2009-01-01

The U.S. Geological Survey, in cooperation with the City of Dallas Water Utilities Division, collected water-quality data from 11 sites on Lake Texoma, a reservoir on the Texas-Oklahoma border, during April 2007-September 2008. At 10 of the sites, physical properties (depth, specific conductance, pH, temperature, dissolved oxygen, and alkalinity) were measured and samples were collected for analysis of selected dissolved constituents (bromide, calcium, magnesium, potassium, sodium, carbonate, bicarbonate, chloride, and sulfate); at one site, only physical properties were measured. The primary constituent of interest was bromide. Bromate can form when ozone is used to disinfect raw water containing bromide, and bromate is a suspected human carcinogen. Chloride and sulfate were of secondary interest. Only the analytical results for bromide, chloride, sulfate, and measured specific conductance are discussed in this report. Median dissolved bromide concentrations ranged from 0.28 to 0.60 milligrams per liter. The largest median dissolved bromide concentration (0.60 milligram per liter at site 11) was from the Red River arm of Lake Texoma. Dissolved bromide concentrations generally were larger in the Red River arm of Lake Texoma than in the Washita arm of the lake. Median dissolved chloride concentrations were largest in the Red River arm of Lake Texoma at site 11 (431 milligrams per liter) and smallest at site 8 (122 milligrams per liter) in the Washita arm. At site 11 in the Red River arm, the mean and median chloride concentrations exceeded the secondary maximum contaminant level of 300 milligrams per liter for chloride established by the 'Texas Surface Water Quality Standards' for surface-water bodies designated for the public water supply use. Median dissolved sulfate concentrations ranged from 182 milligrams per liter at site 4 in the Big Mineral arm to 246 milligrams per liter at site 11 in the Red River arm. None of the mean or median sulfate concentrations exceeded the secondary maximum contaminant level of 300 milligrams per liter. Median specific conductance measurements at sites ranged from 1,120 microsiemens per centimeter at site 8 in the Washita arm to 2,100 microsiemens per centimeter in the Red River arm. The spatial distribution of specific conductance in Lake Texoma was similar to that of bromide and chloride, with larger specific conductance values in the Red River arm compared to those in the Washita arm.

Effects of magnesium chloride on rocuronium-induced neuromuscular blockade and sugammadex reversal in an isolated rat phrenic nerve-hemidiaphragm preparation: An in-vitro study.

PubMed

Sung, Tae-Yun; You, Hwang-Ju; Cho, Choon-Kyu; Choi, Hey Ran; Kim, Yong Beom; Shin, Yong Sup; Yang, Hong Seuk

2018-03-01

Magnesium potentiates the effects of nondepolarising muscle relaxants. However, few studies have used magnesium chloride (MgCl2). Sugammadex reverses neuromuscular block by steroidal nondepolarising muscle relaxants. To assess the effects of MgCl2 on rocuronium-induced neuromuscular blockade and its reversal by sugammadex. In-vitro experimental study. Animal laboratory, Asan Medical Center, Seoul, South Korea, from 20 March 2016 to 3 April 2016. Forty male Sprague Dawley rats. Left phrenic nerve-hemidiaphragms from 40 Sprague Dawley rats were allocated randomly to four groups (1, 2, 3 and 4 mmol l MgCl2 group, n = 10 each). Rocuronium was administered cumulatively until the first twitch of train-of-four (TOF) disappeared completely. Then, equimolar sugammadex was administered. The effective concentration (EC) of rocuronium was obtained in each group. After administering sugammadex, recovery of the first twitch height and the TOF ratio were measured for 30 min. EC50, EC90 and EC95 significantly decreased as the concentration of MgCl2 increased (all P ≤ 0.001), except the comparison between the 3 and 4 mmol l MgCl2 groups. After administration of sugammadex, the maximal TOF ratio (%) was lower in the 4 mmol l MgCl2 group than the 1 mmol l MgCl2 group [median 91.7 interquartile range (83.4 to 95.8) vs. 98.3 interquartile range (92.2 to 103.4), P = 0.049]. The mean time (s) from sugammadex injection to achieving maximal first twitch was significantly prolonged in the 4 mmol l MgCl2 group vs. the 1 mmol l MgCl2 and 2 mmol l MgCl2 groups [1483.9 (± 237.0) vs. 1039.0 (± 351.8) and 926.0 (± 278.1), P = 0.022 and 0.002, respectively]. Increases in MgCl2 concentration reduce the ECs of rocuronium. In addition, administering sugammadex equimolar to the administered rocuronium shows limited efficacy as MgCl2 concentration is increased. The in-vitro study was not registered in a database.

Environmental impact of municipal dumpsite leachate on ground-water quality in Jawaharnagar, Rangareddy, Telangana, India

NASA Astrophysics Data System (ADS)

Soujanya Kamble, B.; Saxena, Praveen Raj

2017-10-01

The aim of the present work was to study the impact of dumpsite leachate on ground-water quality of Jawaharnagar village. Leachate and ground-water samples were investigated for various physico-chemical parameters viz., pH, total dissolved solids (TDS), total hardness (TH), calcium (Ca2+), magnesium (Mg2+), sodium (Na+), potassium (K+), chloride (Cl-), carbonates (CO3 2-), bicarbonates (HCO3 -), nitrates (NO3 -), and sulphates (SO4 2-) during dry and wet seasons in 2015 and were reported. The groundwater was hard to very hard in nature, and the concentrations of total dissolved solids, chlorides, and nitrates were found to be exceeding the permissible levels of WHO drinking water quality standards. Piper plots revealed that the dominant hydrochemical facies of the groundwater were of calcium chloride (CaCl2) type and alkaline earths (Ca2+ and Mg2+) exceed the alkali (Na+ and SO4 2-), while the strong acids (Cl- and SO4 2-) exceed the weak acids (CO3 2- and HCO3 -). According to USSL diagram, all the ground-water samples belong to high salinity and low-sodium type (C3S1). Overall, the ground-water samples collected around the dumpsite were found to be polluted and are unfit for human consumption but can be used for irrigation purpose with heavy drainage and irrigation patterns to control the salinity.

Hydrogeochemistry of the Catskill Mountains of New York.

PubMed

Parisio, Steven J; Halton, Casey R; Bowles, Emily K; Keimowitz, Alison R; Corey, Karen; Myers, Kellie; Adams, Morton S

2013-09-01

Major ion chemistry of Catskill region groundwater is characterized on the basis of 207 analyses compiled from three sources, including a web-based U.S. Geological Survey database, state agency regulatory compliance data, and sampling of trailside springs performed by the authors. All samples were analyzed for the complete set of major ions, including calcium, magnesium, sodium, potassium, bicarbonate, chloride, sulfate, and nitrate. Groundwater in pristine, high-elevation areas of the Catskill Peaks was found to be predominantly of calcium bicarbonate, calcium sulfate, or calcium bicarbonate-sulfate types, with relatively low ionic strength. Groundwater at lower elevations along the margins of the region or in valley bottoms was predominantly of sodium-chloride or sodium-bicarbonate types, showing the effects of road salt and other local pollution sources. Nitrate and sulfate enrichment attributable to regional air pollution sources were most evident in the high-elevation spring samples, owing to the generally low concentrations of other major ions. Trailside springs appear to be viable low-cost sources for obtaining samples representative of groundwater, especially in remote and inaccessible areas of the Catskill forest preserve. © 2013 New York Academy of Sciences.

[Correlation between urinary stones and urinary tract infections].

PubMed

Chen, Peilin; Zhang, Liguo; Meng, Bin

2014-05-01

To explore the correlation of urinary stones and urinary tract infections. 300 cases with urinary tract stones received in our hospital from Feb. 2010 to Oct. 2013 were chosen as study samples. Urine routine index, situation of urine positivity and urinary tract infection after surgery were analyzed while, intraoperative cotton swabs were tested after being dipped in liquid near stones. Main components of stones in non-infected and infected stone group were analyzed and compared. Data on urolithiasis was collected. 96 infected stones were found in 300 patients, accounting for 32%, which including 35 cases of E. coli (36.5%), 28 cases of Staphylococcus epidermidis (29.2%), and 15 cases of Proteus mirabilis (15.6%). Numbers of urine abnormalities, urine positivities, positive intraoperative cotton swabs and urinary tract infections in patients in the group with infected stones, were significantly higher than in the group without infected stones and the differences were statistically significant (χ² = 8.203, 73.99, 178.9, 24.26, P < 0.05). The incidence rates of hexahydrate magnesium ammonium phosphate, carbonate apatite and hydroxyapatite stones in the group with infected stones were significantly higher than those in the non-infected-rock group while the incidence rates of calcium oxalate and uric acid stones were found significantly lower than those in the non-infected-stone group, with differences statistically significant (χ² = 167.6, 21.00, 8.586, 73.17, 48.79, P < 0.05). Bacteria could cause urinary tract stones, and infected stones were always associated with urinary tract infections. Bacteria detection in patients with urinary calculi was particularly important to avoid the urinary tract infections.

Can perchlorates be transformed to hydrogen peroxide (H2O2) products by cosmic rays on the Martian surface?

NASA Astrophysics Data System (ADS)

Crandall, Parker B.; Góbi, Sándor; Gillis-Davis, Jeffrey; Kaiser, Ralf I.

2017-09-01

Due to their oxidizing properties, perchlorates (ClO4-) are suggested by the planetary science community to play a vital role in the scarcity of organics on the Martian surface. However, alternative oxidation agents such as hydrogen peroxide (H2O2) have received surprisingly little attention. In this study, samples of magnesium perchlorate hexahydrate (Mg(ClO4)2 · 6H2O) were exposed to monoenergetic electrons and D2+ ions separately, sequentially, and simultaneously to probe the effects of galactic cosmic ray exposure of perchlorates and the potential incorporation of hydrogen (deuterium) into these minerals. The experiments were carried out under ultrahigh-vacuum conditions at 50 K, after which the samples were slowly heated to 300 K while the subliming products were monitored by a quadrupole mass spectrometer. In all cases, molecular oxygen (O2) was detected upon the onset of irradiation and also during the warmup phase. In case of a simultaneous D2+-electron exposure, deuterated water (D2O) and deuterium peroxide (D2O2) were also detected in the warmup phase, whereas only small amounts of D2O2 were found after an exclusive D2+ irradiation. These experiments yield the first data identifying hydrogen peroxide as a potential product in the interaction of cosmic rays with perchlorates in the Martian regolith revealing that perchlorates are capable of producing multiple oxidizing agents (O2 and D2O2) that may account for the destruction of organics on the Martian surface.

Chronic dietary magnesium-L-threonate speeds extinction and reduces spontaneous recovery of a conditioned taste aversion

PubMed Central

Mickley, G. Andrew; Hoxha, Nita; Luchsinger, Joseph L.; Rogers, Morgan M.; Wiles, Nathanael R.

