Sample records for magnetic twisting cytometry

  1. Probing transmembrane mechanical coupling and cytomechanics using magnetic twisting cytometry

    NASA Technical Reports Server (NTRS)

    Wang, N.; Ingber, D. E.

    1995-01-01

    We recently developed a magnetic twisting cytometry technique that allows us to apply controlled mechanical stresses to specific cell surface receptors using ligand-coated ferromagnetic microbeads and to simultaneously measure the mechanical response in living cells. Using this technique, we have previously shown the following: (i) beta 1 integrin receptors mediate mechanical force transfer across the cell surface and to the cytoskeleton, whereas other transmembrane receptors (e.g., scavenger receptors) do not; (ii) cytoskeletal stiffness increases in direct proportion to the level of stress applied to integrins; and (iii) the slope of this linear stiffening response differs depending on the shape of the cell. We now show that different integrins (beta 1, alpha V beta 3, alpha V, alpha 5, alpha 2) and other transmembrane receptors (scavenger receptor, platelet endothelial cell adhesion molecule) differ in their ability to mediate force transfer across the cell surface. In addition, the linear stiffening behavior previously observed in endothelial cells was found to be shared by other cell types. Finally, we demonstrate that dynamic changes in cell shape that occur during both cell spreading and retraction are accompanied by coordinate changes in cytoskeletal stiffness. Taken together, these results suggest that the magnetic twisting cytometry technique may be a powerful and versatile tool for studies analyzing the molecular basis of transmembrane mechanical coupling to the cytoskeleton as well as dynamic relations between changes in cytoskeletal structure and alterations in cell form and function.

  2. A model for cytoplasmic rheology consistent with magnetic twisting cytometry.

    PubMed

    Butler, J P; Kelly, S M

    1998-01-01

    Magnetic twisting cytometry is gaining wide applicability as a tool for the investigation of the rheological properties of cells and the mechanical properties of receptor-cytoskeletal interactions. Current technology involves the application and release of magnetically induced torques on small magnetic particles bound to or inside cells, with measurements of the resulting angular rotation of the particles. The properties of purely elastic or purely viscous materials can be determined by the angular strain and strain rate, respectively. However, the cytoskeleton and its linkage to cell surface receptors display elastic, viscous, and even plastic deformation, and the simultaneous characterization of these properties using only elastic or viscous models is internally inconsistent. Data interpretation is complicated by the fact that in current technology, the applied torques are not constant in time, but decrease as the particles rotate. This paper describes an internally consistent model consisting of a parallel viscoelastic element in series with a parallel viscoelastic element, and one approach to quantitative parameter evaluation. The unified model reproduces all essential features seen in data obtained from a wide variety of cell populations, and contains the pure elastic, viscoelastic, and viscous cases as subsets.

  3. Interfacing 3D magnetic twisting cytometry with confocal fluorescence microscopy to image force responses in living cells.

    PubMed

    Zhang, Yuejin; Wei, Fuxiang; Poh, Yeh-Chuin; Jia, Qiong; Chen, Junjian; Chen, Junwei; Luo, Junyu; Yao, Wenting; Zhou, Wenwen; Huang, Wei; Yang, Fang; Zhang, Yao; Wang, Ning

    2017-07-01

    Cells and tissues can undergo a variety of biological and structural changes in response to mechanical forces. Only a few existing techniques are available for quantification of structural changes at high resolution in response to forces applied along different directions. 3D-magnetic twisting cytometry (3D-MTC) is a technique for applying local mechanical stresses to living cells. Here we describe a protocol for interfacing 3D-MTC with confocal fluorescence microscopy. In 3D-MTC, ferromagnetic beads are bound to the cell surface via surface receptors, followed by their magnetization in any desired direction. A magnetic twisting field in a different direction is then applied to generate rotational shear stresses in any desired direction. This protocol describes how to combine magnetic-field-induced mechanical stimulation with confocal fluorescence microscopy and provides an optional extension for super-resolution imaging using stimulated emission depletion (STED) nanoscopy. This technology allows for rapid real-time acquisition of a living cell's mechanical responses to forces via specific receptors and for quantifying structural and biochemical changes in the same cell using confocal fluorescence microscopy or STED. The integrated 3D-MTC-microscopy platform takes ∼20 d to construct, and the experimental procedures require ∼4 d when carried out by a life sciences graduate student.

  4. Interfacing 3D magnetic twisting cytometry with confocal fluorescence microscopy to image force responses in living cells

    PubMed Central

    Zhang, Yuejin; Wei, Fuxiang; Poh, Yeh-Chuin; Jia, Qiong; Chen, Junjian; Chen, Junwei; Luo, Junyu; Yao, Wenting; Zhou, Wenwen; Huang, Wei; Yang, Fang; Zhang, Yao; Wang, Ning

    2017-01-01

    Cells and tissues can undergo a variety of biological and structural changes in response to mechanical forces. Only few existing techniques are available for quantification of structural changes at high resolution in response to forces applied along different directions. Three dimensional-Magnetic Twisting Cytometry (3D-MTC) is a technique for applying local mechanical stresses on living cells. Here we describe a protocol for interfacing 3D-MTC with confocal fluorescence microscopy. In 3D-MTC, ferromagnetic beads are bound to the cell surface via surface receptors followed by their magnetization in any desired direction. A magnetic twisting field in a different direction is then applied to generate rotational shear stresses in any desired direction. This protocol describes how to combine magnetic field-induced mechanical stimulation with confocal fluorescence microscopy and provides an optional extension for super resolution imaging using stimulated emission depletion (STED) nanoscopy. This technology allows for rapid real time acquisition of a living cell’s mechanical responses to forces via specific receptors and for quantifying structural and biochemical changes in the same cell using confocal fluorescence microscopy or STED. The integrated 3D-MTC – microscopy platform takes around 20 days to construct and the experimental procedures require ~4 days when carried out by a life sciences graduate student. PMID:28686583

  5. Understanding the Twist Distribution Inside Magnetic Flux Ropes by Anatomizing an Interplanetary Magnetic Cloud

    NASA Astrophysics Data System (ADS)

    Wang, Yuming; Shen, Chenglong; Liu, Rui; Liu, Jiajia; Guo, Jingnan; Li, Xiaolei; Xu, Mengjiao; Hu, Qiang; Zhang, Tielong

    2018-05-01

    Magnetic flux rope (MFR) is the core structure of the greatest eruptions, that is, the coronal mass ejections (CMEs), on the Sun, and magnetic clouds are posteruption MFRs in interplanetary space. There is a strong debate about whether or not a MFR exists prior to a CME and how the MFR forms/grows through magnetic reconnection during the eruption. Here we report a rare event, in which a magnetic cloud was observed sequentially by four spacecraft near Mercury, Venus, Earth, and Mars, respectively. With the aids of a uniform-twist flux rope model and a newly developed method that can recover a shock-compressed structure, we find that the axial magnetic flux and helicity of the magnetic cloud decreased when it propagated outward but the twist increased. Our analysis suggests that the "pancaking" effect and "erosion" effect may jointly cause such variations. The significance of the pancaking effect is difficult to be estimated, but the signature of the erosion can be found as the imbalance of the azimuthal flux of the cloud. The latter implies that the magnetic cloud was eroded significantly leaving its inner core exposed to the solar wind at far distance. The increase of the twist together with the presence of the erosion effect suggests that the posteruption MFR may have a high-twist core enveloped by a less-twisted outer shell. These results pose a great challenge to the current understanding on the solar eruptions as well as the formation and instability of MFRs.

  6. Magnetic field twist driven by remote convective motions: Characteristics and twist rates

    NASA Technical Reports Server (NTRS)

    Wang, Zheng-Zhi; Hassam, A. B.

    1987-01-01

    It is generally believed that convective motions below the solar photosphere induce a twist in the coronal magnetic field as a result of frozen-in physics. A question of interest is how much twist can one expect from a persistent convective motion, given the fact that dissipative effects will eventually figure. This question is examined by considering a model problem: two conducting plates, with finite resistivity, are set in sheared motion and forced at constant relative speed. A resistive plasma is between the plates and an initially vertical magnetic field connects the plates. The time rate of tilt experienced by the field is obtained as a function of Hartmann number and the resistivity ratio. Both analytical and numerical approaches are considered.

  7. Effect of Magnetic Twist on Nonlinear Transverse Kink Oscillations of Line-tied Magnetic Flux Tubes

    NASA Astrophysics Data System (ADS)

    Terradas, J.; Magyar, N.; Van Doorsselaere, T.

    2018-01-01

    Magnetic twist is thought to play an important role in many structures of the solar atmosphere. One of the effects of twist is to modify the properties of the eigenmodes of magnetic tubes. In the linear regime standing kink solutions are characterized by a change in polarization of the transverse displacement along the twisted tube. In the nonlinear regime, magnetic twist affects the development of shear instabilities that appear at the tube boundary when it is oscillating laterally. These Kelvin–Helmholtz instabilities (KHI) are produced either by the jump in the azimuthal component of the velocity at the edge of the sharp boundary between the internal and external part of the tube or by the continuous small length scales produced by phase mixing when there is a smooth inhomogeneous layer. In this work the effect of twist is consistently investigated by solving the time-dependent problem including the process of energy transfer to the inhomogeneous layer. It is found that twist always delays the appearance of the shear instability, but for tubes with thin inhomogeneous layers the effect is relatively small for moderate values of twist. On the contrary, for tubes with thick layers, the effect of twist is much stronger. This can have some important implications regarding observations of transverse kink modes and the KHI itself.

  8. On the twists of interplanetary magnetic flux ropes observed at 1 AU

    NASA Astrophysics Data System (ADS)

    Wang, Yuming; Zhuang, Bin; Hu, Qiang; Liu, Rui; Shen, Chenglong; Chi, Yutian

    2016-10-01

    Magnetic flux ropes (MFRs) are one kind of fundamental structures in the solar/space physics and involved in various eruption phenomena. Twist, characterizing how the magnetic field lines wind around a main axis, is an intrinsic property of MFRs, closely related to the magnetic free energy and stableness. Although the effect of the twist on the behavior of MFRs had been widely studied in observations, theory, modeling, and numerical simulations, it is still unclear how much amount of twist is carried by MFRs in the solar atmosphere and in heliosphere and what role the twist played in the eruptions of MFRs. Contrasting to the solar MFRs, there are lots of in situ measurements of magnetic clouds (MCs), the large-scale MFRs in interplanetary space, providing some important information of the twist of MFRs. Thus, starting from MCs, we investigate the twist of interplanetary MFRs with the aid of a velocity-modified uniform-twist force-free flux rope model. It is found that most of MCs can be roughly fitted by the model and nearly half of them can be fitted fairly well though the derived twist is probably overestimated by a factor of 2.5. By applying the model to 115 MCs observed at 1 AU, we find that (1) the twist angles of interplanetary MFRs generally follow a trend of about 0.6l/R radians, where l/R is the aspect ratio of a MFR, with a cutoff at about 12π radians AU-1, (2) most of them are significantly larger than 2.5π radians but well bounded by 2l/R radians, (3) strongly twisted magnetic field lines probably limit the expansion and size of MFRs, and (4) the magnetic field lines in the legs wind more tightly than those in the leading part of MFRs. These results not only advance our understanding of the properties and behavior of interplanetary MFRs but also shed light on the formation and eruption of MFRs in the solar atmosphere. A discussion about the twist and stableness of solar MFRs are therefore given.

  9. Twisting integrin receptors increases endothelin-1 gene expression in endothelial cells

    NASA Technical Reports Server (NTRS)

    Chen, J.; Fabry, B.; Schiffrin, E. L.; Wang, N.; Ingber, D. E. (Principal Investigator)

    2001-01-01

    A magnetic twisting stimulator was developed based on the previously published technique of magnetic twisting cytometry. Using ligand-coated ferromagnetic microbeads, this device can apply mechanical stresses with varying amplitudes, duration, frequencies, and waveforms to specific cell surface receptors. Biochemical and biological responses of the cells to the mechanical stimulation can be assayed. Twisting integrin receptors with RGD (Arg-Gly-Asp)-containing peptide-coated beads increased endothelin-1 (ET-1) gene expression by >100%. In contrast, twisting scavenger receptors with acetylated low-density lipoprotein-coated beads or twisting HLA antigen with anti-HLA antibody-coated beads did not lead to alterations in ET-1 gene expression. In situ hybridization showed that the increase in ET-1 mRNA was localized in the cells that were stressed with the RGD-coated beads. Blocking stretch-activated ion channels with gadolinium, chelating Ca2+ with EGTA, or inhibiting tyrosine phosphorylation with genistein abolished twist-induced ET-1 mRNA elevation. Abolishing cytoskeletal tension with an inhibitor of the myosin ATPase, with an inhibitor of myosin light chain kinase, or with an actin microfilament disrupter blocked twisted-induced increases in ET-1 expression. Our results are consistent with the hypothesis that the molecular structural linkage of integrin-cytoskeleton is an important pathway for stress-induced ET-1 gene expression.

  10. Magnetic Helicity Estimations in Models and Observations of the Solar Magnetic Field. III. Twist Number Method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Y.; Pariat, E.; Moraitis, K.

    We study the writhe, twist, and magnetic helicity of different magnetic flux ropes, based on models of the solar coronal magnetic field structure. These include an analytical force-free Titov–Démoulin equilibrium solution, non-force-free magnetohydrodynamic simulations, and nonlinear force-free magnetic field models. The geometrical boundary of the magnetic flux rope is determined by the quasi-separatrix layer and the bottom surface, and the axis curve of the flux rope is determined by its overall orientation. The twist is computed by the Berger–Prior formula, which is suitable for arbitrary geometry and both force-free and non-force-free models. The magnetic helicity is estimated by the twistmore » multiplied by the square of the axial magnetic flux. We compare the obtained values with those derived by a finite volume helicity estimation method. We find that the magnetic helicity obtained with the twist method agrees with the helicity carried by the purely current-carrying part of the field within uncertainties for most test cases. It is also found that the current-carrying part of the model field is relatively significant at the very location of the magnetic flux rope. This qualitatively explains the agreement between the magnetic helicity computed by the twist method and the helicity contributed purely by the current-carrying magnetic field.« less

  11. Twisted versus braided magnetic flux ropes in coronal geometry. II. Comparative behaviour

    NASA Astrophysics Data System (ADS)

    Prior, C.; Yeates, A. R.

    2016-06-01

    Aims: Sigmoidal structures in the solar corona are commonly associated with magnetic flux ropes whose magnetic field lines are twisted about a mutual axis. Their dynamical evolution is well studied, with sufficient twisting leading to large-scale rotation (writhing) and vertical expansion, possibly leading to ejection. Here, we investigate the behaviour of flux ropes whose field lines have more complex entangled/braided configurations. Our hypothesis is that this internal structure will inhibit the large-scale morphological changes. Additionally, we investigate the influence of the background field within which the rope is embedded. Methods: A technique for generating tubular magnetic fields with arbitrary axial geometry and internal structure, introduced in part I of this study, provides the initial conditions for resistive-MHD simulations. The tubular fields are embedded in a linear force-free background, and we consider various internal structures for the tubular field, including both twisted and braided topologies. These embedded flux ropes are then evolved using a 3D MHD code. Results: Firstly, in a background where twisted flux ropes evolve through the expected non-linear writhing and vertical expansion, we find that flux ropes with sufficiently braided/entangled interiors show no such large-scale changes. Secondly, embedding a twisted flux rope in a background field with a sigmoidal inversion line leads to eventual reversal of the large-scale rotation. Thirdly, in some cases a braided flux rope splits due to reconnection into two twisted flux ropes of opposing chirality - a phenomenon previously observed in cylindrical configurations. Conclusions: Sufficiently complex entanglement of the magnetic field lines within a flux rope can suppress large-scale morphological changes of its axis, with magnetic energy reduced instead through reconnection and expansion. The structure of the background magnetic field can significantly affect the changing morphology of a

  12. RESONANT ABSORPTION OF AXISYMMETRIC MODES IN TWISTED MAGNETIC FLUX TUBES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giagkiozis, I.; Verth, G.; Goossens, M.

    2016-06-01

    It has been shown recently that magnetic twist and axisymmetric MHD modes are ubiquitous in the solar atmosphere, and therefore the study of resonant absorption for these modes has become a pressing issue because it can have important consequences for heating magnetic flux tubes in the solar atmosphere and the observed damping. In this investigation, for the first time, we calculate the damping rate for axisymmetric MHD waves in weakly twisted magnetic flux tubes. Our aim is to investigate the impact of resonant damping of these modes for solar atmospheric conditions. This analytical study is based on an idealized configurationmore » of a straight magnetic flux tube with a weak magnetic twist inside as well as outside the tube. By implementing the conservation laws derived by Sakurai et al. and the analytic solutions for weakly twisted flux tubes obtained recently by Giagkiozis et al. we derive a dispersion relation for resonantly damped axisymmetric modes in the spectrum of the Alfvén continuum. We also obtain an insightful analytical expression for the damping rate in the long wavelength limit. Furthermore, it is shown that both the longitudinal magnetic field and the density, which are allowed to vary continuously in the inhomogeneous layer, have a significant impact on the damping time. Given the conditions in the solar atmosphere, resonantly damped axisymmetric modes are highly likely to be ubiquitous and play an important role in energy dissipation. We also suggest that, given the character of these waves, it is likely that they have already been observed in the guise of Alfvén waves.« less

  13. DO THE LEGS OF MAGNETIC CLOUDS CONTAIN TWISTED FLUX-ROPE MAGNETIC FIELDS?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Owens, M. J.

    2016-02-20

    Magnetic clouds (MCs) are a subset of interplanetary coronal mass ejections (ICMEs) characterized primarily by a smooth rotation in the magnetic field direction indicative of the presence of a magnetic flux rope. Energetic particle signatures suggest MC flux ropes remain magnetically connected to the Sun at both ends, leading to widely used model of global MC structure as an extended flux rope, with a loop-like axis stretching out from the Sun into the heliosphere and back to the Sun. The time of flight of energetic particles, however, suggests shorter magnetic field line lengths than such a continuous twisted flux ropemore » would produce. In this study, two simple models are compared with observed flux rope axis orientations of 196 MCs to show that the flux rope structure is confined to the MC leading edge. The MC “legs,” which magnetically connect the flux rope to the Sun, are not recognizable as MCs and thus are unlikely to contain twisted flux rope fields. Spacecraft encounters with these non-flux rope legs may provide an explanation for the frequent observation of non-MC ICMEs.« less

  14. Magnetic Causes of Solar Coronal Mass Ejections: Dominance of the Free Magnetic Energy Over the Magnetic Twist Alone

    NASA Technical Reports Server (NTRS)

    Falconer, D. A.; Moore, R. L.; Gary, g. A.

    2006-01-01

    We examine the magnetic causes of coronal mass ejections (CMEs) by examining, along with the correlations of active-region magnetic measures with each other, the correlations of these measures with active-region CME productivity observed in time windows of a few days, either centered on or extending forward from the day of the magnetic measurement. The measures are from 36 vector magnetograms of bipolar active regions observed within -30" of disk center by the Marshal Space Flight Center (MSFC) vector magnetograph. From each magnetogram, we extract six whole-active-region measures twice, once from the original plane-of-the-sky magnetogram and again a h r deprojection of the magnetogram to disk center. Three of the measures are alternative measures of the total nonpotentiality of the active region, two are alternative measures of the overall twist in the active-region's magnetic field, and one is a measure of the magnetic size of the active region (the active region's magnetic flux content). From the deprojected magnetograms, we find evidence that (1) magnetic twist and magnetic size are separate but comparably strong causes of active-region CME Productivity, and (2) the total free magnetic energy in an active region's magnetic field is a stronger determinant of the active region's CME productivity than is the field's overall twist (or helicity) alone. From comparison of results from the non-deprojected magnetograms with corresponding results from the deprojected magnetograms, we find evidence that (for prediction of active-region CME productivity and for further studies of active-region magnetic size as a cause of CMEs), for active regions within approx.30deg of disk center, active-region total nonpotentiality and flux content can be adequately measured from line-of-sight magnetograms, such as from SOH0 MDI.

  15. The Effect of a Twisted Magnetic Field on the Phase Mixing of the Kink Magnetohydrodynamic Waves in Coronal Loops

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ebrahimi, Zanyar; Karami, Kayoomars; Soler, Roberto, E-mail: z.ebrahimi@uok.ac.ir

    There is observational evidence for the existence of a twisted magnetic field in the solar corona. This inspires us to investigate the effect of a twisted magnetic field on the evolution of magnetohydrodynamic (MHD) kink waves in coronal loops. With this aim, we solve the incompressible linearized MHD equations in a magnetically twisted nonuniform coronal flux tube in the limit of long wavelengths. Our results show that a twisted magnetic field can enhance or diminish the rate of phase mixing of the Alfvén continuum modes and the decay rate of the global kink oscillation depending on the twist model andmore » the sign of the longitudinal ( k{sub z} ) and azimuthal ( m ) wavenumbers. Also, our results confirm that in the presence of a twisted magnetic field, when the sign of one of the two wavenumbers m and k {sub z} is changed, the symmetry with respect to the propagation direction is broken. Even a small amount of twist can have an important impact on the process of energy cascading to small scales.« less

  16. Buildup of a highly twisted magnetic flux rope during a solar eruption.

    PubMed

    Wang, Wensi; Liu, Rui; Wang, Yuming; Hu, Qiang; Shen, Chenglong; Jiang, Chaowei; Zhu, Chunming

    2017-11-06

    The magnetic flux rope is among the most fundamental magnetic configurations in plasma. Although its presence after solar eruptions has been verified by spacecraft measurements near Earth, its formation on the Sun remains elusive, yet is critical to understanding a broad spectrum of phenomena. Here we study the dynamic formation of a magnetic flux rope during a classic two-ribbon flare. Its feet are identified unambiguously with conjugate coronal dimmings completely enclosed by irregular bright rings, which originate and expand outward from the far ends of flare ribbons. The expansion is associated with the rapid ribbon separation during the flare main phase. Counting magnetic flux through the feet and the ribbon-swept area reveals that the rope's core is more twisted than its average of four turns. It propagates to the Earth as a typical magnetic cloud possessing a similar twist profile obtained by the Grad-Shafranov reconstruction of its three dimensional structure.

  17. Buildup of a highly twisted magnetic flux rope during a solar eruption

    NASA Astrophysics Data System (ADS)

    Wang, Wensi; Liu, Rui; Wang, Yuming; Hu, Qiang; Shen, Chenglong; Jiang, Chaowei; Zhu, Chunming

    2017-11-01

    The magnetic flux rope is among the most fundamental magnetic configurations in plasma. Although its presence after solar eruptions has been verified by spacecraft measurements near Earth, its formation on the Sun remains elusive, yet is critical to understanding a broad spectrum of phenomena. Here we study the dynamic formation of a magnetic flux rope during a classic two-ribbon flare. Its feet are identified unambiguously with conjugate coronal dimmings completely enclosed by irregular bright rings, which originate and expand outward from the far ends of flare ribbons. The expansion is associated with the rapid ribbon separation during the flare main phase. Counting magnetic flux through the feet and the ribbon-swept area reveals that the rope's core is more twisted than its average of four turns. It propagates to the Earth as a typical magnetic cloud possessing a similar twist profile obtained by the Grad-Shafranov reconstruction of its three dimensional structure.

  18. The Physics of Twisted Magnetic Tubes Rising in a Stratified Medium: Two-dimensional Results

    NASA Astrophysics Data System (ADS)

    Emonet, T.; Moreno-Insertis, F.

    1998-01-01

    The physics of a twisted magnetic flux tube rising in a stratified medium is studied using a numerical magnetohydrodynamic (MHD) code. The problem considered is fully compressible (has no Boussinesq approximation), includes ohmic resistivity, and is two-dimensional, i.e., there is no variation of the variables in the direction of the tube axis. We study a high-plasma β-case with a small ratio of radius to external pressure scale height. The results obtained will therefore be of relevance to understanding the transport of magnetic flux across the solar convection zone. We confirm that a sufficient twist of the field lines around the tube axis can suppress the conversion of the tube into two vortex rolls. For a tube with a relative density deficit on the order of 1/β (the classical Parker buoyancy) and a radius smaller than the pressure scale height (R2<twist necessary corresponds to an average pitch angle on the order of sin-1 [(R/Hp)1/2]. The evolution of a tube with this degree of twist is studied in detail, including the initial transient phase, the internal torsional oscillations, and the asymptotic, quasi-stationary phase. During the initial phase, the outermost, weakly magnetized layers of the tube are torn off its main body and endowed with vorticity. They yield a trailing magnetized wake with two vortex rolls. The fraction of the total magnetic flux that is brought to the wake is a function of the initial degree of twist. In the weakly twisted case, most of the initial tube is turned into vortex rolls. With a strong initial twist, the tube rises with only a small deformation and no substantial loss of magnetic flux. The formation of the wake and the loss of flux from the main body of the tube are basically complete after the initial transient phase. A sharp interface between the tube interior and the external flows is formed at the tube front and sides; this area has the characteristic features of a magnetic boundary layer. Its

  19. THE EFFECT OF A TWISTED MAGNETIC FIELD ON THE PERIOD RATIO P{sub 1}/P{sub 2} OF NONAXISYMMETRIC MAGNETOHYDRODYNAMIC WAVES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karami, K.; Bahari, K., E-mail: KKarami@uok.ac.ir, E-mail: K.Bahari@razi.ac.ir

    2012-10-01

    We consider nonaxisymmetric magnetohydrodynamic (MHD) modes in a zero-beta cylindrical compressible thin magnetic flux tube modeled as a twisted core surrounded by a magnetically twisted annulus, with both embedded in a straight ambient external field. The dispersion relation is derived and solved analytically and numerically to obtain the frequencies of the nonaxisymmetric MHD waves. The main result is that the twisted magnetic annulus does affect the period ratio P{sub 1}/P{sub 2} of the kink modes. For the kink modes, the magnetic twist in the annulus region can achieve deviations from P{sub 1}/P{sub 2} = 2 of the same order ofmore » magnitude as in the observations. Furthermore, the effect of the internal twist on the fluting modes is investigated.« less

  20. Parametric study on kink instabilities of twisted magnetic flux ropes in the solar atmosphere

    NASA Astrophysics Data System (ADS)

    Mei, Z. X.; Keppens, R.; Roussev, I. I.; Lin, J.

    2018-01-01

    Aims: Twisted magnetic flux ropes (MFRs) in the solar atmosphere have been researched extensively because of their close connection to many solar eruptive phenomena, such as flares, filaments, and coronal mass ejections (CMEs). In this work, we performed a set of 3D isothermal magnetohydrodynamic (MHD) numerical simulations, which use analytical twisted MFR models and study dynamical processes parametrically inside and around current-carrying twisted loops. We aim to generalize earlier findings by applying finite plasma β conditions. Methods: Inside the MFR, approximate internal equilibrium is obtained by pressure from gas and toroidal magnetic fields to maintain balance with the poloidal magnetic field. We selected parameter values to isolate best either internal or external kink instability before studying complex evolutions with mixed characteristics. We studied kink instabilities and magnetic reconnection in MFRs with low and high twists. Results: The curvature of MFRs is responsible for a tire tube force due to its internal plasma pressure, which tends to expand the MFR. The curvature effect of toroidal field inside the MFR leads to a downward movement toward the photosphere. We obtain an approximate internal equilibrium using the opposing characteristics of these two forces. A typical external kink instability totally dominates the evolution of MFR with infinite twist turns. Because of line-tied conditions and the curvature, the central MFR region loses its external equilibrium and erupts outward. We emphasize the possible role of two different kink instabilities during the MFR evolution: internal and external kink. The external kink is due to the violation of the Kruskal-Shafranov condition, while the internal kink requires a safety factor q = 1 surface inside the MFR. We show that in mixed scenarios, where both instabilities compete, complex evolutions occur owing to reconnections around and within the MFR. The S-shaped structures in current distributions

  1. Observation of nanoscale magnetic fields using twisted electron beams

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grillo, Vincenzo; Harvey, Tyler R.; Venturi, Federico

    Electron waves give an unprecedented enhancement to the field of microscopy by providing higher resolving power compared to their optical counterpart. Further information about a specimen, such as electric and magnetic features, can be revealed in electron microscopy because electrons possess both a magnetic moment and charge. In-plane magnetic structures in materials can be studied experimentally using the effect of the Lorentz force. On the other hand, full mapping of the magnetic field has hitherto remained challenging. Here we measure a nanoscale out-of-plane magnetic field by interfering a highly twisted electron vortex beam with a reference wave. We implement amore » recently developed holographic technique to manipulate the electron wavefunction, which gives free electrons an additional unbounded quantized magnetic moment along their propagation direction. Our finding demonstrates that full reconstruction of all three components of nanoscale magnetic fields is possible without tilting the specimen.« less

  2. Observation of nanoscale magnetic fields using twisted electron beams

    DOE PAGES

    Grillo, Vincenzo; Harvey, Tyler R.; Venturi, Federico; ...

    2017-09-25

    Electron waves give an unprecedented enhancement to the field of microscopy by providing higher resolving power compared to their optical counterpart. Further information about a specimen, such as electric and magnetic features, can be revealed in electron microscopy because electrons possess both a magnetic moment and charge. In-plane magnetic structures in materials can be studied experimentally using the effect of the Lorentz force. On the other hand, full mapping of the magnetic field has hitherto remained challenging. Here we measure a nanoscale out-of-plane magnetic field by interfering a highly twisted electron vortex beam with a reference wave. We implement amore » recently developed holographic technique to manipulate the electron wavefunction, which gives free electrons an additional unbounded quantized magnetic moment along their propagation direction. Our finding demonstrates that full reconstruction of all three components of nanoscale magnetic fields is possible without tilting the specimen.« less

  3. Witnessing magnetic twist with high-resolution observation from the 1.6-m New Solar Telescope

    PubMed Central

    Wang, Haimin; Cao, Wenda; Liu, Chang; Xu, Yan; Liu, Rui; Zeng, Zhicheng; Chae, Jongchul; Ji, Haisheng

    2015-01-01

    Magnetic flux ropes are highly twisted, current-carrying magnetic fields. They are crucial for the instability of plasma involved in solar eruptions, which may lead to adverse space weather effects. Here we present observations of a flaring using the highest resolution chromospheric images from the 1.6-m New Solar Telescope at Big Bear Solar Observatory, supplemented by a magnetic field extrapolation model. A set of loops initially appear to peel off from an overall inverse S-shaped flux bundle, and then develop into a multi-stranded twisted flux rope, producing a two-ribbon flare. We show evidence that the flux rope is embedded in sheared arcades and becomes unstable following the enhancement of its twists. The subsequent motion of the flux rope is confined due to the strong strapping effect of the overlying field. These results provide a first opportunity to witness the detailed structure and evolution of flux ropes in the low solar atmosphere. PMID:25919706

  4. Sensitive bistable magnetic sensors using twisted amorphous magnetostrictive ribbons due to Matteucci effect

    NASA Astrophysics Data System (ADS)

    Mohri, K.; Takeuchi, S.

    1982-11-01

    New sensitive magnetic-field sensors are presented using twisted amorphous magnetostrictive ribbons such as Fe80B20 and Fe81-xCrxB17Si2. Sharp voltage pulses are induced between ends of the ribbon of as short as 25 mm or at the terminals of the detecting coil against external fields of as low as 1 Oe and 0.01 Hz-6 kHz. The domain nucleation field at the bistable flux reversal is very constant for 130 °C, 600 h using Fe79Cr2B17Si2, and a possible maximum operating temperature is about 180 °C. Small sized magnetic sensors without any windings for detecting rotational speed, distance, and other mechanical quantities are realized using the twisted ribbons by combining with small magnets. These sensitive and reliable magnetic sensors with digital outputs are suitable for applications in industrial robots and automobiles controlled with microcomputers.

  5. Magnetic fingerprints of rolling cells for quantitative flow cytometry in whole blood

    NASA Astrophysics Data System (ADS)

    Reisbeck, Mathias; Helou, Michael Johannes; Richter, Lukas; Kappes, Barbara; Friedrich, Oliver; Hayden, Oliver

    2016-09-01

    Over the past 50 years, flow cytometry has had a profound impact on preclinical and clinical applications requiring single cell function information for counting, sub-typing and quantification of epitope expression. At the same time, the workflow complexity and high costs of such optical systems still limit flow cytometry applications to specialized laboratories. Here, we present a quantitative magnetic flow cytometer that incorporates in situ magnetophoretic cell focusing for highly accurate and reproducible rolling of the cellular targets over giant magnetoresistance sensing elements. Time-of-flight analysis is used to unveil quantitative single cell information contained in its magnetic fingerprint. Furthermore, we used erythrocytes as a biological model to validate our methodology with respect to precise analysis of the hydrodynamic cell diameter, quantification of binding capacity of immunomagnetic labels, and discrimination of cell morphology. The extracted time-of-flight information should enable point-of-care quantitative flow cytometry in whole blood for clinical applications, such as immunology and primary hemostasis.

  6. Twisting Plasma

    NASA Image and Video Library

    2016-06-08

    A close-up of twisting plasma above the Sun's surface produced a nice display of turbulence by caused combative magnetic forces (June 7-8, 2016) over a day and a half. The plasma does not break away, but just spins and twists the entire period. Images were taken in extreme ultraviolet light. The mass we observed is part of a longer, darkish filament angling down from the upper left of the frame. Filaments are unstable clouds of plasma suspended above the Sun by magnetic forces. http://photojournal.jpl.nasa.gov/catalog/PIA20739

  7. Transverse kink oscillations in the presence of twist

    NASA Astrophysics Data System (ADS)

    Terradas, J.; Goossens, M.

    2012-12-01

    Context. Magnetic twist is thought to play an important role in coronal loops. The effects of magnetic twist on stable magnetohydrodynamic (MHD) waves is poorly understood because they are seldom studied for relevant cases. Aims: The goal of this work is to study the fingerprints of magnetic twist on stable transverse kink oscillations. Methods: We numerically calculated the eigenmodes of propagating and standing MHD waves for a model of a loop with magnetic twist. The azimuthal component of the magnetic field was assumed to be small in comparison to the longitudinal component. We did not consider resonantly damped modes or kink instabilities in our analysis. Results: For a nonconstant twist the frequencies of the MHD wave modes are split, which has important consequences for standing waves. This is different from the degenerated situation for equilibrium models with constant twist, which are characterised by an azimuthal component of the magnetic field that linearly increases with the radial coordinate. Conclusions: In the presence of twist standing kink solutions are characterised by a change in polarisation of the transverse displacement along the tube. For weak twist, and in the thin tube approximation, the frequency of standing modes is unaltered and the tube oscillates at the kink speed of the corresponding straight tube. The change in polarisation is linearly proportional to the degree of twist. This has implications with regard to observations of kink modes, since the detection of this variation in polarisation can be used as an indirect method to estimate the twist in oscillating loops.

  8. The Twist Limit for Bipolar Active Regions

    NASA Technical Reports Server (NTRS)

    Moore, Ron; Falconer, David; Gary, Allen

    2008-01-01

    We present new evidence that further supports the standard idea that active regions are emerged magnetic-flux-rope omega loops. When the axial magnetic twist of a cylindrical flux rope exceeds a critical amount, the flux rope becomes unstable to kinking, and the excess axial twist is converted into writhe twist by the kinking. This suggests that, if active regions are emerged omega loops, then (1) no active region should have magnetic twist much above the limit set by kinking, (2) active regions having twist near the limit should often arise from kinked omega loops, and (3) since active regions having large delta sunspots are outstandingly twisted, these arise from kinked omega loops and should have twist near the limit for kinking. From each of 36 vector magnetograms of bipolar active regions, we have measured (1) the total flux of the vertical field above 100 G, (2) the area covered by this flux, and (3) the net electric current that arches over the polarity inversion line. These three quantities yield an estimate of the axial magnetic twist in a simple model cylindrical flux rope that corresponds to the top of the active region s hypothetical omega loop prior to emergence. In all 36 cases, the estimated twist is below the critical limit for kinking. The 11 most twisted active regions (1) have estimated twist within a factor of approx.3 of the limit, and (2) include all of our 6 active regions having large delta sunspots. Thus, our observed twist limit for bipolar active regions is in good accord with active regions being emerged omega loops.

  9. Artificial blood-flow controlling effects of inhomogeneity of twisted magnetic fields

    NASA Astrophysics Data System (ADS)

    Nakagawa, Hidenori; Ohuchi, Mikio

    2017-06-01

    We developed a blood-flow controlling system using magnetic therapy for some types of nervous diseases. In our research, we utilized overlapped extremely low frequency (ELF) fields for the most effective blood-flow for the system. Results showed the possibility that the inhomogeneous region obtained by overlapping the fields at 50 Hz, namely, a desirably twisted field revealed a significant difference in induced electromotive forces at the insertion points of electrodes. In addition, ELF exposures with a high inhomogeneity of the twisted field at 50 Hz out of phase were more effective in generating an induced electromotive difference by approximately 31%, as contrasted with the difference generated by the exposure in phase. We expect that the increase of the inhomogeneity of the twisted field around a blood vessel can produce the most effective electromotive difference in the blood, and also moderately affect the excitable cells relating to the autonomic nervous system for an outstanding blood-flow control in vivo.

  10. `Twisted' electrons

    NASA Astrophysics Data System (ADS)

    Larocque, Hugo; Kaminer, Ido; Grillo, Vincenzo; Leuchs, Gerd; Padgett, Miles J.; Boyd, Robert W.; Segev, Mordechai; Karimi, Ebrahim

    2018-04-01

    Electrons have played a significant role in the development of many fields of physics during the last century. The interest surrounding them mostly involved their wave-like features prescribed by the quantum theory. In particular, these features correctly predict the behaviour of electrons in various physical systems including atoms, molecules, solid-state materials, and even in free space. Ten years ago, new breakthroughs were made, arising from the new ability to bestow orbital angular momentum (OAM) to the wave function of electrons. This quantity, in conjunction with the electron's charge, results in an additional magnetic property. Owing to these features, OAM-carrying, or twisted, electrons can effectively interact with magnetic fields in unprecedented ways and have motivated materials scientists to find new methods for generating twisted electrons and measuring their OAM content. Here, we provide an overview of such techniques along with an introduction to the exciting dynamics of twisted electrons.

  11. Slow twists of solar magnetic flux tubes and the polar magnetic field of the sun

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, M.A.; Hollweg, J.V.

    The solar wind model of Weber and Davis (1967) is generalized to compute the heliospheric magnetic field resulting from solar rotation or a steady axisymmetric twist including a geometrical expansion which is more rapid than spherical. The calculated increase in the ratio of the toroidal to poloidal field components with heliocentric radial distance r clarifies an expression derived recently by Jokipii and Kota (1989). Magnetic field components transverse to r do not in general grow to dominate the radial component at large r. The analysis also yield expressions for the Poynting flux associated with the steady twists. These results aremore » regarded as indicative of the Poynting flux associated with very low frequency Alfven waves, and it is shown how the Poynting flux and the spatial evolution of the wave amplitude differ from the usual WKB result. It is found that the low-frequency Poynting flux at the base of a coronal hole can be about 50 percent larger than the WKB flux inferred from spectral observations of coronal motions (e.g. Hassler et al., 1988).« less

  12. Probing the Magnetic Causes of CMEs: Free Magnetic Energy More Important Than Either Size Or Twist

    NASA Technical Reports Server (NTRS)

    Falconer, D. A.; Moore, R. L.; Gary, G. A.

    2006-01-01

    To probe the magnetic causes of CMEs, we have examined three types of magnetic measures: size, twist and total nonpotentiality (or total free magnetic energy) of an active region. Total nonpotentiality is roughly the product of size times twist. For predominately bipolar active regions, we have found that total nonpotentiality measures have the strongest correlation with future CME productivity (approx. 75% prediction success rate), while size and twist measures each have a weaker correlation with future CME productivity (approx. 65% prediction success rate) (Falconer, Moore, & Gary, ApJ, 644, 2006). For multipolar active regions, we find that the CME-prediction success rates for total nonpotentiality and size are about the same as for bipolar active regions. We also find that the size measure correlation with CME productivity is nearly all due to the contribution of size to total nonpotentiality. We have a total nonpotentiality measure that can be obtained from a line-of-sight magnetogram of the active region and that is as strongly correlated with CME productivity as are any of our total-nonpotentiality measures from deprojected vector magnetograms. We plan to further expand our sample by using MDI magnetograms of each active region in our sample to determine its total nonpotentiality and size on each day that the active region was within 30 deg. of disk center. The resulting increase in sample size will improve our statistics and allow us to investigate whether the nonpotentiality threshold for CME production is nearly the same or significantly different for multipolar regions than for bipolar regions. In addition, we will investigate the time rates of change of size and total nonpotentiality as additional causes of CME productivity.

  13. MPQ-cytometry: a magnetism-based method for quantification of nanoparticle-cell interactions

    NASA Astrophysics Data System (ADS)

    Shipunova, V. O.; Nikitin, M. P.; Nikitin, P. I.; Deyev, S. M.

    2016-06-01

    Precise quantification of interactions between nanoparticles and living cells is among the imperative tasks for research in nanobiotechnology, nanotoxicology and biomedicine. To meet the challenge, a rapid method called MPQ-cytometry is developed, which measures the integral non-linear response produced by magnetically labeled nanoparticles in a cell sample with an original magnetic particle quantification (MPQ) technique. MPQ-cytometry provides a sensitivity limit 0.33 ng of nanoparticles and is devoid of a background signal present in many label-based assays. Each measurement takes only a few seconds, and no complicated sample preparation or data processing is required. The capabilities of the method have been demonstrated by quantification of interactions of iron oxide nanoparticles with eukaryotic cells. The total amount of targeted nanoparticles that specifically recognized the HER2/neu oncomarker on the human cancer cell surface was successfully measured, the specificity of interaction permitting the detection of HER2/neu positive cells in a cell mixture. Moreover, it has been shown that MPQ-cytometry analysis of a HER2/neu-specific iron oxide nanoparticle interaction with six cell lines of different tissue origins quantitatively reflects the HER2/neu status of the cells. High correlation of MPQ-cytometry data with those obtained by three other commonly used in molecular and cell biology methods supports consideration of this method as a prospective alternative for both quantifying cell-bound nanoparticles and estimating the expression level of cell surface antigens. The proposed method does not require expensive sophisticated equipment or highly skilled personnel and it can be easily applied for rapid diagnostics, especially under field conditions.Precise quantification of interactions between nanoparticles and living cells is among the imperative tasks for research in nanobiotechnology, nanotoxicology and biomedicine. To meet the challenge, a rapid method

  14. Magnetic tweezers for the measurement of twist and torque.

    PubMed

    Lipfert, Jan; Lee, Mina; Ordu, Orkide; Kerssemakers, Jacob W J; Dekker, Nynke H

    2014-05-19

    Single-molecule techniques make it possible to investigate the behavior of individual biological molecules in solution in real time. These techniques include so-called force spectroscopy approaches such as atomic force microscopy, optical tweezers, flow stretching, and magnetic tweezers. Amongst these approaches, magnetic tweezers have distinguished themselves by their ability to apply torque while maintaining a constant stretching force. Here, it is illustrated how such a "conventional" magnetic tweezers experimental configuration can, through a straightforward modification of its field configuration to minimize the magnitude of the transverse field, be adapted to measure the degree of twist in a biological molecule. The resulting configuration is termed the freely-orbiting magnetic tweezers. Additionally, it is shown how further modification of the field configuration can yield a transverse field with a magnitude intermediate between that of the "conventional" magnetic tweezers and the freely-orbiting magnetic tweezers, which makes it possible to directly measure the torque stored in a biological molecule. This configuration is termed the magnetic torque tweezers. The accompanying video explains in detail how the conversion of conventional magnetic tweezers into freely-orbiting magnetic tweezers and magnetic torque tweezers can be accomplished, and demonstrates the use of these techniques. These adaptations maintain all the strengths of conventional magnetic tweezers while greatly expanding the versatility of this powerful instrument.

  15. Detecting endotoxin with a flow cytometry-based magnetic aptasensor.

    PubMed

    Zuo, Ming-Yan; Chen, Li-Juan; Jiang, Hao; Tan, Lin; Luo, Zhao-Feng; Wang, Yan-Mei

    2014-12-01

    Endotoxin, which is also known as lipopolysaccharide (LPS), is a marker for intruding gram-negative pathogens. It is essential to detect endotoxin quickly and sensitively in a complex milieu. A new flow cytometry (FCM)-based magnetic aptasensor assay that employs two endotoxin-binding aptamers and magnetic beads has been developed to detect endotoxin. The endotoxin-conjugated sandwich complex on magnetic beads was observed by scanning confocal laser microscopy. The resulting magnetic aptasensor rapidly detected (<1 min) endotoxin within a broad dynamic detection range of 10(-8) to 10(0)mg/ml in the presence of bovine serum albumin (BSA), RNA, sucrose, and glucose, which are most likely to coexist with endotoxin in the majority of biological liquids. Only 2 μl of magnetic aptasensor was required to quantify the endotoxin solution. Furthermore, the magnetic aptasensor could be regenerated seven times and still presented an outstanding response to the endotoxin solution. Therefore, the magnetic aptasensor exhibited high sensitivity, selectivity, and reproducibility, thereby serving as a powerful tool for the quality control and high-throughput detection of endotoxin in the food and pharmaceutical industries. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. A Magnetic Reconnection Event in the Solar Atmosphere Driven by Relaxation of a Twisted Arch Filament System

    NASA Astrophysics Data System (ADS)

    Huang, Zhenghua; Mou, Chaozhou; Fu, Hui; Deng, Linhua; Li, Bo; Xia, Lidong

    2018-02-01

    We present high-resolution observations of a magnetic reconnection event in the solar atmosphere taken with the New Vacuum Solar Telescope, Atmospheric Imaging Assembly (AIA), and Helioseismic and Magnetic Imager (HMI). The reconnection event occurred between the threads of a twisted arch filament system (AFS) and coronal loops. Our observations reveal that the relaxation of the twisted AFS drives some of its threads to encounter the coronal loops, providing inflows of the reconnection. The reconnection is evidenced by flared X-shape features in the AIA images, a current-sheet-like feature apparently connecting post-reconnection loops in the Hα + 1 Å images, small-scale magnetic cancelation in the HMI magnetograms and flows with speeds of 40–80 km s‑1 along the coronal loops. The post-reconnection coronal loops seen in the AIA 94 Å passband appear to remain bright for a relatively long time, suggesting that they have been heated and/or filled up by dense plasmas previously stored in the AFS threads. Our observations suggest that the twisted magnetic system could release its free magnetic energy into the upper solar atmosphere through reconnection processes. While the plasma pressure in the reconnecting flux tubes are significantly different, the reconfiguration of field lines could result in transferring of mass among them and induce heating therein.

  17. Theory of twisted trunks

    NASA Astrophysics Data System (ADS)

    Carlqvist, P.; Gahm, G. F.; Kristen, H.

    2003-05-01

    Using the 2.6 m Nordic Optical Telescope we have observed a large number of elephant trunks in several H II regions. Here, we present a small selection of this material consisting of a few large, well-developed trunks, and some smaller ones. We find that: (i) the well-developed trunks are made up of dark filaments and knots which show evidence of twisted structures, (ii) the trunks are connected with essentially two filamentary legs running in V-shape, and (iii) all trunks have the maximum extinction in their heads. We advance a theory of twisted elephant trunks which is based on the presence of magnetic flux ropes in molecular clouds where hot OB stars are formed. If the rope contains a local condensation it may adopt a V-shape as the H II region around the hot stars expands. If, in addition, the magnetic field in the rope is sufficiently twisted, the rope may form a double helix at the apex of the V. The double helix is identified with the twisted elephant trunks. In order to illustrate the mechanisms behind the double helix we have constructed a mechanical analogy model of the magnetic flux rope in which the rope has been replaced by a bundle of elastic strings loaded by a weight. Experiments with the model clearly show that part of the bundle will transform into a double helix when the twist of the bundle is sufficiently large. We have also worked out a simple theoretical model of a mass-loaded magnetic flux rope. Numerical calculations show that a double helix will indeed form when the twist of the rope exceeds a certain critical limit. Numerical model calculations are applied to both the analogy model experiments and one of the well-developed elephant trunks. On the basis of our model we also suggest a new interpretation of the so called EGGs. The double helix mechanism is quite general, and should be active also in other suitable environments. One such environment may be the shell of supernova remnants. Another example is the expanding bubble outlined by the

  18. OBSERVATIONS OF A SERIES OF FLARES AND ASSOCIATED JET-LIKE ERUPTIONS DRIVEN BY THE EMERGENCE OF TWISTED MAGNETIC FIELDS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Eun-Kyung; Yurchyshyn, Vasyl; Kim, Sujin

    We studied temporal changes of morphological and magnetic properties of a succession of four confined flares followed by an eruptive flare using the high-resolution New Solar Telescope (NST) operating at the Big Bear Solar Observatory (BBSO) and Helioseismic and Magnetic Imager (HMI) magnetograms and Atmospheric Image Assembly (AIA) EUV images provided by the Solar Dynamics Observatory (SDO). From the NST/Hα and the SDO/AIA 304 Å observations we found that each flare developed a jet structure that evolved in a manner similar to evolution of the blowout jet: (1) an inverted-Y-shaped jet appeared and drifted away from its initial position; (2) jets formed amore » curtain-like structure that consisted of many fine threads accompanied by subsequent brightenings near the footpoints of the fine threads; and finally, (3) the jet showed a twisted structure visible near the flare maximum. Analysis of the HMI data showed that both the negative magnetic flux and the magnetic helicity have been gradually increasing in the positive-polarity region, indicating the continuous injection of magnetic twist before and during the series of flares. Based on these results, we suggest that the continuous emergence of twisted magnetic flux played an important role in producing successive flares and developing a series of blowout jets.« less

  19. Homologous and cannibalistic coronal mass ejections from twisted magnetic flux rope simulations

    NASA Astrophysics Data System (ADS)

    Chatterjee, Piyali; Fan, Yuhong

    We present results from magnetohydrodynamic simulations of the development of homologous sequence of coronal mass ejections (CMEs) and demonstrate their so-called cannibalistic behavior. These CMEs originate from the repeated formations and partial eruptions of kink unstable flux ropes as a result of continued emergence of a twisted flux rope across the lower boundary into a pre-existing coronal potential arcade field. Our simulation shows that a CME erupting into the open magnetic field created by a preceding CME has a higher speed. The second of the three successive CMEs in one of the simulations is cannibalistic, catching up and merging with the first into a single fast CME before exiting the domain. All the CMEs including the leading merged CME, attained speeds of about 1000 km s-1 as they exit the domain. The reformation of a twisted flux rope after each CME eruption during the sustained flux emergence can naturally explain the X-ray observations of repeated reformations of sigmoids and "sigmoid-under-cusp" configurations at a low-coronal source of homologous CMEs. We also investigate the initiation mechanism and ejecta topology of these energetic CMEs as a function of the twist parameter of the flux rope.

  20. Effect of magnetic bead agglomeration on Cytomagnetometric measurements.

    PubMed

    Möller, Winfried; Nemoto, Iku; Heyder, Joachim

    2003-12-01

    Magnetic twisting cytometry (MTC) is a novel tool to measure cytoskeleton-associated cell functions by the use of ferromagnetic microbeads. Magnetic beads are either incorporated by living cells by phagocytic processes or attached to integrin receptors to the cell membrane. The magnetic beads are magnetized and aligned in a strong magnetic field pulse. The application of twisting forces allows to investigate mechanical properties (stiffness, viscoelasticity) of the cytoskeleton of living cells by analyzing the magnetic cell field. Incorporated magnetic beads undergo intracellular transport processes, which result in a loss of particle alignment and in a decay of the remanent magnetic cell field. This process, called relaxation, depends on the mechanical cytoskeletal properties and can directly visualize the intracellular energy of cellular transport processes. The preparation of spherical monodisperse ferromagnetic beads made it possible to understand the above-described processes using mathematical models. Experimental conditions with many magnetic particles per cell enhances the formation of aggregates because of the attractive forces between magnetic spheres, resulting in a change of magnetic properties and of hydrodynamic behavior. Due to mutual magnetization, the remanent magnetic moment of an aggregate is stronger compared to the same number of single particles. This implies a higher cell field. Additionally the relaxation is retarded because of the change in shape factor and in volume, which also implies a faulty estimation of intracellular transport energy. Magnetic particle twisting is less influenced. In summary, valuable cytomagnetometric measurements have to be done with less than one particle per macrophage to ensure low probability of multiple particles per cell.

  1. Propulsion and hydrodynamic particle transport of magnetically twisted colloidal ribbons

    NASA Astrophysics Data System (ADS)

    Massana-Cid, Helena; Martinez-Pedrero, Fernando; Navarro-Argemí, Eloy; Pagonabarraga, Ignacio; Tierno, Pietro

    2017-10-01

    We describe a method to trap, transport and release microscopic particles in a viscous fluid using the hydrodynamic flow field generated by a magnetically propelled colloidal ribbon. The ribbon is composed of ferromagnetic microellipsoids that arrange with their long axis parallel to each other, a configuration that is energetically favorable due to their permanent magnetic moments. We use an external precessing magnetic field to torque the anisotropic particles forming the ribbon, and to induce propulsion of the entire structure due to the hydrodynamic coupling with the close substrate. The propulsion speed of the ribbon can be controlled by varying the driving frequency, or the amplitude of the precessing field. The latter parameter is also used to reduce the average inter particle distance and to induce the twisting of the ribbon due to the increase in the attraction between the rotating ellipsoids. Furthermore, non magnetic particles are attracted or repelled with the hydrodynamic flow field generated by the propelling ribbon. The proposed method may be used in channel free microfluidic applications, where the precise trapping and transport of functionalized particles via non invasive magnetic fields is required.

  2. PARTIAL ERUPTION OF A FILAMENT WITH TWISTING NON-UNIFORM FIELDS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bi, Yi; Jiang, Yunchun; Yang, Jiayan

    The eruption of a filament in a kinklike fashion is often regarded as a signature of kink instability. However, the kink instability threshold for the filament’s magnetic structure is not widely understood. Using Hα observations from the New Vacuum Solar Telescope, we present a partial eruptive filament. During the eruption, the filament thread appeared to split from its middle and to break out in a kinklike fashion. In this period, the remaining filament material stayed below and erupted without the kinking motion later on. The coronal magnetic field lines associated with the filament are obtained from nonlinear force-free field extrapolationsmore » using the twelve-minute-cadence vector magnetograms of the Helioseismic and Magnetic Imager (HMI) on board the Solar Dynamic Observatory. We studied the extrapolated field lines passing through the magnetic dips which are in good agreement with the observed filament. The field lines are non-uniformly twisted and appear to be composed of two twisted flux ropes winding around each other. One of them has a higher twist than the other, and the flux rope with the higher twist has its dips aligned with the kinking eruptive thread at the beginning of its eruption. Before the eruption, moreover, the flux rope with the higher twist was found to expand with an approximately constant field twist. In addition, the helicity flux maps deduced from the HMI magnetograms show that some helicity is injected into the overlying magnetic arcade, but no significant helicity is injected into the flux ropes. Accordingly, we suggest that the highly twisted flux rope became kink unstable when the instability threshold declined with the expansion of the flux rope.« less

  3. Probing Twisted Magnetic Field Using Microwave Observations in an M Class Solar Flare on 11 February, 2014

    NASA Astrophysics Data System (ADS)

    Sharykin, I. N.; Kuznetsov, A. A.; Myshyakov, I. I.

    2018-02-01

    This work demonstrates the possibility of magnetic-field topology investigations using microwave polarimetric observations. We study a solar flare of GOES M1.7 class that occurred on 11 February, 2014. This flare revealed a clear signature of spatial inversion of the radio-emission polarization sign. We show that the observed polarization pattern can be explained by nonthermal gyrosynchrotron emission from the twisted magnetic structure. Using observations of the Reuven Ramaty High Energy Solar Spectroscopic Imager, Nobeyama Radio Observatory, Radio Solar Telescope Network, and Solar Dynamics Observatory, we have determined the parameters of nonthermal electrons and thermal plasma and identified the magnetic structure where the flare energy release occurred. To reconstruct the coronal magnetic field, we use nonlinear force-free field (NLFFF) and potential magnetic-field approaches. Radio emission of nonthermal electrons is simulated by the GX Simulator code using the extrapolated magnetic field and the parameters of nonthermal electrons and thermal plasma inferred from the observations; the model radio maps and spectra are compared with observations. We have found that the potential-magnetic-field approach fails to explain the observed circular polarization pattern; on the other hand, the Stokes-V map is successfully explained by assuming nonthermal electrons to be distributed along the twisted magnetic structure determined by the NLFFF extrapolation approach. Thus, we show that the radio-polarization maps can be used for diagnosing the topology of the flare magnetic structures where nonthermal electrons are injected.

  4. Anderson transition in a multiply-twisted helix.

    PubMed

    Ugajin, R

    2001-06-01

    We investigated the Anderson transition in a multiply-twisted helix in which a helical chain of components, i.e., atoms or nanoclusters, is twisted to produce a doubly-twisted helix, which itself can be twisted to produce a triply-twisted helix, and so on, in which there are couplings between adjacent rounds of helices. As the strength of the on-site random potentials increases, an Anderson transition occurs, suggesting that the number of dimensions is 3 for electrons running along the multiply-twisted helix when the couplings between adjacent rounds are strong enough. If the couplings are weakened, the dimensionality becomes less, resulting in localization of electrons. The effect of random connections between adjacent rounds of helices and random magnetic fields that thread the structure is analyzed using the spectral statistics of a quantum particle.

  5. Twist-induced Magnetosphere Reconfiguration for Intermittent Pulsars

    NASA Astrophysics Data System (ADS)

    Huang, Lei; Yu, Cong; Tong, Hao

    2016-08-01

    We propose that the magnetosphere reconfiguration induced by magnetic twists in the closed field line region can account for the mode switching of intermittent pulsars. We carefully investigate the properties of axisymmetric force-free pulsar magnetospheres with magnetic twists in closed field line regions around the polar caps. The magnetosphere with twisted closed lines leads to enhanced spin-down rates. The enhancement in spin-down rate depends on the size of the region with twisted closed lines. Typically, it is increased by a factor of ˜2, which is consistent with the intermittent pulsars’ spin-down behavior during the “off” and “on” states. We find that there is a threshold of maximal twist angle {{Δ }}{φ }{{thres}}˜ 1. The magnetosphere is stable only if the closed line twist angle is less than {{Δ }}{φ }{{thres}}. Beyond this value, the magnetosphere becomes unstable and gets untwisted. The spin-down rate would reduce to its off-state value. The quasi-periodicity in spin-down rate change can be explained by long-term activities in the star’s crust and the untwisting induced by MHD instability. The estimated duration of on-state is about 1 week, consistent with observations. Due to the MHD instability, there exists an upper limit for the spin-down ratio (f˜ 3) between the on-state and the off-state, if the Y-point remains at the light cylinder.

  6. Twisting and Writhing with George Ellery Hale

    NASA Astrophysics Data System (ADS)

    Canfield, Richard C.

    2013-06-01

    Early in his productive career in astronomy, George Ellery Hale developed innovative solar instrumentation that allowed him to make narrow-band images. Among the solar phenomena he discovered were sunspot vortices, which he attributed to storms akin to cyclones in our own atmosphere. Using the concept of magnetic helicity, physicists and mathematicians describe the topology of magnetic fields, including twisting and writhing. Our contemporary understanding of Hale's vortices as a consequence of large-scale twist in sunspot magnetic fields hinges on a key property of helicity: conservation. I will describe the critical role that this property plays, when applied to twist and writhe, in a fundamental aspect of global solar magnetism: the hemispheric and solar cycle dependences of active region electric currents with respect to magnetic fields. With the advent of unbroken sequences of high-resolution magnetic images, such as those presently available from the Helioseismic and Magnetic Imager on Solar Dynamics Observatory, the flux of magnetic helicity through the photosphere can be observed quantitatively. As magnetic flux tubes buoy up through the convection zone, buffeted and shredded by turbulence, they break up into fragments by repeated random bifurcation. We track these rising flux fragments in the photosphere, and calculate the flux of energy and magnetic helicity there. Using a quantitative model of coronal currents, we also track connections between these fragments to calculate the energy and magnetic helicity stored at topological interfaces that are in some ways analogous to the storage of stress at faults in the Earth's crust. Comparison of these values to solar flares and interplanetary coronal mass ejections implies that this is the primary storage mechanism for energy and magnetic helicity released in those phenomena, and suggests a useful tool for quantitative prediction of geomagnetic storms.

  7. Observing the release of twist by magnetic reconnection in a solar filament eruption

    PubMed Central

    Xue, Zhike; Yan, Xiaoli; Cheng, Xin; Yang, Liheng; Su, Yingna; Kliem, Bernhard; Zhang, Jun; Liu, Zhong; Bi, Yi; Xiang, Yongyuan; Yang, Kai; Zhao, Li

    2016-01-01

    Magnetic reconnection is a fundamental process of topology change and energy release, taking place in plasmas on the Sun, in space, in astrophysical objects and in the laboratory. However, observational evidence has been relatively rare and typically only partial. Here we present evidence of fast reconnection in a solar filament eruption using high-resolution H-alpha images from the New Vacuum Solar Telescope, supplemented by extreme ultraviolet observations. The reconnection is seen to occur between a set of ambient chromospheric fibrils and the filament itself. This allows for the relaxation of magnetic tension in the filament by an untwisting motion, demonstrating a flux rope structure. The topology change and untwisting are also found through nonlinear force-free field modelling of the active region in combination with magnetohydrodynamic simulation. These results demonstrate a new role for reconnection in solar eruptions: the release of magnetic twist. PMID:27306479

  8. Model of a fluxtube with a twisted magnetic field in the stratified solar atmosphere

    NASA Astrophysics Data System (ADS)

    Sen, S.; Mangalam, A.

    2018-01-01

    We build a single vertical straight magnetic fluxtube spanning the solar photosphere and the transition region which does not expand with height. We assume that the fluxtube containing twisted magnetic fields is in magnetohydrostatic equilibrium within a realistic stratified atmosphere subject to solar gravity. Incorporating specific forms of current density and gas pressure in the Grad-Shafranov equation, we solve the magnetic flux function, and find it to be separable with a Coulomb wave function in radial direction while the vertical part of the solution decreases exponentially. We employ improved fluxtube boundary conditions and take a realistic ambient external pressure for the photosphere to transition region, to derive a family of solutions for reasonable values of the fluxtube radius and magnetic field strength at the base of the axis that are the free parameters in our model. We find that our model estimates are consistent with the magnetic field strength and the radii of Magnetic bright points (MBPs) as estimated from observations. We also derive thermodynamic quantities inside the fluxtube.

  9. Force-free field modeling of twist and braiding-induced magnetic energy in an active-region corona

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thalmann, J. K.; Tiwari, S. K.; Wiegelmann, T., E-mail: julia.thalmann@uni-graz.at

    2014-01-01

    The theoretical concept that braided magnetic field lines in the solar corona may dissipate a sufficient amount of energy to account for the brightening observed in the active-region (AR) corona has only recently been substantiated by high-resolution observations. From the analysis of coronal images obtained with the High Resolution Coronal Imager, first observational evidence of the braiding of magnetic field lines was reported by Cirtain et al. (hereafter CG13). We present nonlinear force-free reconstructions of the associated coronal magnetic field based on Solar Dynamics Observatory/Helioseismic and Magnetic Imager vector magnetograms. We deliver estimates of the free magnetic energy associated withmore » a braided coronal structure. Our model results suggest (∼100 times) more free energy at the braiding site than analytically estimated by CG13, strengthening the possibility of the AR corona being heated by field line braiding. We were able to appropriately assess the coronal free energy by using vector field measurements and we attribute the lower energy estimate of CG13 to the underestimated (by a factor of 10) azimuthal field strength. We also quantify the increase in the overall twist of a flare-related flux rope that was noted by CG13. From our models we find that the overall twist of the flux rope increased by about half a turn within 12 minutes. Unlike another method to which we compare our results, we evaluate the winding of the flux rope's constituent field lines around each other purely based on their modeled coronal three-dimensional field line geometry. To our knowledge, this is done for the first time here.« less

  10. Sunspot rotation. II. Effects of varying the field strength and twist of an emerging flux tube

    NASA Astrophysics Data System (ADS)

    Sturrock, Z.; Hood, A. W.

    2016-09-01

    Context. Observations of flux emergence indicate that rotational velocities may develop within sunspots. However, the dependence of this rotation on sub-photospheric field strength and twist remains largely unknown. Aims: We investigate the effects of varying the initial field strength and twist of an emerging sub-photospheric magnetic flux tube on the rotation of the sunspots at the photosphere. Methods: We consider a simple model of a stratified domain with a sub-photospheric interior layer and three overlying atmospheric layers. A twisted arched flux tube is inserted in the interior and is allowed to rise into the atmosphere. To achieve this, the magnetohydrodynamic equations are solved using the Lagrangian-remap code, Lare3d. We perform a parameter study by independently varying the sub-photospheric magnetic field strength and twist. Results: Altering the initial magnetic field strength and twist of the flux tube significantly affects the tube's evolution and the rotational motions that develop at the photosphere. The rotation angle, vorticity, and current show a direct dependence on the initial field strength. We find that an increase in field strength increases the angle through which the fieldlines rotate, the length of the fieldlines extending into the atmosphere, and the magnetic energy transported to the atmosphere. This also affects the amount of residual twist in the interior. The length of the fieldlines is crucial as we predict the twist per unit length equilibrates to a lower value on longer fieldlines. No such direct dependence is found when we modify the twist of the magnetic field owing to the complex effect this has on the tension force acting on the tube. However, there is still a clear ordering in quantities such as the rotation angle, helicity, and free energy with higher initial twist cases being related to sunspots that rotate more rapidly, transporting more helicity and magnetic energy to the atmosphere.

  11. Unwinding motion of a twisted active region filament

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, X. L.; Xue, Z. K.; Kong, D. F.

    To better understand the structures of active region filaments and the eruption process, we study an active region filament eruption in active region NOAA 11082 in detail on 2010 June 22. Before the filament eruption, the opposite unidirectional material flows appeared in succession along the spine of the filament. The rising of the filament triggered two B-class flares at the upper part of the filament. As the bright material was injected into the filament from the sites of the flares, the filament exhibited a rapid uplift accompanying the counterclockwise rotation of the filament body. From the expansion of the filament,more » we can see that the filament consisted of twisted magnetic field lines. The total twist of the filament is at least 5π obtained by using a time slice method. According to the morphology change during the filament eruption, it is found that the active region filament was a twisted flux rope and its unwinding motion was like a solar tornado. We also find that there was a continuous magnetic helicity injection before and during the filament eruption. It is confirmed that magnetic helicity can be transferred from the photosphere to the filament. Using the extrapolated potential fields, the average decay index of the background magnetic fields over the filament is 0.91. Consequently, these findings imply that the mechanism of solar filament eruption could be due to the kink instability and magnetic helicity accumulation.« less

  12. Field line twist and field-aligned currents in an axially symmetric equilibrium magnetosphere. [of Uranus

    NASA Technical Reports Server (NTRS)

    Voigt, Gerd-Hannes

    1986-01-01

    Field-aligned Birkeland currents and the angle of the magnetic line twist were calculated for an axially symmetric pole-on magnetosphere (assumed to be in MHD equilibrium). The angle of the field line twist was shown to have a strong radial dependence on the axisymmetric magnetotail as well as on the ionospheric conductivity and the amount of thermal plasma contained in closed magnetotail flux tubes. The field line twist results from the planetary rotation, which leads to the development of a toroidal magnetic B-sub-phi component and to differentially rotating magnetic field lines. It was shown that the time development of the toroidal magnetic B-sub-phi component and the rotation frequency are related through an induction equation.

  13. Study of nonlinear MHD equations governing the wave propagation in twisted coronal loops

    NASA Technical Reports Server (NTRS)

    Parhi, S.; DeBruyne, P.; Goossens, M.; Zhelyazkov, I.

    1995-01-01

    The solar corona, modelled by a low beta, resistive plasma slab, sustains MHD wave propagations due to shearing footpoint motions in the photosphere. By using a numerical algorithm the excitation and nonlinear development of MHD waves in twisted coronal loops are studied. The plasma responds to the footpoint motion by sausage waves if there is no twist. The twist in the magnetic field of the loop destroys initially developed sausage-like wave modes and they become kinks. The transition from sausage to kink modes is analyzed. The twist brings about mode degradation producing high harmonics and this generates more complex fine structures. This can be attributed to several local extrema in the perturbed velocity profiles. The Alfven wave produces remnants of the ideal 1/x singularity both for zero and non-zero twist and this pseudo-singularity becomes less pronounced for larger twist. The effect of nonlinearity is clearly observed by changing the amplitude of the driver by one order of magnitude. The magnetosonic waves also exhibit smoothed remnants of ideal logarithmic singularities when the frequency of the driver is correctly chosen. This pseudo-singularity for fast waves is absent when the coronal loop does not undergo any twist but becomes pronounced when twist is included. On the contrary, it is observed for slow waves even if there is no twist. Increasing the twist leads to a higher heating rate of the loop. The larger twist shifts somewhat uniformly distributed heating to layers inside the slab corresponding to peaks in the magnetic field strength.

  14. Twisted supersymmetry: Twisted symmetry versus renormalizability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dimitrijevic, Marija; Nikolic, Biljana; Radovanovic, Voja

    We discuss a deformation of superspace based on a Hermitian twist. The twist implies a *-product that is noncommutative, Hermitian and finite when expanded in a power series of the deformation parameter. The Leibniz rule for the twisted supersymmetry transformations is deformed. A minimal deformation of the Wess-Zumino action is proposed and its renormalizability properties are discussed. There is no tadpole contribution, but the two-point function diverges. We speculate that the deformed Leibniz rule, or more generally the twisted symmetry, interferes with renormalizability properties of the model. We discuss different possibilities to render a renormalizable model.

  15. Evidence of Twisted Flux-Tube Emergence in Active Regions

    NASA Astrophysics Data System (ADS)

    Poisson, M.; Mandrini, C. H.; Démoulin, P.; López Fuentes, M.

