Science.gov

Sample records for major components composed

  1. Composing simulations using persistent software components

    SciTech Connect

    Holland, J.V.; Michelsen, R.E.; Powell, D.R.; Upton, S.C.; Thompson, D.R.

    1999-03-01

    The traditional process for developing large-scale simulations is cumbersome, time consuming, costly, and in some cases, inadequate. The topics of software components and component-based software engineering are being explored by software professionals in academic and industrial settings. A component is a well-delineated, relatively independent, and replaceable part of a software system that performs a specific function. Many researchers have addressed the potential to derive a component-based approach to simulations in general, and a few have focused on military simulations in particular. In a component-based approach, functional or logical blocks of the simulation entities are represented as coherent collections of components satisfying explicitly defined interface requirements. A simulation is a top-level aggregate comprised of a collection of components that interact with each other in the context of a simulated environment. A component may represent a simulation artifact, an agent, or any entity that can generated events affecting itself, other simulated entities, or the state of the system. The component-based approach promotes code reuse, contributes to reducing time spent validating or verifying models, and promises to reduce the cost of development while still delivering tailored simulations specific to analysis questions. The Integrated Virtual Environment for Simulation (IVES) is a composition-centered framework to achieve this potential. IVES is a Java implementation of simulation composition concepts developed at Los Alamos National Laboratory for use in several application domains. In this paper, its use in the military domain is demonstrated via the simulation of dismounted infantry in an urban environment.

  2. Perceptual integrality of major chord components.

    PubMed

    Acker, B E; Pastore, R E

    1996-07-01

    In the present study, an accuracy, rather than a reaction time, version of the Garner paradigm was used to evaluate the integrality or separability of major chord components. Tuned (prototype, or P) and mistuned (nonprototype, or NP) sets of root position C-major triads were constructed by holding the C constant in all stimuli and varying the E and G frequencies in 2- and 4-Hz steps. The P stimuli represent small systematic mistunings in the E and G notes relative to an equal-tempered C-major chord. The NP stimuli represent an equivalent range of frequency variation, but relative to a significantly out-of-tune C-major triad. In different experimental sessions, a same-different (AX) task was used to separately evaluate discrimination performance for the E and G frequencies as a function of whether the nontarget frequency (G or E) was fixed or varied in either a correlated or an orthogonal fashion (with the C frequency always held constant). Compared with a fixed baseline condition where only the target frequency changed, both chord components exhibited a significant redundancy gain in the correlated conditions and, to varying degrees, significant interference effects in the orthogonal condition, indicating that the chord components function largely in an integral fashion. Relative to the discrimination of G, discrimination of the E frequency was less influenced by variation in the nontarget (G) frequency, showing that attention, to some degree, could be selectively allocated to the E chord component. In addition, the results were consistent with previous findings that the functional prototype for the major chord category seems to act as a perceptual anchor, rather than as a magnet, and appears to be located in the physiologically defined area of just temperament, as opposed to the more experientially defined area of equal temperament.

  3. Heavy Water Components Test Reactor Decommissioning - Major Component Removal

    SciTech Connect

    Austin, W.; Brinkley, D.

    2010-05-05

    experienced cladding failures as operational capabilities of the different designs were being established. In addition, numerous spills of heavy water occurred within the facility. Currently, radiation and radioactive contamination levels are low within HWCTR with most of the radioactivity contained within the reactor vessel. There are no known insults to the environment, however with the increasing deterioration of the facility, the possibility exists that contamination could spread outside the facility if it is not decommissioned. An interior panoramic view of the ground floor elevation taken in August 2009 is shown in Figure 2. The foreground shows the transfer coffin followed by the reactor vessel and control rod drive platform in the center. Behind the reactor vessel is the fuel pool. Above the ground level are the polar crane and the emergency deluge tank at the top of the dome. Note the considerable rust and degradation of the components and the interior of the containment building. Alternative studies have concluded that the most environmentally safe, cost effective option for final decommissioning is to remove the reactor vessel, steam generators, and all equipment above grade including the dome. Characterization studies along with transport models have concluded that the remaining below grade equipment that is left in place including the transfer coffin will not contribute any significant contamination to the environment in the future. The below grade space will be grouted in place. A concrete cover will be placed over the remaining footprint and the groundwater will be monitored for an indefinite period to ensure compliance with environmental regulations. The schedule for completion of decommissioning is late FY2011. This paper describes the concepts planned in order to remove the major components including the dome, the reactor vessel (RV), the two steam generators (SG), and relocating the transfer coffin (TC).

  4. Titin: major myofibrillar components of striated muscle.

    PubMed Central

    Wang, K; McClure, J; Tu, A

    1979-01-01

    Electrophoretic analyses of protein components of striated muscle myofibril purified from various vertebrate and invertebrate species revealed that proteins much larger than myosin heavy chain are present in significant amounts. To define possible roles of these heretofore unidentified proteins, we purified a combination of two uncommonly large proteins, designated as titin, from chicken breast myofibrils. Chemical and immunological studies indicated that titin is distinct from myosin, actin, and filamin. Specific titin anti body crossreacts with similar protein in both skeletal and cardiac myofibrils of many vertebrate and invertebrate species. Immunofluorescent staining of glycerinated chicken breast myofibrils indicated that titin is present in M lines, Z lines, the junctions of A and I bands, and perhaps throughout the entire A bands. Similar staining studies of myofibrils from other species suggest that titinlike proteins may be organized in all myofibrils according to a common architectural plan. We conclude that titin is a structurally conserved myofibrillar component of vertebrate and invertebrate striated muscles. Images PMID:291034

  5. Radiation chemistry of major food components

    USDA-ARS?s Scientific Manuscript database

    This book chapter summarizes radiolysis of lipids, proteins, carbohydrates and vitamins. The major focuses of the chapter are on recent developments in radiation chemistry and the use of irradiation to reduce undesirable chemicals in foods. Specifically, formation of volatile sulfur compounds from...

  6. Two Components in Major Solar Particle Events

    NASA Technical Reports Server (NTRS)

    White, Nicholas E. (Technical Monitor); Cane, H. V.; vonRosenvinge, T. T.; Cohen, C. M. S.; Mewaldt, R. A.

    2003-01-01

    A study has been made of 29 intense, solar particle events observed in the energy range 25-100 MeV/nuc near Earth in the years 1997 through 2001. It is found that the majority of the events (19/29) had Fe to O ratios which were reasonably constant with time and energy, and with values above coronal. These all originated on the Sun s western hemisphere and most had intensities that rose rapidly at the time of an associated flare, and coronal mass ejection (CME), and then decayed more gradually. Few interplanetary shocks were observed during these increases. The spectra were mainly power laws. The remaining 10 events had different intensity-time profiles and Fe to O ratios that varied with time and energy with values at or below coronal. Most of these originated near central meridian and 6 had strong interplanetary shocks that were observed near Earth. In general the spectra were not power laws but steepened at high energies, particularly for Fe. There were four events with two peaks in the intensity-time profiles, the first near the time of the associated flare and the other at shock passage. The results, considered in the light of other recent work, suggest that the high energy particles that occur shortly after flares are indeed flare particles. At the highest rigidities considered here shock-accelerated particles are uncommon and are observed only in association with unusually fast shocks.

  7. Lytic and mechanical stability of clots composed of fibrin and blood vessel wall components.

    PubMed

    Rottenberger, Z; Komorowicz, E; Szabó, L; Bóta, A; Varga, Z; Machovich, R; Longstaff, C; Kolev, K

    2013-03-01

    Proteases expressed in atherosclerotic plaque lesions generate collagen fragments, release glycosaminoglycans (chondroitin sulfate [CS] and dermatan sulfate [DS]) and expose extracellular matrix (ECM) proteins (e.g. decorin) at sites of fibrin formation. Here we address the effect of these vessel wall components on the lysis of fibrin by the tissue plasminogen activator (tPA)/plasminogen system and on the mechanical stability of clots. MMP-8-digested collagen fragments, isolated CS, DS, glycosylated decorin and its core protein were used to prepare mixed matrices with fibrin (additives present at a 50-fold lower mass concentration than fibrinogen). Scanning electron microscopy (SEM) showed that the presence of ECM components resulted in a coarse fibrin structure, most pronounced for glycosylated decorin causing an increase in the median fiber diameter from 85 to 187 nm. Rheological measurements indicated that these structural alterations were coupled to decreased shear resistance (1.8-fold lower shear stress needed for gel/fluid transition of the clots containing glycosylated decorin) and rigidity (reduction of the storage modulus from 54.3 to 33.2 Pa). The lytic susceptibility of the modified fibrin structures was increased. The time to 50% lysis by plasmin was reduced approximately 2-fold for all investigated ECM components (apart from the core protein of decorin which produced a moderate reduction of the lysis time by 25%), whereas fibrin-dependent plasminogen activation by tPA was inhibited by up to 30%. ECM components compromise the chemical and mechanical stability of fibrin as a result of changes in its ultrastructure. © 2012 International Society on Thrombosis and Haemostasis.

  8. Packing characteristics of two-component bilayers composed of ester- and ether-linked phospholipids.

    PubMed Central

    Batenjany, M M; O'Leary, T J; Levin, I W; Mason, J T

    1997-01-01

    The miscibility properties of ether- and ester-linked phospholipids in two-component, fully hydrated bilayers have been studied by differential scanning calorimetry (DSC) and Raman spectroscopy. Mixtures of 1,2-di-O-hexadecyl-rac-glycero-3-phosphocholine (DHPC) with 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine (DHPE) and of 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) with 1,2-di-O-hexadecyl-sn-glycero-3-phosphoethanolamine (DHPE) have been investigated. The phase diagram for the DPPC/DHPE mixtures indicates that these two phospholipids are miscible in all proportions in the nonrippled bilayer gel phase. In contrast, the DHPC/DPPE mixtures display two regions of gel phase immiscibility between 10 and 30 mol% DPPE. Raman spectroscopic measurements of DHPC/DPPE mixtures in the C-H stretching mode region suggest that this immiscibility arises from the formation of DHPC-rich interdigitated gel phase domains with strong lateral chain packing interactions at temperatures below 27 degrees C. However, in the absence of interdigitation, our findings, and those of others, lead to the conclusion that the miscibility properties of mixtures of ether- and ester-linked phospholipids are determined by the nature of the phospholipid headgroups and are independent of the character of the hydrocarbon chain linkages. Thus it seems unlikely that the ether linkage has any significant effect on the miscibility properties of phospholipids in biological membranes. PMID:9083673

  9. Investigation of data quality in a wireless sensing unit composed of off-the-shelf components

    NASA Astrophysics Data System (ADS)

    Pei, Jin-Song; Kapoor, Chetan; Graves-Abe, Troy L.; Sugeng, Yohanes P.; Ferzli, Nadim; Lynch, Jerome P.

    2005-05-01

    This paper presents the preliminary findings of a study on data and system identification results (derived from collected data) in a wireless sensing environment. The goal of this study is to understand how various hardware design choices and operational conditions affect the quality of the data and accuracy of the identified results; the focus of this paper is packet and data loss. A series of experimental investigations are carried out using a laboratory shaking table instrumented with off-the-shelf Micro-Electro-Mechanical Systems (MEMS) accelerometers. A wireless sensing unit is developed to interface with these wired analog accelerometers to enable wireless data transmission. To reduce the overall design variance and aid convenient application in civil infrastructure health monitoring, this wireless unit is built with off-the-shelf microcontroller and radio development boards. The anti-aliasing filter and analog-to-digital convectors (ADC) are the only customized components in the hardware. By varying critical hardware configurations, including using analog accelerometers of different commercial brands, taking various designs for the anti-aliasing filter, and adopting ADCs with different resolutions, shaking table tests are repeated, the collected data are processed, and the results are compared. Operational conditions such as sampling rate and wireless data transmitting range are also altered separately in the repeated testing. In all of the cases tested, data is also collected using a wire-based data acquisition system to serve as a performance baseline for evaluation of the wireless data transmission performance. Based on this study, the challenges in the hardware design of wireless sensing units and data processing are identified.

  10. Elevations, Major Component Isometric, Propellant Flow Schematic, and External Tank ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    Elevations, Major Component Isometric, Propellant Flow Schematic, and External Tank Connection to Shuttle Main Engines - Space Transportation System, Space Shuttle Main Engine, Lyndon B. Johnson Space Center, 2101 NASA Parkway, Houston, Harris County, TX

  11. A Recipe Composed of Chinese Herbal Active Components Regulates Hepatic Lipid Metabolism of NAFLD In Vivo and In Vitro

    PubMed Central

    Meng, Sheng-xi; Liu, Qian; Tang, Ya-jun; Wang, Wen-jing; Zheng, Qing-shan; Tian, Hua-jie; Yao, Dong-sheng; Liu, Lin; Peng, Jing-hua; Zhao, Yu; Hu, Yi-yang; Feng, Qin

    2016-01-01

    This study is to investigate the therapeutic effects of the recipe composed of Atractylodes macrocephala polysaccharide, chlorogenic acid, and geniposide (named ACG) on experimental nonalcoholic fatty liver (NAFL). The research was divided into two parts as screening experiment and verification experiment. In the screening experiment, we used high-fat diet (HFD) induced NAFL rat model and uniform design to get the recipe from five Chinese herbal active components. In the verification experiment, HFD induced fatty liver rat and mouse NAFL models and free fatty acid (FFA) induced HepG2 cell model were used to verify the effects of ACG. According to the multiple regression equation of the hepatic triglyceride (TG) contents of each group in the screening experiment, the recipe ACG was obtained and the doses of Atractylodes macrocephala polysaccharide, chlorogenic acid, and geniposide for rats were 266.67, 3.33, and 45 mg/kg, respectively. The results of verification experiment verified that ACG could significantly reduce hepatic TG contents of NAFL rats and mice, as well as the cellular TG content of FFA-induced HepG2 cells. ACG could also improve HOMA-IR and hepatic mitochondrial ultrastructure of NAFL mice. Our study verified that ACG recipe could regulate lipid metabolism of NAFL in vivo and in vitro. PMID:27069915

  12. Aging management of major LWR components with nondestructive evaluation

    SciTech Connect

    Shah, V.N.; MacDonald, P.E.; Akers, D.W.; Sellers, C.; Murty, K.L.; Miraglia, P.Q.; Mathew, M.D.; Haggag, F.M.

    1997-12-31

    Nondestructive evaluation of material damage can contribute to continued safe, reliable, and economical operation of nuclear power plants through their current and renewed license period. The aging mechanisms active in the major light water reactor components are radiation embrittlement, thermal aging, stress corrosion cracking, flow-accelerated corrosion, and fatigue, which reduce fracture toughness, structural strength, or fatigue resistance of the components and challenge structural integrity of the pressure boundary. This paper reviews four nondestructive evaluation methods with the potential for in situ assessment of damage caused by these mechanisms: stress-strain microprobe for determining mechanical properties of reactor pressure vessel and cast stainless materials, magnetic methods for estimating thermal aging damage in cast stainless steel, positron annihilation measurements for estimating early fatigue damage in reactor coolant system piping, and ultrasonic guided wave technique for detecting cracks and wall thinning in tubes and pipes and corrosion damage to embedded portion of metal containments.

  13. Major components of China's anthropogenic primary particulate emissions.

    SciTech Connect

    Zhang, Q.; Streets, D. G.; He, K.; Klimont, Z.; Decision and Information Sciences; Tsinghua Univ.; International Inst. for Applied Systems Analysis

    2007-10-01

    This paper presents the first comprehensive estimates of particulate emissions in China by size distribution and major components. Using a technology-based emission inventory approach, we are able to classify particulate emissions into three size ranges, TSP, PM{sub 10} and PM{sub 2.5}, and identify the contributions of black carbon (BC), organic carbon (OC), Ca and Mg. Total particulate emissions are estimated to be 27.4 Tg for the year 2001, of which 17.8 Tg are PM{sub 10} and 12.7 Tg are PM{sub 2.5}. Industrial processes are the major sources of particles over all three size ranges, but residential biofuel use and transportation sources become increasingly important for PM{sub 10} and PM{sub 2.5}. The industrialized coastal provinces, such as Shandong, Jiangsu and Hebei, are the major sources of particulate emissions. The industrialized and developing regions show different characteristic emission ratios of PM{sub 2.5}/TSP, (BC+OC)/PM{sub 2.5} and (Ca+Mg)/TSP. In the future, we can expect significant reductions in primary particulate emissions and major changes in the patterns of size and species.

  14. Build Less Code, Deliver More Science: An Experience Report on Composing Scientific Environments using Component-based and Commodity Software Platforms

    SciTech Connect

    Gorton, Ian; Liu, Yan; Lansing, Carina S.; Elsethagen, Todd O.; Kleese van Dam, Kerstin

    2013-07-17

    Modern scientific software is daunting in its diversity and complexity. From massively parallel simulations running on the world’s largest supercomputers, to visualizations and user support environments that manage ever growing complex data collections, the challenges for software engineers are plentiful. While high performance simulators are necessarily specialized codes to maximize performance on specific supercomputer architectures, we argue the vast majority of supporting infrastructure, data management and analysis tools can leverage commodity open source and component-based technologies. This approach can significantly drive down the effort and costs of building complex, collaborative scientific user environments, as well as increase their reliability and extensibility. In this paper we describe our experiences in creating an initial user environment for scientists involved in modeling the detailed effects of climate change on the environment of selected geographical regions. Our approach composes the user environment using the Velo scientific knowledge management platform and the MeDICi Integration Framework for scientific workflows. These established platforms leverage component-based technologies and extend commodity open source platforms with abstractions and capabilities that make them amenable for broad use in science. Using this approach we were able to deliver an operational user environment capable of running thousands of simulations in a 7 month period, and achieve significant software reuse.

  15. Neuroprotective Activity of Hypericum perforatum and Its Major Components.

    PubMed

    Oliveira, Ana I; Pinho, Cláudia; Sarmento, Bruno; Dias, Alberto C P

    2016-01-01

    Hypericum perforatum is a perennial plant, with worldwide distribution, commonly known as St. John's wort. It has been used for centuries in traditional medicine for the treatment of several disorders, such as minor burns, anxiety, and mild to moderate depression. In the past years, its antidepressant properties have been extensively studied. Despite that, other H. perforatum biological activities, as its neuroprotective properties have also been evaluated. The present review aims to provide a comprehensive summary of the main biologically active compounds of H. perforatum, as for its chemistry, pharmacological activities, drug interactions and adverse reactions and gather scattered information about its neuroprotective abilities. As for this, it has been demonstrated that H. perforatum extracts and several of its major molecular components have the ability to protect against toxic insults, either directly, through neuroprotective mechanisms, or indirectly, through is antioxidant properties. H. perforatum has therefore the potential to become an effective neuroprotective therapeutic agent, despite further studies that need to be carried out.

  16. Major Components of the National TRU Waste System Optimization Project.

    SciTech Connect

    Moody, D. C.; Bennington, B.; Sharif, F.

    2002-01-01

    The National Transuranic (TRU) Program (NTP) is being optimized to allow for disposing of the legacy TRU waste at least 10 years earlier than originally planned. This acceleration will save the nation an estimated $713. The Department of Energy's (DOE'S) Carlsbad Field Office (CBFO) has initiated the National TRU Waste System Optimization Project to propose, and upon approvaI, implement activities that produce significant cost saving by improving efficiency, thereby accelerating the rate of TRU waste disposal without compromising safety. In its role as NTP agent of change, the National TRU Waste System Optimization Project (the Project) (1) interacts closely with all NTP activities. Three of the major components of the Project are the Central Characterization Project (CCP), the Central Confirmation Facility (CCF), and the MobiIe/Modular Deployment Program.

  17. Quercetin, not caffeine, is a major neuroprotective component in coffee.

    PubMed

    Lee, Moonhee; McGeer, Edith G; McGeer, Patrick L

    2016-10-01

    Epidemiologic studies indicate that coffee consumption reduces the risk of Parkinson's disease and Alzheimer's disease. To determine the factors involved, we examined the protective effects of coffee components. The test involved prevention of neurotoxicity to SH-SY5Y cells that was induced by lipopolysaccharide plus interferon-γ or interferon-γ released from activated microglia and astrocytes. We found that quercetin, flavones, chlorogenic acid, and caffeine protected SH-SY5Y cells from these toxins. They also reduced the release of tumor necrosis factor-α and interleukin-6 from the activated microglia and astrocytes and attenuated the activation of proteins from P38 mitogen-activated protein kinase (MAPK) and nuclear factor kappa light chain enhancer of activated B cells (NFκB). After exposure to toxin containing glial-stimulated conditioned medium, we also found that quercetin reduced oxidative/nitrative damage to DNA, as well as to the lipids and proteins of SH-SY5Y cells. There was a resultant increase in [GSH]i in SH-SY5Y cells. The data indicate that quercetin is the major neuroprotective component in coffee against Parkinson's disease and Alzheimer's disease.

  18. Neuroprotective Activity of Hypericum perforatum and Its Major Components

    PubMed Central

    Oliveira, Ana I.; Pinho, Cláudia; Sarmento, Bruno; Dias, Alberto C. P.

    2016-01-01

    Hypericum perforatum is a perennial plant, with worldwide distribution, commonly known as St. John’s wort. It has been used for centuries in traditional medicine for the treatment of several disorders, such as minor burns, anxiety, and mild to moderate depression. In the past years, its antidepressant properties have been extensively studied. Despite that, other H. perforatum biological activities, as its neuroprotective properties have also been evaluated. The present review aims to provide a comprehensive summary of the main biologically active compounds of H. perforatum, as for its chemistry, pharmacological activities, drug interactions and adverse reactions and gather scattered information about its neuroprotective abilities. As for this, it has been demonstrated that H. perforatum extracts and several of its major molecular components have the ability to protect against toxic insults, either directly, through neuroprotective mechanisms, or indirectly, through is antioxidant properties. H. perforatum has therefore the potential to become an effective neuroprotective therapeutic agent, despite further studies that need to be carried out. PMID:27462333

  19. Major component analysis of dynamic networks of physiologic organ interactions

    NASA Astrophysics Data System (ADS)

    Liu, Kang K. L.; Bartsch, Ronny P.; Ma, Qianli D. Y.; Ivanov, Plamen Ch

    2015-09-01

    The human organism is a complex network of interconnected organ systems, where the behavior of one system affects the dynamics of other systems. Identifying and quantifying dynamical networks of diverse physiologic systems under varied conditions is a challenge due to the complexity in the output dynamics of the individual systems and the transient and nonlinear characteristics of their coupling. We introduce a novel computational method based on the concept of time delay stability and major component analysis to investigate how organ systems interact as a network to coordinate their functions. We analyze a large database of continuously recorded multi-channel physiologic signals from healthy young subjects during night-time sleep. We identify a network of dynamic interactions between key physiologic systems in the human organism. Further, we find that each physiologic state is characterized by a distinct network structure with different relative contribution from individual organ systems to the global network dynamics. Specifically, we observe a gradual decrease in the strength of coupling of heart and respiration to the rest of the network with transition from wake to deep sleep, and in contrast, an increased relative contribution to network dynamics from chin and leg muscle tone and eye movement, demonstrating a robust association between network topology and physiologic function.

  20. The major bioactive components of seaweeds and their mosquitocidal potential.

    PubMed

    Yu, Ke-Xin; Jantan, Ibrahim; Ahmad, Rohani; Wong, Ching-Lee

    2014-09-01

    Seaweeds are one of the most widely studied natural resources for their biological activities. Novel seaweed compounds with unique chemical structures have been reported for their pharmacological properties. The urge to search for novel insecticidal compound with a new mode of action for development of botanical insecticides supports the relevant scientific research on discovering the bioactive compounds in seaweeds. The mosquitocidal potential of seaweed extracts and their isolated compounds are documented in this review paper, along with the discussion on bioactivities of the major components of seaweeds such as polysaccharides, phenolics, proteins, terpenes, lipids, and halogenated compounds. The effects of seaweed extracts and compounds toward different life stages of mosquito (egg, larva, pupa, and adult), its growth, development, and reproduction are elaborated. The structure-activity relationships of mosquitocidal compounds are discussed to extrapolate the possible chemical characteristics of seaweed compounds responsible for insecticidal properties. Furthermore, the possible target sites and mode of actions of the mosquitocidal seaweed compounds are included in this paper. The potential synergistic effects between seaweeds and commercial insecticides as well as the toxic effects of seaweed extracts and compounds toward other insects and non-target organisms in the same habitat are also described. On top of that, various factors that influence the mosquitocidal potential of seaweeds, such as abiotic and biotic variables, sample preparation, test procedures, and considerations for a precise experimental design are discussed. The potential of active seaweed extracts and compounds in the development of effective bioinsecticide are also discussed.

  1. Alpha amylase is a major allergenic component in occupational asthma patients caused by porcine pancreatic extract.

    PubMed

    Park, Hae-Sim; Kim, Hee-Yeon; Suh, You-Jin; Lee, Soo-Jin; Lee, Soo-Keol; Kim, Sun-Sin; Nahm, Dong-Ho

    2002-09-01

    Porcine pancreatic extracts (PPE) are composed of alpha-amylase and lipase, which are common components of digestive enzymes. They have been known to cause occupational asthma in exposed workers in pharmaceutical and baking industries, as well as in a laboratory technician, but there has been no report of PPE-induced occupational asthma in medical personnel and their IgE binding components to each component. Four asthmatic subjects showing positive results on PPE-bronchoprovocation testing were enrolled. All of them were nurses working in a university hospital. Their job included grinding and mixing PPE powder for admitted patients. Serum-specific IgE antibodies to PPE, alpha-amylase, and lipase were measured by enzyme linked immunosorbent assay (ELISA). To confirm specificity of IgE binding and cross-allergenicity among the three extracts, ELISA inhibition tests were performed. In order to characterize allergenic components within these three extracts, SDS-PAGE and IgE immunoblot analysis were done. Specific IgE antibodies to PPE, alpha-amylase, and lipase were detectable by ELISA in all study subjects. An alpha-amylase ELISA inhibition test showed significant inhibitions by amylase and PPE, and minimal inhibition by lipase. However, a lipase ELISA inhibition test showed significant inhibitions by alpha-amylase and PPE with a lesser degree of inhibition by lipase. Furthermore, IgE immunoblot analysis showed one IgE binding component (55 kDa) within PPE, six components (55 kDa, 43 kDa, 41 kDa, 32 kDa, 31 kDa, 29 kDa) within alpha-amylase and two components (31 kDa, 29 kDa) within lipase extracts. Thesefindings suggest that inhalation of PPE powder can induce IgE-mediated bronchoconstriction in exposed nurses. Alpha-amylase is a major allergenic component within PPE.

  2. The influence of different food components on the in vitro availability of iron, zinc and calcium from a composed meal.

    PubMed

    Van Dyck, K; Tas, S; Robberecht, H; Deelstra, H

    1996-11-01

    The availability of iron, zinc and calcium from a composed meal was studied by an in vitro method using equilibrium dialysis after simulated gastric digestion. Four different concentrations of four influencing factors (coffee, vitamin C, wheat bran and pectin) were added to the mixed meal and their effect on the relative index of availability was studied after elemental analysis by atomic absorption spectrometry. Apart from ascorbic acid, all other factors had a negative effect on availability of minerals and trace elements. Most pronounced effect, and for all three elements, was observed for the addition of wheat bran. Zinc was the trace element, which was most sensitive to increased spiking of food constituents.

  3. Correlation of major components of ocular astigmatism in myopic patients.

    PubMed

    Mohammadpour, Mehrdad; Heidari, Zahra; Khabazkhoob, Mehdi; Amouzegar, Afsaneh; Hashemi, Hassan

    2016-02-01

    To investigate the correlation of major components of ocular astigmatism in myopic patients in an academic hospital. This cross-sectional study was conducted on 376 eyes of 188 patients who were referred to Farabi Eye Hospital for refractive surgery. Preoperative examinations including refraction and corneal topography were performed for all candidates to measure refractive and corneal astigmatism. Ocular residual astigmatism was calculated using vector analysis. Pearson's correlation and ANOVA analysis were used to evaluate the strength of the association between different types of astigmatism. Both eyes were defined as cluster and the Generalized Estimating Equations (GEE) analysis were performed. Mean age of 119 women (63.3%) and 69 men (36.7%) was 27.8 ± 5.7 years. Mean refractive error based on spherical equivalent was -3.59 ± 1.95D (range, -0.54 to -10.22D). Mean refractive and corneal astigmatism was 1.97 ± 1.3D and 1.85 ± 1.01D, respectively. Mean amount of ORA was 0.65 ± 0.36D.There was a significant correlation between ORA and refractive astigmatism(r=0.23, p<0.001), corneal and refractive astigmatism (r=0.91, p<0.001) and a weak correlation between ORA and corneal astigmatism (r=0.13, p=0.014). There was a significant correlation between J0 and J45 values of ORA and corneal astigmatism (p<0.001). There is a significant correlation between ORA and refractive astigmatism, refractive and corneal astigmatism and a weak correlation between ORA and corneal astigmatism in refractive surgery candidates. Identifying the type of astigmatism and preoperative measurement of ocular residual astigmatism is highly recommended prior to any refractive surgery, especially in cases with significant astigmatism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Structure, dynamics, evolution, and function of a major scaffold component in the nuclear pore complex.

    PubMed

    Sampathkumar, Parthasarathy; Kim, Seung Joong; Upla, Paula; Rice, William J; Phillips, Jeremy; Timney, Benjamin L; Pieper, Ursula; Bonanno, Jeffrey B; Fernandez-Martinez, Javier; Hakhverdyan, Zhanna; Ketaren, Natalia E; Matsui, Tsutomu; Weiss, Thomas M; Stokes, David L; Sauder, J Michael; Burley, Stephen K; Sali, Andrej; Rout, Michael P; Almo, Steven C

    2013-04-02

    The nuclear pore complex, composed of proteins termed nucleoporins (Nups), is responsible for nucleocytoplasmic transport in eukaryotes. Nuclear pore complexes (NPCs) form an annular structure composed of the nuclear ring, cytoplasmic ring, a membrane ring, and two inner rings. Nup192 is a major component of the NPC's inner ring. We report the crystal structure of Saccharomyces cerevisiae Nup192 residues 2-960 [ScNup192(2-960)], which adopts an α-helical fold with three domains (i.e., D1, D2, and D3). Small angle X-ray scattering and electron microscopy (EM) studies reveal that ScNup192(2-960) could undergo long-range transition between "open" and "closed" conformations. We obtained a structural model of full-length ScNup192 based on EM, the structure of ScNup192(2-960), and homology modeling. Evolutionary analyses using the ScNup192(2-960) structure suggest that NPCs and vesicle-coating complexes are descended from a common membrane-coating ancestral complex. We show that suppression of Nup192 expression leads to compromised nuclear transport and hypothesize a role for Nup192 in modulating the permeability of the NPC central channel.

  5. The disease complex of the gypsy moth. 1. Major components

    Treesearch

    R.W. Campbell; J.D. Podgwaite

    1971-01-01

    A study was undertaken to elucidate the impact of the various components of disease on natural populations of the gypsy moth, Porthetria dispar. Diseased larvae from both sparse and dense populations were examined and categorized on the basis of etiologic and nonetiologic mortality factors. Results indicated a significantly higher incidence of...