2013-01-01

Elevation of brain magnesium enhances synaptic plasticity and extinction of conditioned fear memories. This experiment examined the generalizability of this phenomenon by studying the effects of a novel magnesium compound, magnesium-L-threonate (MgT), on conditioned taste aversion (CTA) extinction and spontaneous recovery (SR). Adult male Sprague-Dawley rats were maintained on a 23-hour water deprivation cycle and acquired a CTA following the taste of a CS [0.3% saccharin + 16mg/ml MgT (SAC+MgT)] paired with a US [81 mg/kg (i.p.) Lithium Chloride (LiCl)]. Following CTA acquisition, rats drank a water + MgT solution for up to 1 hour/day over the next 31 days. For 14 additional days, some animals continued water + MgT treatment, but others drank water only to allow MgT to be eliminated from the body. We then employed 2 different extinction paradigms: (1) CS-Only (CSO), in which SAC was presented, every-other day, or (2) Explicitly Unpaired (EU), in which both SAC and LiCl were presented, but on alternate days. EU extinction procedures have been shown to speed CTA extinction and reduce spontaneous recovery of the aversion. Throughout extinction, half of the rats in each group continued to drink MgT (now in SAC or supplemental water+MgT solution), whereas the other half drank SAC only/water only until SAC drinking reached ≥ 90% of baseline (asymptotic extinction). Rats receiving MgT just before/during extinction drank less SAC on the first day of extinction suggesting that they had retained a stronger CTA. MgT enhanced the rate of extinction. Furthermore, the MgT-treated rats showed a relatively modest SR of the CTA 30 days later – indicating that the extinction procedure was more effective for these animals. Our data suggest that long-term dietary MgT may enhance the consolidation/retention of a CTA, speed extinction, and inhibit SR of this learned aversion. PMID:23474371

Water-quality characteristics of six small, semiarid watersheds in the Green River coal region of Colorado

USGS Publications Warehouse

Turk, John T.; Parker, Randolph S.

1982-01-01

Analysis of major and trace constituents in streams flowing through six semiarid watersheds indicates that the stream chemistry is characterized by saturation with respect to common carbonate minerals (calcium, magnesium, iron, manganese, and lead). The solubility of the carbonate minerals may be a major control on the absolute and relative concentrations of calcium, magnesium, bicarbonate, iron, manganese, and lead; however, other mechanisms probably control the concentrations of cadmium and zinc. Statistical analyses indicate that the mean concentrations of the major ions in the two climatic areas studied are significantly (P=0.05) different from one another, with larger mean concentrations in the more arid area. Trace-metal concentrations were similar from one area to another and indistinguishable from site to site (P=0.05) for lead, cadmium, and zinc. Linear regressions of major ion concentration to specific conductance are similar in both areas for sodium, bicarbonate, sulfate, and chloride. Results of the study may be useful in providing a first approximation of stream chemistry in other watersheds with the same geologic setting, determining watersheds with similar geochemical controls, and determining future changes in stream chemistry in the watersheds studied. (USGS)

Evaluation of Microstructure, Mechanical Properties and Corrosion Resistance of Friction Stir-Welded Aluminum and Magnesium Dissimilar Alloys

NASA Astrophysics Data System (ADS)

Verma, Jagesvar; Taiwade, Ravindra V.; Sapate, Sanjay G.; Patil, Awanikumar P.; Dhoble, Ashwinkumar S.

2017-10-01

Microstructure, mechanical properties and corrosion resistance of dissimilar friction stir-welded aluminum and magnesium alloys were investigated by applying three different rotational speeds at two different travel speeds. Sound joints were obtained in all the conditions. The microstructure was examined by an optical and scanning electron microscope, whereas localized chemical information was studied by energy-dispersive spectroscopy. Stir zone microstructure showed mixed bands of Al and Mg with coarse and fine equiaxed grains. Grain size of stir zone reduced compared to base metals, indicated by dynamic recrystallization. More Al patches were observed in the stir zone as rotational speed increased. X-ray diffraction showed the presence of intermetallics in the stir zone. Higher tensile strength and hardness were obtained at a high rotational speed corresponding to low travel speed. Tensile fractured surface indicated brittle nature of joints. Dissimilar friction stir weld joints showed different behaviors in different corrosive environments, and better corrosion resistance was observed at a high rotational speed corresponding to low travel speed (FW3) in a sulfuric and chloride environments. Increasing travel speed did not significantly affect on microstructure, mechanical properties and corrosion resistance as much as the rotational speed.

Magnesia-Based Cements: A Journey of 150 Years, and Cements for the Future?

PubMed

Walling, Sam A; Provis, John L

2016-04-13

This review examines the detailed chemical insights that have been generated through 150 years of work worldwide on magnesium-based inorganic cements, with a focus on both scientific and patent literature. Magnesium carbonate, phosphate, silicate-hydrate, and oxysalt (both chloride and sulfate) cements are all assessed. Many such cements are ideally suited to specialist applications in precast construction, road repair, and other fields including nuclear waste immobilization. The majority of MgO-based cements are more costly to produce than Portland cement because of the relatively high cost of reactive sources of MgO and do not have a sufficiently high internal pH to passivate mild steel reinforcing bars. This precludes MgO-based cements from providing a large-scale replacement for Portland cement in the production of steel-reinforced concretes for civil engineering applications, despite the potential for CO2 emissions reductions offered by some such systems. Nonetheless, in uses that do not require steel reinforcement, and in locations where the MgO can be sourced at a competitive price, a detailed understanding of these systems enables their specification, design, and selection as advanced engineering materials with a strongly defined chemical basis.

Lithium ion conducting electrolytes

DOEpatents

Angell, C. Austen; Liu, Changle

1996-01-01

A liquid, predominantly lithium-conducting, ionic electrolyte having exceptionally high conductivity at temperatures of 100.degree. C. or lower, including room temperature, and comprising the lithium salts selected from the group consisting of the thiocyanate, iodide, bromide, chloride, perchlorate, acetate, tetrafluoroborate, perfluoromethane sulfonate, perfluoromethane sulfonamide, tetrahaloaluminate, and heptahaloaluminate salts of lithium, with or without a magnesium-salt selected from the group consisting of the perchlorate and acetate salts of magnesium. Certain of the latter embodiments may also contain molecular additives from the group of acetonitrile (CH.sub.3 CN) succinnonitrile (CH.sub.2 CN).sub.2, and tetraglyme (CH.sub.3 --O--CH.sub.2 --CH.sub.2 --O--).sub.2 (or like solvents) solvated to a Mg.sup.+2 cation to lower the freezing point of the electrolyte below room temperature. Other particularly useful embodiments contain up to about 40, but preferably not more than about 25, mol percent of a long chain polyether polymer dissolved in the lithium salts to provide an elastic or rubbery solid electrolyte of high ambient temperature conductivity and exceptional 100.degree. C. conductivity. Another embodiment contains up to about but not more than 10 mol percent of a molecular solvent such as acetone.

Lithium ion conducting electrolytes

DOEpatents

Angell, C.A.; Liu, C.

1996-04-09

A liquid, predominantly lithium-conducting, ionic electrolyte is described having exceptionally high conductivity at temperatures of 100 C or lower, including room temperature, and comprising the lithium salts selected from the group consisting of the thiocyanate, iodide, bromide, chloride, perchlorate, acetate, tetrafluoroborate, perfluoromethane sulfonate, perfluoromethane sulfonamide, tetrahaloaluminate, and heptahaloaluminate salts of lithium, with or without a magnesium-salt selected from the group consisting of the perchlorate and acetate salts of magnesium. Certain of the latter embodiments may also contain molecular additives from the group of acetonitrile (CH{sub 3}CN), succinnonitrile (CH{sub 2}CN){sub 2}, and tetraglyme (CH{sub 3}--O--CH{sub 2}--CH{sub 2}--O--){sub 2} (or like solvents) solvated to a Mg{sup +2} cation to lower the freezing point of the electrolyte below room temperature. Other particularly useful embodiments contain up to about 40, but preferably not more than about 25, mol percent of a long chain polyether polymer dissolved in the lithium salts to provide an elastic or rubbery solid electrolyte of high ambient temperature conductivity and exceptional 100 C conductivity. Another embodiment contains up to about but not more than 10 mol percent of a molecular solvent such as acetone. 2 figs.

Mechanical properties and microstructures of a magnesium alloy gas tungsten arc welded with a cadmium chloride flux

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Z.D.; Liu, L.M.; Shen, Y.

2008-01-15

Gas tungsten arc (GTA) welds were prepared on 5-mm thick plates of wrought magnesium AZ31B alloy, using an activated flux. The microstructural characteristics of the weld joint were investigated using optical and scanning microscopy, and the fusion zone microstructure was compared with that of the base metal. The elemental distribution was also investigated by electron probe microanalysis (EPMA). Mechanical properties were determined by standard tensile tests on small-scale specimens. The as-welded fusion zone prepared using a CdCl{sub 2} flux exhibited a larger grain size than that prepared without flux; the microstructure consisted of matrix {alpha}-Mg, eutectic {alpha}-Mg and {beta}-Al{sub 12}Mg{submore » 17}. The HAZ was observed to be slightly wider for the weld prepared with a CdCl{sub 2} flux compared to that prepared without flux; thus the tensile strength was lower for the flux-prepared weld. The fact that neither Cd nor Cl was detected in the weld seam by EPMA indicates that the CdCl{sub 2} flux has a small effect on convection in the weld pool.« less

Metabolic and respiratory status of cold-stunned Kemp's ridley sea turtles (Lepidochelys kempii).

PubMed

Innis, Charles J; Tlusty, Michael; Merigo, Constance; Weber, E Scott

2007-08-01

"Cold-stunning" of sea turtles has been reported as a naturally occurring stressor for many years; however, the physiologic status of cold-stunned turtles has only been partially described. This study investigated initial and convalescent venous blood gas, acid-base, and critical plasma biochemical data for 26 naturally cold-stunned Kemp's ridley sea turtles (Lepidochelys kempii) from Cape Cod, MA, USA. Samples were analyzed for pH, pCO(2), pO(2), bicarbonate, plasma osmolality, sodium, potassium, chloride, ionized calcium, ionized magnesium, glucose, lactate, and blood urea nitrogen using a clinical point-of-care analyzer. Data were corrected for the patient's body temperature using both species-specific and more general correction methods. In general, venous blood gas, acid-base, and plasma biochemical data obtained for surviving cold-stunned Kemp's ridley sea turtles were consistent with previously documented data for sea turtles exposed to a wide range of temperatures and physiologic stressors. Data indicated that turtles were initially affected by metabolic and respiratory acidosis. Initial pH-corrected ionized calcium concentrations were lower than convalescent concentrations, and initial pH-corrected ionized magnesium concentrations were higher than convalescent concentrations.

Geochemical assessments and classification of coal mine spoils for better understanding of potential salinity issues at closure.