    2015-03-01

    Elongated magnetic polarities are observed during the emergence phase of bipolar active regions (ARs). These extended features, called magnetic tongues, are interpreted as a consequence of the azimuthal component of the magnetic flux in the toroidal flux-tubes that form ARs. We develop a new systematic and user-independent method to identify AR tongues. Our method is based on determining and analyzing the evolution of the AR main polarity inversion line (PIL). The effect of the tongues is quantified by measuring the acute angle [ τ] between the orientation of the PIL and the direction orthogonal to the AR main bipolar axis. We apply a simple model to simulate the emergence of a bipolar AR. This model lets us interpret the effect of magnetic tongues on parameters that characterize ARs ( e.g. the PIL inclination and the tilt angles, and their evolution). In this idealized kinematic emergence model, τ is a monotonically increasing function of the twist and has the same sign as the magnetic helicity. We systematically apply our procedure to a set of bipolar ARs (41 ARs) that were observed emerging in line-of-sight magnetograms over eight years. For most of the cases studied, the tongues only have a small influence on the AR tilt angle since tongues have a much lower magnetic flux than the more concentrated main polarities. From the observed evolution of τ, corrected for the temporal evolution of the tilt angle and its final value when the AR is fully emerged, we estimate the average number of turns in the subphotospherically emerging flux-rope. These values for the 41 observed ARs are below unity, except for one. This indicates that subphotospheric flux-ropes typically have a low amount of twist, i.e. highly twisted flux-tubes are rare. Our results demonstrate that the evolution of the PIL is a robust indicator of the presence of tongues and constrains the amount of twist in emerging flux-tubes.

  16. Direct Observation of Twisted Surface skyrmions in Bulk Crystals

    NASA Astrophysics Data System (ADS)

    Zhang, S. L.; van der Laan, G.; Wang, W. W.; Haghighirad, A. A.; Hesjedal, T.

    2018-06-01

    Magnetic skyrmions in noncentrosymmetric helimagnets with Dn symmetry are Bloch-type magnetization swirls with a helicity angle of ±9 0 ° . At the surface of helimagnetic thin films below a critical thickness, a twisted skyrmion state with an arbitrary helicity angle has been proposed; however, its direct experimental observation has remained elusive. Here, we show that circularly polarized resonant elastic x-ray scattering is able to unambiguously measure the helicity angle of surface skyrmions, providing direct experimental evidence that a twisted skyrmion surface state also exists in bulk systems. The exact surface helicity angles of twisted skyrmions for both left- and right-handed chiral bulk Cu2 OSeO3 , in the single as well as in the multidomain skyrmion lattice state, are determined, revealing their detailed internal structure. Our findings suggest that a skyrmion surface reconstruction is a universal phenomenon, stemming from the breaking of translational symmetry at the interface.

  17. Formation of Twisted Elephant Trunks in the Rosette Nebula

    NASA Astrophysics Data System (ADS)

    Carlqvist, P.; Gahm, G. F.; Kristen, H.

    New observations show that dark elephant trunks in the Rosette nebula are often built up by thin filaments. In several of the trunks the filaments seem to form a twisted pattern. This pattern is hard to reconcile with current theory. We propose a new model for the formation of twisted elephant trunks in which electromagnetic forces play an important role. The model considers the behaviour of a twisted magnetic filament in a molecular cloud, where a cluster of hot stars has been recently born. As a result of stellar winds, and radiation pressure, electromagnetic forces, and inertia forces part of the filament can develop into a double helix pointing towards the stars. The double helix represents the twisted elephant trunk. A simple analogy experiment visualizes and supports the trunk model.

  18. Optical studies of blue phase III, twist-bend and bent-core nematic liquid crystals in high magnetic fields

    NASA Astrophysics Data System (ADS)

    Challa, Pavan Kumar

    that form the recently discovered twist-bend nematic (NTB) phase, which represents a new type of 3-dimensional anisotropic fluid with about 10 nm periodicity and accompanied optical stripes are discussed. In twist-bend nematic phase the director follows an oblique helicoid, maintaining a constant oblique angle with the helix axis and experiencing twist and bend. The pitch of the oblique helocoid is in the nanometer range. Light from a red laser was passed normally through the sample placed between crossed polarizers oriented at 45° with respect to the vertical magnetic field. Optical birefringence was measured from the transmitted light. Magnetic field of B=25T shifts downward the N-NTB phase transitions by almost 1 Celsius. We also show that the optical stripes can be unwound by a temperature and material dependent magnetic induction in the range of B=5-25T. Finally, we propose a Helfrich-Hurault type mechanism for the optical stripe formation. Based on this model we calculate the magnetic field unwinding the optical scale stripes, and find agreement with our experimental results.

  19. Electric currents induced by twisted light in Quantum Rings.

    PubMed

    Quinteiro, G F; Berakdar, J

    2009-10-26

    We theoretically investigate the generation of electric currents in quantum rings resulting from the optical excitation with twisted light. Our model describes the kinetics of electrons in a two-band model of a semiconductor-based mesoscopic quantum ring coupled to light having orbital angular momentum (twisted light). We find the analytical solution, which exhibits a "circular" photon-drag effect and an induced magnetization, suggesting that this system is the circular analog of that of a bulk semiconductor excited by plane waves. For realistic values of the electric field and material parameters, the computed electric current can be as large as microA; from an applied perspective, this opens new possibilities to the optical control of the magnetization in semiconductors.

  20. New twisted intermetallic compound superconductor: A concept

    NASA Technical Reports Server (NTRS)

    Coles, W. D.; Brown, G. V.; Laurence, J. C.

    1972-01-01

    Method for processing Nb3Sn and other intermetallic compound superconductors produces a twisted, stabilized wire or tube which can be used to wind electromagnetics, armatures, rotors, and field windings for motors and generators as well as other magnetic devices.

  1. A unified formulation of dichroic signals using the Borrmann effect and twisted photon beams.

    PubMed

    Collins, Stephen P; Lovesey, Stephen W

    2018-05-21

    Dichroic X-ray signals derived from the Borrmann effect and a twisted photon beam with topological charge l = 1 are formulated with an effective wavevector. The unification applies for non-magnetic and magnetic materials. Electronic degrees of freedom associated with an ion are encapsulated in multipoles previously used to interpret conventional dichroism and Bragg diffraction enhanced by an atomic resonance. A dichroic signal exploiting the Borrmann effect with a linearly polarized beam presents charge-like multipoles that include a hexadecapole. A difference between dichroic signals obtained with a twisted beam carrying spin polarization (circular polarization) and opposite winding numbers presents charge-like atomic multipoles, whereas a twisted beam carrying linear polarization alone presents magnetic (time-odd) multipoles. Charge-like multipoles include a quadrupole, and magnetic multipoles include a dipole and an octupole. We discuss the practicalities and relative merits of spectroscopy exploiting the two remarkably closely-related processes. Signals using beams with topological charges l ≥ 2 present additional atomic multipoles.

  2. Twisting Plasma Interactions

    NASA Image and Video Library

    2017-06-19

    Several short stalks of cooler, darker plasma spun and twisted as they interacted with each other at the sun's edge (June 14-15, 2017). The row of strands, which together form a prominence, were being pulled back and forth by magnetic forces. The dynamic action was observed for just over one day. Also noteworthy is the rapid development of a bright active region in the upper right about halfway through the clip. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA21761

  3. Interactions of Twisted Ω-loops in a Model Solar Convection Zone

    NASA Astrophysics Data System (ADS)

    Jouve, L.; Brun, A. S.; Aulanier, G.

    2018-04-01

    This study aims at investigating the ability of strong interactions between magnetic field concentrations during their rise through the convection zone to produce complex active regions at the solar surface. To do so, we perform numerical simulations of buoyant magnetic structures evolving and interacting in a model solar convection zone. We first produce a 3D model of rotating convection and then introduce idealized magnetic structures close to the bottom of the computational domain. These structures possess a certain degree of field line twist and they are made buoyant on a particular extension in longitude. The resulting twisted Ω-loops will thus evolve inside a spherical convective shell possessing large-scale mean flows. We present results on the interaction between two such loops with various initial parameters (mainly buoyancy and twist) and on the complexity of the emerging magnetic field. In agreement with analytical predictions, we find that if the loops are introduced with opposite handedness and same axial field direction or the same handedness but opposite axial field, they bounce against each other. The emerging region is then constituted of two separated bipolar structures. On the contrary, if the loops are introduced with the same direction of axial and peripheral magnetic fields and are sufficiently close, they merge while rising. This more interesting case produces complex magnetic structures with a high degree of non-neutralized currents, especially when the convective motions act significantly on the magnetic field. This indicates that those interactions could be good candidates to produce eruptive events like flares or CMEs.

  4. Twisted Hubbard model for Sr2IrO4: magnetism and possible high temperature superconductivity.

    PubMed

    Wang, Fa; Senthil, T

    2011-04-01

    Sr(2)IrO(4) has been suggested as a Mott insulator from a single J(eff)=1/2 band, similar to the cuprates. However, this picture is complicated by the measured large magnetic anisotropy and ferromagnetism. Based on a careful mapping to the J(eff)=1/2 (pseudospin-1/2) space, we propose that the low energy electronic structure of Sr(2)IrO(4) can indeed be described by a SU(2) invariant pseudospin-1/2 Hubbard model very similar to that of the cuprates, but with a twisted coupling to an external magnetic field (a g tensor with a staggered antisymmetric component). This perspective naturally explains the magnetic properties of Sr(2)IrO(4). We also derive several simple facts based on this mapping and the known results about the Hubbard model and the cuprates, which may be tested in future experiments on Sr(2)IrO(4). In particular, we propose that (electron-)doping Sr(2)IrO(4) can potentially realize high-temperature superconductivity. © 2011 American Physical Society

  5. Twist limits for late twisting double somersaults on trampoline.

    PubMed

    Yeadon, M R; Hiley, M J

    2017-06-14

    An angle-driven computer simulation model of aerial movement was used to determine the maximum amount of twist that could be produced in the second somersault of a double somersault on trampoline using asymmetrical movements of the arms and hips. Lower bounds were placed on the durations of arm and hip angle changes based on performances of a world trampoline champion whose inertia parameters were used in the simulations. The limiting movements were identified as the largest possible odd number of half twists for forward somersaulting takeoffs and even number of half twists for backward takeoffs. Simulations of these two limiting movements were found using simulated annealing optimisation to produce the required amounts of somersault, tilt and twist at landing after a flight time of 2.0s. Additional optimisations were then run to seek solutions with the arms less adducted during the twisting phase. It was found that 3½ twists could be produced in the second somersault of a forward piked double somersault with arms abducted 8° from full adduction during the twisting phase and that three twists could be produced in the second somersault of a backward straight double somersault with arms fully adducted to the body. These two movements are at the limits of performance for elite trampolinists. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. A Three-dimensional Magnetohydrodynamic Simulation of the Formation of Solar Chromospheric Jets with Twisted Magnetic Field Lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iijima, H.; Yokoyama, T., E-mail: h.iijima@isee.nagoya-u.ac.jp

    This paper presents a three-dimensional simulation of chromospheric jets with twisted magnetic field lines. Detailed treatments of the photospheric radiative transfer and the equations of state allow us to model realistic thermal convection near the solar surface, which excites various MHD waves and produces chromospheric jets in the simulation. A tall chromospheric jet with a maximum height of 10–11 Mm and lifetime of 8–10 minutes is formed above a strong magnetic field concentration. The magnetic field lines are strongly entangled in the chromosphere, which helps the chromospheric jet to be driven by the Lorentz force. The jet exhibits oscillatory motionmore » as a natural consequence of its generation mechanism. We also find that the produced chromospheric jet forms a cluster with a diameter of several Mm with finer strands. These results imply a close relationship between the simulated jet and solar spicules.« less

  7. How Well Can the Observed Flux Ropes in the Solar Wind be Fitted by a Uniform-twist Flux Rope Model?

    NASA Astrophysics Data System (ADS)

    Wang, Y.

    2015-12-01

    In the solar wind, flux ropes, e.g., magnetic clouds (MCs), are a frequently observational phenomenon. Their magnetic field configuration or the way that the field lines wind around the flux rope axis is one of the most important information to understand the formation and evolution of the observed flux ropes. Most MCs are believed to be in the force-free state, and widely modeled by the Lundquist force-free solution, in which the twist of the field line increases from zero at the axis to infinity at the boundary. However, Lundquist solution is not the only form of a force-free magnetic field. Some studies based on suprathermal electron observations and models have shown that MCs may carry magnetic field lines more likely to be uniformly twisted. The nonlinear force-free field extrapolation of solar magnetic field also suggests that the field lines of a flux rope twist limitedly. In this study, we have developed a velocity-modified uniform-twist force-free flux rope model, and fit observed MCs with this model. By using this approach, we test how well the observed MCs can be fitted into a uniform-twist flux rope. Some interesting results will be given in this presentation.

  8. The Twist Box Domain is Required for Twist1-induced Prostate Cancer Metastasis

    PubMed Central

    Gajula, Rajendra P.; Chettiar, Sivarajan T.; Williams, Russell D.; Thiyagarajan, Saravanan; Kato, Yoshinori; Aziz, Khaled; Wang, Ruoqi; Gandhi, Nishant; Wild, Aaron T.; Vesuna, Farhad; Ma, Jinfang; Salih, Tarek; Cades, Jessica; Fertig, Elana; Biswal, Shyam; Burns, Timothy F.; Chung, Christine H.; Rudin, Charles M.; Herman, Joseph M.; Hales, Russell K.; Raman, Venu; An, Steven S.; Tran, Phuoc T.

    2013-01-01

    Twist1, a basic helix-loop-helix transcription factor, plays a key role during development and is a master regulator of the epithelial-mesenchymal transition (EMT) that promotes cancer metastasis. Structure-function relationships of Twist1 to cancer-related phenotypes are underappreciated, so we studied the requirement of the conserved Twist box domain for metastatic phenotypes in prostate cancer (PCa). Evidence suggests that Twist1 is overexpressed in clinical specimens and correlated with aggressive/metastatic disease. Therefore, we examined a transactivation mutant, Twist1-F191G, in PCa cells using in vitro assays which mimic various stages of metastasis. Twist1 overexpression led to elevated cytoskeletal stiffness and cell traction forces at the migratory edge of cells based on biophysical single-cell measurements. Twist1 conferred additional cellular properties associated with cancer cell metastasis including increased migration, invasion, anoikis resistance, and anchorage-independent growth. The Twist box mutant was defective for these Twist1 phenotypes in vitro. Importantly, we observed a high frequency of Twist1-induced metastatic lung tumors and extra-thoracic metastases in vivo using the experimental lung metastasis assay. The Twist box was required for PCa cells to colonize metastatic lung lesions and extra-thoracic metastases. Comparative genomic profiling revealed transcriptional programs directed by the Twist box that were associated with cancer progression, such as Hoxa9. Mechanistically, Twist1 bound to the Hoxa9 promoter and positively regulated Hoxa9 expression in PCa cells. Finally, Hoxa9 was important for Twist1-induced cellular phenotypes associated with metastasis. These data suggest that the Twist box domain is required for Twist1 transcriptional programs and PCa metastasis. PMID:23982216

  9. Kelvin-Helmholtz instability in a twisting solar polar coronal hole jet observed by SDO/AIA

    NASA Astrophysics Data System (ADS)

    Zhelyazkov, I.; Zaqarashvili, T. V.; Ofman, L.; Chandra, R.

    2018-01-01

    We investigate the conditions under which the fluting (m = 2), m = 3 , and m = 12 magnetohydrodynamic (MHD) modes in a uniformly twisted flux tube moving along its axis become unstable in order to model the Kelvin-Helmholtz (KH) instability in a twisting solar coronal hole jet near the northern pole of the Sun. We employed the dispersion relations of MHD modes derived from the linearized MHD equations. We assumed real wavenumbers and complex angular wave frequencies, namely complex wave phse velocities. The dispersion relations were solved numerically at fixed input parameters (taken from observational data) and varying degrees of torsion of the internal magnetic field. It is shown that the stability of the modes depends upon five parameters: the density contrast between the flux tube and its environment, the ratio of the external and internal axial magnetic fields, the twist of the magnetic field lines inside the tube, the ratio of transverse and axial jet's velocities, and the value of the Alfvén Mach number (the ratio of the tube axial velocity to Alfvén speed inside the flux tube). Using a twisting jet of 2010 August 21 by SDO/AIA and other observations of coronal jets we set the parameters of our theoretical model and have obtained that in a twisted magnetic flux tube of radius of 9.8 Mm, at a density contrast of 0.474 and fixed Alfvén Mach number of ≅ 0.76 , for the three MHD modes there exist instability windows whose width crucially depends upon the internal magnetic field twist. It is found that for the considered modes an azimuthal magnetic field of 1.3 - 1.4 G (computed at the tube boundary) makes the width of the instability windows equal to zero, that is, it suppress the KH instability onset. On the other hand, the times for developing KH instability of the m = 12 MHD mode at instability wavelengths between 15 and 12 Mm turn out to be in the range of 1.9 - 4.7 min that is in agreement with the growth rates estimated from the temporal evolution of

  10. High mode magnetohydrodynamic waves propagation in a twisted rotating jet emerging from a filament eruption

    NASA Astrophysics Data System (ADS)

    Zhelyazkov, Ivan; Chandra, Ramesh

    2018-05-01

    We study the conditions under which high mode magnetohydrodynamic (MHD) waves propagating on a rotating jet emerging from the filament eruption on 2013 April 10-11 can became unstable against the Kelvin-Helmholtz instability (KHI). The evolution of jet indicates the blob like structure at its boundary which could be one of the observable features of the KHI development. We model the jet as a twisted rotating axially moving magnetic flux tube and explore the propagation characteristics of the running MHD modes on the basis of dispersion relations derived in the framework of the ideal magnetohydrodynamics. It is established that unstable MHD waves with wavelengths in the range of 12-15 Mm and instability developing times from 1.5 to 2.6 min can be detected at the excitation of high mode MHD waves. The magnitude of the azimuthal mode number m crucially depends upon the twist of the internal magnetic field. It is found that at slightly twisted magnetic flux tube the appropriate azimuthal mode number is m = 16 while in the case of a moderately twisted flux tube it is equal to 18.

  11. Twisted magnetosphere with quadrupolar fields in the exterior of a neutron star

    NASA Astrophysics Data System (ADS)

    Kojima, Yasufumi

    2018-04-01

    The magnetar magnetosphere is gradually twisted by shearing from footpoint motion, and stored magnetic energy also increases at the same time. When a state exceeds a threshold, flares/outbursts manifest themselves as a result of a catastrophic transition. Axisymmetric static solutions for a relativistic force-free magnetosphere with dipole-quadrupole mixed fields at the surface have been calculated. The quadrupole component represents a kind of magnetic-field irregularity at a small scale. Locally twisted models are constructed by limiting current flow regions, where the small part originates from a dipole-quadrupole mixture. The energy along a sequence of equilibria increases and becomes sufficient to open the magnetic field in some models. In energetically metastable states, a magnetic flux rope is formed in the vicinity of the star. The excess energy may be ejected as a magnetar flare/outburst. The general relativistic gravity is sufficient to confine the flux rope and to store huge magnetic energy, and the mechanism is also discussed.

  12. Twisted magnetosphere with quadrupolar fields in the exterior of a neutron star

    NASA Astrophysics Data System (ADS)

    Kojima, Yasufumi

    2018-07-01

    The magnetar magnetosphere is gradually twisted by shearing from footpoint motion, and stored magnetic energy also increases at the same time. When a state exceeds a threshold, flares/outbursts manifest themselves as a result of a catastrophic transition. Axisymmetric static solutions for a relativistic force-free magnetosphere with dipole-quadrupole mixed fields at the surface have been calculated. The quadrupole component represents a kind of magnetic-field irregularity at a small scale. Locally twisted models are constructed by limiting current flow regions, where the small part originates from a dipole-quadrupole mixture. The energy along a sequence of equilibria increases and becomes sufficient to open the magnetic field in some models. In energetically metastable states, a magnetic flux rope is formed in the vicinity of the star. The excess energy may be ejected as a magnetar flare/outburst. The general relativistic gravity is sufficient to confine the flux rope and to store huge magnetic energy, and the mechanism is also discussed.

  13. Hyperspectral cytometry.

    PubMed

    Grégori, Gérald; Rajwa, Bartek; Patsekin, Valery; Jones, James; Furuki, Motohiro; Yamamoto, Masanobu; Paul Robinson, J

    2014-01-01

    Hyperspectral cytometry is an emerging technology for single-cell analysis that combines ultrafast optical spectroscopy and flow cytometry. Spectral cytometry systems utilize diffraction gratings or prism-based monochromators to disperse fluorescence signals from multiple labels (organic dyes, nanoparticles, or fluorescent proteins) present in each analyzed bioparticle onto linear detector arrays such as multianode photomultipliers or charge-coupled device sensors. The resultant data, consisting of a series of characterizing every analyzed cell, are not compensated by employing the traditional cytometry approach, but rather are spectrally unmixed utilizing algorithms such as constrained Poisson regression or non-negative matrix factorization. Although implementations of spectral cytometry were envisioned as early as the 1980s, only recently has the development of highly sensitive photomultiplier tube arrays led to design and construction of functional prototypes and subsequently to introduction of commercially available systems. This chapter summarizes the historical efforts and work in the field of spectral cytometry performed at Purdue University Cytometry Laboratories and describes the technology developed by Sony Corporation that resulted in release of the first commercial spectral cytometry system-the Sony SP6800. A brief introduction to spectral data analysis is also provided, with emphasis on the differences between traditional polychromatic and spectral cytometry approaches.

  14. Twisted Fermi surface of a thin-film Weyl semimetal

    NASA Astrophysics Data System (ADS)

    Bovenzi, N.; Breitkreiz, M.; O'Brien, T. E.; Tworzydło, J.; Beenakker, C. W. J.

    2018-02-01

    The Fermi surface of a conventional two-dimensional electron gas is equivalent to a circle, up to smooth deformations that preserve the orientation of the equi-energy contour. Here we show that a Weyl semimetal confined to a thin film with an in-plane magnetization and broken spatial inversion symmetry can have a topologically distinct Fermi surface that is twisted into a figure-8—opposite orientations are coupled at a crossing which is protected up to an exponentially small gap. The twisted spectral response to a perpendicular magnetic field B is distinct from that of a deformed Fermi circle, because the two lobes of a figure-8 cyclotron orbit give opposite contributions to the Aharonov-Bohm phase. The magnetic edge channels come in two counterpropagating types, a wide channel of width β {l}m2\\propto 1/B and a narrow channel of width {l}m\\propto 1/\\sqrt{B} (with {l}m=\\sqrt{{\\hslash }/{eB}} the magnetic length and β the momentum separation of the Weyl points). Only one of the two is transmitted into a metallic contact, providing unique magnetotransport signatures.

  15. Twist for Snyder space

    NASA Astrophysics Data System (ADS)

    Meljanac, Daniel; Meljanac, Stjepan; Mignemi, Salvatore; Pikutić, Danijel; Štrajn, Rina

    2018-03-01

    We construct the twist operator for the Snyder space. Our starting point is a non-associative star product related to a Hermitian realisation of the noncommutative coordinates originally introduced by Snyder. The corresponding coproduct of momenta is non-coassociative. The twist is constructed using a general definition of the star product in terms of a bi-differential operator in the Hopf algebroid approach. The result is given by a closed analytical expression. We prove that this twist reproduces the correct coproducts of the momenta and the Lorentz generators. The twisted Poincaré symmetry is described by a non-associative Hopf algebra, while the twisted Lorentz symmetry is described by the undeformed Hopf algebra. This new twist might be important in the construction of different types of field theories on Snyder space.

  16. Validation of Flow Cytometry and Magnetic Bead-Based Methods to Enrich CNS Single Cell Suspensions for Quiescent Microglia.

    PubMed

    Volden, T A; Reyelts, C D; Hoke, T A; Arikkath, J; Bonasera, S J

    2015-12-01

    Microglia are resident mononuclear phagocytes within the CNS parenchyma that intimately interact with neurons and astrocytes to remodel synapses and extracellular matrix. We briefly review studies elucidating the molecular pathways that underlie microglial surveillance, activation, chemotaxis, and phagocytosis; we additionally place these studies in a clinical context. We describe and validate an inexpensive and simple approach to obtain enriched single cell suspensions of quiescent parenchymal and perivascular microglia from the mouse cerebellum and hypothalamus. Following preparation of regional CNS single cell suspensions, we remove myelin debris, and then perform two serial enrichment steps for cells expressing surface CD11b. Myelin depletion and CD11b enrichment are both accomplished using antigen-specific magnetic beads in an automated cell separation system. Flow cytometry of the resultant suspensions shows a significant enrichment for CD11b(+)/CD45(+) cells (perivascular microglia) and CD11b(+)/CD45(-) cells (parenchymal microglia) compared to starting suspensions. Of note, cells from these enriched suspensions minimally express Aif1 (aka Iba1), suggesting that the enrichment process does not evoke significant microglial activation. However, these cells readily respond to a functional challenge (LPS) with significant changes in the expression of molecules specifically associated with microglia. We conclude that methods employing a combination of magnetic-bead based sorting and flow cytometry produce suspensions highly enriched for microglia that are appropriate for a variety of molecular and cellular assays.

  17. On the peculiarities of galvanomagnetic effects in high magnetic fields in twisting bicrystals of the 3D topological insulator Bi{sub 1–x}Sb{sub x} (0.07 ≤ x ≤ 0.2)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muntyanu, F. M., E-mail: muntean-teodor@yahoo.com; Gheorghitsa, E. I.; Gilewski, A.

    2017-04-15

    Galvanomagnetic effects in twisting bicrystals of Bi{sub 1–x}Sb{sub x} alloys (0.07 ≤ x ≤ 0.2) at low temperatures and in magnetic fields up to 40 T are studied. It is found that, at small crystallite misorientation angles, the semiconductor–semimetal transition is induced in the central layer (~60-nm-thick) and two adjacent layers (each ~20-nm-thick) of the interface at different values of ultraquantum magnetic field. Bicrystals with large misorientation angles, being located in strong magnetic fields, exhibit quantum oscillations of the magnetoresistance and the Hall effect, thus indicating that the density of states is higher and charge carriers are heavier in themore » adjacent layers of the interfaces than in the crystallites. Our results show also that twisting bicrystals contain regions with different densities of quantum electronic states, which are determined by the crystallite misorientation angle and magnetic-field strength.« less

  18. Cytometry standards continuum

    NASA Astrophysics Data System (ADS)

    Leif, Robert C.; Spidlen, Josef; Brinkman, Ryan R.

    2008-02-01

    Introduction: The International Society for Analytical Cytology, ISAC, is developing a new combined flow and image Analytical Cytometry Standard (ACS). This standard needs to serve both the research and clinical communities. The clinical medicine and clinical research communities have a need to exchange information with hospital and other clinical information systems. Methods: 1) Prototype the standard by creating CytometryML and a RAW format for binary data. 2) Join the ISAC Data Standards Task Force. 3) Create essential project documentation. 4) Cooperate with other groups by assisting in the preparation of the DICOM Supplement 122: Specimen Module and Pathology Service-Object Pair Classes. Results: CytometryML has been created and serves as a prototype and source of experience for the following: the Analytical Cytometry Standard (ACS) 1.0, the ACS container, Minimum Information about a Flow Cytometry Experiment (MIFlowCyt), and Requirements for a Data File Standard Format to Describe Flow Cytometry and Related Analytical Cytology Data. These requirements provide a means to judge the appropriateness of design elements and to develop tests for the final ACS. The requirements include providing the information required for understanding and reproducing a cytometry experiment or clinical measurement, and for a single standard for both flow and digital microscopic cytometry. Schemas proposed by other members of the ISAC Data Standards Task Force (e.g, Gating-ML) have been independently validated and have been integrated with CytometryML. The use of netCDF as an element of the ACS container has been proposed by others and a suggested method of its use is proposed.

  19. Nanorobotic System iTRo for Controllable 1D Micro/nano Material Twisting Test.

    PubMed

    Lu, Haojian; Shang, Wanfeng; Wei, Xueyong; Yang, Zhan; Fukuda, Toshio; Shen, Yajing

    2017-06-08

    In-situ micro/nano characterization is an indispensable methodology for material research. However, the precise in-situ SEM twisting of 1D material with large range is still challenge for current techniques, mainly due to the testing device's large size and the misalignment between specimen and the rotation axis. Herein, we propose an in-situ twist test robot (iTRo) to address the above challenges and realize the precise in-situ SEM twisting test for the first time. Firstly, we developed the iTRo and designed a series of control strategies, including assembly error initialization, triple-image alignment (TIA) method for rotation axis alignment, deformation-based contact detection (DCD) method for sample assembly, and switch control for robots cooperation. After that, we chose three typical 1D material, i.e., magnetic microwire Fe 74 B 13 Si 11 C 2 , glass fiber, and human hair, for twisting test and characterized their properties. The results showed that our approach is able to align the sample to the twisting axis accurately, and it can provide large twisting range, heavy load and high controllability. This work fills the blank of current in-situ mechanical characterization methodologies, which is expected to give significant impact in the fundamental nanomaterial research and practical micro/nano characterization.

  20. Wire harness twisting aid

    NASA Technical Reports Server (NTRS)

    Casey, E. J.; Commadore, C. C.; Ingles, M. E.

    1980-01-01

    Long wire bundles twist into uniform spiral harnesses with help of simple apparatus. Wires pass through spacers and through hand-held tool with hole for each wire. Ends are attached to low speed bench motor. As motor turns, operator moves hand tool away forming smooth twists in wires between motor and tool. Technique produces harnesses that generate less radio-frequency interference than do irregularly twisted cables.

  1. TEST OF THE HEMISPHERIC RULE OF MAGNETIC HELICITY IN THE SUN USING THE HELIOSEISMIC AND MAGNETIC IMAGER (HMI) DATA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Y.; Hoeksema, J. T.; Sun, X.

    Magnetic twist in solar active regions (ARs) has been found to have a hemispheric preference in sign (hemisphere rule): negative in the northern hemisphere and positive in the southern. The preference reported in previous studies ranges greatly, from ∼ 58% to 82%. In this study, we examine this hemispheric preference using vector magnetic field data taken by Helioseismic and Magnetic Imager and find that 75% ± 7% of 151 ARs studied obey the hemisphere rule, well within the preference range in previous studies. If the sample is divided into two groups—ARs having magnetic twist and writhe of the same sign andmore » having opposite signs—the strength of the hemispheric preference differs substantially: 64% ± 11% for the former group and 87% ± 8% for the latter. This difference becomes even more significant in a sub-sample of 82 ARs having a simple bipole magnetic configuration: 56% ± 16% for the ARs having the same signs of twist and writhe, and 93% with lower and upper confidence bounds of 80% and 98% for the ARs having the opposite signs. The error reported here is a 95% confidence interval. This may suggest that, prior to emergence of magnetic tubes, either the sign of twist does not have a hemispheric preference or the twist is relatively weak.« less

  2. Experiment attributes to establish tube with twisted tape insert performance cooling plasma facing components

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clark, Emily; Ramirez, Emilio; Ruggles, Art E.

    The modeling capability for tubes with twisted tape inserts is reviewed with reference to the application of cooling plasma facing components in magnetic confinement fusion devices. The history of experiments examining the cooling performance of tubes with twisted tape inserts is reviewed with emphasis on the manner of heating, flow stability limits and the details of the test section and fluid delivery system. Models for heat transfer, burnout, and onset of net vapor generation in straight tube flows and tube with twisted tape are compared. As a result, the gaps in knowledge required to establish performance limits of the plasmamore » facing components are identified and attributes of an experiment to close those gaps are presented.« less

  3. Experiment attributes to establish tube with twisted tape insert performance cooling plasma facing components

    DOE PAGES

    Clark, Emily; Ramirez, Emilio; Ruggles, Art E.; ...

    2015-08-18

    The modeling capability for tubes with twisted tape inserts is reviewed with reference to the application of cooling plasma facing components in magnetic confinement fusion devices. The history of experiments examining the cooling performance of tubes with twisted tape inserts is reviewed with emphasis on the manner of heating, flow stability limits and the details of the test section and fluid delivery system. Models for heat transfer, burnout, and onset of net vapor generation in straight tube flows and tube with twisted tape are compared. As a result, the gaps in knowledge required to establish performance limits of the plasmamore » facing components are identified and attributes of an experiment to close those gaps are presented.« less

  4. Operator constraints for twist-3 functions and Lorentz invariance properties of twist-3 observables

    DOE PAGES

    Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

    2016-03-14

    We investigate the behavior under Lorentz transformations of perturbative coefficient functions in a collinear twist-3 formalism relevant for high-energy observables including transverse polarization of hadrons. We argue that those perturbative coefficient functions can, a priori, acquire quite different yet Lorentz-invariant forms in various frames. This somewhat surprising difference can be traced back to a general dependence of the perturbative coefficient functions on light cone vectors which are introduced by the twist-3 factorization formulas and which are frame-dependent. One can remove this spurious frame dependence by invoking so-called Lorentz invariance relations (LIRs) between twist-3 parton correlation functions. Some of those relationsmore » for twist-3 distribution functions were discussed in the literature before. In this paper we derive the corresponding LIRs for twist-3 fragmentation functions. We explicitly demonstrate that these LIRs remove the light cone vector dependence by considering transverse spin observables in the single-inclusive production of hadrons in lepton-nucleon collisions, ℓN→hX. Furthermore, with the LIRs in hand, we also show that twist-3 observables in general can be written solely in terms of three-parton correlation functions.« less

  5. Endothelial TWIST1 Promotes Pathological Ocular Angiogenesis

    PubMed Central

    Li, Jie; Liu, Chi-Hsiu; Sun, Ye; Gong, Yan; Fu, Zhongjie; Evans, Lucy P.; Tian, Katherine T.; Juan, Aimee M.; Hurst, Christian G.; Mammoto, Akiko; Chen, Jing

    2014-01-01

    Purpose. Pathological neovessel formation impacts many blinding vascular eye diseases. Identification of molecular signatures distinguishing pathological neovascularization from normal quiescent vessels is critical for developing new interventions. Twist-related protein 1 (TWIST1) is a transcription factor important in tumor and pulmonary angiogenesis. This study investigated the potential role of TWIST1 in modulating pathological ocular angiogenesis in mice. Methods. Twist1 expression and localization were analyzed in a mouse model of oxygen-induced retinopathy (OIR). Pathological ocular angiogenesis in Tie2-driven conditional Twist1 knockout mice were evaluated in both OIR and laser-induced choroidal neovascularization models. In addition, the effects of TWIST1 on angiogenesis and endothelial cell function were analyzed in sprouting assays of aortic rings and choroidal explants isolated from Twist1 knockout mice, and in human retinal microvascular endothelial cells treated with TWIST1 small interfering RNA (siRNA). Results. TWIST1 is highly enriched in pathological neovessels in OIR retinas. Conditional Tie2-driven depletion of Twist1 significantly suppressed pathological neovessels in OIR without impacting developmental retinal angiogenesis. In a laser-induced choroidal neovascularization model, Twist1 deficiency also resulted in significantly smaller lesions with decreased vascular leakage. In addition, loss of Twist1 significantly decreased vascular sprouting in both aortic ring and choroid explants. Knockdown of TWIST1 in endothelial cells led to dampened expression of vascular endothelial growth factor receptor 2 (VEGFR2) and decreased endothelial cell proliferation. Conclusions. Our study suggests that TWIST1 is a novel regulator of pathologic ocular angiogenesis and may represent a new molecular target for developing potential therapeutic treatments to suppress pathological neovascularization in vascular eye diseases. PMID:25414194

  6. Superconducting flat tape cable magnet

    DOEpatents

    Takayasu, Makoto

    2015-08-11

    A method for winding a coil magnet with the stacked tape cables, and a coil so wound. The winding process is controlled and various shape coils can be wound by twisting about the longitudinal axis of the cable and bending following the easy bend direction during winding, so that sharp local bending can be obtained by adjusting the twist pitch. Stack-tape cable is twisted while being wound, instead of being twisted in a straight configuration and then wound. In certain embodiments, the straight length should be half of the cable twist-pitch or a multiple of it.

  7. Gauge transformations for twisted spectral triples

    NASA Astrophysics Data System (ADS)

    Landi, Giovanni; Martinetti, Pierre

    2018-05-01

    It is extended to twisted spectral triples the fluctuations of the metric as bounded perturbations of the Dirac operator that arises when a spectral triple is exported between Morita equivalent algebras, as well as gauge transformations which are obtained by the action of the unitary endomorphisms of the module implementing the Morita equivalence. It is firstly shown that the twisted-gauged Dirac operators, previously introduced to generate an extra scalar field in the spectral description of the standard model of elementary particles, in fact follow from Morita equivalence between twisted spectral triples. The law of transformation of the gauge potentials turns out to be twisted in a natural way. In contrast with the non-twisted case, twisted fluctuations do not necessarily preserve the self-adjointness of the Dirac operator. For a self-Morita equivalence, conditions are obtained in order to maintain self-adjointness that are solved explicitly for the minimal twist of a Riemannian manifold.

  8. Comparison of Magnetic Properties in a Magnetic Cloud and Its Solar Source on 2013 April 11-14

    NASA Astrophysics Data System (ADS)

    Vemareddy, P.; Möstl, C.; Amerstorfer, T.; Mishra, W.; Farrugia, C.; Leitner, M.

    2016-09-01

    In the context of the Sun-Earth connection of coronal mass ejections and magnetic flux ropes (MFRs), we studied the solar active region (AR) and the magnetic properties of magnetic cloud (MC) event during 2013 April 14-15. We use in situ observations from the Advanced Composition Explorer and source AR measurements from the Solar Dynamics Observatory. The MCs magnetic structure is reconstructed from the Grad-Shafranov method, which reveals a northern component of the axial field with left handed helicity. The MC invariant axis is highly inclined to the ecliptic plane pointing northward and is rotated by 117° with respect to the source region PIL. The net axial flux and current in the MC are comparatively higher than from the source region. Linear force-free alpha distribution (10-7-10-6 m-1) at the sigmoid leg matches the range of twist number in the MC of 1-2 au MFR. The MFR is nonlinear force-free with decreasing twist from the axis (9 turns/au) toward the edge. Therefore, a Gold-Hoyle (GH) configuration, assuming a constant twist, is more consistent with the MC structure than the Lundquist configuration of increasing twist from the axis to boundary. As an indication of that, the GH configuration yields a better fitting to the global trend of in situ magnetic field components, in terms of rms, than the Lundquist model. These cylindrical configurations improved the MC fitting results when the effect of self-similar expansion of MFR was considered. For such twisting behavior, this study suggests an alternative fitting procedure to better characterize the MC magnetic structure and its source region links.

  9. Invariant structures of magnetic flux tubes

    NASA Astrophysics Data System (ADS)

    Solovev, A. A.

    1982-04-01

    The basic properties of a screened magnetic flux tube possessing a finite radius of curvature are discussed in order to complement the findings of Parker (1974, 1976) and improve their accuracy. Conditions of equilibrium, twisting equilibrium, and twisting oscillations are discussed, showing that a twisted magnetic loop or arch is capable of executing elastic oscillations about an equilibrium state. This property can in particular be used in the theory of solar flares. Invariant structures of a force-free magnetic tube are analyzed, showing that invariant structures of the field preserve their form when the geometrical parameters of the flux tube are changed. In a quasi-equilibrium transition of the tube from one state to another the length and pitch of the tube spiral change in proportion to the radius of its cross section.

  10. Twisted complex superfluids in optical lattices

    PubMed Central

    Jürgensen, Ole; Sengstock, Klaus; Lühmann, Dirk-Sören

    2015-01-01

    We show that correlated pair tunneling drives a phase transition to a twisted superfluid with a complex order parameter. This unconventional superfluid phase spontaneously breaks the time-reversal symmetry and is characterized by a twisting of the complex phase angle between adjacent lattice sites. We discuss the entire phase diagram of the extended Bose—Hubbard model for a honeycomb optical lattice showing a multitude of quantum phases including twisted superfluids, pair superfluids, supersolids and twisted supersolids. Furthermore, we show that the nearest-neighbor interactions lead to a spontaneous breaking of the inversion symmetry of the lattice and give rise to dimerized density-wave insulators, where particles are delocalized on dimers. For two components, we find twisted superfluid phases with strong correlations between the species already for surprisingly small pair-tunneling amplitudes. Interestingly, this ground state shows an infinite degeneracy ranging continuously from a supersolid to a twisted superfluid. PMID:26345721

  11. Hydrogen bonds and twist in cellulose microfibrils.

    PubMed

    Kannam, Sridhar Kumar; Oehme, Daniel P; Doblin, Monika S; Gidley, Michael J; Bacic, Antony; Downton, Matthew T

    2017-11-01

    There is increasing experimental and computational evidence that cellulose microfibrils can exist in a stable twisted form. In this study, atomistic molecular dynamics (MD) simulations are performed to investigate the importance of intrachain hydrogen bonds on the twist in cellulose microfibrils. We systematically enforce or block the formation of these intrachain hydrogen bonds by either constraining dihedral angles or manipulating charges. For the majority of simulations a consistent right handed twist is observed. The exceptions are two sets of simulations that block the O2-O6' intrachain hydrogen bond, where no consistent twist is observed in multiple independent simulations suggesting that the O2-O6' hydrogen bond can drive twist. However, in a further simulation where exocyclic group rotation is also blocked, right-handed twist still develops suggesting that intrachain hydrogen bonds are not necessary to drive twist in cellulose microfibrils. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Cytometry metadata in XML

    NASA Astrophysics Data System (ADS)

    Leif, Robert C.; Leif, Stephanie H.

    2016-04-01

    Introduction: The International Society for Advancement of Cytometry (ISAC) has created a standard for the Minimum Information about a Flow Cytometry Experiment (MIFlowCyt 1.0). CytometryML will serve as a common metadata standard for flow and image cytometry (digital microscopy). Methods: The MIFlowCyt data-types were created, as is the rest of CytometryML, in the XML Schema Definition Language (XSD1.1). The datatypes are primarily based on the Flow Cytometry and the Digital Imaging and Communication (DICOM) standards. A small section of the code was formatted with standard HTML formatting elements (p, h1, h2, etc.). Results:1) The part of MIFlowCyt that describes the Experimental Overview including the specimen and substantial parts of several other major elements has been implemented as CytometryML XML schemas (www.cytometryml.org). 2) The feasibility of using MIFlowCyt to provide the combination of an overview, table of contents, and/or an index of a scientific paper or a report has been demonstrated. Previously, a sample electronic publication, EPUB, was created that could contain both MIFlowCyt metadata as well as the binary data. Conclusions: The use of CytometryML technology together with XHTML5 and CSS permits the metadata to be directly formatted and together with the binary data to be stored in an EPUB container. This will facilitate: formatting, data- mining, presentation, data verification, and inclusion in structured research, clinical, and regulatory documents, as well as demonstrate a publication's adherence to the MIFlowCyt standard, promote interoperability and should also result in the textual and numeric data being published using web technology without any change in composition.

  13. COMPARISON OF MAGNETIC PROPERTIES IN A MAGNETIC CLOUD AND ITS SOLAR SOURCE ON 2013 APRIL 11–14

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vemareddy, P.; Möstl, C.; Amerstorfer, T.

    2016-09-01

    In the context of the Sun–Earth connection of coronal mass ejections and magnetic flux ropes (MFRs), we studied the solar active region (AR) and the magnetic properties of magnetic cloud (MC) event during 2013 April 14–15. We use in situ observations from the Advanced Composition Explorer and source AR measurements from the Solar Dynamics Observatory . The MCs magnetic structure is reconstructed from the Grad–Shafranov method, which reveals a northern component of the axial field with left handed helicity. The MC invariant axis is highly inclined to the ecliptic plane pointing northward and is rotated by 117° with respect tomore » the source region PIL. The net axial flux and current in the MC are comparatively higher than from the source region. Linear force-free alpha distribution (10{sup −7}–10{sup −6} m{sup −1}) at the sigmoid leg matches the range of twist number in the MC of 1–2 au MFR. The MFR is nonlinear force-free with decreasing twist from the axis (9 turns/au) toward the edge. Therefore, a Gold–Hoyle (GH) configuration, assuming a constant twist, is more consistent with the MC structure than the Lundquist configuration of increasing twist from the axis to boundary. As an indication of that, the GH configuration yields a better fitting to the global trend of in situ magnetic field components, in terms of rms, than the Lundquist model. These cylindrical configurations improved the MC fitting results when the effect of self-similar expansion of MFR was considered. For such twisting behavior, this study suggests an alternative fitting procedure to better characterize the MC magnetic structure and its source region links.« less

  14. Magnetic helicity in emerging solar active regions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Y.; Hoeksema, J. T.; Bobra, M.

    Using vector magnetic field data from the Helioseismic and Magnetic Imager instrument aboard the Solar Dynamics Observatory, we study magnetic helicity injection into the corona in emerging active regions (ARs) and examine the hemispheric helicity rule. In every region studied, photospheric shearing motion contributes most of the helicity accumulated in the corona. In a sample of 28 emerging ARs, 17 follow the hemisphere rule (61% ± 18% at a 95% confidence interval). Magnetic helicity and twist in 25 ARs (89% ± 11%) have the same sign. The maximum magnetic twist, which depends on the size of an AR, is inferredmore » in a sample of 23 emerging ARs with a bipolar magnetic field configuration.« less

  15. Modeling and control of active twist aircraft

    NASA Astrophysics Data System (ADS)

    Cramer, Nicholas Bryan

    The Wright Brothers marked the beginning of powered flight in 1903 using an active twist mechanism as their means of controlling roll. As time passed due to advances in other technologies that transformed aviation the active twist mechanism was no longer used. With the recent advances in material science and manufacturability, the possibility of the practical use of active twist technologies has emerged. In this dissertation, the advantages and disadvantages of active twist techniques are investigated through the development of an aeroelastic modeling method intended for informing the designs of such technologies and wind tunnel testing to confirm the capabilities of the active twist technologies and validate the model. Control principles for the enabling structural technologies are also proposed while the potential gains of dynamic, active twist are analyzed.

  16. Teaching Spatial Awareness for Better Twisting Somersaults.

    ERIC Educational Resources Information Center

    Hennessy, Jeff T.

    1985-01-01

    The barani (front somersault with one-half twist) and the back somersault with one twist are basic foundation skills necessary for more advanced twisting maneuvers. Descriptions of these movements on a trampoline surface are offered. (DF)

  17. Magnetic Fluxtube Tunneling

    NASA Technical Reports Server (NTRS)

    Dahlburg, Russell B.; Antiochos,, Spiro K.; Norton, D.

    1996-01-01

    We present numerical simulations of the collision and subsequent interaction of two initially orthogonal, twisted, force free field magnetic fluxtubes. The simulations were carried out using a new three dimensional explicit parallelized Fourier collocation algorithm for solving the viscoresistive equations of compressible magnetohydrodynamics. It is found that, under a wide range of conditions, the fluxtubes can 'tunnel' through each other. Two key conditions must be satisfied for tunneling to occur: the magnetic field must be highly twisted with a field line pitch much greater than 1, and the magnetic Lundquist number must be somewhat large, greater than or equal to 2880. This tunneling behavior has not been seen previously in studies of either vortex tube or magnetic fluxtube interactions. An examination of magnetic field lines shows that tunneling is due to a double reconnection mechanism. Initially orthogonal field lines reconnect at two specific locations, exchange interacting sections and 'pass' through each other. The implications of these results for solar and space plasmas are discussed.

  18. Magnetic Causes of Solar Coronal Mass Ejections: Dominance of the Free Magnetic Energy over Either the Magnetic Twist or Size Alone

    NASA Technical Reports Server (NTRS)

    Falconer, D. A.; Moore, R. L.; Gary, G. A.

    2006-01-01

    We report further results from our ongoing assessment of magnetogram-based measures of active-region nonpotentiality and size as predictors of coronal mass ejections (CMEs). We have devised improved generalized measures of active-region nonpotentiality that apply to active regions of any degree of magnetic complexity, rather than being limited to bipolar active regions as our initial measures were. From a set of approx.50 active-regions, we have found that measures of total nonpotentiality have a 75-80% success rate n predicting whether an active region will produce a CME in 2 days after the magnetogram. This makes measures of total nonpotentiality a better predictor than either active-region size, or active region twist (size-normalized nonpotentiality), which have a approx.65% success rates. We have also found that we can measure from the line-of-sight magnetograms an active region's total nonpotentiality and the size, which allows use to use MDI to evaluate these quantities for 4-5 consecutive days for each active region, and to investigate if there is some combination of size and total nonpotentiality that have a stronger predictive power than does total nonpotentiality. This work was funded by NASA through its LWS TR&T Program and its Solar and Heliospheric Physics SR&T Program, and by NSF through its Solar Terrestrial Research and SHINE programs.

  19. Spectral determinants for twist field correlators

    NASA Astrophysics Data System (ADS)

    Belitsky, A. V.

    2018-04-01

    Twist fields were introduced a few decades ago as a quantum counterpart to classical kink configurations and disorder variables in low dimensional field theories. In recent years they received a new incarnation within the framework of geometric entropy and strong coupling limit of four-dimensional scattering amplitudes. In this paper, we study their two-point correlation functions in a free massless scalar theory, namely, twist-twist and twist-antitwist correlators. In spite of the simplicity of the model in question, the properties of the latter are far from being trivial. The problem is reduced, within the formalism of the path integral, to the study of spectral determinants on surfaces with conical points, which are then computed exactly making use of the zeta function regularization. We also provide an insight into twist correlators for a massive complex scalar by means of the Lifshitz-Krein trace formula.

  20. Genomic pathways modulated by Twist in breast cancer.

    PubMed

    Vesuna, Farhad; Bergman, Yehudit; Raman, Venu

    2017-01-13

    The basic helix-loop-helix transcription factor TWIST1 (Twist) is involved in embryonic cell lineage determination and mesodermal differentiation. There is evidence to indicate that Twist expression plays a role in breast tumor formation and metastasis, but the role of Twist in dysregulating pathways that drive the metastatic cascade is unclear. Moreover, many of the genes and pathways dysregulated by Twist in cell lines and mouse models have not been validated against data obtained from larger, independant datasets of breast cancer patients. We over-expressed the human Twist gene in non-metastatic MCF-7 breast cancer cells to generate the estrogen-independent metastatic breast cancer cell line MCF-7/Twist. These cells were inoculated in the mammary fat pad of female severe compromised immunodeficient mice, which subsequently formed xenograft tumors that metastasized to the lungs. Microarray data was collected from both in vitro (MCF-7 and MCF-7/Twist cell lines) and in vivo (primary tumors and lung metastases) models of Twist expression. Our data was compared to several gene datasets of various subtypes, classes, and grades of human breast cancers. Our data establishes a Twist over-expressing mouse model of breast cancer, which metastasizes to the lung and replicates some of the ontogeny of human breast cancer progression. Gene profiling data, following Twist expression, exhibited novel metastasis driver genes as well as cellular maintenance genes that were synonymous with the metastatic process. We demonstrated that the genes and pathways altered in the transgenic cell line and metastatic animal models parallel many of the dysregulated gene pathways observed in human breast cancers. Analogous gene expression patterns were observed in both in vitro and in vivo Twist preclinical models of breast cancer metastasis and breast cancer patient datasets supporting the functional role of Twist in promoting breast cancer metastasis. The data suggests that genetic

  1. General planar transverse domain walls realized by optimized transverse magnetic field pulses in magnetic biaxial nanowires

    NASA Astrophysics Data System (ADS)

    Li, Mei; Wang, Jianbo; Lu, Jie

    2017-02-01

    The statics and field-driven dynamics of transverse domain walls (TDWs) in magnetic nanowires (NWs) have attracted continuous interests because of their theoretical significance and application potential in future magnetic logic and memory devices. Recent results demonstrate that uniform transverse magnetic fields (TMFs) can greatly enhance the wall velocity, meantime leave a twisting in the TDW azimuthal distribution. For application in high-density NW devices, it is preferable to erase the twisting so as to minimize magnetization frustrations. Here we report the realization of a completely planar TDW with arbitrary tilting attitude in a magnetic biaxial NW under a TMF pulse with fixed strength and well-designed orientation profile. We smooth any twisting in the TDW azimuthal plane thus completely decouple the polar and azimuthal degrees of freedom. The analytical differential equation describing the polar angle distribution is derived and the resulting solution is not the Walker-ansatz form. With this TMF pulse comoving, the field-driven dynamics of the planar TDW is investigated with the help of the asymptotic expansion method. It turns out the comoving TMF pulse increases the wall velocity under the same axial driving field. These results will help to design a series of modern magnetic devices based on planar TDWs.

  2. Magnetic helicity and flux tube dynamics in the solar convection zone: Comparisons between observation and theory

    NASA Astrophysics Data System (ADS)

    Nandy, Dibyendu

    2006-12-01

    Magnetic helicity, a conserved topological parameter in ideal MHD systems, conditions close to which are realized in the solar plasma, is intimately connected to the creation and subsequent dynamics of magnetic flux tubes in the solar interior. It can therefore be used as a tool to probe such dynamics. In this paper we show how photospheric observations of magnetic helicity of isolated magnetic flux tubes, manifested as the twist and writhe of solar active regions, can constrain the creation and dynamics of flux tubes in the solar convection zone and the nature of convective turbulence itself. We analyze the observed latitudinal distribution of twists in photospheric active regions, derived from solar vector magnetograms, in the largest such sample studied till-date. We confirm and put additional constraints on the hemispheric twist helicity trend and find that the dispersion in the active region twist distribution is latitude-independent, implying that the amplitude of turbulent fluctuations does not vary with latitude in the convection zone. Our data set also shows that the amplitude and dispersion of twist decreases with increasing magnetic size of active regions, supporting the conclusion that larger flux tubes are less affected by turbulence. Among the various theoretical models that have been proposed till-date to explain the origin of twist, our observations best match the Σ effect model, which invokes helical turbulent buffeting of rising flux tubes as the mechanism for twist creation. Finally, we complement our analysis of twists with past observations of tilts in solar active regions and tie them in with theoretical modeling studies, to build up a comprehensive picture of the dynamics of twisted magnetic flux tubes throughout the solar convection zone. This general framework, binding together theory and observations, suggests that flux tubes have a wide range of twists in the solar convection zone, with some as high as to make them susceptible to the

  3. Electronic and Optical Properties of Twisted Bilayer Graphene

    NASA Astrophysics Data System (ADS)

    Huang, Shengqiang

    The ability to isolate single atomic layers of van der Waals materials has led to renewed interest in the electronic and optical properties of these materials as they can be fundamentally different at the monolayer limit. Moreover, these 2D crystals can be assembled together layer by layer, with controllable sequence and orientation, to form artificial materials that exhibit new features that are not found in monolayers nor bulk. Twisted bilayer graphene is one such prototype system formed by two monolayer graphene layers placed on top of each other with a twist angle between their lattices, whose electronic band structure depends on the twist angle. This thesis presents the efforts to explore the electronic and optical properties of twisted bilayer graphene by Raman spectroscopy and scanning tunneling microscopy measurements. We first synthesize twisted bilayer graphene with various twist angles via chemical vapor deposition. Using a combination of scanning tunneling microscopy and Raman spectroscopy, the twist angles are determined. The strength of the Raman G peak is sensitive to the electronic band structure of twisted bilayer graphene and therefore we use this peak to monitor changes upon doping. Our results demonstrate the ability to modify the electronic and optical properties of twisted bilayer graphene with doping. We also fabricate twisted bilayer graphene by controllable stacking of two graphene monolayers with a dry transfer technique. For twist angles smaller than one degree, many body interactions play an important role. It requires eight electrons per moire unit cell to fill up each band instead of four electrons in the case of a larger twist angle. For twist angles smaller than 0.4 degree, a network of domain walls separating AB and BA stacking regions forms, which are predicted to host topologically protected helical states. Using scanning tunneling microscopy and spectroscopy, these states are confirmed to appear on the domain walls when inversion

  4. Physics of magnetic flux ropes

    NASA Astrophysics Data System (ADS)

    Russell, C. T.; Priest, E. R.; Lee, L. C.

    The present work encompasses papers on the structure, waves, and instabilities of magnetic flux ropes (MFRs), photospheric flux tubes (PFTs), the structure and heating of coronal loops, solar prominences, coronal mass ejections and magnetic clouds, flux ropes in planetary ionospheres, the magnetopause, magnetospheric field-aligned currents and flux tubes, and the magnetotail. Attention is given to the equilibrium of MFRs, resistive instability, magnetic reconnection and turbulence in current sheets, dynamical effects and energy transport in intense flux tubes, waves in solar PFTs, twisted flux ropes in the solar corona, an electrodynamical model of solar flares, filament cooling and condensation in a sheared magnetic field, the magnetopause, the generation of twisted MFRs during magnetic reconnection, ionospheric flux ropes above the South Pole, substorms and MFR structures, evidence for flux ropes in the earth magnetotail, and MFRs in 3D MHD simulations.

  5. Morphing wing structure with controllable twist based on adaptive bending-twist coupling

    NASA Astrophysics Data System (ADS)

    Raither, Wolfram; Heymanns, Matthias; Bergamini, Andrea; Ermanni, Paolo

    2013-06-01

    A novel semi-passive morphing airfoil concept based on variable bending-twist coupling induced by adaptive shear center location and torsional stiffness is presented. Numerical parametric studies and upscaling show that the concept relying on smart materials permits effective twist control while offering the potential of being lightweight and energy efficient. By means of an experimental characterization of an adaptive beam and a scaled adaptive wing structure, effectiveness and producibility of the structural concept are demonstrated.

  6. Conical twist fields and null polygonal Wilson loops

    NASA Astrophysics Data System (ADS)

    Castro-Alvaredo, Olalla A.; Doyon, Benjamin; Fioravanti, Davide

    2018-06-01

    Using an extension of the concept of twist field in QFT to space-time (external) symmetries, we study conical twist fields in two-dimensional integrable QFT. These create conical singularities of arbitrary excess angle. We show that, upon appropriate identification between the excess angle and the number of sheets, they have the same conformal dimension as branch-point twist fields commonly used to represent partition functions on Riemann surfaces, and that both fields have closely related form factors. However, we show that conical twist fields are truly different from branch-point twist fields. They generate different operator product expansions (short distance expansions) and form factor expansions (large distance expansions). In fact, we verify in free field theories, by re-summing form factors, that the conical twist fields operator product expansions are correctly reproduced. We propose that conical twist fields are the correct fields in order to understand null polygonal Wilson loops/gluon scattering amplitudes of planar maximally supersymmetric Yang-Mills theory.

  7. Twist planet drive

    NASA Technical Reports Server (NTRS)

    Vranish, John M. (Inventor)

    1996-01-01

    A planetary gear system includes a sun gear coupled to an annular ring gear through a plurality of twist-planet gears, a speeder gear, and a ground structure having an internal ring gear. Each planet gear includes a solid gear having a first half portion in the form of a spur gear which includes vertical gear teeth and a second half portion in the form of a spur gear which includes helical gear teeth that are offset from the vertical gear teeth and which contact helical gear teeth on the speeder gear and helical gear teeth on the outer ring gear. One half of the twist planet gears are preloaded downward, while the other half are preloaded upwards, each one alternating with the other so that each one twists in a motion opposite to its neighbor when rotated until each planet gear seats against the sun gear, the outer ring gear, the speeder gear, and the inner ring gear. The resulting configuration is an improved stiff anti-backlash gear system.

  8. Aeromechanical Evaluation of Smart-Twisting Active Rotor

    NASA Technical Reports Server (NTRS)

    Lim, Joon W.; Boyd, D. Douglas, Jr.; Hoffman, Frauke; van der Wall, Berend G.; Kim, Do-Hyung; Jung, Sung N.; You, Young H.; Tanabe, Yasutada; Bailly, Joelle; Lienard, Caroline; hide

    2014-01-01

    An investigation of Smart-Twisting Active Rotor (STAR) was made to assess potential benefits of the current active twist rotor concept for performance improvement, vibration reduction, and noise alleviation. The STAR rotor is a 40% Mach-scaled, Bo105 rotor with an articulated flap-lag hinge at 3.5%R and no pre-cone. The 0-5 per rev active twist harmonic inputs were applied for various flight conditions including hover, descent, moderate to high speed level flights, and slowed rotor high advance ratio. For the analysis, the STAR partners used multiple codes including CAMRAD II, S4, HOST, rFlow3D, elsA, and their associated software. At the high thrust level in hover, the 0 per rev active twist with 80% amplitude increased figure of merit (FM) by 0.01-0.02 relative to the baseline. In descent, the largest BVI noise reduction was on the order of 2 to 5 dB at the 3 per rev active twist. In the high speed case (mu = 0.35), the 2 per rev actuation was found to be the most effective in achieving a power reduction as well as a vibration reduction. At the 2 per rev active twist, total power was reduced by 0.65% at the 60 deg active twist phase, and vibration was reduced by 47.6% at the 45 deg active twist phase. The use of the 2 per rev active twist appears effective for vibration reduction. In the high advance ratio case (mu = 0.70), the 0 per rev actuation appeared to have negligible impact on performance improvement. In summary, computational simulations successfully demonstrated that the current active twist concept provided a significant reduction of the maximum BVI noise in descent, a significant reduction of the vibration in the high speed case, a small improvement on rotor performance in hover, and a negligible impact on rotor performance in forward flight.

  9. Renormalization constants for 2-twist operators in twisted mass QCD

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexandrou, C.; Computation-based Science and Technology Research Center, The Cyprus Institute, 15 Kypranoros Str., 1645 Nicosia; Constantinou, M.

    2011-01-01

    Perturbative and nonperturbative results on the renormalization constants of the fermion field and the twist-2 fermion bilinears are presented with emphasis on the nonperturbative evaluation of the one-derivative twist-2 vector and axial-vector operators. Nonperturbative results are obtained using the twisted mass Wilson fermion formulation employing two degenerate dynamical quarks and the tree-level Symanzik improved gluon action. The simulations have been performed for pion masses in the range of about 450-260 MeV and at three values of the lattice spacing a corresponding to {beta}=3.9, 4.05, 4.20. Subtraction of O(a{sup 2}) terms is carried out by performing the perturbative evaluation of thesemore » operators at 1-loop and up to O(a{sup 2}). The renormalization conditions are defined in the RI{sup '}-MOM scheme, for both perturbative and nonperturbative results. The renormalization factors, obtained for different values of the renormalization scale, are evolved perturbatively to a reference scale set by the inverse of the lattice spacing. In addition, they are translated to MS at 2 GeV using 3-loop perturbative results for the conversion factors.« less

  10. Twisted electron-acoustic waves in plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aman-ur-Rehman, E-mail: amansadiq@gmail.com; Department of Physics and Applied Mathematics; Ali, S.

    2016-08-15

    In the paraxial limit, a twisted electron-acoustic (EA) wave is studied in a collisionless unmagnetized plasma, whose constituents are the dynamical cold electrons and Boltzmannian hot electrons in the background of static positive ions. The analytical and numerical solutions of the plasma kinetic equation suggest that EA waves with finite amount of orbital angular momentum exhibit a twist in its behavior. The twisted wave particle resonance is also taken into consideration that has been appeared through the effective wave number q{sub eff} accounting for Laguerre-Gaussian mode profiles attributed to helical phase structures. Consequently, the dispersion relation and the damping ratemore » of the EA waves are significantly modified with the twisted parameter η, and for η → ∞, the results coincide with the straight propagating plane EA waves. Numerically, new features of twisted EA waves are identified by considering various regimes of wavelength and the results might be useful for transport and trapping of plasma particles in a two-electron component plasma.« less

  11. Hyperchromatic laser scanning cytometry

    NASA Astrophysics Data System (ADS)

    Tárnok, Attila; Mittag, Anja

    2007-02-01

    In the emerging fields of high-content and high-throughput single cell analysis for Systems Biology and Cytomics multi- and polychromatic analysis of biological specimens has become increasingly important. Combining different technologies and staining methods polychromatic analysis (i.e. using 8 or more fluorescent colors at a time) can be pushed forward to measure anything stainable in a cell, an approach termed hyperchromatic cytometry. For cytometric cell analysis microscope based Slide Based Cytometry (SBC) technologies are ideal as, unlike flow cytometry, they are non-consumptive, i.e. the analyzed sample is fixed on the slide. Based on the feature of relocation identical cells can be subsequently reanalyzed. In this manner data on the single cell level after manipulation steps can be collected. In this overview various components for hyperchromatic cytometry are demonstrated for a SBC instrument, the Laser Scanning Cytometer (Compucyte Corp., Cambridge, MA): 1) polychromatic cytometry, 2) iterative restaining (using the same fluorochrome for restaining and subsequent reanalysis), 3) differential photobleaching (differentiating fluorochromes by their different photostability), 4) photoactivation (activating fluorescent nanoparticles or photocaged dyes), and 5) photodestruction (destruction of FRET dyes). With the intelligent combination of several of these techniques hyperchromatic cytometry allows to quantify and analyze virtually all components of relevance on the identical cell. The combination of high-throughput and high-content SBC analysis with high-resolution confocal imaging allows clear verification of phenotypically distinct subpopulations of cells with structural information. The information gained per specimen is only limited by the number of available antibodies and by sterical hindrance.

  12. Explicit formulae for Chern-Simons invariants of the twist-knot orbifolds and edge polynomials of twist knots

    NASA Astrophysics Data System (ADS)

    Ham, J.-Y.; Lee, J.

    2016-09-01

    We calculate the Chern-Simons invariants of twist-knot orbifolds using the Schläfli formula for the generalized Chern-Simons function on the family of twist knot cone-manifold structures. Following the general instruction of Hilden, Lozano, and Montesinos-Amilibia, we here present concrete formulae and calculations. We use the Pythagorean Theorem, which was used by Ham, Mednykh and Petrov, to relate the complex length of the longitude and the complex distance between the two axes fixed by two generators. As an application, we calculate the Chern-Simons invariants of cyclic coverings of the hyperbolic twist-knot orbifolds. We also derive some interesting results. The explicit formulae of the A-polynomials of twist knots are obtained from the complex distance polynomials. Hence the edge polynomials corresponding to the edges of the Newton polygons of the A-polynomials of twist knots can be obtained. In particular, the number of boundary components of every incompressible surface corresponding to slope -4n+2 turns out to be 2. Bibliography: 39 titles.

  13. Twist-induced tuning in tapered fiber couplers.

    PubMed

    Birks, T A

    1989-10-01

    The power-splitting ratio of fused tapered single-mode fiber couplers can be reversibly tuned by axial twisting without affecting loss. The twist-tuning behavior of a range of different tapered couplers is described. A simple expression for twist-tuning can be derived by representing the effects of twist by a change in the refractive index profile. Good agreement between this expression and experimental results is demonstrated. Repeated tuning over tens of thousands of cycles is found not to degrade coupler performance, and a number of practical applications, including a freely tunable tapered coupler, are described.

  14. Electrostatic contribution to twist rigidity of DNA.

    PubMed

    Mohammad-Rafiee, Farshid; Golestanian, Ramin

    2004-06-01

    The electrostatic contribution to the twist rigidity of DNA is studied, and it is shown that the Coulomb self-energy of the double-helical sugar-phosphate backbone makes a considerable contribution-the electrostatic twist rigidity of DNA is found to be C(elec) approximately 5 nm, which makes up about 7% of its total twist rigidity ( C(DNA) approximately 75 nm). The electrostatic twist rigidity is found, however, to depend only weakly on the salt concentration, because of a competition between two different screening mechanisms: (1) Debye screening by the salt ions in the bulk, and (2) structural screening by the periodic charge distribution along the backbone of the helical polyelectrolyte. It is found that, depending on the parameters, the electrostatic contribution to the twist rigidity could stabilize or destabilize the structure of a helical polyelectrolyte.

  15. Twist number and order properties of periodic orbits

    NASA Astrophysics Data System (ADS)

    Petrisor, Emilia

    2013-11-01

    A less studied numerical characteristic of periodic orbits of area preserving twist maps of the annulus is the twist or torsion number, called initially the amount of rotation Mather (1984) [2]. It measures the average rotation of tangent vectors under the action of the derivative of the map along that orbit, and characterizes the degree of complexity of the dynamics. The aim of this paper is to give new insights into the definition and properties of the twist number and to relate its range to the order properties of periodic orbits. We derive an algorithm to deduce the exact value or a demi-unit interval containing the exact value of the twist number. We prove that at a period-doubling bifurcation threshold of a mini-maximizing periodic orbit, the new born doubly periodic orbit has the absolute twist number larger than the absolute twist of the original orbit after bifurcation. We give examples of periodic orbits having large absolute twist number, that are badly ordered, and illustrate how characterization of these orbits only by their residue can lead to incorrect results. In connection to the study of the twist number of periodic orbits of standard-like maps we introduce a new tool, called 1-cone function. We prove that the location of minima of this function with respect to the vertical symmetry lines of a standard-like map encodes a valuable information on the symmetric periodic orbits and their twist number.

  16. Strain-Induced Pseudomagnetic Fields in Twisted Graphene Nanoribbons

    NASA Astrophysics Data System (ADS)

    Zhang, Dong-Bo; Seifert, Gotthard; Chang, Kai

    2014-03-01

    We present, for the first time, an atomic-level and quantitative study of a strain-induced pseudomagnetic field in graphene nanoribbons with widths of hundreds of nanometers. We show that twisting strongly affects the band structures of graphene nanoribbons with arbitrary chirality and generates well-defined pseudo-Landau levels, which mimics the quantization of massive Dirac fermions in a magnetic field up to 160 T. Electrons are localized either at ribbon edges forming the edge current or at the ribbon center forming the snake orbit current, both being valley polarized. Our result paves the way for the design of new graphene-based nanoelectronics.