  6. Recorder Composer

    ERIC Educational Resources Information Center

    Stephenson, Kimberly

    2012-01-01

    The best moments happen when students begin to realize how much power they have and use that power to create. Composing as they master different instrumental stages helps students make composition and performance a natural step in learning. A step-by-step process (rhythm notation, add pitches, copy to a five-line staff, check work, and play) keeps…

  7. Recorder Composer

    ERIC Educational Resources Information Center

    Stephenson, Kimberly

    2012-01-01

    The best moments happen when students begin to realize how much power they have and use that power to create. Composing as they master different instrumental stages helps students make composition and performance a natural step in learning. A step-by-step process (rhythm notation, add pitches, copy to a five-line staff, check work, and play) keeps…

  8. Synthesis of two major toxaphene components and their photostabilities.

    PubMed

    Coelhan, Mehmet; Maurer, Martin

    2005-12-28

    The synthesis of 2-endo,3-exo,5-endo,6-exo,8,9,10-heptachlorobornane (B7-1001, Hp-Sed) and 2-endo,3-exo,5-endo,6-exo,8,9,9,10-octachlorobornane (B8-1412) is described. Both compounds are components of toxaphene, an insecticide that has been widely used in the past. B7-1001 is an important toxaphene congener, comprising up to 99% of total toxaphene concentrations found in fish and sediment samples from treated lakes. B8-1412 is also a significant component of toxaphene contamination in samples from biota. In synthesizing the compounds, 2-exo,3-endo,6-endo,8,9,10-hexachlorobornane (B6-913) was obtained by reduction of the well-known toxaphene component P 32 (B7-515, 2,2,5-endo,6-exo,8,9,10-heptachlorobornane), which was itself isolated from the chlorination products of (+)-camphene. Chlorination of B6-913 provided B7-1001 in 49.5% yield, and P 32 and four other heptachlorobornanes were also detected in the reaction mixture. Structures of two of the heptachlorobornanes were elucidated by MS and NMR as 2-exo,3-endo,6-endo,8,9,9,10-heptachlorobornane (B7-1461) and 2-exo,3,3,6-endo,8,9,10-heptachlorobornane (B7-1303). B8-1412 was isolated from the product mixture obtained by chlorination of 2-exo,3-endo,6-endo,8,9,9,10-heptachlorobornane. Photolysis experiments at lambda = 254 nm revealed that B6-913 is photochemicaly the most stable compound of the seven toxaphene compounds studied, with a t(1/2) of 213 h. B7-1001, having a t(1/2) of 82 h, was the second most stable compound. B8-1412 was degraded more rapidly, with a t(1/2) of 28.8 h, than B7-1001, but was still much more stable than P 50 (B9-1679, 2-endo,3-exo,5-endo,6-exo,8,8,9,10,10-nonachlorobornane), which had a t(1/2) of 9.4 h, despite its reputation as a very persistant compound. Under the same experimental conditions hexachlorobenzene (HLB) and octachlorodibenzodioxine (OCDD) were consumed very quickly with t(1/2) = 0.0025 and 0.0015 h, respectively.

  9. Proteins of human milk. I. Identification of major components

    SciTech Connect

    Anderson, N.G.; Powers, M.T.; Tollaksen, S.L.

    1982-04-01

    Traditionally, human milk proteins are identified largely by reference to bovine milk. Hence, to identify the major proteins in human milk, we subjected human and bovine milk, in parallel, to high-resolution two-dimensional electrophoresis. Isoelectric precipitation at pH 4.6 was our criterion for distinguishing whey proteins from those of the casein complex. The ..cap alpha..- and..beta..-caseins were identified on the basis of relative abundance, relative molecular mass, and relative isoelectric points. No protein disappeared from ISO-DALT patterns of human milk after rennin treatment, and no new protein comparable to bovine para K-casein appeared in the BASO-DALT patterns; this suggests that K-casein is absent from human milk. The proteins identified in human milk patterns include the ..cap alpha.. and ..beta.. casein families, lactalbumin, albumin, transferrin, IgA, and lactoferrin. Numerous additional proteins seen in patterns for human milk remain to be identified.

  10. TFF peptides and mucins are major components of dacryoliths.

    PubMed

    Paulsen, Friedrich P; Schaudig, Ulrich; Fabian, Alexander; Ehrich, Dirk; Sel, Saadettin

    2006-09-01

    The study was performed to determine whether trefoil factor peptides (TFF) and/or mucins are components of dacryoliths and to gain further insight into dacryolith composition and formation. Twenty dacryoliths found in lacrimal surgery in patients suffering from primary acquired nasolacrimal duct obstruction were analyzed for the presence of TFF peptides (TFF1, 2, 3), mucins (MUC1, 2, 3, 4, 5AC, 5B, 6, 7, 8), defense cells (T- and B lymphocytes, macrophages, neutrophils), and antimicrobial substances (alpha defensins 1-3, secretory phospholipase A(2)) by means of light microscopy, histochemistry, immunohistochemistry, reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR. All dacryoliths except one revealed clear immunoreactivity for all three TFF peptides. The immunohistochemical distribution of mucins was inhomogeneous throughout the different dacryoliths. However, in some dacryoliths all mucins investigated were detected. MUC8 showed reactivity in 14 out of 15 dacryoliths analyzed by immunohistochemistry. Most dacryoliths contained alpha defensins 1-3 as the secretory product of neutrophils. T and B lymphocytes, macrophages and secretory phospholipase A(2) were only present in single dacryoliths. Quantification of TFF peptide expression supported the immunohistochemical finding that all three TFF peptides are augmented in dacryoliths. Dacryoliths consist partly of secreted mucins comparable with the mucin spectrum of the epithelium of healthy nasolacrimal ducts. Beside TFF1 and TFF3, both of which are produced under healthy circumstances, TFF2 is additionally induced and secreted in cases of dacryolithiasis. All three TFF peptides appear to be augmented in dacryoliths. With regard to their rheologic properties, TFF peptides may play a functional role in dacryolith formation. However, our results raise the question of whether TFF peptides per se influence dacryolith formation or whether their secretion, as in secretion of mucins and alpha

  11. 41 CFR 102-85.40 - What are the major components of the pricing policy?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... components of the pricing policy? 102-85.40 Section 102-85.40 Public Contracts and Property Management...-PRICING POLICY FOR OCCUPANCY IN GSA SPACE Pricing Policy-General § 102-85.40 What are the major components of the pricing policy? The major components of the pricing policy are: (a) An OA between a customer...

  12. A Novel Aqueous Two Phase System Composed of Surfactant and Xylitol for the Purification of Lipase from Pumpkin (Cucurbita moschata) Seeds and Recycling of Phase Components.

    PubMed

    Amid, Mehrnoush; Manap, Mohd Yazid; Hussin, Muhaini; Mustafa, Shuhaimi

    2015-06-17

    Lipase is one of the more important enzymes used in various industries such as the food, detergent, pharmaceutical, textile, and pulp and paper sectors. A novel aqueous two-phase system composed of surfactant and xylitol was employed for the first time to purify lipase from Cucurbita moschata. The influence of different parameters such as type and concentration of surfactants, and the composition of the surfactant/xylitol mixtures on the partitioning behavior and recovery of lipase was investigated. Moreover, the effect of system pH and crude load on the degree of purification and yield of the purified lipase were studied. The results indicated that the lipase was partitioned into the top surfactant rich phase while the impurities partitioned into the bottom xylitol-rich phase using an aqueous two phase system composed of 24% (w/w) Triton X-100 and 20% (w/w) xylitol, at 56.2% of tie line length (TLL), (TTL is one of the important parameters in this study and it is determined from a bimodal curve in which the tie-line connects two nodes on the bimodal, that represent concentration of phase components in the top and bottom phases) and a crude load of 25% (w/w) at pH 8.0. Recovery and recycling of components was also measured in each successive step process. The enzyme was successfully recovered by the proposed method with a high purification factor of 16.4 and yield of 97.4% while over 97% of the phase components were also recovered and recycled. This study demonstrated that the proposed novel aqueous two phase system method is more efficient and economical than the traditional aqueous two phase system method for the purification and recovery of the valuable enzyme lipase.

  13. Members of the salivary gland surface protein (SGS) family are major immunogenic components of mosquito saliva.

    PubMed

    King, Jonas G; Vernick, Kenneth D; Hillyer, Julián F

    2011-11-25

    Mosquitoes transmit Plasmodium and certain arboviruses during blood feeding, when they are injected along with saliva. Mosquito saliva interferes with the host's hemostasis and inflammation response and influences the transmission success of some pathogens. One family of mosquito salivary gland proteins, named SGS, is composed of large bacterial-type proteins that in Aedes aegypti were implicated as receptors for Plasmodium on the basal salivary gland surface. Here, we characterize the biology of two SGSs in the malaria mosquito, Anopheles gambiae, and demonstrate their involvement in blood feeding. Western blots and RT-PCR showed that Sgs4 and Sgs5 are produced exclusively in female salivary glands, that expression increases with age and after blood feeding, and that protein levels fluctuate in a circadian manner. Immunohistochemistry showed that SGSs are present in the acinar cells of the distal lateral lobes and in the salivary ducts of the proximal lobes. SDS-PAGE, Western blots, bite blots, and immunization via mosquito bites showed that SGSs are highly immunogenic and form major components of mosquito saliva. Last, Western and bioinformatic analyses suggest that SGSs are secreted via a non-classical pathway that involves cleavage into a 300-kDa soluble fragment and a smaller membrane-bound fragment. Combined, these data strongly suggest that SGSs play an important role in blood feeding. Together with their role in malaria transmission, we propose that SGSs could be used as markers of human exposure to mosquito bites and in the development of disease control strategies.

  14. A novel aqueous micellar two-phase system composed of surfactant and sorbitol for purification of pectinase enzyme from Psidium guajava and recycling phase components.

    PubMed

    Amid, Mehrnoush; Murshid, Fara Syazana; Manap, Mohd Yazid; Hussin, Muhaini

    2015-01-01

    A novel aqueous two-phase system composed of a surfactant and sorbitol was employed for the first time to purify pectinase from Psidium guajava. The influences of different parameters, including the type and concentration of the surfactant and the concentration and composition of the surfactant/sorbitol ratio, on the partitioning behavior and recovery of pectinase were investigated. Moreover, the effects of system pH and the crude load on purification fold and the yield of purified pectinase were studied. The experimental results indicated that the pectinase was partitioned into surfactant-rich top phase, and the impurities were partitioned into the sorbitol-rich bottom phase with the novel method involving an ATPS composed of 26% (w/w) Triton X-100 and 23% (w/w) sorbitol at 54.2% of the TLL crude load of 20% (w/w) at pH 6.0. The enzyme was successfully recovered by this method with a high purification factor of 15.2 and a yield of 98.3%, whereas the phase components were also recovered and recycled at rates above 96%. This study demonstrated that this novel ATPS method can be used as an efficient and economical alternative to the traditional ATPS for the purification and recovery of the valuable enzyme.

  15. A Novel Aqueous Micellar Two-Phase System Composed of Surfactant and Sorbitol for Purification of Pectinase Enzyme from Psidium guajava and Recycling Phase Components

    PubMed Central

    Murshid, Fara Syazana; Manap, Mohd Yazid; Hussin, Muhaini

    2015-01-01

    A novel aqueous two-phase system composed of a surfactant and sorbitol was employed for the first time to purify pectinase from Psidium guajava. The influences of different parameters, including the type and concentration of the surfactant and the concentration and composition of the surfactant/sorbitol ratio, on the partitioning behavior and recovery of pectinase were investigated. Moreover, the effects of system pH and the crude load on purification fold and the yield of purified pectinase were studied. The experimental results indicated that the pectinase was partitioned into surfactant-rich top phase, and the impurities were partitioned into the sorbitol-rich bottom phase with the novel method involving an ATPS composed of 26% (w/w) Triton X-100 and 23% (w/w) sorbitol at 54.2% of the TLL crude load of 20% (w/w) at pH 6.0. The enzyme was successfully recovered by this method with a high purification factor of 15.2 and a yield of 98.3%, whereas the phase components were also recovered and recycled at rates above 96%. This study demonstrated that this novel ATPS method can be used as an efficient and economical alternative to the traditional ATPS for the purification and recovery of the valuable enzyme. PMID:25756051

  16. Brain components

    MedlinePlus Videos and Cool Tools

    The brain is composed of more than a thousand billion neurons. Specific groups of them, working in concert, provide ... of information. The 3 major components of the brain are the cerebrum, cerebellum, and brain stem. The ...

  17. Composing Science

    NASA Astrophysics Data System (ADS)

    Atkins, Leslie

    2015-03-01

    The course Scientific Inquiry at California State University was developed by faculty in biology, physics and English to meet ``writing proficiency'' requirements for non-science majors. Drawing from previous work in composition studies, the position that we take in this course is that we should be engaging students in writing that replicates the work that writing does in science, rather than replicating the particular structural conventions characteristic of scientific writing. That is, scientists use writing to have, remember, share, vet, challenge, and stabilize ideas, and our course requires students use writing to achieve those aims, rather than produce writing that obeys particular conventions of scientific writing. This talk will describe how we have integrated findings from composition studies with a course on scientific inquiry, and provide examples of how scientific communication has resulted from this dialogue. Funding by NSF #1140860.

  18. 77 FR 39521 - Application for a License To Export Nuclear Reactor Major Components and Equipment

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-03

    ... COMMISSION Application for a License To Export Nuclear Reactor Major Components and Equipment Pursuant to 10... Reactor internals, Components and For use in Braka nuclear power Company LLC reactor coolant equipment for... plant in Braka. 110060011 control equipment, auxiliary equipment and emergency cooling systems. Dated...

  19. Measuring the Success of Acquisition Reform by Major DoD Components

    DTIC Science & Technology

    2015-05-13

    Assistant, Defense-Industrial Initiatives Group May 13, 2015 Measuring the Success of Acquisition Reform by Major DoD Components csis.org/diig...in 2010? • How successful have the components been at promoting contracting opportunities for small businesses? • Have the DoD components...Starting Regime 9 csis.org/diig | Military Health Competition by Starting Regime 10 csis.org/diig | Vendor Size How successful have the

  20. Miscibility/stability considerations in binary solid dispersion systems composed of functional excipients towards the design of multi-component amorphous systems.

    PubMed

    Yoo, Seung-uk; Krill, Steven L; Wang, Zeren; Telang, Chitra

    2009-12-01

    The correlations between amorphous miscibility/physical stability of binary solid dispersions (a highly crystalline additive-an amorphous polymer) and the physicochemical properties of the components were investigated. Crystalline functional excipients including surfactants, organic acids, and organic bases were prepared in binary solid dispersions in amorphous polymers by solvent evaporation method. Amorphous miscibility and physical stability of the systems were characterized using polarized light microscope, differential scanning calorimeter, and powder X-ray diffraction. Physicochemical parameters (solubility parameter (delta), hydrogen bond energy, Log P, pK(a) value as an indicator of acid-base ionic interaction, and T(g) of the dispersion as a surrogate of system's mobility) were selected as thermodynamic and kinetic factors to examine their influences on the systems' amorphous miscibility and physical stability. All systems possessing acid-base ionic interaction formed amorphous state. In the absence of the ionic interaction, solubility parameter and partition coefficient were shown to have major roles on amorphous formation. Upon storage condition at 25 degrees C/60% RH for 50 days, systems having ionic interaction and high T(g) remained in the amorphous state. This binary system study provides an insight and a basis for formation of the amorphous state of multi-component solid dispersions utilizing their physicochemical properties.

  1. Composing and Arranging Careers

    ERIC Educational Resources Information Center

    Schwartz, Elliott; And Others

    1977-01-01

    With the inspiration, the originality, the skill and craftsmanship, the business acumen, the patience, and the luck, it's possible to become a classical composer, pop/rock/country composer, jingle composer, or educational composer. Describes these careers. (Editor/RK)

  2. Chemical composition and antiprotozoal activities of Colombian Lippia spp essential oils and their major components.

    PubMed

    Escobar, Patricia; Milena Leal, Sandra; Herrera, Laura Viviana; Martinez, Jairo Rene; Stashenko, Elena

    2010-03-01

    The chemical composition and biological activities of 19 essential oils and seven of their major components were tested against free and intracellular forms of Leishmania chagasi and Trypanosoma cruzi parasites as well as Vero and THP-1 mammalian cell lines. The essential oils were obtained from different species of Lippia, a widely distributed genus of Colombian plants. They were extracted by microwave radiation-assisted hydro-distillation and characterised by GC-FID and GC-MS. The major components were geranial, neral, limonene, nerol, carvacrol, p-cymene, gamma-terpinene, carvone and thymol. The essential oil of Lippia alba exhibited the highest activity against T. cruzi epimastigotes and intracellular amastigotes with an IC50 of 5.5 microg/mL and 12.2 microg/mL, respectively. The essential oil of Lippia origanoides had an IC50 of 4.4 microg/mL in L. chagasi promastigotes and exhibited no toxicity in mammalian cells. Thymol (IC50 3.2 +/- 0.4 microg/mL) and S-carvone (IC50 6.1 +/- 2.2 microg/mL), two of the major components of the active essential oils, were active on intracellular amastigotes of T. cruziinfected Vero cells, with a selective index greater than 10. None of the essential oils or major components tested in this study was active on amastigotes of L. chagasi infected THP-1 cells.

  3. 21 CFR 1020.30 - Diagnostic x-ray systems and their major components.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Diagnostic x-ray systems and their major components. 1020.30 Section 1020.30 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... copper, as given in “Aluminum Standards and Data” (1969). Copies may be obtained from The Aluminum...

  4. 21 CFR 1020.30 - Diagnostic x-ray systems and their major components.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Diagnostic x-ray systems and their major components. 1020.30 Section 1020.30 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... copper, as given in “Aluminum Standards and Data” (1969). Copies may be obtained from The Aluminum...

  5. Antibacterial properties and major bioactive components of cinnamon stick (Cinnamomum burmannii): activity against foodborne pathogenic bacteria.

    PubMed

    Shan, Bin; Cai, Yi-Zhong; Brooks, John D; Corke, Harold

    2007-07-11

    Cinnamomum burmannii Blume (cinnamon stick) from Indonesia is a little-investigated spice. In this study, the antibacterial activity, minimum inhibitory concentration (MIC), and minimum bactericidal concentration (MBC) of cinnamon stick extract were evaluated against five common foodborne pathogenic bacteria (Bacillus cereus, Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, and Salmonella anatum). Cinnamon stick extract exhibited significant antibacterial properties. Major compounds in cinnamon stick were tentatively identified by gas chromatography-mass spectrometry (GC-MS) and liquid chromatography (LC-MS) as a predominant volatile oil component ((E)-cinnamaldehyde) and several polyphenols (mainly proanthocyanidins and (epi)catechins). Both (E)-cinnamaldehyde and proanthocyanidins significantly contributed to the antibacterial properties. Additionally, scanning electron microscopy was used to observe morphological changes of bacteria treated with the crude extract of cinnamon stick and its major components. This study suggests that cinnamon stick and its bioactive components have potential for application as natural food preservatives.

  6. Physiological responses induced in tomato plants by a two-component nanostructural system composed of carbon nanotubes conjugated with quantum dots and its in vivo multimodal detection

    NASA Astrophysics Data System (ADS)

    Alimohammadi, Mohammad; Xu, Yang; Wang, Daoyuan; Biris, Alexandru S.; Khodakovskaya, Mariya V.

    2011-07-01

    Plant seedlings were exposed to single-walled carbon nanotube-quantum dot conjugates (SWCNT-QD) mixed in the growth medium in order to understand the interactions between these multicomponent nanosystems and plants. A combination of fluorescent and Raman-scattering 2D mapping analysis was used to clearly monitor the presence of the SWCNT-QD conjugates in various parts of the tomato seedlings. We found that the addition of QDs to SWCNTs dramatically changed the biological viability of the tomato plants by significantly accelerating leaf senescence and inhibiting root formation. Although the exposure of SWCNTs only to the plants induced positive effects, the chlorophyll content decreased by 1.5-fold in leaves, and the total weight of the root system decreased four times for the tomato plants exposed to SWCNT-QDs (50 µg ml - 1) compared to plants grown on regular medium as controls. Our results clearly indicate that the exposure of plants to multicomponent nanomaterials is highly influenced by the presence and bioactivity of each component, individually. Such studies could be the foundation for understanding how complex nanosized systems affect the activity of various biological systems with a major impact on ecotoxicology.

  7. Physiological responses induced in tomato plants by a two-component nanostructural system composed of carbon nanotubes conjugated with quantum dots and its in vivo multimodal detection.

    PubMed

    Alimohammadi, Mohammad; Xu, Yang; Wang, Daoyuan; Biris, Alexandru S; Khodakovskaya, Mariya V

    2011-07-22

    Plant seedlings were exposed to single-walled carbon nanotube-quantum dot conjugates (SWCNT-QD) mixed in the growth medium in order to understand the interactions between these multicomponent nanosystems and plants. A combination of fluorescent and Raman-scattering 2D mapping analysis was used to clearly monitor the presence of the SWCNT-QD conjugates in various parts of the tomato seedlings. We found that the addition of QDs to SWCNTs dramatically changed the biological viability of the tomato plants by significantly accelerating leaf senescence and inhibiting root formation. Although the exposure of SWCNTs only to the plants induced positive effects, the chlorophyll content decreased by 1.5-fold in leaves, and the total weight of the root system decreased four times for the tomato plants exposed to SWCNT-QDs (50 µg ml(-1)) compared to plants grown on regular medium as controls. Our results clearly indicate that the exposure of plants to multicomponent nanomaterials is highly influenced by the presence and bioactivity of each component, individually. Such studies could be the foundation for understanding how complex nanosized systems affect the activity of various biological systems with a major impact on ecotoxicology.

  8. My Career: Composer

    ERIC Educational Resources Information Center

    Morganelli, Patrick

    2013-01-01

    In this article, the author talks about his career as a composer and offers some advice for aspiring composers. The author works as a composer in the movie industry, creating music that supports a film's story. Other composers work on television shows, and some do both television and film. The composer uses music to tell the audience what kind of…

  9. Cytotoxicity of clove (Syzygium aromaticum) oil and its major components to human skin cells.

    PubMed

    Prashar, A; Locke, I C; Evans, C S

    2006-08-01

    The essential oil extracted from clove (Syzygium aromaticum) is used as a topical application to relieve pain and promote healing in herbal medicine and also finds use in the fragrance and flavouring industries. Clove oil has two major components, eugenol and beta-caryophyllene, which constitute 78% and 13% of the oil, respectively. Clove oil and these components are generally recognized as 'safe', but the in-vitro study here demonstrates cytotoxic properties of both the oil and eugenol, towards human fibroblasts and endothelial cells. Clove oil was found to be highly cytotoxic at concentrations as low as 0.03% (v/v) with up to 73% of this effect attributable to eugenol. beta-caryophyllene did not exhibit any cytotoxic activity, indicating that other cytotoxic components may also exist within the parent oil.

  10. Allergenic components in three different species of Penicillium: crossreactivity among major allergens.

    PubMed

    Shen, H D; Lin, W L; Tsai, J J; Liaw, S F; Han, S H

    1996-04-01

    Penicillium species have been considered as important causative agents of extrinsic bronchial asthma. However, little is known about the allergens of these ubiquitous airborne fungal species. This study compares the allergenic profiles and allergenic crossreactivity among allergens of three prevalent airborne Penicillium species. IgE-binding Penicillium components were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)-immunoblotting using sera from 67 asthmatic patients. The presence of allergenic crossreactivity was analysed by immunoblot inhibition. Among the 67 serum samples tested, 15, 14 and 11 samples showed IgE reactivity to components of P. citrinum, P. notatum and P. brevicompactum, respectively. All 15 P. citrinum-positive serum samples showed IgE-binding to a 33 kDa extract component of this species. Thirteen (93%) of the 14 P. notatum-positive serum samples and 10 (91%) of the 11 P. brevicompactum-positive sera also showed IgE reactivity to components with a molecular weight of about 33 kDa in individual Penicillium species. All of the 10 P. brevicompactum 33 kDa component-positive serum samples showed IgE reactivity to the 33 kDa components of the other two Penicillium species tested. Dose-dependent inhibition of IgE-binding to these major allergens was observed when the positive serum sample was absorbed with different amounts of individual allergenic extract as well as with different amounts of extracts prepared from the other two Penicillium species. Although different allergenic profiles were observed in the three different Penicillium species tested, results showed that there was an IgE crossreactivity among the 33 kDa group major allergens of P. citrinum, P. notatum and P. brevicompactum.

  11. 40 CFR Table W-1c to Subpart W of... - Default Average Component Counts For Major Crude Oil Production Equipment

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 22 2013-07-01 2013-07-01 false Default Average Component Counts For Major Crude Oil Production Equipment W Table W-1C to Subpart W of Part 98 Protection of Environment... Average Component Counts For Major Crude Oil Production Equipment Major equipment Valves...

  12. 40 CFR Table W-1c to Subpart W of... - Default Average Component Counts For Major Crude Oil Production Equipment

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 21 2014-07-01 2014-07-01 false Default Average Component Counts For Major Crude Oil Production Equipment W Table W-1C to Subpart W of Part 98 Protection of Environment... Average Component Counts For Major Crude Oil Production Equipment Major equipment Valves...

  13. Seasonal contribution of mineral dust and other major components to particulate matter at two remote sites in Central Asia

    NASA Astrophysics Data System (ADS)

    Miller-Schulze, Justin P.; Shafer, Martin; Schauer, James J.; Heo, Jongbae; Solomon, Paul A.; Lantz, Jeffrey; Artamonova, Maria; Chen, Boris; Imashev, Sanjar; Sverdlik, Leonid; Carmichael, Greg; DeMinter, Jeff

    2015-10-01

    Dust storms are significant contributors to ambient levels of particulate matter (PM) in many areas of the world. Central Asia, an area that is relatively understudied in this regard, is anticipated to be affected by dust storms due to its proximity to several major deserts that are in and generally surround Central Asia (e.g., the Aral Sea region, the Taklimakan desert in Western China). To investigate the relative importance of mineral dust (dust specifically composed of soil related minerals and oxides) in Central Asia, PM10 and PM2.5, and by difference, coarse particles (particles with diameters between 2.5 and 10 μm) were measured at two sites, Bishkek and Lidar Station Teplokluchenka (Lidar), in the Kyrgyz Republic. Samples were collected every other day from July 2008 to July 2009. Daily samples were analyzed for mass and organic and elemental carbon. Samples were also composited on a bi-weekly basis and analyzed for elemental constituents and ionic components. In addition, samples collected on days with relatively high and low PM concentrations were analyzed before, and separately, from the biweekly composites to investigate the chemical differences between the episodic events. Data from the episodic samples were averaged into the composited averages. Using the elemental component data, several observational models were examined to estimate the contribution of mineral dust to ambient PM levels. A mass balance was also conducted. Results indicate that at both sites, mineral dust (as approximated by the ;dust oxide; model) and organic matter (OM) were the dominant contributors to PM10 and PM2.5. Mineral dust was a more significant contributor to the coarse PM (PM10-2.5) during high event samples at both sites, although the relative contribution is greater at the Lidar site (average ± standard deviation = 42 ± 29%) as compared with the Bishkek site (26 ± 16%). Principal Components Analysis (PCA) was performed using data from both sites, and PCA indicated

  14. Antibacterial activity of the essential oil from Rosmarinus officinalis and its major components against oral pathogens.

    PubMed

    Bernardes, Wagner A; Lucarini, Rodrigo; Tozatti, Marcos G; Flauzino, Lúzio G Bocalon; Souza, Maria G M; Turatti, Isabel C C; Andrade e Silva, Márcio L; Martins, Carlos H G; da Silva Filho, Ademar A; Cunha, Wilson R

    2010-01-01

    The essential oil of Rosmarinus officinalis L. (rosemary) was obtained by hydro-distillation and analysed by gas chromatography-mass spectrometry. Sixty-two constituents were identified, representing 98.06% of the total oil content. Oxygenated monoterpenes were the predominant components. The rosemary oil was characterized as having prominent (> 5%) contents of camphor (18.9%), verbenone (11.3%), a-pinene (9.6%), beta-myrcene (8.6%), 1,8-cineole (8.0%), and beta-caryophyllene (5.1%). The antimicrobial activity of the oil as well as of its major constituents was tested against the following microorganisms: Streptococcus mutans, Streptococcus mitis, Streptococcus sanguinis, Streptococcus salivarius, Streptococcus sobrinus, and Enterococcus faecalis, which are potentially responsible for the formation of dental caries in humans. The microdilution method was used for determination of the minimum inhibitory concentration (MIC) during evaluation of the antibacterial activity. The essential oil displayed low activity against the selected microorganisms. In the present study, the pure major compounds were more active than the essential oil. Among all the microorganisms tested, the pathogen S. mitis was the most susceptible and E. faecalis was the most resistant to the evaluated samples. This is the first report on antimicrobial activity of the major components of rosemary oil against oral pathogens.

  15. Piceatannol, a potent bioactive stilbene, as major phenolic component in Rhodomyrtus tomentosa.

    PubMed

    Lai, Thi Ngoc Ha; Herent, Marie-France; Quetin-Leclercq, Joëlle; Nguyen, Thi Bich Thuy; Rogez, Hervé; Larondelle, Yvan; André, Christelle M

    2013-06-01

    The sim fruit (Rhodomyrtus tomentosa) has long been used in folk medicine to treat diarrhoea, dysentery, and to boost the immune system. The purpose of this work was to determine its phenolic profile and to evaluate the changes of content during maturation, as well as the variations induced by environmental conditions. Using HPLC-ESI-HR-MS, 19 phenolic compounds (PCs) were tentatively characterised and included stilbenes and ellagitannins as major components, followed by anthocyanins, flavonols, and gallic acid. PCs were then further quantified by HPLC-DAD. Piceatannol, a promising health-promoting stilbene component, was the major PC in the fruit with a concentration of 2.3mg/g dry weight at full maturity stage. This concentration is 1000-2000 times higher than that of red grapes, a major source of stilbene in the human diet. During maturation, the contents in piceatannol and other stilbenes, ellagitannins, and flavonols decreased while the anthocyanin content increased. Shade-grown sim fruits showed significantly higher piceatannol levels than sun-exposed fruits. Taken together, these findings highlight the potential of sim, an under-utilised plant species from South-East Asia, as a source of health-promoting fruits.

  16. Neuroinformatic analyses of common and distinct genetic components associated with major neuropsychiatric disorders.

    PubMed

    Lotan, Amit; Fenckova, Michaela; Bralten, Janita; Alttoa, Aet; Dixson, Luanna; Williams, Robert W; van der Voet, Monique

    2014-01-01

    Major neuropsychiatric disorders are highly heritable, with mounting evidence suggesting that these disorders share overlapping sets of molecular and cellular underpinnings. In the current article we systematically test the degree of genetic commonality across six major neuropsychiatric disorders-attention deficit hyperactivity disorder (ADHD), anxiety disorders (Anx), autistic spectrum disorders (ASD), bipolar disorder (BD), major depressive disorder (MDD), and schizophrenia (SCZ). We curated a well-vetted list of genes based on large-scale human genetic studies based on the NHGRI catalog of published genome-wide association studies (GWAS). A total of 180 genes were accepted into the analysis on the basis of low but liberal GWAS p-values (<10(-5)). 22% of genes overlapped two or more disorders. The most widely shared subset of genes-common to five of six disorders-included ANK3, AS3MT, CACNA1C, CACNB2, CNNM2, CSMD1, DPCR1, ITIH3, NT5C2, PPP1R11, SYNE1, TCF4, TENM4, TRIM26, and ZNRD1. Using a suite of neuroinformatic resources, we showed that many of the shared genes are implicated in the postsynaptic density (PSD), expressed in immune tissues and co-expressed in developing human brain. Using a translational cross-species approach, we detected two distinct genetic components that were both shared by each of the six disorders; the 1st component is involved in CNS development, neural projections and synaptic transmission, while the 2nd is implicated in various cytoplasmic organelles and cellular processes. Combined, these genetic components account for 20-30% of the genetic load. The remaining risk is conferred by distinct, disorder-specific variants. Our systematic comparative analysis of shared and unique genetic factors highlights key gene sets and molecular processes that may ultimately translate into improved diagnosis and treatment of these debilitating disorders.