PubMed

Park, Jin Hee; Li, Xiaofang; Edraki, Mansour; Baumgartl, Thomas; Kirsch, Bernie

2013-06-01

Coal mining wastes in the form of spoils, rejects and tailings deposited on a mine lease can cause various environmental issues including contamination by toxic metals, acid mine drainage and salinity. Dissolution of salt from saline mine spoil, in particular, during rainfall events may result in local or regional dispersion of salts through leaching or in the accumulation of dissolved salts in soil pore water and inhibition of plant growth. The salinity in coal mine environments is from the geogenic salt accumulations and weathering of spoils upon surface exposure. The salts are mainly sulfates and chlorides of calcium, magnesium and sodium. The objective of the research is to investigate and assess the source and mobility of salts and trace elements in various spoil types, thereby predicting the leaching behavior of the salts and trace elements from spoils which have similar geochemical properties. X-ray diffraction analysis, total digestion, sequential extraction and column experiments were conducted to achieve the objectives. Sodium and chloride concentrations best represented salinity of the spoils, which might originate from halite. Electrical conductivity, sodium and chloride concentrations in the leachate decreased sharply with increasing leaching cycles. Leaching of trace elements was not significant in the studied area. Geochemical classification of spoil/waste defined for rehabilitation purposes was useful to predict potential salinity, which corresponded with the classification from cluster analysis based on leaching data of major elements. Certain spoil groups showed high potential salinity by releasing high sodium and chloride concentrations. Therefore, the leaching characteristics of sites having saline susceptible spoils require monitoring, and suitable remediation technologies have to be applied.

Assessment of a Novel Ternary Eutectic Chloride Salt for Next Generation High-Temperature Sensible Heat Storage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vidal, Judith C; Mohan, Gowtham; Venkataraman, Mahesh

A novel ternary eutectic salt mixture for high-temperature sensible heat storage, composed of sodium chloride, potassium chloride and magnesium chloride (NaKMg-Cl) was developed based on a phase diagram generated with FactSage(R). The differential scanning calorimetry (DSC) technique was used to experimentally validate the predicted melting point of the ternary eutectic composition, which was measured as 387 degrees C, in good agreement with the prediction. The ternary eutectic was compared to two binary salts formulated based on prediction of the eutectic composition by FactSage, but unfortunately DSC measurements showed that neither binary salt composition was eutectic. Nonetheless, the measured thermo-physical propertiesmore » of the ternary and the two binary mixtures are compared. Liquid heat capacities of both the ternary and binary salts were determined by using DSC with sapphire as the standard reference. The average heat capacity of the ternary mixture was recorded as 1.18 J g-1 K-1. The mass loss of the molten eutectic salts was studied up to 1000 degrees C using a thermogravimetric analyser in nitrogen, argon and air. The results showed a significant mass loss due to vaporisation in an open system, particularly above 700 degrees C. However, simulation of mass loss in a closed system with an inert cover gas indicates storage temperatures above 700 degrees C may be feasible, and highlights the importance of the design of the storage tank system. In terms of storage material cost, the NaKMg-Cl mixture is approximately 4.5 USD/kWh, which is 60% cheaper than current state-of-the-art nitrate salt mixtures.« less

Ginkgo biloba extract alleviates oxidative stress and some neurotransmitters changes induced by aluminum chloride in rats.

PubMed

Mohamed, Naglaa El-Shahat; Abd El-Moneim, Ahmed E

2017-03-01

In the present study, twenty four adult male albino rats were classified into four groups. The control group received normal diet and water; the second group was treated daily with oral dose of Ginkgo biloba (200 mg/kg body weight [b.wt]) for 3 mo; the third group was treated daily with oral dose of aluminum chloride (10 mg/kg b.wt) for 3 mo; and the fourth group was treated with both Ginkgo biloba and aluminum chloride (200 and 10 mg/kg b.wt, respectively) using a stomach tube for 3 mo. The results showed that administration of AlCl 3 to rats induced significant increase (P < 0.05) in thiobarbituric acid reactive substance and decrease (P < 0.05) in glutathione, catalase, and superoxide dismutase in brain and testis homogenates. The data also showed significant decrease (P < 0.05) in noradrenaline, dopamine, and serotonin (5-HT) levels in brain tissue. The rats administered AlCl 3 showed significant decrease (P < 0.05) in serum zinc (Zn) and copper (Cu), significant increase (P < 0.05) in serum iron (Fe), and non-significant decrease in magnesium (Mg). Furthermore, significant increase (P < 0.05) in serum alkaline phosphatase and acid phosphatase and significant decrease (P < 0.05) in testosterone were recorded. The histologic examination showed some degenerative changes in both brain and testis tissues while significant improvement in biochemical and histologic changes were observed in the aluminum chloride plus Ginkgo biloba group. It could be concluded that the protective effect of Ginkgo biloba may be attributed to its antioxidant properties. Copyright © 2017 Elsevier Inc. All rights reserved.

Hydrogeology and quality of ground water on Guemes Island, Skagit County, Washington

USGS Publications Warehouse

Kahle, S.C.; Olsen, T.D.

1995-01-01

Guemes Island, located in Puget Sound of Washington State, is experiencing population growth and seawater intrusion. The island consists of Pleistocene glacial deposits overlying bedrock. Geologic sections and a map of surficial geology were constructed and used to delineate six hydrogeologic units, three of which are aquifers. The most productive aquifer is the Double Bluff aquifer, situated at or below sea level. Water budget estimates indicate that of the 21-29 inches of precipitation received in a typical year, 0-4 inches runs off, 12-22 inches evapotranspires, and 2-10 inches recharges the ground-water system. Of the water recharged, 0.1-0.3 inches is withdrawn by wells; the remainder recharges deeper aquifer(s) or discharges from the ground-water system to drainage ditches or the sea. The median dissolved-solids concentration was 236 mg/L (milligrams per liter). Half of the samples were classified as moderately hard, the remainder as hard or very hard. Although magnesium-calcium/bicarbonate water types dominate, some samples contained large amounts of sodium and chloride. The median concentration of 0.08 mg/L for nitrate indicates that no widespread contamination from septic systems or livestock exists. Small concentrations of arsenic were present in 5 of 24 samples. Trace concentrations of volatile organic compounds were detected in three of five samples. None of the U.S. Environmental Protection Agency's maximum contaminant levels was exceeded. However, secondary maximum contaminant levels were exceeded for dissolved solids, chloride, manganese, and iron. Seasonal variability of chloride concentration was apparent in water from coastal wells that had chloride concentrations greater than 100 mg/L. Higher values occurred from April through September because of increased pumping and lower recharge.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Blood biochemical and cellular changes during a decompression procedure involving eight hours of oxygen prebreathing

NASA Technical Reports Server (NTRS)

Jauchem, J. R.

1989-01-01

Chemical and cellular parameters were measured in human subjects before and after exposure to a decompression schedule involving 8 h of oxygen prebreathing. The exposure was designed to simulate space-flight extravehicular activity (EVA) for 6 h. Several statistically significant changes in blood parameters were observed following the exposure: increases in calcium, magnesium, osmolality, low-density lipoprotein cholesterol, monocytes, and prothrombin time, and decreases in chloride, creatine phosphokinase and eosinophils. The changes, however, were small in magnitude and blood factor levels remained within normal clinical ranges. Thus, the decompression profile used in this study is not likely to result in blood changes that would pose a threat to astronauts during EVA.

Potentiostatic control of ionic liquid surface film formation on ZE41 magnesium alloy.

PubMed

Efthimiadis, Jim; Neil, Wayne C; Bunter, Andrew; Howlett, Patrick C; Hinton, Bruce R W; MacFarlane, Douglas R; Forsyth, Maria

2010-05-01

The generation of potentially corrosion-resistant films on light metal alloys of magnesium have been investigated. Magnesium alloy, ZE41 [Mg-Zn-Rare Earth (RE)-Zr, nominal composition approximately 4 wt % Zn, approximately 1.7 wt % RE (Ce), approximately 0.6 wt % Zr, remaining balance, Mg], was exposed under potentiostatic control to the ionic liquid trihexyl(tetradecyl)phosphonium diphenylphosphate, denoted [P(6,6,6,14)][DPP]. During exposure to this IL, a bias potential, shifted from open circuit, was applied to the ZE41 surface. Electrochemical impedance spectroscopy (EIS) and chronoamperometry (CA) were used to monitor the evolution of film formation on the metal surface during exposure. The EIS data indicate that, of the four bias potentials examined, applying a potential of -200 mV versus OCP during the exposure period resulted in surface films of greatest resistance. Both EIS measurements and scanning electron microscopy (SEM) imaging indicate that these surfaces are substantially different to those formed without potential bias. Time of flight-secondary ion mass spectrometry (ToF-SIMS) elemental mapping of the films was utilized to ascertain the distribution of the ionic liquid cationic and anionic species relative to the microstructural surface features of ZE41 and indicated a more uniform distribution compared with the surface following exposure in the absence of a bias potential. Immersion of the treated ZE41 specimens in a chloride contaminated salt solution clearly indicated that the ionic liquid generated surface films offered significant protection against pitting corrosion, although the intermetallics were still insufficiently protected by the IL and hence favored intergranular corrosion processes.

Crystal water as the mol-ecular glue for obtaining different co-crystal ratios: the case of gallic acid tris-caffeine hexa-hydrate.

PubMed

Vella-Zarb, L; Baisch, U

2018-04-01

The crystal structure of the hexa-hydrate co-crystal of gallic acid and caffeine, C 7 H 6 O 5 ·3C 8 H 10 N 4 O 2 ·6H 2 O or GAL3CAF·6H 2 O , is a remarkable example of the importance of hydrate water acting as structural glue to facilitate the crystallization of two components of different stoichiometries and thus to compensate an imbalance of hydrogen-bond donors and acceptors. The water mol-ecules provide the additional hydrogen bonds required to form a crystalline solid. Whereas the majority of hydrogen bonds forming the inter-molecular network between gallic acid and caffeine are formed by crystal water, only one direct classical hydrogen bond between two mol-ecules is formed between the carb-oxy-lic oxygen of gallic acid and the carbonyl oxygen of caffeine with d ( D ⋯ A ) = 2.672 (2) Å. All other hydrogen bonds either involve crystal water or utilize protonated carbon atoms as donors.