  17. Processing mechanics of alternate twist ply (ATP) yarn technology

    NASA Astrophysics Data System (ADS)

    Elkhamy, Donia Said

    Ply yarns are important in many textile manufacturing processes and various applications. The primary process used for producing ply yarns is cabling. The speed of cabling is limited to about 35m/min. With the world's increasing demands of ply yarn supply, cabling is incompatible with today's demand activated manufacturing strategies. The Alternate Twist Ply (ATP) yarn technology is a relatively new process for producing ply yarns with improved productivity and flexibility. This technology involves self plying of twisted singles yarn to produce ply yarn. The ATP process can run more than ten times faster than cabling. To implement the ATP process to produce ply yarns there are major quality issues; uniform Twist Profile and yarn Twist Efficiency. The goal of this thesis is to improve these issues through process modeling based on understanding the physics and processing mechanics of the ATP yarn system. In our study we determine the main parameters that control the yarn twist profile. Process modeling of the yarn twist across different process zones was done. A computational model was designed to predict the process parameters required to achieve a square wave twist profile. Twist efficiency, a measure of yarn torsional stability and bulk, is determined by the ratio of ply yarn twist to singles yarn twist. Response Surface Methodology was used to develop the processing window that can reproduce ATP yarns with high twist efficiency. Equilibrium conditions of tensions and torques acting on the yarns at the self ply point were analyzed and determined the pathway for achieving higher twist efficiency. Mechanistic modeling relating equilibrium conditions to the twist efficiency was developed. A static tester was designed to zoom into the self ply zone of the ATP yarn. A computer controlled, prototypic ATP machine was constructed and confirmed the mechanistic model results. Optimum parameters achieving maximum twist efficiency were determined in this study. The

  18. Symmetries and Boundary Conditions with a Twist

    NASA Astrophysics Data System (ADS)

    Zawadzki, Krissia; D'Amico, Irene; Oliveira, Luiz N.

    2017-10-01

    Interest in finite-size systems has risen in the last decades, due to the focus on nanotechnological applications and because they are convenient for numerical treatment that can subsequently be extrapolated to infinite lattices. Independently of the envisioned application, special attention must be given to boundary condition, which may or may not preserve the symmetry of the infinite lattice. Here, we present a detailed study of the compatibility between boundary conditions and conservation laws. The conflict between open boundary conditions and momentum conservation is well understood, but we examine other symmetries, as well: we discuss gauge invariance, inversion, spin, and particle-hole symmetry and their compatibility with open, periodic, and twisted boundary conditions. In the interest of clarity, we develop the reasoning in the framework of the one-dimensional half-filled Hubbard model, whose Hamiltonian displays a variety of symmetries. Our discussion includes analytical and numerical results. Our analytical survey shows that, as a rule, boundary conditions break one or more symmetries of the infinite-lattice Hamiltonian. The exception is twisted boundary condition with the special torsion Θ = πL/2, where L is the lattice size. Our numerical results for the ground-state energy at half-filling and the energy gap for L = 2-7 show how the breaking of symmetry affects the convergence to the L → ∞ limit. We compare the computed energies and gaps with the exact results for the infinite lattice drawn from the Bethe-Ansatz solution. The deviations are boundary-condition dependent. The special torsion yields more rapid convergence than open or periodic boundary conditions. For sizes as small as L = 7, the numerical results for twisted condition are very close to the L → ∞ limit. We also discuss the ground-state electronic density and magnetization at half filling under the three boundary conditions.

  19. Acoustic Aspects of Active-Twist Rotor Control

    NASA Technical Reports Server (NTRS)

    Booth, Earl R., Jr.; Wilbur, Matthew L.

    2002-01-01

    The use of an Active Twist Rotor system to provide both vibration reduction and performance enhancement has been explored in recent analytical and experimental studies. Effects of active-twist control on rotor noise, however, had not been determined. During a recent wind tunnel test of an active-twist rotor system, a set of acoustic measurements were obtained to assess the effects of active-twist control on noise produced by the rotor, especially blade-vortex interaction (BVI) noise. It was found that for rotor operating conditions where BVI noise is dominant, active-twist control provided a reduction in BVI noise level. This BVI noise reduction was almost, but not quite, as large as that obtained in a similar test using HHC. However, vibration levels were usually adversely affected at operating conditions favoring minimum BVI noise. Conversely, operating conditions favoring minimum vibration levels affected BVI noise levels, but not always adversely.

  20. Electromagnetic torque tweezers: a versatile approach for measurement of single-molecule twist and torque.

    PubMed

    Janssen, Xander J A; Lipfert, Jan; Jager, Tessa; Daudey, Renier; Beekman, Jaap; Dekker, Nynke H

    2012-07-11

    The well-established single-molecule force-spectroscopy techniques have recently been complemented by methods that can measure torque and twist directly, notably magnetic torque tweezers and the optical torque wrench. A limitation of the current torque measurement schemes is the intrinsic coupling between the force and torque degrees of freedom. Here we present electromagnetic torque tweezers (eMTT) that combine permanent and electromagnets to enable independent control of the force and torsional trap stiffness for sensitive measurements of single molecule torque and twist. Using the eMTT, we demonstrate sensitive torque measurements on tethered DNA molecules from simple tracking of the beads' (x,y)-position, obviating the need for any angular tracking algorithms or markers. Employing the eMTT for high-resolution torque measurements, we experimentally confirm the theoretically predicted torque overshoot at the DNA buckling transition in high salt conditions. We envision that the flexibility and control afforded by the eMTT will enable a range of new torque and twist measurement schemes from single-molecules to living cells.

  1. Impact of DNA twist accumulation on progressive helical wrapping of torsionally constrained DNA.

    PubMed

    Li, Wei; Wang, Peng-Ye; Yan, Jie; Li, Ming

    2012-11-21

    DNA wrapping is an important mechanism for chromosomal DNA packaging in cells and viruses. Previous studies of DNA wrapping have been performed mostly on torsionally unconstrained DNA, while in vivo DNA is often under torsional constraint. In this study, we extend a previously proposed theoretical model for wrapping of torsionally unconstrained DNA to a new model including the contribution of DNA twist energy, which influences DNA wrapping drastically. In particular, due to accumulation of twist energy during DNA wrapping, it predicts a finite amount of DNA that can be wrapped on a helical spool. The predictions of the new model are tested by single-molecule study of DNA wrapping under torsional constraint using magnetic tweezers. The theoretical predictions and the experimental results are consistent with each other and their implications are discussed.

  2. Enhanced intersystem crossing in core-twisted aromatics.

    PubMed

    Nagarajan, Kalaivanan; Mallia, Ajith R; Muraleedharan, Keerthi; Hariharan, Mahesh

    2017-03-01

    We describe the design, bottom-up synthesis and X-ray single crystal structure of systematically twisted aromatics 1c and 2d for efficient intersystem crossing. Steric congestion at the cove region creates a nonplanar geometry that induces a significant yield of triplet excited states in the electron-poor core-twisted aromatics 1c and 2d . A systematic increase in the number of twisted regions in 1c and 2d results in a concomitant enhancement in the rate and yield of intersystem crossing, monitored using femtosecond and nanosecond transient absorption spectroscopy. Time-resolved absorption spectroscopic measurements display enhanced triplet quantum yields ( Φ T = 10 ± 1% for 1c and Φ T = 30 ± 2% for 2d ) in the twisted aromatics when compared to a negligible Φ T (<1%) in the planar analog 3c . Twist-induced spin-orbit coupling via activated out-of-plane C-H/C 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000

  3. Twist functions in vertebral column formation in medaka, Oryzias latipes.

    PubMed

    Yasutake, Junichi; Inohaya, Keiji; Kudo, Akira

    2004-07-01

    Medaka twist, a basic helix-loop-helix (bHLH) transcription factor, is expressed in the sclerotome during embryogenesis. We previously established a line of twist-EGFP transgenic medaka, whose EGFP expression is regulated by the twist promoter; therefore, we could observe the behavior of sclerotomal cells in vivo. In the transgenic medaka embryos, EGFP-positive sclerotomal cells migrated dorsally around the notochord and the neural tube, where at a later stage the vertebral column would be formed. This finding strongly suggests that twist-expressing sclerotomal cells participate in vertebral column formation in medaka. To clarify the function of twist gene in the sclerotome, we performed knockdown analysis of twist by using two kinds of morpholino antisense oligonucleotides targeted against twist (MO1 and MO2). Both the MO1 and MO2 morphants exhibited absence of neural arches, which are bilaterally paired, dorsomedially oriented bones on the dorsal aspect of the centrum. In addition, MO2, which blocks translation of only endogenous twist mRNA in the twist-EGFP transgenic medaka, did not affect the migration pattern of EGFP-positive cells, revealing that the migration of sclerotome-derived cells were normal in the absence of twist gene function. These results demonstrate that medaka twist functions in vertebral column formation by regulating the sclerotomal cell differentiation.

  4. Aptamer-facilitated mass cytometry.

    PubMed

    Mironov, Gleb G; Bouzekri, Alexandre; Watson, Jessica; Loboda, Olga; Ornatsky, Olga; Berezovski, Maxim V

    2018-05-01

    Mass cytometry is a novel cell-by-cell analysis technique, which uses elemental tags instead of fluorophores. Sample cells undergo rapid ionization in inductively coupled plasma and the ionized elemental tags are then analyzed by means of time-of-flight mass spectrometry. Benefits of the mass cytometry approach are in no need for compensation, the high number of detection channels (up to 100) and low background noise. In this work, we applied a biotinylated aptamer against human PTK7 receptor for characterization of positive (human acute lymphoblastic leukemia) and negative (human Burkitt's lymphoma) cells by a mass cytometry instrument. Our proof of principal experiments showed that biotinylated aptamers in conjunction with metal-labeled neutravidin can be successfully utilized for mass cytometry experiments at par with commercially available antibodies. Graphical abstract Biotinylated aptamers in conjunction with metal-labeled neutravidin bind to cell biomarkers, and then injected into the inductively coupled plasma (ICP) source, where cells are vaporized, atomized, and ionized in the plasma for subsequent mass spectrometry (MS) analysis of lanthanide metals.

  5. Twisted Radio Waves and Twisted Thermodynamics

    PubMed Central

    Kish, Laszlo B.; Nevels, Robert D.

    2013-01-01

    We present and analyze a gedanken experiment and show that the assumption that an antenna operating at a single frequency can transmit more than two independent information channels to the far field violates the Second Law of Thermodynamics. Transmission of a large number of channels, each associated with an angular momenta ‘twisted wave’ mode, to the far field in free space is therefore not possible. PMID:23424647

  6. Structure of chaotic magnetic field lines in IR-T1 tokamak due to ergodic magnetic limiter

    NASA Astrophysics Data System (ADS)

    Ahmadi, S.; Salar Elahi, A.; Ghorannevis, M.

    2018-03-01

    In this paper we have studied an Ergodic Magnetic Limiter (EML) based chaotic magnetic field for transport control in the edge plasma of IR-T1 tokamak. The resonance created by the EML causes perturbation of the equilibrium field line in tokamak and as a result, the field lines are chaotic in the vicinity of the dimerized island chains. Transport barriers are formed in the chaotic field line and actually observe in tokamak with reverse magnetic shear. We used area-preserving non-twist (and twist) Poincaré maps to describe the formation of transport barriers, which are actually features of Hamiltonian systems. This transport barrier is useful in reducing radial diffusion of the field line and thus improving the plasma confinement.

  7. Two-Photon Flow Cytometry

    NASA Technical Reports Server (NTRS)

    Zhog, Cheng Frank; Ye, Jing Yong; Norris, Theodore B.; Myc, Andrzej; Cao, Zhengyl; Bielinska, Anna; Thomas, Thommey; Baker, James R., Jr.

    2004-01-01

    Flow cytometry is a powerful technique for obtaining quantitative information from fluorescence in cells. Quantitation is achieved by assuring a high degree of uniformity in the optical excitation and detection, generally by using a highly controlled flow such as is obtained via hydrodynamic focusing. In this work, we demonstrate a two-beam, two- channel detection and two-photon excitation flow cytometry (T(sup 3)FC) system that enables multi-dye analysis to be performed very simply, with greatly relaxed requirements on the fluid flow. Two-photon excitation using a femtosecond near-infrared (NIR) laser has the advantages that it enables simultaneous excitation of multiple dyes and achieves very high signal-to-noise ratio through simplified filtering and fluorescence background reduction. By matching the excitation volume to the size of a cell, single-cell detection is ensured. Labeling of cells by targeted nanoparticles with multiple fluorophores enables normalization of the fluorescence signal and thus ratiometric measurements under nonuniform excitation. Quantitative size measurements can also be done even under conditions of nonuniform flow via a two-beam layout. This innovative detection scheme not only considerably simplifies the fluid flow system and the excitation and collection optics, it opens the way to quantitative cytometry in simple and compact microfluidics systems, or in vivo. Real-time detection of fluorescent microbeads in the vasculature of mouse ear demonstrates the ability to do flow cytometry in vivo. The conditions required to perform quantitative in vivo cytometry on labeled cells will be presented.

  8. VLBA Observations Put New Twist on Quasar Jet Model

    NASA Astrophysics Data System (ADS)

    2005-06-01

    When a pair of researchers aimed the National Science Foundation's Very Long Baseline Array (VLBA) radio telescope toward a famous quasar, they sought evidence to support a popular theory for why the superfast jets of particles streaming from quasars are confined to narrow streams. Instead, they got a surprise that "may send the theorists back to the drawing boards," according to one of the astronomers. 3C 273's Jet A VLBA RADIO IMAGE of the quasar 3C 273's core and jet, top. At bottom, inside an outline (green) of the overall jet image, is a color-coded image of the measured amount by which radio waves have been rotated. This measurement provides clues about the nature and environment of the jet, composed of subatomic particles propelled from the galaxy at a speed nearly that of light. CREDIT: Zavala and Taylor, NRAO/AUI/NSF (Click on images for larger versions.) 3C 273's Jet "We did find the evidence we were looking for, but we also found an additional piece of evidence that seems to contradict it," said Robert Zavala, an astronomer at the U.S. Naval Observatory's Flagstaff, Arizona, station. Zavala and Greg Taylor, of the National Radio Astronomy Observatory and the Kavli Institute of Particle Astrophysics and Cosmology, presented their findings to the American Astronomical Society's meeting in Minneapolis, Minnesota. Quasars are generally thought to be supermassive black holes at the cores of galaxies, the black hole surrounded by a spinning disk of material being drawn inexorably into the black hole's gravitational maw. Through processes still not well understood, powerful jets of particles are propelled outward at speeds nearly that of light. A popular theoretical model says that magnetic-field lines in the spinning disk are twisted tightly together and confine the fast-moving particles into narrow "jets" streaming from the poles of the disk. In 1993, Stanford University and Kavli Institute astrophysicist Roger Blandford suggested that such a twisted magnetic

  9. Lifshits Tails for Randomly Twisted Quantum Waveguides

    NASA Astrophysics Data System (ADS)

    Kirsch, Werner; Krejčiřík, David; Raikov, Georgi

    2018-03-01

    We consider the Dirichlet Laplacian H_γ on a 3D twisted waveguide with random Anderson-type twisting γ . We introduce the integrated density of states N_γ for the operator H_γ , and investigate the Lifshits tails of N_γ , i.e. the asymptotic behavior of N_γ (E) as E \\downarrow \\inf supp dN_γ . In particular, we study the dependence of the Lifshits exponent on the decay rate of the single-site twisting at infinity.

  10. Characterization of sequences in human TWIST required for nuclear localization

    PubMed Central

    Singh, Shalini; Gramolini, Anthony O

    2009-01-01

    Background Twist is a transcription factor that plays an important role in proliferation and tumorigenesis. Twist is a nuclear protein that regulates a variety of cellular functions controlled by protein-protein interactions and gene transcription events. The focus of this study was to characterize putative nuclear localization signals (NLSs) 37RKRR40 and 73KRGKK77 in the human TWIST (H-TWIST) protein. Results Using site-specific mutagenesis and immunofluorescences, we observed that altered TWISTNLS1 K38R, TWISTNLS2 K73R and K77R constructs inhibit nuclear accumulation of H-TWIST in mammalian cells, while TWISTNLS2 K76R expression was un-affected and retained to the nucleus. Subsequently, co-transfection of TWIST mutants K38R, K73R and K77R with E12 formed heterodimers and restored nuclear localization despite the NLSs mutations. Using a yeast-two-hybrid assay, we identified a novel TWIST-interacting candidate TCF-4, a basic helix-loop-helix transcription factor. The interaction of TWIST with TCF-4 confirmed using NLS rescue assays, where nuclear expression of mutant TWISTNLS1 with co-transfixed TCF-4 was observed. The interaction of TWIST with TCF-4 was also seen using standard immunoprecipitation assays. Conclusion Our study demonstrates the presence of two putative NLS motifs in H-TWIST and suggests that these NLS sequences are functional. Furthermore, we identified and confirmed the interaction of TWIST with a novel protein candidate TCF-4. PMID:19534813

  11. Twisting short dsDNA with applied tension

    NASA Astrophysics Data System (ADS)

    Zoli, Marco

    2018-02-01

    The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

  12. Helically twisted photonic crystal fibres

    NASA Astrophysics Data System (ADS)

    Russell, P. St. J.; Beravat, R.; Wong, G. K. L.

    2017-02-01

    Recent theoretical and experimental work on helically twisted photonic crystal fibres (PCFs) is reviewed. Helical Bloch theory is introduced, including a new formalism based on the tight-binding approximation. It is used to explore and explain a variety of unusual effects that appear in a range of different twisted PCFs, including fibres with a single core and fibres with N cores arranged in a ring around the fibre axis. We discuss a new kind of birefringence that causes the propagation constants of left- and right-spinning optical vortices to be non-degenerate for the same order of orbital angular momentum (OAM). Topological effects, arising from the twisted periodic `space', cause light to spiral around the fibre axis, with fascinating consequences, including the appearance of dips in the transmission spectrum and low loss guidance in coreless PCF. Discussing twisted fibres with a single off-axis core, we report that optical activity in a PCF is opposite in sign to that seen in a step-index fibre. Fabrication techniques are briefly described and emerging applications reviewed. The analytical results of helical Bloch theory are verified by an extensive series of `numerical experiments' based on finite-element solutions of Maxwell's equations in a helicoidal frame. This article is part of the themed issue 'Optical orbital angular momentum'.

  13. Twisted gravitational waves

    NASA Astrophysics Data System (ADS)

    Bini, Donato; Chicone, Carmen; Mashhoon, Bahram

    2018-03-01

    In general relativity (GR), linearized gravitational waves propagating in empty Minkowski spacetime along a fixed spatial direction have the property that the wave front is the Euclidean plane. Beyond the linear regime, exact plane waves in GR have been studied theoretically for a long time and many exact vacuum solutions of the gravitational field equations are known that represent plane gravitational waves. These have parallel rays and uniform wave fronts. It turns out, however, that GR also admits exact solutions representing gravitational waves propagating along a fixed direction that are nonplanar. The wave front is then nonuniform and the bundle of rays is twisted. We find a class of solutions representing nonplanar unidirectional gravitational waves and study some of the properties of these twisted waves.

  14. Kinetic theory of twisted waves: Application to space plasmas having superthermal population of species

    NASA Astrophysics Data System (ADS)

    Arshad, Kashif; Poedts, Stefaan; Lazar, Marian

    2017-04-01

    Nowadays electromagnetic (EM) fields have various applications in fundamental research, communication, and home appliances. Even though, there are still some subtle features of electromagnetic field known to us a century ago, yet to be utilized. It is because of the technical complexities to sense three dimensional electromagnetic field. An important characteristic of electromagnetic field is its orbital angular momentum (OAM). The angular momentum consists of two distinct parts; intrinsic part associated with the wave polarization or spin, and the extrinsic part associated with the orbital angular momentum (OAM). The orbital angular momentum (OAM) is inherited by helically phased light or helical (twisted) electric field. The investigations of Allen on lasers carrying orbital angular momentum (OAM), has initiated a new scientific and technological advancement in various growing fields, such as microscopy and imaging, atomic and nano-particle manipulation, ultra-fast optical communications, quantum computing, ionospheric radar facility to observe 3D plasma dynamics in ionosphere, photonic crystal fibre, OAM entanglement of two photons, twisted gravitational waves, ultra-intense twisted laser pulses and astrophysics. Recently, the plasma modes are also investigated with orbital angular momentum. The production of electron vortex beams and its applications are indicated by Verbeeck et al. The magnetic tornadoes (rotating magnetic field structures) exhibit three types of morphology i.e., spiral, ring and split. Leyser pumped helical radio beam carrying OAM into the Ionospheric plasma under High Frequency Active Auroral Research Program (HAARP) and characteristic ring shaped morphology is obtained by the optical emission spectrum of pumped plasma turbulence. The scattering phenomenon like (stimulated Raman and Brillouin backscattering) is observed to be responsible for the interaction between electrostatic and electromagnetic waves through orbital angular momentum. The

  15. Flow cytometry: basic principles and applications.

    PubMed

    Adan, Aysun; Alizada, Günel; Kiraz, Yağmur; Baran, Yusuf; Nalbant, Ayten

    2017-03-01

    Flow cytometry is a sophisticated instrument measuring multiple physical characteristics of a single cell such as size and granularity simultaneously as the cell flows in suspension through a measuring device. Its working depends on the light scattering features of the cells under investigation, which may be derived from dyes or monoclonal antibodies targeting either extracellular molecules located on the surface or intracellular molecules inside the cell. This approach makes flow cytometry a powerful tool for detailed analysis of complex populations in a short period of time. This review covers the general principles and selected applications of flow cytometry such as immunophenotyping of peripheral blood cells, analysis of apoptosis and detection of cytokines. Additionally, this report provides a basic understanding of flow cytometry technology essential for all users as well as the methods used to analyze and interpret the data. Moreover, recent progresses in flow cytometry have been discussed in order to give an opinion about the future importance of this technology.

  16. TWIST User Presentation

    EPA Pesticide Factsheets

    The Wastewater Information System Tool (TWIST) is downloadable, user-friendly management tool that will allow state and local health departments to effectively inventory and manage small wastewater treatment systems in their jurisdictions.

  17. Influence of pinches on magnetic reconnection in turbulent space plasmas

    NASA Astrophysics Data System (ADS)

    Olshevsky, Vyacheslav; Lapenta, Giovanni; Markidis, Stefano; Divin, Andrey

    A generally accepted scenario of magnetic reconnection in space plasmas is the breakage of magnetic field lines in X-points. In laboratory, reconnection is widely studied in pinches, current channels embedded into twisted magnetic fields. No model of magnetic reconnection in space plasmas considers both null-points and pinches as peers. We have performed a particle-in-cell simulation of magnetic reconnection in a three-dimensional configuration where null-points are present nitially, and Z-pinches are formed during the simulation. The X-points are relatively stable, and no substantial energy dissipation is associated with them. On contrary, turbulent magnetic reconnection in the pinches causes the magnetic energy to decay at a rate of approximately 1.5 percent per ion gyro period. Current channels and twisted magnetic fields are ubiquitous in turbulent space plasmas, so pinches can be responsible for the observed high magnetic reconnection rates.

  18. Development and evaluation of TWIST Dixon for dynamic contrast-enhanced (DCE) MRI with improved acquisition efficiency and fat suppression.

    PubMed

    Le, Yuan; Kroeker, Randall; Kipfer, Hal D; Lin, Chen

    2012-08-01

    To develop a new pulse sequence called time-resolved angiography with stochastic trajectories (TWIST) Dixon for dynamic contrast enhanced magnetic resonance imaging (DCE-MRI). The method combines dual-echo Dixon to generate separated water and fat images with a k-space view-sharing scheme developed for 3D TWIST. The performance of TWIST Dixon was compared with a volume interpolated breathhold examination (VIBE) sequence paired with spectrally selective adiabatic inversion Recovery (SPAIR) and quick fat-sat (QFS) fat-suppression techniques at 3.0T using quantitative measurements of fat-suppression accuracy and signal-to-noise ratio (SNR) efficiency, as well as qualitative breast image evaluations. The water fraction of a uniform phantom was calculated from the following images: 0.66 ± 0.03 for TWIST Dixon; 0.56 ± 0.23 for VIBE-SPAIR, and 0.53 ± 0.14 for VIBE-QFS, while the reference value is 0.70 measured by spectroscopy. For phantoms with contrast (Gd-BOPTA) concentration ranging from 0-6 mM, TWIST Dixon also provides consistently higher SNR efficiency (3.2-18.9) compared with VIBE-SPAIR (2.8-16.8) and VIBE-QFS (2.4-12.5). Breast images acquired with TWIST Dixon at 3.0T show more robust and uniform fat suppression and superior overall image quality compared with VIBE-SPAIR. The results from phantom and volunteer evaluation suggest that TWIST Dixon outperforms conventional methods in almost every aspect and it is a promising method for DCE-MRI and contrast-enhanced perfusion MRI, especially at higher field strength where fat suppression is challenging. Copyright © 2012 Wiley Periodicals, Inc.

  19. Twisting microfluidics in a planetary centrifuge.

    PubMed

    Yasuda, Shoya; Hayakawa, Masayuki; Onoe, Hiroaki; Takinoue, Masahiro

    2017-03-15

    This paper reports a twisting microfluidic method utilising a centrifuge-based fluid extruding system in a planetary centrifuge which simultaneously generates an orbital rotation and an axial spin. In this method, fluid extrusion from a micro-scale capillary to an 'open-space' solution or air enables release of the fluid from the capillary-based microchannel, which physically means that there is a release of fluids from a confined low-Reynolds-number environment to an open non-low-Reynolds-number environment. As a result, the extruded fluids are separated from the axial spin of the capillary, and the difference in the angular rates of the axial spin between the capillary and the extruded fluids produces the 'twisting' of the fluid. In this study, we achieve control of the twist of highly viscous fluids, and we construct a simple physical model for the fluid twist. In addition, we demonstrate the formation of twisted hydrogel microstructures (stripe-patterned microbeads and multi-helical microfibres) with control over the stripe pattern and the helical pitch length. We believe that this method will enable the generation of more sophisticated microstructures which cannot easily be formed by usual channel-based microfluidic devices. This method can also provide advanced control of microfluids, as in the case of rapid mixing of highly viscous fluids. This method can contribute to a wide range of applications in materials science, biophysics, biomedical science, and microengineering in the future.

  20. Association between Twist and multidrug resistance gene-associated proteins in Taxol®-resistant MCF-7 cells and a 293 cell model of Twist overexpression.

    PubMed

    Wang, Li; Tan, Rui-Zhi; Zhang, Zhi-Xia; Yin, Rui; Zhang, Yong-Liang; Cui, Wei-Jia; He, Tao

    2018-01-01

    Multidrug resistance (MDR) severely limits the effectiveness of chemotherapy. Previous studies have identified Twist as a key factor of acquired MDR in breast, gastric and prostate cancer. However, the underlying mechanisms of action of Twist in MDR remain unclear. In the present study, the expression levels of MDR-associated proteins, including lung resistance-related protein (LRP), topoisomerase IIα (TOPO IIα), MDR-associated protein (MRP) and P-glycoprotein (P-gp), and the expression of Twist in cancerous tissues and pericancerous tissues of human breast cancer, were examined. In order to simulate Taxol ® resistance in cells, a Taxol ® -resistant human mammary adenocarcinoma cell subline (MCF-7/Taxol ® ) was established by repeatedly exposing MCF-7 cells to high concentrations of Taxol ® (up to 15 µg/ml). Twist was also overexpressed in 293 cells by transfecting this cell line with pcDNA5/FRT/TO vector containing full-length hTwist cDNA to explore the dynamic association between Twist and MDR gene-associated proteins. It was identified that the expression levels of Twist, TOPO IIα, MRP and P-gp were upregulated and LRP was downregulated in human breast cancer tissues, which was consistent with the expression of these proteins in the Taxol ® -resistant MCF-7 cell model. Notably, the overexpression of Twist in 293 cells increased the resistance to Taxol ® , Trichostatin A and 5-fluorouracil, and also upregulated the expression of MRP and P-gp. Taken together, these data demonstrated that Twist may promote drug resistance in cells and cancer tissues through regulating the expression of MDR gene-associated proteins, which may assist in understanding the mechanisms of action of Twist in drug resistance.

  1. Twisting/Swirling Motions during a Prominence Eruption as Seen from SDO/AIA

    NASA Astrophysics Data System (ADS)

    Pant, V.; Datta, A.; Banerjee, D.; Chandrashekhar, K.; Ray, S.

    2018-06-01

    A quiescent prominence was observed at the northwest limb of the Sun using different channels of the Atmospheric Imaging Assembly on board the Solar Dynamics Observatory. We report and analyze twisting/swirling motions during and after the prominence eruption. We segregate the observed rotational motions into small and large scales. Small-scale rotational motions manifest in the barbs of the prominence, while the large-scale rotation manifests as the roll motion during the prominence eruption. We noticed that both footpoints of the prominence rotate in the counterclockwise direction. We propose that a similar sense of rotation in both footpoints leads to a prominence eruption. The prominence erupted asymmetrically near the southern footpoint, which may be due to an uneven mass distribution and location of the cavity near the southern footpoint. Furthermore, we study the swirling motion of the plasma along different circular paths in the cavity of the prominence after the prominence eruption. The rotational velocities of the plasma moving along different circular paths are estimated to be ∼9–40 km s‑1. These swirling motions can be explained in terms of twisted magnetic field lines in the prominence cavity. Finally we observe the twist built up in the prominence, being carried away by the coronal mass ejection, as seen in the Large Angle Spectrometric Coronagraph on board the Solar and Heliospheric Observatory.

  2. Strain and curvature induced evolution of electronic band structures in twisted graphene bilayer.

    PubMed

    Yan, Wei; He, Wen-Yu; Chu, Zhao-Dong; Liu, Mengxi; Meng, Lan; Dou, Rui-Fen; Zhang, Yanfeng; Liu, Zhongfan; Nie, Jia-Cai; He, Lin

    2013-01-01

    It is well established that strain and geometry could affect the band structure of graphene monolayer dramatically. Here we study the evolution of local electronic properties of a twisted graphene bilayer induced by a strain and a high curvature, which are found to strongly affect the local band structures of the twisted graphene bilayer. The energy difference of the two low-energy van Hove singularities decreases with increasing lattice deformation and the states condensed into well-defined pseudo-Landau levels, which mimic the quantization of massive chiral fermions in a magnetic field of about 100 T, along a graphene wrinkle. The joint effect of strain and out-of-plane distortion in the graphene wrinkle also results in a valley polarization with a significant gap. These results suggest that strained graphene bilayer could be an ideal platform to realize the high-temperature zero-field quantum valley Hall effect.

  3. Helically twisted photonic crystal fibres

    PubMed Central

    Beravat, R.; Wong, G. K. L.

    2017-01-01

    Recent theoretical and experimental work on helically twisted photonic crystal fibres (PCFs) is reviewed. Helical Bloch theory is introduced, including a new formalism based on the tight-binding approximation. It is used to explore and explain a variety of unusual effects that appear in a range of different twisted PCFs, including fibres with a single core and fibres with N cores arranged in a ring around the fibre axis. We discuss a new kind of birefringence that causes the propagation constants of left- and right-spinning optical vortices to be non-degenerate for the same order of orbital angular momentum (OAM). Topological effects, arising from the twisted periodic ‘space’, cause light to spiral around the fibre axis, with fascinating consequences, including the appearance of dips in the transmission spectrum and low loss guidance in coreless PCF. Discussing twisted fibres with a single off-axis core, we report that optical activity in a PCF is opposite in sign to that seen in a step-index fibre. Fabrication techniques are briefly described and emerging applications reviewed. The analytical results of helical Bloch theory are verified by an extensive series of ‘numerical experiments’ based on finite-element solutions of Maxwell's equations in a helicoidal frame. This article is part of the themed issue ‘Optical orbital angular momentum’. PMID:28069771

  4. Structural and electron diffraction scaling of twisted graphene bilayers

    NASA Astrophysics Data System (ADS)

    Zhang, Kuan; Tadmor, Ellad B.

    2018-03-01

    Multiscale simulations are used to study the structural relaxation in twisted graphene bilayers and the associated electron diffraction patterns. The initial twist forms an incommensurate moiré pattern that relaxes to a commensurate microstructure comprised of a repeating pattern of alternating low-energy AB and BA domains surrounding a high-energy AA domain. The simulations show that the relaxation mechanism involves a localized rotation and shrinking of the AA domains that scales in two regimes with the imposed twist. For small twisting angles, the localized rotation tends to a constant; for large twist, the rotation scales linearly with it. This behavior is tied to the inverse scaling of the moiré pattern size with twist angle and is explained theoretically using a linear elasticity model. The results are validated experimentally through a simulated electron diffraction analysis of the relaxed structures. A complex electron diffraction pattern involving the appearance of weak satellite peaks is predicted for the small twist regime. This new diffraction pattern is explained using an analytical model in which the relaxation kinematics are described as an exponentially-decaying (Gaussian) rotation field centered on the AA domains. Both the angle-dependent scaling and diffraction patterns are in quantitative agreement with experimental observations. A Matlab program for extracting the Gaussian model parameters accompanies this paper.

  5. Magnetohydrodynamics of atmospheric transients. IV - Nonplane two-dimensional analyses of energy conversion and magnetic field evolution. [during corona following solar flare

    NASA Technical Reports Server (NTRS)

    Wu, S. T.; Nakagawa, Y.; Han, S. M.; Dryer, M.

    1982-01-01

    The evolution of the magnetic field and the manner of conversion of thermal energy into different forms in the corona following a solar flare are investigated by means of a nonplane magnetohydrodynamic (MHD) analysis. All three components of magnetic field and velocity are treated in a physically self-consistent manner, with all physical variables as functions of time (t) and two spatial coordinates (r, theta). The difference arising from the initial magnetic field, either twisted (force-free) or non-twisted (potential), is demonstrated. Consideration is given to two initial field topologies (open vs. closed). The results demonstrate that the conversion of magnetic energy is faster for the case of the initially twisted (force-free) field than for the initially untwisted (potential) field. In addition, the twisted field is found to produce a complex structure of the density enhancements.

  6. Fundamentals of flow cytometry.

    PubMed

    Jaroszeski, M J; Radcliff, G

    1999-02-01

    Flow cytometers are instruments that are used primarily to measure the physical and biochemical characteristics of biological particles. This technology is used to perform measurements on whole cells as well as prepared cellular constituents, such as nuclei and organelles. Flow cytometers are investigative tools for a broad range of scientific disciplines because they make measurements on thousands of individual cells/particles in a matter of seconds. This is a unique advantage relative to other detection instruments that provide bulk particle measurements. Flow cytometry is a complex and highly technical field; therefore, a basic understanding of the technology is essential for all users. The purpose of this article is to provide fundamental information about the instrumentation used for flow cytometry as well as the methods used to analyze and interpret data. This information will provide a foundation to use flow cytometry effectively as a research tool.

  7. Scanning tunneling microscopy and spectroscopy of twisted trilayer graphene

    NASA Astrophysics Data System (ADS)

    Zuo, Wei-Jie; Qiao, Jia-Bin; Ma, Dong-Lin; Yin, Long-Jing; Sun, Gan; Zhang, Jun-Yang; Guan, Li-Yang; He, Lin

    2018-01-01

    Twist, as a simple and unique degree of freedom, could lead to enormous novel quantum phenomena in bilayer graphene. A small rotation angle introduces low-energy van Hove singularities (VHSs) approaching the Fermi level, which result in unusual correlated states in the bilayer graphene. It is reasonable to expect that the twist could also affect the electronic properties of few-layer graphene dramatically. However, such an issue has remained experimentally elusive. Here, by using scanning tunneling microscopy/spectroscopy (STM/STS), we systematically studied a twisted trilayer graphene (TTG) with two different small twist angles between adjacent layers. Two sets of VHSs, originating from the two twist angles, were observed in the TTG, indicating that the TTG could be simply regarded as a combination of two different twisted bilayers of graphene. By using high-resolution STS, we observed a split of the VHSs and directly imaged the spatial symmetry breaking of electronic states around the VHSs. These results suggest that electron-electron interactions play an important role in affecting the electronic properties of graphene systems with low-energy VHSs.

  8. [Expression and mechanism of Twist2 in glioma].

    PubMed

    Wang, L Z; Wang, W J; Xiong, Y F; Xu, S; Wang, S S; Tu, Y; Wang, Z Y; Yan, X L; Mei, J H; Wang, C L

    2017-12-08

    Objective: To investigate the significance of Twist2 in glioma and whether it is involved in the malignant transformation of glioma by epithelial-mesenchymal transition (EMT). Methods: Using immunohistochemical method detected the expression level of Twist2 in 60 cases of gliomas (including WHO grades Ⅱ, Ⅲ and Ⅳ, each for 20 cases) and 20 cases of non-tumor brain tissues. Real-time fluorescence quantitative PCR and Western blot were used to detect the expression level of Twist2 mRNA and protein in 61 cases of fresh glioma tissue (WHO grade Ⅱ 16 cases, Ⅲ 21 cases, Ⅳ 24 cases) and 12 cases of adjacent tissues, and the expression levels of E-cadherin, N-cadherin and vimentin were also investigated in fresh glioma tissue. Results: Immunohistochemistry results showed that the percentages of Twist2 expression in glioma was 90%(54/60) compared with 30%(6/20) in non-tumor brain tissues( P <0.01). The percentages of Twist2 expression were 75% (15/20), 95% (19/20), and 100% (20/20) in the WHO gradesⅡ, Ⅲ and Ⅳ gliomas, respectively. WHO grades Ⅳ and Ⅲ were significantly higher than that of WHO grade Ⅱ ( P <0.01). There was no significant difference between WHO grade Ⅳand WHO Ⅲ glioma ( P >0.05). Real-time fluorescence quantitative PCR and Western blot showed that the expression level of Twist 2 in gliomas was significantly higher than that in para-cancerous tissues ( P <0.01), and those in WHO grades Ⅳ and Ⅲ gliomas were significantly higher than that in WHO grade Ⅱ glioma ( P <0.01). There was no significant difference between WHO grade Ⅳand grade Ⅲ glioma ( P >0.05). Detection of key protein expression in EMT by Western blot displayed that the expression of E-cadherin was negatively associated with Twist2 in glioma ( r =-0.972, P <0.01). The expression of N-cadherin and vimentin was positively associated with Twist2 in glioma( r =0.971, P <0.01; r =0.968, P <0.01). Conclusions: The expression of Twist2 in human glioma is positively

  9. Analysis of lead twist in modern high-performance grinding methods

    NASA Astrophysics Data System (ADS)

    Kundrák, J.; Gyáni, K.; Felhő, C.; Markopoulos, AP; Deszpoth, I.

    2016-11-01

    According to quality requirements of road vehicles shafts, which bear dynamic seals, twisted-pattern micro-geometrical topography is not allowed. It is a question whether newer modern grinding methods - such as quick-point grinding and peel grinding - could provide twist- free topography. According to industrial experience, twist-free surfaces can be made, however with certain settings, same twist occurs. In this paper it is proved by detailed chip-geometrical analysis that the topography generated by the new procedures is theoretically twist-patterned because of the feeding motion of the CBN tool. The presented investigation was carried out by a single-grain wheel model and computer simulation.

  10. Trace of the Twisted Heisenberg Category

    NASA Astrophysics Data System (ADS)

    Oğuz, Can Ozan; Reeks, Michael

    2017-12-01

    We show that the trace decategorification, or zeroth Hochschild homology, of the twisted Heisenberg category defined by Cautis and Sussan is isomorphic to a quotient of {W^-}, a subalgebra of W_{1+∞} defined by Kac, Wang, and Yan. Our result is a twisted analogue of that by Cautis, Lauda, Licata, and Sussan relating W_{1+∞} and the trace decategorification of the Heisenberg category.

  11. Prostacyclin Suppresses Twist Expression in the Presence of Indomethacin in Bone Marrow-Derived Mesenchymal Stromal Cells

    PubMed Central

    Kemper, Oliver; Herten, Monika; Fischer, Johannes; Haversath, Marcel; Beck, Sascha; Classen, Tim; Warwas, Sebastian; Tassemeier, Tjark; Landgraeber, Stefan; Lensing-Höhn, Sabine; Krauspe, Rüdiger; Jäger, Marcus

    2014-01-01

    Background Iloprost, a stable prostacyclin I2 analogue, seems to have an osteoblast-protective potential, whereas indomethacin suppresses new bone formation. The aim of this study was to investigate human bone marrow stromal cell (BMSC) proliferation and differentiation towards the osteoblastic lineage by administration of indomethacin and/or iloprost. Material/Methods Human bone marrow cells were obtained from 3 different donors (A=26 yrs/m; B=25 yrs/f, C=35 yrs/m) via vacuum aspiration of the iliac crest followed by density gradient centrifugation and flow cytometry with defined antigens (CD105+/73+/45−/14−). The cells were seeded and incubated as follows: without additives (Group 0; donor A/B/C), with 10−7 M iloprost only (Group 0+ilo; A/B), with indomethacin only in concentrations of 10−6 M (Group 1, A), 10−5 M (Group 2, B), 10−4 M (Group 3, A/B), and together with 10−7 M iloprost (Groups 4–6, A/B/C). On Day 10 and 28, UV/Vis spectrometric and immunocytochemical assays (4 samples per group and donor) were performed to investigate cell proliferation (cell count measurement) and differentiation towards the osteoblastic lineage (CD34−, CD45−, CD105+, type 1 collagen (Col1), osteocalcin (OC), alkaline phosphatase (ALP), Runx2, Twist, specific ALP-activity). Results Indomethacin alone suppressed BMSC differentiation towards the osteoblastic lineage by downregulation of Runx2, Col1, and ALP. In combination with indomethacin, iloprost increased cell proliferation and differentiation and it completely suppressed Twist expression at Day 10 and 28. Iloprost alone did not promote cell proliferation, but moderately enhanced Runx2 and Twist expression. However, the proliferative effects and the specific ALP-activity varied donor-dependently. Conclusions Iloprost partially antagonized the suppressing effects of indomethacin on BMSC differentiation towards the osteoblast lineage. It enhanced the expression of Runx2 and, only in the presence of indomethacin

  12. Reaction mechanism of the acidic hydrolysis of highly twisted amides: Rate acceleration caused by the twist of the amide bond.

    PubMed

    Mujika, Jon I; Formoso, Elena; Mercero, Jose M; Lopez, Xabier

    2006-08-03

    We present an ab initio study of the acid hydrolysis of a highly twisted amide and a planar amide analogue. The aim of these studies is to investigate the effect that the twist of the amide bond has on the reaction barriers and mechanism of acid hydrolysis. Concerted and stepwise mechanisms were investigated using density functional theory and polarizable continuum model calculations. Remarkable differences were observed between the mechanism of twisted and planar amide, due mainly to the preference for N-protonation of the former and O-protonation of the latter. In addition, we were also able to determine that the hydrolytic mechanism of the twisted amide will be pH dependent. Thus, there is a preference for a stepwise mechanism with formation of an intermediate in the acid hydrolysis, whereas the neutral hydrolysis undergoes a concerted-type mechanism. There is a nice agreement between the characterized intermediate and available X-ray data and a good agreement with the kinetically estimated rate acceleration of hydrolysis with respect to analogous undistorted amide compounds. This work, along with previous ab initio calculations, describes a complex and rich chemistry for the hydrolysis of highly twisted amides as a function of pH. The theoretical data provided will allow for a better understanding of the available kinetic data of the rate acceleration of amides upon twisting and the relation of the observed rate acceleration with intrinsic differential reactivity upon loss of amide bond resonance.

  13. Twisted multifilament superconductor

    NASA Technical Reports Server (NTRS)

    Coles, W. D. (Inventor)

    1973-01-01

    Masking selected portions of a ribbon and forming an intermetallic compound on the unmasked portions by a controlled diffusion reaction produces a twisted filamentary structure. The masking material prohibits the formation of superconductive material on predetermined areas of the substrate.

  14. Moiré edge states in twisted graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Fleischmann, M.; Gupta, R.; Weckbecker, D.; Landgraf, W.; Pankratov, O.; Meded, V.; Shallcross, S.

    2018-05-01

    The edge physics of graphene based systems is well known to be highly sensitive to the atomic structure at the boundary, with localized zero mode edge states found only on the zigzag-type termination of the lattice. Here we demonstrate that the graphene twist bilayer supports an additional class of edge states, that (i) are found for all edge geometries and thus are robust against edge roughness, (ii) occur at energies coinciding with twist induced Van Hove singularities in the bulk and (iii) possess an electron density strongly modulated by the moiré lattice. Interestingly, these "moiré edge states" exist only for certain lattice commensurations and thus the edge physics of the twist bilayer is, in dramatic contrast to that of the bulk, not uniquely determined by the twist angle.

  15. CytometryML: a markup language for analytical cytology

    NASA Astrophysics Data System (ADS)

    Leif, Robert C.; Leif, Stephanie H.; Leif, Suzanne B.

    2003-06-01

    Cytometry Markup Language, CytometryML, is a proposed new analytical cytology data standard. CytometryML is a set of XML schemas for encoding both flow cytometry and digital microscopy text based data types. CytometryML schemas reference both DICOM (Digital Imaging and Communications in Medicine) codes and FCS keywords. These schemas provide representations for the keywords in FCS 3.0 and will soon include DICOM microscopic image data. Flow Cytometry Standard (FCS) list-mode has been mapped to the DICOM Waveform Information Object. A preliminary version of a list mode binary data type, which does not presently exist in DICOM, has been designed. This binary type is required to enhance the storage and transmission of flow cytometry and digital microscopy data. Index files based on Waveform indices will be used to rapidly locate the cells present in individual subsets. DICOM has the advantage of employing standard file types, TIF and JPEG, for Digital Microscopy. Using an XML schema based representation means that standard commercial software packages such as Excel and MathCad can be used to analyze, display, and store analytical cytometry data. Furthermore, by providing one standard for both DICOM data and analytical cytology data, it eliminates the need to create and maintain special purpose interfaces for analytical cytology data thereby integrating the data into the larger DICOM and other clinical communities. A draft version of CytometryML is available at www.newportinstruments.com.

  16. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    NASA Astrophysics Data System (ADS)

    Hu, F.; Das, Suprem R.; Luan, Y.; Chung, T.-F.; Chen, Y. P.; Fei, Z.

    2017-12-01

    We report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly due to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.

  17. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, F.; Das, Suprem R.; Luan, Y.

    Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

  18. Real-Space Imaging of the Tailored Plasmons in Twisted Bilayer Graphene

    DOE PAGES

    Hu, F.; Das, Suprem R.; Luan, Y.; ...

    2017-12-13

    Here, we report a systematic plasmonic study of twisted bilayer graphene (TBLG)—two graphene layers stacked with a twist angle. Through real-space nanoimaging of TBLG single crystals with a wide distribution of twist angles, we find that TBLG supports confined infrared plasmons that are sensitively dependent on the twist angle. At small twist angles, TBLG has a plasmon wavelength comparable to that of single-layer graphene. At larger twist angles, the plasmon wavelength of TBLG increases significantly with apparently lower damping. Further analysis and modeling indicate that the observed twist-angle dependence of TBLG plasmons in the Dirac linear regime is mainly duemore » to the Fermi-velocity renormalization, a direct consequence of interlayer electronic coupling. Our work unveils the tailored plasmonic characteristics of TBLG and deepens our understanding of the intriguing nano-optical physics in novel van der Waals coupled two-dimensional materials.« less

  19. Reversible Twisting of Primary Amides via Ground State N-C(O) Destabilization: Highly Twisted Rotationally Inverted Acyclic Amides.

    PubMed

    Meng, Guangrong; Shi, Shicheng; Lalancette, Roger; Szostak, Roman; Szostak, Michal

    2018-01-17

    Since the seminal studies by Pauling in 1930s, planarity has become the defining characteristic of the amide bond. Planarity of amides has central implications for the reactivity and chemical properties of amides of relevance to a range of chemical disciplines. While the vast majority of amides are planar, nonplanarity has a profound effect on the properties of the amide bond, with the most common method to restrict the amide bond relying on the incorporation of the amide function into a rigid cyclic ring system. In a major departure from this concept, here, we report the first class of acyclic twisted amides that can be prepared, reversibly, from common primary amides in a single, operationally trivial step. Di-tert-butoxycarbonylation of the amide nitrogen atom yields twisted amides in which the amide bond exhibits nearly perpendicular twist. Full structural characterization of a range of electronically diverse compounds from this new class of twisted amides is reported. Through reactivity studies we demonstrate unusual properties of the amide bond, wherein selective cleavage of the amide bond can be achieved by a judicious choice of the reaction conditions. Through computational studies we evaluate structural and energetic details pertaining to the amide bond deformation. The ability to selectively twist common primary amides, in a reversible manner, has important implications for the design and application of the amide bond nonplanarity in structural chemistry, biochemistry and organic synthesis.

  20. Twisted sigma-model solitons on the quantum projective line

    NASA Astrophysics Data System (ADS)

    Landi, Giovanni

    2018-04-01

    On the configuration space of projections in a noncommutative algebra, and for an automorphism of the algebra, we use a twisted Hochschild cocycle for an action functional and a twisted cyclic cocycle for a topological term. The latter is Hochschild-cohomologous to the former and positivity in twisted Hochschild cohomology results into a lower bound for the action functional. While the equations for the critical points are rather involved, the use of the positivity and the bound by the topological term lead to self-duality equations (thus yielding twisted noncommutative sigma-model solitons, or instantons). We present explicit nontrivial solutions on the quantum projective line.

  1. The Twist Tensor Nuclear Norm for Video Completion.

    PubMed

    Hu, Wenrui; Tao, Dacheng; Zhang, Wensheng; Xie, Yuan; Yang, Yehui

    2017-12-01

    In this paper, we propose a new low-rank tensor model based on the circulant algebra, namely, twist tensor nuclear norm (t-TNN). The twist tensor denotes a three-way tensor representation to laterally store 2-D data slices in order. On one hand, t-TNN convexly relaxes the tensor multirank of the twist tensor in the Fourier domain, which allows an efficient computation using fast Fourier transform. On the other, t-TNN is equal to the nuclear norm of block circulant matricization of the twist tensor in the original domain, which extends the traditional matrix nuclear norm in a block circulant way. We test the t-TNN model on a video completion application that aims to fill missing values and the experiment results validate its effectiveness, especially when dealing with video recorded by a nonstationary panning camera. The block circulant matricization of the twist tensor can be transformed into a circulant block representation with nuclear norm invariance. This representation, after transformation, exploits the horizontal translation relationship between the frames in a video, and endows the t-TNN model with a more powerful ability to reconstruct panning videos than the existing state-of-the-art low-rank models.

  2. An introduction to mass cytometry: fundamentals and applications.

    PubMed

    Tanner, Scott D; Baranov, Vladimir I; Ornatsky, Olga I; Bandura, Dmitry R; George, Thaddeus C

    2013-05-01

    Mass cytometry addresses the analytical challenges of polychromatic flow cytometry by using metal atoms as tags rather than fluorophores and atomic mass spectrometry as the detector rather than photon optics. The many available enriched stable isotopes of the transition elements can provide up to 100 distinguishable reporting tags, which can be measured simultaneously because of the essential independence of detection provided by the mass spectrometer. We discuss the adaptation of traditional inductively coupled plasma mass spectrometry to cytometry applications. We focus on the generation of cytometry-compatible data and on approaches to unsupervised multivariate clustering analysis. Finally, we provide a high-level review of some recent benchmark reports that highlight the potential for massively multi-parameter mass cytometry.

  3. "Twisted Beam" SEE Observations of Ionospheric Heating from HAARP

    NASA Astrophysics Data System (ADS)

    Briczinski, S. J.; Bernhardt, P. A.; Siefring, C. L.; Han, S.-M.; Pedersen, T. R.; Scales, W. A.

    2015-10-01

    Nonlinear interactions of high power HF radio waves in the ionosphere provide aeronomers with a unique space-based laboratory capability. The High-Frequency Active Auroral Research Program (HAARP) in Gakona, Alaska is the world's largest heating facility, yielding effective radiated powers in the gigawatt range. New results are present from HAARP experiments using a "twisted beam" excitation mode. Analysis of twisted beam heating shows that the SEE results obtained are identical to more traditional patterns. One difference in the twisted beam mode is the heating region produced is in the shape of a ring as opposed to the more traditional "solid spot" region from a pencil beam. The ring heating pattern may be more conducive to the creation of stable artificial airglow layers because of the horizontal structure of the ring. The results of these runs include artificial layer creation and evolution as pertaining to the twisted beam pattern. The SEE measurements aid the interpretation of the twisted beam interactions in the ionosphere.

  4. Role of left ventricular twist mechanics in cardiomyopathies, dance of the helices

    PubMed Central

    Kauer, Floris; Geleijnse, Marcel Leonard; van Dalen, Bastiaan Martijn

    2015-01-01

    Left ventricular twist is an essential part of left ventricular function. Nevertheless, knowledge is limited in “the cardiology community” as it comes to twist mechanics. Fortunately the development of speckle tracking echocardiography, allowing accurate, reproducible and rapid bedside assessment of left ventricular twist, has boosted the interest in this important mechanical aspect of left ventricular deformation. Although the fundamental physiological role of left ventricular twist is undisputable, the clinical relevance of assessment of left ventricular twist in cardiomyopathies still needs to be established. The fact remains; analysis of left ventricular twist mechanics has already provided substantial pathophysiological understanding on a comprehensive variety of cardiomyopathies. It has become clear that increased left ventricular twist in for example hypertrophic cardiomyopathy may be an early sign of subendocardial (microvascular) dysfunction. Furthermore, decreased left ventricular twist may be caused by left ventricular dilatation or an extensive myocardial scar. Finally, the detection of left ventricular rigid body rotation in noncompaction cardiomyopathy may provide an indispensible method to objectively confirm this difficult diagnosis. All this endorses the value of left ventricular twist in the field of cardiomyopathies and may further encourage the implementation of left ventricular twist parameters in the “diagnostic toolbox” for cardiomyopathies. PMID:26322187

  5. Twisted surfaces with vanishing curvature in Galilean 3-space

    NASA Astrophysics Data System (ADS)

    Dede, Mustafa; Ekici, Cumali; Goemans, Wendy; Ünlütürk, Yasin

    In this work, we define twisted surfaces in Galilean 3-space. In order to construct these surfaces, a planar curve is subjected to two simultaneous rotations, possibly with different rotation speeds. The existence of Euclidean rotations and isotropic rotations leads to three distinct types of twisted surfaces in Galilean 3-space. Then we classify twisted surfaces in Galilean 3-space with zero Gaussian curvature or zero mean curvature.

  6. Coronal plasma development in wire-array z-pinches made of twisted-pairs

    NASA Astrophysics Data System (ADS)

    Hoyt, C. L.; Greenly, J. B.; Gourdain, P. A.; Knapp, P. F.; Pikuz, S. A.; Shelkovenko, T. A.; Hammer, D. A.; Kusse, B. R.

    2009-11-01

    We have investigated coronal and core plasma development in wire array z-pinches in which single fine wires are replaced by twisted-pairs (``cable'') on the 1 MA, 100 ns rise time COBRA pulsed power generator. X-ray radiography, employed to investigate dense wire core expansion, showed periodic axial nonuniformity and evidence for shock waves developing where the individual wire plasmas collide. Laser shadowgraphy images indicated that the axial instability properties of the coronal plasma are substantially modified from ordinary wire arrays. Cable mass per unit length, material and the twist wavelength were varied in order to study their effects upon the instability wavelength. Implosion uniformity and bright-spot formation, as well as magnetic topology evolution, have also been investigated using self-emission imaging, x-ray diagnostics and small B-dot probes, respectively. Results from the cable-array z-pinches will be compared with results from ordinary wire-array z-pinches. This research was supported by the SSAA program of the National Nuclear Security Administration under DOE Cooperative agreement DE-FC03-02NA00057.

  7. Imaging flow cytometry for phytoplankton analysis.

    PubMed

    Dashkova, Veronika; Malashenkov, Dmitry; Poulton, Nicole; Vorobjev, Ivan; Barteneva, Natasha S

    2017-01-01

    This review highlights the concepts and instrumentation of imaging flow cytometry technology and in particular its use for phytoplankton analysis. Imaging flow cytometry, a hybrid technology combining speed and statistical capabilities of flow cytometry with imaging features of microscopy, is rapidly advancing as a cell imaging platform that overcomes many of the limitations of current techniques and contributed significantly to the advancement of phytoplankton analysis in recent years. This review presents the various instrumentation relevant to the field and currently used for assessment of complex phytoplankton communities' composition and abundance, size structure determination, biovolume estimation, detection of harmful algal bloom species, evaluation of viability and metabolic activity and other applications. Also we present our data on viability and metabolic assessment of Aphanizomenon sp. cyanobacteria using Imagestream X Mark II imaging cytometer. Herein, we highlight the immense potential of imaging flow cytometry for microalgal research, but also discuss limitations and future developments. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. CytometryML and other data formats

    NASA Astrophysics Data System (ADS)

    Leif, Robert C.

    2006-02-01

    Cytology automation and research will be enhanced by the creation of a common data format. This data format would provide the pathology and research communities with a uniform way for annotating and exchanging images, flow cytometry, and associated data. This specification and/or standard will include descriptions of the acquisition device, staining, the binary representations of the image and list-mode data, the measurements derived from the image and/or the list-mode data, and descriptors for clinical/pathology and research. An international, vendor-supported, non-proprietary specification will allow pathologists, researchers, and companies to develop and use image capture/analysis software, as well as list-mode analysis software, without worrying about incompatibilities between proprietary vendor formats. Presently, efforts to create specifications and/or descriptions of these formats include the Laboratory Digital Imaging Project (LDIP) Data Exchange Specification; extensions to the Digital Imaging and Communications in Medicine (DICOM); Open Microscopy Environment (OME); Flowcyt, an extension to the present Flow Cytometry Standard (FCS); and CytometryML. The feasibility of creating a common data specification for digital microscopy and flow cytometry in a manner consistent with its use for medical devices and interoperability with both hospital information and picture archiving systems has been demonstrated by the creation of the CytometryML schemas. The feasibility of creating a software system for digital microscopy has been demonstrated by the OME. CytometryML consists of schemas that describe instruments and their measurements. These instruments include digital microscopes and flow cytometers. Optical components including the instruments' excitation and emission parts are described. The description of the measurements made by these instruments includes the tagged molecule, data acquisition subsystem, and the format of the list-mode and/or image data. Many

  9. Twisting perturbed parafermions

    NASA Astrophysics Data System (ADS)

    Belitsky, A. V.

    2017-07-01

    The near-collinear expansion of scattering amplitudes in maximally supersymmetric Yang-Mills theory at strong coupling is governed by the dynamics of stings propagating on the five sphere. The pentagon transitions in the operator product expansion which systematize the series get reformulated in terms of matrix elements of branch-point twist operators in the two-dimensional O(6) nonlinear sigma model. The facts that the latter is an asymptotically free field theory and that there exists no local realization of twist fields prevents one from explicit calculation of their scaling dimensions and operator product expansion coefficients. This complication is bypassed making use of the equivalence of the sigma model to the infinite-level limit of WZNW models perturbed by current-current interactions, such that one can use conformal symmetry and conformal perturbation theory for systematic calculations. Presently, to set up the formalism, we consider the O(3) sigma model which is reformulated as perturbed parafermions.

  10. Twisted Vanes Would Enhance Fuel/Air Mixing In Turbines

    NASA Technical Reports Server (NTRS)

    Nguyen, H. Lee; Micklow, Gerald J.; Dogra, Anju S.

    1994-01-01

    Computations of flow show performance of high-shear airblast fuel injector in gas-turbine engine enhanced by use of appropriately proportioned twisted (instead of flat) dome swirl vanes. Resultant more nearly uniform fuel/air mixture burns more efficiently, emitting smaller amounts of nitrogen oxides. Twisted-vane high-shear airblast injectors also incorporated into paint sprayers, providing advantages of low pressure drop characteristic of airblast injectors in general and finer atomization of advanced twisted-blade design.

  11. Performance of twist-coupled blades on variable speed rotors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lobitz, D.W.; Veers, P.S.; Laino, D.J.

    1999-12-07

    The load mitigation and energy capture characteristics of twist-coupled HAWT blades that are mounted on a variable speed rotor are investigated in this paper. These blades are designed to twist toward feather as they bend with pretwist set to achieve a desirable twist distribution at rated power. For this investigation, the ADAMS-WT software has been modified to include blade models with bending-twist coupling. Using twist-coupled and uncoupled models, the ADAMS software is exercised for steady wind environments to generate C{sub p} curves at a number of operating speeds to compare the efficiencies of the two models. The ADAMS software ismore » also used to generate the response of a twist-coupled variable speed rotor to a spectrum of stochastic wind time series. This spectrum contains time series with two mean wind speeds at two turbulence levels. Power control is achieved by imposing a reactive torque on the low speed shaft proportional to the RPM squared with the coefficient specified so that the rotor operates at peak efficiency in the linear aerodynamic range, and by limiting the maximum RPM to take advantage of the stall controlled nature of the rotor. Fatigue calculations are done for the generated load histories using a range of material exponents that represent materials from welded steel to aluminum to composites, and results are compared with the damage computed for the rotor without twist-coupling. Results indicate that significant reductions in damage are achieved across the spectrum of applied wind loading without any degradation in power production.« less

  12. CytometryML binary data standards

    NASA Astrophysics Data System (ADS)

    Leif, Robert C.

    2005-03-01

    CytometryML is a proposed new Analytical Cytology (Cytomics) data standard, which is based on a common set of XML schemas for encoding flow cytometry and digital microscopy text based data types (metadata). CytometryML schemas reference both DICOM (Digital Imaging and Communications in Medicine) codes and FCS keywords. Flow Cytometry Standard (FCS) list-mode has been mapped to the DICOM Waveform Information Object. The separation of the large binary data objects (list mode and image data) from the XML description of the metadata permits the metadata to be directly displayed, analyzed, and reported with standard commercial software packages; the direct use of XML languages; and direct interfacing with clinical information systems. The separation of the binary data into its own files simplifies parsing because all extraneous header data has been eliminated. The storage of images as two-dimensional arrays without any extraneous data, such as in the Adobe Photoshop RAW format, facilitates the development by scientists of their own analysis and visualization software. Adobe Photoshop provided the display infrastructure and the translation facility to interconvert between the image data from commercial formats and RAW format. Similarly, the storage and parsing of list mode binary data type with a group of parameters that are specified at compilation time is straight forward. However when the user is permitted at run-time to select a subset of the parameters and/or specify results of mathematical manipulations, the development of special software was required. The use of CytometryML will permit investigators to be able to create their own interoperable data analysis software and to employ commercially available software to disseminate their data.

  13. Comparison of split double and triple twists in pair figure skating.

    PubMed

    King, Deborah L; Smith, Sarah L; Brown, Michele R; McCrory, Jean L; Munkasy, Barry A; Scheirman, Gary I

    2008-05-01

    In this study, we compared the kinematic variables of the split triple twist with those of the split double twist to help coaches and scientists understand these landmark pair skating skills. High-speed video was taken during the pair short and free programmes at the 2002 Salt Lake City Winter Olympics and the 2003 International Skating Union Grand Prix Finals. Three-dimensional analyses of 14 split double twists and 15 split triple twists from eleven pairs were completed. In spite of considerable variability in the performance variables among the pairs, the main difference between the split double twists and split triple twists was an increase in rotational rate. While eight of the eleven pairs relied primarily on an increased rotational rate to complete the split triple twist, three pairs employed a combined strategy of increased rotational rate and increased flight time due predominantly to delayed or lower catches. These results were similar to observations of jumps in singles skating for which the extra rotation is typically due to an increase in rotational velocity; increases in flight time come primarily from delayed landings as opposed to additional height during flight. Combining an increase in flight time and rotational rate may be a good strategy for completing the split triple twist in pair skating.

  14. Particle-in-Cell Simulations of the Twisted Magnetospheres of Magnetars. I.

    NASA Astrophysics Data System (ADS)

    Chen, Alexander Y.; Beloborodov, Andrei M.

    2017-08-01

    The magnetospheres of magnetars are believed to be filled with electron-positron plasma generated by electric discharge. We present a first numerical experiment demonstrating this process in an axisymmetric magnetosphere with a simple threshold prescription for pair creation, which is applicable to the inner magnetosphere with an ultrastrong field. The {e}+/- discharge occurs in response to the twisting of the closed magnetic field lines by a shear deformation of the magnetar surface, which launches electric currents into the magnetosphere. The simulation shows the formation of an electric “gap” with an unscreened electric field ({\\boldsymbol{E}}\\cdot {\\boldsymbol{B}}\

  15. On the origin of pure optical rotation in twisted-cross metamaterials

    PubMed Central

    Barr, Lauren E.; Díaz-Rubio, Ana; Tremain, Ben; Carbonell, Jorge; Sánchez-Dehesa, José; Hendry, Euan; Hibbins, Alastair P.

    2016-01-01

    We present an experimental and computational study of the response of twisted-cross metamaterials that provide near dispersionless optical rotation across a broad band of frequencies from 19 GHz to 37 GHz. We compare two distinct geometries: firstly, a bilayer structure comprised of arrays of metallic crosses where the crosses in the second layer are twisted about the layer normal; and secondly where the second layer is replaced by the complementary to the original, i.e. an array of cross-shaped holes. Through numerical modelling we determine the origin of rotatory effects in these two structures. In both, pure optical rotation occurs in a frequency band between two transmission minima, where alignment of electric and magnetic dipole moments occurs. In the cross/cross metamaterial, the transmission minima occur at the symmetric and antisymmetric resonances of the coupled crosses. By contrast, in the cross/complementary-cross structure the transmission minima are associated with the dipole and quadrupole modes of the cross, the frequencies of which appear intrinsic to the cross layer alone. Hence the bandwidth of optical rotation is found to be relatively independent of layer separation. PMID:27457405

  16. Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.

    PubMed

    Xue, Gongda; Hemmings, Brian A

    2012-02-01

    The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.

  17. Effect of twist on single-mode fiber-optic 3 × 3 couplers

    NASA Astrophysics Data System (ADS)

    Chen, Dandan; Ji, Minning; Peng, Lei

    2018-01-01

    In the fabricating process of a 3 × 3 fused tapered coupler, the three fibers are usually twisted to be close-contact. The effect of twist on 3 × 3 fused tapered couplers is investigated in this paper. It is found that though a linear 3 × 3 coupler may realize equal power splitting ratio theoretically by twisting a special angle, it is hard to be fabricated actually because the twist angle and the coupler's length must be determined in advance. While an equilateral 3 × 3 coupler can not only realize approximate equal power splitting ratio theoretically but can also be fabricated just by controlling the elongation length. The effect of twist on the equilateral 3 × 3 coupler lies in the relationship between the equal ratio error and the twist angle. The more the twist angle is, the larger the equal ratio error may be. The twist angle usually should be no larger than 90° on one coupling period length in order to keep the equal ratio error small enough. The simulation results agree well with the experimental data.

  18. Twisted ultrathin silicon nanowires: A possible torsion electromechanical nanodevice

    NASA Astrophysics Data System (ADS)

    Garcia, J. C.; Justo, J. F.

    2014-11-01

    Nanowires have been considered for a number of applications in nanometrology. In such a context, we have explored the possibility of using ultrathin twisted nanowires as torsion nanobalances to probe forces and torques at molecular level with high precision, a nanoscale system analogous to the Coulomb's torsion balance electrometer. In order to achieve this goal, we performed a first-principles investigation on the structural and electronic properties of twisted silicon nanowires, in their pristine and hydrogenated forms. The results indicated that wires with pentagonal and hexagonal cross-sections are the thinnest stable silicon nanostructures. Additionally, all wires followed a Hooke's law behavior for small twisting deformations. Hydrogenation leads to spontaneous twisting, but with angular spring constants considerably smaller than the ones for the respective pristine forms. We observed considerable changes on the nanowire electronic properties upon twisting, which allows to envision the possibility of correlating the torsional angular deformation with the nanowire electronic transport. This could ultimately allow a direct access to measurements on interatomic forces at molecular level.

  19. New twist on artificial muscles.

    PubMed

    Haines, Carter S; Li, Na; Spinks, Geoffrey M; Aliev, Ali E; Di, Jiangtao; Baughman, Ray H

    2016-10-18

    Lightweight artificial muscle fibers that can match the large tensile stroke of natural muscles have been elusive. In particular, low stroke, limited cycle life, and inefficient energy conversion have combined with high cost and hysteretic performance to restrict practical use. In recent years, a new class of artificial muscles, based on highly twisted fibers, has emerged that can deliver more than 2,000 J/kg of specific work during muscle contraction, compared with just 40 J/kg for natural muscle. Thermally actuated muscles made from ordinary polymer fibers can deliver long-life, hysteresis-free tensile strokes of more than 30% and torsional actuation capable of spinning a paddle at speeds of more than 100,000 rpm. In this perspective, we explore the mechanisms and potential applications of present twisted fiber muscles and the future opportunities and challenges for developing twisted muscles having improved cycle rates, efficiencies, and functionality. We also demonstrate artificial muscle sewing threads and textiles and coiled structures that exhibit nearly unlimited actuation strokes. In addition to robotics and prosthetics, future applications include smart textiles that change breathability in response to temperature and moisture and window shutters that automatically open and close to conserve energy.

  20. New twist on artificial muscles

    PubMed Central

    Haines, Carter S.; Li, Na; Spinks, Geoffrey M.; Aliev, Ali E.; Di, Jiangtao; Baughman, Ray H.