  17. Neuroinformatic analyses of common and distinct genetic components associated with major neuropsychiatric disorders

    PubMed Central

    Lotan, Amit; Fenckova, Michaela; Bralten, Janita; Alttoa, Aet; Dixson, Luanna; Williams, Robert W.; van der Voet, Monique

    2014-01-01

    Major neuropsychiatric disorders are highly heritable, with mounting evidence suggesting that these disorders share overlapping sets of molecular and cellular underpinnings. In the current article we systematically test the degree of genetic commonality across six major neuropsychiatric disorders—attention deficit hyperactivity disorder (ADHD), anxiety disorders (Anx), autistic spectrum disorders (ASD), bipolar disorder (BD), major depressive disorder (MDD), and schizophrenia (SCZ). We curated a well-vetted list of genes based on large-scale human genetic studies based on the NHGRI catalog of published genome-wide association studies (GWAS). A total of 180 genes were accepted into the analysis on the basis of low but liberal GWAS p-values (<10−5). 22% of genes overlapped two or more disorders. The most widely shared subset of genes—common to five of six disorders–included ANK3, AS3MT, CACNA1C, CACNB2, CNNM2, CSMD1, DPCR1, ITIH3, NT5C2, PPP1R11, SYNE1, TCF4, TENM4, TRIM26, and ZNRD1. Using a suite of neuroinformatic resources, we showed that many of the shared genes are implicated in the postsynaptic density (PSD), expressed in immune tissues and co-expressed in developing human brain. Using a translational cross-species approach, we detected two distinct genetic components that were both shared by each of the six disorders; the 1st component is involved in CNS development, neural projections and synaptic transmission, while the 2nd is implicated in various cytoplasmic organelles and cellular processes. Combined, these genetic components account for 20–30% of the genetic load. The remaining risk is conferred by distinct, disorder-specific variants. Our systematic comparative analysis of shared and unique genetic factors highlights key gene sets and molecular processes that may ultimately translate into improved diagnosis and treatment of these debilitating disorders. PMID:25414627

  18. The Ovary of Tubifex tubifex (Clitellata, Naididae, Tubificinae) Is Composed of One, Huge Germ-Line Cyst that Is Enriched with Cytoskeletal Components.

    PubMed

    Urbisz, Anna Z; Chajec, Łukasz; Świątek, Piotr

    2015-01-01

    Recent studies on the ovary organization and oogenesis in Tubificinae have revealed that their ovaries are small polarized structures that are composed of germ cells in subsequent stages of oogenesis that are associated with somatic cells. In syncytial cysts, as a rule, each germ cell is connected to the central cytoplasmic mass, the cytophore, via only one stable intercellular bridge (ring canal). In this paper we present detailed data about the composition of germ-line cysts in Tubifex tubifex with special emphasis on the occurrence and distribution of the cytoskeletal elements. Using fixed material and live cell imaging techniques, we found that the entire ovary of T. tubifex is composed of only one, huge multicellular germ-line cyst, which may contain up to 2,600 cells. Its architecture is broadly similar to the cysts that are found in other clitellate annelids, i.e. a common, anuclear cytoplasmic mass in the center of the cyst and germ cells that are connected to it via intercellular bridges. The cytophore in the T. tubifex cyst extends along the long axis of the ovary in the form of elongated and branched cytoplasmic strands. Rhodamine-coupled phalloidin staining revealed that the prominent strands of actin filaments occur inside the cytophore. Similar to the cytophore, F-actin strands are branched and they are especially well developed in the middle and outermost parts of the ovary. Microfilaments are also present in the ring canals that connect the germ cells with the cytophore in the narrow end of the ovary. Using TubulinTracker, we found that the microtubules form a prominent network of loosely and evenly distributed tubules inside the cytophore as well as in every germ cell. The well-developed cytoskeletal elements in T. tubifex ovary seem to ensure the integrity of such a huge germ-line cyst of complex (germ cells-ring canals-cytophore) organization. A comparison between the cysts that are described here and other well-known female germ-line cysts is

  19. Specificity of the Receptor for the Major Sex Pheromone Component in Heliothis virescens

    PubMed Central

    Vásquez, Gissella M.; Syed, Zainulabeuddin; Estes, Patricia A.; Leal, Walter S.; Gould, Fred

    2013-01-01

    In a previous study, the Drosophila melanogaster OR67dGAL4;UAS system was used to functionally characterize the receptor for the major component of the sex pheromone in the tobacco budworm, Heliothis virescens Fabricius (Lepidoptera: Noctuidae), HvOR13. Electrophysiological and behavioral assays showed that transgenic flies expressing HvOR13 responded to (Z)-11-hexadecenal (Z11-16:Ald). However, tests were not performed to determine whether these flies would also respond to secondary components of the H. virescens sex pheromone. Thus, in this study the response spectrum of HvOR13 expressed in this system was examined by performing single cell recordings from odor receptor neuron in trichoid T1 sensilla on antennae of two Or67dGAL4 [1]; UAS-HvOR13 lines stimulated with Z11-16:Ald and six H. virescens secondary pheromone components. Fly courtship assays were also performed to examine the behavioral response of the Or67dGAL4[1]; UAS-HvOR13 flies to Z11-16:Ald and the secondary component Z9-14:Ald. Our combined electrophysiological and behavioral studies indicated high specificity and sensitivity of HvOR13 to Z11-16:Ald. Interestingly, a mutation leading to truncation in the HvOR13 C-terminal region affected but did not abolish pheromone receptor response to Z11-16:Ald. The findings are assessed in relationship to other HvOR13 heterologous expression studies, and the role of the C-terminal domain in receptor function is discussed. A third line expressing HvOR15 was also tested but did not respond to any of the seven pheromone components. PMID:24773407

  20. An Organic Dyad Composed of Diathiafulvalene-Functionalized Diketopyrrolopyrrole-Fullerene for Single-Component High-Efficiency Organic Solar Cells.

    PubMed

    Narayanaswamy, K; Venkateswararao, A; Nagarjuna, P; Bishnoi, Swati; Gupta, Vinay; Chand, Suresh; Singh, Surya Prakash

    2016-09-26

    A new low-band gap dyad DPP-Ful, which consists of covalently linked dithiafulvalene-functionalized diketopyrrolopyrrole as donor and fullerene (C60 ) as the acceptor, has been designed and synthesized. Organic solar cells were successfully constructed using the DPP-Ful dyad as an active layer. This system has a record power-conversion efficiency (PCE) of 2.2 %, which is the highest value when compared to reported single-component organic solar cells.

  1. Review of the phase equilibria and thermodynamics of binary and ternary systems composed of IFR fuel component metals (U, Pu, and Zr) and nitrogen

    SciTech Connect

    Leibowitz, L.; Veleckis, E.; Blomquist, R. A.

    1987-09-01

    Studies of the interactions of IFR fuel alloys with stainless steel cladding materials have shown evidence for segregation of metallic alloy components at the fuel-cladding interface. The phenomenon seems to be related to the availability of nitrogen and other reactive elements. For the interpretation of surface segregation results it will be necessary to establish (1) the composition of the phases formed in the ternary alloys under the action of nitrogen, (2) diffusion characteristics of various components in these phases and those of nitrogen itself, and (3) activity gradients established in the component metals providing driving forces for material migration. In this technical memorandum we present a literature survey and evaluation of the binary and ternary systems formed among uranium, plutonium, zirconium, and nitrogen. Both the phase diagram data and available thermodynamics are included. The following systems were surveyed: U-N, Pu-N, Zr-N, U-Pu, U-Zr, Pu-Zr, U-Pu-Zr, U-Pu-N, U-Zr-N, and Pu-Zr-N.

  2. Identification of H₂O₂ as a major antimicrobial component in coffee.

    PubMed

    Mueller, Ulla; Sauer, Tanja; Weigel, Ingrid; Pichner, Rohtraud; Pischetsrieder, Monika

    2011-05-01

    Coffee shows distinct antimicrobial activity against several bacterial genera. The present study investigated molecular mechanisms and active ingredients mediating the antimicrobial effect of coffee. Depending on concentration, roasted, but not raw coffee brew inhibited the growth of Escherichia coli and Listeria innocua. Several coffee ingredients with known antibacterial properties were tested for their contribution to the observed effect. In natural concentration, caffeine, ferulic acid and a mixture of all test compounds showed very weak, but significant activity, whereas trigonelline, 5-(hydroxymethyl)furfural, chlorogenic acid, nicotinic acid, caffeic acid, and methylglyoxal were not active. Antimicrobial activity, however, was completely abolished by addition of catalase indicating that H(2)O(2) is a major antimicrobial coffee component. In accordance with this assumption, bacterial counts during 16 h of incubation were inversely related to the H(2)O(2) concentration in the incubation solution. Pure H(2)O(2) showed slightly weaker activity. The H(2)O(2) dependent antimicrobial activity of coffee could be mimicked by a reaction mixture of d-ribose and l-lysine (30 min 120 °C) indicating that H(2)O(2) is generated in the coffee brew by Maillard reaction products. Identification of H(2)O(2) as major antimicrobial coffee component is important to evaluate the application of coffee or coffee extracts as natural preservatives.

  3. Molecular and immunological characterization of β'-component (Onc k 5), a major IgE-binding protein in chum salmon roe.

    PubMed

    Shimizu, Yutaka; Kishimura, Hideki; Kanno, Gaku; Nakamura, Atsushi; Adachi, Reiko; Akiyama, Hiroshi; Watanabe, Kazuhiko; Hara, Akihiko; Ebisawa, Motohiro; Saeki, Hiroki

    2014-03-01

    Salmon roe has a high allergic potency and often causes anaphylaxis in Japan. The major allergic protein of salmon roe is β'-component, which is a 35kDa vitellogenin fragment consisting of two subunits. To elucidate structural information and immunological characteristics, β'-component and the subunit components were purified from chum salmon (Onchorhincus keta) roe and vitellogenin-encoding mRNA was used to prepare β'-component subunit-encoding cDNA. This was PCR-amplified, cloned and sequenced and the deduced amino acid sequence compared with partial sequences of β'-component obtained by peptide mapping. The recombinant β'-component subunit was produced by bacterial expression in Escherichia coli and its IgE-binding ability was measured by ELISA using the sera of a patient allergic to salmon roe. This was then compared with that of the native β'-component with and without carboxymethylation. Following successful cloning of the cDNA encoding the β'-component subunit, 170 amino acid residues were deduced and matched with the amino acid sequences of 121 and 88 residues in the 16kDa and 18kDa subunits, respectively. The sequences of both β'-component subunits were almost identical, and the predicted secondary structure of the β'-component showed a high content of β-pleated sheets and no α-helices. There was no difference in IgE-binding ability between the native and recombinant β'-component subunits at the same protein concentration, regardless of carboxymethylation. In conclusion, β'-component is a homodimer protein composed of two isoform subunits having the same level of IgE-binding ability and, therefore, allergenic identity.

  4. Internal scatter, the unavoidable major component of the peripheral dose in photon-beam radiotherapy.

    PubMed

    Chofor, Ndimofor; Harder, Dietrich; Willborn, Kay C; Poppe, Björn

    2012-03-21

    In clinical photon beams, the dose outside the geometrical field limits is produced by photons originating from (i) head leakage, (ii) scattering at the beam collimators and the flattening filter (head scatter) and (iii) scattering from the directly irradiated region of the patient or phantom (internal scatter). While the first two components can be modified, e.g. by reinforcement of shielding components or by re-modeling the filter system, internal scatter remains an unavoidable contributor to the peripheral dose. Its relative magnitude compared to the other components, its numerical variation with beam energy, field size and off-axis distance as well as its spectral distribution are evaluated in this study. We applied a detailed Monte Carlo (MC) model of our 6/15 MV Siemens Primus linear accelerator beam head, provided with ideal head leakage shielding conditions (multi-leaf collimator without gaps) to assess the head scatter contribution. Experimental values obtained under real shielding conditions were used to evaluate the head leakage contribution. It was found that the MC-computed internal scatter doses agree with the results of our previous measurements, that internal scatter is the major contributor to the peripheral dose in the near periphery while head leakage prevails in the far periphery, and that the lateral decline of the internal scatter dose can be represented by the sum of two exponentials, with an asymptotic tenth value of 18 to 19 cm. Internal scatter peripheral doses from various elementary beams are additive, so that their sum increases approximately in proportion with field size. The ratio between normalized internal scatter doses at 6 and 15 MV is approximately 2:1. The energy fluence spectra of the internal scatter component at all points of interest outside the field have peaks near 500 keV. The fact that the energy-shifted internal scatter constitutes the major contributor to the dose in the near periphery has a general bearing for

  5. Internal scatter, the unavoidable major component of the peripheral dose in photon-beam radiotherapy

    NASA Astrophysics Data System (ADS)

    Chofor, Ndimofor; Harder, Dietrich; Willborn, Kay C.; Poppe, Björn

    2012-03-01

    In clinical photon beams, the dose outside the geometrical field limits is produced by photons originating from (i) head leakage, (ii) scattering at the beam collimators and the flattening filter (head scatter) and (iii) scattering from the directly irradiated region of the patient or phantom (internal scatter). While the first two components can be modified, e.g. by reinforcement of shielding components or by re-modeling the filter system, internal scatter remains an unavoidable contributor to the peripheral dose. Its relative magnitude compared to the other components, its numerical variation with beam energy, field size and off-axis distance as well as its spectral distribution are evaluated in this study. We applied a detailed Monte Carlo (MC) model of our 6/15 MV Siemens Primus linear accelerator beam head, provided with ideal head leakage shielding conditions (multi-leaf collimator without gaps) to assess the head scatter contribution. Experimental values obtained under real shielding conditions were used to evaluate the head leakage contribution. It was found that the MC-computed internal scatter doses agree with the results of our previous measurements, that internal scatter is the major contributor to the peripheral dose in the near periphery while head leakage prevails in the far periphery, and that the lateral decline of the internal scatter dose can be represented by the sum of two exponentials, with an asymptotic tenth value of 18 to 19 cm. Internal scatter peripheral doses from various elementary beams are additive, so that their sum increases approximately in proportion with field size. The ratio between normalized internal scatter doses at 6 and 15 MV is approximately 2:1. The energy fluence spectra of the internal scatter component at all points of interest outside the field have peaks near 500 keV. The fact that the energy-shifted internal scatter constitutes the major contributor to the dose in the near periphery has a general bearing for

  6. Constraining The Radiocarbon Distribution Within Major Components of Marine Dissolved Organic Carbon

    NASA Astrophysics Data System (ADS)

    Zigah, P.; Repeta, D.; McNichol, A. P.; Beaupre, S. R.; Xu, L.; Aluwihare, L.; Hemingway, J. D.

    2015-12-01

    Dissolved organic carbon (DOC) is one of the largest active carbon pools on Earth with a carbon inventory similar to that of the atmosphere. The sources and cycling of DOC in the ocean is not well-constrained. However, knowledge of the cycling and annual flux of carbon through DOC is critical to understanding the global carbon cycle and feedback mechanisms in the global climate system. Natural-abundance radiocarbon and stable carbon isotopic values can be used to infer the sources and cycling of DOC in the oceans. Past measurements for the most part have been made on bulk DOC, which represents an average of all DOC components. There is, however, good evidence that the actual range of values within the average is quite large, and recent serial oxidation measurements of the surface and deep ocean total DOC [1, 2, 3] reveal isotopic heterogeneity in the DOC pool with a radiocarbon-enriched modern component and a radiocarbon-depleted older component co-cycling in the surface ocean. Also, modeled data from the serial oxidation of the total DOC suggest the presence of a significant amount of modern DOC in the deep ocean [3]. In this study, we used a detailed size and chemical fractionation approach to examine the isotopic distribution within different size and molecular constituents of DOC. We also used a novel thermal serial oxidation approach to link the isotopic diversity of DOC to its concurrent major structural composition in order to build upon and refine the insights from the total DOC isotopic work. Our data show that, in the deep ocean, a major component of the heteropolysaccharide (HPS)-rich DOC isolated by ultrafiltration has radiocarbon value similar to co-occurring DIC indicating either a chemosynthetic source or conservative transport. In contrast, the fraction of DOC rich in the carboxylic -rich compounds isolated by solid phase extraction was much older than the DIC and also exhibit remarkable isotopic diversity in its constituent organic compounds. Our

  7. Possible electronic decay channels in the ionization spectra of small clusters composed of Ar and Kr: A four-component relativistic treatment

    NASA Astrophysics Data System (ADS)

    Pernpointner, Markus; Kryzhevoi, Nikolai V.; Urbaczek, Sascha

    2008-07-01

    In this work single and double ionization spectra of the homo- and heteronuclear argon/krypton dimers and trimers are calculated by means of propagator methods where a four-component implementation was employed for the single ionizations. Scalar relativistic effects play only a minor role for the outer valence spectral structure, whereas spin-orbit coupling and electron correlation have to be treated adequately in order to reproduce the features correctly. Nonradiative decay mechanisms of subvalence vacancies in the argon and krypton dimers and trimers are discussed both for the interatomic Coulombic decay and the electron transfer mediated decay (ETMD). In the heteronuclear triatomic system which serves as a model for larger clusters, a possible ETMD process of the Ar 3s vacancy is found for the linear arrangement of the atoms. In the bent configuration the ETMD channel is closed.

  8. Some Analysis of Major Impact of Geothermal Fluid Components in Power Plant Equipment

    NASA Astrophysics Data System (ADS)

    Buzăianu, A.; Csaki, I.; Moţoiu, P.; Leósson, K.; Serghiuţă, S.; Arnbjornsson, A.; Moţoiu, V.; Popescu, G.; Guðlaugsson, S.; Guðmundsson, D.

    2016-06-01

    This paper presents the results from a some analysis and major impact of geothermal fluid composition on the equipment in use in geothermal power plant. The structural analysis of material deposition improve the direct influenced of chemical composition of stem and waters included CaO, MgO, Al2O3 and SiO2 incorporated in the molten phase and the deposits in the scales formed due to equipment. The steam turbine corrosion damage, particularly of blades, discs and pomps, has long been recognized as a leading causes of reduced availability in the geothermal power plant. The corrosion process depends on temperature, pressure, chemisty and vaporous carryover by diversity of impurity. The experimental analysis procedure involves characterization of the fluid geothermal composition. Detailed information about surfaces morphological modification of the power plant components are obtained by electron microprobe analysis EDX and SEM investigation. References selection are obtaining by X-ray diffractometer patterns of the specimen.

  9. A procedure for evaluating residual life of major components in light water reactors

    SciTech Connect

    Uchida, S.; Fujimori, H.; Ibe, E.; Kuniya, J.; Hayashi, M.; Fuse, M.; Yamauchi, K.

    1995-12-31

    A computer program for evaluating residual life of major components in boiling water reactors is proposed. It divides the stress corrosion cracking process into two stages; a probabilistic crack generation stage and a deterministic crack propagation one. The minimum period of the crack generation stage is evaluated assuming an exponential distribution of the stage. The crack propagation rate is calculated by the slip-dissolution/film-rupture model. The neutron flux and fluence dependence of the neutron radiation effects on material properties was evaluated by using theoretical models of radiation damage. The computer program works on an engineering work station. Evaluated results are displayed as a map of the residual life, or as graphs of crack length evolution.

  10. Pharmacological activity of salvinorin A, the major component of Salvia divinorum.

    PubMed

    Listos, Joanna; Merska, Alicja; Fidecka, Sylwia

    2011-01-01

    The hallucinogenic plant Salvia divinorum (i.e., "magic mint") is a member of the Sage family that has been historically used for divination and shamanism by the Mazatecs. Today, S. divinorum has become increasingly popular as a recreational drug for its hallucinogenic effects. The non-nitrogenous diterpene, salvinorin A, the major active component of S. divinorum, is responsible for the hallucinogenic effect of this plant. Here, we described the behavioral effects of salvinorin A in animals including the addictive, antinociception and antidepressant properties of the drug. The present paper also demonstrates the not well recognized (or unclear) mechanisms of action of salvinorin A. The last part of the paper presents information about the legal status of S. divinorum and its derivatives. Taking into account the increasing popularity and consumption of salvinorin A and S. divinorum today, it is important to collect all data on the pharmacological profile of this plant and its products.

  11. Gentamicin B1 is a minor gentamicin component with major nonsense mutation suppression activity

    PubMed Central

    Baradaran-Heravi, Alireza; Niesser, Jürgen; Balgi, Aruna D.; Choi, Kunho; Zimmerman, Carla; South, Andrew P.; Anderson, Hilary J.; Strynadka, Natalie C.; Bally, Marcel B.; Roberge, Michel

    2017-01-01

    Nonsense mutations underlie about 10% of rare genetic disease cases. They introduce a premature termination codon (PTC) and prevent the formation of full-length protein. Pharmaceutical gentamicin, a mixture of several related aminoglycosides, is a frequently used antibiotic in humans that can induce PTC readthrough and suppress nonsense mutations at high concentrations. However, testing of gentamicin in clinical trials has shown that safe doses of this drug produce weak and variable readthrough activity that is insufficient for use as therapy. In this study we show that the major components of pharmaceutical gentamicin lack PTC readthrough activity but the minor component gentamicin B1 (B1) is a potent readthrough inducer. Molecular dynamics simulations reveal the importance of ring I of B1 in establishing a ribosome configuration that permits pairing of a near-cognate complex at a PTC. B1 induced readthrough at all three nonsense codons in cultured cancer cells with TP53 (tumor protein p53) mutations, in cells from patients with nonsense mutations in the TPP1 (tripeptidyl peptidase 1), DMD (dystrophin), SMARCAL1 (SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily a-like 1), and COL7A1 (collagen type VII alpha 1 chain) genes, and in an in vivo tumor xenograft model. The B1 content of pharmaceutical gentamicin is highly variable and major gentamicins suppress the PTC readthrough activity of B1. Purified B1 provides a consistent and effective source of PTC readthrough activity to study the potential of nonsense suppression for treatment of rare genetic disorders. PMID:28289221

  12. HLA is unlikely to be a major component of risk in familial inflammatory bowl disease

    SciTech Connect

    Mathew, C.G.; Naom, I.S.; Hodgson, S.V.

    1994-09-01

    Inflammatory bowel disease (IBD) is a chronic inflammation of the bowel which is confined to the colon in ulcerative colitis (UC) or may affect any part of the gastrointestinal tract in Crohn`s disease (CD). The cause of IBD is unknown, but a genetic component is suggested by a 10-fold increase in risk to first degree relatives, and a higher concordance of disease in MZ versus DZ twins. Distinct associations of HLA DR2 with UC and DR1/DQw5 with CD have been reported. We are searching for susceptibility genes in IBD by linkage analysis in a panel of 43 families with 3 or more living affected members, which includes 12 families with CD, 17 with UC and 14 {open_quotes}mixed{close_quotes} families with UC and CD. In view of the reported HLA associations in IBD, we have analyzed 5 microsatellite markers from the major histocompatibility complex for linkage to IBD using both parametric and nonparametric methods. LOD scores were calculated for 4 different genetic models, including both dominant and recessive inheritance, and haplotype sharing was analyzed in affected siblings. LOD scores for the MHC locus were negative in the full data set, and in the 3 classes of family (UC,CD,mixed). Haplotype sharing in affected sibs was very close to that expected if no linkage was present. We conclude that genes from the HLA region are unlikely to be a major component of risk in familial IBD. Linkage analysis of genes which cause chronic colitis when disrupted in transgenic mice is in progress.

  13. Determination of major components and fingerprint analysis of Flaveria bidentis (L.) Kuntze.

    PubMed

    Xie, Qianqian; Ding, Liping; Wei, Yun; Ito, Yoichiro

    2014-03-01

    A sensitive high-performance liquid chromatography method coupled with photodiode array detection was developed for the simultaneous determination of six major constituents in Flaveria bidentis (L.) Kuntze: hyperoside, patuletin-3-O-glucoside, isorhamnetin 3-sulfate, astragalin, 6-methoxykaempferol-3-O-galactoside and α-terthienyl. The chemical fingerprint of Flaveria bidentis (L.) Kuntze leaves was established using raw materials of 12 batches in China. The chromatographic separations were obtained by using an Eclipse XDB-C18 reserved-phase column (150 × 4.6 mm i.d., 5 µm) using gradient elution with water (0.0125% trifluoroacetic acid, v/v) and acetonitrile at a flow rate of 1.0 mL/min, an operating temperature of 30°C and a detection wavelength of 360 nm. The new method was validated by linearity, limits of detection and quantification, precision, reproducibility, stability and recovery, and was also successfully applied to the simultaneous determination of components in Flaveria bidentis (L.) Kuntze. The results indicate that this multi-component determination method in combination with chromatographic fingerprint analysis is suitable for the quantitative analysis and identification of Flaveria bidentis (L.) Kuntze.

  14. Identification of hydrogen peroxide as a major cytotoxic component in Maillard reaction mixtures and coffee.

    PubMed

    Hegele, Jörg; Münch, Gerald; Pischetsrieder, Monika

    2009-06-01

    The cytotoxic activity of Maillard reaction products and coffee was studied using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay and the neutral red uptake (NRU) assay. Equimolar mixtures of sugars and lysine were heated at 120 degrees C and used to stimulate bovine aorta endothelial cells for 24 h. The cytotoxic activity increased with increase in educt concentration and heating time. Mixtures containing ribose were most active, followed by lactose and glucose. Hydrogen peroxide, which was present in the Maillard mixtures in concentrations between 7 and 87 microM, was identified as one of their major cytotoxic components. H2O2-concentrations increased further up to 130 microM under cell culture conditions. Filter coffee, espresso, and green coffee extract reduced cell viability significantly to 10, 19, and 83% of PBS-treated control. The effect was largely attenuated by the addition of catalase. Nil, 33, and 41 microM H2O2 was measured in green coffee extract, filter coffee, and espresso, respectively, increasing to 13, 369, and 333 microM during cell culture conditions. No additional H2O2 formation was detected when coffee was incubated for up to 5 h without further treatment. In conclusion, hydrogen peroxide is a major product in Maillard mixtures and coffee inducing cell death in vitro.

  15. Preparing Students to Compose on a Computer.

    ERIC Educational Resources Information Center

    Gadomski, Kenneth E.

    In the proliferation of articles about using computers in the composition classroom published in the last five or ten years, few mention anything about preparing students to compose on a computer while all assert that computers do indeed help the composing process. Preparing students to compose on a computer involves three major processes:…

  16. Crystal structure of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

    PubMed

    Jin, Tengchuan; Albillos, Silvia M; Guo, Feng; Howard, Andrew; Fu, Tong-Jen; Kothary, Mahendra H; Zhang, Yu-Zhu

    2009-09-23

    Seed storage proteins are accumulated during seed development and act as a reserve of nutrition for seed germination and young sprout growth. Plant seeds play an important role in human nutrition by providing a relatively inexpensive source of protein. However, many plant foods contain allergenic proteins, and the number of people suffering from food allergies has increased rapidly in recent years. The 11S globulins are the most widespread seed storage proteins, present in monocotyledonous and dicotyledonous seeds as well as in gymnosperms (conifers) and other spermatophytes. This family of proteins accounts for a number of known major food allergens. They are of interest to both the public and industry due to food safety concerns. Because of the interests in the structural basis of the allergenicity of food allergens, we sought to determine the crystal structure of Pru1, the major component of the 11 S storage protein from almonds. The structure was refined to 2.4 A, and the R/Rfree for the final refined structure is 17.2/22.9. Pru1 is a hexamer made of two trimers. Most of the back-to-back trimer-trimer association was contributed by monomer-monomer interactions. An alpha helix (helix 6) at the C-terminal end of the acidic domain of one of the interacting monomers lies at the cleft of the two protomers. The residues in this helix correspond to a flexible region in the peanut allergen Ara h 3 that encompasses a previously defined linear IgE epitope.

  17. Effects of Psoraleae fructus and its major component psoralen on Th2 response in allergic asthma.

    PubMed

    Jin, Hualiang; Wang, Limin; Xu, Changqing; Li, Bei; Luo, Qingli; Wu, Jinfeng; Lv, Yubao; Wang, Genfa; Dong, Jingcheng

    2014-01-01

    This study is aimed to evaluate the effects of Psoraleae fructus (PF) on Th2 responses in a rat model of asthma in vivo and psoralen, a major constituent in PF, on Th2 responses in vitro. A rat model of asthma was established by sensitization and challenged with ovalbumin (OVA). Airway hyperresponsiveness was detected by direct airway resistance analysis. Lung tissues were examined for cell infiltration and mucus hypersecretion. Bronchoalveolar lavage fluid (BALF) was assessed for cytokine levels. In vitro study, Th2 cytokine production was evaluated in the culture supernatant of D10.G4.1 (D10 cells) followed by the determination of cell viability, meanwhile Th2 transcription factor GATA-3 expression in D10 cells was also determined. The oral administration of PF significantly reduced airway hyperresponsiveness (AHR) to aerosolized methacholine and decreased IL-4 and IL-13 levels in the BALF. Histological studies showed that PF markedly inhibited inflammatory infiltration and mucus secretion in the lung tissues. In vitro study, psoralen significantly suppressed Th2 cytokines of IL-4, IL-5 and IL-13 by ConA-stimulated D10 cells without inhibitory effect on cell viability. Furthermore, GATA-3 protein expression was also markedly reduced by psoralen. This study demonstrated that PF exhibited inhibitory effects on hyperresponsiveness and airway inflammation in a rat model of asthma, which was associated with the suppression of Th2 response. Psoralen, a major constituent of PF, has immunomodulatory properties on Th2 response in vitro, which indicated that psoralen might be a critical component of PF for its therapeutic effects.

  18. Crystal Structure of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

    SciTech Connect

    Jin, Tengchuan; Albillos, Silvia M.; Guo, Feng; Howard, Andrew; Fu, Tong-Jen; Kothary, Mahendra H.; Zhang, Yu-Zhu

    2010-10-28

    Seed storage proteins are accumulated during seed development and act as a reserve of nutrition for seed germination and young sprout growth. Plant seeds play an important role in human nutrition by providing a relatively inexpensive source of protein. However, many plant foods contain allergenic proteins, and the number of people suffering from food allergies has increased rapidly in recent years. The 11S globulins are the most widespread seed storage proteins, present in monocotyledonous and dicotyledonous seeds as well as in gymnosperms (conifers) and other spermatophytes. This family of proteins accounts for a number of known major food allergens. They are of interest to both the public and industry due to food safety concerns. Because of the interests in the structural basis of the allergenicity of food allergens, we sought to determine the crystal structure of Pru1, the major component of the 11 S storage protein from almonds. The structure was refined to 2.4 {angstrom}, and the R/Rfree for the final refined structure is 17.2/22.9. Pru1 is a hexamer made of two trimers. Most of the back-to-back trimer-trimer association was contributed by monomer-monomer interactions. An {alpha} helix (helix 6) at the C-terminal end of the acidic domain of one of the interacting monomers lies at the cleft of the two protomers. The residues in this helix correspond to a flexible region in the peanut allergen Ara h 3 that encompasses a previously defined linear IgE epitope.