Hydrothermal preparation of ZnO-reduced graphene oxide hybrid with high performance in photocatalytic degradation

NASA Astrophysics Data System (ADS)

Zhou, Xun; Shi, Tiejun; Zhou, Haiou

2012-06-01

Hydrothermal method was utilized to prepare reduced graphene oxide (RGO) and fabricate ZnO-RGO hybrid (ZnO-RGO) with zinc nitrate hexahydrate and graphene oxide (GO) as raw materials under pH value of 11 adjusted by ammonia water. During the process of reduction of GO, hydrothermal condition with ammonia provided thermal and chemical factors to synthesize RGO. The retained functional groups on RGO planes played an important role in anchoring ZnO to RGO, which was characterized by X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), scanning and transmission electron microscopy and photoluminescence spectra. The various mass ratios of zinc nitrate hexahydrate to GO used to prepare ZnO-RGO impacted significantly on the morphology of ZnO nanostructures such as nanoparticles and nanorods. And, the RGO sheets wrapped ZnO nanoparticles and nanorods very tightly. After the emission of photo electrons from ZnO, RGO in ZnO-RGO can effectively transfer the photo electrons to exhibit a high performance and reproducibility in photocatalytic degradation toward methylene blue (MB) absorbed on the surface of RGO through π-π conjugation.

Improving the Explosive Performance of Aluminum Nanoparticles with Aluminum Iodate Hexahydrate (AIH).

PubMed

Gottfried, Jennifer L; Smith, Dylan K; Wu, Chi-Chin; Pantoya, Michelle L

2018-05-23

A new synthesis approach for aluminum particles enables an aluminum core to be passivated by an oxidizing salt: aluminum iodate hexahydrate (AIH). Transmission electron microscopy (TEM) images show that AIH replaces the Al 2 O 3 passivation layer on Al particles that limits Al oxidation. The new core-shell particle reactivity was characterized using laser-induced air shock from energetic materials (LASEM) and results for two different Al-AIH core-shell samples that vary in the AIH concentration demonstrate their potential use for explosive enhancement on both fast (detonation velocity) and slow (blast effects) timescales. Estimates of the detonation velocity for TNT-AIH composites suggest an enhancement of up to 30% may be achievable over pure TNT detonation velocities. Replacement of Al 2 O 3 with AIH allows Al to react on similar timescales as detonation waves. The AIH mixtures tested here have relatively low concentrations of AIH (15 wt. % and 6 wt. %) compared to previously reported samples (57.8 wt. %) and still increase TNT performance by up to 30%. Further optimization of AIH synthesis could result in additional increases in explosive performance.

An effective iodide formulation for killing Bacillus and Geobacillus spores over a wide temperature range.

PubMed

Kida, N; Mochizuki, Y; Taguchi, F

2004-01-01

To develop a sporicidal reagent which shows potent activity against bacterial spores not only at ambient temperatures but also at low temperatures. Suspension tests on spores of Bacillus and Geobacillus were conducted with the reagent based on a previously reported agent (N. Kida, Y. Mochizuki and F. Taguchi, Microbiology and Immunology 2003; 47: 279-283). The modified reagent (tentatively designated as the KMT reagent) was composed of 50 mmol l(-1) EDTA-2Na, 50 mmol l(-1) ferric chloride hexahydrate (FeCl(3).6H(2)O), 50 mmol l(-1) potassium iodide (KI) and 50% ethanol in 0.85% NaCl solution at pH 0.3. The KMT reagent showed significant sporicidal activity against three species of Bacillus and Geobacillus spores over a wide range of temperature. The KMT reagent had many practical advantages, i.e. activity was much less affected by organic substances than was sodium hypochlorite, it did not generate any harmful gas and it was stable for a long period at ambient temperatures. The mechanism(s) of sporicidal activity of the KMT reagent was considered to be based on active iodine species penetrating the spores with enhanced permeability of the spore cortex by a synergistic effect of acid, ethanol and generated active oxygen. The data suggest that the KMT reagent shows potent sporicidal activity over a wide range temperatures and possesses many advantages for practical applications. The results indicate development of a highly applicable sporicidal reagent against Bacillus and Geobacillus spores.

Synthesis of Ferrofluids Made of Iron Oxide Nanoflowers: Interplay between Carrier Fluid and Magnetic Properties

PubMed Central

Dughiero, Fabrizio; Forzan, Michele; Bertani, Roberta

2017-01-01

Ferrofluids are nanomaterials consisting of magnetic nanoparticles that are dispersed in a carrier fluid. Their physical properties, and hence their field of application are determined by intertwined compositional, structural, and magnetic characteristics, including interparticle magnetic interactions. Magnetic nanoparticles were prepared by thermal decomposition of iron(III) chloride hexahydrate (FeCl3·6H2O) in 2-pyrrolidone, and were then dispersed in two different fluids, water and polyethylene glycol 400 (PEG). A number of experimental techniques (especially, transmission electron microscopy, Mössbauer spectroscopy and superconducting quantum interference device (SQUID) magnetometry) were employed to study both the as-prepared nanoparticles and the ferrofluids. We show that, with the adopted synthesis parameters of temperature and FeCl3 relative concentration, nanoparticles are obtained that mainly consist of maghemite and present a high degree of structural disorder and strong spin canting, resulting in a low saturation magnetization (~45 emu/g). A remarkable feature is that the nanoparticles, ultimately due to the presence of 2-pyrrolidone at their surface, are arranged in nanoflower-shape structures, which are substantially stable in water and tend to disaggregate in PEG. The different arrangement of the nanoparticles in the two fluids implies a different strength of dipolar magnetic interactions, as revealed by the analysis of their magnetothermal behavior. The comparison between the magnetic heating capacities of the two ferrofluids demonstrates the possibility of tailoring the performances of the produced nanoparticles by exploiting the interplay with the carrier fluid. PMID:29113079

Synthesis of Ferrofluids Made of Iron Oxide Nanoflowers: Interplay between Carrier Fluid and Magnetic Properties.

PubMed

Spizzo, Federico; Sgarbossa, Paolo; Sieni, Elisabetta; Semenzato, Alessandra; Dughiero, Fabrizio; Forzan, Michele; Bertani, Roberta; Del Bianco, Lucia

2017-11-05

Ferrofluids are nanomaterials consisting of magnetic nanoparticles that are dispersed in a carrier fluid. Their physical properties, and hence their field of application are determined by intertwined compositional, structural, and magnetic characteristics, including interparticle magnetic interactions. Magnetic nanoparticles were prepared by thermal decomposition of iron(III) chloride hexahydrate (FeCl₃·6H₂O) in 2-pyrrolidone, and were then dispersed in two different fluids, water and polyethylene glycol 400 (PEG). A number of experimental techniques (especially, transmission electron microscopy, Mössbauer spectroscopy and superconducting quantum interference device (SQUID) magnetometry) were employed to study both the as-prepared nanoparticles and the ferrofluids. We show that, with the adopted synthesis parameters of temperature and FeCl₃ relative concentration, nanoparticles are obtained that mainly consist of maghemite and present a high degree of structural disorder and strong spin canting, resulting in a low saturation magnetization (~45 emu/g). A remarkable feature is that the nanoparticles, ultimately due to the presence of 2-pyrrolidone at their surface, are arranged in nanoflower-shape structures, which are substantially stable in water and tend to disaggregate in PEG. The different arrangement of the nanoparticles in the two fluids implies a different strength of dipolar magnetic interactions, as revealed by the analysis of their magnetothermal behavior. The comparison between the magnetic heating capacities of the two ferrofluids demonstrates the possibility of tailoring the performances of the produced nanoparticles by exploiting the interplay with the carrier fluid.

Improved thin-layer chromatography bioautographic assay for the detection of actylcholinesterase inhibitors in plants.

PubMed

Yang, Zhong-Duo; Song, Zhu-Wen; Ren, Jin; Yang, Ming-Jun; Li, Shuo

2011-01-01

Thin-layer chromatography (TLC) bioautographic method is a simple and rapid method to screen acetylcholinesterase inhibitors from plant extracts. However, the high consumption of enzyme (6 U/mL) in current methods makes the procedure expensive, which is an obstacle to scientific research centers lacking funding. To develop a new low-cost TLC bioautographic method. A series of compounds, as substrates, were synthesised and their ability to be hydrolysed by acetylcholinesterase was evaluated by the HPLC method. 4-Methoxyphenyl acetate (14) was proved to be an appropriate substrate for TLC bioautographic assay. Therefore a new and cheap TLC bioautographic assay was set up. The mechanism of this new method is that the enzyme converts 4-methoxylphenyl acetate into 4-methoxyphenol, which reacts with a solution of potassium ferricyanide ([K₃(FeCN)₆]) and iron chloride hexahydrate (FeCl₃·6H₂O) to make an aquamarine blue coloured background on the TLC plates. Regions of the TLC plate which contain acetylcholinesterase inhibitors show up as light yellow spots against the background. The consumption of enzyme (1 U/mL) in the new method is low and the detection limit of two known acetylcholinesterase inhibitors, huperzine A (0.0001 μg) and physostigmine (0.001 μg), for this assay are close to published values. A low-cost TLC bioautographic method was developed, which will benefit research groups pursuing natural acetylcholinesterase inhibitors. Copyright © 2011 John Wiley & Sons, Ltd.

Growth and characterization of diammonium copper disulphate hexahydrate single crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siva Sankari, R.; Perumal, Rajesh Narayana, E-mail: r.shankarisai@gmail.com

2014-03-01

Graphical abstract: Diammonium copper disulphate hexahydrate (DACS) is one of the most promising inorganic dielectric crystals with exceptional mechanical properties. Good quality crystals of DACS were grown by using solution method in a period of 30 days. The grown crystals were subjected to single crystal X-ray diffraction analysis in order to establish their crystalline nature. Thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis were performed for the crystal. Several solid state physical parameters have been determined for the grown crystals. The dielectric constant and the dielectric loss and AC conductivity of the grown crystal were studied as a functionmore » of frequency and temperature has been calculated and plotted. - Highlights: • Diammonium copper disulphate is grown for the first time and CCDC number obtained. • Thermal analysis is done to see the stability range of the crystals. • Band gap and UV cut off wavelength of the crystal are determined to be 2.4 eV and 472.86 nm, respectively. • Dielectric constant, dielectric loss and AC conductivity are plotted as a function of applied field. - Abstract: Diammonium copper disulphate hexahydrate is one of the most promising inorganic crystals with exceptional dielectric properties. A good quality crystal was harvested in a 30-day period using solution growth method. The grown crystal was subjected to various characterization techniques like single crystal X-ray diffraction analysis, thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis. Unit cell dimensions of the grown crystal have been identified from XRD studies. Functional groups of the title compounds have been identified from FTIR studies. Thermal stability of the samples was checked by TG/DTA studies. Band gap of the crystal was calculated. The dielectric constant and dielectric loss were studied as a function of frequency of the applied field. AC conductivity was plotted as a function of temperature.« less

Hydrological and chemical estimates of the water balance of a closed-basin lake in north central Minnesota

USGS Publications Warehouse

LaBaugh, James W.; Winter, Thomas C.; Rosenberry, Donald O.; Schuster, Paul F.; Reddy, Michael M.; Aiken, George R.