    2016-01-01

    Lightweight artificial muscle fibers that can match the large tensile stroke of natural muscles have been elusive. In particular, low stroke, limited cycle life, and inefficient energy conversion have combined with high cost and hysteretic performance to restrict practical use. In recent years, a new class of artificial muscles, based on highly twisted fibers, has emerged that can deliver more than 2,000 J/kg of specific work during muscle contraction, compared with just 40 J/kg for natural muscle. Thermally actuated muscles made from ordinary polymer fibers can deliver long-life, hysteresis-free tensile strokes of more than 30% and torsional actuation capable of spinning a paddle at speeds of more than 100,000 rpm. In this perspective, we explore the mechanisms and potential applications of present twisted fiber muscles and the future opportunities and challenges for developing twisted muscles having improved cycle rates, efficiencies, and functionality. We also demonstrate artificial muscle sewing threads and textiles and coiled structures that exhibit nearly unlimited actuation strokes. In addition to robotics and prosthetics, future applications include smart textiles that change breathability in response to temperature and moisture and window shutters that automatically open and close to conserve energy. PMID:27671626

  1. Analysis of gun barrel rifling twist

    NASA Astrophysics Data System (ADS)

    Sun, Jia; Chen, Guangsong; Qian, Linfang; Liu, Taisu

    2017-05-01

    Aiming at the problem of gun barrel rifling twist, the constraint relation between rifling and projectile is investigated. The constraint model of rifling and projectile is established and the geometric relation between the twist and the motion of projectile is analyzed. Based on the constraint model, according to the rotating band that is fired, the stress and the motion law of the rotating band in bore are analyzed. The effects to rotating band (double rotating band or wide driving band) caused by different rifling (rib rifling, increasing rifling and combined rifling) are also investigated. The model is demonstrated by several examples. The results of numerical examples and the constraint mode show that the uncertainty factors will be brought in the increasing rifling and combined rifling during the projectile move in the bore. According to the amplitude and the strength of the twist acting on rotating band, the steady property of rotational motion of the projectile, the rib rifling is a better choose.

  2. Unraveling cellulose microfibrils: a twisted tale.

    PubMed

    Hadden, Jodi A; French, Alfred D; Woods, Robert J

    2013-10-01

    Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. Copyright © 2013 Wiley Periodicals, Inc.

  3. Unraveling Cellulose Microfibrils: A Twisted Tale

    PubMed Central

    Hadden, Jodi A.; French, Alfred D.; Woods, Robert J.

    2014-01-01

    Molecular dynamics (MD) simulations of cellulose microfibrils are pertinent to the paper, textile, and biofuels industries for their unique capacity to characterize dynamic behavior and atomic-level interactions with solvent molecules and cellulase enzymes. While high-resolution crystallographic data have established a solid basis for computational analysis of cellulose, previous work has demonstrated a tendency for modeled microfibrils to diverge from the linear experimental structure and adopt a twisted conformation. Here, we investigate the dependence of this twisting behavior on computational approximations and establish the theoretical basis for its occurrence. We examine the role of solvent, the effect of nonbonded force field parameters [partial charges and van der Waals (vdW) contributions], and the use of explicitly modeled oxygen lone pairs in both the solute and solvent. Findings suggest that microfibril twisting is favored by vdW interactions, and counteracted by both intrachain hydrogen bonds and solvent effects at the microfibril surface. PMID:23681971

  4. Mesoscale mechanics of twisting carbon nanotube yarns.

    PubMed

    Mirzaeifar, Reza; Qin, Zhao; Buehler, Markus J

    2015-03-12

    Fabricating continuous macroscopic carbon nanotube (CNT) yarns with mechanical properties close to individual CNTs remains a major challenge. Spinning CNT fibers and ribbons for enhancing the weak interactions between the nanotubes is a simple and efficient method for fabricating high-strength and tough continuous yarns. Here we investigate the mesoscale mechanics of twisting CNT yarns using full atomistic and coarse grained molecular dynamics simulations, considering concurrent mechanisms at multiple length-scales. To investigate the mechanical response of such a complex structure without losing insights into the molecular mechanism, we applied a multiscale strategy. The full atomistic results are used for training a coarse grained model for studying larger systems consisting of several CNTs. The mesoscopic model parameters are updated as a function of the twist angle, based on the full atomistic results, in order to incorporate the atomistic scale deformation mechanisms in larger scale simulations. By bridging across two length scales, our model is capable of accurately predicting the mechanical behavior of twisted yarns while the atomistic level deformations in individual nanotubes are integrated into the model by updating the parameters. Our results focused on studying a bundle of close packed nanotubes provide novel mechanistic insights into the spinning of CNTs. Our simulations reveal how twisting a bundle of CNTs improves the shear interaction between the nanotubes up to a certain level due to increasing the interaction surface. Furthermore, twisting the bundle weakens the intertube interactions due to excessive deformation in the cross sections of individual CNTs in the bundle.

  5. THE FORMATION AND MAGNETIC STRUCTURES OF ACTIVE-REGION FILAMENTS OBSERVED BY NVST, SDO, AND HINODE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, X. L.; Xue, Z. K.; Wang, J. C.

    2015-08-15

    To better understand the properties of solar active-region filaments, we present a detailed study on the formation and magnetic structures of two active-region filaments in active region NOAA 11884 during a period of four days. It is found that the shearing motion of the opposite magnetic polarities and the rotation of the small sunspots with negative polarity play an important role in the formation of two active-region filaments. During the formation of these two active-region filaments, one foot of the filaments was rooted in a small sunspot with negative polarity. The small sunspot rotated not only around another small sunspotmore » with negative polarity, but also around the center of its umbra. By analyzing the nonlinear force-free field extrapolation using the vector magnetic fields in the photosphere, twisted structures were found in the two active-region filaments prior to their eruptions. These results imply that the magnetic fields were dragged by the shearing motion between opposite magnetic polarities and became more horizontal. The sunspot rotation twisted the horizontal magnetic fields and finally formed the twisted active-region filaments.« less

  6. Landau damping of Langmuir twisted waves with kappa distributed electrons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arshad, Kashif, E-mail: kashif.arshad.butt@gmail.com; Aman-ur-Rehman; Mahmood, Shahzad

    2015-11-15

    The kinetic theory of Landau damping of Langmuir twisted modes is investigated in the presence of orbital angular momentum of the helical (twisted) electric field in plasmas with kappa distributed electrons. The perturbed distribution function and helical electric field are considered to be decomposed by Laguerre-Gaussian mode function defined in cylindrical geometry. The Vlasov-Poisson equation is obtained and solved analytically to obtain the weak damping rates of the Langmuir twisted waves in a nonthermal plasma. The strong damping effects of the Langmuir twisted waves at wavelengths approaching Debye length are also obtained by using an exact numerical method and aremore » illustrated graphically. The damping rates of the planar Langmuir waves are found to be larger than the twisted Langmuir waves in plasmas which shows opposite behavior as depicted in Fig. 3 by J. T. Mendoça [Phys. Plasmas 19, 112113 (2012)].« less

  7. Wing Twist Measurements at the National Transonic Facility

    NASA Technical Reports Server (NTRS)

    Burner, Alpheus W.; Wahls, Richard A.; Goad, William K.

    1996-01-01

    A technique for measuring wing twist currently in use at the National Transonic Facility is described. The technique is based upon a single camera photogrammetric determination of two dimensional coordinates with a fixed (and known) third dimensional coordinate. The wing twist is found from a conformal transformation between wind-on and wind-off 2-D coordinates in the plane of rotation. The advantages and limitations of the technique as well as the rationale for selection of this particular technique are discussed. Examples are presented to illustrate run-to-run and test-to-test repeatability of the technique in air mode. Examples of wing twist in cryogenic nitrogen mode are also presented.

  8. Statistical mechanics of ribbons under bending and twisting torques.

    PubMed

    Sinha, Supurna; Samuel, Joseph

    2013-11-20

    We present an analytical study of ribbons subjected to an external torque. We first describe the elastic response of a ribbon within a purely mechanical framework. We then study the role of thermal fluctuations in modifying its elastic response. We predict the moment-angle relation of bent and twisted ribbons. Such a study is expected to shed light on the role of twist in DNA looping and on bending elasticity of twisted graphene ribbons. Our quantitative predictions can be tested against future single molecule experiments.

  9. Exact special twist method for quantum Monte Carlo simulations

    NASA Astrophysics Data System (ADS)

    Dagrada, Mario; Karakuzu, Seher; Vildosola, Verónica Laura; Casula, Michele; Sorella, Sandro

    2016-12-01

    We present a systematic investigation of the special twist method introduced by Rajagopal et al. [Phys. Rev. B 51, 10591 (1995), 10.1103/PhysRevB.51.10591] for reducing finite-size effects in correlated calculations of periodic extended systems with Coulomb interactions and Fermi statistics. We propose a procedure for finding special twist values which, at variance with previous applications of this method, reproduce the energy of the mean-field infinite-size limit solution within an adjustable (arbitrarily small) numerical error. This choice of the special twist is shown to be the most accurate single-twist solution for curing one-body finite-size effects in correlated calculations. For these reasons we dubbed our procedure "exact special twist" (EST). EST only needs a fully converged independent-particles or mean-field calculation within the primitive cell and a simple fit to find the special twist along a specific direction in the Brillouin zone. We first assess the performances of EST in a simple correlated model such as the three-dimensional electron gas. Afterwards, we test its efficiency within ab initio quantum Monte Carlo simulations of metallic elements of increasing complexity. We show that EST displays an overall good performance in reducing finite-size errors comparable to the widely used twist average technique but at a much lower computational cost since it involves the evaluation of just one wave function. We also demonstrate that the EST method shows similar performances in the calculation of correlation functions, such as the ionic forces for structural relaxation and the pair radial distribution function in liquid hydrogen. Our conclusions point to the usefulness of EST for correlated supercell calculations; our method will be particularly relevant when the physical problem under consideration requires large periodic cells.

  10. Long-term evolution of the force-free twisted magnetosphere of a magnetar

    NASA Astrophysics Data System (ADS)

    Akgün, T.; Cerdá-Durán, P.; Miralles, J. A.; Pons, J. A.

    2017-12-01

    We study the long-term quasi-steady evolution of the force-free magnetosphere of a magnetar coupled to its internal magnetic field. We find that magnetospheric currents can be maintained on long time-scales of the order of thousands of years. Meanwhile, the energy, helicity and twist stored in the magnetosphere all gradually increase over the course of this evolution, until a critical point is reached, beyond which a force-free magnetosphere cannot be constructed. At this point, some large-scale magnetospheric rearrangement, possibly resulting in an outburst or a flare, must occur, releasing a large fraction of the stored energy, helicity and twist. After that, the quasi-steady evolution should continue in a similar manner from the new initial conditions. The time-scale for reaching this critical point depends on the overall magnetic field strength and on the relative fraction of the toroidal field. The energy stored in the force-free magnetosphere is found to be up to ∼30 per cent larger than the corresponding vacuum energy. This implies that for a 1014 G field at the pole, the energy budget available for fast magnetospheric events is of the order of a few 1044 erg. The spin-down rate is estimated to increase by up to ∼60 per cent, since the dipole content in the magnetosphere is enhanced by the currents present there. A rough estimate of the braking index n reveals that it is systematically n < 3 for the most part of the evolution, consistent with actual measurements for pulsars and early estimates for several magnetars.

  11. Twist-3 contributions to wide-angle photoproduction of pions

    NASA Astrophysics Data System (ADS)

    Kroll, P.; Passek-Kumerički, K.

    2018-04-01

    We investigate wide-angle π0 photoproduction within the handbag approach to twist-3 accuracy. In contrast to earlier work both the 2-particle as well as the 3-particle twist-3 contributions are taken into account. It is shown that both are needed for consistent results that respect gauge invariance and crossing properties. The numerical studies reveal the dominance of the twist-3 contribution. With it fair agreement with the recent CLAS measurement of the π0 cross section is obtained. We briefly comment also on wide-angle photoproduction of other pseudoscalar mesons.

  12. Electromagnetically Induced Absorption (EIA) and a ``Twist'' on Nonlinear Magneto-optical Rotation (NMOR) with Cold Atoms

    NASA Astrophysics Data System (ADS)

    Kunz, Paul; Meyer, David; Quraishi, Qudsia

    2015-05-01

    Within the class of nonlinear optical effects that exhibit sub-natural linewidth features, electromagnetically induced transparency (EIT) and nonlinear magneto-optical rotation (NMOR) stand out as having made dramatic impacts on various applications including atomic clocks, magnetometry, and single photon storage. A related effect, known as electromagnetically induced absorption (EIA), has received less attention in the literature. Here, we report on the first observation of EIA in cold atoms using the Hanle configuration, where a single laser beam is used to both pump and probe the atoms while sweeping a magnetic field through zero along the beam direction. We find that, associated with the EIA peak, a ``twist'' appears in the corresponding NMOR signal. A similar twist has been previously noted by Budker et al., in the context of warm vapor optical magnetometry, and was ascribed to optical pumping through nearby hyperfine levels. By studying this feature through numerical simulations and cold atom experiments, thus rendering the hyperfine levels well resolved, we enhance the understanding of the optical pumping mechanism behind it, and elucidate its relation to EIA. Finally, we demonstrate a useful application of these studies through a simple and rapid method for nulling background magnetic fields within our atom chip apparatus.

  13. A photometric determination of twists in early-type galaxies. II

    NASA Technical Reports Server (NTRS)

    Williams, T. B.; Schwarzschild, M.

    1979-01-01

    In continuation of previous work, detailed photometric data have been obtained for two elliptical galaxies by using the Mount Lemmon 1.5-m telescope and a large SEC television camera. As before, the aim of this photometry is to gain additional information on the occurrence of twists in such galaxies; i.e., on the change of the position angle of the major axes of the isophotes from the center outward. No significant twist was found in NGC 1052. However, NGC 584 was found to have a securely observed twist of about 10 deg within 10 kpc from its center. These data strengthen previous indications that many ellipticals contain twists in their inner, bright portions.

  14. Measurement of the torque on a single stretched and twisted DNA using magnetic tweezers.

    PubMed

    Mosconi, Francesco; Allemand, Jean François; Bensimon, David; Croquette, Vincent

    2009-02-20

    We deduced the torque applied on a single stretched and twisted DNA by integrating the change in the molecule's extension with respect to force as it is coiled. While consistent with previous direct measurements of the torque at high forces (F>1 pN), this method, which is simple and does not require a sophisticated setup, allows for lower force estimates. We used this approach to deduce the effective torsional modulus of DNA, which decreases with force, and to estimate the buckling torque of DNA as a function of force in various salt conditions.

  15. Active-Twist Rotor Control Applications for UAVs

    NASA Technical Reports Server (NTRS)

    Wilbur, Matthew L.; Wilkie, W. Keats

    2004-01-01

    The current state-of-the-art in active-twist rotor control is discussed using representative examples from analytical and experimental studies, and the application to rotary-wing UAVs is considered. Topics include vibration and noise reduction, rotor performance improvement, active blade tracking, stability augmentation, and rotor blade de-icing. A review of the current status of piezoelectric fiber composite actuator technology, the class of piezoelectric actuators implemented in active-twist rotor systems, is included.

  16. Aeroelastic Analysis of Helicopter Rotor Blades Incorporating Anisotropic Piezoelectric Twist Actuation

    NASA Technical Reports Server (NTRS)

    Wilkie, W. Keats; Belvin, W. Keith; Park, K. C.

    1996-01-01

    A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consists of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for dynamics simulation using numerical integration. The twist actuation responses for three conceptual fullscale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

  17. Quantitative Magnetic Separation of Particles and Cells using Gradient Magnetic Ratcheting

    PubMed Central

    Murray, Coleman; Pao, Edward; Tseng, Peter; Aftab, Shayan; Kulkarni, Rajan; Rettig, Matthew; Di Carlo, Dino

    2016-01-01

    Extraction of rare target cells from biosamples is enabling for life science research. Traditional rare cell separation techniques, such as magnetic activated cell sorting (MACS), are robust but perform coarse, qualitative separations based on surface antigen expression. We report a quantitative magnetic separation technology using high-force magnetic ratcheting over arrays of magnetically soft micro-pillars with gradient spacing, and use the system to separate and concentrate magnetic beads based on iron oxide content (IOC) and cells based on surface expression. The system consists of a microchip of permalloy micro-pillar arrays with increasing lateral pitch and a mechatronic device to generate a cycling magnetic-field. Particles with higher IOC separate and equilibrate along the miro-pillar array at larger pitches. We develop a semi-analytical model that predicts behavior for particles and cells. Using the system, LNCaP cells were separated based on the bound quantity of 1μm anti-EpCAM particles as a metric for expression. The ratcheting cytometry system was able to resolve a ±13 bound particle differential, successfully distinguishing LNCaP from PC3 populations based on EpCAM expression, correlating with flow cytometry analysis. As a proof of concept, EpCAM-labeled cells from patient blood were isolated with 74% purity, demonstrating potential towards a quantitative magnetic separation instrument. PMID:26890496

  18. Quantitative Magnetic Separation of Particles and Cells Using Gradient Magnetic Ratcheting.

    PubMed

    Murray, Coleman; Pao, Edward; Tseng, Peter; Aftab, Shayan; Kulkarni, Rajan; Rettig, Matthew; Di Carlo, Dino

    2016-04-13

    Extraction of rare target cells from biosamples is enabling for life science research. Traditional rare cell separation techniques, such as magnetic activated cell sorting, are robust but perform coarse, qualitative separations based on surface antigen expression. A quantitative magnetic separation technology is reported using high-force magnetic ratcheting over arrays of magnetically soft micropillars with gradient spacing, and the system is used to separate and concentrate magnetic beads based on iron oxide content (IOC) and cells based on surface expression. The system consists of a microchip of permalloy micropillar arrays with increasing lateral pitch and a mechatronic device to generate a cycling magnetic field. Particles with higher IOC separate and equilibrate along the miropillar array at larger pitches. A semi-analytical model is developed that predicts behavior for particles and cells. Using the system, LNCaP cells are separated based on the bound quantity of 1 μm anti-epithelial cell adhesion molecule (EpCAM) particles as a metric for expression. The ratcheting cytometry system is able to resolve a ±13 bound particle differential, successfully distinguishing LNCaP from PC3 populations based on EpCAM expression, correlating with flow cytometry analysis. As a proof-of-concept, EpCAM-labeled cells from patient blood are isolated with 74% purity, demonstrating potential toward a quantitative magnetic separation instrument. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Small lasers in flow cytometry.

    PubMed

    Telford, William G

    2004-01-01

    Laser technology has made tremendous advances in recent years, particularly in the area of diode and diode-pumped solid state sources. Flow cytometry has been a direct beneficiary of these advances, as these small, low-maintenance, inexpensive lasers with reasonable power outputs are integrated into flow cytometers. In this chapter we review the contribution and potential of solid-state lasers to flow cytometry, and show several examples of these novel sources integrated into production flow cytometers. Technical details and critical parameters for successful application of these lasers for biomedical analysis are reviewed.

  20. Effect of twist on transverse impact response of ballistic fiber yarns

    DOE PAGES

    Song, Bo; Lu, Wei -Yang

    2015-06-15

    A Hopkinson bar was employed to conduct transverse impact testing of twisted Kevlar KM2 fiber yarns at the same impact speed. The speed of Euler transverse wave generated by the impact was measured utilizing a high speed digital camera. The study included fiber yarns twisted by different amounts. The Euler transverse wave speed was observed to increase with increasing amount of twist of the fiber yarn, within the range of this investigation. As a result, the higher transverse wave speeds in the more twisted fiber yarns indicate better ballistic performance in soft body armors for personal protection.

  1. Cerclage handling for improved fracture treatment. A biomechanical study on the twisting procedure.

    PubMed

    Wähnert, D; Lenz, M; Schlegel, U; Perren, S; Windolf, M

    2011-01-01

    Twisting is clinically the most frequently applied method for tightening and maintaining cerclage fixation. The twisting procedure is controversially discussed. Several factors during twisting affect the mechanical behaviour of the cerclage. This in vitro study investigated the influence of different parameters of the twisting procedure on the fixation strength of the cerclage in an experimental setup with centripetal force application. Cortical half shells of the femoral shaft were mounted on a testing fixture. 1.0 mm, 1.25 mm and 1.5 mm stainless ste- el wire cerclages as well as a 1.0mm cable cerclage were applied to the bone. Pretension of the cerclage during the installation was measured during the locking procedure. Subsequently, cyclic testing was performed up to failure. Higher pretension could be achieved with increasing wire diameter. However, with larger wire diameter the drop of pre- tension due to the bending and cutting the twist also increased. The cable cerclage showed the highest pretension after locking. Cerclages twisted under traction revealed significantly higher initial cerclage tension. Plastically deformed twists offered higher cerclage pretension compared to twists which were deformed in the elastic region of the material. Cutting the wire within the twist caused the highest loss of cerclage tension (44% initial tension) whereas only 11 % was lost when cutting the wire ends separately. The bending direction of the twist significantly influenced the cerclage pretension. 45% pretension was lost in forward bending of the twist, 53% in perpendicular bending and 90% in backward bending. Several parameters affect the quality of a cerclage fixation. Adequate installation of cerclage wires could markedly improve the clinical outcome of cerclage.

  2. Topological entanglement entropy with a twist.

    PubMed

    Brown, Benjamin J; Bartlett, Stephen D; Doherty, Andrew C; Barrett, Sean D

    2013-11-27

    Defects in topologically ordered models have interesting properties that are reminiscent of the anyonic excitations of the models themselves. For example, dislocations in the toric code model are known as twists and possess properties that are analogous to Ising anyons. We strengthen this analogy by using the topological entanglement entropy as a diagnostic tool to identify properties of both defects and excitations in the toric code. Specifically, we show, through explicit calculation, that the toric code model including twists and dyon excitations has the same quantum dimensions, the same total quantum dimension, and the same fusion rules as an Ising anyon model.

  3. AKT-ions with a TWIST between EMT and MET.

    PubMed

    Tang, Huifang; Massi, Daniela; Hemmings, Brian A; Mandalà, Mario; Hu, Zhengqiang; Wicki, Andreas; Xue, Gongda

    2016-09-20

    The transcription factor Twist is an important regulator of cranial suture during embryogenesis. Closure of the neural tube is achieved via Twist-triggered cellular transition from an epithelial to mesenchymal phenotype, a process known as epithelial-mesenchymal transition (EMT), characterized by a remarkable increase in cell motility. In the absence of Twist activity, EMT and associated phenotypic changes in cell morphology and motility can also be induced, albeit moderately, by other transcription factor families, including Snail and Zeb. Aberrant EMT triggered by Twist in human mammary tumour cells was first reported to drive metastasis to the lung in a metastatic breast cancer model. Subsequent analysis of many types of carcinoma demonstrated overexpression of these unique EMT transcription factors, which statistically correlated with worse outcome, indicating their potential as biomarkers in the clinic. However, the mechanisms underlying their activation remain unclear. Interestingly, increasing evidence indicates they are selectively activated by distinct intracellular kinases, thereby acting as downstream effectors facilitating transduction of cytoplasmic signals into nucleus and reprogramming EMT and mesenchymal-epithelial transition (MET) transcription to control cell plasticity. Understanding these relationships and emerging data indicating differential phosphorylation of Twist leads to complex and even paradoxical functionalities, will be vital to unlocking their potential in clinical settings.

  4. Conductive sub-layer of twisted-tape-induced swirl-flow heat transfer in vertical circular tubes with various twisted-tape inserts

    NASA Astrophysics Data System (ADS)

    Hata, K.; Fukuda, K.; Masuzaki, S.

    2018-04-01

    Twisted-tape-induced swirl-flow heat transfer due to exponentially increasing heat inputs with various exponential periods ( Q = Q 0 exp(t/τ), τ = 6.04 to 23.07 s) and twisted-tape-induced pressure drop was systematically measured for various mass velocities ( G = 4115 to 13,656 kg/m2 s), inlet liquid temperatures ( T in = 285.88 to 299.09 K), and inlet pressures ( P in = 847.45 to 943.29 kPa) using an experimental water loop flow. Measurements were made over a 59.2-mm effective length and three sections (upper, middle, and lower positions), within which four potential taps were spot-welded onto the outer surface of a 6-mm-inner-diameter, 69.6-mm-heated length, 0.4-mm-thickness platinum circular test tube. Type SUS304 twisted tapes with a width w = 5.6 mm, a thickness δ T = 0.6 mm, a total length l = 372 mm, and twist ratios y = 2.39 and 4.45 were employed in this study. The RANS equations (Reynolds Averaged Navier-Stokes Simulation) with a k-ɛ turbulence model for a circular tube 6 mm in diameter and 636 mm in length were numerically solved for heating of water with a heated section 6 mm in diameter and 70 mm in length using the CFD code, under the same conditions as the experimental ones and considering the temperature dependence of the thermo-physical properties concerned. The theoretical values of surface heat flux q on the circular tubes with twisted tapes with twist ratios y of 2.39 and 4.45 were found to be almost in agreement with the corresponding experimental values of heat flux q, with deviations of less than 30% for the range of temperature difference between the average heater inner surface temperature and the liquid bulk mean temperature ΔT L [ = T s,av - T L , T L = ( T in + T out )/2] considered in this study. The theoretical values of the local surface temperature T s , local average liquid temperature T f,av , and local liquid pressure drop ΔP x were found to be within almost 15% of the corresponding experimental ones. The thickness of the

  5. Sox5 induces epithelial to mesenchymal transition by transactivation of Twist1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pei, Xin-Hong; Department of Pathology, The Basic Medical College of Zhengzhou University, Zhengzhou, Henan; Lv, Xin-Quan

    2014-03-28

    Highlights: • Depletion of Sox5 inhibits breast cancer proliferation, migration, and invasion. • Sox5 transactivates Twist1 expression. • Sox5 induces epithelial to mesenchymal transition through transactivation of Twist1 expression. - Abstract: The epithelial to mesenchymal transition (EMT), a highly conserved cellular program, plays an important role in normal embryogenesis and cancer metastasis. Twist1, a master regulator of embryonic morphogenesis, is overexpressed in breast cancer and contributes to metastasis by promoting EMT. In exploring the mechanism underlying the increased Twist1 in breast cancer cells, we found that the transcription factor SRY (sex-determining region Y)-box 5(Sox5) is up-regulation in breast cancer cellsmore » and depletion of Sox5 inhibits breast cancer cell proliferation, migration, and invasion. Furthermore, depletion of Sox5 in breast cancer cells caused a dramatic decrease in Twist1 and chromosome immunoprecipitation assay showed that Sox5 can bind directly to the Twist1 promoter, suggesting that Sox5 transactivates Twist1 expression. We further demonstrated that knockdown of Sox5 up-regulated epithelial phenotype cell biomarker (E-cadherin) and down-regulated mesenchymal phenotype cell biomarkers (N-cadherin, Vimentin, and Fibronectin 1), resulting in suppression of EMT. Our study suggests that Sox5 transactivates Twist1 expression and plays an important role in the regulation of breast cancer progression.« less

  6. ggCyto: Next Generation Open-Source Visualization Software for Cytometry.

    PubMed

    Van, Phu; Jiang, Wenxin; Gottardo, Raphael; Finak, Greg

    2018-06-01

    Open source software for computational cytometry has gained in popularity over the past few years. Efforts such as FlowCAP, the Lyoplate and Euroflow projects have highlighted the importance of efforts to standardize both experimental and computational aspects of cytometry data analysis. The R/BioConductor platform hosts the largest collection of open source cytometry software covering all aspects of data analysis and providing infrastructure to represent and analyze cytometry data with all relevant experimental, gating, and cell population annotations enabling fully reproducible data analysis. Data visualization frameworks to support this infrastructure have lagged behind. ggCyto is a new open-source BioConductor software package for cytometry data visualization built on ggplot2 that enables ggplot-like functionality with the core BioConductor flow cytometry data structures. Amongst its features are the ability to transform data and axes on-the-fly using cytometry-specific transformations, plot faceting by experimental meta-data variables, and partial matching of channel, marker and cell populations names to the contents of the BioConductor cytometry data structures. We demonstrate the salient features of the package using publicly available cytometry data with complete reproducible examples in a supplementary material vignette. https://bioconductor.org/packages/devel/bioc/html/ggcyto.html. gfinak@fredhutch.org. Supplementary data are available at Bioinformatics online and at http://rglab.org/ggcyto/.

  7. Magnetic reconnection during eruptive magnetic flux ropes

    NASA Astrophysics Data System (ADS)

    Mei, Z. X.; Keppens, R.; Roussev, I. I.; Lin, J.

    2017-08-01

    Aims: We perform a three-dimensional (3D) high resolution numerical simulation in isothermal magnetohydrodynamics to study the magnetic reconnection process in a current sheet (CS) formed during an eruption of a twisted magnetic flux rope (MFR). Because the twist distribution violates the Kruskal-Shafranov condition, the kink instability occurs, and the MFR is distorted. The centre part of the MFR loses its equilibrium and erupts upward, which leads to the formation of a 3D CS underneath it. Methods: In order to study the magnetic reconnection inside the CS in detail, mesh refinement has been used to reduce the numerical diffusion and we estimate a Lundquist number S = 104 in the vicinity of the CS. Results: The refined mesh allows us to resolve fine structures inside the 3D CS: a bifurcating sheet structure signaling the 3D generalization of Petschek slow shocks, some distorted-cylindrical substructures due to the tearing mode instabilities, and two turbulence regions near the upper and the lower tips of the CS. The topological characteristics of the MFR depend sensitively on the observer's viewing angle: it presents as a sigmoid structure, an outwardly expanding MFR with helical distortion, or a flare-CS-coronal mass ejection symbiosis as in 2D flux-rope models when observed from the top, the front, or the side. The movie associated to Fig. 2 is available at http://www.aanda.org

  8. Do twisted laser beams evoke nuclear hyperpolarization?

    PubMed

    Schmidt, A B; Andrews, D L; Rohrbach, A; Gohn-Kreuz, C; Shatokhin, V N; Kiselev, V G; Hennig, J; von Elverfeldt, D; Hövener, J-B

    2016-07-01

    The hyperpolarization of nuclear spins promises great advances in chemical analysis and medical diagnosis by substantially increasing the sensitivity of nuclear magnetic resonance (NMR). Current methods to produce a hyperpolarized sample, however, are arduous, time-consuming or costly and require elaborate equipment. Recently, a much simpler approach was introduced that holds the potential, if harnessed appropriately, to revolutionize the production of hyperpolarized spins. It was reported that high levels of hyperpolarization in nuclear spins can be created by irradiation with a laser beam carrying orbital angular momentum (twisted light). Aside from these initial reports however, no further experimental verification has been presented. In addition, this effect has so far evaded a critical theoretical examination. In this contribution, we present the first independent attempt to reproduce the effect. We exposed a sample of immersion oil or a fluorocarbon liquid that was placed within a low-field NMR spectrometer to Laguerre-Gaussian and Bessel laser beams at a wavelength of 514.5nm and various topological charges. We acquired (1)H and (19)F NMR free induction decay data, either during or alternating with the irradiation that was parallel to B0. We observed an irregular increase in NMR signal in experiments where the sample was exposed to beams with higher values of the topological charge. However, at no time did the effect reach statistical significance of 95%. Given the measured sensitivity of our setup, we estimate that a possible effect did not exceed a hyperpolarization (at 5mT) of 0.14-6%, depending on the assumed hyperpolarized volume. It should be noted though, that there were some differences between our setup and the previous implementation of the experiment, which may have inhibited the full incidence of this effect. To approach a theoretical description of this effect, we considered the interaction of an electron with a plane wave, which is known to be

  9. Extension-twist coupling of composite circular tubes with application to tilt rotor blade design

    NASA Technical Reports Server (NTRS)

    Nixon, Mark W.

    1987-01-01

    This investigation was conducted to determine if twist deformation required for the design of full-scale extension-twist-coupled tilt-rotor blades can be achieved within material design limit loads, and to demonstrate the accuracy of a coupled-beam analysis in predicting twist deformations. Two extension-twist-coupled tilt-rotor blade designs were developed based on theoretically optimum aerodynamic twist distributions. The designs indicated a twist rate requirement of between .216 and .333 deg/in. Agreement between axial tests and analytical predictions was within 10 percent at design limit loads. Agreement between the torsion tests and predictions was within 11 percent.

  10. Photo-switchable bistable twisted nematic liquid crystal optical switch.

    PubMed

    Wang, Chun-Ta; Wu, Yueh-Chi; Lin, Tsung-Hsien

    2013-02-25

    This work demonstrates a photo-switchable bistable optical switch that is based on an azo-chiral doped liquid crystal (ACDLC). The photo-induced isomerization of the azo-chiral dopant can change the chirality of twisted nematic liquid crystal and the gap/pitch ratio of an ACDLC device, enabling switching between 0° and 180° twist states in a homogeneous aligned cell. The bistable 180° and 0° twist states of the azo-chiral doped liquid crystal between crossed polarizers correspond to the ON and OFF states of a light shutter, respectively, and they can be maintained stably for tens of hours. Rapid switching between 180° and 0° twist states can be carried out using 408 and 532 nm addressing light. Such a photo-controllable optical switch requires no specific asymmetric alignment layer or precise control of the cell gap/pitch ratio, so it is easily fabricated and has the potential for use in optical systems.

  11. Geometric Constraints and the Anatomical Interpretation of Twisted Plant Organ Phenotypes

    PubMed Central

    Weizbauer, Renate; Peters, Winfried S.; Schulz, Burkhard

    2011-01-01

    The study of plant mutants with twisting growth in axial organs, which normally grow straight in the wild-type, is expected to improve our understanding of the interplay among microtubules, cellulose biosynthesis, cell wall structure, and organ biomechanics that control organ growth and morphogenesis. However, geometric constraints based on symplastic growth and the consequences of these geometric constraints concerning interpretations of twisted-organ phenotypes are currently underestimated. Symplastic growth, a fundamental concept in plant developmental biology, is characterized by coordinated growth of adjacent cells based on their connectivity through cell walls. This growth behavior implies that in twisting axial organs, all cell files rotate in phase around the organ axis, as has been illustrated for the Arabidopsis spr1 and twd1 mutants in this work. Evaluating the geometry of such organs, we demonstrate that a radial gradient in cell elongation and changes in cellular growth anisotropy must occur in twisting organs out of geometric necessity alone. In-phase rotation of the different cell layers results in a decrease of length and angle toward organ axis from the outer cell layers inward. Additionally, the circumference of each cell layer increases in twisting organs, which requires compensation through radial expansion or an adjustment of cell number. Therefore, differential cell elongation and growth anisotropy cannot serve as arguments for or against specific hypotheses regarding the molecular cause of twisting growth. We suggest instead, that based on mathematical modeling, geometric constraints in twisting organs are indispensable for the explanation of the causal connection of molecular and biomechanical processes in twisting as well as normal organs. PMID:22645544

  12. MAVEN observations of complex magnetic field topology in the Martian magnetotail

    NASA Astrophysics Data System (ADS)

    DiBraccio, Gina A.; Espley, Jared R.; Luhmann, Janet G.; Curry, Shannon M.; Gruesbeck, Jacob R.; Connerney, John E. P.; Soobiah, Yasir; Xu, Shaosui; Mitchell, David M.; Harada, Yuki; Halekas, Jasper S.; Brain, David A.; Dong, Chuanfei; Hara, Takuya; Jakosky, Bruce M.

    2017-04-01

    MAVEN observations have revealed an unexpectedly complex magnetic field configuration in the magnetotail of Mars. This planetary magnetotail forms as the solar wind interacts with the Martian upper atmosphere and the interplanetary magnetic field (IMF) drapes around the planet. This interaction is classically defined as an induced magnetosphere similar to the plasma environments of Venus and comets. However, unlike at these induced magnetic environments, Mars is complicated by the existence of crustal magnetic fields, which are able to reconnect with the IMF to produce open magnetic fields. Preliminary magnetohydrodynamic simulation results have suggested that this magnetic reconnection may be responsible for creating a hybrid magnetotail configuration between intrinsic and induced magnetospheres. This hybrid tail is composed of the closed planetary fields, draped IMF, and two distinct lobes of open magnetic fields. More importantly, these open lobes appear to be twisted by roughly 45°, either clockwise or counterclockwise, from the ecliptic plane with a strong dependence on the east-west component of the IMF and negligible influence from crustal field orientation. To explore this unexpected twisted-tail configuration, we analyze MAVEN Magnetometer (MAG) and Solar Wind Ion Analyzer (SWIA) data to examine magnetic field topology in the Martian magnetotail. We compare the average magnetic field orientation, directed toward and away from the planet, for a variety of solar wind parameters at various downtail distances. We conclude that the east-west IMF component strongly affects the magnetotail structure, as predicted by simulations. Furthermore, these data reveal that the tail lobes are indeed twisted, which we infer based on model results, to be regions of open magnetic fields that are likely reconnected crustal fields. These MAVEN observations confirm that the Martian magnetotail has a hybrid configuration between an intrinsic and induced magnetosphere, shifting

  13. Precision Measurement of the Neutron Twist-3 Matrix Element dn2: Probing Color Forces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Posik, Matthew; Flay, David; Parno, Diana

    2014-07-01

    Double-spin asymmetries and absolute cross sections were measured at large Bjorken x (0.25 lte x lte 0.90), in both the deep-inelastic and resonance regions, by scattering longitudinally polarized electrons at beam energies of 4.7 and 5.9 GeV from a transversely and longitudinally polarized 3He target. In this dedicated experiment, the spin structure function g2 on 3He was determined with precision at large x, and the neutron twist-three matrix element dn2 was measured at ?Q2? of 3.21 and 4.32 GeV2/c2, with an absolute precision of about 10?5. Our results are found to be in agreement with lattice QCD calculations and resolvemore » the disagreement found with previous data at ?Q2?= 5 GeV2/c2. Combining dn2 and a newly extracted twist-four matrix element, fn2, the average neutron color electric and magnetic forces were extracted and found to be of opposite sign and about 60 MeV/fm in magnitude.« less

  14. Twisting solar coronal jet launched at the boundary of an active region

    NASA Astrophysics Data System (ADS)

    Schmieder, B.; Guo, Y.; Moreno-Insertis, F.; Aulanier, G.; Yelles Chaouche, L.; Nishizuka, N.; Harra, L. K.; Thalmann, J. K.; Vargas Dominguez, S.; Liu, Y.

    2013-11-01

    Aims: A broad jet was observed in a weak magnetic field area at the edge of active region NOAA 11106 that also produced other nearby recurring and narrow jets. The peculiar shape and magnetic environment of the broad jet raised the question of whether it was created by the same physical processes of previously studied jets with reconnection occurring high in the corona. Methods: We carried out a multi-wavelength analysis using the EUV images from the Atmospheric Imaging Assembly (AIA) and magnetic fields from the Helioseismic and Magnetic Imager (HMI) both on-board the Solar Dynamics Observatory, which we coupled to a high-resolution, nonlinear force-free field extrapolation. Local correlation tracking was used to identify the photospheric motions that triggered the jet, and time-slices were extracted along and across the jet to unveil its complex nature. A topological analysis of the extrapolated field was performed and was related to the observed features. Results: The jet consisted of many different threads that expanded in around 10 minutes to about 100 Mm in length, with the bright features in later threads moving faster than in the early ones, reaching a maximum speed of about 200 km s-1. Time-slice analysis revealed a striped pattern of dark and bright strands propagating along the jet, along with apparent damped oscillations across the jet. This is suggestive of a (un)twisting motion in the jet, possibly an Alfvén wave. Bald patches in field lines, low-altitude flux ropes, diverging flow patterns, and a null point were identified at the basis of the jet. Conclusions: Unlike classical λ or Eiffel-tower-shaped jets that appear to be caused by reconnection in current sheets containing null points, reconnection in regions containing bald patches seems to be crucial in triggering the present jet. There is no observational evidence that the flux ropes detected in the topological analysis were actually being ejected themselves, as occurs in the violent phase of

  15. Composite material bend-twist coupling for wind turbine blade applications

    NASA Astrophysics Data System (ADS)

    Walsh, Justin M.

    Current efforts in wind turbine blade design seek to employ bend-twist coupling of composite materials for passive power control by twisting blades to feather. Past efforts in this area of study have proved to be problematic, especially in formulation of the bend-twist coupling coefficient alpha. Kevlar/epoxy, carbon/epoxy and glass/epoxy specimens were manufactured to study bend-twist coupling, from which numerical and analytical models could be verified. Finite element analysis was implemented to evaluate fiber orientation and material property effects on coupling magnitude. An analytical/empirical model was then derived to describe numerical results and serve as a replacement for the commonly used coupling coefficient alpha. Through the results from numerical and analytical models, a foundation for aeroelastic design of wind turbines blades utilizing biased composite materials is provided.

  16. Wear characteristics of UHMW polyethylene by twist method

    NASA Astrophysics Data System (ADS)

    Chișiu, G.; Popescu, A. M.; Tudor, A.; Petrescu, A. M.; Stoica, G. F.; Subhi, K. A.

    2018-01-01

    A wear test of the twist movement was performed as a new method to estimate the in vivo wear behavior of an acetabular cup material for total knee replacements. A series of UHMWPE samples was used to evaluate the dynamic coefficient of friction in twist movement in contact with steel. The experimental data were conducted to validate the related theoretical model developed in the present study.

  17. Chirality-controlled spontaneous twisting of crystals due to thermal topochemical reaction.

    PubMed

    Rai, Rishika; Krishnan, Baiju P; Sureshan, Kana M

    2018-03-20

    Crystals that show mechanical response against various stimuli are of great interest. These stimuli induce polymorphic transitions, isomerizations, or chemical reactions in the crystal and the strain generated between the daughter and parent domains is transcribed into mechanical response. We observed that the crystals of modified dipeptide LL (N 3 -l-Ala-l-Val-NHCH 2 C≡CH) undergo spontaneous twisting to form right-handed twisted crystals not only at room temperature but also at 0 °C over time. Using various spectroscopic techniques, we have established that the twisting is due to the spontaneous topochemical azide-alkyne cycloaddition (TAAC) reaction at room temperature or lower temperatures. The rate of twisting can be increased by heating, exploiting the faster kinetics of the TAAC reaction at higher temperatures. To address the role of molecular chirality in the direction of twisting the enantiomer of dipeptide LL, N 3 -d-Ala-d-Val-NHCH 2 C≡CH (DD), was synthesized and topochemical reactivity and mechanoresponse of its crystals were studied. We have found that dipeptide DD not only underwent TAAC reaction, giving 1,4-triazole-linked pseudopolypeptides of d-amino acids, but also underwent twisting with opposite handedness (left-handed twisting), establishing the role of molecular chirality in controlling the direction of mechanoresponse. This paper reports ( i ) a mechanical response due to a thermal reaction and ( ii ) a spontaneous mechanical response in crystals and ( iii ) explains the role of molecular chirality in the handedness of the macroscopic mechanical response.

  18. Raman spectroscopy measurement of bilayer graphene's twist angle to boron nitride

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Bin; Wang, Peng; Pan, Cheng

    2015-07-20

    When graphene is placed on hexagonal boron nitride with a twist angle, new properties develop due to the resulting moiré superlattice. Here, we report a method using Raman spectroscopy to make rapid, non-destructive measurements of the twist angle between bilayer graphene and hexagonal boron nitride. The lattice orientation is determined by using flakes with both bilayer and monolayer regions, and using the known Raman signature for the monolayer to measure the twist angle of the entire flake. The widths of the second order Raman peaks are found to vary linearly in the superlattice period and are used to determine themore » twist angle. The results are confirmed by using transport measurements to infer the superlattice period by the charge density required to reach the secondary resistance peaks. Small twist angles are also found to produce a significant modification of the first order Raman G band peak.« less

  19. Kinetic study of ion acoustic twisted waves with kappa distributed electrons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arshad, Kashif, E-mail: kashif.arshad.butt@gmail.com; Aman-ur-Rehman, E-mail: amansadiq@gmail.com; Mahmood, Shahzad, E-mail: shahzadm100@gmail.com

    2016-05-15

    The kinetic theory of Landau damping of ion acoustic twisted modes is developed in the presence of orbital angular momentum of the helical (twisted) electric field in plasmas with kappa distributed electrons and Maxwellian ions. The perturbed distribution function and helical electric field are considered to be decomposed by Laguerre-Gaussian mode function defined in cylindrical geometry. The Vlasov-Poisson equation is obtained and solved analytically to obtain the weak damping rates of the ion acoustic twisted waves in a non-thermal plasma. The strong damping effects of ion acoustic twisted waves at low values of temperature ratio of electrons and ions aremore » also obtained by using exact numerical method and illustrated graphically, where the weak damping wave theory fails to explain the phenomenon properly. The obtained results of Landau damping rates of the twisted ion acoustic wave are discussed at different values of azimuthal wave number and non-thermal parameter kappa for electrons.« less

  20. Bend-Twist Coupled Carbon-Fiber Laminate Beams: Fundamental Behavior and Applications

    NASA Astrophysics Data System (ADS)

    Babuska, Pavel

    Material-induced bend-twist coupling in laminated composite beams has seen applications in engineered structures for decades, ranging from airplane wings to turbine blades. Symmetric, unbalanced, carbon fiber laminates which exhibit bend-twist coupling can be difficult to characterize and exhibit unintuitive deformation states which may pose challenges to the engineer. In this thesis, bend-twist coupled beams are investigated comprehensively, by experimentation, numerical modeling, and analytical methods. Beams of varying fiber angle and amount of coupling were manufactured and physically tested in both linear and nonlinear static and dynamic settings. Analytical mass and stiffness matrices were derived for the development of a beam element to use in the stiffness matrix analysis method. Additionally, an ABAQUS finite element model was used in conjunction with the analytical methods to predict and further characterize the behavior of the beams. The three regimes, experimental, analytical, and numerical, represent a full-field characterization of bend-twist coupling in composite beams. A notable application of bend-twist coupled composites is for passively adaptive turbine blades whereby the deformation coupling can be built into the blade structure to simultaneously bend and twist, thus pitching the blade into or away from the fluid flow, changing the blade angle of attack. Passive pitch adaptation has been implemented successfully in wind turbine blades, however, for marine turbine blades, the technology is still in the development phase. Bend-twist coupling has been shown numerically to be beneficial to the tidal turbine performance, however little validation has been conducted in the experimental regime. In this thesis, passively adaptive experiment scale tidal turbine blades were designed, analyzed, manufactured, and physically tested, validating the foundational numerical work. It was shown that blade forces and root moments as well as turbine thrust and power

  1. Twist promotes tumor metastasis in basal-like breast cancer by transcriptionally upregulating ROR1.

    PubMed

    Cao, Jingying; Wang, Xin; Dai, Tao; Wu, Yuanzhong; Zhang, Meifang; Cao, Renxian; Zhang, Ruhua; Wang, Gang; Jiang, Rou; Zhou, Binhua P; Shi, Jian; Kang, Tiebang

    2018-01-01

    Rationale: Twist is a key transcription factor for induction of epithelial-mesenchymal transition (EMT), which promotes cell migration, invasion, and cancer metastasis, confers cancer cells with stem cell-like characteristics, and provides therapeutic resistance. However, the functional roles and targeted genes of Twist in EMT and cancer progression remain elusive. Methods: The potential targeted genes of Twist were identified from the global transcriptomes of T47D/Twist cells by microarray analysis. EMT phenotype was detected by western blotting and immunofluorescence of marker proteins. The dual-luciferase reporter and chromatin immunoprecipitation assays were employed to observe the direct transcriptional induction of ROR1 by Twist. A lung metastasis model was used to study the pro-metastatic role of Twist and ROR1 by injecting MDA-MB-231 cells into tail vein of nude mice. Bio-informatics analysis was utilized to measure the metastasis-free survival of breast cancer patients. Results: Twist protein was proved to directly activate the transcription of ROR1 gene, a receptor of Wnt5a in non-canonical WNT signaling pathway. Silencing of ROR1 inhibited EMT process, cell migration, invasion, and cancer metastasis of basal-like breast cancer (BLBC) cells. Knockdown of ROR1 also ameliorated the pro-metastatic effect of Twist. Furthermore, analyses of clinical specimens indicated that high expression of both ROR1 and Twist tightly correlates with poor metastasis-free survival of breast cancer patients. Conclusion: ROR1 is a targeted gene of Twist. Twist/ROR1 signaling is critical for invasion and metastasis of BLBC cells.

  2. A Geometric Construction of Cyclic Cocycles on Twisted Convolution Algebras

    NASA Astrophysics Data System (ADS)

    Angel, Eitan

    2010-09-01

    In this thesis we give a construction of cyclic cocycles on convolution algebras twisted by gerbes over discrete translation groupoids. In his seminal book, Connes constructs a map from the equivariant cohomology of a manifold carrying the action of a discrete group into the periodic cyclic cohomology of the associated convolution algebra. Furthermore, for proper étale groupoids, J.-L. Tu and P. Xu provide a map between the periodic cyclic cohomology of a gerbe twisted convolution algebra and twisted cohomology groups. Our focus will be the convolution algebra with a product defined by a gerbe over a discrete translation groupoid. When the action is not proper, we cannot construct an invariant connection on the gerbe; therefore to study this algebra, we instead develop simplicial notions related to ideas of J. Dupont to construct a simplicial form representing the Dixmier-Douady class of the gerbe. Then by using a JLO formula we define a morphism from a simplicial complex twisted by this simplicial Dixmier-Douady form to the mixed bicomplex of certain matrix algebras. Finally, we define a morphism from this complex to the mixed bicomplex computing the periodic cyclic cohomology of the twisted convolution algebras.

  3. Finite element and analytical models for twisted and coiled actuator

    NASA Astrophysics Data System (ADS)

    Tang, Xintian; Liu, Yingxiang; Li, Kai; Chen, Weishan; Zhao, Jianguo

    2018-01-01

    Twisted and coiled actuator (TCA) is a class of recently discovered artificial muscle, which is usually made by twisting and coiling polymer fibers into spring-like structures. It has been widely studied since discovery due to its impressive output characteristics and bright prospects. However, its mathematical models describing the actuation in response to the temperature are still not fully developed. It is known that the large tensile stroke is resulted from the untwisting of the twisted fiber when heated. Thus, the recovered torque during untwisting is a key parameter in the mathematical model. This paper presents a simplified model for the recovered torque of TCA. Finite element method is used for evaluating the thermal stress of the twisted fiber. Based on the results of the finite element analyses, the constitutive equations of twisted fibers are simplified to develop an analytic model of the recovered torque. Finally, the model of the recovered torque is used to predict the deformation of TCA under varying temperatures and validated against experimental results. This work will enhance our understanding of the deformation mechanism of TCAs, which will pave the way for the closed-loop position control.

  4. Near infrared lasers in flow cytometry.

    PubMed

    Telford, William G

    2015-07-01

    Technology development in flow cytometry has closely tracked laser technology, the light source that flow cytometers almost exclusively use to excite fluorescent probes. The original flow cytometers from the 1970s and 1980s used large water-cooled lasers to produce only one or two laser lines at a time. Modern cytometers can take advantage of the revolution in solid state laser technology to use almost any laser wavelength ranging from the ultraviolet to the near infrared. Commercial cytometers can now be equipped with many small solid state lasers, providing almost any wavelength needed for cellular analysis. Flow cytometers are now equipped to analyze 20 or more fluorescent probes simultaneously, requiring multiple laser wavelengths. Instrument developers are now trying to increase this number by designing fluorescent probes that can be excited by laser wavelength at the "edges" of the visible light range, in the near ultraviolet and near-infrared region. A variety of fluorescent probes have been developed that excite with violet and long wavelength ultraviolet light; however, the near-infrared range (660-800 nm) has yet seen only exploitation in flow cytometry. Fortunately, near-infrared laser diodes and other solid state laser technologies appropriate for flow cytometry have been in existence for some time, and can be readily incorporated into flow cytometers to accelerate fluorescent probe development. The near infrared region represents one of the last "frontiers" to maximize the number of fluorescent probes that can be analyzed by flow cytometry. In addition, near infrared fluorescent probes used in biomedical tracking and imaging could also be employed for flow cytometry with the correct laser wavelengths. This review describes the available technology, including lasers, fluorescent probes and detector technology optimal for near infrared signal detection. Published by Elsevier Inc.

  5. Magnetic Characterization of Micro Shutters for James Web Space Telescope (JWST)

    NASA Technical Reports Server (NTRS)

    Wasilewski, P. (Technical Monitor); Kletetschka, Gunther

    2005-01-01

    Summary of Research that was part of the grant: NASA NAG5 - 13405: Magnetic Characterization of Micro Shutters for James Web Space Telescope (JWST) Period: May 1 2003-October 31 2005 The above funding resulted in following major achievements related to microshutter system for JWST. 1. The original rectangular pattern of magnetic material was changed into magnetic striped pattern to prevent unnecessary twisting during the actuation. The Original geometry favored magnetic remanence vector being oriented along the longer side of the shutter and thus resulting torque caused out of plane twist. Stripe pattern minimizes the out of plane motion and thus prolongs the life-time of microshutter device. 2. We built a new magnetic system (magnetic rotisserie) allowing an accelerated life test of microshutters at various temperatures. This system identified that shutter are capable to withstand as many as several millions of actuating cycles. Our system also identified fabrication related features, like bowing with temperature, collisions with the frame due to misalignment, delaminating of the light shields due to uncontrolled voltage release and poorly fabricated light shields.

  6. Dynamical and fractal properties in periodically forced stretch-twist-fold (STF) flow

    NASA Astrophysics Data System (ADS)

    Aqeel, Muhammad; Ahmad, Salman; Azam, Anam; Ahmed, Faizan

    2017-05-01

    The periodically forced stretch-twist-fold (STF) flow is introduced in this article. The nonlinear behavior of the STF flow with periodic force along the y -axis is investigated analytically and numerically. The STF flow is a prototype of the dynamo theory that proposes a mechanism of magnetic field generation continuously. The stability analysis is done by Routh Huwritz criteria and Cardano method. Chasing chaos through numerical simulation is determined to demonstrate the chaotic behavior of the forced STF flow. With the help of fractal processes based on the forced STF flow, a multi-wing forced STF flow is obtained that gives a n -wing forced STF flow system.

  7. Experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers

    NASA Astrophysics Data System (ADS)

    Yin, Long-Jing; Qiao, Jia-Bin; Zuo, Wei-Jie; Li, Wen-Tian; He, Lin

    2015-08-01

    Non-Abelian gauge potentials are quite relevant in subatomic physics, but they are relatively rare in a condensed matter context. Here we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by scanning tunneling microscopy and spectroscopy. At a magic twisted angle, θ ≈(1.11±0.05 ) ∘ , a pronounced sharp peak, which arises from the nondispersive flat bands at the charge neutrality point, is observed in the tunneling density of states due to the action of the non-Abelian gauge fields. Moreover, we observe confined electronic states in the twisted bilayer, as manifested by regularly spaced tunneling peaks with energy spacing δ E ≈vF/D ≈70 meV (here vF is the Fermi velocity of graphene and D is the period of the moiré patterns). This indicates that the non-Abelian gauge potentials in twisted graphene bilayers confine low-energy electrons into a triangular array of quantum dots following the modulation of the moiré patterns. Our results also directly demonstrate that the Fermi velocity in twisted bilayers can be tuned from about 106m /s to zero by simply reducing the twisted angle of about 2∘.

  8. In Vivo Flow Cytometry: A Horizon of Opportunities

    PubMed Central

    Tuchin, Valery V.; Tárnok, Attila; Zharov, Vladimir P.

    2012-01-01

    Flow cytometry has been a fundamental tool of biological discovery for many years. Invasive extraction of cells from a living organism, however, may lead to changes in cell properties and prevents studying cells in their native environment. These problems can be overcome by use of in vivo flow cytometry which provides detection and imaging of circulating normal and abnormal cells directlyin blood or lymph flow. The goal of this mini-review is to provide a brief history, features and challenges of this new generation of flow cytometry methods and instruments. Spectrum of possibilities of in vivo flow cytometry in biological science (e.g., cell metabolism, immune function, or apoptosis) and medical fields (e.g., cancer, infection, cardiovascular disorder) including integrated photoacoustic-photothermal theranostics of circulating abnormal cells are discussed with focus on recent advances of this new platform. PMID:21915991

  9. A Transformation Called "Twist"

    ERIC Educational Resources Information Center

    Hwang, Daniel

    2010-01-01

    The transformations found in secondary mathematics curriculum are typically limited to stretches and translations (e.g., ACARA, 2010). Advanced students may find the transformation, twist, to be of further interest. As most available resources are written for professional-level readers, this article is intended to be an introduction accessible to…

  10. Twisted Quantum Lax Equations

    NASA Astrophysics Data System (ADS)

    Jurčo, Branislav; Schupp, Peter

    We show the construction of twisted quantum Lax equations associated with quantum groups, and solve these equations using factorization properties of the corresponding quantum groups. Our construction generalizes in many respects the AKS construction for Lie groups and the construction of M. A. Semenov-Tian-Shansky for the Lie-Poisson case.

  11. The magnetic non-equilibrium of buoyant flux tubes in the solar corona

    NASA Technical Reports Server (NTRS)

    Browning, P. K.; Priest, E. R.

    1984-01-01

    The magnetic field in the convection zone and photosphere of the sun exists mostly as concentrated tubes of magnetic flux. It is, therefore, necessary to study the basic properties of magnetic flux tubes to obtain a basis for understanding the behavior of the sun's magnetic field. The present investigation is concerned with the global equilibrium shape of a flux tube in the stratified solar atmosphere. A fundamental property of isolated flux tubes is magnetic buoyancy. Attention is given to flux tubes with external field, and twisted flux tubes. It is shown that the analysis of Parker (1975, 1979) and Spruit (1981) for calculating the equilibrium of a slender flux tube in a stratified atmosphere may be extended to more general situations. The slender tube approximation provides a method of solving the problem of modeling the overall curvature of flux tubes. It is found that for a twisted flux tube, there can be two possible equilibrium values of the height.

  12. TWIST1-WDR5-Hottip regulates Hoxa9 chromatin to facilitate prostate cancer metastasis

    PubMed Central

    Malek, Reem; Gajula, Rajendra P.; Williams, Russell D.; Nghiem, Belinda; Simons, Brian W.; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R.; True, Lawrence; An, Steven S.; DeWeese, Theodore L.; Ross, Ashley E.; Schaeffer, Edward M.; Pienta, Kenneth J.; Hurley, Paula J.; Morrissey, Colm; Tran, Phuoc T.

    2017-01-01

    TWIST1 is a transcription factor critical for development which can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are co-expressed in mouse prostate and then silenced post-natally. Here we report that TWIST1 and HOXA9 co-expression are re-activated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to co-enrichment of TWIST1 and WDR5 as well increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacological inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo. This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. PMID:28484075

  13. Optimal flapping wing for maximum vertical aerodynamic force in hover: twisted or flat?

    PubMed

    Phan, Hoang Vu; Truong, Quang Tri; Au, Thi Kim Loan; Park, Hoon Cheol

    2016-07-08

    This work presents a parametric study, using the unsteady blade element theory, to investigate the role of twist in a hovering flapping wing. For the investigation, a flapping-wing system was developed to create a wing motion of large flapping amplitude. Three-dimensional kinematics of a passively twisted wing, which is capable of creating a linearly variable geometric angle of attack (AoA) along the wingspan, was measured during the flapping motion and used for the analysis. Several negative twist or wash-out configurations with different values of twist angle, which is defined as the difference in the average geometric AoAs at the wing root and the wing tip, were obtained from the measured wing kinematics through linear interpolation and extrapolation. The aerodynamic force generation and aerodynamic power consumption of these twisted wings were obtained and compared with those of flat wings. For the same aerodynamic power consumption, the vertical aerodynamic forces produced by the negatively twisted wings are approximately 10%-20% less than those produced by the flat wings. However, these twisted wings require approximately 1%-6% more power than flat wings to produce the same vertical force. In addition, the maximum-force-producing twisted wing, which was found to be the positive twist or wash-in configuration, was used for comparison with the maximum-force-producing flat wing. The results revealed that the vertical aerodynamic force and aerodynamic power consumption of the two types of wings are almost identical for the hovering condition. The power loading of the positively twisted wing is only approximately 2% higher than that of the maximum-force-producing flat wing. Thus, the flat wing with proper wing kinematics (or wing rotation) can be regarded as a simple and efficient candidate for the development of hovering flapping-wing micro air vehicle.

  14. Design optimization for active twist rotor blades

    NASA Astrophysics Data System (ADS)

    Mok, Ji Won

    This dissertation introduces the process of optimizing active twist rotor blades in the presence of embedded anisotropic piezo-composite actuators. Optimum design of active twist blades is a complex task, since it involves a rich design space with tightly coupled design variables. The study presents the development of an optimization framework for active helicopter rotor blade cross-sectional design. This optimization framework allows for exploring a rich and highly nonlinear design space in order to optimize the active twist rotor blades. Different analytical components are combined in the framework: cross-sectional analysis (UM/VABS), an automated mesh generator, a beam solver (DYMORE), a three-dimensional local strain recovery module, and a gradient based optimizer within MATLAB. Through the mathematical optimization problem, the static twist actuation performance of a blade is maximized while satisfying a series of blade constraints. These constraints are associated with locations of the center of gravity and elastic axis, blade mass per unit span, fundamental rotating blade frequencies, and the blade strength based on local three-dimensional strain fields under worst loading conditions. Through pre-processing, limitations of the proposed process have been studied. When limitations were detected, resolution strategies were proposed. These include mesh overlapping, element distortion, trailing edge tab modeling, electrode modeling and foam implementation of the mesh generator, and the initial point sensibility of the current optimization scheme. Examples demonstrate the effectiveness of this process. Optimization studies were performed on the NASA/Army/MIT ATR blade case. Even though that design was built and shown significant impact in vibration reduction, the proposed optimization process showed that the design could be improved significantly. The second example, based on a model scale of the AH-64D Apache blade, emphasized the capability of this framework to

  15. Au-coated tilted fiber Bragg grating twist sensor based on surface plasmon resonance

    NASA Astrophysics Data System (ADS)

    Shen, Changyu; Zhang, Yang; Zhou, Wenjun; Albert, Jacques

    2014-02-01

    A fiber twist sensor based on the surface plasmon resonance (SPR) effect of an Au-coated tilted fiber Bragg grating (TFBG) is proposed. The SPR response to the twist effect on an Au-coated TFBG (immersing in distilled water) is studied theoretically and experimentally. The results show that the transmission power around the wavelength of SPR changes with the twist angle. For the twist ranging from 0° to 180° in clockwise or anti-clockwise directions, the proposed sensor shows sensitivities of 0.037 dBm/° (S-polarized) and 0.039 dBm/° (P-polarized), which are almost 7.5 times higher than that of the current similar existing twist sensor.

  16. New dualities and misleading anomaly matchings from outer-automorphism twists

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pal, Sridip; Song, Jaewon

    We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

  17. New dualities and misleading anomaly matchings from outer-automorphism twists

    DOE PAGES

    Pal, Sridip; Song, Jaewon

    2017-03-29

    We study four-dimensional N=1, 2 superconformal theories in class S obtained by compactifying the 6d N=(2, 0) theory on a Riemann surface C with outer-automorphism twist lines. From the pair-of-pants decompositions of C, we find various dual descriptions for the same theory having distinct gauge groups. We show that the various configurations of the twist line give rise to dual descriptions for the identical theory. We compute the ’t Hooft anomaly coefficients and the superconformal indices to test dualities. Surprisingly, we find that the class S theories with twist lines wrapping 1-cycles of C have the identical ’t Hooft anomaliesmore » as the ones without the twist line, whereas the superconformal indices differ. As a result, this provides a large set of examples where the anomaly matching is insufficient to test dualities.« less

  18. Fermion number of twisted kinks in the NJL2 model revisited

    NASA Astrophysics Data System (ADS)

    Thies, Michael

    2018-03-01

    As a consequence of axial current conservation, fermions cannot be bound in localized lumps in the massless Nambu-Jona-Lasinio model. In the case of twisted kinks, this manifests itself in a cancellation between the valence fermion density and the fermion density induced in the Dirac sea. To attribute the correct fermion number to these bound states requires an infrared regularization. Recently, this has been achieved by introducing a bare fermion mass, at least in the nonrelativistic regime of small twist angles and fermion numbers. Here, we propose a simpler regularization using a finite box which preserves integrability and can be applied at any twist angle. A consistent and physically plausible assignment of fermion number to all twisted kinks emerges.

  19. Nonrigid registration of carotid ultrasound and MR images using a "twisting and bending" model

    NASA Astrophysics Data System (ADS)

    Nanayakkara, Nuwan D.; Chiu, Bernard; Samani, Abbas; Spence, J. David; Parraga, Grace; Samarabandu, Jagath; Fenster, Aaron

    2008-03-01

    Atherosclerosis at the carotid bifurcation resulting in cerebral emboli is a major cause of ischemic stroke. Most strokes associated with carotid atherosclerosis can be prevented by lifestyle/dietary changes and pharmacological treatments if identified early by monitoring carotid plaque changes. Plaque composition information from magnetic resonance (MR) carotid images and dynamic characteristics information from 3D ultrasound (US) are necessary for developing and validating US imaging tools to identify vulnerable carotid plaques. Combining these images requires nonrigid registration to correct the non-linear miss-alignments caused by relative twisting and bending in the neck due to different head positions during the two image acquisitions sessions. The high degree of freedom and large number of parameters associated with existing nonrigid image registration methods causes several problems including unnatural plaque morphology alteration, computational complexity, and low reliability. Our approach was to model the normal movement of the neck using a "twisting and bending model" with only six parameters for nonrigid registration. We evaluated our registration technique using intra-subject in-vivo 3D US and 3D MR carotid images acquired on the same day. We calculated the Mean Registration Error (MRE) between the segmented vessel surfaces in the target image and the registered image using a distance-based error metric after applying our "twisting bending model" based nonrigid registration algorithm. We achieved an average registration error of 1.33+/-0.41mm using our nonrigid registration technique. Visual inspection of segmented vessel surfaces also showed a substantial improvement of alignment with our non-rigid registration technique.

  20. Twisting failure of centrally loaded open-section columns in the elastic range

    NASA Technical Reports Server (NTRS)

    Kappus, Robert

    1938-01-01

    In the following report a complete theory of twisting failure by the energy method is developed, based on substantially the same assumptions as those employed by Wagner and Bleich. Problems treated in detail are: the stress and strain condition under St. Venant twist and in twist with axial constraint; the concept of shear center and the energy method for problems of elastic stability.

  1. Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

    NASA Astrophysics Data System (ADS)

    Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

    2018-05-01

    Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

  2. TWIST1-WDR5-Hottip Regulates Hoxa9 Chromatin to Facilitate Prostate Cancer Metastasis.

    PubMed

    Malek, Reem; Gajula, Rajendra P; Williams, Russell D; Nghiem, Belinda; Simons, Brian W; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R; True, Lawrence; An, Steven S; DeWeese, Theodore L; Ross, Ashley E; Schaeffer, Edward M; Pienta, Kenneth J; Hurley, Paula J; Morrissey, Colm; Tran, Phuoc T

    2017-06-15

    TWIST1 is a transcription factor critical for development that can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are coexpressed in mouse prostate and then silenced postnatally. Here we report that TWIST1 and HOXA9 coexpression are reactivated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to coenrichment of TWIST1 and WDR5 as well as increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter, which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacologic inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. Cancer Res; 77(12); 3181-93. ©2017 AACR . ©2017 American Association for Cancer Research.

  3. Slug, Twist, and E-Cadherin as Immunohistochemical Biomarkers in Meningeal Tumors

    PubMed Central

    Nagaishi, Masaya; Nobusawa, Sumihito; Tanaka, Yuko; Ikota, Hayato; Yokoo, Hideaki; Nakazato, Yoichi

    2012-01-01

    The overexpression of Twist and Slug and subsequent down-regulation of E-cadherin facilitate the acquirement of invasive growth properties in cancer cells. It is unclear which of these molecules are expressed in mesenchymal tumors in the central nervous system. Here, we investigated 10 cases each of hemangiopericytoma, solitary fibrous tumor, meningothelial, fibrous, angiomatous, and atypical meningiomas, and 5 cases of anaplastic meningioma for Slug, Twist, E-cadherin, and N-cadherin immunoexpression. Nuclear Slug expression was observed in 9/10 (90%) hemangiopericytomas and 5/10 (50%) solitary fibrous tumors, but not in any meningiomas, except for 1 case. Similarly, nuclear Twist expression was more extensive in hemangiopericytomas and solitary fibrous tumors than meningiomas. In contrast to Slug and Twist, the positive expression of E-cadherin was observed in 39/45 (87%) meningiomas, but not in any hemangiopericytomas or solitary fibrous tumors (P<0.0001). The fraction of tumor cells expressing E-cadherin in meningeal tumors was negatively correlated to those of Twist (P = 0.004) and Slug (P<0.0001). The overexpression of Slug and Twist with down-regulation of E-cadherin was characteristic findings in hemangiopericytomas and solitary fibrous tumors, but not in meningiomas. The immunohistochemical profiles of the two tumor groups may be useful as diagnostic markers in cases that present a differential diagnosis challenge. PMID:23029385

  4. Designing Polyamide Inhibitors of TWIST 1 for Prosenescence Therapy

    DTIC Science & Technology

    2014-09-01

    Pyrrole -Imidazole Polyamides; TWIST1; KRAS; non-small cell lung cancer (NSCLC); senescence 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF... Pyrrole -Imidazole Polyamides (PIP) are a class of cell permeable programmable small-molecule heterocyclic amino acid oligomers that can be designed...The original specific aims are below: Specific Aim#1. Design and synthesize a TWIST1-inhibitory specific Pyrrole -Imidazole Polyamides (PIP

  5. Twisted waves and instabilities in a permeating dusty plasma

    NASA Astrophysics Data System (ADS)

    Bukhari, S.; Ali, S.; Khan, S. A.; Mendonca, J. T.

    2018-04-01

    New features of the twisted dusty plasma modes and associated instabilities are investigated in permeating plasmas. Using the Vlasov-Poisson model equations, a generalized dispersion relation is obtained for a Maxwellian distributed plasma to analyse the dust-acoustic and dust-ion-acoustic waves with finite orbital angular momentum (OAM) states. Existence conditions for damping/growth rates are discussed and showed significant modifications in twisted dusty modes as compared to straight propagating dusty modes. Numerically, the instability growth rate, which depends on particle streaming and twist effects in the wave potential, is significantly modified due to the Laguerre-Gaussian profiles. Relevance of the study to wave excitations due to penetration of solar wind into cometary clouds or interstellar dusty plasmas is discussed.

  6. Rayleigh scattering of twisted light by hydrogenlike ions

    NASA Astrophysics Data System (ADS)

    Peshkov, A. A.; Volotka, A. V.; Surzhykov, A.; Fritzsche, S.