  19. Brush-border calmodulin. A major component of the isolated microvillus core

    PubMed Central

    1980-01-01

    Calmodulin is present in brush borders isolated from intestinal epithelial cells and is one of the major components of the microvillar filament bundle. Calmodulin was purified from either demembranated brush borders or microvilli by a simple boiling procedure. The boiled supernate derived from the microvillus cores contained one major polypeptide of 20,000 daltons.The supernate from the brush-border preparation contained the 20,000-dalton subunit and a second protein of 30,000 daltons. The 20,000-dalton subunit has been identified as calmodulin by several criteria: (a) heat resistance, (b) comigration with brain calmodulin on alkaline urea gels and SDS gels, both cases in which the 20,000-dalton protein, like calmodulin, exhibits a shift in electrophoretic mobility in the presence of Ca++, and (c) 4--5-fold activation of 3',5'-cyclic nucleotide phosphodiesterase in the presence but not the absence of Ca++. With a cosedimentation assay it was determined that brush-border calmodulin does not bind directly to actin. In the presence of Ca++ (greater than 5 x 10(-7) M) there was a partial release of calmodulin from the microvillus core, along with a substantial conversion of microvillus actin into a nonpelletable from. The dissociation of calmodulin was reversed by removal of Ca++. If microvillus cores were pretreated with phalloidin, the Ca++-induced solubilization of actin was prevented, but the partial dissociation of calmodulin still occurred. The molar ratio of calmodulin:actin is 1:10 in the demembranated brush border and 1:2-3 in the microvillus core. No calmodulin was detected in the detergent-solubilized brush-border membrane fraction. PMID:6893051

  20. Effect of cold storage and packaging material on the major aroma components of sweet cream butter.

    PubMed

    Lozano, Patricio R; Miracle, Evan R; Krause, Andrea J; Drake, Maryanne; Cadwallader, Keith R

    2007-09-19

    The major aroma compounds of commercial sweet cream AA butter quarters were analyzed by GC-olfactometry and GC-MS combined with dynamic headspace analysis (DHA) and solvent-assisted flavor evaporation (SAFE). In addition, the effect of long-term storage (0, 6, and 12 months) and type of wrapping material (wax parchment paper vs foil) on the aroma components and sensory properties of these butters kept under refrigerated (4 degrees C) and frozen (-20 degrees C) storage was evaluated. The most intense compounds in the aroma of pasteurized AA butter were butanoic acid, delta-octalactone, delta-decalactone, 1-octen-3-one, 2-acetyl-1-pyrroline, dimethyl trisulfide, and diacetyl. The intensities of lipid oxidation volatiles and methyl ketones increased as a function of storage time. Refrigerated storage caused greater flavor deterioration compared with frozen storage. The intensity and relative abundance of styrene increased as a function of time of storage at refrigeration temperature. Butter kept frozen for 12 months exhibited lower styrene levels and a flavor profile more similar to that of fresh butter compared to butter refrigerated for 12 months. Foil wrapping material performed better than wax parchment paper in preventing styrene migration into butter and in minimizing the formation of lipid oxidation and hydroxyl acid products that contribute to the loss of fresh butter flavor.

  1. Identification of transcalciferin as a major component of human parotid saliva by crossed immunoelectrophoretic mapping.

    PubMed

    Joneja, J M; Greenstein, P M; Revis, G J; Crowle, A J

    1982-01-01

    Human parotid saliva collected from Stenson's duct during sour candy-stimulated salivation was studied by crossed immunoelectrophoresis (X-IEP). Eleven antigens were identified in a pool of salivas from 10 adult, caucasoid males and females. Four were related to serum antigens, three being previously known: IgG, IgA and albumin. The fourth was identified as Gc globulin, also known by function as transcalciferin. Salivary Gc is electrophoretically different from serum Gc, migrating as an alpha 2-beta component rather than as an alpha 1 globulin. The quantities of 8 of the 11 antigens detected by X-IEP were compared for salivas from 10 subjects. These quantities and their ratios to each other were highly variable, indicating idiosyncratic secretory patterns. Only quantities of amylase were moderately consistent from donor to donor. Quantitatively, Gc is a major antigen in parotid saliva. Large proportions of a salivary antigen, alpha 1c, were found in two of the 10 subjects--adult males who never had developed caries. Among the other 8 subjects, all with caries, proportions of alpha 1c were much lower, and 2 subjects lacked it. None of the other antigens measured showed any correlation with caries resistance. The nature and function of alpha 1c are unknown.

  2. Biogenic non-crystalline U(IV) revealed as major component in uranium ore deposits

    NASA Astrophysics Data System (ADS)

    Bhattacharyya, Amrita; Campbell, Kate M.; Kelly, Shelly D.; Roebbert, Yvonne; Weyer, Stefan; Bernier-Latmani, Rizlan; Borch, Thomas

    2017-06-01

    Historically, it is believed that crystalline uraninite, produced via the abiotic reduction of hexavalent uranium (U(VI)) is the dominant reduced U species formed in low-temperature uranium roll-front ore deposits. Here we show that non-crystalline U(IV) generated through biologically mediated U(VI) reduction is the predominant U(IV) species in an undisturbed U roll-front ore deposit in Wyoming, USA. Characterization of U species revealed that the majority (~58-89%) of U is bound as U(IV) to C-containing organic functional groups or inorganic carbonate, while uraninite and U(VI) represent only minor components. The uranium deposit exhibited mostly 238U-enriched isotope signatures, consistent with largely biotic reduction of U(VI) to U(IV). This finding implies that biogenic processes are more important to uranium ore genesis than previously understood. The predominance of a relatively labile form of U(IV) also provides an opportunity for a more economical and environmentally benign mining process, as well as the design of more effective post-mining restoration strategies and human health-risk assessment.

  3. Biogenic non-crystalline U(IV) revealed as major component in uranium ore deposits

    DOE PAGES

    Bhattacharyya, Amrita; Campbell, Kate M.; Kelly, Shelly D.; ...

    2017-06-01

    Historically, it is believed that crystalline uraninite, produced via the abiotic reduction of hexavalent uranium (U(VI)) is the dominant reduced U species formed in low-temperature uranium roll-front ore deposits. Here we show that non-crystalline U(IV) generated through biologically mediated U(VI) reduction is the predominant U(IV) species in an undisturbed U roll-front ore deposit in Wyoming, USA. Characterization of U species revealed that the majority (~58-89%) of U is bound as U(IV) to C-containing organic functional groups or inorganic carbonate, while uraninite and U(VI) represent only minor components. The uranium deposit exhibited mostly 238U-enriched isotope signatures, consistent with largely biotic reductionmore » of U(VI) to U(IV). This finding implies that biogenic processes are more important to uranium ore genesis than previously understood. The predominance of a relatively labile form of U(IV) also provides an opportunity for a more economical and environmentally benign mining process, as well as the design of more effective post-mining restoration strategies and human health-risk assessment.« less

  4. d-Alanylcardiolipin, a Major Component of the Unique Lipid Pattern of Vagococcus fluvialis

    PubMed Central

    Fischer, Werner; Arneth-Seifert, Doris

    1998-01-01

    Motile group N streptococci, classified as Vagococcus fluvialis, have been isolated from cows’ udders, human and animal feces, river water, and seawater. They possess an unusual membrane lipid and fatty acid pattern. We isolated and characterized 13 polar lipids, 8 of them also found in other gram-positive bacteria: mono- and dihexosyldiacylglycerol, an acylated and a glycerophosphate-substituted derivative of the latter, cardiolipin, phosphatidylglycerol, d-alanylphosphatidylglycerol, and l-lysylphosphatidylglycerol. Besides them, we characterized two rare compounds, bis(acylglycero)phosphate and α-d-glucopyranosylcardiolipin, and two compounds so far not detected in nature, d-alanylbis(acylglycero)phosphate and d-alanylcardiolipin. The concomitant occurrence of four aminoacyl phospholipids in one organism is another unique finding. Substituted cardiolipins represent a novel lipid class: in vagococci, d-alanylcardiolipin is a major membrane lipid component, contributing 11 and 26 mol% of total lipids in the exponential and stationary phases of growth, respectively. The vagococcal lipids contain even-numbered straight-chain saturated and cis-monounsaturated fatty acids, but the cis-monoenic acids belong to the ω-9 series and not the ω-7 series, found in enterococci, lactococci, and streptococci. PMID:9603887

  5. Biogenic non-crystalline U(IV) revealed as major component in uranium ore deposits

    PubMed Central

    Bhattacharyya, Amrita; Campbell, Kate M.; Kelly, Shelly D.; Roebbert, Yvonne; Weyer, Stefan; Bernier-Latmani, Rizlan; Borch, Thomas

    2017-01-01

    Historically, it is believed that crystalline uraninite, produced via the abiotic reduction of hexavalent uranium (U(VI)) is the dominant reduced U species formed in low-temperature uranium roll-front ore deposits. Here we show that non-crystalline U(IV) generated through biologically mediated U(VI) reduction is the predominant U(IV) species in an undisturbed U roll-front ore deposit in Wyoming, USA. Characterization of U species revealed that the majority (∼58-89%) of U is bound as U(IV) to C-containing organic functional groups or inorganic carbonate, while uraninite and U(VI) represent only minor components. The uranium deposit exhibited mostly 238U-enriched isotope signatures, consistent with largely biotic reduction of U(VI) to U(IV). This finding implies that biogenic processes are more important to uranium ore genesis than previously understood. The predominance of a relatively labile form of U(IV) also provides an opportunity for a more economical and environmentally benign mining process, as well as the design of more effective post-mining restoration strategies and human health-risk assessment. PMID:28569759

  6. Sintered spherical pellets containing clay as a major component useful for gas and oil well proppants

    SciTech Connect

    Fitzgibbon, J.J.

    1992-03-24

    This patent describes a method for increasing permeability in a subterranean formation penetrated by a well wherein a fluid is pumped into the well to create a fracture in the subterranean formation. This patent describes improvement in introducing into a fluid composite, spherical, sintered pellets comprised of a combination of clay and a member of the group of bauxite, alumina, or mixtures thereof, the pellets containing on a dry weight basis a major portion of clay, the pellets having an apparent specific gravity of less than 3.40 and having a titanium dioxide content of at least 2.68 weight percent derived from the bauxite and clay and having components other than Al{sub 2}O{sub 3}, SiO{sub 2}, Fe{sub 2} and TiO{sub 2} in an amount no greater than 2.50 weight percent; introducing the pellet-containing fluid into a fracture, the compaction pressure of which is between about 280 and about 700 Kg/cm{sup 2} (4,000 and about 100,000 psi), to deposit a propping distribution of the pellets, the pellets having an average particle size between 0.1 and 2.5 millimeters.

  7. Changes in major components of tea fungus metabolites during prolonged fermentation.

    PubMed

    Chen, C; Liu, B Y

    2000-11-01

    Changes in major components and microbes in tea fungus broth (or kombucha; teakwass) prepared from nine different sources during a prolonged fermentation of up to 60 days were investigated. Cell concentrations of both yeasts and acetic acid bacteria in broth were generally higher than those in the cellulosic pellicles. The residual sucrose concentration decreased linearly with time, although the rate fell after the first month. Metabolic fates of glucose and fructose produced as a result of the hydrolysis of sucrose were different. Glucose was not produced in parallel with fructose (0.085 g 100 ml(-1) d(-1)) but was produced with a lower initial rate (0.041 g 100 ml(-1) d(-1)). Both titratable acidity and gluconic acid increased steadily with time for all samples, although gluconic acid was not generated for 6 days until the fermentation had begun. Acetic acid increased slowly to a maximum value of 1.1 g 100 ml(-1) after 30 days; thereafter, it decreased gradually. Gluconic acid contributed to the titratable acidity and thus, the taste of tea fungus broth, during the final stage of fermentation. It is concluded that the desired quality or composition of kombucha can be obtained through the proper control of fermentation time.

  8. Tenascin-C Is a Major Component of the Fibrogenic Niche in Kidney Fibrosis.

    PubMed

    Fu, Haiyan; Tian, Yuan; Zhou, Lili; Zhou, Dong; Tan, Roderick J; Stolz, Donna B; Liu, Youhua

    2017-03-01

    Kidney fibrosis initiates at certain focal sites in which the fibrogenic niche provides a specialized microenvironment that facilitates fibroblast activation and proliferation. However, the molecular identity of these fibrogenic niches is poorly characterized. Here, we determined whether tenascin-C (TNC), an extracellular matrix glycoprotein, is a component of the fibrogenic niche in kidney fibrosis. In vivo, TNC expression increased rapidly in kidneys subjected to unilateral ureteral obstruction or ischemia/reperfusion injury and predominantly localized at the foci rich in fibroblasts in renal interstitium. In vitro, TNC selectively promoted renal interstitial fibroblast proliferation, bromodeoxyuridine incorporation, and the expression of proliferation-related genes. The mitogenic activity of TNC required the integrin/focal adhesion kinase/mitogen-activated protein kinase signaling cascade. Using decellularized extracellular matrix scaffolds, we found that TNC-enriched scaffolds facilitated fibroblast proliferation, whereas TNC-deprived scaffolds inhibited proliferation. Matrix scaffold prepared from fibrotic kidney also promoted greater ex vivo fibroblast proliferation than did scaffolds prepared from healthy kidney. Conversely, small interfering RNA-mediated knockdown of TNC in vivo repressed injury-induced fibroblast expansion and renal fibrosis. These studies identify TNC as a major constituent of the fibrogenic niche that promotes fibroblast proliferation, and illustrate a pivotal role for the TNC-enriched microenvironment in kidney fibrogenesis. Copyright © 2017 by the American Society of Nephrology.

  9. Pharmacokinetics of Compound D, the Major Bioactive Component of Zingiber cassumunar, in Rats.

    PubMed

    Khemawoot, Phisit; Hunsakunachai, Natthaphon; Anukunwithaya, Tosapol; Bangphumi, Kunan; Ongpipattanakul, Boonsri; Jiratchariyakul, Weena; Soawakontha, Ruedee; Inthachart, Thanakorn; Dechatiwongse Na Ayudhya, Thaweephol; Koontongkaew, Sittichai; Poachanukoon, Orapan

    2016-08-01

    Rhizomes of Zingiber cassumunar have been used for many years in traditional Thai medicine as an anti-inflammatory agent. The major bioactive component of this plant is Compound D [E-4-(3', 4'-dimethoxyphenyl)but-3-en-1-ol], which is a strong smooth muscle relaxant, and has antihistamine and anti-inflammatory actions. There is, however, incomplete information available for the pharmacokinetics of Compound D in mammals. In this study, we examined the pharmacokinetic profiles of Compound D in male Wistar rats. A standardized extract of Z. cassumunar containing 4 % w/w Compound D was administered intravenously at 25 mg/kg or by oral gavage at 25, 75, or 250 mg/kg to Wistar rats. Blood, tissues, urine, and feces were collected from 0 to 48 h after dosing and the level of Compound D was determined by liquid chromatography-tandem mass spectrometry. The concentration of Compound D ranged from 10-100 µg/L, reached a maximum approximately 0.15 h after oral dosing. Compound D exhibited an excellent tissue to plasma ratio, ranging from 1- to 1000 in several organs at 1-4 h after oral dosing. Less than 1 % of unchanged Compound D was excreted in the urine and feces. Further studies on tissue uptake and metabolite identification are required to obtain complete pharmacokinetic information and to develop appropriate dosing strategies of Compound D and the standardized extract of Z. cassumunar.

  10. Class I major histocompatibility proteins are an essential component of the simian virus 40 receptor.

    PubMed Central

    Breau, W C; Atwood, W J; Norkin, L C

    1992-01-01

    The class I molecules encoded by the major histocompatibility complex (MHC) present endogenously synthesized antigenic peptide fragments to cytotoxic T lymphocytes. We show here that these proteins are an essential component of the cell surface receptor for simian virus 40 (SV40). First, SV40 binding to cells can be blocked by two monoclonal antibodies against class I human lymphocyte antigen (HLA) proteins but not by monoclonal antibodies specific for other cell surface proteins. Second, SV40 does not bind to cells of two different human lymphoblastoid cell lines which do not express surface class I MHC proteins because of genetic defects in the beta 2-microglobulin gene in one line and in the HLA complex in the other. Transfection of these cell lines with cloned genes for beta 2-microglobulin and HLA-B8, respectively, restored expression of their surface class I MHC proteins and resulted in concomitant SV40 binding. Finally, SV40 binds to purified HLA proteins in vitro and selectively binds to class I MHC proteins in a cell surface extract. Images PMID:1312619

  11. Rubber elongation factor (REF), a major allergen component in Hevea brasiliensis latex has amyloid properties.

    PubMed

    Berthelot, Karine; Lecomte, Sophie; Estevez, Yannick; Coulary-Salin, Bénédicte; Bentaleb, Ahmed; Cullin, Christophe; Deffieux, Alain; Peruch, Frédéric

    2012-01-01

    REF (Hevb1) and SRPP (Hevb3) are two major components of Hevea brasiliensis latex, well known for their allergenic properties. They are obviously taking part in the biosynthesis of natural rubber, but their exact function is still unclear. They could be involved in defense/stress mechanisms after tapping or directly acting on the isoprenoid biosynthetic pathway. The structure of these two proteins is still not described. In this work, it was discovered that REF has amyloid properties, contrary to SRPP. We investigated their structure by CD, TEM, ATR-FTIR and WAXS and neatly showed the presence of β-sheet organized aggregates for REF, whereas SRPP mainly fold as a helical protein. Both proteins are highly hydrophobic but differ in their interaction with lipid monolayers used to mimic the monomembrane surrounding the rubber particles. Ellipsometry experiments showed that REF seems to penetrate deeply into the monolayer and SRPP only binds to the lipid surface. These results could therefore clarify the role of these two paralogous proteins in latex production, either in the coagulation of natural rubber or in stress-related responses. To our knowledge, this is the first report of an amyloid formed from a plant protein. This suggests also the presence of functional amyloid in the plant kingdom.

  12. Biogenic non-crystalline U(IV) revealed as major component in uranium ore deposits

    USGS Publications Warehouse

    Bhattacharyya, Amrita; Campbell, Kate M.; Kelly, Shelly; Roebbert, Yvonne; Weyer, Stefan; Bernier-Latmani, Rizlan; Borch, Thomas

    2017-01-01

    Historically, it is believed that crystalline uraninite, produced via the abiotic reduction of hexavalent uranium (U(VI)) is the dominant reduced U species formed in low-temperature uranium roll-front ore deposits. Here we show that non-crystalline U(IV) generated through biologically mediated U(VI) reduction is the predominant U(IV) species in an undisturbed U roll-front ore deposit in Wyoming, USA. Characterization of U species revealed that the majority (∼58-89%) of U is bound as U(IV)to C-containing organic functional groups or inorganic carbonate, while uraninite and U(VI) represent only minor components. The uranium deposit exhibited mostly 238U-enriched isotope signatures, consistent with largely biotic reduction of U(VI) to U(IV). This finding implies that biogenic processes are more important to uranium ore genesis than previously understood. The predominance of a relatively labile form of U(IV) also provides an opportunity for a more economical and environmentally benign mining process, as well as the design of more effective post-mining restoration strategies and human health-risk assessment.

  13. Hydrogeochemistry of the Fraser River, British Columbia: seasonal variation in major and minor components

    NASA Astrophysics Data System (ADS)

    Cameron, Eion M.

    1996-07-01

    For several years Environment Canada (EC) has carried out a program of water sampling at four stations along the Fraser River and at one station on each of its two principal tributaries, the Thompson and the Nechako. Samples collected at bi-weekly intervals have been analyzed by EC for major and some trace components. Seasonal variation in water composition mainly relates to changes in discharge, this being low during winter and high during early summer snowmelt. Dissolved constituents, Mg, Si, K, Ca, Sr, HCO 3, SO 4 and (NO 3 + NO 2), show moderate variation, being least concentrated during maximum discharge, reflecting dilution of groundwater by melting snow. Factor analysis shows secondary seasonal variation for SO 4, that is related to the importance of deep groundwater as a source, and for (NO 3 + NO 2), precipitated with snow and released during snowmelt. Large amounts of Na and Cl are added in pulp mill effluent. A uniform flux of this effluent, superimposed on a highly variable river discharge, gives rise to greater seasonal variation for Na and Cl than other dissolved constituents. The trace constituents, Fe, Mn, Al, P and Sr, were analyzed by EC in unfiltered water samples by methods that extract the elements from suspended material. Except for Sr, these elements have a high partition factor in favor of suspended over dissolved phases; their results reflect seasonal changes in quantities of suspended material, which can vary by two orders of magnitude.

  14. Rubber Elongation Factor (REF), a Major Allergen Component in Hevea brasiliensis Latex Has Amyloid Properties

    PubMed Central

    Berthelot, Karine; Lecomte, Sophie; Estevez, Yannick; Coulary-Salin, Bénédicte; Bentaleb, Ahmed; Cullin, Christophe; Deffieux, Alain; Peruch, Frédéric

    2012-01-01

    REF (Hevb1) and SRPP (Hevb3) are two major components of Hevea brasiliensis latex, well known for their allergenic properties. They are obviously taking part in the biosynthesis of natural rubber, but their exact function is still unclear. They could be involved in defense/stress mechanisms after tapping or directly acting on the isoprenoid biosynthetic pathway. The structure of these two proteins is still not described. In this work, it was discovered that REF has amyloid properties, contrary to SRPP. We investigated their structure by CD, TEM, ATR-FTIR and WAXS and neatly showed the presence of β-sheet organized aggregates for REF, whereas SRPP mainly fold as a helical protein. Both proteins are highly hydrophobic but differ in their interaction with lipid monolayers used to mimic the monomembrane surrounding the rubber particles. Ellipsometry experiments showed that REF seems to penetrate deeply into the monolayer and SRPP only binds to the lipid surface. These results could therefore clarify the role of these two paralogous proteins in latex production, either in the coagulation of natural rubber or in stress-related responses. To our knowledge, this is the first report of an amyloid formed from a plant protein. This suggests also the presence of functional amyloid in the plant kingdom. PMID:23133547

  15. Composing in Public

    ERIC Educational Resources Information Center

    Heintz, Anne

    2011-01-01

    The central premise of this project is that researching student communication and composing actions in light of audience will illuminate particular features of student composing processes in 21st century interdisciplinary contexts. Students in this study took part in a six week inquiry unit about their local area. Data generated included student…

  16. Measuring the Success of Acquisition Reform by Major DoD Components

    DTIC Science & Technology

    2015-04-30

    Have the DoD components increased their rates of effective competition since the introduction of BBP in 2010? How successful have the components...the DoD components increased their rates of effective competition since the introduction of BBP in 2010? How successful have the components been at...dollars unless specifically noted otherwise. See http://csis.org/program/methodology for the full methodology. Competition The study team followed

  17. Recombinant Sox Enzymes from Paracoccus pantotrophus Degrade Hydrogen Sulfide, a Major Component of Oral Malodor

    PubMed Central

    Ramadhani, Atik; Kawada-Matsuo, Miki; Komatsuzawa, Hitoshi; Oho, Takahiko

    2017-01-01

    Hydrogen sulfide (H2S) is emitted from industrial activities, and several chemotrophs possessing Sox enzymes are used for its removal. Oral malodor is a common issue in the dental field and major malodorous components are volatile sulfur compounds (VSCs), including H2S and methyl mercaptan. Paracoccus pantotrophus is an aerobic, neutrophilic facultatively autotrophic bacterium that possesses sulfur-oxidizing (Sox) enzymes in order to use sulfur compounds as an energy source. In the present study, we cloned the Sox enzymes of P. pantotrophus GB17 and evaluated their VSC-degrading activities for the prevention of oral malodor. Six genes, soxX, soxY, soxZ, soxA, soxB, and soxCD, were amplified from P. pantotrophus GB17. Each fragment was cloned into a vector for the expression of 6×His-tagged fusion proteins in Escherichia coli. Recombinant Sox (rSox) proteins were purified from whole-cell extracts of E. coli using nickel affinity chromatography. The enzyme mixture was investigated for the degradation of VSCs using gas chromatography. Each of the rSox enzymes was purified to apparent homogeneity, as confirmed by SDS-PAGE. The rSox enzyme mixture degraded H2S in dose- and time-dependent manners. All rSox enzymes were necessary for degrading H2S. The H2S-degrading activities of rSox enzymes were stable at 25–80°C, and the optimum pH was 7.0. The amount of H2S produced by periodontopathic bacteria or oral bacteria collected from human subjects decreased after an incubation with rSox enzymes. These results suggest that the combination of rSox enzymes from P. pantotrophus GB17 is useful for the prevention of oral malodor. PMID:28260736

  18. Recombinant Sox Enzymes from Paracoccus pantotrophus Degrade Hydrogen Sulfide, a Major Component of Oral Malodor.

    PubMed

    Ramadhani, Atik; Kawada-Matsuo, Miki; Komatsuzawa, Hitoshi; Oho, Takahiko

    2017-03-31

    Hydrogen sulfide (H2S) is emitted from industrial activities, and several chemotrophs possessing Sox enzymes are used for its removal. Oral malodor is a common issue in the dental field and major malodorous components are volatile sulfur compounds (VSCs), including H2S and methyl mercaptan. Paracoccus pantotrophus is an aerobic, neutrophilic facultatively autotrophic bacterium that possesses sulfur-oxidizing (Sox) enzymes in order to use sulfur compounds as an energy source. In the present study, we cloned the Sox enzymes of P. pantotrophus GB17 and evaluated their VSC-degrading activities for the prevention of oral malodor. Six genes, soxX, soxY, soxZ, soxA, soxB, and soxCD, were amplified from P. pantotrophus GB17. Each fragment was cloned into a vector for the expression of 6×His-tagged fusion proteins in Escherichia coli. Recombinant Sox (rSox) proteins were purified from whole-cell extracts of E. coli using nickel affinity chromatography. The enzyme mixture was investigated for the degradation of VSCs using gas chromatography. Each of the rSox enzymes was purified to apparent homogeneity, as confirmed by SDS-PAGE. The rSox enzyme mixture degraded H2S in dose- and time-dependent manners. All rSox enzymes were necessary for degrading H2S. The H2S-degrading activities of rSox enzymes were stable at 25-80°C, and the optimum pH was 7.0. The amount of H2S produced by periodontopathic bacteria or oral bacteria collected from human subjects decreased after an incubation with rSox enzymes. These results suggest that the combination of rSox enzymes from P. pantotrophus GB17 is useful for the prevention of oral malodor.

  19. Analytical and experimental investigation of aircraft metal structures reinforced with filamentary composites. Phase 3: Major component development

    NASA Technical Reports Server (NTRS)

    Bryson, L. L.; Mccarty, J. E.

    1973-01-01

    Analytical and experimental investigations, performed to establish the feasibility of reinforcing metal aircraft structures with advanced filamentary composites, are reported. Aluminum-boron-epoxy and titanium-boron-epoxy were used in the design and manufacture of three major structural components. The components were representative of subsonic aircraft fuselage and window belt panels and supersonic aircraft compression panels. Both unidirectional and multidirectional reinforcement concepts were employed. Blade penetration, axial compression, and inplane shear tests were conducted. Composite reinforced structural components designed to realistic airframe structural criteria demonstrated the potential for significant weight savings while maintaining strength, stability, and damage containment properties of all metal components designed to meet the same criteria.

  20. Larvicidal effect of Eucalyptus grandis essential oil and turpentine and their major components on Aedes aegypti larvae.

    PubMed

    Lucia, Alejandro; Gonzalez Audino, Paola; Seccacini, Emilia; Licastro, Susana; Zerba, Eduardo; Masuh, Hector

    2007-09-01

    In the search for new alternatives for the control of Aedes aegypti the larvicidal activity of Eucalyptus grandis essential oil and pine resin essential oil (turpentine) and their major components (alpha- and beta-pinene and 1,8-cineole) was determined. Gas chromatography-mass spectroscopy analysis of E. grandis essential oil revealed that its major components are alpha-pinene and 1,8-cineole. Similar analysis of turpentine obtained by distillation of the resin pitch of conifers showed that alpha- and beta-pinene are the only major components. Third and early 4th instars of the CIPEIN-susceptible strain of Ae. aegypti were exposed to acetonic solutions of E. grandis essential oil, turpentine, and their major components for 24 h. Turpentine, with an LC50 of 14.7 ppm, was more active than the essential oil of E. grandis (LC50: 32.4 ppm). Larvicidal activity of the essential oil components showed that alpha- and beta-pinene present low LC50 values (15.4 and 12.1 ppm, respectively), whereas pure 1,8-cineole showed an LC50 of 57.2 ppm. These results suggest that alpha-pinene in E. grandis and alpha- and beta-pinene in turpentine serve as the principal larvicidal components of both oils. Results obtained on larvicidal effects of essential oil of Eucalyptus grandis and turpentine could be considered a contribution to the search for new biodegradable larvicides of natural origin.

  1. Composability in quantum cryptography

    NASA Astrophysics Data System (ADS)

    Müller-Quade, Jörn; Renner, Renato

    2009-08-01

    If we combine two secure cryptographic systems, is the resulting system still secure? Answering this question is highly nontrivial and has recently sparked a considerable research effort, in particular, in the area of classical cryptography. A central insight was that the answer to the question is yes, but only within a well-specified composability framework and for carefully chosen security definitions. In this article, we review several aspects of composability in the context of quantum cryptography. The first part is devoted to key distribution. We discuss the security criteria that a quantum key distribution (QKD) protocol must fulfill to allow its safe use within a larger security application (e.g. for secure message transmission); and we demonstrate—by an explicit example—what can go wrong if conventional (non-composable) security definitions are used. Finally, to illustrate the practical use of composability, we show how to generate a continuous key stream by sequentially composing rounds of a QKD protocol. In the second part, we take a more general point of view, which is necessary for the study of cryptographic situations involving, for example, mutually distrustful parties. We explain the universal composability (UC) framework and state the composition theorem that guarantees that secure protocols can securely be composed to larger applications. We focus on the secure composition of quantum protocols into unconditionally secure classical protocols. However, the resulting security definition is so strict that some tasks become impossible without additional security assumptions. Quantum bit commitment is impossible in the UC framework even with mere computational security. Similar problems arise in the quantum bounded storage model and we observe a trade-off between the UC and the use of the weakest possible security assumptions.

  2. Antifungal effects of different plant extracts and their major components of selected aloe species.

    PubMed

    Ali, M I; Shalaby, N M; Elgamal, M H; Mousa, A S

    1999-08-01

    Different extracts of both fresh and dry leaves of Aloe eru A. Berger, A. vera L. Webb & Berth and A. arborescens Mill. were screened for their antifungal activity against Aspergillus niger, Cladosporium herbarum and Fusarium moniliforme. The toxicity of the isolated pure components were evaluated on the tested fungi. A comparative chromatographic study was performed to differentiate between natural components existing in various fractions and extracts of Aloe species and specific spray reagents were used for the detection of anthraquinones in the isolated components.

  3. Comparative study of the pyrolysis of lignocellulose and its major components: characterization and overall distribution of their biochars and volatiles.

    PubMed

    Cao, Xuefei; Zhong, Linxin; Peng, Xinwen; Sun, Shaoni; Li, Shouming; Liu, Shijie; Sun, Runcang

    2014-03-01

    In order to investigate the pyrolysis differences among lignocellulose and its major components, the biochars and volatiles of lignocellulose (bamboo), lignin, hemicellulose and holocellulose (from bamboo), and cellulose (from cotton linter) were studied using elemental analysis, FTIR, XRD, SEM, Py-GC/MS and TGA-FTIR. Result showed that the biochar yield of lignin (48.8%) was much higher than those of hemicellulose (21.1%), cellulose (8.3%), holocellulose (20.4%) and bamboo (15.1%), while no obvious elemental difference among these biochars was found. Results from Py-GC/MS indicated that carbonyl compounds, ethers and alcohols were the major volatiles of polysaccharide component pyrolysis, while aromatic compounds were the major volatiles of lignin pyrolysis. The pyrolysis of polysaccharide component mainly occurred at 200-400°C, while the pyrolysis of lignin happened at 300-700°C. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Potassium influx in human neonatal red blood cells. Partition into its major components.