1997-01-01

Chemical mass balances for sodium, magnesium, chloride, dissolved organic carbon, and oxygen 18 were used to estimate groundwater seepage to and from Williams Lake, Minnesota, over a 15-month period, from April 1991 through June 1992. Groundwater seepage to the lake and seepage from the lake to groundwater were determined independently using a flow net approach using data from water table wells installed as part of the study. Hydrogeological analysis indicated groundwater seepage to the lake accounted for 74% of annual water input to the lake; the remainder came from atmospheric precipitation, as determined from a gage in the watershed and from nearby National Weather Service gages. Seepage from the lake accounted for 69% of annual water losses from the lake; the remainder was removed by evaporation, as determined by the energy budget method. Calculated annual water loss exceeded calculated annual water gain, and this imbalance was double the value of the independently measured decrease in lake volume. Seepage to the lake determined from oxygen 18 was larger (79% of annual water input) than that determined from the flow net approach and made the difference between calculated annual water gain and loss consistent with the independently measured decrease in lake volume. Although the net difference between volume of seepage to the lake and volume of seepage from the lake was 1% of average lake volume, movement of water into and out of the lake by seepage represented an annual exchange of groundwater with the lake equal to 26–27% of lake volume. Estimates of seepage to the lake from sodium, magnesium, chloride, and dissolved organic carbon did not agree with the values determined from flow net approach or oxygen 18. These results indicated the importance of using a combination of hydrogeological and chemical approaches to define volume of seepage to and from Williams Lake and identify uncertainties in chemical fluxes.

Antinociceptive effect of systemically administered dipyrone (metamizol), magnesium chloride or both in a murine model of cancer.

PubMed

Brito, B E; Vazquez, E; Taylor, P; Alvarado, Y; Vanegas, H; Millan, A; Tortorici, V

2017-03-01

Opioid effectiveness to treat cancer pain is often compromised by the development of tolerance and the occurrence of undesirable side effects, particularly during long-term treatment. Hence, the search for more efficient analgesics remains a necessity. The main goal of this study was to relieve neuropathic symptoms associated with tumour growth by administering the non-opioid analgesic dipyrone (DIP) alone or in combination with magnesium chloride (MgCl 2 ), an adjuvant that blocks the NMDA receptor channel. Mice were inoculated with a melanoma cell line (B16-BL6) in the left thigh and two protocols were used to evaluate the effect of DIP (270 mg/kg), MgCl 2 (200 mg/kg), or the combination DIP-MgCl 2 . In the therapeutic protocol the drugs, alone or combined, were administered once tumour had promoted increased nociception. In the preventive protocol, drugs were administered prior to the appearance of the primary tumour. Tumour growth was assessed with a caliper and nociception was determined using behavioural tests. DIP promoted antinociception only at the beginning of both protocols due to the development of tolerance. The combination DIP-MgCl 2 improved the antinociceptive effect, avoiding tolerance and reducing tumour growth in the preventive treatment, more efficiently than each compound alone. These results suggest that DIP-MgCl 2 may represent a safe, affordable and accessible option to reduce tumour growth and to treat cancer pain avoiding the risk of tolerance, without the typical complications of opioids agents, particularly when long-term treatment is required. This study shows a non-opioid analgesic combined with an adjuvant as a therapeutic option to treat cancer pain. The avoidance of antinociceptive tolerance when repeated administration is required, as well as tumor growth reduction, are additional advantages to be considered. © 2016 European Pain Federation - EFIC®.

Hydrogeochemical characteristics and assessment of water quality in the Al-Saad Lake, Abha Saudi Arabia

NASA Astrophysics Data System (ADS)

Mallick, Javed

2017-10-01

Hydrogeochemical characteristics and assessment of water quality investigations have been carried out at Abha, located in Saudi Arabia, where Al-Saad Lake represents a rare example of natural endorheic lake. The ecosystem within and around the Al-Saad Lake including catchment area is of great social, cultural, aesthetic, environmental and economic values to Abha. Sampling and experiments of lake water has been carried out with the aim of characterizing the main physico-chemical parameters, such as DO, EC, TDS, Mg2+, Ca2+, Na+, K+, SO4 2-, Cl-, HCO3, NO3 - and F- concentration. The ordinary kriging (OK) method was used to produce the spatial patterns of water quality. The Result of DO (mean 5.38 mg/L) trend in Al-Saad Lake is not very encouraging as majority of the lake area is under DO stress or marginally above it. So, proper management strategies are needed to be formulated to protect flora and fauna of the lake. Furthermore, the chemical analysis results show the abundance of the major cations in the order Mg2+ > Ca2+ > Na+ > K+ whereas the abundance of anions are in the order SO4 2- > Cl- > HCO3 > NO3 - > F-. The result obtained in this investigation inferred that the cations in water i.e. sodium and iron are within the permissible limits but magnesium and potassium have exceeded the permissible limit. Whereas anions such as nitrate and fluoride are within the permissible range but chloride and sulphate have exceeded the permissible limits. The concentration of cation, magnesium (Mg) and potassium (K) in the lake water has exceeded the desirable range (30, 10 mg/L, respectively). This may be due to weathering and transported from rocks and particularly from sulphate deposits such as gypsum and anhydride and subsequently ends up in water. The concentration of anion, Sulphate (SO4) and chloride are above the desirable limit. The major source of bicarbonate are the carbonate rocks containing calcite (CaCO3) and dolomite (CaMg (CO3)2), Calcium (Ca) and Magnesium (Mg) can also be transported from Ca-silicates and Mg-silicates. The piper trilinear plot suggests the increase of Ca and SO4 contents is attributed to dissolution of gypsum and anhydrite, which are commonly found in the quaternary formations of watershed (wadi). Ion exchange, dissolution of calcite, semi-arid climate, alkaline condition and weathering are responsible for high concentration of ions exceeding the desirable limit of the study area.

Photophysical analysis of 1,10-phenanthroline-embedded porphyrin analogues and their magnesium(II) complexes.

PubMed

Ishida, Masatoshi; Lim, Jong Min; Lee, Byung Sun; Tani, Fumito; Sessler, Jonathan L; Kim, Dongho; Naruta, Yoshinori

2012-11-05

The synthesis, characterization, photophysical properties, and theoretical analysis of a series of tetraaza porphyrin analogues (H-Pn: n=1-4) containing a dipyrrin subunit and an embedded 1,10-phenanthroline subunit are described. The meso-phenyl-substituted derivative (H-P1) interacts with a Mg(2+) salt (e.g., MgCl(2), MgBr(2), MgI(2), Mg(ClO(4))(2), and Mg(OAc)(2)) in MeCN solution, thereby giving rise to a cation-dependent red-shift in both the absorbance- and emission maxima. In this system, as well as in the other H-Pn porphyrin analogues used in this study, the four nitrogen atoms of the ligand interact with the bound magnesium cation to form Mg(2+)-dipyrrin-phenanthroline complexes of the general structure MgX-Pn (X=counteranion). Both single-crystal X-ray diffraction analysis of the corresponding zinc-chloride derivative (ZnCl-P1) and fluorescence spectroscopy of the Mg-adducts that are formed from various metal salts provide support for the conclusion that, in complexes such as MgCl-P1, a distorted square-pyramidal geometry persists about the metal cation wherein a chloride anion acts as an axial counteranion. Several analogues (HPn) that contain electron-donating and/or electron-withdrawing dipyrrin moieties were prepared in an effort to understand the structure-property relationships and the photophysical attributes of these Mg-dipyrrin complexes. Analysis of various MgX-Pn (X=anion) systems revealed significant substitution effects on their chemical, electrochemical, and photophysical properties, as well as on the Mg(2+)-cation affinities. The fluorescence properties of MgCl-Pn reflected the effect of donor-excited photoinduced electron transfer (d-PET) processes from the dipyrrin subunit (as a donor site) to the 1,10-phenanthroline acceptor subunit. The proposed d-PET process was analyzed by electron paramagnetic resonance (EPR) spectroscopy and by femtosecond transient absorption (TA) spectroscopy, as well as by theoretical DFT calculations. Taken together, these studies provide support for the suggestion that a radical species is produced as the result of an intramolecular charge-transfer process, following photoexcitation. These photophysical effects, combined with a mixed dipyrrin-phenanthroline structure that is capable of effective Mg(2+)-cation complexation, lead us to suggest that porphyrin-inspired systems, such as HPn, have a role to play as magnesium-cation sensors. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Characteristics of mineral licks used by white-tailed deer (Odocoileus virginianus)

USGS Publications Warehouse

Kennedy, John F.; Jenks, Jonathan A.; Jones, Robert L.; Jenkins, Kurt J.

1995-01-01

Characteristics of mineral licks used by white-tailed deer (Odocoileus virginianus) were examined in the northern Black Hills of South Dakota in May 1992. Concentrations of sodium, nitrogen, phosphorus, potassium, calcium, chloride and magnesium, and soil texture, organic matter and pH for licks and nonlick soils were compared. Black Hills lick and nonlick samples also were compared to 67 other North American licks characterized by Jones and Hanson (1985). Degree of use (high or low), and vegetative and topographic characteristics also were determined. Use of mineral licks by deer was highest in spring and early summer; mineral licks were not used by deer in winter. Mostly adult females, and on a few occasions fawns visited licks. Soil texture was finer and organic matter was lower (P < 0.05) in lick than nonlick soils. Soil pH, soluble salts, sodium and nitrate nitrogen were higher (P < 0.05) in lick than in nonlick soils. Chloride was the only mineral that differed (P = 0.03) between high-use and low-use licks but was not considered important in lick selection. Sodium was the primary mineral sought by white-tailed deer using mineral licks.

Determining Changes in Groundwater Quality during Managed Aquifer Recharge

NASA Astrophysics Data System (ADS)

Gambhir, T.; Houlihan, M.; Fakhreddine, S.; Dadakis, J.; Fendorf, S. E.

2016-12-01

Managed aquifer recharge (MAR) is becoming an increasingly prevalent technology for improving the sustainability of freshwater supply. However, recharge water can alter the geochemical conditions of the aquifer, mobilizing contaminants native to the aquifer sediments. Geochemical alterations on deep (>300 m) injection of highly treated recycled wastewater for MAR has received limited attention. We aim to determine how residual disinfectants used in water treatment processes, specifically the strong oxidants chloramine and hydrogen peroxide, affect metal mobilization within deep injection wells of the Orange County Water District. Furthermore, as the treated recharge water has very low ionic strength (44.6 mg L-1 total dissolved solids), we tested how differing concentrations of magnesium chloride and calcium chloride affected metal mobilization within deep aquifers. Continuous flow experiments were conducted on columns dry packed with sediments from a deep injection MAR site in Orange County, CA. The effluent was analyzed for shifts in water quality, including aqueous concentrations of arsenic, uranium, and chromium. Interaction between the sediment and oxic recharge solution causes naturally-occurring arsenopyrite to repartition onto iron oxides. The stability of arsenic on the newly precipitated iron oxides is dependent on pH changes during recharge.