    2018-02-01

    The elastic Rayleigh scattering of twisted light and, in particular, the polarization (transfer) of the scattered photons have been analyzed within the framework of second-order perturbation theory and Dirac's relativistic equation. Special attention was paid hereby to the scattering on three different atomic targets: single atoms, a mesoscopic (small) target, and a macroscopic (large) target, which are all centered with regard to the beam axis. Detailed calculations of the polarization Stokes parameters were performed for C5 + ions and for twisted Bessel beams. It is shown that the polarization of scattered photons is sensitive to the size of an atomic target and to the helicity, the opening angle, and the projection of the total angular momentum of the incident Bessel beam. These computations indicate more that the Stokes parameters of the (Rayleigh) scattered twisted light may significantly differ from their behavior for an incident plane-wave radiation.

  7. Twisting Neutron Waves

    NASA Astrophysics Data System (ADS)

    Pushin, Dmitry

    Most waves encountered in nature can be given a ``twist'', so that their phase winds around an axis parallel to the direction of wave propagation. Such waves are said to possess orbital angular momentum (OAM). For quantum particles such as photons, atoms, and electrons, this corresponds to the particle wavefunction having angular momentum of Lℏ along its propagation axis. Controlled generation and detection of OAM states of photons began in the 1990s, sparking considerable interest in applications of OAM in light and matter waves. OAM states of photons have found diverse applications such as broadband data multiplexing, massive quantum entanglement, optical trapping, microscopy, quantum state determination and teleportation, and interferometry. OAM states of electron beams have been used to rotate nanoparticles, determine the chirality of crystals and for magnetic microscopy. Here I discuss the first demonstration of OAM control of neutrons. Using neutron interferometry with a spatially incoherent input beam, we show the addition and conservation of quantum angular momenta, entanglement between quantum path and OAM degrees of freedom. Neutron-based quantum information science heretofore limited to spin, path, and energy degrees of freedom, now has access to another quantized variable, and OAM modalities of light, x-ray, and electron beams are extended to a massive, penetrating neutral particle. The methods of neutron phase imprinting demonstrated here expand the toolbox available for development of phase-sensitive techniques of neutron imaging. Financial support provided by the NSERC Create and Discovery programs, CERC and the NIST Quantum Information Program is acknowledged.

  8. Structural and electronic transformation in low-angle twisted bilayer graphene

    NASA Astrophysics Data System (ADS)

    Gargiulo, Fernando; Yazyev, Oleg V.

    2018-01-01

    Experiments on bilayer graphene unveiled a fascinating realization of stacking disorder where triangular domains with well-defined Bernal stacking are delimited by a hexagonal network of strain solitons. Here we show by means of numerical simulations that this is a consequence of a structural transformation of the moiré pattern inherent to twisted bilayer graphene taking place at twist angles θ below a crossover angle θ\\star=1.2\\circ . The transformation is governed by the interplay between the interlayer van der Waals interaction and the in-plane strain field, and is revealed by a change in the functional form of the twist energy density. This transformation unveils an electronic regime characteristic of vanishing twist angles in which the charge density converges, though not uniformly, to that of ideal bilayer graphene with Bernal stacking. On the other hand, the stacking domain boundaries form a distinct charge density pattern that provides the STM signature of the hexagonal solitonic network.

  9. Anisotropic piezoelectric twist actuation of helicopter rotor blades: Aeroelastic analysis and design optimization

    NASA Astrophysics Data System (ADS)

    Wilkie, William Keats

    1997-12-01

    An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain a soluti An aeroelastic model suitable for control law and preliminary structural design of composite helicopter rotor blades incorporating embedded anisotropic piezoelectric actuator laminae is developed. The aeroelasticity model consists of a linear, nonuniform beam representation of the blade structure, including linear piezoelectric actuation terms, coupled with a nonlinear, finite-state unsteady aerodynamics model. A Galerkin procedure and numerical integration in the time domain are used to obtain amited additional piezoelectric material mass, it is shown that blade twist actuation approaches which exploit in-plane piezoelectric free-stain anisotropies are capable of producing amplitudes of oscillatory blade twisting sufficient for rotor vibration reduction applications. The second study examines the effectiveness of using embedded piezoelectric actuator laminae to alleviate vibratory loads due to retreating blade stall. A 10 to 15 percent improvement in dynamic stall limited forward flight speed, and a 5 percent improvement in stall limited rotor thrust were numerically demonstrated for the active twist rotor blade relative to a conventional blade design. The active twist blades are also demonstrated to be more susceptible than the conventional blades to dynamic stall induced vibratory loads when not operating with twist actuation. This is the result of designing the active twist blades with low torsional stiffness in order to maximize piezoelectric twist authority

  10. Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

    NASA Astrophysics Data System (ADS)

    Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

    2016-03-01

    Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

  11. An active, collaborative approach to learning skills in flow cytometry.

    PubMed

    Fuller, Kathryn; Linden, Matthew D; Lee-Pullen, Tracey; Fragall, Clayton; Erber, Wendy N; Röhrig, Kimberley J

    2016-06-01

    Advances in science education research have the potential to improve the way students learn to perform scientific interpretations and understand science concepts. We developed active, collaborative activities to teach skills in manipulating flow cytometry data using FlowJo software. Undergraduate students were given compensated clinical flow cytometry listmode output (FCS) files and asked to design a gating strategy to diagnose patients with different hematological malignancies on the basis of their immunophenotype. A separate cohort of research trainees was given uncompensated data files on which they performed their own compensation, calculated the antibody staining index, designed a sequential gating strategy, and quantified rare immune cell subsets. Student engagement, confidence, and perceptions of flow cytometry were assessed using a survey. Competency against the learning outcomes was assessed by asking students to undertake tasks that required understanding of flow cytometry dot plot data and gating sequences. The active, collaborative approach allowed students to achieve learning outcomes not previously possible with traditional teaching formats, for example, having students design their own gating strategy, without forgoing essential outcomes such as the interpretation of dot plots. In undergraduate students, favorable perceptions of flow cytometry as a field and as a potential career choice were correlated with student confidence but not the ability to perform flow cytometry data analysis. We demonstrate that this new pedagogical approach to teaching flow cytometry is beneficial for student understanding and interpretation of complex concepts. It should be considered as a useful new method for incorporating complex data analysis tasks such as flow cytometry into curricula. Copyright © 2016 The American Physiological Society.

  12. Twisted bilayer graphene photoluminescence emission peaks at van Hove singularities.

    PubMed

    Alencar, Thonimar V; von Dreifus, Driele; Gabriela Cota Moreira, Maria; Eliel, Gomes S N; Yeh, Chao-Hui; Chiu, Po-Wen; Pimenta, Marcos A; Malard, Leandro M; Maria de Paula, Ana

    2018-05-02

    We report on photoluminescence emission imaging by femtosecond laser excitation on twisted bilayer graphene samples. The emission images are obtained by tuning the excitation laser energies in the near infrared region. We demonstrate an increase of the photoluminescence emission at excitation energies that depends on the bilayer twist angle. The results show a peak for the light emission when the excitation is in resonance with transitions at the van Hove singularities in the electronic density of states. We measured the photoluminescence excitation peak position and width for samples with various twist angles showing resonances in the energy range of 1.2 to 1.7 eV.

  13. Twisted bilayer graphene photoluminescence emission peaks at van Hove singularities

    NASA Astrophysics Data System (ADS)

    Alencar, Thonimar V.; von Dreifus, Driele; Cota Moreira, Maria Gabriela; Eliel, Gomes S. N.; Yeh, Chao-Hui; Chiu, Po-Wen; Pimenta, Marcos A.; Malard, Leandro M.; de Paula, Ana Maria

    2018-05-01

    We report on photoluminescence emission imaging by femtosecond laser excitation on twisted bilayer graphene samples. The emission images are obtained by tuning the excitation laser energies in the near infrared region. We demonstrate an increase of the photoluminescence emission at excitation energies that depends on the bilayer twist angle. The results show a peak for the light emission when the excitation is in resonance with transitions at the van Hove singularities in the electronic density of states. We measured the photoluminescence excitation peak position and width for samples with various twist angles showing resonances in the energy range of 1.2 to 1.7 eV.

  14. Development of a Fluorescent Based Immunosensor for the Serodiagnosis of Canine Leishmaniasis Combining Immunomagnetic Separation and Flow Cytometry

    PubMed Central

    Sousa, Susana; Cardoso, Luís; Reed, Steven G.; Reis, Alexandre B.; Martins-Filho, Olindo A.; Silvestre, Ricardo; Cordeiro da Silva, Anabela

    2013-01-01

    Background An accurate diagnosis is essential for the control of infectious diseases. In the search for effective and efficient tests, biosensors have increasingly been exploited for the development of new and highly sensitive diagnostic methods. Here, we describe a new fluorescent based immunosensor comprising magnetic polymer microspheres coated with recombinant antigens to improve the detection of specific antibodies generated during an infectious disease. As a challenging model, we used canine leishmaniasis due to the unsatisfactory sensitivity associated with the detection of infection in asymptomatic animals where the levels of pathogen-specific antibodies are scarce. Methodology Ni-NTA magnetic microspheres with 1,7 µm and 8,07 µm were coated with the Leishmania recombinant proteins LicTXNPx and rK39, respectively. A mixture of equal proportions of both recombinant protein-coated microspheres was used to recognize and specifically bind anti-rK39 and anti-LicTNXPx antibodies present in serum samples of infected dogs. The microspheres were recovered by magnetic separation and the percentage of fluorescent positive microspheres was quantified by flow cytometry. Principal Findings A clinical evaluation carried out with 129 dog serum samples using the antigen combination demonstrated a sensitivity of 98,8% with a specificity of 94,4%. rK39 antigen alone demonstrated a higher sensitivity for symptomatic dogs (96,9%), while LicTXNPx antigen showed a higher sensitivity for asymptomatic (94,4%). Conclusions Overall, our results demonstrated the potential of a magnetic microsphere associated flow cytometry methodology as a viable tool for highly sensitive laboratorial serodiagnosis of both clinical and subclinical forms of canine leishmaniasis. PMID:23991232

  15. Microfluidic Impedance Flow Cytometry Enabling High-Throughput Single-Cell Electrical Property Characterization

    PubMed Central

    Chen, Jian; Xue, Chengcheng; Zhao, Yang; Chen, Deyong; Wu, Min-Hsien; Wang, Junbo

    2015-01-01

    This article reviews recent developments in microfluidic impedance flow cytometry for high-throughput electrical property characterization of single cells. Four major perspectives of microfluidic impedance flow cytometry for single-cell characterization are included in this review: (1) early developments of microfluidic impedance flow cytometry for single-cell electrical property characterization; (2) microfluidic impedance flow cytometry with enhanced sensitivity; (3) microfluidic impedance and optical flow cytometry for single-cell analysis and (4) integrated point of care system based on microfluidic impedance flow cytometry. We examine the advantages and limitations of each technique and discuss future research opportunities from the perspectives of both technical innovation and clinical applications. PMID:25938973

  16. Twist1 Transcriptional Targets in the Developing Atrio-Ventricular Canal of the Mouse

    PubMed Central

    Vrljicak, Pavle; Cullum, Rebecca; Xu, Eric; Chang, Alex C. Y.; Wederell, Elizabeth D.; Bilenky, Mikhail; Jones, Steven J. M.; Marra, Marco A.; Karsan, Aly; Hoodless, Pamela A.

    2012-01-01

    Malformations of the cardiovascular system are the most common type of birth defect in humans, frequently affecting the formation of valves and septa. During heart valve and septa formation, cells from the atrio-ventricular canal (AVC) and outflow tract (OFT) regions of the heart undergo an epithelial-to-mesenchymal transformation (EMT) and invade the underlying extracellular matrix to give rise to endocardial cushions. Subsequent maturation of newly formed mesenchyme cells leads to thin stress-resistant leaflets. TWIST1 is a basic helix-loop-helix transcription factor expressed in newly formed mesenchyme cells of the AVC and OFT that has been shown to play roles in cell survival, cell proliferation and differentiation. However, the downstream targets of TWIST1 during heart valve formation remain unclear. To identify genes important for heart valve development downstream of TWIST1, we performed global gene expression profiling of AVC, OFT, atria and ventricles of the embryonic day 10.5 mouse heart by tag-sequencing (Tag-seq). Using this resource we identified a novel set of 939 genes, including 123 regulators of transcription, enriched in the valve forming regions of the heart. We compared these genes to a Tag-seq library from the Twist1 null developing valves revealing significant gene expression changes. These changes were consistent with a role of TWIST1 in controlling differentiation of mesenchymal cells following their transformation from endothelium in the mouse. To study the role of TWIST1 at the DNA level we performed chromatin immunoprecipitation and identified novel direct targets of TWIST1 in the developing heart valves. Our findings support a role for TWIST1 in the differentiation of AVC mesenchyme post-EMT in the mouse, and suggest that TWIST1 can exert its function by direct DNA binding to activate valve specific gene expression. PMID:22815831

  17. Recombinant mouse periostin ameliorates coronal sutures fusion in Twist1+/- mice.

    PubMed

    Bai, Shanshan; Li, Dong; Xu, Liang; Duan, Huichuan; Yuan, Jie; Wei, Min

    2018-04-17

    Saethre-Chotzen syndrome is an autosomal dominantly inherited disorder caused by mutations in the twist family basic helix-loop-helix transcription factor 1 (TWIST1) gene. Surgical procedures are frequently required to reduce morphological and functional defects in patients with Saethre-Chotzen syndrome. Therefore, the development of noninvasive procedures to treat Saethre-Chotzen syndrome is critical. We identified that periostin, which is an extracellular matrix protein that plays an important role in both bone and connective tissues, is downregulated in craniosynostosis patients. We aimed to verify the effects of different concentrations (0, 50, 100, and 200 μg/l) of recombinant mouse periostin in Twist1 +/- mice (a mouse model of Saethre-Chotzen syndrome) coronal suture cells in vitro and in vivo. Cell proliferation, migration, and osteogenic differentiation were observed and detected. Twist1 +/- mice were also injected with recombinant mouse periostin to verify the treatment effects. Cell Counting Kit-8 results showed that recombinant mouse periostin inhibited the proliferation of suture-derived cells in a time- and concentration-dependent manner. Cell migration was also suppressed when treated with recombinant mouse periostin. Real-time quantitative PCR and Western blotting results suggested that messenger ribonucleic acid and protein expression of alkaline phosphatase, bone sialoprotein, collagen type I, and osteocalcin were all downregulated after treatment with recombinant mouse periostin. However, the expression of Wnt-3a, Wnt-1, and β-catenin were upregulated. The in vivo results demonstrated that periostin-treated Twist1 +/- mice showed patent coronal sutures in comparison with non-treated Twist1 +/- mice which have coronal craniosynostosis. Our results suggest that recombinant mouse periostin can inhibit coronal suture cell proliferation and migration and suppress osteogenic differentiation of suture-derived cells via Wnt canonical signaling, as

  18. An aeroelastic analysis of helicopter rotor blades incorporating piezoelectric fiber composite twist actuation

    NASA Technical Reports Server (NTRS)

    Wilkie, W. Keats; Park, K. C.

    1996-01-01

    A simple aeroelastic analysis of a helicopter rotor blade incorporating embedded piezoelectric fiber composite, interdigitated electrode blade twist actuators is described. The analysis consist of a linear torsion and flapwise bending model coupled with a nonlinear ONERA based unsteady aerodynamics model. A modified Galerkin procedure is performed upon the rotor blade partial differential equations of motion to develop a system of ordinary differential equations suitable for numerical integration. The twist actuation responses for three conceptual full-scale blade designs with realistic constraints on blade mass are numerically evaluated using the analysis. Numerical results indicate that useful amplitudes of nonresonant elastic twist, on the order of one to two degrees, are achievable under one-g hovering flight conditions for interdigitated electrode poling configurations. Twist actuation for the interdigitated electrode blades is also compared with the twist actuation of a conventionally poled piezoelectric fiber composite blade. Elastic twist produced using the interdigitated electrode actuators was found to be four to five times larger than that obtained with the conventionally poled actuators.

  19. Scalable clustering algorithms for continuous environmental flow cytometry.

    PubMed

    Hyrkas, Jeremy; Clayton, Sophie; Ribalet, Francois; Halperin, Daniel; Armbrust, E Virginia; Howe, Bill

    2016-02-01

    Recent technological innovations in flow cytometry now allow oceanographers to collect high-frequency flow cytometry data from particles in aquatic environments on a scale far surpassing conventional flow cytometers. The SeaFlow cytometer continuously profiles microbial phytoplankton populations across thousands of kilometers of the surface ocean. The data streams produced by instruments such as SeaFlow challenge the traditional sample-by-sample approach in cytometric analysis and highlight the need for scalable clustering algorithms to extract population information from these large-scale, high-frequency flow cytometers. We explore how available algorithms commonly used for medical applications perform at classification of such a large-scale, environmental flow cytometry data. We apply large-scale Gaussian mixture models to massive datasets using Hadoop. This approach outperforms current state-of-the-art cytometry classification algorithms in accuracy and can be coupled with manual or automatic partitioning of data into homogeneous sections for further classification gains. We propose the Gaussian mixture model with partitioning approach for classification of large-scale, high-frequency flow cytometry data. Source code available for download at https://github.com/jhyrkas/seaflow_cluster, implemented in Java for use with Hadoop. hyrkas@cs.washington.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Twist1 Suppresses Senescence Programs and Thereby Accelerates and Maintains Mutant Kras-Induced Lung Tumorigenesis

    PubMed Central

    Thiyagarajan, Saravanan; Das, Sandhya T.; Zabuawala, Tahera; Chen, Joy; Cho, Yoon-Jae; Luong, Richard; Tamayo, Pablo; Salih, Tarek; Aziz, Khaled; Adam, Stacey J.; Vicent, Silvestre; Nielsen, Carsten H.; Withofs, Nadia; Sweet-Cordero, Alejandro; Gambhir, Sanjiv S.; Rudin, Charles M.; Felsher, Dean W.

    2012-01-01

    KRAS mutant lung cancers are generally refractory to chemotherapy as well targeted agents. To date, the identification of drugs to therapeutically inhibit K-RAS have been unsuccessful, suggesting that other approaches are required. We demonstrate in both a novel transgenic mutant Kras lung cancer mouse model and in human lung tumors that the inhibition of Twist1 restores a senescence program inducing the loss of a neoplastic phenotype. The Twist1 gene encodes for a transcription factor that is essential during embryogenesis. Twist1 has been suggested to play an important role during tumor progression. However, there is no in vivo evidence that Twist1 plays a role in autochthonous tumorigenesis. Through two novel transgenic mouse models, we show that Twist1 cooperates with KrasG12D to markedly accelerate lung tumorigenesis by abrogating cellular senescence programs and promoting the progression from benign adenomas to adenocarcinomas. Moreover, the suppression of Twist1 to physiological levels is sufficient to cause Kras mutant lung tumors to undergo senescence and lose their neoplastic features. Finally, we analyzed more than 500 human tumors to demonstrate that TWIST1 is frequently overexpressed in primary human lung tumors. The suppression of TWIST1 in human lung cancer cells also induced cellular senescence. Hence, TWIST1 is a critical regulator of cellular senescence programs, and the suppression of TWIST1 in human tumors may be an effective example of pro-senescence therapy. PMID:22654667

  1. Twist-2 matching of transverse momentum dependent distributions

    NASA Astrophysics Data System (ADS)

    Gutiérrez-Reyes, Daniel; Scimemi, Ignazio; Vladimirov, Alexey A.

    2017-06-01

    We systematically study the large-qT (or small-b) matching of transverse momentum dependent (TMD) distributions to the twist-2 integrated parton distributions. Performing operator product expansion for a generic TMD operator at the next-to-leading order (NLO) we found the complete set of TMD distributions that match twist-2. These are unpolarized, helicity, transversity, pretzelosity and linearly polarized gluon distributions. The NLO matching coefficients for these distributions are presented. The pretzelosity matching coefficient is zero at the presented order, however, it is evident that it is non-zero in the following orders. This result offers a natural explanation of the small value of pretzelosity found in phenomenological fits. We also demonstrate that the cancellation of rapidity divergences by the leading order soft factor imposes the necessary requirement on the Lorentz structure of TMD operators, which is supported only by the TMD distributions of leading dynamical twist. Additionally, this requirement puts restrictions on the γ5-definition in the dimensional regularization.

  2. DNA polymorphism identity determination using flow cytometry

    DOEpatents

    Nolan, John P.; White, P. Scott; Cai, Hong

    2001-01-01

    DNA polymorphism identity determination using flow cytometry. Primers designed to be immobilized on microspheres are allowed to anneal to the DNA strand under investigation, and are extended by either DNA polymerase using fluorescent dideoxynucleotides or ligated by DNA ligase to fluorescent reporter oligonucleotides. The fluorescence of either the dideoxynucleotide or the reporter oligonucleotide attached to the immobilized primer is measured by flow cytometry, thereby identifying the nucleotide polymorphism on the DNA strand.

  3. Rotating Magnetic Structures Associated with a Quasi-circular Ribbon Flare

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haidong; Jiang, Yunchun; Yang, Jiayan

    We present the detection of a small eruption and the associated quasi-circular ribbon flare during the emergence of a bipole occurring on 2015 February 3. Under a fan dome, a sigmoid was rooted in a single magnetic bipole, which was encircled by negative polarity. The nonlinear force-free field extrapolation shows the presence of twisted field lines, which can represent a sigmoid structure. The rotation of the magnetic bipole may cause the twisting of magnetic field lines. An initial brightening appeared at one of the footpoints of the sigmoid, where the positive polarity slides toward a nearby negative polarity field region.more » The sigmoid displayed an ascending motion and then interacted intensively with the spine-like field. This type of null point reconnection in corona led to a violent blowout jet, and a quasi-circular flare ribbon was also produced. The magnetic emergence and rotational motion are the main contributors to the energy buildup for the flare, while the cancellation and collision might act as a trigger.« less

  4. Highly sensitive twist sensor based on tilted fiber Bragg grating of polarization-dependent properties

    NASA Astrophysics Data System (ADS)

    Lu, Yanfang; Shen, Changyu; Chen, Debao; Chu, Jinlei; Wang, Qiang; Dong, Xinyong

    2014-10-01

    The transmission intensity of the tilted fiber Bragg grating (TFBG) is strongly dependent on the polarization properties of the TFBG. The polarization characteristic of the cladding modes can be used for twist measuring. In this paper, a highly sensitive fiber twist sensor is proposed. The transmission intensity on the strong loss wavelength showed a quasi-sin θ changing with the twist angle ranging from 0° to 180° for S- or P-polarized input. A high sensitivity of 0.299 dB/° is achieved, which is almost 17.9 times higher than that of the current similar existing twist sensor. The twist angle can be measured precisely with the matrix.

  5. Control of Spin Wave Dynamics in Spatially Twisted Magnetic Structures

    DTIC Science & Technology

    2017-06-27

    realize high-performance spintronic and magnetic storage devices. 15. SUBJECT TERMS nano- electronics , spin, wave, magnetic, multi-functional, device 16... electronics has required us to develop high-performance and multi-functional electronic devices driven with extremely low power consumption...Spintronics”, simultaneously utilizing the charge and the spin of electrons , provides us with solutions to essential problems for semiconductor-based

  6. In Silico Measurements of Twist and Bend Moduli for β-Solenoid Protein Self-Assembly Units.

    PubMed

    Heinz, Leonard P; Ravikumar, Krishnakumar M; Cox, Daniel L

    2015-05-13

    We compute potentials of mean force for bend and twist deformations via force pulling and umbrella sampling experiments for four β-solenoid proteins (BSPs) that show promise in nanotechnology applications. In all cases, we find quasi-Hooke's law behavior until the point of rupture. Bending moduli show modest anisotropy for two-sided and three-sided BSPs, and little anisotropy for a four-sided BSP. There is a slight clockwise/counterclockwise asymmetry in the twist potential of mean force, showing greater stiffness when the applied twist follows the intrinsic twist. When we extrapolate to beam theory appropriate for amyloid fibrils of the BSPs, we find bend/twist moduli which are somewhat smaller than those in the literature for other amyloid fibrils. Twist persistence lengths are on the order of a micron, and bend persistence lengths are several microns. Provided the intrinsic twist can be reversed, these results support the usage of BSPs in biomaterials applications.

  7. Two-pseudoscalar-meson decay of {chi}{sub cJ} with twist-3 corrections

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou Mingzhen; Zhou Haiqing; Department of Physics, Southeast University, Nanjing 211189

    2009-11-01

    The decays of {chi}{sub cJ}{yields}{pi}{sup +}{pi}{sup -}, K{sup +}K{sup -} (J=0,2) are discussed within the standard and modified hard-scattering approach when including the contributions from twist-3 distribution amplitudes and wave functions of the light pseudoscalar meson. A model for twist-2 and twist-3 distribution amplitudes and wave functions of the pion and kaon with BHL prescription are proposed as the solution to the end-point singularities. The results show that the contributions from twist-3 parts are actually not power suppressed comparing with the leading-twist contribution. After including the effects from the transverse momentum of light meson valence-quark state and Sudakov factors, themore » decay widths of the {chi}{sub cJ} into pions or kaons are comparable with the their experimental data.« less

  8. Direct measurement of torque and twist generated by a dye binding to DNA

    NASA Astrophysics Data System (ADS)

    Gore, Jeff; Bryant, Zev; Bustamante, Carlos

    2004-03-01

    Many biologically important chemicals and proteins change the twist of DNA upon binding. We have used magnetic tweezers to directly measure the torque and twist generated when ethidium bromide binds and unbinds to DNA. One end of the DNA is bound specifically to a glass coverslip and the opposite end is held away from the surface by a paramagnetic bead. Attached to the middle of the DNA is a second fluorescent bead whose position can be tracked with high angular and temporal resolution. On one side of the fluorescent bead binding site we have engineered a single strand nick that acts like a free swivel. Addition of ethidium bromide then powered rotation of the central fluorescent bead. After the ethidium bromide was bound we used magnesium to compete out the intercalated ethidium bromide, thus inducing a rotation in the opposite direction. We studied the torque generation, energetics, and kinetics associated with ethidium bromide binding and unbinding by tracking the rotation of the fluorescent bead. This system is a demonstration of a reversible chemically powered DNA-based rotary motor. We also expect that this technique will be useful in studying proteins that bind to or rotate DNA, including recA, polymerases, and topoisomerases.

  9. Flow cytometry shows added value in diagnosing lymphoma in brain biopsies.

    PubMed

    van der Meulen, Matthijs; Bromberg, Jacoline E C; Lam, King H; Dammers, Ruben; Langerak, Anton W; Doorduijn, Jeanette K; Kros, Johan M; van den Bent, Martin J; van der Velden, Vincent H J

    2018-05-10

    To assess the sensitivity, specificity and turnaround time of flow cytometric analysis on brain biopsies compared to histology plus immunohistochemistry analysis in tumors with clinical suspicion of lymphoma. All brain biopsies performed between 2010 and 2015 at our institution and analyzed by both immunohistochemistry and flow cytometry were included in this retrospective study. Immunohistochemistry was considered the gold standard. In a total of 77 biopsies from 71 patients, 49 lymphomas were diagnosed by immunohistochemistry, flow cytometry results were concordant in 71 biopsies (92,2%). We found a specificity and sensitivity of flow cytometry of 100% and 87,8%, respectively. The time between the biopsy and reporting the result (turnaround time) was significantly shorter for flow cytometry, compared to immunohistochemistry (median: 1 versus 5 days). Flow cytometry has a high specificity and can confirm the diagnosis of a lymphoma significantly faster than immunohistochemistry. This allows for rapid initiation of treatment in this highly aggressive tumor. However, since its sensitivity is less than 100%, we recommend to perform histology plus immunohistochemistry in parallel to flow cytometry. This article is protected by copyright. All rights reserved. © 2018 International Clinical Cytometry Society.

  10. Projection Moire Interferometry for Rotorcraft Applications: Deformation Measurements of Active Twist Rotor Blades

    NASA Technical Reports Server (NTRS)

    Fleming, Gary A.; Soto, Hector L.; South, Bruce W.

    2002-01-01

    Projection Moire Interferometry (PMI) has been used during wind tunnel tests to obtain azimuthally dependent blade bending and twist measurements for a 4-bladed Active Twist Rotor (ATR) system in simulated forward flight. The ATR concept offers a means to reduce rotor vibratory loads and noise by using piezoelectric active fiber composite actuators embedded in the blade structure to twist each blade as they rotate throughout the rotor azimuth. The twist imparted on the blades for blade control causes significant changes in blade loading, resulting in complex blade deformation consisting of coupled bending and twist. Measurement of this blade deformation is critical in understanding the overall behavior of the ATR system and the physical mechanisms causing the reduction in rotor loads and noise. PMI is a non-contacting, video-based optical measurement technique capable of obtaining spatially continuous structural deformation measurements over the entire object surface within the PMI system field-of-view. When applied to rotorcraft testing, PMI can be used to measure the azimuth-dependent blade bending and twist along the full span of the rotor blade. This paper presents the PMI technique as applied to rotorcraft testing, and provides results obtained during the ATR tests demonstrating the PMI system performance. PMI measurements acquired at select blade actuation conditions generating minimum and maximum rotor loads are provided to explore the interrelationship between rotor loads, blade bending, and twist.

  11. Twist Model Development and Results from the Active Aeroelastic Wing F/A-18 Aircraft

    NASA Technical Reports Server (NTRS)

    Lizotte, Andrew M.; Allen, Michael J.

    2007-01-01

    Understanding the wing twist of the active aeroelastic wing (AAW) F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption. This technique produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

  12. Twist Model Development and Results From the Active Aeroelastic Wing F/A-18 Aircraft

    NASA Technical Reports Server (NTRS)

    Lizotte, Andrew; Allen, Michael J.

    2005-01-01

    Understanding the wing twist of the active aeroelastic wing F/A-18 aircraft is a fundamental research objective for the program and offers numerous benefits. In order to clearly understand the wing flexibility characteristics, a model was created to predict real-time wing twist. A reliable twist model allows the prediction of twist for flight simulation, provides insight into aircraft performance uncertainties, and assists with computational fluid dynamic and aeroelastic issues. The left wing of the aircraft was heavily instrumented during the first phase of the active aeroelastic wing program allowing deflection data collection. Traditional data processing steps were taken to reduce flight data, and twist predictions were made using linear regression techniques. The model predictions determined a consistent linear relationship between the measured twist and aircraft parameters, such as surface positions and aircraft state variables. Error in the original model was reduced in some cases by using a dynamic pressure-based assumption and by using neural networks. These techniques produced excellent predictions for flight between the standard test points and accounted for nonlinearities in the data. This report discusses data processing techniques and twist prediction validation, and provides illustrative and quantitative results.

  13. Experimental Investigation of the Electronic Properties of Twisted Bilayer Graphene by STM and STS

    NASA Astrophysics Data System (ADS)

    Yin, Longjing; Qiao, Jiabin; Wang, Wenxiao; Zuo, Weijie; He, Lin

    The electronic properties of graphene multilayers depend sensitively on their stacking order. A twisted angle is treated as a unique degree of freedom to tune the electronic properties of graphene system. Here we study electronic structures of the twisted bilayers by scanning tunneling microscopy (STM) and spectroscopy (STS). We demonstrate that the interlayer coupling strength affects both the Van Hove singularities and the Fermi velocity of twisted bilayers dramatically. This removes the discrepancy about the Fermi velocity renormalization in the twisted bilayers and provides a consistent interpretation of all current data. Moreover, we report the experimental evidence for non-Abelian gauge potentials in twisted graphene bilayers by STM and STS. At a magic twisted angle, about 1.11°, a pronounced sharp peak is observed in the tunnelling spectra due to the action of the non-Abelian gauge fields. Because of the effective non-Abelian gauge fields, the rotation angle could transfer the charge carriers in the twisted bilayers from massless Dirac fermions into well localized electrons, or vice versa, efficiently. This provides a new route to tune the electronic properties of graphene systems, which will be essential in future graphene nanoelectronics.

  14. Factorising the 3D topologically twisted index

    NASA Astrophysics Data System (ADS)

    Cabo-Bizet, Alejandro

    2017-04-01

    We explore the path integration — upon the contour of hermitian (non-auxliary) field configurations — of topologically twisted N=2 Chern-Simons-matter theory (TTCSM) on {S}_2 times a segment. In this way, we obtain the formula for the 3D topologically twisted index, first as a convolution of TTCSM on {S}_2 times halves of {S}_1 , second as TTCSM on {S}_2 times {S}_1 — with a puncture, — and third as TTCSM on {S}_2× {S}_1 . In contradistinction to the first two cases, in the third case, the vector multiplet auxiliary field D is constrained to be anti-hermitian.

  15. Obstructions for twist star products

    NASA Astrophysics Data System (ADS)

    Bieliavsky, Pierre; Esposito, Chiara; Waldmann, Stefan; Weber, Thomas

    2018-05-01

    In this short note, we point out that not every star product is induced by a Drinfel'd twist by showing that not every Poisson structure is induced by a classical r-matrix. Examples include the higher genus symplectic Pretzel surfaces and the symplectic sphere S^2.

  16. Optics of twisted nematic and supertwisted nematic liquid-crystal displays

    NASA Astrophysics Data System (ADS)

    Leenhouts, F.; Schadt, M.

    1986-11-01

    For the first time calculations of the off-state transmission of twisted nematic liquid-crystal displays (LCD's) are presented which exhibit twist angles greater than the conventional 90 °. The transmission has been calculated using a treatment introduced by Priestley. In addition, the CIE (Commission Internationale d'Eclairage) color coordinates were evaluated which, together with the brightness, determine the optical appearance of an LCD. The finite efficiency of the polarizers was taken into account. The results are compared with those obtained for conventional 90 ° twisted nematic LCD's. From the calculations follow the conditions required to obtain optimal contrast and steep electro-optical characteristics in 180 ° supertwisted LCD's designed for high information content applications.

  17. Mechanism of Twist1-Induced Invasion in Breast Cancer Metastasis

    DTIC Science & Technology

    2012-01-01

    Breast Cancer Metastasis PRINCIPAL INVESTIGATOR: Mark Adam Eckert CONTRACTING...2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Mechanism of Twist1-Induced Invasion in Breast Cancer Metastasis 5b. GRANT NUMBER W81XWH-09-1...an important mediator of breast cancer metastasis by driving the epithelial-mesenchymal transition. We find that Twist1 promotes metastasis by

  18. A New Twisting Somersault: 513XD

    NASA Astrophysics Data System (ADS)

    Tong, William; Dullin, Holger R.

    2017-12-01

    We present the mathematical framework of an athlete modelled as a system of coupled rigid bodies to simulate platform and springboard diving. Euler's equations of motion are generalised to non-rigid bodies and are then used to innovate a new dive sequence that in principle can be performed by real-world athletes. We begin by assuming that shape changes are instantaneous so that the equations of motion simplify enough to be solved analytically, and then use this insight to present a new dive (513XD) consisting of 1.5 somersaults and five twists using realistic shape changes. Finally, we demonstrate the phenomenon of converting pure somersaulting motion into pure twisting motion by using a sequence of impulsive shape changes, which may have applications in other fields such as space aeronautics.

  19. Twist1-positive epithelial cells retain adhesive and proliferative capacity throughout dissemination

    PubMed Central

    Shamir, Eliah R.; Coutinho, Kester; Georgess, Dan; Auer, Manfred

    2016-01-01

    ABSTRACT Dissemination is the process by which cells detach and migrate away from a multicellular tissue. The epithelial-to-mesenchymal transition (EMT) conceptualizes dissemination in a stepwise fashion, with downregulation of E-cadherin leading to loss of intercellular junctions, induction of motility, and then escape from the epithelium. This gain of migratory activity is proposed to be mutually exclusive with proliferation. We previously developed a dissemination assay based on inducible expression of the transcription factor Twist1 and here utilize it to characterize the timing and dynamics of intercellular adhesion, proliferation and migration during dissemination. Surprisingly, Twist1+ epithelium displayed extensive intercellular junctions, and Twist1– luminal epithelial cells could still adhere to disseminating Twist1+ cells. Although proteolysis and proliferation were both observed throughout dissemination, neither was absolutely required. Finally, Twist1+ cells exhibited a hybrid migration mode; their morphology and nuclear deformation were characteristic of amoeboid cells, whereas their dynamic protrusive activity, pericellular proteolysis and migration speeds were more typical of mesenchymal cells. Our data reveal that epithelial cells can disseminate while retaining competence to adhere and proliferate. PMID:27402962

  20. Hover Testing of the NASA/Army/MIT Active Twist Rotor Prototype Blade

    NASA Technical Reports Server (NTRS)

    Wilbur, Matthew L.; Yeager, William T., Jr.; Wilkie, W. Keats; Cesnik, Carlos E. S.; Shin, Sangloon

    2000-01-01

    Helicopter rotor individual blade control promises to provide a mechanism for increased rotor performance and reduced rotorcraft vibrations and noise. Active material methods, such as piezoelectrically actuated trailing-edge flaps and strain-induced rotor blade twisting, provide a means of accomplishing individual blade control without the need for hydraulic power in the rotating system. Recent studies have indicated that controlled strain induced blade twisting can be attained using piezoelectric active fiber composite technology. In order to validate these findings experimentally, a cooperative effort between NASA Langley Research Center, the Army Research Laboratory, and the MIT Active Materials and Structures Laboratory has been developed. As a result of this collaboration an aeroelastically-scaled active-twist model rotor blade has been designed and fabricated for testing in the heavy gas environment of the Langley Transonic Dynamics Tunnel (TDT). The results of hover tests of the active-twist prototype blade are presented in this paper. Comparisons with applicable analytical predictions of active-twist frequency response in hovering flight are also presented.

  1. Flow Cytometry Scientist | Center for Cancer Research

    Cancer.gov

    PROGRAM DESCRIPTION The Basic Science Program (BSP) pursues independent, multidisciplinary research in basic and applied molecular biology, immunology, retrovirology, cancer biology, and human genetics. Research efforts and support are an integral part of the Center for Cancer Research (CCR) at the Frederick National Laboratory for Cancer Research (FNLCR). KEY ROLES/RESPONSIBILITIES The Flow Cytometry Core (Flow Core) in the Cancer and Inflammation Program (CIP) is a service core which supports the research efforts of the CCR by providing expertise in the field of flow cytometry (using analyzers and sorters) with the goal of gaining a more thorough understanding of the biology of the immune system, cancer, and inflammation processes. The Flow Core provides service to 12-15 CIP laboratories and more than 22 non-CIP laboratories. Flow core staff provide technical advice on the experimental design of applications, which include immunological phenotyping, cell function assays, and cell cycle analysis. Work is performed per customer requirements, and no independent research is involved. The Flow Cytometry Scientist will be responsible for: Daily management of the Flow Cytometry Core, to include the supervision and guidance of technical staff members Monitor performance of and maintain high dimensional flow cytometer analyzers and cell sorters Operate high dimensional flow cytometer analyzers and cell sorters Provide scientific expertise to the user community and facilitate the development of cutting edge technologies Interact with Flow Core users and customers, and provide technical and scientific advice, and guidance regarding their experiments, including possible collaborations Train staff and scientific end users on the use of flow cytometry in their research, as well as teach them how to operate and troubleshoot the bench-top analyzer instruments Prepare and deliver lectures, as well as one-on-one training sessions, with customers/users Ensure that protocols are up

  2. Reducing Magnetic Fields Around Power Cables

    NASA Technical Reports Server (NTRS)

    Sargent, Noel B.; Gitelman, Florida; Pongracz-Bartha, Edward; Spalding, John

    1993-01-01

    Four power conductors arranged symmetrically about fifth grounded conductor. Four current-carrying wires arranged symmetrically around central grounded wire that nominally carries no current. In comparison with other cable configurations, this one results in smaller magnetic fields around cable. Technique for use when size of wires in cable makes twisting impractical.

  3. Demonstration of an elastically coupled twist control concept for tilt rotor blade application

    NASA Technical Reports Server (NTRS)

    Lake, R. C.; Nixon, M. W.; Wilbur, M. L.; Singleton, J. D.; Mirick, P. H.

    1994-01-01

    The purpose of this Note is to present results from an analytic/experimental study that investigated the potential for passively changing blade twist through the use of extension-twist coupling. A set of composite model rotor blades was manufactured from existing blade molds for a low-twist metal helicopter rotor blade, with a view toward establishing a preliminary proof concept for extension-twist-coupled rotor blades. Data were obtained in hover for both a ballasted and unballasted blade configuration in sea-level atmospheric conditions. Test data were compared with results obtained from a geometrically nonlinear analysis of a detailed finite element model of the rotor blade developed in MSC/NASTRAN.

  4. Focused tight dressing does not prevent cochlear implant magnet migration under 1.5 Tesla MRI.

    PubMed

    Cuda, D; Murri, A; Succo, G

    2013-04-01

    We report a retrospective case of inner magnet migration, which occurred after 1.5 Tesla MRI scanning in an adult recipient of a bilateral cochlear implant (CI) despite a focused head dressing. The patient, bilaterally implanted with Nucleus 5 CIs (Cochlear LTD, Sydney, Australia), underwent a 1.5 Tesla cholangio-MRI scan for biliary duct pathology. In subsequent days, a focal skin alteration appeared over the left inner coil. Plain skull radiographs showed partial magnet migration on the left side. Surgical exploration confirmed magnet twisting; the magnet was effectively repositioned. Left CI performance was restored to pre-migration level. The wound healed without complications. Thus, focused dressing does not prevent magnet migration in CI recipients undergoing 1.5 Tesla MRI. All patients should be counselled on this potential complication. A minor surgical procedure is required to reposition the magnet. Nevertheless, timely diagnosis is necessary to prevent skin breakdown and subsequent device contamination. Plain skull radiograph is very effective in identifying magnet twisting; it should be performed systematically after MRI or minimally on all suspected cases.

  5. Gravity in twisted space

    NASA Technical Reports Server (NTRS)

    Farrar, Kelly A.; Melott, Adrian L.

    1990-01-01

    Numerical simulations with periodic boundary conditions are widely used in cosmology. These have a multiply connected topology known as a three-torus. Such nontrivial topologies for the actual universe may have arisen in the Big Bang. A two-dimensional numerical model with a twisted topology, sometimes a Klein bottle, is shown as well as the fact that local properties of the model are not dependent on topology.

  6. Theory of twisted nonuniformly heated bars

    NASA Technical Reports Server (NTRS)

    Shorr, B. F.

    1980-01-01

    Nonlineary distributed stresses in twisted nonuniformly heated bars of arbitrary cross section are calculated taking into account various elasticity parameters. The approximate theory is shown to be sufficiently general and accurate by comparison with experimental data.

  7. Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

    PubMed Central

    Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

    2012-01-01

    Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

  8. A possible regulatory link between Twist 1 and PPARγ gene regulation in 3T3-L1 adipocytes.

    PubMed

    Ren, Rui; Chen, Zhufeng; Zhao, Xia; Sun, Tao; Zhang, Yuchao; Chen, Jie; Lu, Sumei; Ma, Wanshan

    2016-11-08

    Peroxisome proliferator-activated receptor γ (PPARγ) is a critical gene that regulates the function of adipocytes. Therefore, studies on the molecular regulation mechanism of PPARγ are important to understand the function of adipose tissue. Twist 1 is another important functional gene in adipose tissue, and hundreds of genes are regulated by Twist 1. The aim of this study was to investigate the regulation of Twist 1 and PPARγ expression in 3T3-L1 mature adipocytes. We induced differentiation in 3T3-L1 preadipocytes and examined alterations in Twist 1 and PPARγ expression. We used the PPARγ agonist pioglitazone and the PPARγ antagonist T0070907 to investigate the effect of PPARγ on Twist 1 expression. In addition, we utilized retroviral interference and overexpression of Twist 1 to determine the effects of Twist 1 on PPARγ expression. The expression levels of Twist 1 and PPARγ were induced during differentiation in 3T3-L1 adipocytes. Application of either a PPARγ agonist (pioglitazone) or antagonist (T0070907) influenced Twist 1 expression, with up-regulation of Twist 1 under pioglitazone (1 μM, 24 h) and down-regulation of Twist 1 under T0070907 (100 μM, 24 h) exposure. Furthermore, the retroviral interference of Twist 1 decreased the protein and mRNA expression of PPARγ, while Twist 1 overexpression had the opposite effect. There was a possible regulatory link between Twist 1 and PPARγ in 3T3-L1 mature adipocytes. This regulatory link enhanced the regulation of PPARγ and may be a functional mechanism of Twist 1 regulation of adipocyte physiology and pathology.

  9. The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis.

    PubMed

    Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

    2011-02-01

    The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis.

  10. The TWIST/Mi2/NuRD protein complex and its essential role in cancer metastasis

    PubMed Central

    Fu, Junjiang; Qin, Li; He, Tao; Qin, Jun; Hong, Jun; Wong, Jiemin; Liao, Lan; Xu, Jianming

    2011-01-01

    The epithelial-mesenchymal transition (EMT) converts epithelial tumor cells into invasive and metastatic cancer cells, leading to mortality in cancer patients. Although TWIST is a master regulator of EMT and metastasis for breast and other cancers, the mechanisms responsible for TWIST-mediated gene transcription remain unknown. In this study, purification and characterization of the TWIST protein complex revealed that TWIST interacts with several components of the Mi2/nucleosome remodeling and deacetylase (Mi2/NuRD) complex, MTA2, RbAp46, Mi2 and HDAC2, and recruits them to the proximal regions of the E-cadherin promoter for transcriptional repression. Depletion of these TWIST complex components from cancer cell lines that depend on TWIST for metastasis efficiently suppresses cell migration and invasion in culture and lung metastasis in mice. These findings not only provide novel mechanistic and functional links between TWIST and the Mi2/NuRD complex but also establish new essential roles for the components of Mi2/NuRD complex in cancer metastasis. PMID:20714342

  11. Saethre-Chotzen syndrome, Pro136His TWIST mutation, hearing loss, and external and middle ear structural anomalies: report on a Brazilian family.

    PubMed

    Lamônica, Dionísia A C; Maximino, Luciana P; Feniman, Mariza Ribeiro; Silva, Greyce K; Zanchetta, Sthella; Abramides, Dagma V M; Passos-Bueno, Maria Rita; Rocha, Kátia; Richieri-Costa, Antonio

    2010-09-01

    To describe the clinical, speech, hearing, and imaging findings in three members of a Brazilian family with Saethre-Chotzen syndrome (SCS) who presented some unusual characteristics within the spectrum of the syndrome. Clinical evaluation was performed by a multidisciplinary team. Direct sequencing of the polymerase chain reaction-amplified coding region of the TWIST1 gene, routine and electrophysiological hearing evaluation, speech evaluation, and imaging studies through computed tomography (CT) scan and magnetic resonance imaging (MRI) were performed. TWIST1 gene analysis revealed a Pro136His mutation in all patients. Hearing evaluation showed peripherial and mixed hearing loss in two of the patients, one of them with severe unilateral microtia. Computed tomography scan showed structural middle ear anomalies, and MRI showed distortion of the skull contour as well as some of the brain structures. We report a previously undescribed TWIST1 gene mutation in patients with SCS. There is evidence that indicates hearing loss (conductive and mixed) can be related both with middle ear (microtia, high jugular bulb, and enlarged vestibules) as well as with brain stem anomalies. Here we discuss the relationship between the gene mutation and the clinical, imaging, speech, and hearing findings.

  12. Precision measurement of the neutron twist-3 matrix element d(2)(n): probing color forces.

    PubMed

    Posik, M; Flay, D; Parno, D S; Allada, K; Armstrong, W; Averett, T; Benmokhtar, F; Bertozzi, W; Camsonne, A; Canan, M; Cates, G D; Chen, C; Chen, J-P; Choi, S; Chudakov, E; Cusanno, F; Dalton, M M; Deconinck, W; de Jager, C W; Deng, X; Deur, A; Dutta, C; El Fassi, L; Franklin, G B; Friend, M; Gao, H; Garibaldi, F; Gilad, S; Gilman, R; Glamazdin, O; Golge, S; Gomez, J; Guo, L; Hansen, O; Higinbotham, D W; Holmstrom, T; Huang, J; Hyde, C; Ibrahim, H F; Jiang, X; Jin, G; Katich, J; Kelleher, A; Kolarkar, A; Korsch, W; Kumbartzki, G; LeRose, J J; Lindgren, R; Liyanage, N; Long, E; Lukhanin, A; Mamyan, V; McNulty, D; Meziani, Z-E; Michaels, R; Mihovilovič, M; Moffit, B; Muangma, N; Nanda, S; Narayan, A; Nelyubin, V; Norum, B; Nuruzzaman; Oh, Y; Peng, J C; Qian, X; Qiang, Y; Rakhman, A; Riordan, S; Saha, A; Sawatzky, B; Shabestari, M H; Shahinyan, A; Širca, S; Solvignon, P; Subedi, R; Sulkosky, V; Tobias, W A; Troth, W; Wang, D; Wang, Y; Wojtsekhowski, B; Yan, X; Yao, H; Ye, Y; Ye, Z; Yuan, L; Zhan, X; Zhang, Y; Zhang, Y-W; Zhao, B; Zheng, X

    2014-07-11

    Double-spin asymmetries and absolute cross sections were measured at large Bjorken x  (0.25≤x≤0.90), in both the deep-inelastic and resonance regions, by scattering longitudinally polarized electrons at beam energies of 4.7 and 5.9 GeV from a transversely and longitudinally polarized (3)He target. In this dedicated experiment, the spin structure function g(2)((3)He) was determined with precision at large x, and the neutron twist-3 matrix element d(2)(n) was measured at ⟨Q(2)⟩ of 3.21 and 4.32  GeV(2)/c(2), with an absolute precision of about 10(-5). Our results are found to be in agreement with lattice QCD calculations and resolve the disagreement found with previous data at ⟨Q(2)⟩=5  GeV(2)/c(2). Combining d(2)(n) and a newly extracted twist-4 matrix element f(2)(n), the average neutron color electric and magnetic forces were extracted and found to be of opposite sign and about 30  MeV/fm in magnitude.

  13. Highly multiparametric analysis by mass cytometry.

    PubMed

    Ornatsky, Olga; Bandura, Dmitry; Baranov, Vladimir; Nitz, Mark; Winnik, Mitchell A; Tanner, Scott

    2010-09-30

    This review paper describes a new technology, mass cytometry, that addresses applications typically run by flow cytometer analyzers, but extends the capability to highly multiparametric analysis. The detection technology is based on atomic mass spectrometry. It offers quantitation, specificity and dynamic range of mass spectrometry in a format that is familiar to flow cytometry practitioners. The mass cytometer does not require compensation, allowing the application of statistical techniques; this has been impossible given the constraints of fluorescence noise with traditional cytometry instruments. Instead of "colors" the mass cytometer "reads" the stable isotope tags attached to antibodies using metal-chelating labeling reagents. Because there are many available stable isotopes, and the mass spectrometer provides exquisite resolution between detection channels, many parameters can be measured as easily as one. For example, in a single tube the technique allows for the ready detection and characterization of the major cell subsets in blood or bone marrow. Here we describe mass cytometric immunophenotyping of human leukemia cell lines and leukemia patient samples, differential cell analysis of normal peripheral and umbilical cord blood; intracellular protein identification and metal-encoded bead arrays. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Twist effects in quantum vortices and phase defects

    NASA Astrophysics Data System (ADS)

    Zuccher, Simone; Ricca, Renzo L.

    2018-02-01

    In this paper we show that twist, defined in terms of rotation of the phase associated with quantum vortices and other physical defects effectively deprived of internal structure, is a property that has observable effects in terms of induced axial flow. For this we consider quantum vortices governed by the Gross-Pitaevskii equation (GPE) and perform a number of test cases to investigate and compare the effects of twist in two different contexts: (i) when this is artificially superimposed on an initially untwisted vortex ring; (ii) when it is naturally produced on the ring by the simultaneous presence of a central straight vortex. In the first case large amplitude perturbations quickly develop, generated by the unnatural setting of the initial condition that is not an analytical solution of the GPE. In the second case much milder perturbations emerge, signature of a genuine physical process. This scenario is confirmed by other test cases performed at higher twist values. Since the second setting corresponds to essential linking, these results provide new evidence of the influence of topology on physics.

  15. Low-Frequency Interlayer Raman Modes to Probe Interface of Twisted Bilayer MoS 2

    DOE PAGES

    Huang, Shengxi; Liang, Liangbo; Ling, Xi; ...

    2016-02-21

    A variety of van der Waals homo- and hetero- structures assembled by stamping monolayers together present optoelectronic properties suitable for diverse applications. Understanding the details of the interlayer stacking and resulting coupling is crucial for tuning these properties. Twisted bilayer transition metal dichalcogenides offer a great platform for developing a precise understanding of the structure/property relationship. Here, we study the low-frequency interlayer shear and breathing Raman modes (<50 cm-1) in twisted bilayer MoS 2 by Raman spectroscopy and first-principles modeling. Twisting introduces both rotational and translational shifts and significantly alters the interlayer stacking and coupling, leading to notable frequency andmore » intensity changes of low-frequency modes. The frequency variation can be up to 8 cm-1 and the intensity can vary by a factor of ~5 for twisting near 0 and 60 , where the stacking is a mixture of multiple high-symmetry stacking patterns and is thus especially sensitive to twisting. Moreover, for twisting angles between 20 and 40 , the interlayer coupling is nearly constant since the stacking results in mismatched lattices over the entire sample. It follows that the Raman signature is relatively uniform. Interestingly, unlike the breathing mode, the shear mode is extremely sensitive to twisting: it disappears between 20 and 40 as its frequency drops to almost zero due to the stacking-induced mismatch. Note that for some samples, multiple breathing mode peaks appear, indicating non-uniform coupling across the interface. In contrast to the low-frequency interlayer modes, high-frequency intralayer Raman modes are much less sensitive to interlayer stacking and coupling, showing negligible changes upon twisting. Our research demonstrates the effectiveness of low-frequency Raman modes for probing the interfacial coupling and environment of twisted bilayer MoS2, and potentially other two-dimensional materials and

  16. Web-Based Analysis and Publication of Flow Cytometry Experiments

    PubMed Central

    Kotecha, Nikesh; Krutzik, Peter O.; Irish, Jonathan M.

    2014-01-01

    Cytobank is a web-based application for storage, analysis, and sharing of flow cytometry experiments. Researchers use a web browser to log in and use a wide range of tools developed for basic and advanced flow cytometry. In addition to providing access to standard cytometry tools from any computer, Cytobank creates a platform and community for developing new analysis and publication tools. Figure layouts created on Cytobank are designed to allow transparent access to the underlying experiment annotation and data processing steps. Since all flow cytometry files and analysis data are stored on a central server, experiments and figures can be viewed or edited by anyone with the proper permissions from any computer with Internet access. Once a primary researcher has performed the initial analysis of the data, collaborators can engage in experiment analysis and make their own figure layouts using the gated, compensated experiment files. Cytobank is available to the scientific community at www.cytobank.org PMID:20578106

  17. Web-based analysis and publication of flow cytometry experiments.

    PubMed

    Kotecha, Nikesh; Krutzik, Peter O; Irish, Jonathan M

    2010-07-01

    Cytobank is a Web-based application for storage, analysis, and sharing of flow cytometry experiments. Researchers use a Web browser to log in and use a wide range of tools developed for basic and advanced flow cytometry. In addition to providing access to standard cytometry tools from any computer, Cytobank creates a platform and community for developing new analysis and publication tools. Figure layouts created on Cytobank are designed to allow transparent access to the underlying experiment annotation and data processing steps. Since all flow cytometry files and analysis data are stored on a central server, experiments and figures can be viewed or edited by anyone with the proper permission, from any computer with Internet access. Once a primary researcher has performed the initial analysis of the data, collaborators can engage in experiment analysis and make their own figure layouts using the gated, compensated experiment files. Cytobank is available to the scientific community at http://www.cytobank.org. (c) 2010 by John Wiley & Sons, Inc.

  18. Work Function Variations in Twisted Graphene Layers

    DOE PAGES

    Robinson, Jeremy T.; Culbertson, James; Berg, Morgann; ...

    2018-01-31

    By combining optical imaging, Raman spectroscopy, kelvin probe force microscopy (KFPM), and photoemission electron microscopy (PEEM), we show that graphene’s layer orientation, as well as layer thickness, measurably changes the surface potential (Φ). Detailed mapping of variable-thickness, rotationally-faulted graphene films allows us to correlate Φ with specific morphological features. Using KPFM and PEEM we measure ΔΦ up to 39 mV for layers with different twist angles, while ΔΦ ranges from 36–129 mV for different layer thicknesses. The surface potential between different twist angles or layer thicknesses is measured at the KPFM instrument resolution of ≤ 200 nm. The PEEM measuredmore » work function of 4.4 eV for graphene is consistent with doping levels on the order of 10 12cm -2. Here, we find that Φ scales linearly with Raman G-peak wavenumber shift (slope = 22.2 mV/cm -1) for all layers and twist angles, which is consistent with doping-dependent changes to graphene’s Fermi energy in the ‘high’ doping limit. Our results here emphasize that layer orientation is equally important as layer thickness when designing multilayer two-dimensional systems where surface potential is considered.« less

  19. Work Function Variations in Twisted Graphene Layers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robinson, Jeremy T.; Culbertson, James; Berg, Morgann

    By combining optical imaging, Raman spectroscopy, kelvin probe force microscopy (KFPM), and photoemission electron microscopy (PEEM), we show that graphene’s layer orientation, as well as layer thickness, measurably changes the surface potential (Φ). Detailed mapping of variable-thickness, rotationally-faulted graphene films allows us to correlate Φ with specific morphological features. Using KPFM and PEEM we measure ΔΦ up to 39 mV for layers with different twist angles, while ΔΦ ranges from 36–129 mV for different layer thicknesses. The surface potential between different twist angles or layer thicknesses is measured at the KPFM instrument resolution of ≤ 200 nm. The PEEM measuredmore » work function of 4.4 eV for graphene is consistent with doping levels on the order of 10 12cm -2. Here, we find that Φ scales linearly with Raman G-peak wavenumber shift (slope = 22.2 mV/cm -1) for all layers and twist angles, which is consistent with doping-dependent changes to graphene’s Fermi energy in the ‘high’ doping limit. Our results here emphasize that layer orientation is equally important as layer thickness when designing multilayer two-dimensional systems where surface potential is considered.« less

  20. Inner Surface Chirality of Single-Handed Twisted Carbonaceous Tubular Nanoribbons.

    PubMed

    Liu, Dan; Li, Baozong; Guo, Yongmin; Li, Yi; Yang, Yonggang

    2015-11-01

    Single-handed twisted 4,4'-biphenylene-bridged polybissilsesquioxane tubular nanoribbons and single-layered nanoribbons were prepared by tuning the water/ethanol volume ratio in the reaction mixture at pH = 11.6 through a supramolecular templating approach. The single-layered nanoribbons were formed by shrinking tubular nanoribbons after the removal of the templates. In addition, solvent-induced handedness inversion was achieved. The handedness of the polybissilsesquioxanes could be controlled by changing the ethanol/water volume ratio in the reaction mixture. After carbonization at 900 °C for 4.0 h and removal of silica, single-handed twisted carbonaceous tubular nanoribbons and single-layered nanoribbons with micropores in the walls were obtained. X-ray diffraction and Raman spectroscopy analyses indicated that the carbon is predominantly amorphous. The circular dichroism spectra show that the twisted tubular nanoribbons exhibit optical activity, while the twisted single-layered nanoribbons do not. The results shown here indicate that chirality is transferred from the organic self-assemblies to the inner surfaces of the 4,4'-biphenylene-bridged polybissilsesquioxane tubular nanoribbons and subsequently to those of the carbonaceous tubular nanoribbons. © 2015 Wiley Periodicals, Inc.

  1. Design and simulation of the micromixer with chaotic advection in twisted microchannels.

    PubMed

    Jen, Chun-Ping; Wu, Chung-Yi; Lin, Yu-Cheng; Wu, Ching-Yi

    2003-05-01

    Chaotic mixers with twisted microchannels were designed and simulated numerically in the present study. The phenomenon whereby a simple Eulerian velocity field may generate a chaotic response in the distribution of a Lagrangian marker is termed chaotic advection. Dynamic system theory indicates that chaotic particle motion can occur when a velocity field is either two-dimensional and time-dependent, or three-dimensional. In the present study, micromixers with three-dimensional structures of the twisted microchannel were designed in order to induce chaotic mixing. In addition to the basic T-mixer, three types of micromixers with inclined, oblique and wavelike microchannels were investigated. In the design of each twisted microchannel, the angle of the channels' bottoms alternates in each subsection. When the fluids enter the twisted microchannels, the flow sways around the varying structures within the microchannels. The designs of the twisted microchannels provide a third degree of freedom to the flow field in the microchannel. Therefore, chaotic regimes that lead to chaotic mixing may arise. The numerical results indicate that mixing occurs in the main channel and progressively larger mixing lengths are required as the Peclet number increased. The swaying of the flow in the twisted microchannel causes chaotic advection. Among the four micromixer designs, the micromixer with the inclined channel most improved mixing. Furthermore, using the inclined mixer with six subsections yielded optimum performance, decreasing the mixing length by up to 31% from that of the basic T-mixer.

  2. SET8 promotes epithelial–mesenchymal transition and confers TWIST dual transcriptional activities

    PubMed Central

    Yang, Fen; Sun, Luyang; Li, Qian; Han, Xiao; Lei, Liandi; Zhang, Hua; Shang, Yongfeng

    2012-01-01

    SET8 is implicated in transcriptional regulation, heterochromatin formation, genomic stability, cell-cycle progression, and development. As such, it is predicted that SET8 might be involved in the development and progression of tumour. However, whether and how SET8 might be implicated in tumourigenesis is currently unknown. Here, we report that SET8 is physically associated with TWIST, a master regulator of epithelial–mesenchymal transition (EMT). We demonstrated that SET8 and TWIST are functionally interdependent in promoting EMT and enhancing the invasive potential of breast cancer cells in vitro and in vivo. We showed that SET8 acts as a dual epigenetic modifier on the promoters of the TWIST target genes E-cadherin and N-cadherin via its H4K20 monomethylation activity. Significantly, in breast carcinoma samples, SET8 expression is positively correlated with metastasis and the expression of TWIST and N-cadherin and negatively correlated with E-cadherin. Together, our experiments revealed a novel role for SET8 in tumour invasion and metastasis and provide a molecular mechanism underlying TWIST-promoted EMT, suggesting SET8 as a potential target for intervention of the metastasis of breast cancer. PMID:21983900

  3. Nonpotential features observed in the magnetic field of an active region

    NASA Technical Reports Server (NTRS)

    Gary, G. A.; Moore, R. L.; Hagyard, M. J.; Haisch, Bernhard M.

    1987-01-01

    A unique coordinated data set consisting of vector magnetograms, H-alpha photographs, and high-resolution ultraviolet images of a solar active region is used, together with mathematical models, to calculate potential and force-free magnetic field lines and to examine the nonpotential nature of the active region structure. It is found that the overall bipolar magnetic field of the active region had a net twist corresponding to net current of order 3 x 10 to the 12th A and average density of order 4 x 10 to the -4th A/sq m flowing antiparallel to the field. There were three regions of enhanced nonpotentiality in the interior of the active region; in one the field had a marked nonpotential twist or shear with height above the photosphere. The measured total nonpotential magnetic energy stored in the entire active region was of order 10 to the 32nd ergs, about 3 sigma above the noise level.

  4. Application of magnetic carriers to two examples of quantitative cell analysis

    NASA Astrophysics Data System (ADS)

    Zhou, Chen; Qian, Zhixi; Choi, Young Suk; David, Allan E.; Todd, Paul; Hanley, Thomas R.

    2017-04-01

    The use of magnetophoretic mobility as a surrogate for fluorescence intensity in quantitative cell analysis was investigated. The objectives of quantitative fluorescence flow cytometry include establishing a level of labeling for the setting of parameters in fluorescence activated cell sorters (FACS) and the determination of levels of uptake of fluorescently labeled substrates by living cells. Likewise, the objectives of quantitative magnetic cytometry include establishing a level of labeling for the setting of parameters in flowing magnetic cell sorters and the determination of levels of uptake of magnetically labeled substrates by living cells. The magnetic counterpart to fluorescence intensity is magnetophoretic mobility, defined as the velocity imparted to a suspended cell per unit of magnetic ponderomotive force. A commercial velocimeter available for making this measurement was used to demonstrate both applications. Cultured Gallus lymphoma cells were immunolabeled with commercial magnetic beads and shown to have adequate magnetophoretic mobility to be separated by a novel flowing magnetic separator. Phagocytosis of starch nanoparticles having magnetic cores by cultured Chinese hamster ovary cells, a CHO line, was quantified on the basis of magnetophoretic mobility.

  5. Masks in Imaging Flow Cytometry

    PubMed Central

    Dominical, Venina; Samsel, Leigh; McCoy, J. Philip

    2016-01-01

    Data analysis in imaging flow cytometry incorporates elements of flow cytometry together with other aspects of morphological analysis of images. A crucial early step in this analysis is the creation of a mask to distinguish the portion of the image upon which further examination of specified features can be performed. Default masks are provided by the manufacturer of the imaging flow cytometer but additional custom masks can be created by the individual user for specific applications. Flawed or inaccurate masks can have a substantial negative impact on the overall analysis of a sample, thus great care must be taken to ensure the accuracy of masks. Here we discuss various types of masks and cite examples of their use. Furthermore we provide our insight for how to approach selecting and assessing the optimal mask for a specific analysis. PMID:27461256

  6. Universality, twisted fans, and the Ising model. [Renormalization, two-loop calculations, scale

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dash, J.W.; Harrington, S.J.

    1975-06-24

    Critical exponents are evaluated for the Ising model using universality in the form of ''twisted fans'' previously introduced in Reggeon field theory. The universality is with respect to scales induced through renormalization. Exact twists are obtained at ..beta.. = 0 in one loop for D = 2,3 with ..nu.. = 0.75 and 0.60 respectively. In two loops one obtains ..nu.. approximately 1.32 and 0.68. No twists are obtained for eta, however. The results for the standard two loop calculations are also presented as functions of a scale.

  7. Small Twisting Prominence

    NASA Image and Video Library

    2018-01-12

    A small prominence rose up above the sun, appeared to twist around for several hours, and then began to send some streams of plasma back into the sun (Jan. 3-4, 2018). The action, observed in a wavelength of extreme ultraviolet light, lasted just about one day. Prominences like this one are quite common. In fact, there were several over the past few days. For a sense of scale, the prominence reached up more than several times the size of Earth. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA22198

  8. Flow Cytometry Technician | Center for Cancer Research

    Cancer.gov

    PROGRAM DESCRIPTION The Basic Science Program (BSP) pursues independent, multidisciplinary research in basic and applied molecular biology, immunology, retrovirology, cancer biology, and human genetics. Research efforts and support are an integral part of the Center for Cancer Research (CCR) at the Frederick National Laboratory for Cancer Research (FNLCR). KEY ROLES/RESPONSIBILITIES The Flow Cytometry Core (Flow Core) of the Cancer and Inflammation Program (CIP) is a service core which supports the research efforts of the CCR by providing expertise in the field of flow cytometry (using analyzers and sorters) with the goal of gaining a more thorough understanding of the biology of cancer and cancer cells. The Flow Core provides service to 12-15 CIP laboratories and more than 22 non-CIP laboratories. Flow core staff provide technical advice on the experimental design of applications, which include immunological phenotyping, cell function assays, and cell cycle analysis. Work is performed per customer requirements, and no independent research is involved. The Flow Cytometry Technician will be responsible for: Monitor performance of and maintain high dimensional flow cytometer analyzers and cell sorters Operate high dimensional flow cytometer analyzers and cell sorters Monitoring lab supply levels and order lab supplies, perform various record keeping responsibilities Assist in the training of scientific end users on the use of flow cytometry in their research, as well as how to operate and troubleshoot the bench-top analyzer instruments Experience with sterile technique and tissue culture

  9. Magnetic fish-robot based on multi-motion control of a flexible magnetic actuator.

    PubMed

    Kim, Sung Hoon; Shin, Kyoosik; Hashi, Shuichiro; Ishiyama, Kazushi

    2012-09-01

    This paper presents a biologically inspired fish-robot driven by a single flexible magnetic actuator with a rotating magnetic field in a three-axis Helmholtz coil. Generally, magnetic fish-robots are powered by alternating and gradient magnetic fields, which provide a single motion such as bending the fish-robot's fins. On the other hand, a flexible magnetic actuator driven by an external rotating magnetic field can create several gaits such as the bending vibration, the twisting vibration, and their combination. Most magnetic fish-like micro-robots do not have pectoral fins on the side and are simply propelled by the tail fin. The proposed robot can swim and perform a variety of maneuvers with the addition of pectoral fins and control of the magnetic torque direction. In this paper, we find that the robot's dynamic actuation correlates with the magnetic actuator and the rotating magnetic field. The proposed robot is also equipped with new features, such as a total of six degrees of freedom, a new control method that stabilizes posture, three-dimensional swimming, a new velocity control, and new turning abilities.

  10. Flow Cytometry and Solid Organ Transplantation: A Perfect Match

    PubMed Central

    Maguire, Orla; Tario, Joseph D.; Shanahan, Thomas C.; Wallace, Paul K.; Minderman, Hans

    2015-01-01

    In the field of transplantation, flow cytometry serves a well-established role in pre-transplant crossmatching and monitoring immune reconstitution following hematopoietic stem cell transplantation. The capabilities of flow cytometers have continuously expanded and this combined with more detailed knowledge of the constituents of the immune system, their function and interaction and newly developed reagents to study these parameters have led to additional utility of flow cytometry-based analyses, particularly in the post-transplant setting. This review discusses the impact of flow cytometry on managing alloantigen reactions, monitoring opportunistic infections and graft rejection and gauging immunosuppression in the context of solid organ transplantation. PMID:25296232

  11. An analysis of rotor blade twist variables associated with different Euler sequences and pretwist treatments

    NASA Technical Reports Server (NTRS)

    Alkire, K.