    PubMed

    Serrani, R E; Venera, G; Gioia, I A; Corchs, J L

    1990-03-01

    The potassium influx in human neonatal red blood cells (nRBC) shows an approximately 25% lower value compared to the total potassium influx in adult red blood cells (aRBC). The ouabain-sensitive potassium influx component represents approximately 70-75% of the total potassium influx for both types of cells but with an absolute value significantly lower in nRBC. In nRBC, the half maximum inhibitory effect for ouabain was obtained at a 10(-9) M concentration. The ouabain-insensitive nRBC potassium influx fractions showed two components: (i) a bumetanide-sensitive component, significantly lower than that of aRBC, (ii) a ouabain-bumetanide-insensitive (leak) component with a similar value in both cell types. The sum of the ouabain-sensitive and furosemide-sensitive components amounted in nRBC to a greater value than the total potassium influx. This behaviour could be interpreted as a superposition of the action of the inhibitors on the components affected.

  5. The Components of a Visual Arts Curriculum for Non-Art and Art Majors. Session IV.

    ERIC Educational Resources Information Center

    Passow, Harry; And Others

    1991-01-01

    This panel interview from the Indiana University Summer Arts Institute contrasts notions about a traditional Bauhaus foundation with a flexible, organic curriculum model. Directed instruction is also compared to problem-solving approaches. Peer teaching, science for art majors, and art for science majors are also discussed. (Author/PB)

  6. Molecular Architecture of the Major Membrane Ring Component of the Nuclear Pore Complex.

    PubMed

    Upla, Paula; Kim, Seung Joong; Sampathkumar, Parthasarathy; Dutta, Kaushik; Cahill, Sean M; Chemmama, Ilan E; Williams, Rosemary; Bonanno, Jeffrey B; Rice, William J; Stokes, David L; Cowburn, David; Almo, Steven C; Sali, Andrej; Rout, Michael P; Fernandez-Martinez, Javier

    2017-03-07

    The membrane ring that equatorially circumscribes the nuclear pore complex (NPC) in the perinuclear lumen of the nuclear envelope is composed largely of Pom152 in yeast and its ortholog Nup210 (or Gp210) in vertebrates. Here, we have used a combination of negative-stain electron microscopy, nuclear magnetic resonance, and small-angle X-ray scattering methods to determine an integrative structure of the ∼120 kDa luminal domain of Pom152. Our structural analysis reveals that the luminal domain is formed by a flexible string-of-pearls arrangement of nine repetitive cadherin-like Ig-like domains, indicating an evolutionary connection between NPCs and the cell adhesion machinery. The 16 copies of Pom152 known to be present in the yeast NPC are long enough to form the observed membrane ring, suggesting how interactions between Pom152 molecules help establish and maintain the NPC architecture.

  7. Composing decoherence functionals

    NASA Astrophysics Data System (ADS)

    Boës, Paul; Navascués, Miguel

    2017-02-01

    Quantum measure theory (QMT) is a generalization of quantum theory where physical predictions are computed from a matrix known as the decoherence functional (DF). Previous works have noted that, in its original formulation, QMT exhibits a problem with composability, since the composition of two decoherence functionals is, in general, not a valid decoherence functional. This does not occur when the DFs in question happen to be positive semidefinite (a condition known as strong positivity). In this paper, we study the concept of composability of DFs and its consequences for QMT. Firstly, we show that the problem of composability is much deeper than originally envisaged, since, for any n , there exists a DF that can coexist with n -1 copies of itself, but not with n . Secondly, we prove that the set of strongly positive DFs cannot be enlarged while remaining closed under composition. Furthermore, any closed set of DFs containing all quantum DFs can only contain strongly positive DFs.

  8. Composing and Comprehending.

    ERIC Educational Resources Information Center

    Jensen, Julie M., Ed.

    Intended for elementary school teachers of reading and composition, this book assembles several articles on the reading/writing relationship that have appeared in 1982 and 1983 issues of the journal "Language Arts." The three sections of the book define the relationship between composing and comprehending, explore relevant research, and…

  9. [Isolation and partial structural characteristics of major toxic components of Latrodectus pallidus venom].

    PubMed

    Charakha, A R; Shevchenko, L V; Molodkin, A K; Pluzhnikov, K A; Volkova, T M; Grishin, E V

    1997-03-01

    Toxic components of the Latrodectus pallidus spider venom were isolated and characterized. The venom was shown to contain a toxin specific for mammals and at least one insectospecific toxin. Partial amino acid sequences of both toxins were determined, and their high structural homology with previously studied alpha-latrotoxin and alpha-latroinsectotoxin from L. mactans tredecimguttatus was found.

  10. Bacterial components are the major contributors to the macrophage stimulating activity exhibited by extracts of common edible mushrooms

    USDA-ARS?s Scientific Manuscript database

    Background: Recent studies have indicated that a major contributor to the innate immune enhancing properties of some medicinal plants derive from the cell wall components of bacteria colonizing these plants. Purpose: The purpose of the current study was to assess if the bacteria present within edib...

  11. Bacterial components are the major contributors to the macrophage stimulating activity exhibited by extracts of common edible mushrooms

    USDA-ARS?s Scientific Manuscript database

    Background: Recent studies have indicated that a major contributor to the innate immune enhancing properties of some medicinal plants is derived from the cell wall components of bacteria colonizing these plants. Purpose: The purpose of the current study was to assess if the bacteria present withi...

  12. THE DISTRIBUTION OF ORGANIC CARBON IN MAJOR COMPONENTS OF FORESTS LOCATED IN FIVE LIFE ZONES OF VENEZUELA

    EPA Science Inventory

    One of the major uncertainties concerning the role of tropical forests in the global carbon cycle is the lack of adequate data on the carbon content of all their components. The goal of this study was to contribute to filling this data gap by estimating the quantity of carbon in ...

  13. THE DISTRIBUTION OF ORGANIC CARBON IN MAJOR COMPONENTS OF FORESTS LOCATED IN FIVE LIFE ZONES OF VENEZUELA

    EPA Science Inventory

    One of the major uncertainties concerning the role of tropical forests in the global carbon cycle is the lack of adequate data on the carbon content of all their components. The goal of this study was to contribute to filling this data gap by estimating the quantity of carbon in ...

  14. Sequential application of major habit-reversal components to treat motor tics in children.

    PubMed Central

    Woods, D W; Miltenberger, R G; Lumley, V A

    1996-01-01

    In this study, we sequentially administered up to four components of the habit-reversal treatment to 4 children with motor tics within a multiple baseline design. The habit-reversal components included (a) awareness training; (b) awareness training and self-monitoring; (c) awareness training, self-monitoring, and social support; and (d) awareness training, social support, and the use of a competing response. Results demonstrated that the combined use of awareness training, social support, and competing response training was effective in eliminating motor tics in 2 of 4 children, that awareness training alone was effective for 1 child, and that a combination of awareness training and self-monitoring was effective for the 4th child. The treatment and ensuing improvement were found to be socially valid. We discuss possible explanations for these results and recommend directions for future research. PMID:8995831

  15. Pharmacokinetics of the Individual Major Components of Polymyxin B and Colistin in Rats.

    PubMed

    Sivanesan, Sivashangarie; Roberts, Kade; Wang, Jiping; Chea, Soon-Ee; Thompson, Philip E; Li, Jian; Nation, Roger L; Velkov, Tony

    2017-01-27

    The pharmacokinetics of polymyxin B1, polymyxin B2, colistin A, and colistin B were investigated in a rat model following intravenous administration (0.8 mg/kg) of each individual component. Plasma and urine concentrations were determined by LC-MS/MS, and plasma protein binding was measured by ultracentrifugation. Total and unbound pharmacokinetic parameters for each component were calculated using noncompartmental analysis. All of the polymyxin components had a similar clearance, volume of distribution, elimination half-life, and urinary recovery. The area under the concentration-time curve for polymyxins B1 and B2 was greater than those of colistins A and B. Colistin A (56.6 ± 9.25%) and colistin B (41.7 ± 12.4%) displayed lower plasma protein binding in rat plasma compared to polymyxin B1 (82.3 ± 4.30%) and polymyxin B2 (68.4 ± 3.50%). These differences in plasma protein binding potentially equate to significant differences in unbound pharmacokinetics, highlighting the need for more stringent standardization of the composition of commercial products currently available for clinical use.

  16. Semi-continuous mass closure of the major components of fine particulate matter in Riverside, CA

    NASA Astrophysics Data System (ADS)

    Grover, Brett D.; Eatough, Norman L.; Woolwine, Woods R.; Cannon, Justin P.; Eatough, Delbert J.; Long, Russell W.

    The application of newly developed semi-continuous aerosol monitors allows for the measurement of all the major species of PM 2.5 on a 1-h time basis. Temporal resolution of both non-volatile and semi-volatile species is possible. A suite of instruments to measure the major chemical species of PM 2.5 allows for semi-continuous mass closure. A newly developed dual-oven Sunset carbon monitor is used to measure non-volatile organic carbon, semi-volatile organic carbon and elemental carbon. Inorganic species, including sulfate and nitrate, can be measured with an ion chromatograph based sampler. Comparison of the sum of the major chemical species in an urban aerosol with mass measured by an FDMS resulted in excellent agreement. Linear regression analysis resulted in a zero-intercept slope of 0.98±0.01 with an R2=0.86. One-hour temporal resolution of the major species of PM 2.5 may reduce the uncertainty in receptor based source apportionment modeling, will allow for better forecasting of PM 2.5 episodes, and may lead to increased understanding of related health effects.

  17. Composing Interfering Abstract Protocols

    DTIC Science & Technology

    2016-04-01

    when composing abstract protocols. To evaluate the expres- siveness of our protocol framework for ensuring safe shared memory interference, we show how...progress and preservation theorems that show the ab- sence of unsafe interference in correctly typed programs. Our design ensures memory safety and data...system by discussing how our core shared memory protocol framework is capable of expressing safe, typeful message-passing idioms. Next, we briefly

  18. Identification of major water-soluble fluorescent components of some petrochemicals.

    PubMed

    Groner, M; Muroski, A R; Myrick, M L

    2001-10-01

    The chemical identities of several organic compounds that dominate the ultraviolet (UV) fluorescence of water after exposure to gasoline, diesel fuel and crude oil are presented. A combination of high-performance liquid chromatography with UV-fluorescence detection, fluorescence spectroscopy and gas chromatography-mass spectrometry (GC-MS) is used to show that naphthalene, methylnaphthalene and methylstyrene are the major fluorescent species in water following exposure to gasoline. These compounds are not dominant in water exposed to other petrochemicals we studied.

  19. Retrotransposon BARE-1 is a major, dispersed component of the barley (Hordeum vulgare L.) genome.

    PubMed

    Suoniemi, A; Anamthawat-Jónsson, K; Arna, T; Schulman, A H

    1996-03-01

    The barley BARE-1 is a transcribed, copia-like retroelement with well-conserved functional domains, an active promoter, and a copy number of at least 3 x 10(4). We examined its chromosomal localization by in situ hybridization. The long terminal repeat (LTR) probe displayed a uniform hybridization pattern over the whole of all chromosomes, excepting paracentromeric regions, telomeres, and nucleolar organizer (NOR) regions. The integrase probe showed a similar pattern. The 5'-untranslated leader (UTL) probe, expected to be the most rapidly evolving component, labeled chromosomes in a dispersed and non-uniform manner, concentrated in the distal regions, possibly indicating a targe site preference.

  20. Gallic acid is the major component of grape seed extract that inhibits amyloid fibril formation.

    PubMed

    Liu, Yanqin; Pukala, Tara L; Musgrave, Ian F; Williams, Danielle M; Dehle, Francis C; Carver, John A

    2013-12-01

    Many protein misfolding diseases, for example, Alzheimer's, Parkinson's and Huntington's, are characterised by the accumulation of protein aggregates in an amyloid fibrillar form. Natural products which inhibit fibril formation are a promising avenue to explore as therapeutics for the treatment of these diseases. In this study we have shown, using in vitro thioflavin T assays and transmission electron microscopy, that grape seed extract inhibits fibril formation of kappa-casein (κ-CN), a milk protein which forms amyloid fibrils spontaneously under physiological conditions. Among the components of grape seed extract, gallic acid was the most active component at inhibiting κ-CN fibril formation, by stabilizing κ-CN to prevent its aggregation. Concomitantly, gallic acid significantly reduced the toxicity of κ-CN to pheochromocytoma12 cells. Furthermore, gallic acid effectively inhibited fibril formation by the amyloid-beta peptide, the putative causative agent in Alzheimer's disease. It is concluded that the gallate moiety has the fibril-inhibitory activity. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Biologically recycled continental iron is a major component in banded iron formations

    PubMed Central

    Li, Weiqiang; Beard, Brian L.; Johnson, Clark M.

    2015-01-01

    Banded iron formations (BIFs) record a time of extensive Fe deposition in the Precambrian oceans, but the sources and pathways for metals in BIFs remain controversial. Here, we present Fe- and Nd-isotope data that indicate two sources of Fe for the large BIF units deposited 2.5 billion y ago. High-εNd and -δ56Fe signatures in some BIF samples record a hydrothermal component, but correlated decreases in εNd- and δ56Fe values reflect contributions from a continental component. The continental Fe source is best explained by Fe mobilization on the continental margin by microbial dissimilatory iron reduction (DIR) and confirms for the first time, to our knowledge, a microbially driven Fe shuttle for the largest BIFs on Earth. Detailed sampling at various scales shows that the proportions of hydrothermal and continental Fe sources were invariant over periods of 100–103 y, indicating that there was no seasonal control, although Fe sources varied on longer timescales of 105–106 y, suggesting a control by marine basin circulation. These results show that Fe sources and pathways for BIFs reflect the interplay between abiologic (hydrothermal) and biologic processes, where the latter reflects DIR that operated on a basin-wide scale in the Archean. PMID:26109570

  2. Biologically recycled continental iron is a major component in banded iron formations.

    PubMed

    Li, Weiqiang; Beard, Brian L; Johnson, Clark M

    2015-07-07

    Banded iron formations (BIFs) record a time of extensive Fe deposition in the Precambrian oceans, but the sources and pathways for metals in BIFs remain controversial. Here, we present Fe- and Nd-isotope data that indicate two sources of Fe for the large BIF units deposited 2.5 billion y ago. High-εNd and -δ(56)Fe signatures in some BIF samples record a hydrothermal component, but correlated decreases in εNd- and δ(56)Fe values reflect contributions from a continental component. The continental Fe source is best explained by Fe mobilization on the continental margin by microbial dissimilatory iron reduction (DIR) and confirms for the first time, to our knowledge, a microbially driven Fe shuttle for the largest BIFs on Earth. Detailed sampling at various scales shows that the proportions of hydrothermal and continental Fe sources were invariant over periods of 10(0)-10(3) y, indicating that there was no seasonal control, although Fe sources varied on longer timescales of 10(5)-10(6) y, suggesting a control by marine basin circulation. These results show that Fe sources and pathways for BIFs reflect the interplay between abiologic (hydrothermal) and biologic processes, where the latter reflects DIR that operated on a basin-wide scale in the Archean.

  3. Parvalbumins from coelacanth muscle. III. Amino acid sequence of the major component.

    PubMed

    Jauregui-Adell, J; Pechere, J F

    1978-09-26

    The primary structure of the major parvalbumin (pI = 4.52) from coelacanth muscle (Latimeria chalumnae) has been determined. Sequence analysis of the tryptic peptides, in some cases obtained with beta-trypsin, accounts for the total amino acid content of the protein. Chymotryptic peptides provide appropriate sequence overlaps, to complete the localization of the tryptic peptides. Examination of the amino acid sequence of this protein shows the typical structure of a beta-parvalbumin. Its position in the dendrogram of related calcium-binding proteins corresponds to that usually accepted for crossopterygians.

  4. Spectroscopic determination of intermolecular potentials of gas laser components and of major atmospheric constituents. Final report

    SciTech Connect

    Klemperer, W.

    1982-01-01

    A systematic study of the structure of weakly bound complexes of hydrogen fluoride has been accomplished. This research provides a broad account of the interaction of hydrogen fluoride with a variety of laser components and atmospheric constituents. Precision structures are now available for the species ArHF, CO/sub 2/HF, N/sub 2/OHF and SCOHF as a result of the present research program. In addition, precision structures have been obtained for ArCO2 and ArN/sub 2/0. This research provides the basic information necessary for reliable modelling of intermolecular forces between HF and Ar, CO/sub 2/, N/sub 2/0 and OCS as well as between Ar and CO/sub 2/ and N/sub 2/0.

  5. Major component contributions to PM 10 composition in the UK atmosphere

    NASA Astrophysics Data System (ADS)

    Turnbull, Alan B.; Harrison, Roy M.

    Physical and chemical characteristics of PM 10, including chloride, nitrate, sulphate, and black smoke, have been measured on a seasonal basis at four coastal, rural, and urban sites across the UK. Weekly campaigns with 6 h sample resolution were conducted, and the results related to meteorological conditions and air mass back trajectories. Seasonal and location- specific mean values are reported, along with an indication of diurnal characteristics. Although the urban site reflected generally higher values for the anthropogenic pollutants, long-range transport of primary and secondary particles was significant. The data have been analysed using a four-component multi-linear regression model including black smoke as a surrogate for primary combustion particles, secondary particles (sulphate and nitrate), chloride, and a constant which describes "other", mainly coarse mode particles. Regression coefficients have been calculated on a site and seasonal basis. "Other" particles were higher during the summer and in the urban environment with an overall mean value of 5 μg m -3. Secondary nitrate and sulphate were strongly related to meteorological conditions and less to location. Overall, the four-component model accounts quite well ( r 2=0.76 for all data) for PM 10 mass and for some sites and seasons gives an excellent fit to the data. Addition of dummy variables representing season, urban/rural location and time of sampling gives an improvement in fit, with r 2=0.84 . Application of the coefficients derived from the "all data" model shows secondary particles contributing 28-35% of site-mean PM 10, primary combustion particles from 20 to 57%, sodium chloride, 11-34% and "other", mainly crustal particles, 3-21%. It is felt that this probably underestimates the crustal contribution, but the reasons are unclear.

  6. Complex Forms of Soil Organic Phosphorus-A Major Component of Soil Phosphorus.

    PubMed

    McLaren, Timothy I; Smernik, Ronald J; McLaughlin, Mike J; McBeath, Therese M; Kirby, Jason K; Simpson, Richard J; Guppy, Christopher N; Doolette, Ashlea L; Richardson, Alan E

    2015-11-17

    Phosphorus (P) is an essential element for life, an innate constituent of soil organic matter, and a major anthropogenic input to terrestrial ecosystems. The supply of P to living organisms is strongly dependent on the dynamics of soil organic P. However, fluxes of P through soil organic matter remain unclear because only a minority (typically <30%) of soil organic P has been identified as recognizable biomolecules of low molecular weight (e.g., inositol hexakisphosphates). Here, we use (31)P nuclear magnetic resonance spectroscopy to determine the speciation of organic P in soil extracts fractionated into two molecular weight ranges. Speciation of organic P in the high molecular weight fraction (>10 kDa) was markedly different to that of the low molecular weight fraction (<10 kDa). The former was dominated by a broad peak, which is consistent with P bound by phosphomonoester linkages of supra-/macro-molecular structures, whereas the latter contained all of the sharp peaks that were present in unfractionated extracts, along with some broad signal. Overall, phosphomonoesters in supra-/macro-molecular structures were found to account for the majority (61% to 73%) of soil organic P across the five diverse soils. These soil phosphomonoesters will need to be integrated within current models of the inorganic-organic P cycle of soil-plant terrestrial ecosystems.

  7. Erosion of modern terrestrial organic matter as a major component of sediments in fjords

    NASA Astrophysics Data System (ADS)

    Cui, Xingqian; Bianchi, Thomas S.; Savage, Candida

    2017-02-01

    Fjords have recently been recognized as "hot spots" of carbon burial. In this study, we investigated organic carbon (OC) and biomarker radiocarbon values in fjord sediments from New Zealand. Our results showed that OC was mostly modern with the most aged OC in middle reaches of fjords, likely related to hydrodynamic sorting and inputs along adjacent slopes. Radiocarbon ages of sedimentary OC increased from north-to-south, consistent with the Fiordland regional gradients of lower fjord slopes and less rainfall. Our biomarker results suggested that lignin and long-chain fatty acids were preferentially linked with fresh terrestrial debris and degraded soil, respectively, likely due to their chemical and physical properties. Finally, we propose that fjords are a significant sink of modern OC, in contrast to large lowland coastal systems as a major sink of preaged OC. Overall, this study indicated that radiocarbon techniques are critical in investigating carbon dynamics in coastal systems.

  8. Isolation and characterization of ellagitannins as the major polyphenolic components of Longan (Dimocarpus longan Lour) seeds.

    PubMed

    Sudjaroen, Yuttana; Hull, William E; Erben, Gerhard; Würtele, Gerd; Changbumrung, Supranee; Ulrich, Cornelia M; Owen, Robert W

    2012-05-01

    Longan (Dimocarpus longan Lour, syn. Euphoria longan Lam.) represents an important fruit in Northern Thailand and has significant economic impact. The fruit is either consumed fresh or as commercially prepared dried and canned products. The canning industry in Thailand produces considerable quantities of waste products, in particular Longan seeds. Because these seeds may be an exploitable source of natural phenolic antioxidants, it was of interest to identify, purify and quantitate the major potential antioxidant phenolics contained therein. The polyphenolic fraction from ground Longan seeds was obtained by extraction with methanol after delipidation with hexane. The hexane extract contained predominantly long-chain fatty acids with major contributions from palmitic (35%) and oleic (28%) acids. The polyphenolic fraction (80.90 g/kg dry weight) was dominated by ellagic acid (25.84 g/kg) and the known ellagitannins corilagin (13.31 g/kg), chebulagic acid (13.06 g/kg), ellagic acid 4-O-α-l-arabinofuranoside (9.93 g/kg), isomallotinic acid (8.56 g/kg) and geraniin (5.79 g/kg). Structure elucidation was performed with mass spectrometry and complete assignment of (1)H and (13)C NMR signals. The methanol extracts exhibited strong antioxidant capacities with an IC(50) of 154 μg/ml for reactive oxygen species attack on salicylic acid and 78 μg/ml for inhibition of xanthine oxidase in the hypoxanthine/xanthine oxidase assay. The extracts were less effective in the 2-deoxyguanosine assay (IC(50)=2.46 mg/ml), indicating that gallates along with ellagic acid and its congeners exert their potential antioxidant effects predominantly by precipitation of proteins such as xanthine oxidase. This was confirmed for the pure compounds gallic acid, methyl gallate, ellagic acid and corilagin.

  9. Free fatty acids as a major component of the chlorosulfolipid membrane of Ochromonas danica

    SciTech Connect

    Winicov, I.

    1985-01-01

    This work is an attempt to determine whether or not free fatty acids are components of the natural membrane of Ochromonas danica. If the FFAs were artifacts, they would most likely have been produced during solvent extraction or during the procedure for flagellar detachment. Attempts to denature putative solvent-activated lipase(s) through exposure to boiling isopropanol or by crosslinking the flagella with glutaraldehyde prior to extraction failed to eliminate the free fatty acid fraction, nor to significantly alter its composition. Exposure of flagella to albumin resulted in the net transfer of FFAs to the supernatant phase, showing their presence is not caused by solvent activated lipolysis. Finally levels of labelled free fatty acids failed to rise as a function of time after deflagellation in cells grown in the presence of (10-/sup 14/C)-oleic acid. Acid hydrolysis of the total labelled lipid at elevated temperature increased the percentage of counts occurring as unesterified fatty acids (from 2.6% to 64.8%). This, taken together with a corresponding loss of the more polar labelled material (66.8% to 8.2%) indicates that some esterified lipids were present, but probably not broken down during the isolation procedure.

  10. Major advances in testing of dairy products: milk component and dairy product attribute testing.

    PubMed

    Barbano, D M; Lynch, J M

    2006-04-01

    Milk component analysis is relatively unusual in the field of quantitative analytical chemistry because an analytical test result determines the allocation of very large amounts of money between buyers and sellers of milk. Therefore, there is high incentive to develop and refine these methods to achieve a level of analytical performance rarely demanded of most methods or laboratory staff working in analytical chemistry. In the last 25 yr, well-defined statistical methods to characterize and validate analytical method performance combined with significant improvements in both the chemical and instrumental methods have allowed achievement of improved analytical performance for payment testing. A shift from marketing commodity dairy products to the development, manufacture, and marketing of value added dairy foods for specific market segments has created a need for instrumental and sensory approaches and quantitative data to support product development and marketing. Bringing together sensory data from quantitative descriptive analysis and analytical data from gas chromatography olfactometry for identification of odor-active compounds in complex natural dairy foods has enabled the sensory scientist and analytical chemist to work together to improve the consistency and quality of dairy food flavors.

  11. Preventive effect of Kaempferia parviflora ethyl acetate extract and its major components polymethoxyflavonoid on metabolic diseases.

    PubMed

    Shimada, Tsutomu; Horikawa, Takumi; Ikeya, Yukinobu; Matsuo, Hirotaka; Kinoshita, Kaoru; Taguchi, Takaaki; Ichinose, Koji; Takahashi, Kunio; Aburada, Masaki

    2011-12-01

    Previously, we reported that rhizome powder of Kaempferia parviflora Wall. Ex. Baker prevented obesity and a range of metabolic diseases. In this study, to clarify which molecular mechanisms and active ingredients of K. parviflora have an anti-obesity effect, we investigated the effect of ethyl acetate extract of K. parviflora (KPE) on TSOD mice, a spontaneously obese Type II diabetes model, and on pancreatic lipase. In the TSOD groups, KPE showed a suppressive effect on body weight increase and visceral fat accumulation and also showed preventive effects on symptoms related to insulin resistance, hypertension and fatty liver. In addition, KPE also suppressed body weight increase and food intake in TSNO mice groups, which served as reference animals, at an early stage of administration. Searching for the ingredients in KPE revealed that KPE contains at least 12 kinds of polymethoxyflavonoid (PMF). Furthermore, KPE and its component PMFs showed an inhibitory effect on pancreatic lipase. The above results suggest that KPE has a preventive effect on obesity and various metabolic diseases. The mechanisms of action probably involve inhibition of pancreatic lipase by the PMFs in KPE. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Model of Close Packing for Determination of the Major Characteristics of the Liquid Dispersions Components

    PubMed Central

    Kolikov, Kiril Hristov; Hristozov, Dimo Donchev; Koleva, Radka Paskova; Krustev, Georgi Aleksandrov

    2014-01-01

    We introduce a close packing model of the particles from the disperse phase of a liquid dispersion. With this model, we find the sediment volumes, the emergent, and the bound dispersion medium. We formulate a new approach for determining the equivalent radii of the particles from the sediment and the emergent (different from the Stokes method). We also describe an easy manner to apply algebraic method for determining the average volumetric mass densities of the ultimate sediment and emergent, as well as the free dispersion medium (without using any pycnometers or densitometers). The masses of the different components and the density of the dispersion phase in the investigated liquid dispersion are also determined by means of the established densities. We introduce for the first time a dimensionless scale for numeric characterization and therefore an index for predicting the sedimentation stability of liquid dispersions in case of straight and/or reverse sedimentation. We also find the quantity of the pure substance (without pouring out or drying) in the dispersion phase of the liquid dispersions. PMID:25136673

  13. The inhibition of Candida albicans by selected essential oils and their major components.

    PubMed

    Tampieri, Maria Paola; Galuppi, Roberta; Macchioni, Fabio; Carelle, Maria Stella; Falcioni, Laura; Cioni, Pier Luigi; Morelli, Ivano

    2005-04-01

    Many volatile oils are known to possess antifungal properties and are potentially applicable as antimycotic agents. By studying the efficacy of essential oils against different pathogenic mycetes, we have evaluated the in-vitro inhibiting activity of some essential oils and their main constituents against a strain of Candida albicans. Sixteen commercial essential oils and forty-two pure constituents (alcohols, aldehydes, ketons, phenols and hydrocarbons), were tested by using a semisolid agar antifungal susceptibility (SAAS) method. Gas chromatography/mass spectroscopy analyses of the oils tested were performed. The essential oils of Origanum vulgare, Satureja montana, Mentha piperita, Cinnamomum verum, Cymbopogon flexuosus showed maximum inhibitory activity (MIC = 500 ppm) after 7 days. According to the results of the examination of pure constituents, beta-phellandrene proved to be the most interesting component among cyclic monoterpenic hydrocarbons as it showed a strong activity (MIC = 50 ppm). The most active of phenols was carvacrol (MIC 100 ppm). The open-chain alcohol 1-decanol was the most active of alcohols at 50 ppm. Finally, among aldehydes, a strong activity was shown by trans-cynnamaldehyde (MIC 50 ppm).

  14. NIR rapid assessments of Chinese material medica: simultaneous determination of three major active components of licorice

    NASA Astrophysics Data System (ADS)

    Wu, Zhisheng; Zhou, Xiangzhen; Yu, Fulai; Shi, Xinyuan; Wang, Wenquan; Qiao, Yanjiang

    2014-11-01

    Objective: A rapid and nondestructive method was used to quantitatively predict the content of three main active components (glycyrrhizin, liquiritin and isoliquiritin) in licorice by near infrared spectroscopy (NIRS). Methods: Diffuse reflectance spectra of licorice powder were obtained, the contents of glycyrrhizin, liquiritin and isoliquiritin were analyzed simultaneously by high-performance liquid chromatography (HPLC). The partial least squares (PLS) regression algorithm was used to establish the quantitative models. Several pretreatments such as multiplicative scatter correction (MSC), first derivative, second derivative and Savitzky-Golay (SG) smoothing were utilized to correct the scattering effect and eliminate the baseline shift in all spectra. The calibration equations produced the highest determination of coefficient values (R2), the lowest root mean square error of calibration (RMSEC) and the lowest root mean square error of prediction (RMSEP) were used for the determination of glycyrrhizin, liquiritin and isoliquiritin. Results: The R2 of glycyrrhizin, liquiritin and isoliquiritin were 0.999, 0.996 and 0.999, respectively. The RMSEC of glycyrrhizin, liquiritin and isoliquiritin were 1.14 mg/g, 0.77 mg/g and 0.068 mg/g respectively. The RMSEP of glycyrrhizin, liquiritin and isoliquiritin were 4.92 mg/g, 2.06 mg/g and 0.35 mg/g respectively. Conclusions: The results indicated that the NIRS method could be used for the rapid assessment of licorice.

  15. A review of the effects of Berberis vulgaris and its major component, berberine, in metabolic syndrome

    PubMed Central

    Tabeshpour, Jamshid; Imenshahidi, Mohsen; Hosseinzadeh, Hossein

    2017-01-01

    Metabolic syndrome (MetS), characterized by a cluster of metabolic abnormalities including hypertension, obesity, type 2 diabetes mellitus (T2DM) and dyslipidemia, is a well-known cardiovascular risk factor (CVRF). Cardiovascular disease (CVD) represents a massive healthcare burden worldwide. In recent years, with regard to the adverse effects of synthetic drugs, increasing attention has been paid by researchers to herbal medicines for a variety of disorders such as CVD. A large body of literature supports different pharmacological actions of Berberis vulgaris (B. vulgaris) and its active component, berberine (BBR), such as antidiabetic, antiobesity, hypotensive and hypolipidemic properties that could be interesting in the management of MetS associated with high CVD risk. Numerous preclinical in vitro and in vivo studies support all these effects. In this review, we evaluated the most related original articles to discover the role of B. vulgaris on various constituents of MetS and CVRF comprising dyslipidemia, obesity, high blood pressure and high blood glucose. This review suggests a potential role of B. vulgaris and BBR in the managing of MetS; nevertheless more investigations, especially reliable clinical trials, need to be accomplished to evaluate their effectiveness. PMID:28656091

  16. The Apollo 16 drive tube 60009/60010. II - Petrology and major element partitioning among the regolith components

    NASA Technical Reports Server (NTRS)

    Vaniman, D. T.; Papike, J. J.; Schweitzer, E. L.