Chemical quality of ground water in the eastern Sacramento Valley, California

USGS Publications Warehouse

Fogelman, Ronald P.

1979-01-01

The study area is about 1,300 square miles in the eastern Sacramento Valley, Calif., extending from the latitude of Roseville on the south to thelatitude of Chico on the north. Considering the increased agricultural development of the area, this report documents the chemical character of the ground water prior to water-level declines that could result from extensive pumping for irrigation or to changes caused by extensive use of imported surface water. Chemical analyses of samples from 222 wells show that most of the area is underlain by ground water of a quality suitable for most agricultural and domestic purposes. Ninety-five percent of the water sampled has dissolved-solids concentrations of less than 700 milligrams per liter. The general water type for the area is a calcium and magnesium bicarbonate water and there are negligible amounts of toxic trace elements. The potential for water-quality problems exists in the area south of Yuba City along the west bank of the Feather River. There, concentrations of chloride, sulfate, and dissolved solids are higher than in other parts of the area, and they could limit future agricultural activities if chloride- and sulfate-sensitive crops are grown. (Woodard-USGS)

Communications: Blood chemistry of laboratory-reared Golden trout

USGS Publications Warehouse

Hunn, Joseph B.; Wiedmeyer, Ray H.; Greer, Ivan E.; Grady, Andrew W.

1992-01-01

Golden trout Oncorhynchus aguabonita obtained from a wild stock as fertilized eggs were reared in the laboratory for 21 months. The laboratory-reared golden trout in our study reached sexual maturity earlier and grew more rapidly than wild golden trout do (according to the scientific literature). Male fish averaged 35.6 cm in total length and 426 g in weight, and females averaged 36.2 cm and 487 g. All golden trout were sexually mature when used for hematological analysis. The hematological profile (hematocrit, red blood cells, white blood cells, and thrombocytes) of golden trout was similar to that reported elsewhere for other trout species. Male and female golden trout did not have significantly different thrombocyte counts; however, the immobilization treatment used on the fish (anesthesia versus a blow to the head) resulted in significant treatment differences in thrombocyte numbers and interaction effect of sex in treatment for hematocrits. Gravid female golden trout had significantly higher plasma protein and calcium levels than did males. The ionic compositions of plasma (sodium, potassium, calcium, magnesium, copper, zinc, iron, and chloride) and gallbladder bile (calcium and chloride) were similar to those reported for other salmonids.

Methods for collection and analysis of geopressured geothermal and oil field waters

USGS Publications Warehouse

Lico, Michael S.; Kharaka, Yousif K.; Carothers, William W.; Wright, Victoria A.

1982-01-01

Present methods are described for the collection, preservation, and chemical analysis of waters produced from geopressured geothermal and petroleum wells. Detailed procedures for collection include precautions and equipment necessary to ensure that the sample is representative of the water produced. Procedures for sample preservation include filtration, acidification, dilution for silica, methyl isobutyl ketone (MIBK) extraction of aluminum, addition of potassium permanganate to preserve mercury, and precipitation of carbonate species as strontium carbonate for stable carbon isotopes and total dissolved carbonate analysis. Characteristics determined at the well site are sulfide, pH, ammonia, and conductivity. Laboratory procedures are given for the analysis of lithium, sodium, potassium, rubidium, cesium, magnesium, calcium, strontium, barium, iron, manganese, zinc, lead, aluminum, .and mercury by atomic absorption and flame emission spectroscopy. Chloride is determined by silver nitrate titration and fluoride by ion-specific electrode. Bromide and iodide concentrations are determined by the hypochlorite oxidation method. Sulfate is analyzed by titration using barium chloride with thorin indicator after pretreatment with alumina. Boron and silica are determined colorimetrically by the carmine and molybdate-blue methods, respectively. Aliphatic acid anions (C2 through C5) are determined by gas chromatography after separation and concentration in a chloroform-butanol mixture.

Results of hydrologic tests and water-chemistry analyses, wells H-5A, H-5B, and H-5C, at the proposed Waste Isolation Pilot Plant site, southeastern New Mexico

USGS Publications Warehouse

Dennehy, Kevin F.; Mercer, Jerry W.

1982-01-01

Data were collected during hydrologic testing at wells H-5A, H-5B, and H-5C in the northeastern part of the proposed Waste Isolation Pilot Plant site in southeastern New Mexico. The three water-bearing zones tested, the Magenta and Culebra Dolomite Members of the Rustler Formation and the Rustler Formation-Salado Formation contact, yield water to wells at rates less than 0.6 gallon per minute. Throughout the testing, water-pressure response in the tested zone was monitored by a pressure-transducer system. Shut-in and slug tests were conducted to acquire data. Water samples from the Magenta Dolomite Member, Culebra Dolomite Member, and Rustler Formation-Salado Formation contact had dissolved-solids concentrations of 6,090, 144,000, and 412,000 milligrams per liter, respectively. The major chemical constituents of water samples from the Magenta Dolomite Member were sodium and sulfate; from the Culebra Dolomite Member, sodium and chloride; and from the Rustler Formation-Salado Formation contact, magnesium, and chloride. Radium-226, a naturally occurring radioactive element, was present in samples from all three zones. (USGS)

Molecular biology of hereditary diabetes insipidus.

PubMed

Fujiwara, T Mary; Bichet, Daniel G

2005-10-01

The identification, characterization, and mutational analysis of three different genes-the arginine vasopressin gene (AVP), the arginine vasopressin receptor 2 gene (AVPR2), and the vasopressin-sensitive water channel gene (aquaporin 2 [AQP2])-provide the basis for understanding of three different hereditary forms of "pure" diabetes insipidus: Neurohypophyseal diabetes insipidus, X-linked nephrogenic diabetes insipidus (NDI), and non-X-linked NDI, respectively. It is clinically useful to distinguish two types of hereditary NDI: A "pure" type characterized by loss of water only and a complex type characterized by loss of water and ions. Patients who have congenital NDI and bear mutations in the AVPR2 or AQP2 genes have a "pure" NDI phenotype with loss of water but normal conservation of sodium, potassium, chloride, and calcium. Patients who bear inactivating mutations in genes (SLC12A1, KCNJ1, CLCNKB, CLCNKA and CLCNKB in combination, or BSND) that encode the membrane proteins of the thick ascending limb of the loop of Henle have a complex polyuro-polydipsic syndrome with loss of water, sodium, chloride, calcium, magnesium, and potassium. These advances provide diagnostic and clinical tools for physicians who care for these patients.

Interference of ascorbic acid with chemical analytes.

PubMed

Meng, Qing H; Irwin, William C; Fesser, Jennifer; Massey, K Lorne

2005-11-01

Ascorbic acid can interfere with methodologies involving redox reactions, while comprehensive studies on main chemistry analysers have not been reported. We therefore attempted to determine the interference of ascorbic acid with analytes on the Beckman Synchron LX20. Various concentrations of ascorbic acid were added to serum, and the serum analytes were measured on the LX20. With a serum ascorbic acid concentration of 12.0 mmol/L, the values for sodium, potassium, calcium and creatinine increased by 43%, 58%, 103% and 26%, respectively (P<0.01). With a serum ascorbic acid concentration of 12.0 mmol/L, the values for chloride, total bilirubin and uric acid decreased by 33%, 62% and 83%, respectively (P<0.01), and were undetectable for total cholesterol, triglyceride, ammonia and lactate. There was no definite influence of ascorbic acid on analytical values for total CO(2), urea, glucose, phosphate, total protein, albumin, amylase, creatine kinase, creatine kinase-MB, aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total iron, unbound iron-binding capacity or magnesium. Ascorbic acid causes a false increase in sodium, potassium, calcium and creatinine results and a false decrease in chloride, total bilirubin, uric acid, total cholesterol, triglyceride, ammonia and lactate results.

Utilization of struvite recovered from high-strength ammonium-containing simulated wastewater as slow-release fertilizer and fire-retardant barrier.

PubMed

Yetilmezsoy, Kaan; Kocak, Emel; Akbin, Havva Melda; Özçimen, Didem

2018-06-28

Sustainable uses of the struvite (magnesium ammonium phosphate hexahydrate, MgNH 4 PO 4 ·6H 2 O, MAP) recovered from the synthetic wastewater, as a high-quality slow-release fertilizer for the growth of nine medicinal plants and a fire-retardant barrier on the flammability of cotton fabric and wooden plate, were explored in this study. The previous experimental results demonstrated that under the optimal conditions, about 98.7% of [Formula: see text] (initial [Formula: see text] = 1000 mg/L) could be effectively and successfully recovered from simulated wastewater in the form of MAP precipitate. Rates of increase in total fresh weights, total dry weights, and fresh heights of plants grown in soil fertilized with the struvite were determined as 67%, 52%, and 12% for valerian; 121%, 75%, and 18% for cucumber; 421%, 260%, and 47% for dill; 314%, 318%, and 27% for coriander; 432%, 566%, and 30% for tomato; 285%, 683%, and 26% for parsley; 200%, 225%, and 9% for basil; 857%, 656%, and 92% for rocket; and 146%, 115%, and 28% for cress, respectively, compared to the control pots. The microstructure, elemental composition, surface area, thermal behaviour, and functional groups of the grown crystals were characterized using SEM, EDS, BET, TGA-DTG-DSC, and FTIR analyses, respectively. Flammability tests and thermal analyses concluded that the dried and crumbled/implanted form of struvite used as a fire-retardant barrier demonstrated a remarkable flame-resistant behaviour for both cotton fabric and wooden plate. Findings of this experimental study clearly corroborated the versatility of struvite as non-polluting and environmentally friendly clean product for the sustainable usage in different fields.

Formation of oxidizing species via irradiation of perchlorates using high-energy electrons and D 2 + ions

NASA Astrophysics Data System (ADS)

Crandall, Parker B.; Gillis-Davis, Jeffrey J.; Kaiser, Ralf-Ingo

2016-10-01

The perchlorate ion (ClO4-) has garnered particular interest in recent years following the discovery of perchlorate salts in the Martian regolith at levels of 0.4-0.6 wt% by the Phoenix lander in 2006 and Mars Science Laboratory's Curiosity rover in 2013. Due to their oxidizing properties, perchlorates are suspected to play a contributing role to the surprising lack of organics on the Martian surface. In this study, magnesium perchlorate hexahydrate (Mg(ClO4)2●6H2O) samples were irradiated with monoenergetic beams of 5 keV electrons and D2+ ions separately, sequentially, and simultaneously to simulate the effects of galactic cosmic ray exposure of perchlorates. The irradiation experiments were carried out under ultra-high vacuum conditions at 50 K, after which the samples were slowly heated to 300 K (0.5 K min-1) while desorbing products were monitored by quadrupole mass spectrometry. In all cases, molecular oxygen (O2) was detected upon the onset of irradiation and again during the warmup phase. In the case of simultaneous irradiation, deuterated water (D2O) and deuterium peroxide (D2O2) were also detected as the sample was heated whereas in the D2+ experiment small amounts of D2O2 was found exclusively. When samples were irradiated sequentially, the production of D2O2 was dependent upon the sample being irradiated with D2+ ions prior to electrons. These experiments show that perchlorates are capable of producing multiple oxidizing agents (O2, D2O2) which may also account for the lack of organics on the Martian surface.