    1984-01-01

    A nonlinear analysis which is necessary to adequately model elastic helicopter rotor blades experiencing moderately large deformations was examined. The analysis must be based on an appropriate description of the blade's deformation geometry including elastic bending and twist. Built-in pretwist angles complicate the deformation process ant its definition. Relationships between the twist variables associated with different rotation sequences and corresponding forms of the transformation matrix are lasted. Relationships between the twist variables associated with first, the pretwist combined with the deformation twist are included. Many of the corresponding forms of the transformation matrix for the two cases are listed. It is shown that twist variables connected with the combined twist treatment are related to those where the pretwist is applied initially. A method to determine the relationships and some results are outlined. A procedure to evaluate the transformation matrix that eliminates the Eulerlike sequence altogether is demonstrated. The resulting form of the transformation matrix is unaffected by rotation sequence or pretwist treatment.

  12. Twisted, multifilament Nb3Sn superconductive ribbon

    NASA Technical Reports Server (NTRS)

    Coles, W. D.

    1972-01-01

    An experimental study of superconductor stabilization has resulted in the successful application of the concepts of filamentary structure and conductor twist to Nb3Sn ribbon. The Nb3Sn is formed in parallel, helical paths, which are continuous around the ribbon. Short lengths (12-18cm) of 1.27 cm wide superconductive ribbon were produced. The filamentary and twist characteristics are incorporated in the ribbon by means of an inert mask formed on the ribbon surface early in the fabrication process. Diffusion reaction of the niobium and tin is prevented at the filament boundaries. Described are the conductor methods of fabrication, and test results obtained. The technology required to adapt the processes for the production of long lengths of ribbon is available.

  13. Magnetic diffusion and flare energy buildup

    NASA Technical Reports Server (NTRS)

    Wu, S. T.; Yin, C. L.; Yang, W.-H.

    1992-01-01

    Photospheric motion shears or twists solar magnetic fields to increase magnetic energy in the corona, because this process may change a current-free state of a coronal field to force-free states which carry electric current. This paper analyzes both linear and nonlinear 2D force-free magnetic field models and derives relations of magnetic energy buildup with photospheric velocity field. When realistic data of solar magnetic field and photospheric velocity field are used, it is found that 3-4 hours are needed to create an amount of free magnetic energy which is of the order of the current-free field energy. Furthermore, the paper studies situations in which finite magnetic diffusivities in photospheric plasma are introduced. The shearing motion increases coronal magnetic energy, while the photospheric diffusion reduces the energy. The variation of magnetic energy in the coronal region, then, depends on which process dominates.

  14. Elastic continuum theory: towards understanding of the twist-bend nematic phases.

    PubMed

    Barbero, G; Evangelista, L R; Rosseto, M P; Zola, R S; Lelidis, I

    2015-09-01

    The twist-bend nematic phase, N_{TB}, may be viewed as a heliconical molecular arrangement in which the director n precesses uniformly about an extra director field, t. It corresponds to a nematic ground state exhibiting nanoscale periodic modulation. To demonstrate the stability of this phase from the elastic point of view, a natural extension of the Frank elastic energy density is proposed. The elastic energy density is built in terms of the elements of symmetry of the new phase in which intervene the components of these director fields together with the usual Cartesian tensors. It is shown that the ground state corresponds to a deformed state for which K_{22}>K_{33}. In the framework of the model, the phase transition between the usual and the twist-bend nematic phase is of second order with a finite wave vector. The model does not require a negative K_{33} in agreement with recent experimental data that yield K_{33}>0. A threshold is predicted for the molecular twist power below which no transition to a twist-bend nematic may occur.

  15. High performance twisted and coiled soft actuator with spandex fiber for artificial muscles

    NASA Astrophysics Data System (ADS)

    Yang, Sang Yul; Cho, Kyeong Ho; Kim, Youngeun; Song, Min-Geun; Jung, Ho Sang; Yoo, Ji Wang; Moon, Hyungpil; Koo, Ja Choon; Nam, Jae-do; Ryeol Choi, Hyouk

    2017-10-01

    This paper reports the twisted and coiled soft actuator (abbreviated with STCA) with spandex fiber. The STCA exhibits higher actuation strain at lower temperature than the previous nylon twisted and coiled soft actuators (abbreviated with NTCAs). While NTCAs are fabricated using a twist-insertion process until coils are formed, a new method is developed to fabricate the STCA using the ultra-stretch of spandex, whereby the STCA is twisted again after the coil has been formed. A 6-gear-twist-insertion device that increases the stability and the fabrication speed is developed to fabricate the STCA. The superior performance exhibited by the STCA is due to the 14% contraction strain of the bare spandex (bare nylon: 4%) and the low spring constant of 0.0115 N mm-1. The maximum tensile actuation strain of STCA was 45% at 130 °C, and the maximum specific work was 1.523 kJ kg-1 at 130 °C. STCA could repeatedly actuate 100 times with a strain change of less than 0.4%.

  16. FuGEFlow: data model and markup language for flow cytometry.

    PubMed

    Qian, Yu; Tchuvatkina, Olga; Spidlen, Josef; Wilkinson, Peter; Gasparetto, Maura; Jones, Andrew R; Manion, Frank J; Scheuermann, Richard H; Sekaly, Rafick-Pierre; Brinkman, Ryan R

    2009-06-16

    Flow cytometry technology is widely used in both health care and research. The rapid expansion of flow cytometry applications has outpaced the development of data storage and analysis tools. Collaborative efforts being taken to eliminate this gap include building common vocabularies and ontologies, designing generic data models, and defining data exchange formats. The Minimum Information about a Flow Cytometry Experiment (MIFlowCyt) standard was recently adopted by the International Society for Advancement of Cytometry. This standard guides researchers on the information that should be included in peer reviewed publications, but it is insufficient for data exchange and integration between computational systems. The Functional Genomics Experiment (FuGE) formalizes common aspects of comprehensive and high throughput experiments across different biological technologies. We have extended FuGE object model to accommodate flow cytometry data and metadata. We used the MagicDraw modelling tool to design a UML model (Flow-OM) according to the FuGE extension guidelines and the AndroMDA toolkit to transform the model to a markup language (Flow-ML). We mapped each MIFlowCyt term to either an existing FuGE class or to a new FuGEFlow class. The development environment was validated by comparing the official FuGE XSD to the schema we generated from the FuGE object model using our configuration. After the Flow-OM model was completed, the final version of the Flow-ML was generated and validated against an example MIFlowCyt compliant experiment description. The extension of FuGE for flow cytometry has resulted in a generic FuGE-compliant data model (FuGEFlow), which accommodates and links together all information required by MIFlowCyt. The FuGEFlow model can be used to build software and databases using FuGE software toolkits to facilitate automated exchange and manipulation of potentially large flow cytometry experimental data sets. Additional project documentation, including

  17. FuGEFlow: data model and markup language for flow cytometry

    PubMed Central

    Qian, Yu; Tchuvatkina, Olga; Spidlen, Josef; Wilkinson, Peter; Gasparetto, Maura; Jones, Andrew R; Manion, Frank J; Scheuermann, Richard H; Sekaly, Rafick-Pierre; Brinkman, Ryan R

    2009-01-01

    Background Flow cytometry technology is widely used in both health care and research. The rapid expansion of flow cytometry applications has outpaced the development of data storage and analysis tools. Collaborative efforts being taken to eliminate this gap include building common vocabularies and ontologies, designing generic data models, and defining data exchange formats. The Minimum Information about a Flow Cytometry Experiment (MIFlowCyt) standard was recently adopted by the International Society for Advancement of Cytometry. This standard guides researchers on the information that should be included in peer reviewed publications, but it is insufficient for data exchange and integration between computational systems. The Functional Genomics Experiment (FuGE) formalizes common aspects of comprehensive and high throughput experiments across different biological technologies. We have extended FuGE object model to accommodate flow cytometry data and metadata. Methods We used the MagicDraw modelling tool to design a UML model (Flow-OM) according to the FuGE extension guidelines and the AndroMDA toolkit to transform the model to a markup language (Flow-ML). We mapped each MIFlowCyt term to either an existing FuGE class or to a new FuGEFlow class. The development environment was validated by comparing the official FuGE XSD to the schema we generated from the FuGE object model using our configuration. After the Flow-OM model was completed, the final version of the Flow-ML was generated and validated against an example MIFlowCyt compliant experiment description. Results The extension of FuGE for flow cytometry has resulted in a generic FuGE-compliant data model (FuGEFlow), which accommodates and links together all information required by MIFlowCyt. The FuGEFlow model can be used to build software and databases using FuGE software toolkits to facilitate automated exchange and manipulation of potentially large flow cytometry experimental data sets. Additional project

  18. Metastasis-associated in colon cancer-1 promotes vasculogenic mimicry in gastric cancer by upregulating TWIST1/2

    PubMed Central

    Wang, Lin; Lin, Li; Chen, Xi; Sun, Li; Liao, Yulin; Huang, Na; Liao, Wangjun

    2015-01-01

    Vasculogenic mimicry (VM) is a blood supply modality that is strongly associated with the epithelial-mesenchymal transition (EMT), TWIST1 activation and tumor progression. We previously reported that metastasis-associated in colon cancer-1 (MACC1) induced the EMT and was associated with a poor prognosis of patients with gastric cancer (GC), but it remains unknown whether MACC1 promotes VM and regulates the TWIST signaling pathway in GC. In this study, we investigated MACC1 expression and VM by immunohistochemistry in 88 patients with stage IV GC, and also investigated the role of TWIST1 and TWIST2 in MACC1-induced VM by using nude mice with GC xenografts and GC cell lines. We found that the VM density was significantly increased in the tumors of patients who died of GC and was positively correlated with MACC1 immunoreactivity (p < 0.05). The 3-year survival rate was only 8.6% in patients whose tumors showed double positive staining for MACC1 and VM, whereas it was 41.7% in patients whose tumors were negative for both MACC1 and VM. Moreover, nuclear expression of MACC1, TWIST1, and TWIST2 was upregulated in GC tissues compared with matched adjacent non-tumorous tissues (p < 0.05). Overexpression of MACC1 increased TWIST1/2 expression and induced typical VM in the GC xenografts of nude mice and in GC cell lines. MACC1 enhanced TWIST1/2 promoter activity and facilitated VM, while silencing of TWIST1 or TWIST2 inhibited VM. Hepatocyte growth factor (HGF) increased the nuclear translocation of MACC1, TWIST1, and TWIST2, while a c-Met inhibitor reduced these effects. These findings indicate that MACC1 promotes VM in GC by regulating the HGF/c-Met-TWIST1/2 signaling pathway, which means that MACC1 and this pathway are potential new therapeutic targets for GC. PMID:25895023

  19. Insulin-like growth factor-I induces CLU expression through Twist1 to promote prostate cancer growth.

    PubMed

    Takeuchi, Ario; Shiota, Masaki; Beraldi, Eliana; Thaper, Daksh; Takahara, Kiyoshi; Ibuki, Naokazu; Pollak, Michael; Cox, Michael E; Naito, Seiji; Gleave, Martin E; Zoubeidi, Amina

    2014-03-25

    Clusterin (CLU) is cytoprotective molecular chaperone that is highly expressed in castrate-resistant prostate cancer (CRPC). CRPC is also characterized by increased insulin-like growth factor (IGF)-I responsiveness which induces prostate cancer survival and CLU expression. However, how IGF-I induces CLU expression and whether CLU is required for IGF-mediated growth signaling remain unknown. Here we show that IGF-I induced CLU via STAT3-Twist1 signaling pathway. In response to IGF-I, STAT3 was phosphorylated, translocated to the nucleus and bound to the Twist1 promoter to activate Twist1 transcription. In turn, Twist1 bound to E-boxes on the CLU promoter and activated CLU transcription. Inversely, we demonstrated that knocking down Twist1 abrogated IGF-I induced CLU expression, indicating that Twist1 mediated IGF-I-induced CLU expression. When PTEN knockout mice were crossed with lit/lit mice, the resultant IGF-I deficiency suppressed Twist1 as well as CLU gene expression in mouse prostate glands. Moreover, both Twist1 and CLU knockdown suppressed prostate cancer growth accelerated by IGF-I, suggesting the relevance of this signaling not only in an in vitro, but also in an in vivo. Collectively, this study indicates that IGF-I induces CLU expression through sequential activation of STAT3 and Twist1, and suggests that this signaling cascade plays a critical role in prostate cancer pathogenesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  20. Mass cytometry: a highly multiplexed single-cell technology for advancing drug development.

    PubMed

    Atkuri, Kondala R; Stevens, Jeffrey C; Neubert, Hendrik

    2015-02-01

    Advanced single-cell analysis technologies (e.g., mass cytometry) that help in multiplexing cellular measurements in limited-volume primary samples are critical in bridging discovery efforts to successful drug approval. Mass cytometry is the state-of-the-art technology in multiparametric single-cell analysis. Mass cytometers (also known as cytometry by time-of-flight or CyTOF) combine the cellular analysis principles of traditional fluorescence-based flow cytometry with the selectivity and quantitative power of inductively coupled plasma-mass spectrometry. Standard flow cytometry is limited in the number of parameters that can be measured owing to the overlap in signal when detecting fluorescently labeled antibodies. Mass cytometry uses antibodies tagged to stable isotopes of rare earth metals, which requires minimal signal compensation between the different metal tags. This unique feature enables researchers to seamlessly multiplex up to 40 independent measurements on single cells. In this overview we first present an overview of mass cytometry and compare it with traditional flow cytometry. We then discuss the emerging and potential applications of CyTOF technology in the pharmaceutical industry, including quantitative and qualitative deep profiling of immune cells and their applications in assessing drug immunogenicity, extensive mapping of signaling networks in single cells, cell surface receptor quantification and multiplexed internalization kinetics, multiplexing sample analysis by barcoding, and establishing cell ontologies on the basis of phenotype and/or function. We end with a discussion of the anticipated impact of this technology on drug development lifecycle with special emphasis on the utility of mass cytometry in deciphering a drug's pharmacokinetics and pharmacodynamics relationship. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

  1. Multinode acoustic focusing for parallel flow cytometry

    PubMed Central

    Piyasena, Menake E.; Suthanthiraraj, Pearlson P. Austin; Applegate, Robert W.; Goumas, Andrew M.; Woods, Travis A.; López, Gabriel P.; Graves, Steven W.

    2012-01-01

    Flow cytometry can simultaneously measure and analyze multiple properties of single cells or particles with high sensitivity and precision. Yet, conventional flow cytometers have fundamental limitations with regards to analyzing particles larger than about 70 microns, analyzing at flow rates greater than a few hundred microliters per minute, and providing analysis rates greater than 50,000 per second. To overcome these limits, we have developed multi-node acoustic focusing flow cells that can position particles (as small as a red blood cell and as large as 107 microns in diameter) into as many as 37 parallel flow streams. We demonstrate the potential of such flow cells for the development of high throughput, parallel flow cytometers by precision focusing of flow cytometry alignment microspheres, red blood cells, and the analysis of CD4+ cellular immunophenotyping assay. This approach will have significant impact towards the creation of high throughput flow cytometers for rare cell detection applications (e.g. circulating tumor cells), applications requiring large particle analysis, and high volume flow cytometry. PMID:22239072

  2. Immunophenotyping of acute leukaemias by flow cytometry: a review.

    PubMed

    Pamnani, R

    2009-12-01

    To provide an overview of the utility of flow cytometry for phenotyping of acute leukaemias and selection-of monoclonal antibodies. The literature review was obtained through internet, journals and chapters in the relevant books. Relevant articles and chapters on immunophenotyping of acute leukaemias were selected from respected international journals and books in the field of haematology and were reviewed. Complete articles relevant to the topic were selected and reviewed and the necessary information extracted for this review. Flow cytometry has been used extensively in recent years to characterise haemopoeitic malignancies and done routinely in the developed world. This technique has greatly improved the diagnosis and classification of haemopoeitic malignancies and has been recommended by World Health Organisation classification (WHO) of tumours of haemopoeitic and lymphoid tissue. Application of flow cytometry for the diagnosis of leukaemias has been recently introduced in Kenya and is currently being undertaken in research using limited but appropriate panels of monoclonal antibodies. It is hoped that findings of this research will inform the use of flow cytometry as an ancillary diagnostic technique in our resource-constrained set up.

  3. Wrinkles, loops, and topological defects in twisted ribbons

    NASA Astrophysics Data System (ADS)

    Chopin, Julien

    Nature abounds with elastic ribbon like shapes including double-stranded semiflexible polymers, graphene and metal oxide nanoribbons which are examples of elongated elastic structures with a strongly anisotropic cross-section. Due to this specific geometry, it is far from trivial to anticipate if a ribbon should be considered as a flat flexible filament or a narrow thin plate. We thus perform an experiment in which a thin elastic ribbon is loaded using a twisting and traction device coupled with a micro X-ray computed tomography machine allowing a full 3D shape reconstruction. A wealth of morphological behaviors can be observed including wrinkled helicoids, curled and looped configurations, and faceted ribbons. In this talk, I will show that most morphologies can be understood using a far-from-threshold approach and simple scaling arguments. Further, we find that the various shapes can be organized in a phase diagram using the twist, the tension, and the geometry of the ribbon as control parameters. Finally, I will discuss the spontaneous formation of topological defects with negatively-signed Gaussian charge at large twist and small but finite stretch.

  4. Fiber-Optic Sensors for Measurements of Torsion, Twist and Rotation: A Review.

    PubMed

    Budinski, Vedran; Donlagic, Denis

    2017-02-23

    Optical measurement of mechanical parameters is gaining significant commercial interest in different industry sectors. Torsion, twist and rotation are among the very frequently measured mechanical parameters. Recently, twist/torsion/rotation sensors have become a topic of intense fiber-optic sensor research. Various sensing concepts have been reported. Many of those have different properties and performances, and many of them still need to be proven in out-of-the laboratory use. This paper provides an overview of basic approaches and a review of current state-of-the-art in fiber optic sensors for measurements of torsion, twist and/or rotation.Invited Paper.

  5. Define the Twist ATX LPAR1 Signaling Axis in Promoting Obesity Associated Triple Negative Breast Cancer

    DTIC Science & Technology

    2017-05-01

    developed CRISPR technology to examine if Twist enhances ATX and LPAR1 expression. Specifically, we performed lentiviral transduction of Twist...targeting gRNA into breast cancer cells MDA-MB-578 and SUM-1315, and selected single cell colony with Twist knockout. We chose CRISPR -gRNA over the...shRNA system which was originally proposed, as CRISPR provides higher specificity and fewer off-target effects. To verify knockout of Twist, we first

  6. Immunophenotyping by slide-based cytometry and by flow cytometry are comparable

    NASA Astrophysics Data System (ADS)

    Gerstner, Andreas O.; Laffers, Wiebke; Mittag, Anja; Daehnert, Ingo; Lenz, Domnik; Bootz, Friedrich; Bocsi, Jozsef; Tarnok, Attila

    2005-03-01

    Immunophenotyping of peripheral blood leukocytes (PBLs) is performed by flow cytometry (FCM) as the golden standard. Slide based cytometry systems for example laser scanning cytometer (LSC) can give additional information (repeated staining and scanning, morphology). In order to adequately judge on the clinical usefulness of immunophenotyping by LSC it is obligatory to compare it with the long established FCM assays. We performed this study to systematically compare the two methods, FCM and LSC for immunophenotyping and to test the correlation of the results. Leucocytes were stained with directly labeled monoclonal antibodies with whole blood staining method. Aliquots of the same paraformaldehyde fixed specimens were analyzed in a FACScan (BD-Biosciences) using standard protocols and parallel with LSC (CompuCyte) after placing to glass slide, drying and fixation by aceton and 7-AAD staining. Calculating the percentage distribution of PBLs obtained by LSC and by FCM shows very good correlation with regression coefficients close to 1.0 for the major populations (neutrophils, lymphocytes, and monocytes), as well as for the lymphocyte sub-populations (T-helper-, T-cytotoxic-, B-, NK-cells). LSC can be recommended for immunophenotyping of PBLs especially in cases where only very limited sample volumes are available or where additional analysis of the cells" morphology is important. There are limitations in the detection of rare leucocytes or weak antigens where appropriate amplification steps for immunofluorescence should be engaged.

  7. Thermodynamic properties of the S =1 /2 twisted triangular spin tube

    NASA Astrophysics Data System (ADS)

    Ito, Takuya; Iino, Chihiro; Shibata, Naokazu

    2018-05-01

    Thermodynamic properties of the twisted three-leg spin tube under magnetic field are studied by the finite-T density-matrix renormalization group method. The specific heat, spin, and chiral susceptibilities of the infinite system are calculated for both the original and its low-energy effective models. The obtained results show that the presence of the chirality is observed as a clear peak in the specific heat at low temperature and the contribution of the chirality dominates the low-temperature part of the specific heat as the exchange coupling along the spin tube decreases. The peak structures in the specific heat, spin, and chiral susceptibilities are strongly modified near the quantum phase transition where the critical behaviors of the spin and chirality correlations change. These results confirm that the chirality plays a major role in characteristic low-energy behaviors of the frustrated spin systems.

  8. Modeling and development of a twisting wing using inductively heated shape memory alloy actuators

    NASA Astrophysics Data System (ADS)

    Saunders, Robert N.; Hartl, Darren J.; Boyd, James G.; Lagoudas, Dimitris C.

    2015-04-01

    Wing twisting has been shown to improve aircraft flight performance. The potential benefits of a twisting wing are often outweighed by the mass of the system required to twist the wing. Shape memory alloy (SMA) actuators repeatedly demonstrate abilities and properties that are ideal for aerospace actuation systems. Recent advances have shown an SMA torsional actuator that can be manufactured and trained with the ability to generate large twisting deformations under substantial loading. The primary disadvantage of implementing large SMA actuators has been their slow actuation time compared to conventional actuators. However, inductive heating of an SMA actuator allows it to generate a full actuation cycle in just seconds rather than minutes while still . The aim of this work is to demonstrate an experimental wing being twisted to approximately 10 degrees by using an inductively heated SMA torsional actuator. This study also considers a 3-D electromagnetic thermo-mechanical model of the SMA-wing system and compare these results to experiments to demonstrate modeling capabilities.

  9. Superconducting magnet

    NASA Technical Reports Server (NTRS)

    1985-01-01

    Extensive computer based engineering design effort resulted in optimization of a superconducting magnet design with an average bulk current density of approximately 12KA/cm(2). Twisted, stranded 0.0045 inch diameter NbTi superconductor in a copper matrix was selected. Winding the coil from this bundle facilitated uniform winding of the small diameter wire. Test coils were wound using a first lot of the wire. The actual packing density was measured from these. Interwinding voltage break down tests on the test coils indicated the need for adjustment of the wire insulation on the lot of wire subsequently ordered for construction of the delivered superconducting magnet. Using the actual packing densities from the test coils, a final magnet design, with the required enhancement and field profile, was generated. All mechanical and thermal design parameters were then also fixed. The superconducting magnet was then fabricated and tested. The first test was made with the magnet immersed in liquid helium at 4.2K. The second test was conducted at 2K in vacuum. In the latter test, the magnet was conduction cooled from the mounting flange end.

  10. Polarization-dependent diffraction in all-dielectric, twisted-band structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kardaś, Tomasz M.; Jagodnicka, Anna; Wasylczyk, Piotr, E-mail: pwasylcz@fuw.edu.pl

    2015-11-23

    We propose a concept for light polarization management: polarization-dependent diffraction in all-dielectric microstructures. Numerical simulations of light propagation show that with an appropriately configured array of twisted bands, such structures may exhibit zero birefringence and at the same time diffract two circular polarizations with different efficiencies. Non-birefringent structures as thin as 3 μm have a significant difference in diffraction efficiency for left- and right-hand circular polarizations. We identify the structural parameters of such twisted-band matrices for optimum performance as circular polarizers.

  11. Spaceflight Flow Cytometry: Design Challenges and Applications

    NASA Technical Reports Server (NTRS)

    Pappas, Dimitri; Kao, Shih-Hsin; Jeevarajan, Antony S.

    2004-01-01

    Future space exploration missions will require analytical technology capable of providing both autonomous medical care to the crew and investigative capabilities to researchers. While several promising candidate technologies exist for further development, flow cytometry is an attractive technology as it offers both crew health and a wide array of biochemistry and immunology assays. While flow cytometry has been widely used for cellular analysis in both clinical and research settings, the requirements for proper operation in spaceflight impose constraints on any instrument designs. The challenges of designing a spaceflight-ready flow cytometer are discussed, as well as some preliminary results using a prototype system.

  12. Flow cytometry in the post fluorescence era.

    PubMed

    Nolan, Garry P

    2011-12-01

    While flow cytometry once enabled researchers to examine 10--15 cell surface parameters, new mass flow cytometry technology enables interrogation of up to 45 parameters on a single cell. This new technology has increased understanding of cell expression and how cells differentiate during hematopoiesis. Using this information, knowledge of leukemia cell biology has also increased. Other new technologies, such as SPADE analysis and single cell network profiling (SCNP), are enabling researchers to put different cancers into more biologically similar categories and have the potential to enable more personalized medicine. Copyright © 2011. Published by Elsevier Ltd.

  13. Controlling coupled bending-twisting vibrations of anisotropic composite wing

    NASA Astrophysics Data System (ADS)

    Ryabov, Victor; Yartsev, Boris

    2018-05-01

    The paper discusses the possibility to control coupled bending-twisting vibrations of anisotropic composite wing by means of the monoclinic structures in the reinforcement of the plating. Decomposing the potential straining energy and kinetic energy of natural vibration modes into interacting and non-interacting parts, it became possible to introduce the two coefficients that integrally consider the effect of geometry and reinforcement structure upon the dynamic response parameters of the wing. The first of these coefficients describes the elastic coupling of the natural vibration modes, the second coefficient describes the inertial one. The paper describes the numerical studies showing how the orientation of considerably anisotropic CRP layers in the plating affects natural frequencies, loss factors, coefficients of elastic and inertial coupling for several lower tones of natural bending-twisting vibrations of the wing. Besides, for each vibration mode, partial values of the above mentioned dynamic response parameters were determined by means of the relationships for orthotropic structures where instead of "free" shearing modulus in the reinforcement plant, "pure" shearing modulus is used. Joint analysis of the obtained results has shown that each pair of bending-twisting vibration modes has its orientation angle ranges of the reinforcing layers where the inertial coupling caused by asymmetry of the cross-section profile with respect to the main axes of inertia decreases, down to the complete extinction, due to the generation of the elastic coupling in the plating material. These ranges are characterized by the two main features: 1) the difference in the natural frequencies of the investigated pair of bending-twisting vibration modes is the minimum and 2) natural frequencies of bending-twisting vibrations belong to a stretch restricted by corresponding partial natural frequencies of the investigated pair of vibration modes. This result is of practical importance

  14. Terahertz conductivity of twisted bilayer graphene

    NASA Astrophysics Data System (ADS)

    Chia, Elbert E. M.; Zou, Xingquan; Shang, Jingzhi; Leaw, Jianing; Luo, Zhiqiang; Luo, Liyan; Cheong, Siew Ann; Su, Haibin; Zhu, Jian-Xin; Castro Neto, A. H.; Yu, Ting

    2013-03-01

    Using terahertz time-domain spectroscopy, the real part of optical conductivity [σ1 (ω) ] of twisted bilayer graphene was obtained at different temperatures (10 - 300 K) in the frequency range 0.3 - 3 THz. On top of a Drude-like response, we see a strong and narrow peak in σ1 (ω) at ~2.7 THz. We analyze the overall Drude-like response using a disorder-dependent (unitary scattering) model, then attribute the peak at 2.7 THz to an enhanced density of states at that energy, that is caused by the presence of van Hove singularities arising from a commensurate twisting of the two graphene layers. Singapore MOE AcRF Tier 2 (ARC 23/08), NRF-CRP (NRF-CRP4-2008-04), NNSA of the U.S. DOE at LANL (DE-AC52-06NA25396), LANL LDRD Program, NRF-CRP (R-144-000-295-281), DOE DE-FG02-08ER46512, ONR MURI N00014-09-1-1063.

  15. Development of an active twist rotor blade with distributed actuation and orthotropic material

    NASA Astrophysics Data System (ADS)

    Wierach, Peter; Riemenschneider, Johannes; Keye, Stefan

    2005-05-01

    Individual blade control (IBC) as well as higher harmonic control (HHC) for helicopter rotors promises to be a method to increase flight performance and to reduce vibration and noise. For those controls, an additional twist actuation of the rotor blade is needed. The developed concept comprises the implementation of distributed piezoelectric actuation into the rotor blade skin. In order to maximize the twist within given constraints, as torsional rigidity and given actuator design, the concept takes advantage of an orthotropic rotor blade skin. That way, a combination of shear actuation with orthotropic coupling generates more twist than each one of these effects alone. Previous approaches with distributed actuation used actuators operating in +/-45° direction with quasi-isotropic composites. A FE-Model of the blade was developed and validated using a simplified demonstrator. The objective of this study was to identify the effects of various geometric and material parameters to optimize the active twist performance of the blades. The whole development was embedded in an iterative process followed by an objective assessment. For this purpose a detailed structural model on the basis of the BO105 model rotor blade was developed, to predict the performance with respect to rotor dynamics, stability, aerodynamics and acoustics. Rotor dynamic simulations provided an initial overview of the active twist rotor performance. In comparison to the BO105 baseline rotor a noise reduction of 3 dB was predicted for an active twist of 0.8° at the blade tip. Additionally, a power reduction of 2.3% at 87m/s based on a 2.5 to BO105 was computed. A demonstrator blade with a rotor radius of 2m has been designed and manufactured. This blade will be tested to prove, that the calculated maximum twist can also be achieved under centrifugal loads.

  16. Coexistence of twisted and untwisted crystals: An impurity/structural order model with implications for agate patterns

    USGS Publications Warehouse

    Comer, J.; Ortoleva, P.

    2007-01-01

    Coexistence of twisted and untwisted crystals is explained via a model that accounts for the coupling of the entropic and energetic effects of impurities and a supra-lattice-scale structural order parameter. It is shown that twisted impure crystals can be in equilibrium with untwisted purer ones. The model explains how coexistence can occur in agates and other systems under hydrostatic stress. The model implies that untwisted crystals grown under one set of conditions could undergo a phase separation that, when accompanied by an imposed compositional gradient, leads to commonly observed, alternating bands of twisted and untwisted crystals and, when occurring in the absence of an external gradient, mossy patterns of crystal texture can emerge. This phenomenon is not related to anisotropic applied stress. Rather coexistence is a consequence of a compositional segregation/twist phase transition. Since twist coexistence is a compositional equilibrium, it arises from the exchange between bulk phases; hence, the detailed nature of the atomic structure within an interface between twisted and untwisted zones is not relevant. The approach places crystal-twist phenomena within the theory of order/disorder phase transitions.

  17. Colliding Magnetic Flux Ropes and Quasi-Separatrix Layers in a Laboratory Plasma

    NASA Astrophysics Data System (ADS)

    Lawrence, Eric Eugene

    An experimental study of the dynamics of colliding magnetic flux ropes and the magnetic reconnection that occurs during these collisions is presented. A magnetic flux rope is a bundle of twisted magnetic field lines that is ubiquitous in space and solar plasmas. The flux ropes are created in the Large Plasma Device (LAPD) using two heated lanthanum hexaboride (LaB6) cathodes that inject currents into the background plasma. The currents are initially parallel to the background magnetic field. The azimuthal field of each current together with the background axial field create helical twisted flux ropes. It is found that the flux ropes rotate in time (corkscrew) and collide with each other. During a collision, antiparallel magnetic fields can undergo magnetic reconnection. When these collisions occur, we observe current layers flowing in the opposite direction of the injected current, a signatuare of reconnection. Analysis of the three-dimensional magnetic field lines shows the existence of quasi-separatrix layers (QSLs). These are regions in the magnetic configuration where there are large spatial gradients in the connectivity of field line footpoints in the boundary surfaces. QSLs are thought to be favorable sites for magnetic reconnection. It is shown that the location and shape of the QSL is similar to what is seen in simulations of merging flux ropes. Furthermore, the field line structure of the QSL is similar to that of a twisted hyperbolic flux tube (HFT). An HFT is a type of QSL that has been shown to be a preferred site for current sheet formation in simulations of interacting coronal loops. The HFT in this experiment is found to be generally near the reverse current layers, although the agreement is not perfect. Looking at the time evolution of the QSL, we find that the QSL cross-sectional area grows and contracts at the same time that the flux ropes collide and that the reverse current layers appear. Analysis of the field line motion shows that, during

  18. Temperature-and field dependent characterization of a twisted stacked-tape cable

    NASA Astrophysics Data System (ADS)

    Barth, C.; Takayasu, M.; Bagrets, N.; Bayer, C. M.; Weiss, K.-P.; Lange, C.

    2015-04-01

    The twisted stacked-tape cable (TSTC) is one of the major high temperature superconductor cable concepts combining scalability, ease of fabrication and high current density making it a possible candidate as conductor for large scale magnets. To simulate the boundary conditions of such a magnets as well as the temperature dependence of TSTCs a 1.16 m long sample consisting of 40, 4 mm wide SuperPower REBCO tapes is characterized using the ‘FBI’ (force-field-current) superconductor test facility of the Institute for Technical Physics of the Karlsruhe Institute of Technology. In a first step, the magnetic background field is cycled while measuring the current carrying capabilities to determine the impact of Lorentz forces on the TSTC sample performance. In the first field cycle, the critical current of the TSTC sample is tested up to 12 T. A significant Lorentz force of up to 65.6 kN m-1 at the maximal magnetic background field of 12 T result in a 11.8% irreversible degradation of the current carrying capabilities. The degradation saturates (critical cable current of 5.46 kA at 4.2 K and 12 T background field) and does not increase in following field cycles. In a second step, the sample is characterized at different background fields (4-12 T) and surface temperatures (4.2-37.8 K) utilizing the variable temperature insert of the ‘FBI’ test facility. In a third step, the performance along the length of the sample is determined at 77 K, self-field. A 15% degradation is obtained for the central part of the sample which was within the high field region of the magnet during the in-field measurements.

  19. Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition.

    PubMed

    Khan, Md Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

    2015-08-14

    Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis.

  20. Thymoquinone inhibits cancer metastasis by downregulating TWIST1 expression to reduce epithelial to mesenchymal transition

    PubMed Central

    Khan, Md. Asaduzzaman; Tania, Mousumi; Wei, Chunli; Mei, Zhiqiang; Fu, Shelly; Cheng, Jingliang; Xu, Jianming; Fu, Junjiang

    2015-01-01

    Proteins that promote epithelial to mesenchymal transition (EMT) are associated with cancer metastasis. Inhibition of EMT regulators may be a promising approach in cancer therapy. In this study, Thymoquinone (TQ) was used to treat cancer cell lines to investigate its effects on EMT-regulatory proteins and cancer metastasis. We show that TQ inhibited cancer cell growth, migration and invasion in a dose-dependent manner. At the molecular level, TQ treatment decreased the transcriptional activity of the TWIST1 promoter and the mRNA expression of TWIST1, an EMT-promoting transcription factor. Accordingly, TQ treatment also decreased the expression of TWIST1-upregulated genes such as N-Cadherin and increased the expression of TWIST1-repressed genes such as E-Cadherin, resulting in a reduction of cell migration and invasion. TQ treatment also inhibited the growth and metastasis of cancer cell-derived xenograft tumors in mice but partially attenuated the migration and invasion in TWIST1-overexpressed cell lines. Furthermore, we found that TQ treatment enhanced the promoter DNA methylation of the TWIST1 gene in BT 549 cells. Together, these results demonstrate that TQ treatment inhibits TWIST1 promoter activity and decreases its expression, leading to the inhibition of cancer cell migration, invasion and metastasis. These findings suggest TQ as a potential small molecular inhibitor of cancer growth and metastasis. PMID:26023736

  1. Design and analysis of variable-twist tiltrotor blades using shape memory alloy hybrid composites

    NASA Astrophysics Data System (ADS)

    Park, Jae-Sang; Kim, Seong-Hwan; Jung, Sung Nam; Lee, Myeong-Kyu

    2011-01-01

    The tiltrotor blade, or proprotor, acts as a rotor in the helicopter mode and as a propeller in the airplane mode. For a better performance, the proprotor should have different built-in twist distributions along the blade span, suitable for each operational mode. This paper proposes a new variable-twist proprotor concept that can adjust the built-in twist distribution for given flight modes. For a variable-twist control, the present proprotor adopts shape memory alloy hybrid composites (SMAHC) containing shape memory alloy (SMA) wires embedded in the composite matrix. The proprotor of the Korea Aerospace Research Institute (KARI) Smart Unmanned Aerial Vehicle (SUAV), which is based on the tiltrotor concept, is used as a baseline proprotor model. The cross-sectional properties of the variable-twist proprotor are designed to maintain the cross-sectional properties of the original proprotor as closely as possible. However, the torsion stiffness is significantly reduced to accommodate the variable-twist control. A nonlinear flexible multibody dynamic analysis is employed to investigate the dynamic characteristics of the proprotor such as natural frequency and damping in the whirl flutter mode, the blade structural loads in a transition flight and the rotor performance in hover. The numerical results show that the present proprotor is designed to have a strong similarity to the baseline proprotor in dynamic and load characteristics. It is demonstrated that the present proprotor concept could be used to improve the hover performance adaptively when the variable-twist control using the SMAHC is applied appropriately.

  2. Reproducibility of Echocardiograph-Derived Multilevel Left Ventricular Apical Twist Mechanics.

    PubMed

    Stewart, Glenn M; Yamada, Akira; Kavanagh, Justin J; Haseler, Luke J; Chan, Jonathan; Sabapathy, Surendran

    2016-02-01

    Left ventricular (LV) twist mechanics are routinely assessed via echocardiography in clinical and research trials investigating the function of obliquely oriented myocardial fibers. However, echocardiograph-derived measures of LV twist may be compromised by nonstandardized acquisition of the apical image. This study examined the reproducibility of echocardiograph-derived parameters of apical twist mechanics at multiple levels of the apical myocardium. Two sets of 2D LV parasternal short-axis images were obtained in 30 healthy subjects (24 men; 19-57 year) via echocardiography. Images were acquired immediately distal to the papillary muscles (apical image 1), immediately above the point of LV cavity obliteration at end systole (apical image 3), and midway between apical image 1 and apical image 3 (apical image 2). Repeat scans were performed within 1 hour, and twist mechanics (rotation and rotation rate) were calculated via frame-by-frame tracking of natural acoustic echocardiographic markers (speckle tracking). The magnitude of apical rotation increased progressively toward the apex (apical image 1: 4.2 ± 2.1°, apical image 2: 7.2 ± 3.9°, apical image 3: 11.8 ± 4.6°). apical images 1, 2, and 3 each had moderate to good correlations between repeat scans (ICC: 0.531-0.856). When apical images 1, 2, and 3 were averaged, rotation was 7.7 ± 2.7° and between-scan correlation was excellent (ICC: 0.910). Similar results were observed for systolic and diastolic rotation rates. Averaging multiple standardized apical images, tending progressively toward the apex, generated the most reproducible rotation indices and may be optimal for the assessment of LV twist mechanics across therapeutic, interventional, and research studies; however, care should be taken given the influence of acquisition level on the magnitude of apical rotation. © 2015, Wiley Periodicals, Inc.

  3. Magnetic Untwisting in Most Solar X-Ray Jets

    NASA Technical Reports Server (NTRS)

    Moore, Ronald; Sterling, Alphonse; Falconer, David; Robe, Dominic

    2013-01-01

    From 54 X-ray jets observed in the polar coronal holes by Hinode's X-Ray Telescope (XRT) during coverage in movies from Solar Dynamic Observatory's Atmospheric Imaging Assembly (AIA) taken in its He II 304 Å band at a cadence of 12 s, we have established a basic characteristic of solar X-ray jets: untwisting motion in the spire. In this presentation, we show the progression of few of these X-ray jets in XRT images and track their untwisting in AIA He II images. From their structure displayed in their XRT movies, 19 jets were evidently standard jets made by interchange reconnection of the magnetic-arcade base with ambient open field, 32 were evidently blowout jets made by blowout eruption of the base arcade, and 3 were of ambiguous form. As was anticipated from the >10,000 km span of the base arcade in most polar X-ray jets and from the disparity of standard jets and blowout jets in their magnetic production, few of the standard X-ray jets (3 of 19) but nearly all of the blowout X-ray jets (29 of 32) carried enough cool (T is approximately 105 K) plasma to be seen in their He II movies. In the 32 X-ray jets that showed a cool component, the He II movies show 10-100 km/s untwisting motions about the axis of the spire in all 3 standard jets and in 26 of the 29 blowout jets. Evidently, the open magnetic field in nearly all blowout X-ray jets and probably in most standard X-ray jets carries transient twist. This twist apparently relaxes by propagating out along the open field as a torsional wave. High-resolution spectrograms and Dopplergrams have shown that most Type-II spicules have torsional motions of 10-30 km/s. Our observation of similar torsional motion in X-ray jets strengthens the case for Type-II spicules being made in the same way as X-ray jets, by blowout eruption of a twisted magnetic arcade in the spicule base and/or by interchange reconnection of the twisted base arcade with the ambient open field. This work was funded by NASA's Heliophysics Division

  4. Dualities and Topological Field Theories from Twisted Geometries

    NASA Astrophysics Data System (ADS)

    Markov, Ruza

    I will present three studies of string theory on twisted geometries. In the first calculation included in this dissertation we use gauge/gravity duality to study the Coulomb branch of an unusual type of nonlocal field theory, called Puff Field Theory. On the gravity side, this theory is given in terms of D3-branes in type IIB string theory with a geometric twist. While the field theory description, available in the IR limit, is a deformation of Yang-Mills gauge theory by an order seven operator which we here compute. In the rest of this dissertation we explore N = 4 super Yang-Mills (SYM) theory compactied on a circle with S-duality and R-symmetry twists that preserve N = 6 supersymmetry in 2 + 1D. It was shown that abelian theory on a flat manifold gives Chern-Simons theory in the low-energy limit and here we are interested in the non-abelian counterpart. To that end, we introduce external static supersymmetric quark and anti-quark sources into the theory and calculate the Witten Index of the resulting Hilbert space of ground states on a two-torus. Using these results we compute the action of simple Wilson loops on the Hilbert space of ground states without sources. In some cases we find disagreement between our results for the Wilson loop eigenvalues and previous conjectures about a connection with Chern-Simons theory. The last result discussed in this dissertation demonstrates a connection between gravitational Chern-Simons theory and N = 4 four-dimensional SYM theory compactified on a circle twisted by S-duality where the remaining three-manifold is not flat starting with the explicit geometric realization of S-duality in terms of (2, 0) theory.

  5. Left ventricular twisting mechanics and exercise in healthy individuals: a systematic review

    PubMed Central

    Drury, C Taylor; Bredin, Shannon SD; Phillips, Aaron A; Warburton, Darren ER

    2012-01-01

    The aim of this study was to review systematically the effects of exercise on left ventricular (LV) twisting mechanics in healthy individuals. Literature searches were conducted in electronic databases for articles reporting measures of LV twisting mechanics in healthy individuals before and during/after exercise. Upon review, 18 articles were analyzed. Studies were separated by exercise type into the following four categories to allow for detailed comparisons: submaximal, prolonged endurance, maximal, and chronic endurance. Despite an overall methodological quality of low to moderate and within-group variations in exercise intensity, duration, and subject characteristics, important trends in the literature emerged. Most important, the coupling of LV systolic twisting and diastolic untwisting was present in all exercise types, as both were either improved or impaired concomitantly, highlighting the linkage between systole and diastole provided through LV twist. In addition, trends regarding the effects of age, training status, and cardiac loading also became apparent within different exercise types. Furthermore, a potential dose-response relationship between exercise duration and the degree of impairment to LV twisting mechanics was found. Although some disagreement existed in results, the observed trends provide important directions for future research. Future investigations should be of higher methodological quality and should include consistent exercise protocols and subject populations in order to minimize the variability between investigations. PMID:24198592

  6. Gate induced monolayer behavior in twisted bilayer black phosphorus

    NASA Astrophysics Data System (ADS)

    Sevik, Cem; Wallbank, John R.; Gülseren, Oğuz; Peeters, François M.; Çakır, Deniz

    2017-09-01

    Optical and electronic properties of black phosphorus strongly depend on the number of layers and type of stacking. Using first-principles calculations within the framework of density functional theory, we investigate the electronic properties of bilayer black phosphorus with an interlayer twist angle of 90°. These calculations are complemented with a simple k\\centerdot p model which is able to capture most of the low energy features and is valid for arbitrary twist angles. The electronic spectrum of 90° twisted bilayer black phosphorus is found to be x-y isotropic in contrast to the monolayer. However x-y anisotropy, and a partial return to monolayer-like behavior, particularly in the valence band, can be induced by an external out-of-plane electric field. Moreover, the preferred hole effective mass can be rotated by 90° simply by changing the direction of the applied electric field. In particular, a + 0.4 (-0.4) V {{{\\mathringA}}-1} out-of-plane electric field results in a  ˜60% increase in the hole effective mass along the \\mathbf{y} (\\mathbf{x} ) axis and enhances the m\\mathbf{y}\\ast/m\\mathbf{x}\\ast (m\\mathbf{x}\\ast/m\\mathbf{y}\\ast ) ratio as much as by a factor of 40. Our DFT and k\\centerdot p simulations clearly indicate that the twist angle in combination with an appropriate gate voltage is a novel way to tune the electronic and optical properties of bilayer phosphorus and it gives us a new degree of freedom to engineer the properties of black phosphorus based devices.

  7. Discriminating cellular heterogeneity using microwell-based RNA cytometry

    PubMed Central

    Dimov, Ivan K.; Lu, Rong; Lee, Eric P.; Seita, Jun; Sahoo, Debashis; Park, Seung-min; Weissman, Irving L.; Lee, Luke P.

    2014-01-01

    Discriminating cellular heterogeneity is important for understanding cellular physiology. However, it is limited by the technical difficulties of single-cell measurements. Here, we develop a two-stage system to determine cellular heterogeneity. In the first stage, we perform multiplex single-cell RNA-cytometry in a microwell array containing over 60,000 reaction chambers. In the second stage, we use the RNA-cytometry data to determine cellular heterogeneity by providing a heterogeneity likelihood score. Moreover, we use Monte-Carlo simulation and RNA-cytometry data to calculate the minimum number of cells required for detecting heterogeneity. We applied this system to characterize the RNA distributions of aging related genes in a highly purified mouse hematopoietic stem cell population. We identified genes that reveal novel heterogeneity of these cells. We also show that changes in expression of genes such as Birc6 during aging can be attributed to the shift of relative portions of cells in the high-expressing subgroup versus low-expressing subgroup. PMID:24667995

  8. Ferroptosis and Cell Death Analysis by Flow Cytometry.

    PubMed

    Chen, Daishi; Eyupoglu, Ilker Y; Savaskan, Nicolai

    2017-01-01

    Cell death and its recently discovered regulated form ferroptosis are characterized by distinct morphological, electrophysiological, and pharmacological features. In particular ferroptosis can be induced by experimental compounds and clinical drugs (i.e., erastin, sulfasalazine, sorafenib, and artesunate) in various cell types and cancer cells. Pharmacologically, this cell death process can be inhibited by iron chelators and lipid peroxidation inhibitors. Relevance of this specific cell death form has been found in different pathological conditions such as cancer, neurotoxicity, neurodegeneration, and ischemia. Distinguishing cell viability and cell death is essential for experimental and clinical applications and a key component in flow cytometry experiments. Dead cells can compromise the integrity of the data by nonspecific binding of antibodies and dyes. Therefore it is essential that dead cells are robustly and reproducibly identified and characterized by means of cytometry application. Here we describe a procedure to detect and quantify cell death and its specific form ferroptosis based on standard flow cytometry techniques.

  9. DC conductivity of twisted bilayer graphene: Angle-dependent transport properties and effects of disorder

    NASA Astrophysics Data System (ADS)

    Andelković, M.; Covaci, L.; Peeters, F. M.

    2018-03-01

    The in-plane dc conductivity of twisted bilayer graphene is calculated using an expansion of the real-space Kubo-Bastin conductivity in terms of Chebyshev polynomials. We investigate within a tight-binding approach the transport properties as a function of rotation angle, applied perpendicular electric field, and vacancy disorder. We find that for high-angle twists, the two layers are effectively decoupled, and the minimum conductivity at the Dirac point corresponds to double the value observed in monolayer graphene. This remains valid even in the presence of vacancies, hinting that chiral symmetry is still preserved. On the contrary, for low twist angles, the conductivity at the Dirac point depends on the twist angle and is not protected in the presence of disorder. Furthermore, for low angles and in the presence of an applied electric field, we find that the chiral boundary states emerging between AB and BA regions contribute to the dc conductivity, despite the appearance of localized states in the AA regions. The results agree qualitatively with recent transport experiments in low-angle twisted bilayer graphene.

  10. Twists and turns in the body: an imaging spectrum.

    PubMed

    Luk, Shiobhon Y; Fung, K H

    2010-10-01

    Life is full of twists and turns. These surprises can sometimes be wonderfully invigorating. Twists and turns can also occur in the body, however, sometimes with dangerous consequences. Torsion and volvulus are important causes of acute abdominal pain. The clinical symptoms and signs associated with torsion and volvulus are often non-specific and are difficult to diagnose clinically. Clinicians frequently rely on imaging methods to make the diagnosis. Prompt and accurate diagnosis is important to avoid the life-threatening complications of torsion and volvulus. Therefore, it is helpful to be familiar with the features of torsion and volvulus.

  11. Robustifying twist-and-turn entanglement with interaction-based readout

    NASA Astrophysics Data System (ADS)

    Mirkhalaf, Safoura S.; Nolan, Samuel P.; Haine, Simon A.

    2018-05-01

    The use of multiparticle entangled states has the potential to drastically increase the sensitivity of atom interferometers and atomic clocks. The twist-and-turn (TNT) Hamiltonian can create multiparticle entanglement much more rapidly than the ubiquitous one-axis twisting Hamiltonian in the same spin system. In this paper, we consider the effects of detection noise—a key limitation in current experiments—on the metrological usefulness of nonclassical states generated under TNT dynamics. We also consider a variety of interaction-based readouts to maximize their performance. Interestingly, the optimum interaction-based readout is not the obvious case of perfect time reversal.

  12. Families of vector-like deformations of relativistic quantum phase spaces, twists and symmetries

    NASA Astrophysics Data System (ADS)

    Meljanac, Daniel; Meljanac, Stjepan; Pikutić, Danijel

    2017-12-01

    Families of vector-like deformed relativistic quantum phase spaces and corresponding realizations are analyzed. A method for a general construction of the star product is presented. The corresponding twist, expressed in terms of phase space coordinates, in the Hopf algebroid sense is presented. General linear realizations are considered and corresponding twists, in terms of momenta and Poincaré-Weyl generators or gl(n) generators are constructed and R-matrix is discussed. A classification of linear realizations leading to vector-like deformed phase spaces is given. There are three types of spaces: (i) commutative spaces, (ii) κ -Minkowski spaces and (iii) κ -Snyder spaces. The corresponding star products are (i) associative and commutative (but non-local), (ii) associative and non-commutative and (iii) non-associative and non-commutative, respectively. Twisted symmetry algebras are considered. Transposed twists and left-right dual algebras are presented. Finally, some physical applications are discussed.

  13. Chiral tunneling in a twisted graphene bilayer.

    PubMed

    He, Wen-Yu; Chu, Zhao-Dong; He, Lin

    2013-08-09

    The perfect transmission in a graphene monolayer and the perfect reflection in a Bernal graphene bilayer for electrons incident in the normal direction of a potential barrier are viewed as two incarnations of the Klein paradox. Here we show a new and unique incarnation of the Klein paradox. Owing to the different chiralities of the quasiparticles involved, the chiral fermions in a twisted graphene bilayer show an adjustable probability of chiral tunneling for normal incidence: they can be changed from perfect tunneling to partial or perfect reflection, or vice versa, by controlling either the height of the barrier or the incident energy. As well as addressing basic physics about how the chiral fermions with different chiralities tunnel through a barrier, our results provide a facile route to tune the electronic properties of the twisted graphene bilayer.

  14. Effect of the cross sectional aspect ratio on the flow past a twisted cylinder

    NASA Astrophysics Data System (ADS)

    Jung, Jae Hwan; Yoon, Hyun Sik

    2013-11-01

    The cross-flow around twisted cylinders of cross sectional aspect ratio (A/B) from 1 to 2.25 is investigated at a subcritical Reynolds number (Re) of 3000 using large eddy simulation (LES). The flow past a corresponding smooth and wavy cylinder is also calculated for comparison and validation against experimental data. The effect of twisted surface assessed in terms of the mean drag and root-mean-square (RMS) value of fluctuating lift. The shear layer of the twisted cylinder covering the recirculation region is more elongated than those of the smooth and the wavy cylinder. Successively, vortex shedding of the twisted cylinder is considerably suppressed, compared with those of the smooth and the wavy cylinder. The maximum drag reduction of up to 13% compared with a smooth cylinder is obtained at a certain cross sectional aspect ratio. The fluctuating lift coefficient of the twisted cylinder is also significantly suppressed. We found that the cross sectional cross sectional aspect ratio (A/B) plays an essential role in determining the vortical structures behind the twisted cylinder which has a significant effect on the reduction of the fluctuating lift and suppression of flow-induced vibration. This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIP) through GCRC-SOP (No. 2011-0030013).

  15. TiO2/water Nanofluid Heat Transfer in Heat Exchanger Equipped with Double Twisted-Tape Inserts

    NASA Astrophysics Data System (ADS)

    Eiamsa-ard, S.; Ketrain, R.; Chuwattanakul, V.

    2018-05-01

    Nowadays, heat transfer enhancement plays an important role in improving efficiency of heat transfer and thermal systems for numerous areas such as heat recovery processes, chemical reactors, air-conditioning/refrigeration system, food engineering, solar air/water heater, cooling of high power electronics etc. The present work presents the experimental results of the heat transfer enhancement of TiO2/water nanofluid in a heat exchanger tube fitted with double twisted tapes. The study covered twist ratios of twisted tapes (y/w) of 1.5, 2.0, and 2.5) while the concentration of the nanofluid was kept constant at 0.05% by volume. Observations show that heat transfer, friction loss and thermal performance increase as twist ratio (y/w) decreases. The use of the nanofluid in the tube equipped with the double twisted-tapes with the smallest twist ratio (y/w = 1.5) results in the increases of heat transfer rates and friction factor up to 224.8% and 8.98 times, respectively as compared to those of water. In addition, the experimental results performed that double twisted tapes induced dual swirling-flows which played an important role in improving fluid mixing and heat transfer enhancement. It is also observed that the TiO2/water nanofluid was responsible for low pressure loss behaviors.

  16. Large-N solution of the heterotic CP(N-1) model with twisted masses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bolokhov, Pavel A.; Department of Physics and Astronomy, University of Victoria, Victoria, BC, V8P 1A1; Shifman, Mikhail

    2010-07-15

    We address a number of unanswered questions in the N=(0,2)-deformed CP(N-1) model with twisted masses. In particular, we complete the program of solving the CP(N-1) model with twisted masses in the large-N limit. In A. Gorsky, M. Shifman, and A. Yung, Phys. Rev. D 73, 065011 (2006), a nonsupersymmetric version of the model with the Z{sub N} symmetric twisted masses was analyzed in the framework of Witten's method. In M. Shifman and A. Yung, Phys. Rev. D 77, 125017 (2008), this analysis was extended: the large-N solution of the heterotic N=(0,2) CP(N-1) model with no twisted masses was found. Heremore » we solve this model with the twisted masses switched on. Dynamical scenarios at large and small m are studied (m is the twisted-mass scale). We found three distinct phases and two phase transitions on the m plane. Two phases with the spontaneously broken Z{sub N} symmetry are separated by a phase with unbroken Z{sub N}. This latter phase is characterized by a unique vacuum and confinement of all U(1) charged fields (''quarks''). In the broken phases (one of them is at strong coupling) there are N degenerate vacua and no confinement, similarly to the situation in the N=(2,2) model. Supersymmetry is spontaneously broken everywhere except a circle |m|={Lambda} in the Z{sub N}-unbroken phase. Related issues are considered. In particular, we discuss the mirror representation for the heterotic model in a certain limiting case.« less

  17. Design of Restoration Method Based on Compressed Sensing and TwIST Algorithm

    NASA Astrophysics Data System (ADS)

    Zhang, Fei; Piao, Yan

    2018-04-01

    In order to improve the subjective and objective quality of degraded images at low sampling rates effectively,save storage space and reduce computational complexity at the same time, this paper proposes a joint restoration algorithm of compressed sensing and two step iterative threshold shrinkage (TwIST). The algorithm applies the TwIST algorithm which used in image restoration to the compressed sensing theory. Then, a small amount of sparse high-frequency information is obtained in frequency domain. The TwIST algorithm based on compressed sensing theory is used to accurately reconstruct the high frequency image. The experimental results show that the proposed algorithm achieves better subjective visual effects and objective quality of degraded images while accurately restoring degraded images.

  18. Joint research effort on vibrations of twisted plates, phase 1: Final results

    NASA Technical Reports Server (NTRS)

    Kielb, R. E.; Leissa, A. W.; Macbain, J. C.; Carney, K. S.

    1985-01-01

    The complete theoretical and experimental results of the first phase of a joint government/industry/university research study on the vibration characteristics of twisted cantilever plates are given. The study is conducted to generate an experimental data base and to compare many different theoretical methods with each other and with the experimental results. Plates with aspect ratios, thickness ratios, and twist angles representative of current gas turbine engine blading are investigated. The theoretical results are generated by numerous finite element, shell, and beam analysis methods. The experimental results are obtained by precision matching a set of twisted plates and testing them at two laboratories. The second and final phase of the study will concern the effects of rotation.

  19. Methods and apparatus for twist bend coupled (TCB) wind turbine blades

    DOEpatents

    Moroz, Emilian Mieczyslaw; LeMieux, David Lawrence; Pierce, Kirk Gee

    2006-10-10

    A method for controlling a wind turbine having twist bend coupled rotor blades on a rotor mechanically coupled to a generator includes determining a speed of a rotor blade tip of the wind turbine, measuring a current twist distribution and current blade loading, and adjusting a torque of a generator to change the speed of the rotor blade tip to thereby increase an energy capture power coefficient of the wind turbine.

  20. Rise of the micromachines: microfluidics and the future of cytometry.

    PubMed

    Wlodkowic, Donald; Darzynkiewicz, Zbigniew

    2011-01-01

    The past decade has brought many innovations to the field of flow and image-based cytometry. These advancements can be seen in the current miniaturization trends and simplification of analytical components found in the conventional flow cytometers. On the other hand, the maturation of multispectral imaging cytometry in flow imaging and the slide-based laser scanning cytometers offers great hopes for improved data quality and throughput while proving new vistas for the multiparameter, real-time analysis of cells and tissues. Importantly, however, cytometry remains a viable and very dynamic field of modern engineering. Technological milestones and innovations made over the last couple of years are bringing the next generation of cytometers out of centralized core facilities while making it much more affordable and user friendly. In this context, the development of microfluidic, lab-on-a-chip (LOC) technologies is one of the most innovative and cost-effective approaches toward the advancement of cytometry. LOC devices promise new functionalities that can overcome current limitations while at the same time promise greatly reduced costs, increased sensitivity, and ultra high throughputs. We can expect that the current pace in the development of novel microfabricated cytometric systems will open up groundbreaking vistas for the field of cytometry, lead to the renaissance of cytometric techniques and most importantly greatly support the wider availability of these enabling bioanalytical technologies. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Rise of the Micromachines: Microfluidics and the Future of Cytometry

    PubMed Central

    Wlodkowic, Donald; Darzynkiewicz, Zbigniew

    2011-01-01

    The past decade has brought many innovations to the field of flow and image-based cytometry. These advancements can be seen in the current miniaturization trends and simplification of analytical components found in the conventional flow cytometers. On the other hand, the maturation of multispectral imaging cytometry in flow imaging and the slide-based laser scanning cytometers offers great hopes for improved data quality and throughput while proving new vistas for the multiparameter, real-time analysis of cells and tissues. Importantly, however, cytometry remains a viable and very dynamic field of modern engineering. Technological milestones and innovations made over the last couple of years are bringing the next generation of cytometers out of centralized core facilities while making it much more affordable and user friendly. In this context, the development of microfluidic, lab-on-a-chip (LOC) technologies is one of the most innovative and cost-effective approaches toward the advancement of cytometry. LOC devices promise new functionalities that can overcome current limitations while at the same time promise greatly reduced costs, increased sensitivity, and ultra high throughputs. We can expect that the current pace in the development of novel microfabricated cytometric systems will open up groundbreaking vistas for the field of cytometry, lead to the renaissance of cytometric techniques and most importantly greatly support the wider availability of these enabling bioanalytical technologies. PMID:21704837

  2. CytometryML: a data standard which has been designed to interface with other standards

    NASA Astrophysics Data System (ADS)

    Leif, Robert C.

    2007-02-01

    Because of the differences in the requirements, needs, and past histories including existing standards of the creating organizations, a single encompassing cytology-pathology standard will not, in the near future, replace the multiple existing or under development standards. Except for DICOM and FCS, these standardization efforts are all based on XML. CytometryML is a collection of XML schemas, which are based on the Digital Imaging and Communications in Medicine (DICOM) and Flow Cytometry Standard (FCS) datatypes. The CytometryML schemas contain attributes that link them to the DICOM standard and FCS. Interoperability with DICOM has been facilitated by, wherever reasonable, limiting the difference between CytometryML and the previous standards to syntax. In order to permit the Resource Description Framework, RDF, to reference the CytometryML datatypes, id attributes have been added to many CytometryML elements. The Laboratory Digital Imaging Project (LDIP) Data Exchange Specification and the Flowcyt standards development effort employ RDF syntax. Documentation from DICOM has been reused in CytometryML. The unity of analytical cytology was demonstrated by deriving a microscope type and a flow cytometer type from a generic cytometry instrument type. The feasibility of incorporating the Flowcyt gating schemas into CytometryML has been demonstrated. CytometryML is being extended to include many of the new DICOM Working Group 26 datatypes, which describe patients, specimens, and analytes. In situations where multiple standards are being created, interoperability can be facilitated by employing datatypes based on a common set of semantics and building in links to standards that employ different syntax.

  3. High-order orbital angular momentum mode generator based on twisted photonic crystal fiber.

    PubMed

    Fu, Cailing; Liu, Shen; Wang, Ying; Bai, Zhiyong; He, Jun; Liao, Changrui; Zhang, Yan; Zhang, Feng; Yu, Bin; Gao, Shecheng; Li, Zhaohui; Wang, Yiping

    2018-04-15

    High-order orbital angular momentum (OAM) modes, namely, OAM +5 and OAM +6 , were generated and demonstrated experimentally by twisting a solid-core hexagonal photonic crystal fiber (PCF) during hydrogen-oxygen flame heating. Leaky orbital resonances in the cladding depend strongly on the twist rate and length of the helical PCF. Moreover, the generated high-order OAM mode could be a polarized mode. The secret of the successful observation of high-order modes is that leaky orbital resonances in the twisted PCF cladding have a high coupling efficiency of more than -20  dB.

  4. Fiber-Optic Sensors for Measurements of Torsion, Twist and Rotation: A Review †

    PubMed Central

    Budinski, Vedran; Donlagic, Denis

    2017-01-01

    Optical measurement of mechanical parameters is gaining significant commercial interest in different industry sectors. Torsion, twist and rotation are among the very frequently measured mechanical parameters. Recently, twist/torsion/rotation sensors have become a topic of intense fiber-optic sensor research. Various sensing concepts have been reported. Many of those have different properties and performances, and many of them still need to be proven in out-of-the laboratory use. This paper provides an overview of basic approaches and a review of current state-of-the-art in fiber optic sensors for measurements of torsion, twist and/or rotation. PMID:28241510

  5. Electrically and magnetically dual-driven Janus particles for handwriting-enabled electronic paper

    NASA Astrophysics Data System (ADS)

    Komazaki, Y.; Hirama, H.; Torii, T.

    2015-04-01

    In this work, we describe the synthesis of novel electrically and magnetically dual-driven Janus particles for a handwriting-enabled twisting ball display via the microfluidic technique. One hemisphere of the Janus particles contains a charge control agent, which allows the display color to be controlled by applying a voltage and superparamagnetic nanoparticles, allows handwriting by applying a magnetic field to the display. We fabricated a twisting ball display utilizing these Janus particles and tested the electric color control and handwriting using a magnet. As a result, the display was capable of permitting handwriting with a small magnet in addition to conventional color control using an applied voltage (80 V). Handwriting performance was improved by increasing the concentration of superparamagnetic nanoparticles and was determined to be possible even when 80 V was applied across the electrodes for 4 wt. % superparamagnetic nanoparticles in one hemisphere. This improvement was impossible when the concentration was reduced to 2 wt. % superparamagnetic nanoparticles. The technology presented in our work can be applied to low-cost, lightweight, highly visible, and energy-saving electronic message boards and large whiteboards because the large-size display can be fabricated easily due to its simple structure.

  6. Analysis of a Caenorhabditis elegans Twist homolog identifies conserved and divergent aspects of mesodermal patterning

    PubMed Central

    Harfe, Brian D.; Gomes, Ana Vaz; Kenyon, Cynthia; Liu, Jun; Krause, Michael; Fire, Andrew

    1998-01-01

    Mesodermal development is a multistep process in which cells become increasingly specialized to form specific tissue types. In Drosophila and mammals, proper segregation and patterning of the mesoderm involves the bHLH factor Twist. We investigated the activity of a Twist-related factor, CeTwist, during Caenorhabditis elegans mesoderm development. Embryonic mesoderm in C. elegans derives from a number of distinct founder cells that are specified during the early lineages; in contrast, a single blast cell (M) is responsible for all nongonadal mesoderm formation during postembryonic development. Using immunofluorescence and reporter fusions, we determined the activity pattern of the gene encoding CeTwist. No activity was observed during specification of mesodermal lineages in the early embryo; instead, the gene was active within the M lineage and in a number of mesodermal cells with nonstriated muscle fates. A role for CeTwist in postembryonic mesodermal cell fate specification was indicated by ectopic expression and genetic interference assays. These experiments showed that CeTwist was responsible for activating two target genes normally expressed in specific subsets of nonstriated muscles derived from the M lineage. In vitro and in vivo assays suggested that CeTwist cooperates with the C. elegans E/Daughterless homolog in directly activating these targets. The two target genes that we have studied, ceh-24 and egl-15, encode an NK-2 class homeodomain and an FGF receptor (FGFR) homolog, respectively. Twist activates FGFR and NK-homeodomain target genes during mesodermal patterning of Drosophila and similar target interactions have been proposed to modulate mesenchymal growth during closure of the vertebrate skull. These results suggest the possibility that a conserved pathway may be used for diverse functions in mesodermal specification. PMID:9716413

  7. Measurement of Lipid Accumulation in Chlorella vulgaris via Flow Cytometry and Liquid-State ¹H NMR Spectroscopy for Development of an NMR-Traceable Flow Cytometry Protocol

    PubMed Central

    Bono Jr., Michael S.; Garcia, Ravi D.; Sri-Jayantha, Dylan V.; Ahner, Beth A.; Kirby, Brian J.

    2015-01-01

    In this study, we cultured Chlorella vulgaris cells with a range of lipid contents, induced via nitrogen starvation, and characterized them via flow cytometry, with BODIPY 505/515 as a fluorescent lipid label, and liquid-state 1H NMR spectroscopy. In doing so, we demonstrate the utility of calibrating flow cytometric measurements of algal lipid content using triacylglyceride (TAG, also known as triacylglycerol or triglyceride) content per cell as measured via quantitative 1H NMR. Ensemble-averaged fluorescence of BODIPY-labeled cells was highly correlated with average TAG content per cell measured by bulk NMR, with a linear regression yielding a linear fit with r 2 = 0.9974. This correlation compares favorably to previous calibrations of flow cytometry protocols to lipid content measured via extraction, and calibration by NMR avoids the time and complexity that is generally required for lipid quantitation via extraction. Flow cytometry calibrated to a direct measurement of TAG content can be used to investigate the distribution of lipid contents for cells within a culture. Our flow cytometry measurements showed that Chlorella vulgaris cells subjected to nitrogen limitation exhibited higher mean lipid content but a wider distribution of lipid content that overlapped the relatively narrow distribution of lipid content for replete cells, suggesting that nitrogen limitation induces lipid accumulation in only a subset of cells. Calibration of flow cytometry protocols using direct in situ measurement of TAG content via NMR will facilitate rapid development of more precise flow cytometry protocols, enabling investigation of algal lipid accumulation for development of more productive algal biofuel feedstocks and cultivation protocols. PMID:26267664

  8. Measurement of lipid accumulation in Chlorella vulgaris via flow cytometry and liquid-state ¹H NMR spectroscopy for development of an NMR-traceable flow cytometry protocol.

    PubMed

    Bono, Michael S; Garcia, Ravi D; Sri-Jayantha, Dylan V; Ahner, Beth A; Kirby, Brian J

    2015-01-01

    In this study, we cultured Chlorella vulgaris cells with a range of lipid contents, induced via nitrogen starvation, and characterized them via flow cytometry, with BODIPY 505/515 as a fluorescent lipid label, and liquid-state 1H NMR spectroscopy. In doing so, we demonstrate the utility of calibrating flow cytometric measurements of algal lipid content using triacylglyceride (TAG, also known as triacylglycerol or triglyceride) content per cell as measured via quantitative 1H NMR. Ensemble-averaged fluorescence of BODIPY-labeled cells was highly correlated with average TAG content per cell measured by bulk NMR, with a linear regression yielding a linear fit with r2 = 0.9974. This correlation compares favorably to previous calibrations of flow cytometry protocols to lipid content measured via extraction, and calibration by NMR avoids the time and complexity that is generally required for lipid quantitation via extraction. Flow cytometry calibrated to a direct measurement of TAG content can be used to investigate the distribution of lipid contents for cells within a culture. Our flow cytometry measurements showed that Chlorella vulgaris cells subjected to nitrogen limitation exhibited higher mean lipid content but a wider distribution of lipid content that overlapped the relatively narrow distribution of lipid content for replete cells, suggesting that nitrogen limitation induces lipid accumulation in only a subset of cells. Calibration of flow cytometry protocols using direct in situ measurement of TAG content via NMR will facilitate rapid development of more precise flow cytometry protocols, enabling investigation of algal lipid accumulation for development of more productive algal biofuel feedstocks and cultivation protocols.