    1978-01-01

    The paper summarizes petrographic and electron microprobe data from 22 polished thin sections that represent the total length of double drive tube 60009/60010 and discusses a new application of the method of modal recombination to estimate bulk chemistry. The modal recombination approach can be used to reliably calculate the chemistry of the greater than 0.02-mm size fraction and, more significantly, to derive the total major element partitioning among the regolith components.

  17. Pipa carvalhoi skin secretion profiling: absence of peptides and identification of kynurenic acid as the major constitutive component.

    PubMed

    Mariano, Douglas Oscar Ceolin; Yamaguchi, Lydia Fumiko; Jared, Carlos; Antoniazzi, Marta Maria; Sciani, Juliana Mozer; Kato, Massuo Jorge; Pimenta, Daniel Carvalho

    2015-01-01

    The presence of peptides has been identified in all African pipid genera; nevertheless, little is known about skin secretion of South American frog genus Pipa. Skin secretion from captive and wild Pipa carvalhoi were obtained in the presence or absence of norepinephrine stimulation. The <10 kDa fraction was analyzed by liquid chromatography and mass spectrometry, searching for peptides. Chromatographic profiles show the presence of a major component in this secretion, regardless of the stimulation method (norepinephrine or mechanical stimulation) and the origin of the animal (captivity or wild), as well as in the absence of any stimulus. The general mass distribution profile in P. carvalhoi skin secretion shows numerous components below 800 Da. Moreover, no peptide could be identified, regardless of the chromatographic approach. The major component was purified and identified as kynurenic acid, an L-tryptophan derivative. P. carvalhoi does not secrete peptides as toxins in its skin. In addition, we here report that kynurenic acid is the main component of P. carvalhoi skin secretion. Although no biological activity was associated with kynurenic acid, we propose that this molecule is a pheromone that signals the presence of a co-specific in the shady environment in which this animal lives. In this study we demonstrate the absence of peptidic toxins in the skin secretion of P. carvalhoi, a break of paradigm in the pipid family. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. AN ANALYTICAL MODEL FOR THE CORONAL COMPONENT OF MAJOR SOLAR ENERGETIC PARTICLE EVENTS

    SciTech Connect

    Kocharov, Leon; Valtonen, Eino; Cho, Kyung-Suk

    2011-07-01

    We formulate an analytical model of the coronal-phase acceleration observed in the beginning of major solar energetic particle (SEP) events, before the main-phase acceleration associated with coronal mass ejections (CMEs) in solar wind. The model is driven and constrained by the broadband observations of SEPs and CMEs, in particular SEP data from the particle telescope of the Energetic and Relativistic Nuclei and Electron (ERNE) experiment on the Solar and Heliospheric Observatory (SOHO) spacecraft, solar radio spectrograms, and low-corona observations of CMEs. The model is also verified against observations of solar high-energy neutrons and neutron-decay protons. The model suggests SEP acceleration above {approx} 50 MeV nucleon{sup -1} by coronal shock and the shock-amplified turbulence in closed magnetic structures, and particle release at magnetic reconnection between the closed structure of expanding CME and pre-existing open magnetic flux tubes. The analytical model connects parameters of coronal shocks and structures and the SEP parameters in space, which facilitates analysis of multiwavelength data and will assist in further development of coronal acceleration models.

  19. Bacterial contamination of blood and blood components in three major blood transfusion centers, Accra, Ghana.

    PubMed

    Adjei, Andrew Anthony; Kuma, George Khumalo; Tettey, Yao; Ayeh-Kumi, Patrick Ferdinand; Opintan, Japheth; Apeagyei, Francis; Ankrah, Jacob Otinkorang; Adiku, Theophilus Korku; Narter-Olaga, Edwin Gbli

    2009-07-01

    Reports from studies conducted in several countries indicate a high incidence of bacterial contamination of donor blood. The prevalence of bacterial contamination of blood and its products in Ghana is not known. This study was conducted to determine the prevalence of bacterial contamination of blood and its products at the three major blood transfusion centers in the Greater Accra Region of Ghana. Stored whole blood and its products were cultured on different media, and isolates were identified using standard biochemical and bacteriological methods. The susceptibility of the isolates to selected antimicrobial agents was also determined by the disc diffusion method. The overall prevalence rate was 9% (28/303; whole blood, 13% [24/192]; plasma, 3% [2/79]; platelet, 9% [2/22]). The Gram-positive bacteria isolated were coagulase-negative Staphylococcus, S. aureus, and Bacillus spp., and the Gram-negative organisms were Yersinia enterocolitica, Citrobacter freundii, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae. The Gram-positive bacteria were sensitive to cloxacillin, erythromycin, tetracycline, and gentamicin but resistant to penicillin, ampicillin, cefuroxime, and cotrimoxazole, while the Gram-negative bacteria were sensitive to amikacin and gentamicin but resistant to chloramphenicol, tetracycline, ampicillin, cefuroxime, cefotaxime (except Y. enterocolitica), and cotrimoxazole. Our results suggest that bacterial contamination of blood and its products is prevalent in Ghana.

  20. [Medicinal chemistry and pharmacology focused on cannabidiol, a major component of the fiber-type cannabis].

    PubMed

    Takeda, Shuso

    2013-01-01

    Considerable attention has focused on cannabidiol (CBD), a major non-psychotropic constituent of fiber-type cannabis plant, and it has been reported to possess diverse biological activities. Although CBD is obtained from non-enzymatic decarboxylation of its parent molecule, cannabidiolic acid (CBDA), several studies have investigated whether CBDA itself is biologically active. In the present report, the author summarizes findings indicating that; 1) CBDA is a selective cyclooxygenase-2 (COX-2) inhibitor, and ii) CBDA possesses an anti-migrative potential for highly invasive cancer cells, apparently through a mechanism involving inhibition of cAMP-dependent protein kinase A, coupled with an activation of the small GTPase, RhoA. Further, the author introduces recent findings on the medicinal chemistry and pharmacology of the CBD derivative, CBD-2',6'-dimethyl ether (CBDD), that exhibits inhibitory activity toward 15-lipoxygenase (15-LOX), an enzyme responsible for the production of oxidized low-density lipoprotein (LDL). These studies establish CBD as both an important experimental tool and as a lead compound for pharmaceutical development. In this review, the author further discusses the potential uses of CBD and its derivatives in future medicines.

  1. Fish as major carbonate mud producers and missing components of the tropical carbonate factory

    USGS Publications Warehouse

    Perry, C.T.; Salter, M.A.; Harborne, A.R.; Crowley, S.F.; Jelks, H.L.; Wilson, R.W.

    2011-01-01

    Carbonate mud is a major constituent of recent marine carbonate sediments and of ancient limestones, which contain unique records of changes in ocean chemistry and climate shifts in the geological past. However, the origin of carbonate mud is controversial and often problematic to resolve. Here we show that tropical marine fish produce and excrete various forms of precipitated (nonskeletal) calcium carbonate from their guts ("low" and "high" Mg-calcite and aragonite), but that very fine-grained (mostly <2 ??m) high Mg-calcite crystallites (i.e., >4 mole % MgCO3) are their dominant excretory product. Crystallites from fish are morphologically diverse and species-specific, but all are unique relative to previously known biogenic and abiotic sources of carbonate within open marine systems. Using site specific fish biomass and carbonate excretion rate data we estimate that fish produce ???6.1 ?? 106 kg CaCO3/year across the Bahamian archipelago, all as mud-grade (the <63 ??m fraction) carbonate and thus as a potential sediment constituent. Estimated contributions from fish to total carbonate mud production average ???14% overall, and exceed 70% in specific habitats. Critically, we also document the widespread presence of these distinctive fish-derived carbonates in the finest sediment fractions from all habitat types in the Bahamas, demonstrating that these carbonates have direct relevance to contemporary carbonate sediment budgets. Fish thus represent a hitherto unrecognized but significant source of fine-grained carbonate sediment, the discovery of which has direct application to the conceptual ideas of how marine carbonate factories function both today and in the past.

  2. Fish as major carbonate mud producers and missing components of the tropical carbonate factory

    USGS Publications Warehouse

    Perry, Chris T.; Salter, Michael A.; Harborne, Alastair R.; Crowley, Stephen F.; Jelks, Howard L.; Wilson, Rod W.

    2011-01-01

    Carbonate mud is a major constituent of recent marine carbonate sediments and of ancient limestones, which contain unique records of changes in ocean chemistry and climate shifts in the geological past. However, the origin of carbonate mud is controversial and often problematic to resolve. Here we show that tropical marine fish produce and excrete various forms of precipitated (nonskeletal) calcium carbonate from their guts ("low" and "high" Mg-calcite and aragonite), but that very fine-grained (mostly 4 mole % MgCO3) are their dominant excretory product. Crystallites from fish are morphologically diverse and species-specific, but all are unique relative to previously known biogenic and abiotic sources of carbonate within open marine systems. Using site specific fish biomass and carbonate excretion rate data we estimate that fish produce ~6.1 x 106 kg CaCO3/year across the Bahamian archipelago, all as mud-grade (the <63 μm fraction) carbonate and thus as a potential sediment constituent. Estimated contributions from fish to total carbonate mud production average ~14% overall, and exceed 70% in specific habitats. Critically, we also document the widespread presence of these distinctive fish-derived carbonates in the finest sediment fractions from all habitat types in the Bahamas, demonstrating that these carbonates have direct relevance to contemporary carbonate sediment budgets. Fish thus represent a hitherto unrecognized but significant source of fine-grained carbonate sediment, the discovery of which has direct application to the conceptual ideas of how marine carbonate factories function both today and in the past.

  3. Fish as major carbonate mud producers and missing components of the tropical carbonate factory

    PubMed Central

    Perry, Chris T.; Salter, Michael A.; Harborne, Alastair R.; Crowley, Stephen F.; Jelks, Howard L.; Wilson, Rod W.

    2011-01-01

    Carbonate mud is a major constituent of recent marine carbonate sediments and of ancient limestones, which contain unique records of changes in ocean chemistry and climate shifts in the geological past. However, the origin of carbonate mud is controversial and often problematic to resolve. Here we show that tropical marine fish produce and excrete various forms of precipitated (nonskeletal) calcium carbonate from their guts (“low” and “high” Mg-calcite and aragonite), but that very fine-grained (mostly < 2 μm) high Mg-calcite crystallites (i.e., MgCO3) are their dominant excretory product. Crystallites from fish are morphologically diverse and species-specific, but all are unique relative to previously known biogenic and abiotic sources of carbonate within open marine systems. Using site specific fish biomass and carbonate excretion rate data we estimate that fish produce ∼6.1 × 106 kg CaCO3/year across the Bahamian archipelago, all as mud-grade (the < 63 μm fraction) carbonate and thus as a potential sediment constituent. Estimated contributions from fish to total carbonate mud production average ∼14% overall, and exceed 70% in specific habitats. Critically, we also document the widespread presence of these distinctive fish-derived carbonates in the finest sediment fractions from all habitat types in the Bahamas, demonstrating that these carbonates have direct relevance to contemporary carbonate sediment budgets. Fish thus represent a hitherto unrecognized but significant source of fine-grained carbonate sediment, the discovery of which has direct application to the conceptual ideas of how marine carbonate factories function both today and in the past. PMID:21368155

  4. Fish as major carbonate mud producers and missing components of the tropical carbonate factory.

    PubMed

    Perry, Chris T; Salter, Michael A; Harborne, Alastair R; Crowley, Stephen F; Jelks, Howard L; Wilson, Rod W

    2011-03-08

    Carbonate mud is a major constituent of recent marine carbonate sediments and of ancient limestones, which contain unique records of changes in ocean chemistry and climate shifts in the geological past. However, the origin of carbonate mud is controversial and often problematic to resolve. Here we show that tropical marine fish produce and excrete various forms of precipitated (nonskeletal) calcium carbonate from their guts ("low" and "high" Mg-calcite and aragonite), but that very fine-grained (mostly < 2 μm) high Mg-calcite crystallites (i.e., > 4 mole % MgCO(3)) are their dominant excretory product. Crystallites from fish are morphologically diverse and species-specific, but all are unique relative to previously known biogenic and abiotic sources of carbonate within open marine systems. Using site specific fish biomass and carbonate excretion rate data we estimate that fish produce ∼6.1 × 10(6) kg CaCO(3)/year across the Bahamian archipelago, all as mud-grade (the < 63 μm fraction) carbonate and thus as a potential sediment constituent. Estimated contributions from fish to total carbonate mud production average ∼14% overall, and exceed 70% in specific habitats. Critically, we also document the widespread presence of these distinctive fish-derived carbonates in the finest sediment fractions from all habitat types in the Bahamas, demonstrating that these carbonates have direct relevance to contemporary carbonate sediment budgets. Fish thus represent a hitherto unrecognized but significant source of fine-grained carbonate sediment, the discovery of which has direct application to the conceptual ideas of how marine carbonate factories function both today and in the past.

  5. Major components of metabolic syndrome and adiponectin levels: a cross-sectional study

    PubMed Central

    2014-01-01

    Background Adiponectin is a major regulator of glucose and lipid homeostasis by its insulin sensitizer properties. Since decreased insulin sensitivity is linked to metabolic syndrome (MS), decreased adiponectin levels may be related to its development. The purpose of the study was to investigate the relationship between adiponectin levels and MS. Methods Firstly, we cross-sectionally examined subjects with or without MS submitted to an oral glucose tolerance test at Hospital de Clínicas de Porto Alegre (n = 172). A replication analysis was performed in subjects (n = 422) undergoing cardiac angiography at Hospital São Paulo. Subchronic inflammation (US-CRP), coagulation marker (fibrinogen), insulin sensitivity and resistance (Matsuda ISI and HOMA-IR) were estimated. Plasma total and high molecular weight (HMW) adiponectin were measured. Results Total and HMW adiponectin levels were lower in MS subjects (P < 0.05). Total adiponectin levels were lower in the presence of high waist circumference, low HDL-cholesterol and elevated triglyceride criteria in both samples and by elevated blood pressure and glucose criteria in Porto Alegre. HMW adiponectin levels were lower in the presence of low HDL-cholesterol, elevated triglycerides, and glucose criteria. Total adiponectin levels were positively related with HDL-cholesterol and ISI Matsuda, negatively related with waist circumference, glucose, triglycerides, HOMA-IR, and US-CRP and not related with blood pressure. While adjusting for sex and age, increased adiponectin levels remained associated with a reduced prevalence ratio for MS in both cohorts (P = 0.001). Conclusions Adiponectin levels decreased with increasing number of MS criteria, and it is in part determined by its relationship with HDL, triglycerides and abdominal adiposity. PMID:24568287

  6. (Z)-9-nonacosene-major component of the contact sex pheromone of the beetle Megacyllene caryae.

    PubMed

    Ginzel, Matthew D; Moreira, Jardel A; Ray, Ann M; Millar, Jocelyn G; Hanks, Lawrence M

    2006-02-01

    Male Megacyllene caryae (Gahan) (Coleoptera: Cerambycidae) respond to females only after touching them with their antennae, indicating that mate recognition is mediated by a contact sex pheromone. Gas chromatography-mass spectrometry analyses of whole-body solvent extracts of male and female M. caryae revealed substantial differences in hydrocarbon profiles, with nearly half of the compounds in the extracts from females being absent from those of males. Biological activities of fractions of crude extracts of females, and reconstructed blends of the most abundant straight-chain (nC(27), nC(28), nC(29)), methyl-branched (2Me-C(26), 9Me-C(29), 11, 13, 15Me-C(29)), and unsaturated (Z9:C(29), Z13:C(29), Z14:C(29), Z13:C(31), Z14:C(31), Z15:C(31)) compounds in extracts of females were tested in arena bioassays, assessing four steps in the mating behavior sequence of males (orientation, arrestment, body alignment, mounting and attempting to couple the genitalia). Males showed limited response to dead females treated with fractions of the crude extract or blends of synthetic straight-chain and methyl-branched alkanes, but responded strongly to the blend of synthetic monoenes. Further trials determined that the complete sequence of mating behaviors, up to and including coupling the genitalia, was elicited by Z9:C(29) alone. Z9:C(29) is a homolog of the contact pheromone (Z9:C(25)) of the congener M. robiniae (Förster). Previous work with M. robiniae suggested that wipe sampling of cuticular hydrocarbons of females by solid phase microextraction yielded a more representative profile of components actually encountered by a male's antennae, and so provided a more readily interpretable profile of potential semiochemicals present in the wax layer than does solvent extraction. We tested this hypothesis by comparing hydrocarbon profiles of female M. caryae by the two sampling methods. Z9:C(29) was the only compound among the dominant hydrocarbons that was present in higher

  7. Process of timbral composing

    NASA Astrophysics Data System (ADS)

    Withrow, Sam

    In this paper, I discuss the techniques and processes of timbral organization I developed while writing my chamber work, Afterimage. I compare my techniques with illustrative examples by other composers to place my work in historical context. I examine three elements of my composition process. The first is the process of indexing and cataloging basic sonic materials. The second consists of the techniques and mechanics of manipulating and assembling these collections into larger scale phrases, textures, and overall form in a musical work. The third element is the more elusive, and often extra-musical, source of inspiration and motivation. The evocative power of tone color is both immediately evident yet difficult to explain. What is timbre? This question cannot be answered solely in scientific terms; subjective factors affect our perception of it.

  8. Pharmacokinetic interactions induced by content variation of major water-soluble components of Danshen preparation in rats

    PubMed Central

    Chang, Bo-bo; Zhang, Lin; Cao, Wan-wen; Cao, Yuan; Yang, Wen-liang; Wang, Yan; Chen, Yuan-cheng; Liu, Xiao-quan

    2010-01-01

    Aim: To investigate the pharmacokinetic interactions induced by content variation of the main water-soluble components of Danshen injection in rats. Methods: Intravenous Danshen injection (control) or Danshen injection with danshensu (DSS), protocatechuic aldehyde (PAL), salvianolic acid A (Sal A) or salvianolic acid B (Sal B) were administered to female Sprague Dawley rats . Plasma concentrations of DSS, Sal A, PAL and its oxidative metabolite protocatechuic acid (PA) were analyzed simultaneously with LC-MS/MS; concentrations of Sal B were determined by the LC-MS method. Non-compartmental pharmacokinetic parameters were calculated and compared for identifying the pharmacokinetic interactions among these components. Results: Compared with the control group, the DSS, Sal A, and Sal B groups had significant increases in AUC0-∞ in response to elevated concentrations of PAL (by 78.1%, 51.0%, and 82.9%, respectively), while the clearances (CL) were markedly reduced (by 42.5%, 32.9%, and 46.8%, respectively). Similarly, Sal A increased the AUC0–∞ of DSS and Sal B (26.7% and 82.4%, respectively) and substantially decreased their clearances (21.4% and 45.6%, respectively). In addition, the pharmacokinetics of DSS and Sal B were significantly affected by the content variation of the other major components; the AUC0-∞ increased by 45.1% and 52.1%, respectively, the CL dropped by 29.6% and 27.1%, respectively, and the T1/2 was decreased by 22.0% and 19.6%, respectively. Conclusion: Complex, extensive pharmacokinetic interactions were observed among the major water-soluble constituents in the Danshen injection. The content variation of PAL had the most significant effect on the pharmacokinetic behaviors of other major constituents. Furthermore, the pharmacokinetics of DSS and Sal B were the most susceptible to the content change of other components. PMID:20364158

  9. Composing Disability: Diagnosis, Interrupted.

    PubMed

    Wilkerson, Abby; Fisher, Joseph; Fletcher, Wade

    2016-12-01

    Writing is central both to the medical diagnostic codification of disability and to disabled people's efforts to interrupt, complicate, or disrupt dominant medical narratives. This Symposium, like the George Washington University conference from which it takes its name, creates space for diverse modes and genres of claiming authority regarding diagnosis and its cultural and material effects. "Queer" and "crip" interrogations of diagnosis illuminate its status as a cultural phenomenon, embracing culturally disavowed embodiments and embodied experiences as tools for diagnosing inegalitarian social relations and opportunities for cultural interventions. This Symposium traces the workings of diagnostic normativity manifested in experiences such as "disruptive deafness," unstable bodily materialities, pathologized grief and other forms of affective distress, and "surgical assemblages." It presents a diverse array of compositions, articulated on each writer's own terms, addressing a range of embodied experiences through multiple genres and voices, ranging from conversation transcript to scholarly essay, poetry, graphic memoir, and personal essay. Here, laypersons interrupt monologic medical diagnosis, claiming space to compose themselves. Together, the authors trace instances of corporeal "correction" back to the noxious agents, both environmental and political, that consistently breach the boundaries of corporeality.

  10. Host cell-induced components of the sulfate assimilation pathway are major protective antigens of Mycobacterium tuberculosis.

    PubMed

    Pinto, Rachel; Leotta, Lisa; Shanahan, Erin R; West, Nicholas P; Leyh, Thomas S; Britton, Warwick; Triccas, James A

    2013-03-01

    New therapies to control tuberculosis are urgently required because of the inability of the only available vaccine, BCG, to adequately protect against tuberculosis. Here we demonstrate that proteins of the Mycobacterium tuberculosis sulfate-assimilation pathway (SAP) represent major immunogenic targets of the bacillus, as defined by strong T-cell recognition by both mice and humans infected with M. tuberculosis. SAP proteins displayed increased expression when M. tuberculosis was resident within host cells, which may account in part for their ability to stimulate anti-M. tuberculosis host immunity. Vaccination with the first enzyme in this pathway, adenosine-5'-triphosphate sulfurylase, conferred significant protection against murine tuberculosis and boosted BCG-induced protective immunity in the lung. Therefore, we have identified SAP components as a new family of M. tuberculosis antigens, and we have demonstrated that these components are promising candidate for inclusion in new vaccines to control tuberculosis in humans.

  11. Host Cell–Induced Components of the Sulfate Assimilation Pathway Are Major Protective Antigens of Mycobacterium tuberculosis

    PubMed Central

    Pinto, Rachel; Leotta, Lisa; Shanahan, Erin R.; West, Nicholas P.; Leyh, Thomas S.; Britton, Warwick; Triccas, James A.

    2013-01-01

    New therapies to control tuberculosis are urgently required because of the inability of the only available vaccine, BCG, to adequately protect against tuberculosis. Here we demonstrate that proteins of the Mycobacterium tuberculosis sulfate-assimilation pathway (SAP) represent major immunogenic targets of the bacillus, as defined by strong T-cell recognition by both mice and humans infected with M. tuberculosis. SAP proteins displayed increased expression when M. tuberculosis was resident within host cells, which may account in part for their ability to stimulate anti-M. tuberculosis host immunity. Vaccination with the first enzyme in this pathway, adenosine-5′-triphosphate sulfurylase, conferred significant protection against murine tuberculosis and boosted BCG-induced protective immunity in the lung. Therefore, we have identified SAP components as a new family of M. tuberculosis antigens, and we have demonstrated that these components are promising candidate for inclusion in new vaccines to control tuberculosis in humans. PMID:23225904

  12. Major component composition of PM 10 and PM 2.5 from roadside and urban background sites

    NASA Astrophysics Data System (ADS)

    Harrison, Roy M.; Jones, Alan M.; Lawrence, Royston G.

    Using dichotomous Partisol samplers, airborne particulate matter has been collected and analysed as PM 2.5 and PM 10. The instruments were deployed at four sets of paired roadside and urban background locations, three in London and one in Birmingham (UK) and the sampling protocols aimed to give equal weight to all seasons of the year. In addition to determination of sample mass, concentrations have been determined for major chemical components as follows: sulphate, nitrate, chloride, organic carbon, elemental carbon, iron and calcium. The measured concentrations have been converted to equivalent quantities of ammonium sulphate, ammonium nitrate (in PM 2.5), sodium nitrate (in PM 2.5-10), sodium chloride, elemental carbon, carbon compounds, gypsum and iron-rich dusts. The mass of strongly bound water has also been calculated following the mass closure methodology of Harrison et al. (Atmos. Environ. 37 (2003) 4927). Examination of the difference between roadside (mean 34.7 μg m -3 PM 10) and corresponding urban background (mean 23.2 μg m -3 PM 10) samples indicates average mass increments of 11.5 μg m -3 of PM 10 and 8.0 μg m -3 of PM 2.5 for the four site pairs, and that the roadside particle increment is comprised very largely of elemental carbon, organic compounds and iron-rich dusts. The major component composition lies somewhere between that reported as typical of the eastern and western US. A comparison with PM 2.5 and PM 15 sampled in Leeds (UK) in 1982 shows a decline in all major constituents except mineral dusts (PM 2.5 only). In a comparison of data for days with PM 10 above the EU 24-h Limit Value of 50 μg m -3 with data from all days, the component showing the greatest ratio between high pollution days and all days is fine particle nitrate.

  13. Localization of polysialoglycoprotein as a major glycoprotein component in cortical alveoli of the unfertilized eggs of Salmo gairdneri.

    PubMed

    Inoue, S; Kitajima, K; Inoue, Y; Kudo, S

    1987-10-01

    Polysialoglycoprotein (PSGP, 200 kDa), first isolated by S. Inoue and M. Iwasaki in 1978 (Biochem. Biophys. Res. Commun. 83, 1018-1023) from unfertilized eggs of rainbow trout, has been shown to comprise a unique class of glycoproteins associated with the exocytosis of cortical alveoli. In 1986, 200-kDa PSGP was shown to undergo proteolytic depolymerization to 9-kDa PSGP on egg fertilization (activation) and there was an indication that 200-kDa PSGP may possibly be a component of cortical alveoli (J. Biol. Chem. 261, 5256-5261). In this paper we present evidence demonstrating that PSGP is actually a component of cortical alveolus. First, a cortical alveolus-rich fraction (CA fraction) was obtained by low-speed centrifugation of the homogenate of unfertilized eggs of rainbow trout. The 200-kDa PSGP was found to be a major component extractable with buffered saline from the CA fraction by chemical analysis of isolated materials. Treatment of the eggs to induce parthenogenetic activation resulted in all cases in the loss of both cortical alveoli and PSGP in the CA fraction. Second, perivitelline space fluid was isolated from the activated eggs of rainbow trout and analyzed, and 9-kDa PSGP was confirmed to be present as a major proteinaceous component. Third, following incubation of the eggs in water for activation, the time course of the appearance of 9-kDa PSGP and the breakdown of 200-kDa PSGP was observed. The formation of 9-kDa PSGP was detected in the eggs after 1 min of incubation and its level rose rapidly, attaining a maximum at 7 min after incubation. During this period, there was a concomitant fall in the level of 200-kDa PSGP. This formation and rapid increase in 9-kDa PSGP correspond directly to the time course of cortical alveolus exocytosis in activated chum salmon eggs recently studied by scanning electron microscopy.

  14. PTSD in victims of sexual assault: test of a major component of the Ehlers-Clark theory.

    PubMed

    Fairbrother, Nichole; Rachman, S

    2006-06-01

    We investigated a major component of the Ehlers-Clark theory of post-traumatic stress disorder (PTSD) in a sample of 50 female victims of sexual assault. In particular, we tested the hypothesis that the victims' appraisals of the trauma and its consequences contribute significantly to the persistence of PTSD symptoms. The results indicated that the victims' appraisals of the sexual assault and its sequelae are strongly and positively related to PTSD symptoms. This finding remained significant after statistically controlling for the perceived severity of the assault. Most of the results are consistent with the Ehlers-Clark theory.

  15. Distribution and excretion of 2,4,5,2',4',5'-hexabromobiphenyl, the major component of Firemaster BP-6.

    PubMed

    Matthews, H B; Kato, S; Morales, N M; Tuey, D B

    1977-10-01

    The intestinal absorption, distribution, and excretion of the major component of Firemaster BP-6,2,4,5,2',4',5'-hexabromobiphenyl, has been studied in the male rat. This polybrominated biphenyl was readily absorbed from the intestine, initially distributed throughout the body, and eventually stored primarily in the adipose tissue, was not subject to appreciable metabolism, and was excreted almost exclusively in the feces and at a very slow rate. Approximately 90% of an oral dose was absorbed from the intestine, and extrapolation of the rate of excretion to infinity indicates that less than 10% of the total dose would ever be excreted.

  16. Chemical composition of the major components of PM in different sites at the Metropolitan Region of Chile

    NASA Astrophysics Data System (ADS)

    Reyes, F.; Castillo, M. A.; Rubio, M.; Gramsch, E.; Vasquez, Y.; Oyola, P.

    2013-05-01

    Santiago, Chile's capital is one of most polluted megacity (5.5 million of people) of the world. Currently, PM2.5 annual concentration is over 2.2 times the Chilean standard (20 μg/m3). Continuous measurements of non-refractory PM1.0 (sulfate, nitrate, chloride, ammonium and organics aerosols), black carbon, and PM2,5 mass concentration were determined using Aerosol Chemical Speciation Monitor (ACSM, Aerodyne Research, Inc), absorption coefficient monitor (SIMCA, Santiago University) and dustrack monitor (TSI Inc) in order to know the temporal variability of the major components of PM. The measurements were carried out at kerbside, urban background, industrial and mixed residential/industrial locations during year 2012 and -2013. Meteorological data (Relative Humidity, temperature, wind speed, wind direction and precipitations) were obtained from the air quality network operated by the environmental authority. The results show strong correlation with the metropolitan region major sources. Multiple regression analysis indicates that precipitations have a strong impact on PM1.0 soluble components; relative humidity has effects only on chloride, sulfate and black carbon. Chloride concentration decrease when temperature is increasing. The perceptual contribution of each component is similar among all sites. All sites shows that OA (Organics Aerosol) as the major constituent of PM1.0 (>50%), followed of nitrates (>13%). Sulfate could be used to differentiate the industrial site; due to there is a strong impact of SO2 emission. Combustion sources direct impact can be seen at BC contribution at industrial and kerbside site. Also, the OA/BC ratio shows slow value at kerbside (3.05) and industrial (3.26) site, and higher at urban background site (4.15). Aged organics aerosols are majority found at all sites (f43/f44 plot), indicating that regional background is strong in all results. These results will be compared with size distribution measurements available from previous

  17. Major components of orange oil inhibit Staphylococcus aureus growth and biofilm formation, and alter its virulence factors.

    PubMed

    Federman, Cassandra; Ma, Christopher; Biswas, Debabrata

    2016-07-01

    Bovine mastitis is a costly disease in the dairy industry and does not always respond to antibiotic treatment. The major components of terpeneless, cold-pressed Valencia orange oil - citral, linalool, decanal and valencene - were examined as potential alternative treatments for Staphylococcus aureus-associated mastitis. The minimum inhibitory concentration (MIC) of all four components against S. aureus was determined after incubation for 24 h. Growth inhibition assays were performed for all effective components on S. aureus for either a 3 h or 72 h treatment. These components were tested for the ability to disrupt pre-formed S. aureus biofilms after 24 h of treatment by measuring absorbance at 540 nm. Cytotoxicity against immortalized bovine mammary epithelial (MAC-T) cells was measured using an MTT assay following a 1 h exposure. Only concentrations below the 50 % cytostatic concentration (CC50) were used in an adherence and invasion assay of S. aureus on MAC-T cells, and for measurements of virulence and biofilm gene expression via qPCR. The MICs of citral and linalool were 0.02 % and 0.12 %, respectively, but decanal and valencene were ineffective. Citral and linalool were capable of inhibiting growth of S. aureus after 24 h at their MIC values and inhibited pre-formed biofilms of S. aureus . The concentrations below the CC50 were 0.02 % for citral and 0.12 % for linalool. These concentrations inhibited the adhesion and invasion ability of S. aureus and downregulated virulence genes. Only 0.12 % linalool downregulated the expression of S. aureus biofilm-forming genes. These components should be considered for further in vivo study.