Direct synthesis of magnesium borohydride

DOEpatents

Ronnebro, Ewa Carin Ellinor [Kennewick, WA; Severa, Godwin [Honolulu, HI; Jensen, Craig M [Kailua, HI

2012-04-03

A method is disclosed for directly preparing an alkaline earth metal borohydride, i.e. Mg(BH.sub.4).sub.2, from the alkaline earth metal boride MgB.sub.2 by hydrogenating the MgB.sub.2 at an elevated temperature and pressure. The boride may also be doped with small amounts of a metal chloride catalyst such as TiCl.sub.3 and/or NiCl.sub.2. The process provides for charging MgB.sub.2 with high pressure hydrogen above at least 70 MPa while simultaneously heating the material to about 350.degree. C. to about 400.degree. C. The method is relatively simple and inexpensive and provides a reversible hydride compound having a hydrogen capacity of at least 11 wt %.

Blood plasma chemistries from wild mourning doves held in captivity.

PubMed

Schulz, J H; Bermudez, A J; Tomlinson, J L; Firman, J D; He, Z

2000-07-01

Despite the extensive amount of research conducted on mourning doves (Zenaida macroura), no biochemical reference values exist for this species. Our objective, therefore, was to establish base line clinical chemistry reference values for mourning doves to assist with establishing clinical diagnoses. Wild mourning doves were captured 19 March 1996 to 8 August 1996, and 6 February 1998 to 12 May 1998; blood samples were collected from 382 mourning doves. Plasma biochemical values were established for glucose, sodium, potassium, chloride, enzymatic CO2, albumin, total protein, globulin, calcium, phosphorus, cholesterol, magnesium, aspartate aminotransferase (AST), gamma glutamyl transferase (GGT), lactate dehydrogenase (LDH), and uric acid. These reference values are invaluable for determining diagnosis of diseases of the gastrointestinal, hepatic, renal, cardiovascular, musculoskeletal, and endocrine systems.

Hematologic and plasma chemistry values in captive psittacine birds.

PubMed

Polo, F J; Peinado, V I; Viscor, G; Palomeque, J

1998-01-01

Reference values for some hematologic parameters in 19 species and plasma chemical values in 11 species of Psittacine birds, including cockatoos, parrots, amazons, macaws, conures, and lories, were established for use in veterinary medicine. The following parameters were studied: hematocrit, hemoglobin concentration, erythrocyte number, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, erythrocyte dimensions, leukocyte number and differential leukocyte count, glucose, urea, uric acid, cholesterol, triglycerides, creatinine, aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, creatinine phosphokinase, lactic dehydrogenase, gamma glutamyl transpeptidase, total plasma protein, albumin, globulins, albumin-globulin ratio, sodium, potassium, calcium, magnesium, total phosphorus, chloride, and osmolality. Hematologically, the Psittacine is a very homogeneous avian group, with small differences between species. They are, however, different from other groups of birds.

Recycling plant, human and animal wastes to plant nutrients in a closed ecological system

NASA Technical Reports Server (NTRS)

Meissner, H. P.; Modell, M.

1979-01-01

The essential minerals for plant growth are nitrogen, phosphorous, potassium (macronutrients), calcium, magnesium, sulfur (secondary nutrients), iron, manganese, boron, copper, zinc, chlorine, sodium, and molybdenum (micronutrients). The first step in recycling wastes will undoubtedly be oxidation of carbon and hydrogen to CO2 and H2O. Transformation of minerals to plant nutrients depends upon the mode of oxidation to define the state of the nutrients. For the purpose of illustrating the type of processing required, ash and off-gas compositions of an incineration process were assumed and subsequent processing requirements were identified. Several processing schemes are described for separating out sodium chloride from the ash, leading to reformulation of a nutrient solution which should be acceptable to plants.

[Determination of micro and macronutrients in the cattle of the Venezuelan plains and their influence on the origin of bovine paraplegic syndrome].

PubMed

Rojas, H; Serrano, J R; DiPolo, R

1994-01-01

We report a study carried out in three livestock-producing regions of Venezuela to determine the mineral status of grazing cattle and its relationship to the Síndrome Parpléjico del Bovino (SPB). Animal tissue samples from blood and liver were collected from a total of 17 farms within three regions: southwest (Apure), central (Guárico) and southeast (Bolívar) both during the dry and rainy seasons. In SPB free animals, the serum levels of sodium, potassium, chloride, magnesium, total and ionized calcium, phosphorus, and creatinine, were within the normal range. Glucose was found to be deficient in cattle from Bolívar and Guárico states and normal in Apure. With the exception of liver copper and serum zinc, all the other microelements analyzed (liver cobalt, and molybdenum, and serum iron) were found to be normal. Copper was found to be low in all regions studied with a mean value of 74.8 ppm indicating a moderate deficiency of this element. Similarly, in the central and southwest regions, zinc was found to be close to 0.34 ppm, significantly lower than the critical level of 0.7 ppm. In order to determine the effect of the dry and rainy seasons on the content of macro and microelements, controlled group of cattle from the three regions were followed in their contents of magnesium, calcium, copper and iron. In the dry season all of these elements tended to be much lower, showing a significant increase in the rainy season. This increase was much greater in cattle that received mineral supplementation and sanitary treatment. Bovines with diagnosis of SPB showed: low liver copper content, low serum magnesium and phosphorus levels significantly higher that control cattle.

Deep sea water modulates blood pressure and exhibits hypolipidemic effects via the AMPK-ACC pathway: an in vivo study.

PubMed

Sheu, Ming-Jyh; Chou, Pei-Yu; Lin, Wen-Hsin; Pan, Chun-Hsu; Chien, Yi-Chung; Chung, Yun-Lung; Liu, Fon-Chang; Wu, Chieh-Hsi

2013-06-17

Deep sea water (DSW), originally pumped from the Pacific Rim off the coast of Hualien County (Taiwan), and its mineral constituents, were concentrated by a low-temperature vacuum evaporation system to produce a hardness of approximately 400,000 mg/L of seawater mineral concentrate. The primary composition of this seawater mineral concentrate was ionic magnesium (Mg²⁺), which was approximately 96,000 mg/L. Referring to the human recommended daily allowance (RDA) of magnesium, we diluted the mineral concentrate to three different dosages: 0.1 × DSW (equivalent to 3.75 mg Mg²⁺/kg DSW); 1 × DSW (equivalent to 37.5 mg Mg²⁺/kg DSW); and 2 × DSW (equivalent to 75 mg Mg²⁺/kg DSW). Additionally, a magnesium chloride treatment was conducted for comparison with the DSW supplement. The study indicated that 0.1 × DSW, 1 × DSW and 2 × DSW decreased the systolic and diastolic pressures in spontaneous hypertensive rats in an eight-week experiment. DSW has been shown to reduce serum lipids and prevent atherogenesis in a hypercholesterolemic rabbit model. Our results demonstrated that 1 × DSW and 2 × DSW significantly suppressed the serum cholesterol levels, reduced the lipid accumulation in liver tissues, and limited aortic fatty streaks. These findings indicated that the antiatherogenic effects of DSW are associated with 5'-adenosine monophosphate-activated protein kinase (AMPK) stimulation and the consequent inhibition of phosphorylation of acetyl-CoA carboxylase (ACC) in atherosclerotic rabbits. We hypothesize that DSW could potentially be used as drinking water because it modulates blood pressure, reduces lipids, and prevents atherogenesis.

Qualitative and quantitative analysis of human nails to find correlation between nutrients and vitamin D deficiency using LIBS and ICP-AES.

PubMed

Almessiere, M A; Altuwiriqi, R; Gondal, M A; AlDakheel, R K; Alotaibi, H F

2018-08-01

In this work, we analysed human fingernails of people who suffer from vitamin D deficiency using the laser-induced breakdown spectroscopy(LIBS) and inductively coupled plasma atomic emission spectroscopy (ICP-AES)techniques. The measurements have been conducted on 71 nail samples collected randomly from volunteers of different genders and ages ranged between 20 and 50 years. The main aim of this study is to find the correlation between vitamin D deficiency and the intensity of some dominated lines in the LIBS spectra. A LIBS spectrum consists of dominant lines of fifteen elements including calcium, magnesium, sodium, potassium, titanium, iron, chloride, sulphur, copper, chromium, zinc, nitrogen, phosphor, and oxygen. By recording the spectrum in specific ranges and focusing on calcium, magnesium, sodium, and potassium, we found a correlation between the intensity of the potassium (K) lines at (766.5 and 769.9 nm)and vitamin D level in both age groups (20 and 25 years old), with weak correlation for the calcium (Ca), magnesium (Mg), and sodium (Na) lines. To verify the validity of the LIBS results, we analysed the nail samples with ICP, a standard analytical technique. The elements detected with our LIBS technique are in a good agreement with those identified by ICP-AES. From the health and physiological perspectives, the LIBS system, which is used for spectral analysis in this work, is appropriate for diagnostic purposes such as to find the correlation between vitamin D deficiency and potassium content, especially for hypertensive patients who simultaneously take potassium-based medication and vitamin D supplement. Copyright © 2018 Elsevier B.V. All rights reserved.