  9. An empirically-based model for the lift coefficients of twisted airfoils with leading-edge tubercles

    NASA Astrophysics Data System (ADS)

    Ni, Zao; Su, Tsung-chow; Dhanak, Manhar

    2018-04-01

    Experimental data for untwisted airfoils are utilized to propose a model for predicting the lift coefficients of twisted airfoils with leading-edge tubercles. The effectiveness of the empirical model is verified through comparison with results of a corresponding computational fluid-dynamic (CFD) study. The CFD study is carried out for both twisted and untwisted airfoils with tubercles, the latter shown to compare well with available experimental data. Lift coefficients of twisted airfoils predicted from the proposed empirically-based model match well with the corresponding coefficients determined using the verified CFD study. Flow details obtained from the latter provide better insight into the underlying mechanism and behavior at stall of twisted airfoils with leading edge tubercles.

  10. Defects in crystalline packings of twisted filament bundles. I. Continuum theory of disclinations.

    PubMed

    Grason, Gregory M

    2012-03-01

    We develop the theory of the coupling between in-plane order and out-of-plane geometry in twisted, two-dimensionally ordered filament bundles based on the nonlinear continuum elasticity theory of columnar materials. We show that twisted textures of filament backbones necessarily introduce stresses into the cross-sectional packing of bundles and that these stresses are formally equivalent to the geometrically induced stresses generated in thin elastic sheets that are forced to adopt spherical curvature. As in the case of crystalline order on curved membranes, geometrically induced stresses couple elastically to the presence of topological defects in the in-plane order. We derive the effective theory of multiple disclination defects in the cross section of bundle with a fixed twist and show that above a critical degree of twist, one or more fivefold disclinations is favored in the elastic energy ground state. We study the structure and energetics of multidisclination packings based on models of equilibrium and nonequilibrium cross-sectional order.

  11. Design and analysis of adaptive Super-Twisting sliding mode control for a microgyroscope.

    PubMed

    Feng, Zhilin; Fei, Juntao

    2018-01-01

    This paper proposes a novel adaptive Super-Twisting sliding mode control for a microgyroscope under unknown model uncertainties and external disturbances. In order to improve the convergence rate of reaching the sliding surface and the accuracy of regulating and trajectory tracking, a high order Super-Twisting sliding mode control strategy is employed, which not only can combine the advantages of the traditional sliding mode control with the Super-Twisting sliding mode control, but also guarantee that the designed control system can reach the sliding surface and equilibrium point in a shorter finite time from any initial state and avoid chattering problems. In consideration of unknown parameters of micro gyroscope system, an adaptive algorithm based on Lyapunov stability theory is designed to estimate the unknown parameters and angular velocity of microgyroscope. Finally, the effectiveness of the proposed scheme is demonstrated by simulation results. The comparative study between adaptive Super-Twisting sliding mode control and conventional sliding mode control demonstrate the superiority of the proposed method.

  12. Symmetries and Invariants of Twisted Quantum Algebras and Associated Poisson Algebras

    NASA Astrophysics Data System (ADS)

    Molev, A. I.; Ragoucy, E.

    We construct an action of the braid group BN on the twisted quantized enveloping algebra U q'( {o}N) where the elements of BN act as automorphisms. In the classical limit q → 1, we recover the action of BN on the polynomial functions on the space of upper triangular matrices with ones on the diagonal. The action preserves the Poisson bracket on the space of polynomials which was introduced by Nelson and Regge in their study of quantum gravity and rediscovered in the mathematical literature. Furthermore, we construct a Poisson bracket on the space of polynomials associated with another twisted quantized enveloping algebra U q'( {sp}2n). We use the Casimir elements of both twisted quantized enveloping algebras to reproduce and construct some well-known and new polynomial invariants of the corresponding Poisson algebras.

  13. A Twist on Facial Selectivity of Hydride Reductions of Cyclic Ketones: Twist-Boat Conformers in Cyclohexanone, Piperidone, and Tropinone Reactions

    PubMed Central

    2015-01-01

    The role of twist-boat conformers of cyclohexanones in hydride reductions was explored. The hydride reductions of a cis-2,6-disubstituted N-acylpiperidone, an N-acyltropinone, and tert-butylcyclohexanone by lithium aluminum hydride and by a bulky borohydride reagent were investigated computationally and compared to experiment. Our results indicate that in certain cases, factors such as substrate conformation, nucleophile bulkiness, and remote steric features can affect stereoselectivity in ways that are difficult to predict by the general Felkin–Anh model. In particular, we have calculated that a twist-boat conformation is relevant to the reactivity and facial selectivity of hydride reduction of cis-2,6-disubstituted N-acylpiperidones with a small hydride reagent (LiAlH4) but not with a bulky hydride (lithium triisopropylborohydride). PMID:25372509

  14. Quantifying the Topology and Evolution of a Magnetic Flux Rope Associated with Multi-flare Activities

    NASA Astrophysics Data System (ADS)

    Yang, Kai; Guo, Yang; Ding, M. D.

    2016-06-01

    Magnetic flux ropes (MFRs) play an important role in solar activities. The quantitative assessment of the topology of an MFR and its evolution is crucial for a better understanding of the relationship between the MFR and associated activities. In this paper, we investigate the magnetic field of active region (AR) 12017 from 2014 March 28-29, during which time 12 flares were triggered by intermittent eruptions of a filament (either successful or confined). Using vector magnetic field data from the Helioseismic and Magnetic Imager on board the Solar Dynamics Observatory, we calculate the magnetic energy and helicity injection in the AR, and extrapolate the 3D magnetic field with a nonlinear force-free field model. From the extrapolations, we find an MFR that is cospatial with the filament. We further determine the configuration of this MFR from the closed quasi-separatrix layer (QSL) around it. Then, we calculate the twist number and the magnetic helicity for the field lines composing the MFR. The results show that the closed QSL structure surrounding the MFR becomes smaller as a consequence of flare occurrence. We also find that the flares in our sample are mainly triggered by kink instability. Moreover, the twist number varies more sensitively than other parameters with the occurrence of flares.

  15. In vivo plant flow cytometry: A first proof-of-concept

    PubMed Central

    Nedosekin, Dmitry A.; Khodakovskaya, Mariya V.; Biris, Alexandru S.; Wang, Daoyuan; Xu, Yang; Villagarcia, Hector; Galanzha, Ekaterina I.; Zharov, Vladimir P.

    2011-01-01

    In vivo flow cytometry has facilitated advances in the ultrasensitive detection of tumor cells, bacteria, nanoparticles, dyes, and other normal and abnormal objects directly in blood and lymph circulatory systems. Here, we propose in vivo plant flow cytometry for the real-time noninvasive study of nanomaterial transport in xylem and phloem plant vascular systems. As a proof of this concept, we demonstrate in vivo real-time photoacoustic monitoring of quantum dot-carbon nanotube conjugate uptake and uptake by roots and spreading through stem to leaves in a tomato plant. In addition, in vivo scanning cytometry using multimodal photoacoustic, photothermal, and fluorescent detection schematics provided multiplex detection and identification of nanoparticles accumulated in plant leaves in the presence of intensive absorption, scattering, and autofluorescent backgrounds. The use of a portable fiber-based photoacoustic flow cytometer for studies of plant vasculature was demonstrated. These integrated cytometry modalities using both endogenous and exogenous contrast agents have a potential to open new avenues of in vivo study of the nutrients, products of photosynthesis and metabolism, nanoparticles, infectious agents, and other objects transported through plant vasculature. PMID:21905208

  16. Flow Cytometry Data Preparation Guidelines for Improved Automated Phenotypic Analysis.

    PubMed

    Jimenez-Carretero, Daniel; Ligos, José M; Martínez-López, María; Sancho, David; Montoya, María C

    2018-05-15

    Advances in flow cytometry (FCM) increasingly demand adoption of computational analysis tools to tackle the ever-growing data dimensionality. In this study, we tested different data input modes to evaluate how cytometry acquisition configuration and data compensation procedures affect the performance of unsupervised phenotyping tools. An analysis workflow was set up and tested for the detection of changes in reference bead subsets and in a rare subpopulation of murine lymph node CD103 + dendritic cells acquired by conventional or spectral cytometry. Raw spectral data or pseudospectral data acquired with the full set of available detectors by conventional cytometry consistently outperformed datasets acquired and compensated according to FCM standards. Our results thus challenge the paradigm of one-fluorochrome/one-parameter acquisition in FCM for unsupervised cluster-based analysis. Instead, we propose to configure instrument acquisition to use all available fluorescence detectors and to avoid integration and compensation procedures, thereby using raw spectral or pseudospectral data for improved automated phenotypic analysis. Copyright © 2018 by The American Association of Immunologists, Inc.

  17. How the embryonic brain tube twists

    NASA Astrophysics Data System (ADS)

    Chen, Zi; Guo, Qiaohang; Forsch, Nickolas; Taber, Larry

    2014-03-01

    During early development, the tubular brain of the chick embryo undergoes a combination of progressive ventral bending and rightward torsion. This deformation is one of the major organ-level symmetry-breaking events in development. Available evidence suggests that bending is caused by differential growth, but the mechanism for torsion remains poorly understood. Since the heart almost always loops in the same direction that the brain twists, researchers have speculated that heart looping affects the direction of brain torsion. However, direct evidence is virtually nonexistent, nor is the mechanical origin of such torsion understood. In our study, experimental perturbations show that the bending and torsional deformations in the brain are coupled and that the vitelline membrane applies an external load necessary for torsion to occur. In addition, the asymmetry of the looping heart gives rise to the chirality of the twisted brain. A computational model is used to interpret these findings. Our work clarifies the mechanical origins of brain torsion and the associated left-right asymmetry, reminiscent of D'Arcy Thompson's view of biological form as ``diagram of forces''.

  18. Visualization of Flows in Packed Beds of Twisted Tapes

    NASA Technical Reports Server (NTRS)

    Hendricks, R. C.; Braun, M. J.; Peloso, D.; Athavale, M. M.; Mullen, R. L.

    2002-01-01

    A videotape presentation of the flow field in a packed bed of 48 twisted tapes which can be simulated by very thin virtual cylinders has been assembled. The indices of refraction of the oil and the Lucite twisted tapes were closely matched, and the flow was seeded with magnesium oxide particles. Planar laser light projected the flow field in two dimensions both along and transverse to the flow axis. The flow field was three dimensional and complex to describe, yet the most prominent finding was flow threads. It appeared that axial flow spiraled along either within the confines of a virtual cylindrical boundary or within the exterior region, between the tangency points, of the virtual cylinders. Random packing and bed voids created vortices and disrupted the laminar flow but minimized the entrance effects. The flow-pressure drops in the packed bed fell below the Ergun model for porous-media flows. Single-twisted-tape results of Smithberg and Landis (1964) were used to guide the analysis. In appendix A the results of several investigators are scaled to the Ergun model. Further investigations including different geometric configurations, computational fluid dynamic (CFD) gridding, and analysis are required.

  19. Recurrent Mutations in the Basic Domain of TWIST2 Cause Ablepharon Macrostomia and Barber-Say Syndromes.

    PubMed

    Marchegiani, Shannon; Davis, Taylor; Tessadori, Federico; van Haaften, Gijs; Brancati, Francesco; Hoischen, Alexander; Huang, Haigen; Valkanas, Elise; Pusey, Barbara; Schanze, Denny; Venselaar, Hanka; Vulto-van Silfhout, Anneke T; Wolfe, Lynne A; Tifft, Cynthia J; Zerfas, Patricia M; Zambruno, Giovanna; Kariminejad, Ariana; Sabbagh-Kermani, Farahnaz; Lee, Janice; Tsokos, Maria G; Lee, Chyi-Chia R; Ferraz, Victor; da Silva, Eduarda Morgana; Stevens, Cathy A; Roche, Nathalie; Bartsch, Oliver; Farndon, Peter; Bermejo-Sanchez, Eva; Brooks, Brian P; Maduro, Valerie; Dallapiccola, Bruno; Ramos, Feliciano J; Chung, Hon-Yin Brian; Le Caignec, Cédric; Martins, Fabiana; Jacyk, Witold K; Mazzanti, Laura; Brunner, Han G; Bakkers, Jeroen; Lin, Shuo; Malicdan, May Christine V; Boerkoel, Cornelius F; Gahl, William A; de Vries, Bert B A; van Haelst, Mieke M; Zenker, Martin; Markello, Thomas C

    2015-07-02

    Ablepharon macrostomia syndrome (AMS) and Barber-Say syndrome (BSS) are rare congenital ectodermal dysplasias characterized by similar clinical features. To establish the genetic basis of AMS and BSS, we performed extensive clinical phenotyping, whole exome and candidate gene sequencing, and functional validations. We identified a recurrent de novo mutation in TWIST2 in seven independent AMS-affected families, as well as another recurrent de novo mutation affecting the same amino acid in ten independent BSS-affected families. Moreover, a genotype-phenotype correlation was observed, because the two syndromes differed based solely upon the nature of the substituting amino acid: a lysine at TWIST2 residue 75 resulted in AMS, whereas a glutamine or alanine yielded BSS. TWIST2 encodes a basic helix-loop-helix transcription factor that regulates the development of mesenchymal tissues. All identified mutations fell in the basic domain of TWIST2 and altered the DNA-binding pattern of Flag-TWIST2 in HeLa cells. Comparison of wild-type and mutant TWIST2 expressed in zebrafish identified abnormal developmental phenotypes and widespread transcriptome changes. Our results suggest that autosomal-dominant TWIST2 mutations cause AMS or BSS by inducing protean effects on the transcription factor's DNA binding. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  20. TWISTED RIBBON FUEL ELEMENT

    DOEpatents

    Breden, C.R.; Schultz, A.B.

    1961-06-01

    A reactor core formed of bundles of parallel fuel elements in the form of ribbons is patented. The fuel ribbons are twisted about their axes so as to have contact with one another at regions spaced lengthwise of the ribbons and to be out of contact with one another at locations between these spaced regions. The contact between the ribbons is sufficient to allow them to be held together in a stable bundle in a containing tube without intermediate support, while permitting enough space between the ribbon for coolant flowing.

  1. How is the relationship between TWIST-1 and BCR-ABL1 gene expressions in chronic myeloid leukaemia patients?

    PubMed

    Heidari, Nazanin; Vosoughi, Tina; Mohammadi Asl, Javad; Saki Malehi, Amal; Saki, Najmaldin

    2018-01-12

    The activation and increased expression of BCR-ABL1 lead to malignant chronic myelogenous leukaemia (CML) cells, as well as the resistance to antitumour agents and apoptosis inducers. Moreover, TWIST-1 protein is a prognostic factor of leukemogenesis, and its level is raised in CML patients with cytogenetic resistance to imatinib. So, there is a likely relationship between BCR-ABL1 and TWIST-1 genes. The aim of the study was to assess the relationship between TWIST-1 and BCR-ABL1 expressions. Peripheral blood samples were obtained from 44 CML patients under treatment and also from ten healthy subjects as normal controls. The expression of TWIST-1 and BCR-ABL1 genes was measured using real-time PCR, and ABL1 was used as the reference gene. The gene expression was evaluated by REST software. The expression levels of TWIST-1 and BCR-ABL1 genes in CML patients was changed 40.23 ± 177.75-fold and 6 ± 18-fold, respectively. No significant relationship was observed between the expressions of TWIST-1 and BCR-ABL1 genes. All patients with TWIST-1 expression levels ≥100-fold had failure of response to treatment. The probability of the relationship between BCR-ABL1 and TWIST-1 is still debatable, and the average of TWIST-1 expression has been higher in patients without response to treatment. Definitive conclusion needs further investigations.

  2. Heat Transfer Enhancement of Laminar Nanofluids Flow in a Circular Tube Fitted with Parabolic-Cut Twisted Tape Inserts

    PubMed Central

    Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

    2014-01-01

    Numerical investigation has been carried out on heat transfer and friction factor characteristics of copper-water nanofluid flow in a constant heat-fluxed tube with the existence of new configuration of vortex generator using Computational Fluid Dynamics (CFD) simulation. Two types of swirl flow generator: Classical twisted tape (CTT) and Parabolic-cut twisted tape (PCT) with a different twist ratio (y = 2.93, 3.91 and 4.89) and different cut depth (w = 0.5, 1.0 and 1.5 cm) with 2% and 4% volume concentration of CuO nanofluid were used for simulation. The effect of different parameters such as flow Reynolds number, twist ratio, cut depth and nanofluid were considered. The results show that the enhancement of heat transfer rate and the friction factor induced by the Classical (CTT) and Parabolic-cut (PCT) inserts increases with twist ratio and cut depth decreases. The results also revealed that the heat transfer enhancement increases with an increase in the volume fraction of the CuO nanoparticle. Furthermore, the twisted tape with twist ratio (y = 2.93) and cut depth w = 0.5 cm offered 10% enhancement of the average Nusselt number with significant increases in friction factor than those of Classical twisted tape. PMID:24605055

  3. Radiative capture of cold neutrons by protons and deuteron photodisintegration with twisted beams

    NASA Astrophysics Data System (ADS)

    Afanasev, Andrei; Serbo, Valeriy G.; Solyanik, Maria

    2018-05-01

    We consider two basic nuclear reactions: capture of neutrons by protons, n + p → γ + d, and its time-reversed counterpart, photodisintegration of the deuteron, γ + d → n + p. In both of these cases we assume that the incoming beam of neutrons or photons is ‘twisted’ by having an azimuthal phase dependence, i.e., it carries an additional angular momentum along its direction of propagation. Taking a low-energy limit of these reactions, we derive relations between corresponding transition amplitudes and cross sections with plane-wave beams and twisted beams. Implications for experiments with twisted cold neutrons and twisted photon beams are discussed.

  4. Mechanical strain energy shuttle for aircraft morphing via wing twist or structural deformation

    NASA Astrophysics Data System (ADS)

    Clingman, Dan J.; Ruggeri, Robert T.

    2004-07-01

    Direct structural deformation to achieve aerodynamic benefit is difficult because large actuators must supply energy for structural strain and aerodynamic loads. This ppaer presents a mechanism that allows most of the energy required to twist or deform a wing to be stored in descrete springs. When this device is used, only sufficient energy is provided to control the position of the wing. This concept allows lightweight actuators to perform wing twisting and other structural distortions, and it reduces the onboard mass of the wing-twist system. The energy shuttle can be used with any actuator and it has been adapted for used with shape memory alloy, piezoelectric, and electromagnetic actuators.

  5. Coils of Magnetic Field Lines

    NASA Image and Video Library

    2017-06-27

    A smallish solar filament looks like it collapsed into the sun and set off a minor eruption that hurled plasma into space (June 20, 2017). Then, the disrupted magnetic field immediately began to reorganize itself, hence the bright series of spirals coiling up over that area. The magnetic field lines are made visible in extreme ultraviolet light as charged particles spin along them. Also of interest are the darker, cooler strands of plasma being pulled and twisted at the edge of the sun just below the active region. The activity here is in a 21-hour period. Movies are available at https://photojournal.jpl.nasa.gov/catalog/PIA21764

  6. High-throughput autofluorescence flow cytometry of breast cancer metabolism (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Shah, Amy T.; Cannon, Taylor M.; Higginbotham, Jim N.; Skala, Melissa C.

    2016-02-01

    Tumor heterogeneity poses challenges for devising optimal treatment regimens for cancer patients. In particular, subpopulations of cells can escape treatment and cause relapse. There is a need for methods to characterize tumor heterogeneity of treatment response. Cell metabolism is altered in cancer (Warburg effect), and cells use the autofluorescent cofactor NADH in numerous metabolic reactions. Previous studies have shown that microscopy measurements of NADH autofluorescence are sensitive to treatment response in breast cancer, and these techniques typically assess hundreds of cells per group. An alternative approach is flow cytometry, which measures fluorescence on a single-cell level and is attractive for characterizing tumor heterogeneity because it achieves high-throughput analysis and cell sorting in millions of cells per group. Current applications for flow cytometry rely on staining with fluorophores. This study characterizes flow cytometry measurements of NADH autofluorescence in breast cancer cells. Preliminary results indicate flow cytometry of NADH is sensitive to cyanide perturbation, which inhibits oxidative phosphorylation, in nonmalignant MCF10A cells. Additionally, flow cytometry is sensitive to higher NADH intensity for HER2-positive SKBr3 cells compared with triple-negative MDA-MB-231 cells. These results agree with previous microscopy studies. Finally, a mixture of SKBr3 and MDA-MB-231 cells were sorted into each cell type using NADH intensity. Sorted cells were cultured, and microscopy validation showed the expected morphology for each cell type. Ultimately, flow cytometry could be applied to characterize tumor heterogeneity based on treatment response and sort cell subpopulations based on metabolic profile. These achievements could enable individualized treatment strategies and improved patient outcomes.

  7. Technical advances in flow cytometry-based diagnosis and monitoring of paroxysmal nocturnal hemoglobinuria

    PubMed Central

    Correia, Rodolfo Patussi; Bento, Laiz Cameirão; Bortolucci, Ana Carolina Apelle; Alexandre, Anderson Marega; Vaz, Andressa da Costa; Schimidell, Daniela; Pedro, Eduardo de Carvalho; Perin, Fabricio Simões; Nozawa, Sonia Tsukasa; Mendes, Cláudio Ernesto Albers; Barroso, Rodrigo de Souza; Bacal, Nydia Strachman

    2016-01-01

    ABSTRACT Objective: To discuss the implementation of technical advances in laboratory diagnosis and monitoring of paroxysmal nocturnal hemoglobinuria for validation of high-sensitivity flow cytometry protocols. Methods: A retrospective study based on analysis of laboratory data from 745 patient samples submitted to flow cytometry for diagnosis and/or monitoring of paroxysmal nocturnal hemoglobinuria. Results: Implementation of technical advances reduced test costs and improved flow cytometry resolution for paroxysmal nocturnal hemoglobinuria clone detection. Conclusion: High-sensitivity flow cytometry allowed more sensitive determination of paroxysmal nocturnal hemoglobinuria clone type and size, particularly in samples with small clones. PMID:27759825

  8. Mesoporous Silica Nanoparticle Delivery of Chemically Modified siRNA Against TWIST1 Leads to Reduced Tumor Burden

    PubMed Central

    Finlay, James; Roberts, Cai M.; Dong, Juyao; Zink, Jeffrey I.; Tamanoi, Fuyuhiko; Glackin, Carlotta A.

    2015-01-01

    Growth and progression of solid tumors depends on the integration of multiple pro-growth and survival signals, including the induction of angiogenesis. TWIST1 is a transcription factor whose reactivation in tumors leads to epithelial to mesenchymal transition (EMT), including increased cancer cell stemness, survival, and invasiveness. Additionally, TWIST1 drives angiogenesis via activation of IL-8 and CCL2, independent of VEGF signaling. In this work, results suggest that chemically modified siRNA against TWIST1 reverses EMT both in vitro and in vivo. siRNA delivery with a polyethyleneimine-coated mesoporous silica nanoparticle (MSN) led to reduction of TWIST1 target genes and migratory potential in vitro. In mice bearing xenograft tumors, weekly intravenous injections of the siRNA-nanoparticle complexes resulted in decreased tumor burden together with a loss of CCL2 suggesting a possible anti-angiogenic response. Therapeutic use of TWIST1 siRNA delivered via MSNs has the potential to inhibit tumor growth and progression in many solid tumor types. Chemically modified siRNA against TWIST1 was complexed to cation-coated mesoporous silica nanoparticles and tested in vitro and in vivo. In cell culture experiments, siRNA reduced expression of TWIST1 and its target genes, and reduced cell migration. In mice, injections of the siRNA-nanoparticle complex led to reduced tumor weight. Data suggest that diminished tumor burden was the result of reduced CCL2 expression and angiogenesis following TWIST1 knockdown. PMID:26115637

  9. Multi-channel imaging cytometry with a single detector

    NASA Astrophysics Data System (ADS)

    Locknar, Sarah; Barton, John; Entwistle, Mark; Carver, Gary; Johnson, Robert

    2018-02-01

    Multi-channel microscopy and multi-channel flow cytometry generate high bit data streams. Multiple channels (both spectral and spatial) are important in diagnosing diseased tissue and identifying individual cells. Omega Optical has developed techniques for mapping multiple channels into the time domain for detection by a single high gain, high bandwidth detector. This approach is based on pulsed laser excitation and a serial array of optical fibers coated with spectral reflectors such that up to 15 wavelength bins are sequentially detected by a single-element detector within 2.5 μs. Our multichannel microscopy system uses firmware running on dedicated DSP and FPGA chips to synchronize the laser, scanning mirrors, and sampling clock. The signals are digitized by an NI board into 14 bits at 60MHz - allowing for 232 by 174 pixel fields in up to 15 channels with 10x over sampling. Our multi-channel imaging cytometry design adds channels for forward scattering and back scattering to the fluorescence spectral channels. All channels are detected within the 2.5 μs - which is compatible with fast cytometry. Going forward, we plan to digitize at 16 bits with an A-toD chip attached to a custom board. Processing these digital signals in custom firmware would allow an on-board graphics processing unit to display imaging flow cytometry data over configurable scanning line lengths. The scatter channels can be used to trigger data buffering when a cell is present in the beam. This approach enables a low cost mechanically robust imaging cytometer.

  10. Separating the signal from the noise: Expanding flow cytometry into the sub-micron range.

    EPA Science Inventory

    Cytometry Part A Special Section: Separating the signal from the noise: Expanding flow cytometry into the sub-micron range. The current Cytometry Part A Special Section presents three studies that utilize cytometers to study sub-micron particles. The three studies involve the 1...

  11. Spectroscopic and Ab Initio Determination of the Ring-Twisting Potential Energy Function for 1,3-Cyclohexadiene

    NASA Astrophysics Data System (ADS)

    Autrey, Daniel; Choo, Jaebum; Laane, Jaan

    2000-10-01

    The ring-twisting vibration of 1,3-cyclohexadiene has been studied using Raman and infrared spectroscopy of the molecule in the vapor phase. The Raman spectrum shows five ring-twisting transitions in the 150 - 200 cm-1 region. The far-infrared spectrum shows only two transitions for this vibration, which is infrared forbidden in the C_2v (planar) approximation. Three ring-twisting combination bands were also observed off a fundamental vibration at 926.1 cm-1. A coordinate dependent kinetic energy expansion for the ring-twisting motion was calculated, and this was used to determine the ring-twisting potential function. Ab initio calculations were performed using Moller-Plesset perturbation theory (MP2) using different basis sets. The barrier to planarity of 1150 cm-1 was determined from the spectroscopic data. The various ab initio calculations gave barriers to planarity in the 1197 - 1593 cm-1 range.

  12. Flow cytometry for intracellular SPION quantification: specificity and sensitivity in comparison with spectroscopic methods

    PubMed Central

    Friedrich, Ralf P; Janko, Christina; Poettler, Marina; Tripal, Philipp; Zaloga, Jan; Cicha, Iwona; Dürr, Stephan; Nowak, Johannes; Odenbach, Stefan; Slabu, Ioana; Liebl, Maik; Trahms, Lutz; Stapf, Marcus; Hilger, Ingrid; Lyer, Stefan; Alexiou, Christoph

    2015-01-01

    Due to their special physicochemical properties, iron nanoparticles offer new promising possibilities for biomedical applications. For bench to bedside translation of super-paramagnetic iron oxide nanoparticles (SPIONs), safety issues have to be comprehensively clarified. To understand concentration-dependent nanoparticle-mediated toxicity, the exact quantification of intracellular SPIONs by reliable methods is of great importance. In the present study, we compared three different SPION quantification methods (ultraviolet spectrophotometry, magnetic particle spectroscopy, atomic adsorption spectroscopy) and discussed the shortcomings and advantages of each method. Moreover, we used those results to evaluate the possibility to use flow cytometric technique to determine the cellular SPION content. For this purpose, we correlated the side scatter data received from flow cytometry with the actual cellular SPION amount. We showed that flow cytometry provides a rapid and reliable method to assess the cellular SPION content. Our data also demonstrate that internalization of iron oxide nanoparticles in human umbilical vein endothelial cells is strongly dependent to the SPION type and results in a dose-dependent increase of toxicity. Thus, treatment with lauric acid-coated SPIONs (SEONLA) resulted in a significant increase in the intensity of side scatter and toxicity, whereas SEONLA with an additional protein corona formed by bovine serum albumin (SEONLA-BSA) and commercially available Rienso® particles showed only a minimal increase in both side scatter intensity and cellular toxicity. The increase in side scatter was in accordance with the measurements for SPION content by the atomic adsorption spectroscopy reference method. In summary, our data show that flow cytometry analysis can be used for estimation of uptake of SPIONs by mammalian cells and provides a fast tool for scientists to evaluate the safety of nanoparticle products. PMID:26170658

  13. Emerging role of Twist1 in fibrotic diseases.

    PubMed

    Ning, Xiaoxuan; Zhang, Kun; Wu, Qingfeng; Liu, Minna; Sun, Shiren

    2018-03-01

    Epithelial-mesenchymal transition (EMT) is a pathological process that occurs in a variety of diseases, including organ fibrosis. Twist1, a basic helix-loop-helix transcription factor, is involved in EMT and plays significant roles in various fibrotic diseases. Suppression of the EMT process represents a promising approach for the treatment of fibrotic diseases. In this review, we discuss the roles and the underlying molecular mechanisms of Twist1 in fibrotic diseases, including those affecting kidney, lung, skin, oral submucosa and other tissues. We aim at providing new insight into the pathogenesis of various fibrotic diseases and facilitating the development of novel diagnostic and therapeutic methods for their treatment. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  14. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  15. Cytobank: providing an analytics platform for community cytometry data analysis and collaboration.

    PubMed

    Chen, Tiffany J; Kotecha, Nikesh

    2014-01-01

    Cytometry is used extensively in clinical and laboratory settings to diagnose and track cell subsets in blood and tissue. High-throughput, single-cell approaches leveraging cytometry are developed and applied in the computational and systems biology communities by researchers, who seek to improve the diagnosis of human diseases, map the structures of cell signaling networks, and identify new cell types. Data analysis and management present a bottleneck in the flow of knowledge from bench to clinic. Multi-parameter flow and mass cytometry enable identification of signaling profiles of patient cell samples. Currently, this process is manual, requiring hours of work to summarize multi-dimensional data and translate these data for input into other analysis programs. In addition, the increase in the number and size of collaborative cytometry studies as well as the computational complexity of analytical tools require the ability to assemble sufficient and appropriately configured computing capacity on demand. There is a critical need for platforms that can be used by both clinical and basic researchers who routinely rely on cytometry. Recent advances provide a unique opportunity to facilitate collaboration and analysis and management of cytometry data. Specifically, advances in cloud computing and virtualization are enabling efficient use of large computing resources for analysis and backup. An example is Cytobank, a platform that allows researchers to annotate, analyze, and share results along with the underlying single-cell data.

  16. Numerical investigation of heat transfer and friction factor characteristics in a circular tube fitted with V-cut twisted tape inserts.

    PubMed

    Salman, Sami D; Kadhum, Abdul Amir H; Takriff, Mohd S; Mohamad, Abu Bakar

    2013-01-01

    Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration.

  17. Numerical Investigation of Heat Transfer and Friction Factor Characteristics in a Circular Tube Fitted with V-Cut Twisted Tape Inserts

    PubMed Central

    Salman, Sami D.; Kadhum, Abdul Amir H.; Takriff, Mohd S.; Mohamad, Abu Bakar

    2013-01-01

    Numerical investigation of the heat transfer and friction factor characteristics of a circular fitted with V-cut twisted tape (VCT) insert with twist ratio (y = 2.93) and different cut depths (w = 0.5, 1, and 1.5 cm) were studied for laminar flow using CFD package (FLUENT-6.3.26). The data obtained from plain tube were verified with the literature correlation to ensure the validation of simulation results. Classical twisted tape (CTT) with different twist ratios (y = 2.93, 3.91, 4.89) were also studied for comparison. The results show that the enhancement of heat transfer rate induced by the classical and V-cut twisted tape inserts increases with the Reynolds number and decreases with twist ratio. The results also revealed that the V-cut twisted tape with twist ratio y = 2.93 and cut depth w = 0.5 cm offered higher heat transfer rate with significant increases in friction factor than other tapes. In addition the results of V-cut twist tape compared with experimental and simulated data of right-left helical tape inserts (RLT), it is found that the V-cut twist tape offered better thermal contact between the surface and the fluid which ultimately leads to a high heat transfer coefficient. Consequently, 107% of maximum heat transfer was obtained by using this configuration. PMID:24078795

  18. Rotor Hover Performance and Flowfield Measurements with Untwisted and Highly-Twisted Blades

    NASA Technical Reports Server (NTRS)

    Ramasamy, Manikandan; Gold, Nili P.; Bhagwat, Mahendra J.

    2010-01-01

    The flowfield and performance characteristics of highly-twisted blades were analyzed at various thrust conditions to improve the fundamental understanding relating the wake effects on rotor performance. Similar measurements made using untwisted blades served as the baseline case. Twisted blades are known to give better hover performance than untwisted blades at high thrust coefficients typical of those found in full-scale rotors. However, the present experiments were conducted at sufficiently low thrust (beginning from zero thrust), where the untwisted blades showed identical, if not better, performance when compared with the highly-twisted blades. The flowfield measurements showed some key wake differences between the two rotors, as well. These observations when combined with simple blade element momentum theory (also called annular disk momentum theory) helped further the understanding of rotor performance characteristics.

  19. Analysis of Snail1 function and regulation by Twist1 in palatal fusion.

    PubMed

    Yu, Wenli; Zhang, Yanping; Ruest, L Bruno; Svoboda, Kathy K H

    2013-01-01

    Palatal fusion is a tightly controlled process which comprises multiple cellular events, including cell movement and differentiation. Midline epithelial seam (MES) degradation is essential to palatal fusion. In this study, we analyzed the function of Snail1 during the degradation of the MES. We also analyzed the mechanism regulating the expression of the Snail1 gene in palatal shelves. Palatal explants treated with Snail1 siRNA did not degrade the MES and E-cadherin was not repressed leading to failure of palatal fusion. Transforming growth factor beta 3 (Tgfβ3) regulated Snail1 mRNA, as Snail1 expression decreased in response to Tgfβ3 neutralizing antibody and a PI-3 kinase (PI3K) inhibitor. Twist1, in collaboration with E2A factors, regulated the expression of Snail1. Twist1/E47 dimers bond to the Snail1 promoter to activate expression. Without E47, Twist1 repressed Snail1 expression. These results support the hypothesis that Tgfβ3 may signal through Twist1 and then Snail1 to downregulate E-cadherin expression during palatal fusion.

  20. The association between left ventricular twisting motion and mechanical dyssynchrony: a three-dimensional speckle tracking study.

    PubMed

    Fujiwara, Shohei; Komamura, Kazuo; Nakabo, Ayumi; Masaki, Mitsuru; Fukui, Miho; Sugahara, Masataka; Itohara, Kanako; Soyama, Yuko; Goda, Akiko; Hirotani, Shinichi; Mano, Toshiaki; Masuyama, Tohru

    2016-02-01

    Left ventricular (LV) dyssynchrony is a causal factor in LV dysfunction and thought to be associated with LV twisting motion. We tested whether three-dimensional speckle tracking (3DT) can be used to evaluate the relationship between LV twisting motion and dyssynchrony. We examined 25 patients with sick sinus syndrome who had received dual chamber pacemakers. The acute effects of ventricular pacing on LV wall motion after the switch from atrial to ventricular pacing were assessed. LV twisting motion and dyssynchrony during each pacing mode were measured using 3DT. LV dyssynchrony was calculated from the time to the minimum peak systolic area strain of 16 LV imaging segments. Ventricular pacing increased LV dyssynchrony and decreased twist and torsion. A significant correlation was observed between changes in LV dyssynchrony and changes in torsion (r = -0.65, p < 0.01). Evaluation of LV twisting motion can potentially be used for diagnosing LV dyssynchrony.

  1. Electric-field effects in the twist-bend nematic phase

    NASA Astrophysics Data System (ADS)

    Meyer, Claire; Dozov, Ivan; Davidson, Patrick; Luckhurst, Geoffrey R.; Dokli, Irena; Knezevic, Anamarija; Lesac, Andreja

    2018-02-01

    In the recently discovered Twist-Bend Nematic (NTB) phase, the nematic director is spontaneously distorted and twisted along a conical helix with an extremely short pitch, 10 nm. We have investigated the behavior of the NTB phase subject to an electric-field. We show that, due to the periodic NTB structure, the electro-optic effects are not nematic-like but are close analogs to those in the smectic and cholesteric phases. In particular, we have studied the fast (sub-microsecond) flexoelectrically-induced rotation of the optic axis, which is similar to the electroclinic effect in the SmA* phase and the flexoelectric response of short-pitch cholesterics. We discuss the possible applications of the fast NTB electro-optic effects.

  2. The vectorial control of magnetization by light.

    PubMed

    Kanda, Natsuki; Higuchi, Takuya; Shimizu, Hirokatsu; Konishi, Kuniaki; Yoshioka, Kosuke; Kuwata-Gonokami, Makoto

    2011-06-21

    Application of coherent light-matter interactions has recently been extended to the ultrafast control of magnetization. An important but unrealized technique is the manipulation of magnetization vector motion to make it follow an arbitrarily designed multidimensional trajectory. Here we demonstrate a full manipulation of two-dimensional magnetic oscillations in antiferromagnetic NiO with a pair of polarization-twisted femtosecond laser pulses. We employ Raman-type nonlinear optical processes, wherein magnetic oscillations are impulsively induced with a controlled initial phase. Their azimuthal angle follows well-defined selection rules that have been determined by the symmetries of the materials. We emphasize that the temporal variation of the laser-pulse polarization angle enables us to control the phase and amplitude of the two degenerate modes, independently. These results lead to a new concept of the vectorial control of magnetization by light.

  3. Reducing Bolt Preload Variation with Angle-of-Twist Bolt Loading

    NASA Technical Reports Server (NTRS)

    Thompson, Bryce; Nayate, Pramod; Smith, Doug; McCool, Alex (Technical Monitor)

    2001-01-01

    Critical high-pressure sealing joints on the Space Shuttle reusable solid rocket motor require precise control of bolt preload to ensure proper joint function. As the reusable solid rocket motor experiences rapid internal pressurization, correct bolt preloads maintain the sealing capability and structural integrity of the hardware. The angle-of-twist process provides the right combination of preload accuracy, reliability, process control, and assembly-friendly design. It improves significantly over previous methods. The sophisticated angle-of-twist process controls have yielded answers to all discrepancies encountered while the simplicity of the root process has assured joint preload reliability.

  4. Pauli energy spectrum for twist-deformed spacetime

    NASA Astrophysics Data System (ADS)

    Daszkiewicz, Marcin

    2018-04-01

    In this paper, we define the Pauli Hamiltonian function for the twist-deformed N-enlarged Newton-Hooke spacetime provided by M. Daszkiewicz [Mod. Phys. Lett. A 27, 1250083 (2012)]. Further, we derive its energy spectrum, i.e. we find the corresponding eigenvalues as well as the proper eigenfunctions.

  5. Experimental and theoretical study of the in- fiber twist sensor based on quasi-fan Solc structure filter.

    PubMed

    Sun, Chunran; Wang, Muguang; Jian, Shuisheng

    2017-08-21

    In this paper, a novel quasi-fan Solc structure filter based on elliptical-core spun fiber for twist sensing has been experimentally investigated and theoretically analyzed. The discrete model of spun fiber has been built to analyze the transmission characteristics of proposed sensor. Both experimental and simulated results indicate that the extinction ratio of the comb spectrum based on quasi-fan Solc birefringent fiber filter varies with twist angle and agrees well with each other. Based on the intensity modulation, the proposed twist sensor exhibits a high sensitivity of 0.02219 dB/(°/m). Moreover, thanks to the invariability of the fiber birefringence and the state of polarization of the input light, the proposed twist sensor has a very low temperature and strain sensitivity, which can avoid the cross-sensitivity problem existing in most twist sensors.

  6. CytometryML with DICOM and FCS

    NASA Astrophysics Data System (ADS)

    Leif, Robert C.

    2018-02-01

    Abstract: Flow Cytometry Standard, FCS, and Digital Imaging and Communications in Medicine standard, DICOM, are based on extensive, superb domain knowledge, However, they are isolated systems, do not take advantage of data structures, require special programs to read and write the data, lack the capability to interoperate or work with other standards and FCS lacks many of the datatypes necessary for clinical laboratory data. The large overlap between imaging and flow cytometry provides strong evidence that both modalities should be covered by the same standard. Method: The XML Schema Definition Language, XSD 1.1 was used to translate FCS and/or DICOM objects. A MIFlowCyt file was tested with published values. Results: Previously, a significant part of an XML standard based upon a combination of FCS and DICOM has been implemented and validated with MIFlowCyt data. Strongly typed translations of FCS keywords have been constructed in XML. These keywords contain links to their DICOM and FCS equivalents.

  7. Study of Three-dimensional Magnetic Structure and the Successive Eruptive Nature of Active Region 12371

    NASA Astrophysics Data System (ADS)

    Vemareddy, P.; Demóulin, P.

    2018-04-01

    We study the magnetic structure of a successively erupting sigmoid in active region 12371 by modeling the quasi-static coronal field evolution with nonlinear force-free field (NLFFF) equilibria. Helioseismic and Magnetic Imager/Solar Dynamic Observatory vector magnetograms are used as input to the NLFFF model. In all eruption events, the modeled structure resembles the observed pre-eruptive coronal sigmoid and the NLFFF core field is a combination of double inverse-J-shaped and inverse-S field lines with dips touching the photosphere. Such field lines are formed by the flux cancellation reconnection of opposite-J field lines at bald-patch locations, which in turn implies the formation of a weakly twisted flux-rope (FR) from large-scale sheared arcade field lines. Later on, this FR undergoes coronal tether-cutting reconnection until a coronal mass ejection is triggered. The modeled structure captured these major features of sigmoid-to-arcade-to-sigmoid transformation, which is reoccuring under continuous photospheric flux motions. Calculations of the field line twist reveal a fractional increase followed by a decrease of the number of pixels having a range of twist. This traces the buildup process of a twisted core field by slow photospheric motions and the relaxation after eruption, respectively. Our study infers that the large eruptivity of this AR is due to a steep decrease of the background coronal field meeting the torus instability criteria at a low height (≈40 Mm) in contrast to noneruptive ARs.

  8. Using 4th order Runge-Kutta method for solving a twisted Skyrme string equation

    NASA Astrophysics Data System (ADS)

    Hadi, Miftachul; Anderson, Malcolm; Husein, Andri

    2016-03-01

    We study numerical solution, especially using 4th order Runge-Kutta method, for solving a twisted Skyrme string equation. We find numerically that the value of minimum energy per unit length of vortex solution for a twisted Skyrmion string is 20.37 × 1060 eV/m.

  9. Normalization of mass cytometry data with bead standards

    PubMed Central

    Finck, Rachel; Simonds, Erin F.; Jager, Astraea; Krishnaswamy, Smita; Sachs, Karen; Fantl, Wendy; Pe’er, Dana; Nolan, Garry P.; Bendall, Sean C.

    2013-01-01

    Mass cytometry uses atomic mass spectrometry combined with isotopically pure reporter elements to currently measure as many as 40 parameters per single cell. As with any quantitative technology, there is a fundamental need for quality assurance and normalization protocols. In the case of mass cytometry, the signal variation over time due to changes in instrument performance combined with intervals between scheduled maintenance must be accounted for and then normalized. Here, samples were mixed with polystyrene beads embedded with metal lanthanides, allowing monitoring of mass cytometry instrument performance over multiple days of data acquisition. The protocol described here includes simultaneous measurements of beads and cells on the mass cytometer, subsequent extraction of the bead-based signature, and the application of an algorithm enabling correction of both short- and long-term signal fluctuations. The variation in the intensity of the beads that remains after normalization may also be used to determine data quality. Application of the algorithm to a one-month longitudinal analysis of a human peripheral blood sample reduced the range of median signal fluctuation from 4.9-fold to 1.3-fold. PMID:23512433

  10. Design and Application of Sensors for Chemical Cytometry.

    PubMed

    Vickerman, Brianna M; Anttila, Matthew M; Petersen, Brae V; Allbritton, Nancy L; Lawrence, David S

    2018-02-08

    The bulk cell population response to a stimulus, be it a growth factor or a cytotoxic agent, neglects the cell-to-cell variability that can serve as a friend or as a foe in human biology. Biochemical variations among closely related cells furnish the basis for the adaptability of the immune system but also act as the root cause of resistance to chemotherapy by tumors. Consequently, the ability to probe for the presence of key biochemical variables at the single-cell level is now recognized to be of significant biological and biomedical impact. Chemical cytometry has emerged as an ultrasensitive single-cell platform with the flexibility to measure an array of cellular components, ranging from metabolite concentrations to enzyme activities. We briefly review the various chemical cytometry strategies, including recent advances in reporter design, probe and metabolite separation, and detection instrumentation. We also describe strategies for improving intracellular delivery, biochemical specificity, metabolic stability, and detection sensitivity of probes. Recent applications of these strategies to small molecules, lipids, proteins, and other analytes are discussed. Finally, we assess the current scope and limitations of chemical cytometry and discuss areas for future development to meet the needs of single-cell research.

  11. A zero torsional stiffness twist morphing blade as a wind turbine load alleviation device

    NASA Astrophysics Data System (ADS)

    Lachenal, X.; Daynes, S.; Weaver, P. M.

    2013-06-01

    This paper presents the design, analysis and realization of a zero stiffness twist morphing wind turbine blade. The morphing blade is designed to actively twist as a means of alleviating the gust loads which reduce the fatigue life of wind turbine blades. The morphing structure exploits an elastic strain energy balance within the blade to enable large twisting deformations with modest actuation requirements. While twist is introduced using the warping of the blade skin, internal pre-stressed members ensure that a constant strain energy balance is achieved throughout the deformation, resulting in a zero torsional stiffness structure. The torsional stability of the morphing blade is characterized by analysing the elastic strain energy in the device. Analytical models of the skin, the pre-stressed components and the complete blade are compared to their respective finite element models as well as experimental results. The load alleviation potential of the adaptive structure is quantified using a two-dimensional steady flow aerodynamic model which is experimentally validated with wind tunnel measurements.

  12. A plant tendril mimic soft actuator with phototunable bending and chiral twisting motion modes

    NASA Astrophysics Data System (ADS)

    Wang, Meng; Lin, Bao-Ping; Yang, Hong

    2016-12-01

    In nature, plant tendrils can produce two fundamental motion modes, bending and chiral twisting (helical curling) distortions, under the stimuli of sunlight, humidity, wetting or other atmospheric conditions. To date, many artificial plant-like mechanical machines have been developed. Although some previously reported materials could realize bending or chiral twisting through tailoring the samples into various ribbons along different orientations, each single ribbon could execute only one deformation mode. The challenging task is how to endow one individual plant tendril mimic material with two different, fully tunable and reversible motion modes (bending and chiral twisting). Here we show a dual-layer, dual-composition polysiloxane-based liquid crystal soft actuator strategy to synthesize a plant tendril mimic material capable of performing two different three-dimensional reversible transformations (bending versus chiral twisting) through modulation of the wavelength band of light stimuli (ultraviolet versus near-infrared). This material has broad application prospects in biomimetic control devices.

  13. A plant tendril mimic soft actuator with phototunable bending and chiral twisting motion modes.

    PubMed

    Wang, Meng; Lin, Bao-Ping; Yang, Hong

    2016-12-22

    In nature, plant tendrils can produce two fundamental motion modes, bending and chiral twisting (helical curling) distortions, under the stimuli of sunlight, humidity, wetting or other atmospheric conditions. To date, many artificial plant-like mechanical machines have been developed. Although some previously reported materials could realize bending or chiral twisting through tailoring the samples into various ribbons along different orientations, each single ribbon could execute only one deformation mode. The challenging task is how to endow one individual plant tendril mimic material with two different, fully tunable and reversible motion modes (bending and chiral twisting). Here we show a dual-layer, dual-composition polysiloxane-based liquid crystal soft actuator strategy to synthesize a plant tendril mimic material capable of performing two different three-dimensional reversible transformations (bending versus chiral twisting) through modulation of the wavelength band of light stimuli (ultraviolet versus near-infrared). This material has broad application prospects in biomimetic control devices.

  14. Simulation of Homologous and Cannibalistic Coronal Mass Ejections produced by the Emergence of a Twisted Flux Rope into the Solar Corona

    NASA Astrophysics Data System (ADS)

    Chatterjee, Piyali; Fan, Yuhong

    2013-11-01

    We report the first results of a magnetohydrodynamic simulation of the development of a homologous sequence of three coronal mass ejections (CMEs) and demonstrate their so-called cannibalistic behavior. These CMEs originate from the repeated formations and partial eruptions of kink unstable flux ropes as a result of continued emergence of a twisted flux rope across the lower boundary into a pre-existing coronal potential arcade field. The simulation shows that a CME erupting into the open magnetic field created by a preceding CME has a higher speed. The second of the three successive CMEs is cannibalistic, catching up and merging with the first into a single fast CME before exiting the domain. All the CMEs including the leading merged CME, attained speeds of about 1000 km s-1 as they exit the domain. The reformation of a twisted flux rope after each CME eruption during the sustained flux emergence can naturally explain the X-ray observations of repeated reformations of sigmoids and "sigmoid-under-cusp" configurations at a low-coronal source of homologous CMEs.

  15. Conformal twists, Yang–Baxter σ-models & holographic noncommutativity

    NASA Astrophysics Data System (ADS)

    Araujo, Thiago; Bakhmatov, Ilya; Colgáin, Eoin Ó.; Sakamoto, Jun-ichi; Sheikh-Jabbari, Mohammad M.; Yoshida, Kentaroh

    2018-06-01

    Expanding upon earlier results (Araujo et al 2017 Phys. Rev. D 95 105006), we present a compendium of σ-models associated with integrable deformations of AdS5 generated by solutions to homogenous classical Yang–Baxter equation. Each example we study from four viewpoints: conformal (Drinfeld) twists, closed string gravity backgrounds, open string parameters and proposed dual noncommutative (NC) gauge theory. Irrespective of whether the deformed background is a solution to supergravity or generalized supergravity, we show that the open string metric associated with each gravity background is undeformed AdS5 with constant open string coupling and the NC structure Θ is directly related to the conformal twist. One novel feature is that Θ exhibits ‘holographic noncommutativity’: while it may exhibit non-trivial dependence on the holographic direction, its value everywhere in the bulk is uniquely determined by its value at the boundary, thus facilitating introduction of a dual NC gauge theory. We show that the divergence of the NC structure Θ is directly related to the unimodularity of the twist. We discuss the implementation of an outer automorphism of the conformal algebra as a coordinate transformation in the AdS bulk and discuss its implications for Yang–Baxter σ-models and self-T-duality based on fermionic T-duality. Finally, we comment on implications of our results for the integrability of associated open strings and planar integrability of dual NC gauge theories.

  16. Time-varying wing-twist improves aerodynamic efficiency of forward flight in butterflies.

    PubMed

    Zheng, Lingxiao; Hedrick, Tyson L; Mittal, Rajat

    2013-01-01

    Insect wings can undergo significant chordwise (camber) as well as spanwise (twist) deformation during flapping flight but the effect of these deformations is not well understood. The shape and size of butterfly wings leads to particularly large wing deformations, making them an ideal test case for investigation of these effects. Here we use computational models derived from experiments on free-flying butterflies to understand the effect of time-varying twist and camber on the aerodynamic performance of these insects. High-speed videogrammetry is used to capture the wing kinematics, including deformation, of a Painted Lady butterfly (Vanessa cardui) in untethered, forward flight. These experimental results are then analyzed computationally using a high-fidelity, three-dimensional, unsteady Navier-Stokes flow solver. For comparison to this case, a set of non-deforming, flat-plate wing (FPW) models of wing motion are synthesized and subjected to the same analysis along with a wing model that matches the time-varying wing-twist observed for the butterfly, but has no deformation in camber. The simulations show that the observed butterfly wing (OBW) outperforms all the flat-plate wings in terms of usable force production as well as the ratio of lift to power by at least 29% and 46%, respectively. This increase in efficiency of lift production is at least three-fold greater than reported for other insects. Interestingly, we also find that the twist-only-wing (TOW) model recovers much of the performance of the OBW, demonstrating that wing-twist, and not camber is key to forward flight in these insects. The implications of this on the design of flapping wing micro-aerial vehicles are discussed.

  17. Time-Varying Wing-Twist Improves Aerodynamic Efficiency of Forward Flight in Butterflies

    PubMed Central

    Zheng, Lingxiao; Hedrick, Tyson L.; Mittal, Rajat

    2013-01-01

    Insect wings can undergo significant chordwise (camber) as well as spanwise (twist) deformation during flapping flight but the effect of these deformations is not well understood. The shape and size of butterfly wings leads to particularly large wing deformations, making them an ideal test case for investigation of these effects. Here we use computational models derived from experiments on free-flying butterflies to understand the effect of time-varying twist and camber on the aerodynamic performance of these insects. High-speed videogrammetry is used to capture the wing kinematics, including deformation, of a Painted Lady butterfly (Vanessa cardui) in untethered, forward flight. These experimental results are then analyzed computationally using a high-fidelity, three-dimensional, unsteady Navier-Stokes flow solver. For comparison to this case, a set of non-deforming, flat-plate wing (FPW) models of wing motion are synthesized and subjected to the same analysis along with a wing model that matches the time-varying wing-twist observed for the butterfly, but has no deformation in camber. The simulations show that the observed butterfly wing (OBW) outperforms all the flat-plate wings in terms of usable force production as well as the ratio of lift to power by at least 29% and 46%, respectively. This increase in efficiency of lift production is at least three-fold greater than reported for other insects. Interestingly, we also find that the twist-only-wing (TOW) model recovers much of the performance of the OBW, demonstrating that wing-twist, and not camber is key to forward flight in these insects. The implications of this on the design of flapping wing micro-aerial vehicles are discussed. PMID:23341923

  18. Cosmic acceleration from M theory on twisted spaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Neupane, Ishwaree P.; Wiltshire, David L.

    2005-10-15

    In a recent paper [I. P. Neupane and D. L. Wiltshire, Phys. Lett. B 619, 201 (2005).] we have found a new class of accelerating cosmologies arising from a time-dependent compactification of classical supergravity on product spaces that include one or more geometric twists along with nontrivial curved internal spaces. With such effects, a scalar potential can have a local minimum with positive vacuum energy. The existence of such a minimum generically predicts a period of accelerated expansion in the four-dimensional Einstein conformal frame. Here we extend our knowledge of these cosmological solutions by presenting new examples and discuss themore » properties of the solutions in a more general setting. We also relate the known (asymptotic) solutions for multiscalar fields with exponential potentials to the accelerating solutions arising from simple (or twisted) product spaces for internal manifolds.« less

  19. QUANTIFYING THE TOPOLOGY AND EVOLUTION OF A MAGNETIC FLUX ROPE ASSOCIATED WITH MULTI-FLARE ACTIVITIES

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Kai; Guo, Yang; Ding, M. D., E-mail: dmd@nju.edu.cn

    2016-06-20

    Magnetic flux ropes (MFRs) play an important role in solar activities. The quantitative assessment of the topology of an MFR and its evolution is crucial for a better understanding of the relationship between the MFR and associated activities. In this paper, we investigate the magnetic field of active region (AR) 12017 from 2014 March 28–29, during which time 12 flares were triggered by intermittent eruptions of a filament (either successful or confined). Using vector magnetic field data from the Helioseismic and Magnetic Imager on board the Solar Dynamics Observatory , we calculate the magnetic energy and helicity injection in themore » AR, and extrapolate the 3D magnetic field with a nonlinear force-free field model. From the extrapolations, we find an MFR that is cospatial with the filament. We further determine the configuration of this MFR from the closed quasi-separatrix layer (QSL) around it. Then, we calculate the twist number and the magnetic helicity for the field lines composing the MFR. The results show that the closed QSL structure surrounding the MFR becomes smaller as a consequence of flare occurrence. We also find that the flares in our sample are mainly triggered by kink instability. Moreover, the twist number varies more sensitively than other parameters with the occurrence of flares.« less

  20. Electrically and magnetically dual-driven Janus particles for handwriting-enabled electronic paper

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Komazaki, Y., E-mail: komazaki@dt.k.u-tokyo.ac.jp; Hirama, H.; Torii, T.

    In this work, we describe the synthesis of novel electrically and magnetically dual-driven Janus particles for a handwriting-enabled twisting ball display via the microfluidic technique. One hemisphere of the Janus particles contains a charge control agent, which allows the display color to be controlled by applying a voltage and superparamagnetic nanoparticles, allows handwriting by applying a magnetic field to the display. We fabricated a twisting ball display utilizing these Janus particles and tested the electric color control and handwriting using a magnet. As a result, the display was capable of permitting handwriting with a small magnet in addition to conventionalmore » color control using an applied voltage (80 V). Handwriting performance was improved by increasing the concentration of superparamagnetic nanoparticles and was determined to be possible even when 80 V was applied across the electrodes for 4 wt. % superparamagnetic nanoparticles in one hemisphere. This improvement was impossible when the concentration was reduced to 2 wt. % superparamagnetic nanoparticles. The technology presented in our work can be applied to low-cost, lightweight, highly visible, and energy-saving electronic message boards and large whiteboards because the large-size display can be fabricated easily due to its simple structure.« less

  1. Diagnosing the Magnetic Field Structure of a Coronal Cavity Observed during the 2017 Total Solar Eclipse

    NASA Astrophysics Data System (ADS)

    Chen, Yajie; Tian, Hui; Su, Yingna; Qu, Zhongquan; Deng, Linhua; Jibben, Patricia R.; Yang, Zihao; Zhang, Jingwen; Samanta, Tanmoy; He, Jiansen; Wang, Linghua; Zhu, Yingjie; Zhong, Yue; Liang, Yu

    2018-03-01

    We present an investigation of a coronal cavity observed above the western limb in the coronal red line Fe X 6374 Å using a telescope of Peking University and in the green line Fe XIV 5303 Å using a telescope of Yunnan Observatories, Chinese Academy of Sciences, during the total solar eclipse on 2017 August 21. A series of magnetic field models is constructed based on the magnetograms taken by the Helioseismic and Magnetic Imager on board the Solar Dynamics Observatory (SDO) one week before the eclipse. The model field lines are then compared with coronal structures seen in images taken by the Atmospheric Imaging Assembly on board SDO and in our coronal red line images. The best-fit model consists of a flux rope with a twist angle of 3.1π, which is consistent with the most probable value of the total twist angle of interplanetary flux ropes observed at 1 au. Linear polarization of the Fe XIII 10747 Å line calculated from this model shows a “lagomorphic” signature that is also observed by the Coronal Multichannel Polarimeter of the High Altitude Observatory. We also find a ring-shaped structure in the line-of-sight velocity of Fe XIII 10747 Å, which implies hot plasma flows along a helical magnetic field structure, in the cavity. These results suggest that the magnetic structure of the cavity is a highly twisted flux rope, which may erupt eventually. The temperature structure of the cavity has also been investigated using the intensity ratio of Fe XIII 10747 Å and Fe X 6374 Å.

  2. Females have greater left ventricular twist mechanics than males during acute reductions to preload.

    PubMed

    Williams, Alexandra M; Shave, Rob E; Stembridge, Mike; Eves, Neil D

    2016-07-01

    Compared to males, females have smaller left ventricular (LV) dimensions and volumes, higher ejection fractions (EF), and higher LV longitudinal and circumferential strain. LV twist mechanics determine ventricular function and are preload-dependent. Therefore, the sex differences in LV structure and myocardial function may result in different mechanics when preload is altered. This study investigated sex differences in LV mechanics during acute challenges to preload. With the use of conventional and speckle-tracking echocardiography, LV structure and function were assessed in 20 males (24 ± 6.2 yr) and 20 females (23 ± 3.1 yr) at baseline and during progressive levels of lower body negative pressure (LBNP). Fourteen participants (8 males, 6 females) were also assessed following a rapid infusion of saline. LV end-diastolic volume, end-systolic volume, stroke volume (SV), and EF were reduced in both groups during LBNP (P < 0.001). While males had greater absolute volumes (P < 0.001), there were no sex differences in allometrically scaled volumes at any stage. Sex differences were not detected at baseline in basal rotation, apical rotation, or twist. Apical rotation and twist increased in both groups (P < 0.001) with LBNP. At -60 mmHg, females had greater apical rotation (P = 0.009), twist (P = 0.008), and torsion (P = 0.002) and faster untwisting velocity (P = 0.02) than males. There were no differences in mechanics following saline infusion. Females have larger LV twist and a faster untwisting velocity than males during large reductions to preload, supporting that females have a greater reliance on LV twist mechanics to maintain SV during severe reductions to preload. Copyright © 2016 the American Physiological Society.

  3. Flow Cytometry: Evolution of Microbiological Methods for Probiotics Enumeration.

    PubMed

    Pane, Marco; Allesina, Serena; Amoruso, Angela; Nicola, Stefania; Deidda, Francesca; Mogna, Luca

    2018-05-14

    The purpose of this trial was to verify that the analytical method ISO 19344:2015 (E)-IDF 232:2015 (E) is valid and reliable for quantifying the concentration of the probiotic Lactobacillus rhamnosus GG (ATCC 53103) in a finished product formulation. Flow cytometry assay is emerging as an alternative rapid method for microbial detection, enumeration, and population profiling. The use of flow cytometry not only permits the determination of viable cell counts but also allows for enumeration of damaged and dead cell subpopulations. Results are expressed as TFU (Total Fluorescent Units) and AFU (Active Fluorescent Units). In December 2015, the International Standard ISO 19344-IDF 232 "Milk and milk products-Starter cultures, probiotics and fermented products-Quantification of lactic acid bacteria by flow cytometry" was published. This particular ISO can be applied universally and regardless of the species of interest. Analytical method validation was conducted on 3 different industrial batches of L. rhamnosus GG according to USP39<1225>/ICH Q2R1 in term of: accuracy, precision (repeatability), intermediate precision (ruggedness), specificity, limit of quantification, linearity, range, robustness. The data obtained on the 3 batches of finished product have significantly demonstrated the validity and robustness of the cytofluorimetric analysis. On the basis of the results obtained, the ISO 19344:2015 (E)-IDF 232:2015 (E) "Quantification of lactic acid bacteria by flow cytometry" can be used for the enumeration of L. rhamnosus GG in a finished product formulation.

  4. Magneto-optical observation of twisted vortices in type-II superconductors

    NASA Astrophysics Data System (ADS)

    Indenbom, M. V.; van der Beek, C. J.; Berseth, V.; Benoit, W.; D'Anna, G.; Erb, A.; Walker, E.; Flükiger, R.

    1997-02-01

    When magnetic flux penetrates a type-II superconductor, it does so as quantized flux lines or vortex lines, so called because each is surrounded by a supercurrent vortex. Interactions between such vortices lead to a very rich and well characterized phenomenology for this 'mixed state'. But an outstanding question remains: are individual vortex lines 'strong', or can they easily be cut and made to pass through one another? The concept of vortex cutting was originally proposed to account for dissipation observed in superconducting wires oriented parallel to an applied magnetic field, where the vortex lines and transport current should be in a force-free configuration1-6. Previous experiments, however, have been unable to establish the vortex topology in the force-free configuration or the size of the energy barrier for vortex cutting. Here we report magneto-optical images of YBa2Cu3O7-δ samples in the force-free configuration which show that thousands of vortex lines can twist together to form highly stable structures. In some cases, these 'vortex twisters' interact with one another to produce wave-like dynamics. Our measurements also determine directly the current required to initiate vortex cutting, and show that it is much higher than that needed to overcome the pinning of vortices by material defects. This implies that thermodynamic phases of entangled vortices7-10 are intrinsically stable and may occupy a significant portion of the mixed-state phase diagram for type-II superconductors.

  5. Two-fluid and magnetohydrodynamic modelling of magnetic reconnection in the MAST spherical tokamak and the solar corona

    NASA Astrophysics Data System (ADS)

    Browning, P. K.; Cardnell, S.; Evans, M.; Arese Lucini, F.; Lukin, V. S.; McClements, K. G.; Stanier, A.

    2016-01-01

    Twisted magnetic flux ropes are ubiquitous in laboratory and astrophysical plasmas, and the merging of such flux ropes through magnetic reconnection is an important mechanism for restructuring magnetic fields and releasing free magnetic energy. The merging-compression scenario is one possible start-up scheme for spherical tokamaks, which has been used on the Mega Amp Spherical Tokamak (MAST). Two current-carrying plasma rings or flux ropes approach each due to mutual attraction, forming a current sheet and subsequently merge through magnetic reconnection into a single plasma torus, with substantial plasma heating. Two-dimensional resistive and Hall-magnetohydrodynamic simulations of this process are reported, including a strong guide field. A model of the merging based on helicity-conserving relaxation to a minimum energy state is also presented, extending previous work to tight-aspect-ratio toroidal geometry. This model leads to a prediction of the final state of the merging, in good agreement with simulations and experiment, as well as the average temperature rise. A relaxation model of reconnection between two or more flux ropes in the solar corona is also described, allowing for different senses of twist, and the implications for heating of the solar corona are discussed.

  6. Twist-writhe partitioning in a coarse-grained DNA minicircle model

    NASA Astrophysics Data System (ADS)

    Sayar, Mehmet; Avşaroǧlu, Barış; Kabakçıoǧlu, Alkan

    2010-04-01

    Here we present a systematic study of supercoil formation in DNA minicircles under varying linking number by using molecular-dynamics simulations of a two-bead coarse-grained model. Our model is designed with the purpose of simulating long chains without sacrificing the characteristic structural properties of the DNA molecule, such as its helicity, backbone directionality, and the presence of major and minor grooves. The model parameters are extracted directly from full-atomistic simulations of DNA oligomers via Boltzmann inversion; therefore, our results can be interpreted as an extrapolation of those simulations to presently inaccessible chain lengths and simulation times. Using this model, we measure the twist/writhe partitioning in DNA minicircles, in particular its dependence on the chain length and excess linking number. We observe an asymmetric supercoiling transition consistent with experiments. Our results suggest that the fraction of the linking number absorbed as twist and writhe is nontrivially dependent on chain length and excess linking number. Beyond the supercoiling transition, chains of the order of one persistence length carry equal amounts of twist and writhe. For longer chains, an increasing fraction of the linking number is absorbed by the writhe.

  7. To investigate the relation between pore size and twist angle in enhanced thermoelectric efficient porous armchair graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Kaur, Sukhdeep; Randhawa, Deep Kamal Kaur; Bindra Narang, Sukhleen

    2018-05-01

    Based on Non-Equilibrium Green’s function method, we demonstrate that the twisted deformation is an efficient method to improve the figure of merit ZT of porous armchair graphene nanoribbons AGNRs. The peak value of ZT can be obtained for a certain tunable twist angle. Further analysis shows that the tunable twist angle exhibits an inverse relationship with the pore size laying forth the designers a choice for the larger twists to be replaced by smaller ones simply by increasing the size of the pore. Ballistic transport regime and semi-empirical method using Huckel basis set is used to obtain the electrical properties while the Tersoff potential is employed for the phononic system. These interesting findings indicate that the twisted porous AGNRs can be utilized as designing materials for potential thermoelectric applications.

  8. Far-Infrared and Raman Spectra and The Ring-Twisting Potential Energy Function of 1,3-Cyclohexadiene

    NASA Astrophysics Data System (ADS)

    Autrey, Daniel; Choo, Jaebum; Laane, Jaan

    2001-10-01

    The nu19 (A2) ring-twisting vibration of 1,3-cyclohexadiene has been analyzed from the vapor-phase Raman and infrared spectra. The Raman spectrum shows nine ring-twisting transitions in the 116 - 199 cm-1 region. The far-infrared spectrum confirms five of these transitions, despite the fact that the vibration is infrared forbidden in the C2v (planar) approximation. Other Raman and infrared combination bands verify the assignments and provide information on the vibrational coupling. A coordinate dependent kinetic energy expansion for the ring-twisting motion was calculated, and this was used to determine the ring-twisting potential function, which has a barrier to planarity of 1132 cm-1 and energy minima corresponding to twisting angles of 9.1º and 30.1º. Ab initio calculations were also carried out using Moller-Plesset perturbation theory (MP2) with a large number of different basis sets. The various ab initio calculations gave barriers to planarity in the 1197 - 1593 cm-1 range and calculated vibrational frequencies in excellent agreement with the experimental values.

  9. Cluster stability in the analysis of mass cytometry data.

    PubMed

    Melchiotti, Rossella; Gracio, Filipe; Kordasti, Shahram; Todd, Alan K; de Rinaldis, Emanuele

    2017-01-01

    Manual gating has been traditionally applied to cytometry data sets to identify cells based on protein expression. The advent of mass cytometry allows for a higher number of proteins to be simultaneously measured on cells, therefore providing a means to define cell clusters in a high dimensional expression space. This enhancement, whilst opening unprecedented opportunities for single cell-level analyses, makes the incremental replacement of manual gating with automated clustering a compelling need. To this aim many methods have been implemented and their successful applications demonstrated in different settings. However, the reproducibility of automatically generated clusters is proving challenging and an analytical framework to distinguish spurious clusters from more stable entities, and presumably more biologically relevant ones, is still missing. One way to estimate cell clusters' stability is the evaluation of their consistent re-occurrence within- and between-algorithms, a metric that is commonly used to evaluate results from gene expression. Herein we report the usage and importance of cluster stability evaluations, when applied to results generated from three popular clustering algorithms - SPADE, FLOCK and PhenoGraph - run on four different data sets. These algorithms were shown to generate clusters with various degrees of statistical stability, many of them being unstable. By comparing the results of automated clustering with manually gated populations, we illustrate how information on cluster stability can assist towards a more rigorous and informed interpretation of clustering results. We also explore the relationships between statistical stability and other properties such as clusters' compactness and isolation, demonstrating that whilst cluster stability is linked to other properties it cannot be reliably predicted by any of them. Our study proposes the introduction of cluster stability as a necessary checkpoint for cluster interpretation and

  10. Sweep-twist adaptive rotor blade : final project report.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ashwill, Thomas D.