  18. Teaching Composing with an Identity as a Teacher-Composer

    ERIC Educational Resources Information Center

    Francis, Jennie

    2012-01-01

    I enjoy composing and feel able to write songs that I like and which feel significant to me. This has not always been the case and the change had nothing to do with my school education or my degree. Composing at secondary school did not move beyond Bach and Handel pastiche. I did not take any composing courses during my degree. What did influence…

  19. Teaching Composing with an Identity as a Teacher-Composer

    ERIC Educational Resources Information Center

    Francis, Jennie

    2012-01-01

    I enjoy composing and feel able to write songs that I like and which feel significant to me. This has not always been the case and the change had nothing to do with my school education or my degree. Composing at secondary school did not move beyond Bach and Handel pastiche. I did not take any composing courses during my degree. What did influence…

  20. Structure elucidation of Sch 20562, a glucosidic cyclic dehydropeptide lactone--the major component of W-10 antifungal antibiotic.

    PubMed

    Afonso, A; Hon, F; Brambilla, R

    1999-04-01

    A novel bacterium designated as Aeromonas sp. W-10 produces the antibiotic W-10 complex which comprises of two major and several minor components. The two major components from this complex, Sch 20562 (1) and Sch 20561 (1a), are of biological interest in view of their potent antifungal activity. The chemical degradation studies utilized for the assignment of structure 1 for Sch 20562 are described here. Some of the noteworthy diversity of structural features in this glucosidic cyclic dehydrononapeptide lactone 1 are: an N-terminal (D)-beta-hydroxymyristyl unit, three D-amino acid units, two (E)-alpha-aminocrotonyl units, and an O-alpha-D-glucosyl-N-methyl-L-allo-threonine unit. The structure determination of 1 utilized the selective cleavage of the dehydropeptide units by ozonolysis to form fragments that were sequenced by mass spectrometry. The stereochemistry of the amino acid units were assigned by isolation of the free amino acids from the hydrolysates of the fragments. The stereochemistry of the alpha-aminocrotonyl units and the glucosidic linkage were assigned by nmr spectroscopy and molecular rotation data.

  1. Dissecting carotenoid from structural components of carotenoid-based coloration: a field experiment with great tits (Parus major).

    PubMed

    Jacot, Alain; Romero-Diaz, Cristina; Tschirren, Barbara; Richner, Heinz; Fitze, Patrick S

    2010-07-01

    Carotenoid-based yellowish to red plumage colors are widespread visual signals used in sexual and social communication. To understand their ultimate signaling functions, it is important to identify the proximate mechanism promoting variation in coloration. Carotenoid-based colors combine structural and pigmentary components, but the importance of the contribution of structural components to variation in pigment-based colors (i.e., carotenoid-based colors) has been undervalued. In a field experiment with great tits (Parus major), we combined a brood size manipulation with a simultaneous carotenoid supplementation in order to disentangle the effects of carotenoid availability and early growth condition on different components of the yellow breast feathers. By defining independent measures of feather carotenoid content (absolute carotenoid chroma) and background structure (background reflectance), we demonstrate that environmental factors experienced during the nestling period, namely, early growth conditions and carotenoid availability, contribute independently to variation in yellow plumage coloration. While early growth conditions affected the background reflectance of the plumage, the availability of carotenoids affected the absolute carotenoid chroma, the peak of maximum ultraviolet reflectance, and the overall shape, that is, chromatic information of the reflectance curves. These findings demonstrate that environment-induced variation in background structure contributes significantly to intraspecific variation in yellow carotenoid-based plumage coloration.

  2. Composing the Curriculum: Teacher Identity

    ERIC Educational Resources Information Center

    Lewis, Rebecca

    2012-01-01

    What is composing and how is it valued? What does a good education in composing look like; what constraints hinder it and is it possible to overcome such constraints? Can composing be a personal, creative and valuable activity for the school student? What role does the teacher play in all of this? These are questions that I discuss in this…

  3. Aspartic Proteases and Major Cell Wall Components in Candida albicans Trigger the Release of Neutrophil Extracellular Traps.

    PubMed

    Zawrotniak, Marcin; Bochenska, Oliwia; Karkowska-Kuleta, Justyna; Seweryn-Ozog, Karolina; Aoki, Wataru; Ueda, Mitsuyoshi; Kozik, Andrzej; Rapala-Kozik, Maria

    2017-01-01

    Neutrophils use different mechanisms to cope with pathogens that invade the host organism. The most intriguing of these responses is a release of neutrophil extracellular traps (NETs) composed of decondensed chromatin and granular proteins with antimicrobial activity. An important potential target of NETs is Candida albicans-an opportunistic fungal pathogen that employs morphological and phenotype switches and biofilm formation during contact with neutrophils, accompanied by changes in epitope exposition that mask the pathogen from host recognition. These processes differ depending on infection conditions and are thus influenced by the surrounding environment. In the current study, we compared the NET release by neutrophils upon contact with purified main candidal cell surface components. We show here for the first time that in addition to the main cell wall-building polysaccharides (mannans and β-glucans), secreted aspartic proteases (Saps) trigger NETs with variable intensities. The most efficient NET-releasing response is with Sap4 and Sap6, which are known to be secreted by fungal hyphae. This involves mixed, ROS-dependent and ROS-independent signaling pathways, mainly through interactions with the CD11b receptor. In comparison, upon contact with the cell wall-bound Sap9 and Sap10, neutrophils responded via a ROS-dependent mechanism using CD16 and CD18 receptors for protease recognition. In addition to the Saps tested, the actuation of selected mediating kinases (Src, Syk, PI3K, and ERK) was also investigated. β-Glucans were found to trigger a ROS-dependent process of NET production with engagement of Dectin-1 as well as CD11b and CD18 receptors. Mannans were observed to be recognized by TLRs, CD14, and Dectin-1 receptors and triggered NET release mainly via a ROS-independent pathway. Our results thus strongly suggest that neutrophils activate NET production in response to different candidal components that are presented locally at low concentrations at the

  4. Aspartic Proteases and Major Cell Wall Components in Candida albicans Trigger the Release of Neutrophil Extracellular Traps

    PubMed Central

    Zawrotniak, Marcin; Bochenska, Oliwia; Karkowska-Kuleta, Justyna; Seweryn-Ozog, Karolina; Aoki, Wataru; Ueda, Mitsuyoshi; Kozik, Andrzej; Rapala-Kozik, Maria

    2017-01-01

    Neutrophils use different mechanisms to cope with pathogens that invade the host organism. The most intriguing of these responses is a release of neutrophil extracellular traps (NETs) composed of decondensed chromatin and granular proteins with antimicrobial activity. An important potential target of NETs is Candida albicans—an opportunistic fungal pathogen that employs morphological and phenotype switches and biofilm formation during contact with neutrophils, accompanied by changes in epitope exposition that mask the pathogen from host recognition. These processes differ depending on infection conditions and are thus influenced by the surrounding environment. In the current study, we compared the NET release by neutrophils upon contact with purified main candidal cell surface components. We show here for the first time that in addition to the main cell wall-building polysaccharides (mannans and β-glucans), secreted aspartic proteases (Saps) trigger NETs with variable intensities. The most efficient NET-releasing response is with Sap4 and Sap6, which are known to be secreted by fungal hyphae. This involves mixed, ROS-dependent and ROS-independent signaling pathways, mainly through interactions with the CD11b receptor. In comparison, upon contact with the cell wall-bound Sap9 and Sap10, neutrophils responded via a ROS-dependent mechanism using CD16 and CD18 receptors for protease recognition. In addition to the Saps tested, the actuation of selected mediating kinases (Src, Syk, PI3K, and ERK) was also investigated. β-Glucans were found to trigger a ROS-dependent process of NET production with engagement of Dectin-1 as well as CD11b and CD18 receptors. Mannans were observed to be recognized by TLRs, CD14, and Dectin-1 receptors and triggered NET release mainly via a ROS-independent pathway. Our results thus strongly suggest that neutrophils activate NET production in response to different candidal components that are presented locally at low concentrations at the

  5. NMR-spectroscopic screening of spider venom reveals sulfated nucleosides as major components for the brown recluse and related species

    PubMed Central

    Schroeder, Frank C.; Taggi, Andrew E.; Gronquist, Matthew; Malik, Rabia U.; Grant, Jacqualine B.; Eisner, Thomas; Meinwald, Jerrold

    2008-01-01

    Extensive chemical analyses of spider venoms from many species have revealed complex mixtures of biologically active compounds, of which several have provided important leads for drug development. We have recently shown that NMR spectroscopy can be used advantageously for a direct structural characterization of the small-molecule content of such complex mixtures. Here, we report the application of this strategy to a larger-scale analysis of a collection of spider venoms representing >70 species, which, in combination with mass spectrometric analyses, allowed the identification of a wide range of known, and several previously undescribed, small molecules. These include polyamines, common neurotransmitters, and amino acid derivatives as well as two additional members of a recently discovered family of natural products, the sulfated nucleosides. In the case of the well studied brown recluse spider, Loxosceles reclusa, sulfated guanosine derivatives were found to comprise the major small-molecule components of the venom. PMID:18794518

  6. The proteins of the grape (Vitis vinifera L.) seed endosperm: fractionation and identification of the major components.

    PubMed

    Gazzola, Diana; Vincenzi, Simone; Gastaldon, Luca; Tolin, Serena; Pasini, Gabriella; Curioni, Andrea

    2014-07-15

    In the present study, grape (Vitis vinifera L.) seed endosperm proteins were characterized after sequential fractionation, according to a modified Osborne procedure. The salt-soluble fraction (albumins and globulins) comprised the majority (58.4%) of the total extracted protein. The protein fractions analysed by SDS-PAGE showed similar bands, indicating different solubility of the same protein components. SDS-PAGE in non-reducing and reducing conditions revealed the polypeptide composition of the protein bands. The main polypeptides, which were similar in all the grape varieties analysed, were identified by LC-MS/MS as homologous to the 11S globulin-like seed storage proteins of other plant species, while a monomeric 43 kDa protein presented high homology with the 7S globulins of legume seeds. The results provide new insights about the identity, structure and polypeptide composition of the grape seed storage proteins. Copyright © 2014 Elsevier Ltd. All rights reserved.

  7. Alpha-eleostearic acid and its dihydroxy derivative are major apoptosis-inducing components of bitter gourd.

    PubMed

    Kobori, Masuko; Ohnishi-Kameyama, Mayumi; Akimoto, Yukari; Yukizaki, Chizuko; Yoshida, Mitsuru

    2008-11-26

    Bitter gourd ( Momordica charantia L.) pericarp, placenta, and seed extracts were previously shown to induce apoptosis in HL60 human leukemia cells. To determine the active component that induces apoptosis in cancer cells, bitter gourd ethanol extract was fractionated by liquid-liquid partition and silica gel column chromatography. Several fractions obtained by silica gel column chromatography inhibited growth and induced apoptosis in HL60 cells. Among them, fraction 7 had the strongest activity in inhibiting growth and inducing apoptosis in HL60 cells. A component that induced apoptosis in HL60 cells was then isolated from fraction 7 by another silica gel column chromatography and high-performance liquid chromatography (HPLC) using a C18 column and was identified as (9Z,11E,13E)-15,16-dihydroxy-9,11,13-octadecatrienoic acid (15,16-dihydroxy alpha-eleostearic acid). 15,16-Dihydroxy alpha-eleostearic acid induced apoptosis in HL60 cells within 5 h at a concentration of 160 microM (50 microg/mL). (9Z,11E,13E)-9,11,13-Octadecatrienoic acid (alpha-eleostearic acid) is known to be the major conjugated linolenic acid in bitter gourd seeds. Therefore, the effect of alpha-eleostearic acid on the growth of some cancer and normal cell lines was examined. alpha-Eleostearic acid strongly inhibited the growth of some cancer and fibroblast cell lines, including those of HL60 leukemia and HT29 colon carcinoma. alpha-Eleostearic acid induced apoptosis in HL60 cells after a 24 h incubation at a concentration of 5 microM. Thus, alpha-eleostearic acid and the dihydroxy derivative from bitter gourd were suggested to be the major inducers of apoptosis in HL60 cells.

  8. Pulmonary epithelial response in the rat lung to instilled Montserrat respirable dusts and their major mineral components

    PubMed Central

    Housley, D; Berube, K; Jones, T; Anderson, S; Pooley, F; Richards, R

    2002-01-01

    Background: The Soufriere Hills, a stratovolcano on Montserrat, started erupting in July 1995, producing volcanic ash, both from dome collapse pyroclastic flows and phreatic explosions. The eruptions/ash resuspension result in high concentrations of suspended particulate matter in the atmosphere, which includes cristobalite, a mineral implicated in respiratory disorders. Aims: To conduct toxicological studies on characterised samples of ash, together with major components of the dust mixture (anorthite, cristobalite), and a bioreactive mineral control (DQ12 quartz). Methods: Rats were challenged with a single mass (1 mg) dose of particles via intratracheal instillation and groups sacrificed at one, three, and nine weeks. Acute bioreactivity of the particles was assessed by increases in lung permeability and inflammation, changes in epithelial cell markers, and increase in the size of bronchothoracic lymph nodes. Results: Data indicated that respirable ash derived from pyroclastic flows (20.1% cristobalite) or phreatic explosion (8.6% cristobalite) had minimal bioreactivity in the lung. Anorthite showed low bioreactivity, in contrast to pure cristobalite, which showed progressive increases in lung damage. Conclusion: Results suggests that either the percentage mass of cristobalite particles present in Montserrat ash was not sufficient as a catalyst in the lung environment, or its surface reactivity was masked by the non-reactive volcanic glass components during the process of ash formation. PMID:12107295

  9. A major haemorrhage protocol improves the delivery of blood component therapy and reduces waste in trauma massive transfusion.

    PubMed

    Khan, Sirat; Allard, Shubha; Weaver, Anne; Barber, Colin; Davenport, Ross; Brohi, Karim

    2013-05-01

    Major haemorrhage protocols (MHP) are required as part of damage control resuscitation regimens in modern trauma care. The primary objectives of this study were to ascertain whether a MHP improved blood product administration and reduced waste compared to traditional massive transfusion protocols (MTP). Datasets on adult trauma admissions 1 year prior and 1 year post implementation of a MHP at a Level 1 trauma centre were obtained from the trauma registry. Demographic and clinical data were collected prospectively including mechanism of injury, physiological observations, ICU admission and length of stay. The volume of blood components (packed red blood cells, platelets, cryoprecipitate and fresh frozen plasma) issued, transfused, returned to stock and wasted within the first 24h was gathered retrospectively. Over the 2-year study period 2986 patient records were available for analysis. 40 patients required a 10+ Units of packed red blood ells transfusion in the MTP group vs. 56 patients post MHP implementation. The administration of blood component therapy improved significantly post MHP implementation. FFP:PRBC transfusion improved from 1:3 to 1:2 (p<0.01) and CRYO:PRBC improved from 1:10 to 1:7 (p<0.05). We reported a significant reduction in the waste of platelets from 14% to 2% (p<0.01). Outcomes had improved: Median hospital length of stay was reduced from 54 days to 26 days (p<0.05). Implementation of a MHP results in improved delivery of blood components and a reduction in the waste of blood products compared to the older model of MTP. In combination with educational programmes MHP can significantly improve blood product administration and patient outcomes in trauma haemorrhage. Level III diagnostic test study. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  10. Bacterial components are the major contributors to the macrophage stimulating activity exhibited by extracts of common edible mushrooms.

    PubMed

    Tyler, Heather L; Haron, Mona H; Pugh, Nirmal D; Zhang, Jin; Jackson, Colin R; Pasco, David S

    2016-10-12

    Recent studies have indicated that a major contributor to the innate immune enhancing properties of some medicinal plants is derived from the cell wall components of bacteria colonizing these plants. The purpose of the current study was to assess if the bacteria present within edible and medicinal mushrooms substantially contribute to the innate immune stimulating potential of these mushrooms. Whole mushrooms from thirteen types of edible fungi and individual parts from Agaricus bisporus were analyzed for in vitro macrophage activation as well as bacterial lipopolysaccharides (LPS) content, cell load, and community composition. Substantial variation between samples was observed in macrophage activation (over 500-fold), total bacterial load (over 200-fold), and LPS content (over 10 million-fold). Both LPS content (ρ = 0.832, p < 0.0001) and total bacterial load (ρ = 0.701, p < 0.0001) correlated significantly with macrophage activation in the whole mushroom extracts. Extract activity was negated by treatment with NaOH, conditions that inactivate LPS and other bacterial components. Significant correlations between macrophage activation and total bacterial load (ρ = 0.723, p = 0.0001) and LPS content (ρ = 0.951, p < 0.0001) were also observed between different tissues of Agaricus bisporus. Pseudomonas and Flavobacterium were the most prevalent genera identified in the different tissue parts and these taxa were significantly correlated with in vitro macrophage activation (ρ = 0.697, p < 0.0001 and ρ = 0.659, p = 0.0001, respectively). These results indicate that components derived from mushroom associated bacteria contribute substantially to the innate immune enhancing activity exhibited by mushrooms and may result in similar therapeutic actions as reported for ingestion of bacterial preparations such as probiotics.

  11. ISWI Remodeling Complexes in Xenopus Egg Extracts: Identification as Major Chromosomal Components that Are Regulated by INCENP-aurora B

    PubMed Central

    MacCallum, David E.; Losada, Ana; Kobayashi, Ryuji; Hirano, Tatsuya

    2002-01-01

    We previously characterized major components of mitotic chromosomes assembled in Xenopus laevis egg extracts and collectively referred to them as Xenopus chromosome–associated polypeptides (XCAPs). They included five subunits of the condensin complex essential for chromosome condensation. In an effort to identify novel proteins involved in this process, we have isolated XCAP-F and found it to be the Xenopus ortholog of ISWI, a chromatin remodeling ATPase. ISWI exists in two major complexes in Xenopus egg extracts. The first complex contains ACF1 and two low-molecular-weight subunits, most likely corresponding to Xenopus CHRAC. The second complex is a novel one that contains the Xenopus ortholog of the human Williams syndrome transcription factor (WSTF). In the absence of the ISWI complexes, the deposition of histones onto DNA is apparently normal, but the spacing of nucleosomes is greatly disturbed. Despite the poor spacing of nucleosomes, ISWI depletion has little effect on DNA replication, chromosome condensation or sister chromatid cohesion in the cell-free extracts. The association of ISWI with chromatin is cell cycle regulated and is under the control of the INCENP-aurora B kinase complex that phosphorylates histone H3 during mitosis. Apparently contradictory to the generally accepted model, we find that neither chromosome condensation nor chromosomal targeting of condensin is compromised when H3 phosphorylation is drastically reduced by depletion of INCENP-aurora B. PMID:11809820

  12. Ceftriaxone-associated gallbladder sludge. Identification of calcium-ceftriaxone salt as a major component of gallbladder precipitate

    SciTech Connect

    Park, H.Z.; Lee, S.P.; Schy, A.L. )

    1991-06-01

    Ceftriaxone, a third-generation cephalosporin, is partially excreted into bile. With its clinical use, the formation of gallbladder sludge detected by ultrasonography has been reported. Four surgical specimens were examined and no gallstones were found. Instead, fine precipitates of 20-250 microns were present. Microscopically, there was a small number of cholesterol monohydrate crystals and bilirubin granules among an abundant amount of granular-crystalline material that was not morphologically cholesterol monohydrate crystals. The chemical composition of the precipitates (n = 4) was determined. There was a small amount of cholesterol (1.7% +/- 0.8%) and bilirubin (13.9% +/- 0.74%). The major component of the precipitate was a residue. On further analysis using thin-layer chromatography, high-performance liquid chromatography, and electron microprobe analysis, the residue was identified as a calcium salt of ceftriaxone. The residue also had identical crystal morphology and chromatographic elution profile as authentic calcium-ceftriaxone standards. It is concluded that ceftriaxone, after excretion and being concentrated in the gallbladder bile, can form a precipitate. The major constituent has been identified as a ceftriaxone-calcium salt.

  13. ISWI remodeling complexes in Xenopus egg extracts: identification as major chromosomal components that are regulated by INCENP-aurora B.

    PubMed

    MacCallum, David E; Losada, Ana; Kobayashi, Ryuji; Hirano, Tatsuya

    2002-01-01

    We previously characterized major components of mitotic chromosomes assembled in Xenopus laevis egg extracts and collectively referred to them as Xenopus chromosome-associated polypeptides (XCAPs). They included five subunits of the condensin complex essential for chromosome condensation. In an effort to identify novel proteins involved in this process, we have isolated XCAP-F and found it to be the Xenopus ortholog of ISWI, a chromatin remodeling ATPase. ISWI exists in two major complexes in Xenopus egg extracts. The first complex contains ACF1 and two low-molecular-weight subunits, most likely corresponding to Xenopus CHRAC. The second complex is a novel one that contains the Xenopus ortholog of the human Williams syndrome transcription factor (WSTF). In the absence of the ISWI complexes, the deposition of histones onto DNA is apparently normal, but the spacing of nucleosomes is greatly disturbed. Despite the poor spacing of nucleosomes, ISWI depletion has little effect on DNA replication, chromosome condensation or sister chromatid cohesion in the cell-free extracts. The association of ISWI with chromatin is cell cycle regulated and is under the control of the INCENP-aurora B kinase complex that phosphorylates histone H3 during mitosis. Apparently contradictory to the generally accepted model, we find that neither chromosome condensation nor chromosomal targeting of condensin is compromised when H3 phosphorylation is drastically reduced by depletion of INCENP-aurora B.

  14. 40 CFR Table W-1b to Subpart W of... - Default Average Component Counts for Major Onshore Natural Gas Production Equipment

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Major Onshore Natural Gas Production Equipment W Table W-1B to Subpart W of Part 98 Protection of... REPORTING Petroleum and Natural Gas Systems Pt. 98, Subpt. W, Table W-1B Table W-1B to Subpart W of Part 98—Default Average Component Counts for Major Onshore Natural Gas Production Equipment Major equipment Valves...

  15. 40 CFR Table W-1b to Subpart W of... - Default Average Component Counts for Major Onshore Natural Gas Production Equipment

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Major Onshore Natural Gas Production Equipment W Table W-1B to Subpart W of Part 98 Protection of... REPORTING Petroleum and Natural Gas Systems Pt. 98, Subpt. W, Table W-1B Table W-1B to Subpart W of Part 98—Default Average Component Counts for Major Onshore Natural Gas Production Equipment Major equipment Valves...

  16. Primary Fatty Alcohols Are Major Components of Suberized Root Tissues of Arabidopsis in the Form of Alkyl Hydroxycinnamates.

    PubMed

    Delude, Camille; Fouillen, Laetitia; Bhar, Palash; Cardinal, Marie-Josée; Pascal, Stephanie; Santos, Patricia; Kosma, Dylan K; Joubès, Jérôme; Rowland, Owen; Domergue, Frédéric

    2016-07-01

    Suberin is a complex hydrophobic polymer that acts as a barrier controlling water and solute fluxes and restricting pathogen infections. Suberin is deposited immediately outside of the plasmalemma in the cell wall of certain tissues such as endodermis of roots, aerial and underground periderms, and seed coats. Suberin consists of a variety of fatty acid derivatives polymerized with glycerol and phenolics. In this study, we show using liquid chromatography-tandem mass spectrometry and gas chromatography-mass spectrometry techniques that most of the fatty alcohols not covalently linked to the suberin polymer are in the form of alkyl hydroxycinnamates (AHCs), with alkyl caffeates predominating. Such compounds are not restricted to the periderm of mature roots but also are present in the endodermis of younger roots, where they are not extracted by rapid dipping in chloroform. Analysis of several mutants affected in key enzymes involved in the biosynthesis and export of suberin monomers suggests that the formation of the suberin polymer and associated waxes involves common pathways and occurs concomitantly in Arabidopsis (Arabidopsis thaliana) roots. Although fatty alcohols represent only minor components of the suberin polymer in Arabidopsis roots, this study demonstrates that they constitute the major aliphatics of suberin-associated waxes in the form of AHCs. Therefore, our results indicate that esterified fatty alcohols, both soluble and polymerized forms, represent major constituents of Arabidopsis root suberized barriers, being as abundant as α,ω-dicarboxylic and unsubstituted fatty acids. In addition, our results show that suberized layers represent a major sink for acyl-lipid metabolism in Arabidopsis roots.

  17. Primary Fatty Alcohols Are Major Components of Suberized Root Tissues of Arabidopsis in the Form of Alkyl Hydroxycinnamates1[OPEN

    PubMed Central

    Delude, Camille; Fouillen, Laetitia; Bhar, Palash; Cardinal, Marie-Josée; Pascal, Stephanie; Kosma, Dylan K.; Joubès, Jérôme

    2016-01-01

    Suberin is a complex hydrophobic polymer that acts as a barrier controlling water and solute fluxes and restricting pathogen infections. Suberin is deposited immediately outside of the plasmalemma in the cell wall of certain tissues such as endodermis of roots, aerial and underground periderms, and seed coats. Suberin consists of a variety of fatty acid derivatives polymerized with glycerol and phenolics. In this study, we show using liquid chromatography-tandem mass spectrometry and gas chromatography-mass spectrometry techniques that most of the fatty alcohols not covalently linked to the suberin polymer are in the form of alkyl hydroxycinnamates (AHCs), with alkyl caffeates predominating. Such compounds are not restricted to the periderm of mature roots but also are present in the endodermis of younger roots, where they are not extracted by rapid dipping in chloroform. Analysis of several mutants affected in key enzymes involved in the biosynthesis and export of suberin monomers suggests that the formation of the suberin polymer and associated waxes involves common pathways and occurs concomitantly in Arabidopsis (Arabidopsis thaliana) roots. Although fatty alcohols represent only minor components of the suberin polymer in Arabidopsis roots, this study demonstrates that they constitute the major aliphatics of suberin-associated waxes in the form of AHCs. Therefore, our results indicate that esterified fatty alcohols, both soluble and polymerized forms, represent major constituents of Arabidopsis root suberized barriers, being as abundant as α,ω-dicarboxylic and unsubstituted fatty acids. In addition, our results show that suberized layers represent a major sink for acyl-lipid metabolism in Arabidopsis roots. PMID:27231100

  18. How Composers Compose: In Search of the Questions

    ERIC Educational Resources Information Center

    Andrews, Bernard W.

    2004-01-01

    The Genesis Project is a multi-phase research project designed for the purpose of developing an in-depth understanding of the nature of musical creativity by investigating how composers compose. In this first phase of the project, an understanding of the four dimensions of musical creativity: (1) the "person", (2) the compositional…

  19. Discourse Theory: Implications for Research in Composing.

    ERIC Educational Resources Information Center

    Odell, Lee; And Others

    Although current theories concerning the composing process overlap in useful and interesting ways, a paradigm is emerging. This article discusses two of the major assumptions of this emerging paradigm: that there are distinct purposes for each kind of discourse (for example, expressive, literary, persuasive, and referential) and that the relation…

  20. [Effects of soy isoflavones and major active component genistein on the expression of ovarian estrogen receptor-α in rats].

    PubMed

    Zhang, Yi-hong; Pang, Hai-yan; Xiao, Xiao-hui; Wen, Hai-xia; Ni, Jiang

    2011-07-26

    To investigate the effects of soy isoflavones (SI) on the expression of estrogen receptor-α (ER-α) in senile rat ovaries and ovarian granulosa cell cultured in vitro treated with genistein, a major active component of SI. The animal model of perimenopause rats was established by unforced aging. The animals were treated by intragastric administration (ig) with low (50 mg/kg), middle (158 mg/kg) and high (500 mg/kg) dose of SI for 8 weeks. The expressions of ER-α mRNA and protein were detected by reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemistry respectively. The granulosa cells of rat ovaries were isolated and administered with genistein (0, 0.1, 1, 5, 10, 100 µmol/L) for 48 h and the expression levels of ER-α mRNA detected by RT-PCR. The ER-α mRNA expression levels of the low, middle and high dose groups of SI (0.207 ± 0.014, 0.316 ± 0.073 and 0.402 ± 0.170 respectively) were higher than those of the model group (0.671 ± 0.170) (all P < 0.01). The expression levels of ER-α protein for the low, middle and high dose groups of SI (7.35 ± 4.90, 13.90 ± 5.12 and 23.79 ± 10.31 respectively) were higher than those of the model group (2.74 ± 0.09) (all P < 0.01). The expression levels of ER-α mRNA in granulosa cells treated with 1, 5, 10 µmol/L genistein for 48 h were 0.927 ± 0.232, 1.067 ± 0.154, 1.118 ± 0.126 respectively (all P < 0.01). They were higher than those of the control group (0.671 ± 0.170). But the expression levels of 100 µmol/L genistein group were lower than those of the control group (P < 0.05). Soy isoflavones can up-regulate the expressions of ER-α mRNA and protein in senile rat ovaries. As a major active component of soy isoflavones, genistein can regulate the expressions ER-α mRNA in granulosa cells of rat ovaries. Such an effect is concentration-dependent. And 1-10 µmol/L genistein may up-regulate the expression of ER-α mRNA.

  1. Biosynthesis, targeting and processing of oleosin-like proteins, which are major pollen coat components in Brassica napus.

    PubMed

    Murphy, D J; Ross, J H

    1998-01-01

    The purpose of this study is to characterise the biosynthesis, targeting and processing of some of the major protein components of the pollen coat, or tryphine, of Brassica napus. The authors have N-terminally sequenced 11 of the most abundant pollen coat polypeptides, and nine of these sequences correspond to proteolytically cleaved products of seven oleosin-like genes, i.e. Oln B;1 to Oln B;6 and Oln B;11. The Oln B;11 gene product is co- or post-translationally targeted in vitro to canine microsomal membranes. This implies that the oleosin-like protein is targeted to the endoplasmic reticulum in tapetal cells in vivo. Affinity-purified antibodies raised against a 20-residue domain of Oln B;3 and B;4 gene products cross-reacted with full-length proteins of 45-48 kDa in early developing (< 2 mm to 5 mm) buds and anthers, but recognised truncated proteins of 32-38 kDa at later (4 mm to 7 mm) stages of development. The 45-48 kDa immunoreactive proteins were associated with a floating lipid body fraction obtained from a tapetal/locular fluid extract from maturing anthers and a major 48 kDa polypeptide from this fraction was confirmed by N-terminal sequencing to be a full length product of the Oln B;3 gene. Quantitative immunocytochemical studies showed that the full length 45-48 kDa oleosin-like proteins were specifically localised in the interior of tapetal cytoplasmic lipid bodies where they were associated with a regular hexagonal-like fibrous reticulum. No significant labelling of elaioplasts was observed. The same antibodies specifically labelled 32-38 kDa oleosin-like proteins on the extracellular pollen coat of maturing pollen grains. These results demonstrate for the first time that many of the major pollen coat proteins are derived from an endoproteolytic cleavage of precursor oleosin-like proteins that originally accumulate within the large cytoplasmic lipid bodies of tapetal cells.

  2. Acute effects of decaffeinated coffee and the major coffee components chlorogenic acid and trigonelline on glucose tolerance.

    PubMed

    van Dijk, Aimée E; Olthof, Margreet R; Meeuse, Joke C; Seebus, Elin; Heine, Rob J; van Dam, Rob M

    2009-06-01

    Coffee consumption has been associated with lower risk of type 2 diabetes. We evaluated the acute effects of decaffeinated coffee and the major coffee components chlorogenic acid and trigonelline on glucose tolerance. We conducted a randomized crossover trial of the effects of 12 g decaffeinated coffee, 1 g chlorogenic acid, 500 mg trigonelline, and placebo (1 g mannitol) on glucose and insulin concentrations during a 2-h oral glucose tolerance test (OGTT) in 15 overweight men. Chlorogenic acid and trigonelline ingestion significantly reduced glucose (-0.7 mmol/l, P = 0.007, and -0.5 mmol/l, P = 0.024, respectively) and insulin (-73 pmol/l, P = 0.038, and -117 pmol/l, P = 0.007) concentrations 15 min following an OGTT compared with placebo. None of the treatments affected insulin or glucose area under the curve values during the OGTT compared with placebo. Chlorogenic acid and trigonelline reduced early glucose and insulin responses during an OGTT.