The contractile basis of ameboid movement. II. Structure and contractility of motile extracts and plasmalemma-ectoplasm ghosts

PubMed Central

1976-01-01

The role of calcium and magnesium-ATP on the structure and contractility in motile extracts of Amoeba proteus and plasmalemma- ectoplasm "ghosts" of Chaos carolinensis has been investigated by correlating light and electron microscope observations with turbidity and birefringence measurements. The extract is nonmotile and contains very few F-actin filaments and myosin aggregates when prepared in the presence of both low calcium ion and ATP concentrations at an ionic strength of I = 0.05, pH 6.8. The addition of 1.0 mM magnesium chloride, 1.0 mM ATP, in the presence of a low calcium ion concentration (relaxation solution) induced the formation of some fibrous bundles of actin without contracting, whereas the addition of a micromolar concentration of calcium in addition to 1.0 mM magnesium-ATP (contraction solution) (Taylor, D. L., J. S. Condeelis, P. L. Moore, and R. D. Allen. 1973. J. Cell Biol. 59:378-394) initiated the formation of large arrays of F-actin filaments followed by contractions. Furthermore, plasmalemma-ectoplasm ghosts prepared in the relaxation solution exhibited very few straight F-actin filaments and myosin aggregates. In contrast, plasmalemmaectoplasm ghosts treated with the contraction solution contained many straight F-actin filaments and myosin aggregates. The increase in the structure of ameba cytoplasm at the endoplasm-ectoplasm interface can be explained by a combination of the transformation of actin from a less filamentous to a more structured filamentous state possibly involving the cross-linking of actin to form fibrillar arrays (see above-mentioned reference) followed by contractions of the actin and myosin along an undetermined distance of the endoplasm and/or ectoplasm. PMID:6480

In vitro degradation of pure Mg in response to glucose

NASA Astrophysics Data System (ADS)

Zeng, Rong-Chang; Li, Xiao-Ting; Li, Shuo-Qi; Zhang, Fen; Han, En-Hou

2015-08-01

Magnesium and its alloys are promising biodegradable biomaterials but are still challenging to be used in person with high levels of blood glucose or diabetes. To date, the influence of glucose on magnesium degradation has not yet been elucidated, this issue requires more attention. Herein, we present pure Mg exhibiting different corrosion responses to saline and Hank’s solutions with different glucose contents, and the degradation mechanism of pure Mg in the saline solution with glucose in comparison with mannitol as a control. On one hand, the corrosion rate of pure Mg increases with the glucose concentration in saline solutions. Glucose rapidly transforms into gluconic acid, which attacks the oxides of the metal and decreases the pH of the solution; it also promotes the absorption of chloride ions on the Mg surface and consequently accelerates corrosion. On the other hand, better corrosion resistance is obtained with increasing glucose content in Hank’s solution due to the fact that glucose coordinates Ca2+ ions in Hank’s solution and thus improves the formation of Ca-P compounds on the pure Mg surface. This finding will open up new avenues for research on the biodegradation of bio-Mg materials in general, which could yield many new and interesting results.

Determination of coumarin in seasonal bakery products using QuEChERS and GC-MS.

PubMed

Vetter, F; Müller, C; Stöckelhuber, M; Bracher, F

2017-06-01

Cinnamon is a traditional herbal drug, but more importantly, it is used as a flavor compound in the production of foodstuff. Due to the content of significant concentrations of coumarin in Cassia cinnamon, effective control of the coumarin content in seasonal bakery products like ginger bread and cinnamon biscuits is urgently needed. Here we present a novel, fast and fully validated protocol for the determination of coumarin in marketed bakery products using the QuEChERS sample preparation technique in combination with GC-MS analysis. Ten grams of homogenized sample was mixed with 20 mL acetonitrile/water (1:1) and 5 g magnesium sulfate/sodium chloride mixture (4:1). The organic phase was cleaned by dSPE with 25 mg magnesium sulfate/PSA (5:1). The LOD was 0.15 μg/mL and the LOQ 0.50 μg/mL. We detected a mean coumarin content of 19.5 μg/kg in 9 out of 14 seasonal food products (ranging from 1.45 to 39.4 mg/kg). No coumarin was detected in five cinnamon containing products. With this investigation we demonstrate that the QuEChERS sample preparation, previously applied mainly to the analysis of pesticides in vegetables, is also suitable for other complex matrices.

Water-quality conditions and an evaluation of ground- and surface-water sampling programs in the Livermore-Amador Valley, California

USGS Publications Warehouse

Sorenson, S.K.; Cascos, P.V.; Glass, R.L.

1984-01-01

A program to monitor the ground- and surface water quality in the Livermore-Amador Valley has been operated since 1976. As of 1982, this monitoring network consisted of approximately 130 wells, about 100 of which were constructed specifically for this program, and 9 surface water stations. Increased demand on the groundwater for municipal and industrial water supply in the past has caused a decline in water levels and a gradual buildup of salts from natural surface-water recharge and land disposal of treated wastewater from waste treatment plants. Results of this study identify the salt buildup to be the major problem with the groundwater quality. Established water quality objectives for dissolved solids are exceeded in 52 of 130 wells. Concentrations of dissolved nitrate are also in excess of basin objectives and health standards. Water quality in both surface and groundwater is highly variable areally. Magnesium to calcium magnesium bicarbonate groundwater are found in the areas where most of the high volume municipal wells are located. Large areas of sodium bicarbonate water occur in the northern part of the valley. Except for two stations on Arroyo Las Positas which has sodium chloride water, surface water is mixed-cation bicarbonate water. (USGS)

Essential elements, cadmium, and lead in raw and pasteurized cow and goat milk

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lopez, A.; Collins, W.F.; Williams, H.L.

1985-08-01

Fifteen essential elements plus cadmium and lead were determined in raw and pasteurized cow and goat milks by atomic absorption spectrophotometry. When results were compared on a wet weight basis, there were no significant differences between the raw and pasteurized milks except for cobalt, iron, and lead in goat milk. When copper in goat milk was expressed on a dry weight basis, there was a significant difference between raw and pasteurized milk. There were significantly higher amounts of cobalt, copper, iron, lead, magnesium, and phosphorus, wet weight basis, in pasteurized goat milk than in pasteurized cow milk. Significantly more nickelmore » and sodium were in pasteurized cow milk. No difference in the content of chloride, calcium, potassium, and zinc was significant between the two milks. When dry weights of the two milks were compared, statistical differences were the same, except there was significantly more calcium and potassium in pasteurized cow milk than in pasteurized goat milk and there were no significant differences in the content of lead and phosphorus between the two milks. Percentages of the established and estimated recommended daily allowances show both cow and goat milk to be excellent sources of calcium, phosphorus, and potassium and fair sources of iron, magnesium, and sodium.« less

Bright carbonate deposits as evidence of aqueous alteration on (1) Ceres

NASA Astrophysics Data System (ADS)

de Sanctis, M. C.; Raponi, A.; Ammannito, E.; Ciarniello, M.; Toplis, M. J.; McSween, H. Y.; Castillo-Rogez, J. C.; Ehlmann, B. L.; Carrozzo, F. G.; Marchi, S.; Tosi, F.; Zambon, F.; Capaccioni, F.; Capria, M. T.; Fonte, S.; Formisano, M.; Frigeri, A.; Giardino, M.; Longobardo, A.; Magni, G.; Palomba, E.; McFadden, L. A.; Pieters, C. M.; Jaumann, R.; Schenk, P.; Mugnuolo, R.; Raymond, C. A.; Russell, C. T.

2016-08-01

The typically dark surface of the dwarf planet Ceres is punctuated by areas of much higher albedo, most prominently in the Occator crater. These small bright areas have been tentatively interpreted as containing a large amount of hydrated magnesium sulfate, in contrast to the average surface, which is a mixture of low-albedo materials and magnesium phyllosilicates, ammoniated phyllosilicates and carbonates. Here we report high spatial and spectral resolution near-infrared observations of the bright areas in the Occator crater on Ceres. Spectra of these bright areas are consistent with a large amount of sodium carbonate, constituting the most concentrated known extraterrestrial occurrence of carbonate on kilometre-wide scales in the Solar System. The carbonates are mixed with a dark component and small amounts of phyllosilicates, as well as ammonium carbonate or ammonium chloride. Some of these compounds have also been detected in the plume of Saturn’s sixth-largest moon Enceladus. The compounds are endogenous and we propose that they are the solid residue of crystallization of brines and entrained altered solids that reached the surface from below. The heat source may have been transient (triggered by impact heating). Alternatively, internal temperatures may be above the eutectic temperature of subsurface brines, in which case fluids may exist at depth on Ceres today.

In vitro degradation of pure Mg in response to glucose

PubMed Central

Zeng, Rong-Chang; Li, Xiao-Ting; Li, Shuo-Qi; Zhang, Fen; Han, En-Hou

2015-01-01

Magnesium and its alloys are promising biodegradable biomaterials but are still challenging to be used in person with high levels of blood glucose or diabetes. To date, the influence of glucose on magnesium degradation has not yet been elucidated, this issue requires more attention. Herein, we present pure Mg exhibiting different corrosion responses to saline and Hank’s solutions with different glucose contents, and the degradation mechanism of pure Mg in the saline solution with glucose in comparison with mannitol as a control. On one hand, the corrosion rate of pure Mg increases with the glucose concentration in saline solutions. Glucose rapidly transforms into gluconic acid, which attacks the oxides of the metal and decreases the pH of the solution; it also promotes the absorption of chloride ions on the Mg surface and consequently accelerates corrosion. On the other hand, better corrosion resistance is obtained with increasing glucose content in Hank’s solution due to the fact that glucose coordinates Ca2+ ions in Hank’s solution and thus improves the formation of Ca-P compounds on the pure Mg surface. This finding will open up new avenues for research on the biodegradation of bio-Mg materials in general, which could yield many new and interesting results. PMID:26264413

49 CFR 176.84 - Other requirements for stowage and segregation for cargo vessels and passenger vessels.

Code of Federal Regulations, 2012 CFR

2012-10-01

... liquids. 29 Stow “away from” ammonium compounds. 30 Stow “away from” animal or vegetable oils. 31 Stow...” alkaline compounds.2 54 Stow “separated from” animal or vegetable oils. 55 Stow “separated from” ammonia... applies. 130 Stowage Category A applies, except for uranyl nitrate hexahydrate solution, uranium metal...

49 CFR 176.84 - Other requirements for stowage and segregation for cargo vessels and passenger vessels.

Code of Federal Regulations, 2011 CFR

2011-10-01

... liquids. 29 Stow “away from” ammonium compounds. 30 Stow “away from” animal or vegetable oils. 31 Stow...” alkaline compounds.2 54 Stow “separated from” animal or vegetable oils. 55 Stow “separated from” ammonia... applies. 130 Stowage Category A applies, except for uranyl nitrate hexahydrate solution, uranium metal...

Facile control of nanoporosity in Cellulose Acetate using Nickel(II) nitrate additive and water pressure treatment for highly efficient battery gel separators.

PubMed

Lee, Woong Gi; Kim, Do Hyeong; Jeon, Woo Cheol; Kwak, Sang Kyu; Kang, Seok Ju; Kang, Sang Wook

2017-04-28

We succeed in fabricating nearly straight nanopores in cellulose acetate (CA) polymers for use as battery gel separators by utilizing an inorganic hexahydrate (Ni(NO 3 ) 2 ·6H 2 O) complex and isostatic water pressure treatment. The continuous nanopores are generated when the polymer film is exposed to isostatic water pressure after complexing the nickel(II) nitrate hexahydrate (Ni(NO 3 ) 2 ·6H 2 O) with the CA. These results can be attributed to the manner in which the polymer chains are weakened because of the plasticization effect of the Ni(NO 3 ) 2 ·6H 2 O that is incorporated into the CA. Furthermore, we performed extensive molecular dynamics simulation for confirming the interaction between electrolyte and CA separator. The well controlled CA membrane after water pressure treatment enables fabrication of highly reliable cell by utilizing 2032-type coin cell structure. The resulting cell performance exhibits not only the effect of the physical morphology of CA separator, but also the chemical interaction of electrolyte with CA polymer which facilitates the Li-ion in the cell.