    2010-02-01

    Knight & Carver was contracted by Sandia National Laboratories to develop a Sweep Twist Adaptive Rotor (STAR) blade that reduced operating loads, thereby allowing a larger, more productive rotor. The blade design used outer blade sweep to create twist coupling without angled fiber. Knight & Carver successfully designed, fabricated, tested and evaluated STAR prototype blades. Through laboratory and field tests, Knight & Carver showed the STAR blade met the engineering design criteria and economic goals for the program. A STAR prototype was successfully tested in Tehachapi during 2008 and a large data set was collected to support engineering and commercialmore » development of the technology. This report documents the methodology used to develop the STAR blade design and reviews the approach used for laboratory and field testing. The effort demonstrated that STAR technology can provide significantly greater energy capture without higher operating loads on the turbine.« less

  11. Organizing the Cellular and Molecular Heterogeneity in High-Grade Serous Ovarian Cancer by Mass Cytometry

    DTIC Science & Technology

    2014-10-01

    Bendall SC, Sung P, Nolan GP, Arvin AM. Single-cell mass cytometry analysis of human tonsil T cell remodeling by varicella zoster virus. Cell Rep...Perspectives on Flow Cytometry 2013, September 20, 2013, Mass Cytometry and Cell Cycle, Mexico City, Mexico (by Web Conference) Nolan: Nuclear

  12. Somatic twist: a model for the evolution of decussation.

    PubMed

    Kinsbourne, Marcel

    2013-09-01

    In the chordate and vertebrate central nervous system, sensory and motor nerve tracts cross from one side to the other as they connect the brain with sensory receptors and motor neurons. These "decussations," crossings in the form of an X, relate each side of the brain to the opposite side of the body. The protochordates derive from an invertebrate ancestor, but no such contralateral arrangement occurs in any invertebrate phylum. No adaptive benefit of decussation has been established. What might explain the evolution of decussation? A brief review of relevant features of comparative morphology of invertebrates, chordates and vertebrates leads to an explanatory model of decussation. A "somatic twist model" of invertebrate-vertebrate transition accounts for decussations as byproducts of a more momentous change; the relocation of the neuraxis from the ventral to the dorsal aspect of the body. Evidence is presented that this inversion proceeded by means of a twisting of the body 180 degrees on its axis just behind its anterior pole. This rotation aligned the neuraxis with the dorsal head ganglia and brain and by twisting the nerve tracts it brought decussation in its wake. Decussation evolved as a byproduct of a genetically determined partial inversion of the body plan, which resulted in a 180 degree rotation posterior to the brain and oropharynx.

  13. New collinear twist-3 analysis of transverse SSA: Toward a resolution for the sign-mismatch problem

    DOE PAGES

    Kanazawa, Koichi; Pitonyak, Daniel; Koike, Yuji; ...

    2014-10-19

    We present a new collinear twist-3 analysis of the transverse SSA A N at RHIC. We use the TMD Sivers/Collins function to fix some of the relevant collinear twist-3 functions and perform a fit of the RHIC data with other parameterized twist-3 functions. This allows us to keep the consistency among descriptions in pp collision, SIDIS, and e +e – annihilation and thus could provide a unified description of the spin asymmetries in the low- and high-P T processes. In conclusion, by taking into account the twist-3 fragmentation contribution, we show for the first time this contribution could be themore » main source of A N in pp ↑ → hX and its inclusion could provide a solution for the sign-mismatch problem.« less

  14. Scaling effects in resonant coupling phenomena between fundamental and cladding modes in twisted microstructured optical fibers.

    PubMed

    Napiorkowski, Maciej; Urbanczyk, Waclaw

    2018-04-30

    We show that in twisted microstructured optical fibers (MOFs) the coupling between the core and cladding modes can be obtained for helix pitch much greater than previously considered. We provide an analytical model describing scaling properties of the twisted MOFs, which relates coupling conditions to dimensionless ratios between the wavelength, the lattice pitch and the helix pitch of the twisted fiber. Furthermore, we verify our model using a rigorous numerical method based on the transformation optics formalism and study its limitations. The obtained results show that for appropriately designed twisted MOFs, distinct, high loss resonance peaks can be obtained in a broad wavelength range already for the fiber with 9 mm helix pitch, thus allowing for fabrication of coupling based devices using a less demanding method involving preform spinning.

  15. CytometryML, an XML format based on DICOM and FCS for analytical cytology data.

    PubMed

    Leif, Robert C; Leif, Suzanne B; Leif, Stephanie H

    2003-07-01

    Flow Cytometry Standard (FCS) was initially created to standardize the software researchers use to analyze, transmit, and store data produced by flow cytometers and sorters. Because of the clinical utility of flow cytometry, it is necessary to have a standard consistent with the requirements of medical regulatory agencies. We extended the existing mapping of FCS to the Digital Imaging and Communications in Medicine (DICOM) standard to include list-mode data produced by flow cytometry, laser scanning cytometry, and microscopic image cytometry. FCS list-mode was mapped to the DICOM Waveform Information Object. We created a collection of Extensible Markup Language (XML) schemas to express the DICOM analytical cytologic text-based data types except for large binary objects. We also developed a cytometry markup language, CytometryML, in an open environment subject to continuous peer review. The feasibility of expressing the data contained in FCS, including list-mode in DICOM, was demonstrated; and a preliminary mapping for list-mode data in the form of XML schemas and documents was completed. DICOM permitted the creation of indices that can be used to rapidly locate in a list-mode file the cells that are members of a subset. DICOM and its coding schemes for other medical standards can be represented by XML schemas, which can be combined with other relevant XML applications, such as Mathematical Markup Language (MathML). The use of XML format based on DICOM for analytical cytology met most of the previously specified requirements and appears capable of meeting the others; therefore, the present FCS should be retired and replaced by an open, XML-based, standard CytometryML. Copyright 2003 Wiley-Liss, Inc.

  16. Capture of Fluorescence Decay Times by Flow Cytometry

    PubMed Central

    Naivar, Mark A.; Jenkins, Patrick; Freyer, James P.

    2012-01-01

    In flow cytometry, the fluorescence decay time of an excitable species has been largely underutilized and is not likely found as a standard parameter on any imaging cytometer, sorting, or analyzing system. Most cytometers lack fluorescence lifetime hardware mainly owing to two central issues. Foremost, research and development with lifetime techniques has lacked proper exploitation of modern laser systems, data acquisition boards, and signal processing techniques. Secondly, a lack of enthusiasm for fluorescence lifetime applications in cells and with bead-based assays has persisted among the greater cytometry community. In this unit, we describe new approaches that address these issues and demonstrate the simplicity of digitally acquiring fluorescence relaxation rates in flow. The unit is divided into protocol and commentary sections in order to provide a most comprehensive discourse on acquiring the fluorescence lifetime with frequency-domain methods. The unit covers (i) standard fluorescence lifetime acquisition (protocol-based) with frequency-modulated laser excitation, (ii) digital frequency-domain cytometry analyses, and (iii) interfacing fluorescence lifetime measurements onto sorting systems. Within the unit is also a discussion on how digital methods are used for aliasing in order to harness higher frequency ranges. Also, a final discussion is provided on heterodyning and processing of waveforms for multi-exponential decay extraction. PMID:25419263

  17. Knockdown of TWIST1 enhances arsenic trioxide- and ionizing radiation-induced cell death in lung cancer cells by promoting mitochondrial dysfunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seo, Sung-Keum; Kim, Jae-Hee; Choi, Ha-Na

    Highlights: • Knockdown of TWIST1 enhanced ATO- and IR-induced cell death in NSCLCs. • Intracellular ROS levels were increased in cells treated with TWIST1 siRNA. • TWIST1 siRNA induced MMP loss and mitochondrial fragmentation. • TWIST1 siRNA upregulated the fission-related proteins FIS1 and DRP1. - Abstract: TWIST1 is implicated in the process of epithelial mesenchymal transition, metastasis, stemness, and drug resistance in cancer cells, and therefore is a potential target for cancer therapy. In the present study, we found that knockdown of TWIST1 by small interfering RNA (siRNA) enhanced arsenic trioxide (ATO)- and ionizing radiation (IR)-induced cell death in non-small-cellmore » lung cancer cells. Interestingly, intracellular reactive oxygen species levels were increased in cells treated with TWIST1 siRNA and further increased by co-treatment with ATO or IR. Pretreatment of lung cancer cells with the antioxidant N-acetyl-cysteine markedly suppressed the cell death induced by combined treatment with TWIST1 siRNA and ATO or IR. Moreover, treatment of cells with TWIST1 siRNA induced mitochondrial membrane depolarization and significantly increased mitochondrial fragmentation (fission) and upregulated the fission-related proteins FIS1 and DRP1. Collectively, our results demonstrate that siRNA-mediated TWIST1 knockdown induces mitochondrial dysfunction and enhances IR- and ATO-induced cell death in lung cancer cells.« less

  18. THE PRE-PENUMBRAL MAGNETIC CANOPY IN THE SOLAR ATMOSPHERE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MacTaggart, David; Guglielmino, Salvo L.; Zuccarello, Francesca

    2016-11-01

    Penumbrae are the manifestation of magnetoconvection in highly inclined (to the vertical direction) magnetic field. The penumbra of a sunspot tends to form, initially, along the arc of the umbra antipodal to the main region of flux emergence. The question of how highly inclined magnetic field can concentrate along the antipodal curves of umbrae, at least initially, remains to be answered. Previous observational studies have suggested the existence of some form of overlying magnetic canopy that acts as the progenitor for penumbrae. We propose that such overlying magnetic canopies are a consequence of how the magnetic field emerges into themore » atmosphere and are, therefore, part of the emerging region. We show, through simulations of twisted flux tube emergence, that canopies of highly inclined magnetic field form preferentially at the required locations above the photosphere.« less

  19. On the small angle twist sub-grain boundaries in Ti3AlC2.

    PubMed

    Zhang, Hui; Zhang, Chao; Hu, Tao; Zhan, Xun; Wang, Xiaohui; Zhou, Yanchun

    2016-04-01

    Tilt-dominated grain boundaries have been investigated in depth in the deformation of MAX phases. In stark contrast, another important type of grain boundaries, twist grain boundaries, have long been overlooked. Here, we report on the observation of small angle twist sub-grain boundaries in a typical MAX phase Ti3AlC2 compressed at 1200 °C, which comprise hexagonal screw dislocation networks formed by basal dislocation reactions. By first-principles investigations on atomic-scale deformation and general stacking fault energy landscapes, it is unequivocally demonstrated that the twist sub-grain boundaries are most likely located between Al and Ti4f (Ti located at the 4f Wyckoff sites of P63/mmc) layers, with breaking of the weakly bonded Al-Ti4f. The twist angle increases with the increase of deformation and is estimated to be around 0.5° for a deformation of 26%. This work may shed light on sub-grain boundaries of MAX phases, and provide fundamental information for future atomic-scale simulations.

  20. Effect of Intrinsic Twist on Length of Crystalline and Disordered Regions in Cellulose Microfibrils

    NASA Astrophysics Data System (ADS)

    Nili, Abdolmadjid; Shklyaev, Oleg; Zhao, Zhen; Zhong, Linghao; Crespi, Vincent

    2013-03-01

    Cellulose is the most abundant biological material in the world. It provides mechanical reinforcement for plant cell wall, and could potentially serve as renewable energy source for biofuel. Native cellulose forms a non-centrosymmetric chiral crystal due to lack of roto-inversion symmetry of constituent glucose chains. Chirality of cellulose crystal could result in an overall twist. Competition between unwinding torsional/extensional and twisting energy terms leads to twist induced frustration along fibril's axis. The accumulated frustration could be the origin of periodic disordered regions observed in cellulose microfibrils. These regions could play significant role in properties of cellulose bundles and ribbons as well as biological implications on plant cell walls. We propose a mechanical model based on Frenkel-Kontorova mechanism to investigate effects of radius dependent twist on crystalline size in cellulose microfibrils. Parameters of the model are adjusted according to all-atom molecular simulations. This work is supported by the US Department of Energy, Office of Basic Energy Sciences as part of The Center for LignoCellulose Structure and Formation, an Energy Frontier Research Center

  1. The TWIST1 oncogene is a direct target of hypoxia-inducible factor-2alpha.

    PubMed

    Gort, E H; van Haaften, G; Verlaan, I; Groot, A J; Plasterk, R H A; Shvarts, A; Suijkerbuijk, K P M; van Laar, T; van der Wall, E; Raman, V; van Diest, P J; Tijsterman, M; Vooijs, M

    2008-03-06

    Hypoxia-inducible factors (HIFs) are highly conserved transcription factors that play a crucial role in oxygen homeostasis. Intratumoral hypoxia and genetic alterations lead to HIF activity, which is a hallmark of solid cancer and is associated with poor clinical outcome. HIF activity is regulated by an evolutionary conserved mechanism involving oxygen-dependent HIFalpha protein degradation. To identify novel components of the HIF pathway, we performed a genome-wide RNA interference screen in Caenorhabditis elegans, to suppress HIF-dependent phenotypes, like egg-laying defects and hypoxia survival. In addition to hif-1 (HIFalpha) and aha-1 (HIFbeta), we identified hlh-8, gska-3 and spe-8. The hlh-8 gene is homologous to the human oncogene TWIST1. We show that TWIST1 expression in human cancer cells is enhanced by hypoxia in a HIF-2alpha-dependent manner. Furthermore, intronic hypoxia response elements of TWIST1 are regulated by HIF-2alpha, but not HIF-1alpha. These results identify TWIST1 as a direct target gene of HIF-2alpha, which may provide insight into the acquired metastatic capacity of hypoxic tumors.

  2. Shape memory alloy TiNi actuators for twist control of smart wing designs

    NASA Astrophysics Data System (ADS)

    Jardine, A. Peter; Kudva, Jayanth N.; Martin, Christopher A.; Appa, Kari

    1996-05-01

    On high performance military aircraft, small changes in both wing twist and wing camber have the potential to provide substantial payoffs in terms of additional lift and enhanced maneuverability. To achieve the required wing shape, actuators made of smart materials are currently being studied under an ARPA/WL contract for a subscale model of a fighter aircraft. The use of the shape memory alloy TiNi for wing twist actuation was investigated using shape memory effect (SME) torque tube actuator configurations. The actuator configurations were sized to fit inside a 16% scale model of an aircraft wing and the torque's supplied to the wing were similarly calculated from full-scale requirements. The actuator systems were tested in a conventional laboratory setting. Design and calibration of the actuators for wing twist are discussed.

  3. Twisting Blob of Plasma

    NASA Image and Video Library

    2017-12-08

    A twisted blob of solar material – a hot, charged gas called plasma – can be seen erupting off the side of the sun on Sept. 26, 2014. The image is from NASA's Solar Dynamics Observatory, focusing in on ionized Helium at 60,000 degrees C. Credit: NASA/SDO NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram

  4. The Effect of Non-Harmonic Active Twist Actuation on BVI Noise

    NASA Technical Reports Server (NTRS)

    Fogarty, David E.; Wilbur, Matthew L.; Sekula, Martin K.

    2011-01-01

    The results of a computational study examining the effects of non-harmonic active-twist control on blade-vortex interaction (BVI) noise for the Apache Active Twist Rotor are presented. Rotor aeroelastic behavior was modeled using the Comprehensive Analytical Model of Rotorcraft Aerodynamics and Dynamics code and the rotor noise was predicted using the acoustics code PSU-WOPWOP. The application of non-harmonic active-twist inputs to the main rotor blade system comprised three parameters: azimuthal location to start actuation, azimuthal duration of actuation, and magnitude of actuation. The acoustic analysis was conducted for a single low-speed flight condition of advance ratio mu=0.14 and shaft angle-of-attack, a(sub s)=+6deg. BVI noise levels were predicted on a flat plane of observers located 1.1 rotor diameters beneath the rotor. The results indicate significant reductions of up to 10dB in BVI noise using a starting azimuthal location for actuation of 90?, an azimuthal duration of actuation of 90deg, and an actuation magnitude of +1.5 ft-lb.

  5. Quercetin Suppresses Twist to Induce Apoptosis in MCF-7 Breast Cancer Cells

    PubMed Central

    Ranganathan, Santhalakshmi; Halagowder, Devaraj; Sivasithambaram, Niranjali Devaraj

    2015-01-01

    Quercetin is a dietary flavonoid which exerts anti-oxidant, anti-inflammatory and anti-cancer properties. In this study, we investigated the anti-proliferative effect of quercetin in two breast cancer cell lines (MCF-7 and MDA-MB-231), which differed in hormone receptor. IC50 value (37μM) of quercetin showed significant cytotoxicity in MCF-7 cells, which was not observed in MDA-MB-231 cells even at 100μM of quercetin treatment. To study the response of cancer cells to quercetin, with respect to different hormone receptors, both the cell lines were treated with a fixed concentration (40μM) of quercetin. MCF-7 cells on quercetin treatment showed more apoptotic cells with G1 phase arrest. In addition, quercetin effectively suppressed the expression of CyclinD1, p21, Twist and phospho p38MAPK, which was not observed in MDA-MB-231 cells. To analyse the molecular mechanism of quercetin in exerting an apoptotic effect in MCF-7 cells, Twist was over-expressed and the molecular changes were observed after quercetin administration. Quercetin effectively regulated the expression of Twist, in turn p16 and p21 which induced apoptosis in MCF-7 cells. In conclusion, quercetin induces apoptosis in breast cancer cells through suppression of Twist via p38MAPK pathway. PMID:26491966

  6. Flow Cytometry of Spinach Chloroplasts 1

    PubMed Central

    Schröder, Wolfgang P.; Petit, Patrice X.

    1992-01-01

    Intact spinach (Spinacia oleracea) chloroplasts, thylakoid membranes, and inside-out or right-side-out thylakoid vesicles have been characterized by flow cytometry with respect to forward angle light scatter, right angle light scatter, and chlorophyll fluorescence. Analysis of intact chloroplasts with respect to forward light scatter and the chlorophyll fluorescence parameter revealed the presence of truly “intact” and “disrupted” chloroplasts. The forward light scatter parameter, normally considered to reflect object size, was instead found to reflect the particle density. One essential advantage of flow cytometry is that additional parameters such as Ricinus communis agglutinin (linked to fluorescein isothiocyanate) fluorescence can be determined through logical conditions placed on bit-maps, amounting to an analytical purification procedure. In the present case, chloroplast subpopulations with fully preserved envelopes, thylakoid membrane, and inside-out or right-side-out thylakoid membranes vesicles can be distinguished. Flow cytometry is also a useful tool to address the question of availability of glycosyl moities on the membrane surfaces if one keeps in mind that organelle-to-organelle interactions could be partially mediated through a recognition process. A high specific binding of R. communis agglutinin and peanut lectin to the chloroplast envelope was detected. This showed that galactose residues were exposed and accessible to specific lectins on the chloroplast surface. No exposed glucose, fucose, or mannose residues could be detected by the appropriate lectins. Ricin binding to the intact chloroplasts caused a strong aggregation. Disruption of these aggregates by resuspension or during passage in the flow cytometer induced partial breakage of the chloroplasts. Only minor binding of R. communis agglutinin and peanut lectin to the purified thylakoid membranes was detected; the binding was found to be low for both inside-out and right

  7. The role of flow cytometry in companion animal diagnostic medicine.

    PubMed

    Tarrant, Jacqueline M

    2005-11-01

    Flow cytometry is a powerful tool for characterising the composition of complex cell populations. The accuracy and precision of this technology for describing and enumerating cells exceeds traditional methods. The number of diagnostic veterinary laboratories with access to a dedicated machine is increasing, and there is the potential to offer a clinical flow cytometry service. The improved availability of monoclonal antibodies (mAb) to cell markers expressed by the leukocytes of companion animals, permits the implementation of comprehensive mAb panels suitable for diagnosis of lympho- and myeloproliferative disease. Reticulated erythrocyte and platelet quantification, antiglobulin assays for immune-mediated cytopenias, lymphocyte subset analysis, and immunophenotyping of lymphoma and leukemia, have been validated for companion animal samples on the flow cytometer. It is now timely to consider the role of flow cytometry in diagnostic practice, and the requirement for quality assurance and standardization of testing procedures.

  8. A Method for the Interpretation of Flow Cytometry Data Using Genetic Algorithms.

    PubMed

    Angeletti, Cesar

    2018-01-01

    Flow cytometry analysis is the method of choice for the differential diagnosis of hematologic disorders. It is typically performed by a trained hematopathologist through visual examination of bidimensional plots, making the analysis time-consuming and sometimes too subjective. Here, a pilot study applying genetic algorithms to flow cytometry data from normal and acute myeloid leukemia subjects is described. Initially, Flow Cytometry Standard files from 316 normal and 43 acute myeloid leukemia subjects were transformed into multidimensional FITS image metafiles. Training was performed through introduction of FITS metafiles from 4 normal and 4 acute myeloid leukemia in the artificial intelligence system. Two mathematical algorithms termed 018330 and 025886 were generated. When tested against a cohort of 312 normal and 39 acute myeloid leukemia subjects, both algorithms combined showed high discriminatory power with a receiver operating characteristic (ROC) curve of 0.912. The present results suggest that machine learning systems hold a great promise in the interpretation of hematological flow cytometry data.

  9. Twisted Pair Of Insulated Wires Senses Moisture

    NASA Technical Reports Server (NTRS)

    Laue, Eric G.; Stephens, James B.

    1989-01-01

    Sensitivity of electronic moisture sensor to low levels of moisture increased by new electrode configuration. Moisture-sensing circuit described in "Low-Cost Humidity Sensor" (NPO-16544). New twisted pair of wires takes place of flat-plate capacitor in circuit. Configuration allows for thermal expansion and contraction of polymer while maintaining nearly constant area of contact between polymer and wires.

  10. Mass cytometry: blessed with the curse of dimensionality.

    PubMed

    Newell, Evan W; Cheng, Yang

    2016-07-19

    Immunologists are being compelled to develop new high-dimensional perspectives of cellular heterogeneity and to determine which applications best exploit the power of mass cytometry and associated multiplex approaches.

  11. Forced three-dimensional magnetic reconnection due to linkage of magnetic flux tubes

    NASA Technical Reports Server (NTRS)

    Otto, A.

    1995-01-01

    During periods of southward interplanetary magnetic field (IMF) orientation the magnetic field geometry at the dayside magnetopause is susceptible to magnetic reconnection. It has been suggested that reconnection may occur in a localized manner at several patches on the magnetopause. A major problem with this picture is the interaction of magnetic flux ropes which are generated by different reconnection processes. An individual flux rope is bent elbowlike where it intersects the magnetopause and the magnetic field changes from magnetospheric to interplanetary magnetic field orientation. Multiple patches of reconnection can lead to the formation of interlinked magnetic flux tubes. Although the corresponding flux is connected to the IMF the northward and southward connected branches are hooked into each other and cannot develop independently. We have studied this problem in the framework of three-dimensional magnetohydrodynamic simulations. The results indicate that a singular current sheet forms at the interface of two interlinked flux tubes if no resistivity is present in the simulation. This current sheet is strongly tilted compared to the original current sheet. In the presence of resistivity the interaction of the two flux tubes forces a fast reconnection process which generates helically twisted closed magnetospheric flux. This linkage induced reconnection generates a boundary layer with layers of open and closed magnetospheric flux and may account for the brightening of auroral arcs poleward of the boundary between open and closed magnetic flux.

  12. Selectively enhanced photocurrent generation in twisted bilayer graphene with van Hove singularity

    PubMed Central

    Yin, Jianbo; Wang, Huan; Peng, Han; Tan, Zhenjun; Liao, Lei; Lin, Li; Sun, Xiao; Koh, Ai Leen; Chen, Yulin; Peng, Hailin; Liu, Zhongfan

    2016-01-01

    Graphene with ultra-high carrier mobility and ultra-short photoresponse time has shown remarkable potential in ultrafast photodetection. However, the broad and weak optical absorption (∼2.3%) of monolayer graphene hinders its practical application in photodetectors with high responsivity and selectivity. Here we demonstrate that twisted bilayer graphene, a stack of two graphene monolayers with an interlayer twist angle, exhibits a strong light–matter interaction and selectively enhanced photocurrent generation. Such enhancement is attributed to the emergence of unique twist-angle-dependent van Hove singularities, which are directly revealed by spatially resolved angle-resolved photoemission spectroscopy. When the energy interval between the van Hove singularities of the conduction and valance bands matches the energy of incident photons, the photocurrent generated can be significantly enhanced (up to ∼80 times with the integration of plasmonic structures in our devices). These results provide valuable insight for designing graphene photodetectors with enhanced sensitivity for variable wavelength. PMID:26948537

  13. Twist drill craniostomy with closed drainage for chronic subdural haematoma in the elderly: an effective method.

    PubMed

    Ramnarayan, R; Arulmurugan, B; Wilson, Paul M; Nayar, Rani

    2008-09-01

    Chronic subdural haematoma is a disease of the elderly and surgery in these patients carries a much higher risk. The common surgical procedures for chronic subdural haematoma include twist drill craniostomy, burr hole evacuation or craniotomy. The aim of this study was to analyse the results of twist drill craniostomy with drainage in elderly patients with chronic subdural haematoma. Forty-two elderly patients (>65 years) with radiologically proven chronic subdural haematoma were analysed. All the patients underwent twist drill craniostomy and continuous drainage of the haematoma under local anaesthesia and total intravenous anaesthesia (TIVA). There were 24 males and 18 females. Headache and cognitive decline was seen in 50% and weakness of limbs in 60% of patients. CT scan was done in all cases. All patients underwent twist drill 2-3 cm in front of the parietal eminence under local anaesthesia. The drain was left for 24-72 h depending on the drainage. At 1 week, 88% of patients had a good outcome. Twist drill craniostomy with drainage under local anaesthesia is a safe and effective procedure for chronic subdural haematoma in the elderly and could be used as the first and only option in these people.

  14. Strain, curvature, and twist measurements in digital holographic interferometry using pseudo-Wigner-Ville distribution based method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rajshekhar, G.; Gorthi, Sai Siva; Rastogi, Pramod

    2009-09-15

    Measurement of strain, curvature, and twist of a deformed object play an important role in deformation analysis. Strain depends on the first order displacement derivative, whereas curvature and twist are determined by second order displacement derivatives. This paper proposes a pseudo-Wigner-Ville distribution based method for measurement of strain, curvature, and twist in digital holographic interferometry where the object deformation or displacement is encoded as interference phase. In the proposed method, the phase derivative is estimated by peak detection of pseudo-Wigner-Ville distribution evaluated along each row/column of the reconstructed interference field. A complex exponential signal with unit amplitude and the phasemore » derivative estimate as the argument is then generated and the pseudo-Wigner-Ville distribution along each row/column of this signal is evaluated. The curvature is estimated by using peak tracking strategy for the new distribution. For estimation of twist, the pseudo-Wigner-Ville distribution is evaluated along each column/row (i.e., in alternate direction with respect to the previous one) for the generated complex exponential signal and the corresponding peak detection gives the twist estimate.« less

  15. Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12

    PubMed Central

    Tan, Jiangning; Tedrow, John R.; Nouraie, Mehdi; Dutta, Justin A.; Miller, David T.; Li, Xiaoyun; Yu, Shibing; Chu, Yanxia; Juan-Guardela, Brenda; Kaminski, Naftali; Ramani, Kritika; Biswas, Partha S.; Zhang, Yingze

    2017-01-01

    Idiopathic pulmonary fibrosis (IPF) is a disease characterized by the accumulation of apoptosis-resistant fibroblasts in the lung. We have previously shown that high expression of the transcription factor Twist1 may explain this prosurvival phenotype in vitro. However, this observation has never been tested in vivo. We found that loss of Twist1 in COL1A2+ cells led to increased fibrosis characterized by very significant accumulation of T cells and bone marrow–derived matrix-producing cells. We found that Twist1-null cells expressed high levels of the T cell chemoattractant CXCL12. In vitro, we found that the loss of Twist1 in IPF lung fibroblasts increased expression of CXCL12 downstream of increased expression of the noncanonical NF-κB transcription factor RelB. Finally, blockade of CXCL12 with AMD3100 attenuated the exaggerated fibrosis observed in Twist1-null mice. Transcriptomic analysis of 134 IPF patients revealed that low expression of Twist1 was characterized by enrichment of T cell pathways. In conclusion, loss of Twist1 in collagen-producing cells led to increased bleomycin-induced pulmonary fibrosis, which is mediated by increased expression of CXCL12. Twist1 expression is associated with dysregulation of T cells in IPF patients. Twist1 may shape the IPF phenotype and regulate inflammation in fibrotic lung injury. PMID:28179498

  16. The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise

    PubMed Central

    Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J.

    2016-01-01

    Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, V˙O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32–69% of V˙O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results. PMID:27100099

  17. The Effects of Exercise Intensity vs. Metabolic State on the Variability and Magnitude of Left Ventricular Twist Mechanics during Exercise.

    PubMed

    Armstrong, Craig; Samuel, Jake; Yarlett, Andrew; Cooper, Stephen-Mark; Stembridge, Mike; Stöhr, Eric J

    2016-01-01

    Increased left ventricular (LV) twist and untwisting rate (LV twist mechanics) are essential responses of the heart to exercise. However, previously a large variability in LV twist mechanics during exercise has been observed, which complicates the interpretation of results. This study aimed to determine some of the physiological sources of variability in LV twist mechanics during exercise. Sixteen healthy males (age: 22 ± 4 years, [Formula: see text]O2peak: 45.5 ± 6.9 ml∙kg-1∙min-1, range of individual anaerobic threshold (IAT): 32-69% of [Formula: see text]O2peak) were assessed at rest and during exercise at: i) the same relative exercise intensity, 40%peak, ii) at 2% above IAT, and, iii) at 40%peak with hypoxia (40%peak+HYP). LV volumes were not significantly different between exercise conditions (P > 0.05). However, the mean margin of error of LV twist was significantly lower (F2,47 = 2.08, P < 0.05) during 40%peak compared with IAT (3.0 vs. 4.1 degrees). Despite the same workload and similar LV volumes, hypoxia increased LV twist and untwisting rate (P < 0.05), but the mean margin of error remained similar to that during 40%peak (3.2 degrees, P > 0.05). Overall, LV twist mechanics were linearly related to rate pressure product. During exercise, the intra-individual variability of LV twist mechanics is smaller at the same relative exercise intensity compared with IAT. However, the absolute magnitude (degrees) of LV twist mechanics appears to be associated with the prevailing rate pressure product. Exercise tests that evaluate LV twist mechanics should be standardised by relative exercise intensity and rate pressure product be taken into account when interpreting results.

  18. Supercontinuum white light lasers for flow cytometry

    PubMed Central

    Telford, William G.; Subach, Fedor V.; Verkhusha, Vladislav V.

    2009-01-01

    Excitation of fluorescent probes for flow cytometry has traditionally been limited to a few discrete laser lines, an inherent limitation in our ability to excite the vast array of fluorescent probes available for cellular analysis. In this report, we have used a supercontinuum (SC) white light laser as an excitation source for flow cytometry. By selectively filtering the wavelength of interest, almost any laser wavelength in the visible spectrum can be separated and used for flow cytometric analysis. The white light lasers used in this study were integrated into a commercial flow cytometry platform, and a series of high-transmission bandpass filters used to select wavelength ranges from the blue (~480 nm) to the long red (>700 nm). Cells labeled with a variety of fluorescent probes or expressing fluorescent proteins were then analyzed, in comparison with traditional lasers emitting at wavelengths similar to the filtered SC source. Based on a standard sensitivity metric, the white light laser bandwidths produced similar excitation levels to traditional lasers for a wide variety of fluorescent probes and expressible proteins. Sensitivity assessment using fluorescent bead arrays confirmed that the SC laser and traditional sources resulted in similar levels of detection sensitivity. Supercontinuum white light laser sources therefore have the potential to remove a significant barrier in flow cytometric analysis, namely the limitation of excitation wavelengths. Almost any visible wavelength range can be made available for excitation, allowing access to virtually any fluorescent probe, and permitting “fine-tuning” of excitation wavelength to particular probes. PMID:19072836

  19. Twist seal for high-pressure vessels such as space shuttle rocket motors

    NASA Technical Reports Server (NTRS)

    von Pragenau, George L. (Inventor)

    1989-01-01

    Seals for sealing clevis and flange joints (14) of a solid rocket booster motor, and more particularly to a seal (30) which is twisted upon application of expansion forces to an edge seal (36). This twisting motion initially causes a leading edge seal (44) to be urged into sealing engagement with a surface (48) of an adjacent member (20) and thereafter, increasing fluid pressure on a pressurized side (64) of a seal (30) drives a broad sealing region (46) into sealing engagement with a surface (48).

  20. TWIST and p-Akt immunoexpression in normal oral epithelium oral dysplasia and in oral squamous cell carcinoma

    PubMed Central

    Yamamoto, Fernanda-Paula; Corrêa Pontes, Flávia-Sirotheau; Cury, Sérgio-Elias; Fonseca, Felipe-Paiva; Rebelo-Pontes, Hélder; Pinto-Júnior, Décio-dos Santos

    2012-01-01

    Objectives: The aim of this study was to evaluate the immunoexpression of TWIST and p-Akt proteins in oral leukoplakia (OL) and oral squamous cell carcinoma (OSCC), correlating their expressions with the histological features of the lesions. Study design: Immunohistochemical studies were carried out on 10 normal oral epithelium, 30 OL and 20 OSCC formalin-fixed, paraffin-embedded tissue samples. Immunoperoxidase reactions for TWIST and p-Akt proteins were applied on the specimens and the positivity of the reactions was calculated for 1000 epithelial cells. Results: Kruskal-Wallis and Dunn’s post tests revealed a significant difference in TWIST and p-Akt immunoexpression among normal oral mucosa, OL and OSCC. In addition, a significant positive correlation was found between TWIST and p-Akt expressions according to the Pearson’s correlation test. Conclusions: The results obtained in the current study suggest that TWIST and p-Akt may participate of the multi-step process of oral carcinogenesis since its early stages. Key words: Oral cancer, oral leukoplakia, dysplasia, immunohistochemistry. PMID:21743395

  1. Theory and compensation method of axial magnetic error induced by axial magnetic field in a polarization-maintaining fiber optic gyro

    NASA Astrophysics Data System (ADS)

    Zhou, Yanru; Zhao, Yuxiang; Tian, Hui; Zhang, Dengwei; Huang, Tengchao; Miao, Lijun; Shu, Xiaowu; Che, Shuangliang; Liu, Cheng

    2016-12-01

    In an axial magnetic field (AMF), which is vertical to the plane of the fiber coil, a polarization-maintaining fiber optic gyro (PM-FOG) appears as an axial magnetic error. This error is linearly related to the intensity of an AMF, the radius of the fiber coil, and the light wavelength, and also influenced by the distribution of fiber twist. When a PM-FOG is manufactured completely, this error only appears a linear correlation with the AMF. A real-time compensation model is established to eliminate the error, and the experimental results show that the axial magnetic error of the PM-FOG is decreased from 5.83 to 0.09 deg/h in 12G AMF with 18-dB suppression.

  2. Integral Twist Actuation of Helicopter Rotor Blades for Vibration Reduction

    NASA Technical Reports Server (NTRS)

    Shin, SangJoon; Cesnik, Carlos E. S.

    2001-01-01

    Active integral twist control for vibration reduction of helicopter rotors during forward flight is investigated. The twist deformation is obtained using embedded anisotropic piezocomposite actuators. An analytical framework is developed to examine integrally-twisted blades and their aeroelastic response during different flight conditions: frequency domain analysis for hover, and time domain analysis for forward flight. Both stem from the same three-dimensional electroelastic beam formulation with geometrical-exactness, and axe coupled with a finite-state dynamic inflow aerodynamics model. A prototype Active Twist Rotor blade was designed with this framework using Active Fiber Composites as the actuator. The ATR prototype blade was successfully tested under non-rotating conditions. Hover testing was conducted to evaluate structural integrity and dynamic response. In both conditions, a very good correlation was obtained against the analysis. Finally, a four-bladed ATR system is built and tested to demonstrate its concept in forward flight. This experiment was conducted at NASA Langley Tansonic Dynamics Tunnel and represents the first-of-a-kind Mach-scaled fully-active-twist rotor system to undergo forward flight test. In parallel, the impact upon the fixed- and rotating-system loads is estimated by the analysis. While discrepancies are found in the amplitude of the loads under actuation, the predicted trend of load variation with respect to its control phase correlates well. It was also shown, both experimentally and numerically, that the ATR blade design has the potential for hub vibratory load reduction of up to 90% using individual blade control actuation. Using the numerical framework, system identification is performed to estimate the harmonic transfer functions. The linear time-periodic system can be represented by a linear time-invariant system under the three modes of blade actuation: collective, longitudinal cyclic, and lateral cyclic. A vibration

  3. Electric current variations and 3D magnetic configuration of coronal jets

    NASA Astrophysics Data System (ADS)

    Schmieder, Brigitte; Harra, Louise K.; Aulanier, Guillaume; Guo, Yang; Demoulin, Pascal; Moreno-Insertis, Fernando, , Prof

    Coronal jets (EUV) were observed by SDO/AIA on September 17, 2010. HMI and THEMIS measured the vector magnetic field from which we derived the magnetic flux, the phostospheric velocity and the vertical electric current. The magnetic configuration was computed with a non linear force-free approach. The phostospheric current pattern of the recurrent jets were associated with the quasi-separatrix layers deduced from the magnetic extrapolation. The large twisted near-by Eiffel-tower-shape jet was also caused by reconnection in current layers containing a null point. This jet cannot be classified precisely within either the quiescent or the blowout jet types. We will show the importance of the existence of bald patches in the low atmosphere

  4. In vivo photoacoustic flow cytometry for early malaria diagnosis.

    PubMed

    Cai, Chengzhong; Carey, Kai A; Nedosekin, Dmitry A; Menyaev, Yulian A; Sarimollaoglu, Mustafa; Galanzha, Ekaterina I; Stumhofer, Jason S; Zharov, Vladimir P

    2016-06-01

    In vivo photoacoustic (PA) flow cytometry (PAFC) has already demonstrated a great potential for the diagnosis of deadly diseases through ultrasensitive detection of rare disease-associated circulating markers in whole blood volume. Here, we demonstrate the first application of this powerful technique for early diagnosis of malaria through label-free detection of malaria parasite-produced hemozoin in infected red blood cells (iRBCs) as high-contrast PA agent. The existing malaria tests using blood smears can detect the disease at 0.001-0.1% of parasitemia. On the contrary, linear PAFC showed a potential for noninvasive malaria diagnosis at an extremely low level of parasitemia of 0.0000001%, which is ∼10(3) times better than the existing tests. Multicolor time-of-flight PAFC with high-pulse repetition rate lasers at wavelengths of 532, 671, and 820 nm demonstrated rapid spectral and spatial identification and quantitative enumeration of individual iRBCs. Integration of PAFC with fluorescence flow cytometry (FFC) provided real-time simultaneous detection of single iRBCs and parasites expressing green fluorescence proteins, respectively. A combination of linear and nonlinear nanobubble-based multicolor PAFC showed capability to real-time control therapy efficiency by counting of iRBCs before, during, and after treatment. Our results suggest that high-sensitivity, high-resolution ultrafast PAFC-FFC platform represents a powerful research tool to provide the insight on malaria progression through dynamic study of parasite-cell interactions directly in bloodstream, whereas portable hand-worn PAFC device could be broadly used in humans for early malaria diagnosis. © 2016 International Society for Advancement of Cytometry. © 2016 International Society for Advancement of Cytometry.

  5. The influence of adrenergic stimulation on sex differences in left ventricular twist mechanics.

    PubMed

    Williams, Alexandra M; Shave, Rob E; Cheyne, William S; Eves, Neil D

    2017-06-15

    Sex differences in left ventricular (LV) mechanics occur during acute physiological challenges; however, it is unknown whether sex differences in LV mechanics are fundamentally regulated by differences in adrenergic control. Using two-dimensional echocardiography and speckle tracking analysis, this study compared LV mechanics in males and females matched for LV length during post-exercise ischaemia (PEI) and β 1 -adrenergic receptor blockade. Our data demonstrate that while basal rotation was increased in males, LV twist was not significantly different between the sexes during PEI. In contrast, during β 1 -adrenergic receptor blockade, LV apical rotation, twist and untwisting velocity were reduced in males compared to females. Significant relationships were observed between LV twist and LV internal diameter and sphericity index in females, but not males. These findings suggest that LV twist mechanics may be more sensitive to alterations in adrenergic stimulation in males, but more highly influenced by ventricular structure and geometry in females. Sex differences in left ventricular (LV) mechanics exist at rest and during acute physiological stress. Differences in cardiac autonomic and adrenergic control may contribute to sex differences in LV mechanics and LV haemodynamics. Accordingly, this study aimed to investigate sex differences in LV mechanics with altered adrenergic stimulation achieved through post-handgrip-exercise ischaemia (PEI) and β 1 -adrenergic receptor (AR) blockade. Twenty males (23 ± 5 years) and 20 females (22 ± 3 years) were specifically matched for LV length (males: 8.5 ± 0.5 cm, females: 8.2 ± 0.6 cm, P = 0.163), and two-dimensional speckle-tracking echocardiography was used to assess LV structure and function at baseline, during PEI and following administration of 5 mg bisoprolol (β 1 -AR antagonist). During PEI, LV end-diastolic volume and stroke volume were increased in both groups (P < 0.001), as was end

  6. Structures of Highly Twisted Amides Relevant to Amide N-C Cross-Coupling: Evidence for Ground-State Amide Destabilization.

    PubMed

    Pace, Vittorio; Holzer, Wolfgang; Meng, Guangrong; Shi, Shicheng; Lalancette, Roger; Szostak, Roman; Szostak, Michal

    2016-10-04

    Herein, we show that acyclic amides that have recently enabled a series of elusive transition-metal-catalyzed N-C activation/cross-coupling reactions are highly twisted around the N-C(O) axis by a new destabilization mechanism of the amide bond. A unique effect of the N-glutarimide substituent, leading to uniformly high twist (ca. 90°) irrespective of the steric effect at the carbon side of the amide bond has been found. This represents the first example of a twisted amide that does not bear significant steric hindrance at the α-carbon atom. The (15) N NMR data show linear correlations between electron density at nitrogen and amide bond twist. This study strongly supports the concept of amide bond ground-state twist as a blueprint for activation of amides toward N-C bond cleavage. The new mechanism offers considerable opportunities for organic synthesis and biological processes involving non-planar amide bonds. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. DNA Detection by Flow Cytometry using PNA-Modified Metal-Organic Framework Particles.

    PubMed

    Mejia-Ariza, Raquel; Rosselli, Jessica; Breukers, Christian; Manicardi, Alex; Terstappen, Leon W M M; Corradini, Roberto; Huskens, Jurriaan

    2017-03-23

    A DNA-sensing platform is developed by exploiting the easy surface functionalization of metal-organic framework (MOF) particles and their highly parallelized fluorescence detection by flow cytometry. Two strategies were employed to functionalize the surface of MIL-88A, using either covalent or non-covalent interactions, resulting in alkyne-modified and biotin-modified MIL-88A, respectively. Covalent surface coupling of an azide-dye and the alkyne-MIL-88A was achieved by means of a click reaction. Non-covalent streptavidin-biotin interactions were employed to link biotin-PNA to biotin-MIL-88A particles mediated by streptavidin. Characterization by confocal imaging and flow cytometry demonstrated that DNA can be bound selectively to the MOF surface. Flow cytometry provided quantitative data of the interaction with DNA. Making use of the large numbers of particles that can be simultaneously processed by flow cytometry, this MOF platform was able to discriminate between fully complementary, single-base mismatched, and randomized DNA targets. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  8. Twisted-Light-Ion Interaction: The Role of Longitudinal Fields

    NASA Astrophysics Data System (ADS)

    Quinteiro, G. F.; Schmidt-Kaler, Ferdinand; Schmiegelow, Christian T.

    2017-12-01

    The propagation of light beams is well described using the paraxial approximation, where field components along the propagation direction are usually neglected. For strongly inhomogeneous or shaped light fields, however, this approximation may fail, leading to intriguing variations of the light-matter interaction. This is the case of twisted light having opposite orbital and spin angular momenta. We compare experimental data for the excitation of a quadrupole transition in a single trapped 40Ca+ ion from Schmiegelow et al. [Nat. Commun. 7, 12998 (2016), 10.1038/ncomms12998] with a complete model where longitudinal components of the electric field are taken into account. Our model matches the experimental data and excludes by 11 standard deviations the approximation of a complete transverse field. This demonstrates the relevance of all field components for the interaction of twisted light with matter.

  9. Immune Response to Mycobacterial Infection: Lessons from Flow Cytometry

    PubMed Central

    Rovina, Nikoletta; Panagiotou, Marios; Koulouris, Nikolaos G.

    2013-01-01

    Detecting and treating active and latent tuberculosis are pivotal elements for effective infection control; yet, due to their significant inherent limitations, the diagnostic means for these two stages of tuberculosis (TB) to date remain suboptimal. This paper reviews the current diagnostic tools for mycobacterial infection and focuses on the application of flow cytometry as a promising method for rapid and reliable diagnosis of mycobacterial infection as well as discrimination between active and latent TB: it summarizes diagnostic biomarkers distinguishing the two states of infection and also features of the distinct immune response against Mycobacterium tuberculosis (Mtb) at certain stages of infection as revealed by flow cytometry to date. PMID:24376464

  10. Immune response to mycobacterial infection: lessons from flow cytometry.

    PubMed

    Rovina, Nikoletta; Panagiotou, Marios; Pontikis, Konstantinos; Kyriakopoulou, Magdalini; Koulouris, Nikolaos G; Koutsoukou, Antonia

    2013-01-01

    Detecting and treating active and latent tuberculosis are pivotal elements for effective infection control; yet, due to their significant inherent limitations, the diagnostic means for these two stages of tuberculosis (TB) to date remain suboptimal. This paper reviews the current diagnostic tools for mycobacterial infection and focuses on the application of flow cytometry as a promising method for rapid and reliable diagnosis of mycobacterial infection as well as discrimination between active and latent TB: it summarizes diagnostic biomarkers distinguishing the two states of infection and also features of the distinct immune response against Mycobacterium tuberculosis (Mtb) at certain stages of infection as revealed by flow cytometry to date.

  11. Aminopeptidase A initiates tumorigenesis and enhances tumor cell stemness via TWIST1 upregulation in colorectal cancer

    PubMed Central

    Chuang, Hui-Yu; Jiang, Jeng-Kae; Yang, Muh-Hwa; Wang, Hsei-Wei; Li, Ming-Chun; Tsai, Chan-Yen; Jhang, Yau-Yun; Huang, Jason C.

    2017-01-01

    Metastasis accounts for the high mortality rate associated with colorectal cancer (CRC), but metastasis regulators are not fully understood. To identify a novel gene involved in tumor metastasis, we used oligonucleotide microarrays, transcriptome distance analyses, and machine learning algorithms to determine links between primary and metastatic colorectal cancers. Aminopeptidase A (APA; also known as ENPEP) was selected as our focus because its relationship with colorectal cancer requires clarification. Higher APA mRNA levels were observed in patients in advanced stages of cancer, suggesting a correlation between ENPEP and degree of malignancy. Our data also indicate that APA overexpression in CRC cells induced cell migration, invasion, anchorage-independent capability, and mesenchyme-like characteristics (e.g., EMT markers). We also observed TWIST induction in APA-overexpressing SW480 cells and TWIST down-regulation in HT29 cells knocked down with APA. Both APA silencing and impaired APA activity were found to reduce migratory capacity, cancer anchorage, stemness properties, and drug resistance in vitro and in vivo. We therefore suggest that APA enzymatic activity affects tumor initiation and cancer malignancy in a TWIST-dependent manner. Results from RT-qPCR and the immunohistochemical staining of specimens taken from CRC patients indicate a significant correlation between APA and TWIST. According to data from SurvExpress analyses of TWIST1 and APA mRNA expression profiles, high APA and TWIST expression are positively correlated with poor CRC prognosis. APA may act as a prognostic factor and/or therapeutic target for CRC metastasis and recurrence. PMID:28177885

  12. Ultraviolet 320 nm laser excitation for flow cytometry.

    PubMed

    Telford, William; Stickland, Lynn; Koschorreck, Marco

    2017-04-01

    Although multiple lasers and high-dimensional analysis capability are now standard on advanced flow cytometers, ultraviolet (UV) lasers (usually 325-365 nm) remain an uncommon excitation source for cytometry. This is primarily due to their cost, and the small number of applications that require this wavelength. The development of the Brilliant Ultraviolet (BUV fluorochromes, however, has increased the importance of this formerly niche excitation wavelength. Historically, UV excitation was usually provided by water-cooled argon- and krypton-ion lasers. Modern flow cytometers primary rely on diode pumped solid state lasers emitting at 355 nm. While useful for all UV-excited applications, DPSS UV lasers are still large by modern solid state laser standards, and remain very expensive. Smaller and cheaper near UV laser diodes (NUVLDs) emitting at 375 nm make adequate substitutes for 355 nm sources in many situations, but do not work as well with very short wavelength probes like the fluorescent calcium chelator indo-1. In this study, we evaluate a newly available UV 320 nm laser for flow cytometry. While shorter in wavelength that conventional UV lasers, 320 is close to the 325 nm helium-cadmium wavelength used in the past on early benchtop cytometers. A UV 320 nm laser was found to excite almost all Brilliant Ultraviolet dyes to nearly the same level as 355 nm sources. Both 320 nm and 355 nm sources worked equally well for Hoechst and DyeCycle Violet side population analysis of stem cells in mouse hematopoetic tissue. The shorter wavelength UV source also showed excellent excitation of indo-1, a probe that is not compatible with NUVLD 375 nm sources. In summary, a 320 nm laser module made a suitable substitute for conventional 355 nm sources. This laser technology is available in a smaller form factor than current 355 nm units, making it useful for small cytometers with space constraints. © 2017 International Society for Advancement of Cytometry. © 2017 International

  13. Data File Standard for Flow Cytometry, version FCS 3.1.

    PubMed

    Spidlen, Josef; Moore, Wayne; Parks, David; Goldberg, Michael; Bray, Chris; Bierre, Pierre; Gorombey, Peter; Hyun, Bill; Hubbard, Mark; Lange, Simon; Lefebvre, Ray; Leif, Robert; Novo, David; Ostruszka, Leo; Treister, Adam; Wood, James; Murphy, Robert F; Roederer, Mario; Sudar, Damir; Zigon, Robert; Brinkman, Ryan R

    2010-01-01

    The flow cytometry data file standard provides the specifications needed to completely describe flow cytometry data sets within the confines of the file containing the experimental data. In 1984, the first Flow Cytometry Standard format for data files was adopted as FCS 1.0. This standard was modified in 1990 as FCS 2.0 and again in 1997 as FCS 3.0. We report here on the next generation flow cytometry standard data file format. FCS 3.1 is a minor revision based on suggested improvements from the community. The unchanged goal of the standard is to provide a uniform file format that allows files created by one type of acquisition hardware and software to be analyzed by any other type.The FCS 3.1 standard retains the basic FCS file structure and most features of previous versions of the standard. Changes included in FCS 3.1 address potential ambiguities in the previous versions and provide a more robust standard. The major changes include simplified support for international characters and improved support for storing compensation. The major additions are support for preferred display scale, a standardized way of capturing the sample volume, information about originality of the data file, and support for plate and well identification in high throughput, plate based experiments. Please see the normative version of the FCS 3.1 specification in Supporting Information for this manuscript (or at http://www.isac-net.org/ in the Current standards section) for a complete list of changes.

  14. Distributed parameter statics of magnetic catheters.

    PubMed

    Tunay, Ilker

    2011-01-01

    We discuss how to use special Cosserat rod theory for deriving distributed-parameter static equilibrium equations of magnetic catheters. These medical devices are used for minimally-invasive diagnostic and therapeutic procedures and can be operated remotely or controlled by automated algorithms. The magnetic material can be lumped in rigid segments or distributed in flexible segments. The position vector of the cross-section centroid and quaternion representation of an orthonormal triad are selected as DOF. The strain energy for transversely isotropic, hyperelastic rods is augmented with the mechanical potential energy of the magnetic field and a penalty term to enforce the quaternion unity constraint. Numerical solution is found by 1D finite elements. Material properties of polymer tubes in extension, bending and twist are determined by mechanical and magnetic experiments. Software experiments with commercial FEM software indicate that the computational effort with the proposed method is at least one order of magnitude less than standard 3D FEM.

  15. New Phenomena in Propagation of Radio Polarizations due to Magnetic Fields on Cosmological Scales

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ralston, J.P.; Jain, P.; Nodland, B.

    1998-07-01

    We discuss a new mechanism which could cause a rotation of polarization of electromagnetic waves due to magnetic fields on cosmological scales. The effect hinges on the geometrical phase of Pancharatnam and Berry, and causes a corkscrew twisting of the plane of polarization. The new effect represents an additional tool that allows possible intergalactic and cosmological magnetic fields to be studied using radio propagation. {copyright} {ital 1998} {ital The American Physical Society}

  16. Stretchable, Twisted Conductive Microtubules for Wearable Computing, Robotics, Electronics, and Healthcare.

    PubMed

    Do, Thanh Nho; Visell, Yon

    2017-05-11

    Stretchable and flexible multifunctional electronic components, including sensors and actuators, have received increasing attention in robotics, electronics, wearable, and healthcare applications. Despite advances, it has remained challenging to design analogs of many electronic components to be highly stretchable, to be efficient to fabricate, and to provide control over electronic performance. Here, we describe highly elastic sensors and interconnects formed from thin, twisted conductive microtubules. These devices consist of twisted assemblies of thin, highly stretchable (>400%) elastomer tubules filled with liquid conductor (eutectic gallium indium, EGaIn), and fabricated using a simple roller coating process. As we demonstrate, these devices can operate as multimodal sensors for strain, rotation, contact force, or contact location. We also show that, through twisting, it is possible to control their mechanical performance and electronic sensitivity. In extensive experiments, we have evaluated the capabilities of these devices, and have prototyped an array of applications in several domains of stretchable and wearable electronics. These devices provide a novel, low cost solution for high performance stretchable electronics with broad applications in industry, healthcare, and consumer electronics, to emerging product categories of high potential economic and societal significance.

  17. SCENERY: a web application for (causal) network reconstruction from cytometry data

    PubMed Central

    Papoutsoglou, Georgios; Athineou, Giorgos; Lagani, Vincenzo; Xanthopoulos, Iordanis; Schmidt, Angelika; Éliás, Szabolcs; Tegnér, Jesper

    2017-01-01

    Abstract Flow and mass cytometry technologies can probe proteins as biological markers in thousands of individual cells simultaneously, providing unprecedented opportunities for reconstructing networks of protein interactions through machine learning algorithms. The network reconstruction (NR) problem has been well-studied by the machine learning community. However, the potentials of available methods remain largely unknown to the cytometry community, mainly due to their intrinsic complexity and the lack of comprehensive, powerful and easy-to-use NR software implementations specific for cytometry data. To bridge this gap, we present Single CEll NEtwork Reconstruction sYstem (SCENERY), a web server featuring several standard and advanced cytometry data analysis methods coupled with NR algorithms in a user-friendly, on-line environment. In SCENERY, users may upload their data and set their own study design. The server offers several data analysis options categorized into three classes of methods: data (pre)processing, statistical analysis and NR. The server also provides interactive visualization and download of results as ready-to-publish images or multimedia reports. Its core is modular and based on the widely-used and robust R platform allowing power users to extend its functionalities by submitting their own NR methods. SCENERY is available at scenery.csd.uoc.gr or http://mensxmachina.org/en/software/. PMID:28525568

  18. Role of receptor occupancy assays by flow cytometry in drug development.

    PubMed

    Stewart, Jennifer J; Green, Cherie L; Jones, Nicholas; Liang, Meina; Xu, Yuanxin; Wilkins, Danice E C; Moulard, Maxime; Czechowska, Kamila; Lanham, David; McCloskey, Thomas W; Ferbas, John; van der Strate, Barry W A; Högerkorp, Carl-Magnus; Wyant, Timothy; Lackey, Alan; Litwin, Virginia

    2016-03-01

    The measurement of the binding of a biotherapeutic to its cellular target, receptor occupancy (RO), is increasingly important in development of biologically-based therapeutic agents. Receptor occupancy (RO) assays by flow cytometry describe the qualitative and/or quantitative assessment of the binding of a therapeutic agent to its cell surface target. Such RO assays can be as simple as measuring the number of cell surface receptors bound by an antireceptor therapeutic agent or can be designed to address more complicated scenarios such as internalization or shedding events once a receptor engages the administered therapeutic agent. Data generated from RO assays can also be used to model whether given doses of an experimental therapeutic agent and their administration schedules lead to predicted levels of receptor occupancy and whether the receptor is modulated (up or down) on cells engaged by the therapeutic agent. There are a variety of approaches that can be used when undertaking RO assays and with the ability to measure distinct subsets in heterogeneous populations, flow cytometry is ideally suited to RO measurements. This article highlights the importance of RO assays on the flow cytometric platform in the development of biotherapeutic agents. © 2016 The Authors Cytometry Part B: Clinical Cytometry Published by Wiley Periodicals, Inc.

  19. Electronic structure and optical properties of twisted bilayer graphene calculated via time evolution of states in real space

    NASA Astrophysics Data System (ADS)

    Le, H. Anh; Do, V. Nam

    2018-03-01

    We investigate the electronic and optical properties of twisted bilayer graphene with arbitrary twist angles θ . Our results are based on a method of evolving in time quantum states in lattice space. We propose an efficient scheme of sampling lattice nodes that helps to reduce significantly computational cost, particularly for tiny twist angles. We demonstrate the continuous variation of the density of states and the optical conductivity with respect to the twist angle. It indicates that the commensurability between the two graphene layers does not play an essential role in governing the electronic and optical properties. We point out that, for the twist angles roughly in the range 0 .1∘<θ <3∘ , the density of states in the vicinity of the Fermi energy exhibits the typical W shape with a small peak locating at the Fermi energy. This peak is formed as the merging of two van Hove peaks and reflects the appearance of states strongly localized in the AA-like region of moiré zones. When decreasing the twist angle to zero, the W shape is gradually transformed to the U shape, which is seen as the behavior of the density of states in the limit of θ →0∘ .

  20. Development of an Active Twist Rotor for Wind: Tunnel Testing (NLPN97-310

    NASA Technical Reports Server (NTRS)

    Cesnik, Carlos E. S.; Shin, SangJoon; Hagood, Nesbitt W., IV

    1998-01-01

    The development of the Active Twist Rotor prototype blade for hub vibration and noise reduction studies is presented in this report. Details of the modeling, design, and manufacturing are explored. The rotor blade is integrally twisted by direct strain actuation. This is accomplished by distributing embedded piezoelectric fiber composites along the span of the blade. The development of the analysis framework for this type of active blade is presented. The requirements for the prototype blade, along with the final design results are also presented. A detail discussion on the manufacturing aspects of the prototype blade is described. Experimental structural characteristics of the prototype blade compare well with design goals, and preliminary bench actuation tests show lower performance than originally predicted. Electrical difficulties with the actuators are also discussed. The presented prototype blade is leading to a complete fully articulated four-blade active twist rotor system for future wind tunnel tests.

  1. Mechanical behaviors of multi-filament twist superconducting strand under tensile and cyclic loading

    NASA Astrophysics Data System (ADS)

    Wang, Xu; Li, Yingxu; Gao, Yuanwen

    2016-01-01

    The superconducting strand, serving as the basic unit cell of the cable-in-conduit-conductors (CICCs), is a typical multi-filament twist composite which is always subjected to a cyclic loading under the operating condition. Meanwhile, the superconducting material Nb3Sn in the strand is sensitive to strain frequently relating to the performance degradation of the superconductivity. Therefore, a comprehensive study on the mechanical behavior of the strand helps understanding the superconducting performance of the strained Nb3Sn strands. To address this issue, taking the LMI (internal tin) strand as an example, a three-dimensional structural finite element model, named as the Multi-filament twist model, of the strand with the real configuration of the LMI strand is built to study the influences of the plasticity of the component materials, the twist of the filament bundle, the initial thermal residual stress and the breakage and its evolution of the filaments on the mechanical behaviors of the strand. The effective properties of superconducting filament bundle with random filament breakage and its evolution versus strain are obtained based on the damage theory of fiber-reinforced composite materials proposed by Curtin and Zhou. From the calculation results of this model, we find that the occurrence of the hysteresis loop in the cyclic loading curve is determined by the reverse yielding of the elastic-plastic materials in the strand. Both the initial thermal residual stress in the strand and the pitch length of the filaments have significant impacts on the axial and hysteretic behaviors of the strand. The damage of the filaments also affects the axial mechanical behavior of the strand remarkably at large axial strain. The critical current of the strand is calculated by the scaling law with the results of the Multi-filament twist model. The predicted results of the Multi-filament twist model show an acceptable agreement with the experiment.

  2. Control of twisted and coiled polymer actuator with anti-windup compensator

    NASA Astrophysics Data System (ADS)

    Suzuki, Motoya; Kamamichi, Norihiro

    2018-07-01

    A twisted and coiled polymer actuator (TCPA) is a novel soft actuator. It is fabricated by twisting nylon thread or fishing line. It can be thermally activated and has remarkable properties such as high power/mass ratio and large deformation. By applying conductive nylon fibers to the actuator, it can be electrically driven by Joule heating. However, if a controller of the actuator is designed without considering an input saturation, the control performance may be descended by windup phenomena. In this paper, to solve this problem, a feedback control with an anti-windup compensator is applied. The validity of the applied method is investigated through numerical simulations and experiments.

  3. Comparative exploration of multidimensional flow cytometry software: a model approach evaluating T cell polyfunctional behavior.

    PubMed

    Spear, Timothy T; Nishimura, Michael I; Simms, Patricia E

    2017-08-01

    Advancement in flow cytometry reagents and instrumentation has allowed for simultaneous analysis of large numbers of lineage/functional immune cell markers. Highly complex datasets generated by polychromatic flow cytometry require proper analytical software to answer investigators' questions. A problem among many investigators and flow cytometry Shared Resource Laboratories (SRLs), including our own, is a lack of access to a flow cytometry-knowledgeable bioinformatics team, making it difficult to learn and choose appropriate analysis tool(s). Here, we comparatively assess various multidimensional flow cytometry software packages for their ability to answer a specific biologic question and provide graphical representation output suitable for publication, as well as their ease of use and cost. We assessed polyfunctional potential of TCR-transduced T cells, serving as a model evaluation, using multidimensional flow cytometry to analyze 6 intracellular cytokines and degranulation on a per-cell basis. Analysis of 7 parameters resulted in 128 possible combinations of positivity/negativity, far too complex for basic flow cytometry software to analyze fully. Various software packages were used, analysis methods used in each described, and representative output displayed. Of the tools investigated, automated classification of cellular expression by nonlinear stochastic embedding (ACCENSE) and coupled analysis in Pestle/simplified presentation of incredibly complex evaluations (SPICE) provided the most user-friendly manipulations and readable output, evaluating effects of altered antigen-specific stimulation on T cell polyfunctionality. This detailed approach may serve as a model for other investigators/SRLs in selecting the most appropriate software to analyze complex flow cytometry datasets. Further development and awareness of available tools will help guide proper data analysis to answer difficult biologic questions arising from incredibly complex datasets. © Society

  4. Investigating the Role of Twist1 in Diabetes Pathogenesis

    DTIC Science & Technology

    Several genes associated with diabetes have been identified in genome wide association studies, but their genetic validation as causative factors...of insulin. Loss-of-function genetic experiments demonstrated that Twist1 deletion against fatty pancreas formation driven by obesity, thereby

  5. A Combined Study of Photospheric Magnetic and Current Helicities and Subsurface Kinetic Helicities of Solar Active Regions during 2006-2013

    NASA Astrophysics Data System (ADS)

    Seligman, D.; Petrie, G. J. D.; Komm, R.

    2014-11-01

    We compare the average photospheric current helicity Hc , photospheric twist parameter α (a well-known proxy for the full relative magnetic helicity), and subsurface kinetic helicity Hk for 194 active regions observed between 2006-2013. We use 2440 Hinode photospheric vector magnetograms, and the corresponding subsurface fluid velocity data derived from GONG (2006-2012) and Helioseismic and Magnetic Imager (2010-2013) dopplergrams. We find a significant hemispheric bias in all three parameters. The subsurface kinetic helicity is preferentially positive in the southern hemisphere and negative in the northern hemisphere. The photospheric current helicity and the α parameter have the same bias for strong fields (|B| > 1000 G) and no significant bias for weak fields (100 G <|B| < 500 G). We find no significant region-by-region correlation between the subsurface kinetic helicity and either the strong-field current helicity or α. Subsurface fluid motions of a given handedness correspond to photospheric helicities of both signs in approximately equal numbers. However, common variations appear in annual averages of these quantities over all regions. Furthermore, in a subset of 77 regions, we find significant correlations between the temporal profiles of the subsurface and photospheric helicities. In these cases, the sign of the linear correlation coefficient matches the sign relationship between the helicities, indicating that the photospheric magnetic field twist is sensitive to the twisting motions below the surface.

  6. Twisting cracks in Bouligand structures.

    PubMed

    Suksangpanya, Nobphadon; Yaraghi, Nicholas A; Kisailus, David; Zavattieri, Pablo

    2017-12-01

    The Bouligand structure, which is found in many biological materials, is a hierarchical architecture that features uniaxial fiber layers assembled periodically into a helicoidal pattern. Many studies have highlighted the high damage-resistant performance of natural and biomimetic Bouligand structures. One particular species that utilizes the Bouligand structure to achieve outstanding mechanical performance is the smashing Mantis Shrimp, Odontodactylus Scyllarus (or stomatopod). The mantis shrimp generates high speed, high acceleration blows using its raptorial appendage to defeat highly armored preys. The load-bearing part of this appendage, the dactyl club, contains an interior region [16] that consists of a Bouligand structure. This region is capable of developing a significant amount of nested twisting microcracks without exhibiting catastrophic failure. The development and propagation of these microcracks are a source of energy dissipation and stress relaxation that ultimately contributes to the remarkable damage tolerance properties of the dactyl club. We develop a theoretical model to provide additional insights into the local stress intensity factors at the crack front of twisting cracks formed within the Bouligand structure. Our results reveal that changes in the local fracture mode at the crack front leads to a reduction of the local strain energy release rate, hence, increasing the necessary applied energy release rate to propagate the crack, which is quantified by the local toughening factor. Ancillary 3D simulations of the asymptotic crack front field were carried out using a J-integral to validate the theoretical values of the energy release rate and the local stress intensity factors. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Needleless electrospinning with twisted wire spinneret

    NASA Astrophysics Data System (ADS)

    Holopainen, Jani; Penttinen, Toni; Santala, Eero; Ritala, Mikko

    2015-01-01

    A needleless electrospinning setup named ‘Needleless Twisted Wire Electrospinning’ was developed. The polymer solution is electrospun from the surface of a twisted wire set to a high voltage and collected on a cylindrical collector around the wire. Multiple Taylor cones are simultaneously self-formed on the downward flowing solution. The system is robust and simple with no moving parts aside from the syringe pump used to transport the solution to the top of the wire. The structure and process parameters of the setup and the results on the preparation of polyvinyl pyrrolidone (PVP), hydroxyapatite (HA) and bioglass fibers with the setup are presented. PVP fiber sheets with areas of 40 × 120 cm2 and masses up to 1.15 g were prepared. High production rates of 5.23 g h-1 and 1.40 g h-1 were achieved for PVP and HA respectively. The major limiting factor of the setup is drying of the polymer solution on the wire during the electrospinning process which will eventually force to interrupt the process for cleaning of the wire. Possible solutions to this problem and other ways to develop the setup are discussed. The presented system provides a simple way to increase the production rate and area of fiber sheet as compared with the conventional needle electrospinning.

  8. Adaptive twisting sliding mode algorithm for hypersonic reentry vehicle attitude control based on finite-time observer.

    PubMed

    Guo, Zongyi; Chang, Jing; Guo, Jianguo; Zhou, Jun

    2018-06-01

    This paper focuses on the adaptive twisting sliding mode control for the Hypersonic Reentry Vehicles (HRVs) attitude tracking issue. The HRV attitude tracking model is transformed into the error dynamics in matched structure, whereas an unmeasurable state is redefined by lumping the existing unmatched disturbance with the angular rate. Hence, an adaptive finite-time observer is used to estimate the unknown state. Then, an adaptive twisting algorithm is proposed for systems subject to disturbances with unknown bounds. The stability of the proposed observer-based adaptive twisting approach is guaranteed, and the case of noisy measurement is analyzed. Also, the developed control law avoids the aggressive chattering phenomenon of the existing adaptive twisting approaches because the adaptive gains decrease close to the disturbance once the trajectories reach the sliding surface. Finally, numerical simulations on the attitude control of the HRV are conducted to verify the effectiveness and benefit of the proposed approach. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  9. Twisting singular solutions of Betheʼs equations

    NASA Astrophysics Data System (ADS)

    Nepomechie, Rafael I.; Wang, Chunguang

    2014-12-01

    The Bethe equations for the periodic XXX and XXZ spin chains admit singular solutions, for which the corresponding eigenvalues and eigenvectors are ill-defined. We use a twist regularization to derive conditions for such singular solutions to be physical, in which case they correspond to genuine eigenvalues and eigenvectors of the Hamiltonian.

  10. High-resolution inchworm linear motor based on electrostatic twisting microactuators

    NASA Astrophysics Data System (ADS)

    Kim, Sa