  3. Use of NIRS technology with a remote reflectance fibre-optic probe for predicting major components in bee pollen.

    PubMed

    González-Martín, I; Hernández-Hierro, J M; Barros-Ferreiro, N; Cordón Marcos, C; García-Villanova, R J

    2007-05-15

    In the present work, we study the use of near infra-red spectroscopy (NIRS) technology together with a remote reflectance fibre-optic probe for determination of the major components in bee pollen. The method allows immediate control of the bee pollen without prior sample treatment or destruction through direct application of the fibre-optic probe to the sample. The regression method employed was modified partial least squares (MPLS). The calibration results obtained using 45 samples of bee pollen allowed the measurement of protein, moisture, ash, reducing sugars, and pH with multiple correlation coefficients (RSQ) and prediction corrected standard errors (SEPC) of 0.91, 0.56% for protein, of 0.78 and 0.49% for moisture; 0.92 and 0.049% for ash; 0.81 and 1.32g of glucose/100g of bee pollen; 0.84 and 0.15 for pH, respectively. The prediction capacity of the pattern was checked by applying it to samples of unknown pollen in external validation.

  4. Beta-lipotropin is the major component of the plasma opioid response to surgical stress in humans

    SciTech Connect

    Porro, C.A.; Facchinetti, F.; Bertellini, E.; Petraglia, F.; Stacca, R.; Barbieri, G.C.; Genazzani, A.R.

    1987-12-07

    There is growing experimental evidence that beta-endorphin immunoreactivity is raised by surgical stress in patients undergoing general anesthesia. As the assay methods employed to date did not allow to fully discriminate between beta-endorphin and its immediate precursor, beta-lipotropin, the authors have investigated in the present study plasma levels of these two peptides by separating them by chromatography on plasma extracts prior to radioimmunoassay. Beta-lipotropin, but not beta-endorphin, plasma levels were found to be significantly elevated during surgery in the general anesthesia group, while no change was found in either peptide concentration in the spinal one. Cortisol plasma levels also increased significantly 90 minutes after the beginning of surgery. Although the sampling time they adopted may have prevented them from detecting an early peak of beta-endorphin during the first 30 minutes of surgery, the major component of the pituitary opioid response to surgical stress appears to be related to beta-lipotropin. This is in agreement with results of experimental work on various kinds of stress in animals and humans and seems to rule out a role for plasma beta-endorphin in post-operative analgesia. 38 references, 1 figure, 1 table.

  5. Lemnitoxin, the major component of Micrurus lemniscatus coral snake venom, is a myotoxic and pro-inflammatory phospholipase A2.

    PubMed

    Casais-E-Silva, Luciana L; Teixeira, Catarina F P; Lebrun, Ivo; Lomonte, Bruno; Alape-Girón, Alberto; Gutiérrez, José María

    2016-08-22

    The venom of Micrurus lemniscatus, a coral snake of wide geographical distribution in South America, was fractionated by reverse-phase HPLC and the fractions screened for phospholipase A2 (PLA2) activity. The major component of the venom, a PLA2, here referred to as 'Lemnitoxin', was isolated and characterized biochemically and toxicologically. It induces myotoxicity upon intramuscular or intravenous injection into mice. The amino acid residues Arg15, Ala100, Asn108, and a hydrophobic residue at position 109, which are characteristic of myotoxic class I phospholipases A2, are present in Lemnitoxin. This PLA2 is antigenically related to M. nigrocinctus nigroxin, Notechis scutatus notexin, Pseudechis australis mulgotoxin, and Pseudonaja textilis textilotoxin, as demonstrated with monoclonal and polyclonal antibodies. Lemnitoxin is highly selective in its targeting of cells, being cytotoxic for differentiated myotubes in vitro and muscle fibers in vivo, but not for undifferentiated myoblasts or endothelial cells. Lemnitoxin is not lethal after intravenous injection at doses up to 2μg/g in mice, evidencing its lack of significant neurotoxicity. Lemnitoxin displays anticoagulant effect on human plasma and proinflammatory activity also, as it induces paw edema and mast cell degranulation. Thus, the results of this work demonstrate that Lemnitoxin is a potent myotoxic and proinflammatory class I PLA2.

  6. Estrogenic/antiestrogenic activities of a Epimedium koreanum extract and its major components: in vitro and in vivo studies.

    PubMed

    Kang, Hyun Ku; Choi, Yun-Ho; Kwon, Hyosuk; Lee, Sang-Bum; Kim, Dong-Hyun; Sung, Chung Ki; Park, Young In; Dong, Mi-Sook

    2012-08-01

    The estrogenic and antiestrogenic activities of Epimedii Herba, which is a traditional medicinal herb used in Korea and China were investigated in this study. The in vitro estrogen receptor (ER) mediated estrogenic/antiestrogenic activities of an Epimedii Herba extract (Epi ext) and its major components were determined using an estrogen responsive element driven reporter gene assay in MCF-7/ERE and HEK293T cells. The Epi ext exhibited ERα- and ERβ-mediated estrogenic activity with an EC(50) of 5.0 and 17.8 μM in HEK293T cells, respectively. Prenylflavonoid glycosides such as icariin (ICA), epimedin A, B, and C did not show any in vitro estrogenic or antiestrogenic activities. Icaritin (ICT) and quercetin exhibited in vitro ER mediated estrogenic activity with a more potent interaction with ERβ. In vivo estrogenic activities of the Epi ext, ICA and ICT were compared using an uterotrophic assay. Although the potency of in vitro estrogenic activity was in the order of ICT>Epi ext>ICA, ICA had the strongest estrogenic activity and next ICT in ovariectomized rats. These results collectively suggest that phytoestrogens possess both estrogenic and antiestrogenic activity, and that the differential expression of these two compounds with opposing activities is dependent on the physiological environment in terms of estrogen level, which may be the case in humans.

  7. Inhibitory effects of geranium essential oil and its major component, citronellol, on degranulation and cytokine production by mast cells.

    PubMed

    Kobayashi, Yuko; Sato, Harumi; Yorita, Mika; Nakayama, Hiroto; Miyazato, Hironari; Sugimoto, Keiichiro; Jippo, Tomoko

    2016-06-01

    We investigated the effects of geranium essential oil (GEO) on anaphylaxis. GEO can exert antioxidant and anti-inflammatory effects, but its roles in allergic reactions are incompletely understood. Here, we used mouse cells to show that GEO inhibited the degranulation of cultured mast cells (CMCs). Citronellol is the major component of GEO and inhibited CMC degranulation. The l-enantiomer of citronellol more effectively suppressed CMC degranulation than did d-citronellol. We also examined whether citronellol could inhibit the immunoglobulin (Ig) E-induced production of tumor necrosis factor (TNF)-α. Treatment with various concentrations of citronellol before CMC activation with IgE significantly inhibited the induction of TNF-α in a dose-dependent manner. Mechanistically, citronellol suppressed the phosphorylation of mitogen-activated protein kinase (ERK), which is critical for ERK activation and the production of inflammatory cytokines in mast cells. These findings suggest that citronellol may represent a candidate compound for the effective treatment of allergic diseases.

  8. Aldehyde dehydrogenase, Ald4p, is a major component of mitochondrial fluorescent inclusion bodies in the yeast Saccharomyces cerevisiae

    PubMed Central

    Misonou, Yoshiko; Kikuchi, Maiko; Sato, Hiroshi; Inai, Tomomi; Kuroiwa, Tsuneyoshi; Tanaka, Kenji; Miyakawa, Isamu

    2014-01-01

    ABSTRACT When Saccharomyces cerevisiae strain 3626 was cultured to the stationary phase in a medium that contained glucose, needle-like structures that emitted autofluorescence were observed in almost all cells by fluorescence microscopy under UV excitation. The needle-like structures completely overlapped with the profile of straight elongated mitochondria. Therefore, these structures were designated as mitochondrial fluorescent inclusion bodies (MFIBs). The MFIB-enriched mitochondrial fractions were successfully isolated and 2D-gel electrophoresis revealed that a protein of 54 kDa was only highly concentrated in the fractions. Determination of the N-terminal amino acid sequence of the 54-kDa protein identified it as a mitochondrial aldehyde dehydrogenase, Ald4p. Immunofluorescence microscopy showed that anti-Ald4p antibody specifically stained MFIBs. Freeze-substitution electron microscopy demonstrated that cells that retained MFIBs had electron-dense filamentous structures with a diameter of 10 nm in straight elongated mitochondria. Immunoelectron microscopy showed that Ald4p was localized to the electron-dense filamentous structures in mitochondria. These results together showed that a major component of MFIBs is Ald4p. In addition, we demonstrate that MFIBs are common features that appear in mitochondria of many species of yeast. PMID:24771619

  9. myo-Inositol hexakisphosphate is a major component of an extracellular structure in the parasitic cestode Echinococcus granulosus.

    PubMed Central

    Irigoín, Florencia; Ferreira, Fernando; Fernández, Cecilia; Sim, Robert B; Díaz, Alvaro

    2002-01-01

    myo-Inositol hexakisphosphate (IP(6)) is an abundant intracellular component of animal cells. In this study we describe the presence of extracellular IP(6) in the hydatid cyst wall (HCW) of the larval stage of the cestode parasite Echinococcus granulosus. The HCW comprises an inner cellular layer and an outer, acellular (laminated) layer up to 2 mm in thickness that protects the parasite from host immune cells. A compound, subsequently identified as IP(6), was detected in and purified from an HCW extract on the basis of its capacity to inhibit complement activation. The identification of the isolated compound was carried out by a combination of NMR, MS and TLC. The majority of IP(6) in the HCW was found in the acellular layer, with only a small fraction of the compound being extracted from cells. In the laminated layer, IP(6) was present in association with calcium, and accounted for up to 15% of the total dry mass of the HCW. IP(6) was not detected in any other structures or stages of the parasite. Our results imply that IP(6) is secreted by the larval stage of the parasite in a polarized fashion towards the interface with the host. This is the first report of the secretion of IP(6), and the possible implications beyond the biology of E. granulosus are discussed. PMID:11853537

  10. Potential Effects of Silymarin and Its Flavonolignan Components in Patients with β-Thalassemia Major: A Comprehensive Review in 2015

    PubMed Central

    Darvishi Khezri, Hadi; Salehifar, Ebrahim; Kosaryan, Mehrnoush; Aliasgharian, Aily; Jalali, Hossein; Hadian Amree, Arash

    2016-01-01

    Major β-thalassemia (β-TM) is one of the most common inherited hemolytic types of anemia which is caused as a result of absent or reduced synthesis of β-globin chains of hemoglobin. This defect results in red blood cells lysis and chronic anemia that can be treated by multiple blood transfusions and iron chelation therapy. Without iron chelation therapy, iron overload will cause lots of complications in patients. Antioxidant components play an important role in the treatment of the disease. Silymarin is an antioxidant flavonoid isolated from Silybum marianum plant. In the present study, we reviewed clinical and experimental studies investigating the use of silymarin prior to September 1, 2015, using PubMed, ISI Web of Knowledge, Science Direct, Scopus, Ovid, and Cochrane Library databases and we evaluated the potential effects of silymarin on controlling the complications induced by iron overload in patients with β-TM. Based on the results of the present study, we can conclude that silymarin may be useful as an adjuvant for improving multiple organ dysfunctions. PMID:26997953

  11. A new family of satellite DNA sequences as a major component of centromeric heterochromatin in owls (Strigiformes).

    PubMed

    Yamada, Kazuhiko; Nishida-Umehara, Chizuko; Matsuda, Yoichi

    2004-03-01

    We isolated a new family of satellite DNA sequences from HaeIII- and EcoRI-digested genomic DNA of the Blakiston's fish owl ( Ketupa blakistoni). The repetitive sequences were organized in tandem arrays of the 174 bp element, and localized to the centromeric regions of all macrochromosomes, including the Z and W chromosomes, and microchromosomes. This hybridization pattern was consistent with the distribution of C-band-positive centromeric heterochromatin, and the satellite DNA sequences occupied 10% of the total genome as a major component of centromeric heterochromatin. The sequences were homogenized between macro- and microchromosomes in this species, and therefore intraspecific divergence of the nucleotide sequences was low. The 174 bp element cross-hybridized to the genomic DNA of six other Strigidae species, but not to that of the Tytonidae, suggesting that the satellite DNA sequences are conserved in the same family but fairly divergent between the different families in the Strigiformes. Secondly, the centromeric satellite DNAs were cloned from eight Strigidae species, and the nucleotide sequences of 41 monomer fragments were compared within and between species. Molecular phylogenetic relationships of the nucleotide sequences were highly correlated with both the taxonomy based on morphological traits and the phylogenetic tree constructed by DNA-DNA hybridization. These results suggest that the satellite DNA sequence has evolved by concerted evolution in the Strigidae and that it is a good taxonomic and phylogenetic marker to examine genetic diversity between Strigiformes species.

  12. Association of occurrence of major earthquakes throughout the globe with variable component of the green line Fe XIV 530.3 nm during 1950-2014

    NASA Astrophysics Data System (ADS)

    Midya, S. K.; Das, A.; Karmakar, N.

    2016-12-01

    The paper presents the variation of variable component of coronal index for two period 1950-1962 and 1963-2014 and its association with major earthquakes (magnitude ≥6.0 Richter scale) for the same two periods is also offered. Analysis shows that frequency of major earthquake increases with the decrease in variable component of coronal index and vice versa. Possible explanation is also presented.

  13. Syllabus for a Women Studies Course on Women Composers.

    ERIC Educational Resources Information Center

    Hayes, Deborah

    An upper division college-level course dealing with women composers for both music majors and nonmusic majors is outlined. The course provides an historical and analytical survey of western music through works composed by women, with emphasis on the 19th and 20th centuries. Students listen to music, participate in class discussions, and listen to…

  14. RNA of Enterococcus faecalis Strain EC-12 Is a Major Component Inducing Interleukin-12 Production from Human Monocytic Cells

    PubMed Central

    Nishibayashi, Ryoichiro; Inoue, Ryo; Harada, Yuri; Watanabe, Takumi; Makioka, Yuko; Ushida, Kazunari

    2015-01-01

    Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing immunogenic component. However, it was recently revealed that bacterial RNA can be a ligand for Toll-like receptor (TLR) 13, which is only expressed in mice. Because TLR13 is not expressed in humans, the immuno-stimulatory and -modulatory effects of LAB RNA in human cells should be augmented excluding TLR13 contribution. In experiment 1 of this study, the role of LAB RNA in IL-12 induction in human immune cells was studied using three LAB strains, E.faecalis EC-12, Lactobacillus gasseri JCM5344, and Bifidobacterium breve JCM1192. RNase A treatment of heat-killed LAB significantly decreased the IL-12 production of human peripheral blood mononuclear cells on stimulation, while RNase III treatment revealed virtually no effects. Further, IL-12 production against heat-killed E. faecalis EC-12 was abolished by depleting monocytes. These results demonstrated that single stranded RNA (ssRNA) of LAB is a strong inducer of IL-12 production from human monocytes. In experiment 2, major receptor for ssRNA of E. faecalis EC-12 was identified using THP-1 cells, a human monocytic cell line. The type of RNA molecules of E. faecalis EC-12 responsible for IL-12 induction was also identified. IL-12 production induced by the total RNA of E. faecalis EC-12 was significantly reduced by the treatment of siRNA for TLR8 but not for TLR7. Furthermore, both 23S and 16S rRNA, but not mRNA, of E. faecalis EC-12 markedly induced IL-12 production from THP-1 cells. These results suggested that the recognition of ssRNA of E. faecalis EC-12 was mediated by TLR8 and that rRNA was the RNA molecule that exhibited IL-12-inducing ability in human cells. PMID:26083838

  15. Epigallocatechin gallate (EGCG), a major component of green tea, is a dual phosphoinositide-3-kinase/mTOR inhibitor

    SciTech Connect

    Van Aller, Glenn S.; Carson, Jeff D.; Tang, Wei; Peng, Hao; Zhao, Lin; Copeland, Robert A.; Tummino, Peter J.; Luo, Lusong

    2011-03-11

    Research highlights: {yields} Epigallocatechin-3-gallate (EGCG) is an ATP-competitive inhibitor of PI3K and mTOR with Ki values around 300 nM. {yields} EGCG inhibits cell proliferation and AKT phosphorylation at Ser473 in MDA-MB-231and A549 cells. {yields} Molecular docking studies show that EGCG binds well to the PI3K kinase domain active site. {yields} These results suggest another important molecular mechanism for the anticancer activities of EGCG. -- Abstract: The PI3K signaling pathway is activated in a broad spectrum of human cancers, either directly by genetic mutation or indirectly via activation of receptor tyrosine kinases or inactivation of the PTEN tumor suppressor. The key nodes of this pathway have emerged as important therapeutic targets for the treatment of cancer. In this study, we show that (-)-epigallocatechin-3-gallate (EGCG), a major component of green tea, is an ATP-competitive inhibitor of both phosphoinositide-3-kinase (PI3K) and mammalian target of rapamycin (mTOR) with K{sub i} values of 380 and 320 nM respectively. The potency of EGCG against PI3K and mTOR is within physiologically relevant concentrations. In addition, EGCG inhibits cell proliferation and AKT phosphorylation at Ser473 in MDA-MB-231 and A549 cells. Molecular docking studies show that EGCG binds well to the PI3K kinase domain active site, agreeing with the finding that EGCG competes for ATP binding. Our results suggest another important molecular mechanism for the anticancer activities of EGCG.

  16. Chemoprevention of esophageal cancer with black raspberries, their component anthocyanins, and a major anthocyanin metabolite, protocatechuic acid.

    PubMed

    Peiffer, Daniel S; Zimmerman, Noah P; Wang, Li-Shu; Ransom, Benjamin W S; Carmella, Steven G; Kuo, Chieh-Ti; Siddiqui, Jibran; Chen, Jo-Hsin; Oshima, Kiyoko; Huang, Yi-Wen; Hecht, Stephen S; Stoner, Gary D

    2014-06-01

    Diets containing either freeze-dried black raspberries (BRBs) or their polyphenolic anthocyanins (ACs) have been shown to inhibit the development of N-nitrosomethylbenzylamine (NMBA)-induced esophageal cancer in rats. The present study was conducted to determine whether PCA, a major microbial metabolite of black raspberry (BRB) ACs, also prevents NMBA-induced esophageal cancer in rats. F344 rats were injected with NMBA three times a week for 5 weeks and then fed control or experimental diets containing 6.1% BRBs, an anthocyanin (AC)-enriched fraction derived from BRBs, or protocatechuic acid (PCA). Animals were exsanguinated at weeks 15, 25, and 35 to quantify the development of preneoplastic lesions and tumors in the esophagus, and to relate this to the expression of inflammatory biomarkers. At weeks 15 and 25, all experimental diets were equally effective in reducing NMBA-induced esophageal tumorigenesis, as well as in reducing the expression of pentraxin-3 (PTX3), a cytokine produced by peripheral blood mononuclear cells in response to interleukin (IL)-1β and TNF-α. All experimental diets were also active at reducing tumorigenesis at week 35; however, the BRB diet was significantly more effective than the AC and PCA diets. Furthermore, all experimental diets inhibited inflammation in the esophagus via reducing biomarker (COX-2, iNOS, p-NF-κB, and sEH) and cytokine (PTX3) expression. Overall, our data suggest that BRBs, their component ACs, and PCA inhibit NMBA-induced esophageal tumorigenesis, at least in part, by their inhibitory effects on genes associated with inflammation. ©2014 American Association for Cancer Research.

  17. Synergistic anti-candidal activity and mode of action of Mentha piperita essential oil and its major components.

    PubMed

    Samber, Neha; Khan, Amber; Varma, Ajit; Manzoor, Nikhat

    2015-01-01

    Mentha piperita L. (Lamiaceae) has been used in folk medicine since antiquity. Its essential oil (mint EO) and major bioactive components have antimicrobial properties but their mechanism of action is still not clear. The present work aims to elucidate M. piperita's anti-Candida activity and mode of action. Chemical constituents of mint EO were identified by GC-MS by injecting 0.1 ml sample in a splitless mode. MIC was determined by the broth dilution method. Synergy with fluconazole (FLC) was evaluated by checkerboard assay and FICI. Mid log phase cells harvested from YPD media were used for proton extrusion measurement and the rate of glucose-induced H(+) efflux gives PM-ATPase activity. Cell membrane integrity was estimated by total ergosterol content and scanning microscopy at respective MIC and sub-MIC values. In vitro hemolytic activity was performed to rule out possible cytotoxicity of the test compounds. The MIC value of mint EO, carvone, menthol, and menthone was 225, 248, 500, and 4200 µg/ml, respectively. At their respective MICs, these compounds showed 47, 42, 35, and 29% decrease in PM-ATPase activity besides showing synergy with FLC. In case of FLC-resistant strains, the decrease in H(+) efflux was by 52, 48, 32, and 30%, a trend similar to the susceptible cases. Exposed Candida cells showed a 100% decrease in the ergosterol content, cell membrane breakage, and alterations in morphology. Our studies suggest that mint EO and its lead compounds exert antifungal activity by reducing ergosterol levels, inhibiting PM-ATPase leading to intracellular acidification, and ultimately cell death. Our results suggest that mint EO and its constituents are potential antifungal agents and need to be further investigated.

  18. Sedative effect of central administration of Coriandrum sativum essential oil and its major component linalool in neonatal chicks.

    PubMed

    Gastón, María Soledad; Cid, Mariana Paula; Vázquez, Ana María; Decarlini, María Florencia; Demmel, Gabriela I; Rossi, Laura I; Aimar, Mario Leandro; Salvatierra, Nancy Alicia

    2016-10-01

    Context Coriandrum sativum L. (Apiaceae) (coriander) is an herb grown throughout the world as a culinary, medicinal or essential crop. In traditional medicine, it is used for the relief of anxiety and insomnia. Systemic hydro-alcoholic and aqueous extract from aerial parts and seeds had anxiolytic and sedative action in rodents, but little is known about its central effect in chicks. Objective To study the effects of intracerebroventricular administration of essential oil from coriander seeds and its major component linalool on locomotor activity and emotionality of neonatal chicks. Materials and methods The chemical composition of coriander essential oil was determined by a gas-chromatographic analysis (> 80% linalool). Behavioural effects of central administration of coriander oil and linalool (both at doses of 0.86, 8.6 and 86 μg/chick) versus saline and a sedative diazepam dose (17.5 μg/chick, standard drug) in an open field test for 10 min were observed. Results Doses of 8.6 and 86 μg from coriander oil and linalool significantly decreased (p < 0.05) squares crossed number, attempted escapes, defecation number and distress calls, and significantly increased (p < 0.05) the sleeping posture on an open field compared with saline and were similar to the diazepam group. Discussion and conclusion The results indicate that intracerebroventricular injection of essential oil from Coriandrum sativum seeds induced a sedative effect at 8.6 and 86 μg doses. This effect may be due to monoterpene linalool, which also induced a similar sedative effect, and, therefore, could be considered as a potential therapeutic agent similar to diazepam.

  19. Ex Vivo Analysis of Human T Lymphotropic Virus Type 1–Specific CD4+ Cells by Use of a Major Histocompatibility Complex Class II Tetramer Composed of a Neurological Disease–Susceptibility Allele and Its Immunodominant Peptide

    PubMed Central

    Nose, Hirohisa; Kubota, Ryuji; Seth, Nilufer P.; Goon, Peter K.; Tanaka, Yuetsu; Izumo, Shuji; Usuku, Koichiro; Ohara, Yoshiro; Wucherpfennig, Kai W.; Bangham, Charles R. M.; Osame, Mitsuhiro; Saito, Mineki

    2015-01-01

    HLA-DRB1*0101 is associated with susceptibility to human T lymphotropic virus type 1 (HTLV-1)–associated myelopathy/tropical spastic paraparesis (HAM/TSP). Here, we used a synthetic tetramer of DRB1*0101 and its epitope peptide to analyze HTLV-1–specific CD4+ T cells ex vivo. The frequency of tetramer+CD4+ T cells was significantly greater in patients with HAM/TSP than in healthy HTLV-1 carriers (HCs) at a given proviral load and correlated with HTLV-1 tax messenger RNA expression in HCs but not in patients with HAM/TSP. These cells displayed an early to intermediate effector memory phenotype and were preferentially infected by HTLV-1. T cell receptor gene analyses of 2 unrelated DRB1*0101-positive patients with HAM/TSP showed similar Vβ repertoires and amino acid motifs in complementarity-determining region 3. Our data suggest that efficient clonal expansion of virus-specific CD4+ T cells in patients with HAM/TSP does not simply reflect higher viral burden but rather reflects a rapid turnover caused by preferential infection and/or in vivo stimulation by major histocompatibility complex–peptide complexes. PMID:18190256

  20. Biological and physicochemical characterization of the major (1.40) and minor (1.45) component of infectious avian adeno-associated virus.

    PubMed

    Bauer, H J; Schneider, R; Gelderblom, H R; Lurz, R; Friehmelt, V; Monreal, G

    1991-01-01

    Two infectious components with buoyant densities of 1.40 g/cm3 and 1.45 g/cm3, designated as major (1.40) and minor (1.45) component, were detected by banding avian adeno-associated virus (AAAV) isopycnically in CsCl. In metrizamide, however, infectious AAAV banded only as a single peak at a density of 1.32 g/cm3. Biological as well as physicochemical properties of the two AAAV components recovered from CsCl density gradient were described. Concerning the minor (1.45) component, three experimental findings may suggest that the capsid structure of this AAAV population is altered in comparison with that of the major (1.40) component: (i) the sedimentation pattern characterized by an additional peak containing slower-sedimenting noninfectious material (16 S); (ii) the specific infectivity decreased by the 3.5 fold; (iii) the ready disintegration when exposed to gently denaturing conditions.

  1. Prospective prediction of the major component of urinary stone composition with dual-source dual-energy CT in vivo.

    PubMed

    Zhang, G-M-Y; Sun, H; Xue, H-D; Xiao, H; Zhang, X-B; Jin, Z-Y

    2016-11-01

    To prospectively evaluate the diagnostic accuracy of dual-source dual-energy computed tomography (DSDECT) for predicting the major component and determining the composition of urinary calculi in patients with urolithiasis, using postoperative in vitro Fourier transform infrared spectroscopy (FT-IR) analysis as the reference standard. Patients with known urolithiasis underwent preoperative DSDECT evaluation, and subsequently, underwent surgical removal of the stones. All patients were examined using the dual-energy renal stone protocol. Material-specific chromatic images were made using dedicated post-processing software. The final determination of stone composition was made using FT-IR postoperatively. Diagnostic parameters of DSDECT for predicting the major component and detecting the presence of four composition types were calculated. A total of 81 urinary calculi were included in this study. Forty-three were pure stones and 38 were mixed stones according to FT-IR. DSDECT correctly identified the major component of all pure stones and 36 mixed stones. The major component of two mixed stones with uric acid as the major component was falsely interpreted as calcium oxalate. The overall accuracy of DSDECT for predicting the major component of stones was 97.5% (79/81). The accuracy of DSDECT for detecting the presence of four types of composition, uric acid, cysteine, hydroxyapatite, and calcium oxalate, was 97.5% (79/81), 93.8% (76/81), 80.2% (65/81), and 93.8% (76/81), respectively. DSDECT could accurately predict the major component of urinary calculi and detect uric acid, cysteine, and calcium oxalate with a satisfactory accuracy. Copyright © 2016 The Royal College of Radiologists. Published by Elsevier Ltd. All rights reserved.

  2. Variability of major organic components in aircraft fuels. Volume 2. Illustrations. Interim report December 1982-November 1983

    SciTech Connect

    Hughes, B.M.; Hess, G.G.; Simon, K.; Mazer, S.; Ross, W.D.

    1984-06-27

    This report summarizes qualitative and quantitative data on the chemical variability of approximately 300 features (chemical components or mixtures of components) with concentrations greater than 0.1 mg/ml in Air Force distillate fuels obtained from over 50 sources. These data wer

  3. Associations of major and trace components in time-series settling particle samples from Cuenca Alfonso, SW Gulf of California

    NASA Astrophysics Data System (ADS)

    Rodríguez-Castañeda, A. P.; Shumilin, E.; Silverberg, N.; Morton-Bermea, O.; Hernandez-Alvarez, E.; Aguirre-Bahena, F.

    2007-12-01

    Cuenca Alfonso is a natural sedimentation basin in Bahía de La Paz, southern Baja California Peninsula, an arid subtropical region characterized by limited land runoff with a productive surface layer overlying a well-developed Oxygen Minimum Zone. A time-series sediment trap program was initiated in 2002 to help understand the processes controlling variations in the biogeochemistry of this environment. INAA, ICP-MS and ICP-OES analyses, as well as flame AAS were made for major and trace elements in 105 subsamples of material collected at 350 m depth during 2002-2005. Principal component analysis, including data for organic and inorganic carbon, biogenic silica and the lithogenic fraction, yielded four factors. Factor 1 (25% of the total variance) showed high eigenvalues for the classical terrigenous aluminosilicate elements: Al, Fe, Mn Sc. High loadings also occurred for the group of light to medium REEs (except for Eu). The latter are frequently associated with acid source rocks, such the granites and rhyolitic volcanics exposed on the margin of the bay. Factor 2 (18%) grouped mainly REEs, with high loading on the heavier members of the series that are more typical of basic rocks (thick sequences of andesitic volcanics occur to the NW), as well as Ni and Rb. Factor 3 (12%) appears to represent carbonate organism production, with high loadings for Cinorg, Ca and moderate levels for Corg and Cu, while %litho is moderately negative, as is biogenic silica. The fourth factor (9%) is characterized by high negative loadings for Cd, Co, Se and moderately negative values for Corg. Moderate positive loadings occur only for Sr and, at lower levels, for U, Sb and %lithogenic. This suggests that this grouping is related to particles that have been partially transformed within the Oxygen Minimum Zone. The results will be examined for distinctive periods within the time-series, such as the hurricane-influenced months of August-September 2003, the generally very low fluxes

  4. Anti-oxidant activity and major chemical component analyses of twenty-six commercially available essential oils.

    PubMed

    Wang, Hsiao-Fen; Yih, Kuang-Hway; Yang, Chao-Hsun; Huang, Keh-Feng

    2017-10-01

    This study analyzed 26 commercially available essential oils and their major chemical components to determine their antioxidant activity levels by measuring their total phenolic content (TPC), reducing power (RP), β-carotene bleaching (BCB) activity, trolox equivalent antioxidant capacity (TEAC), and 1,1-diphenyl-2-picrylhydrazyl free radical scavenging (DFRS) ability. The clove bud and thyme borneol essential oils had the highest RP, BCB activity levels, and TPC values among the 26 commercial essential oils. Furthermore, of the 26 essential oils, the clove bud and ylang ylang complete essential oils had the highest TEAC values, and the clove bud and jasmine absolute essential oils had the highest DFRS ability. At a concentration of 2.5 mg/mL, the clove bud and thyme borneol essential oils had RP and BCB activity levels of 94.56% ± 0.06% and 24.64% ± 0.03% and 94.58% ± 0.01% and 89.33% ± 0.09%, respectively. At a concentration of 1 mg/mL, the clove bud and thyme borneol essential oils showed TPC values of 220.00 ± 0.01 and 69.05 ± 0.01 mg/g relative to gallic acid equivalents, respectively, and the clove bud and ylang ylang complete essential oils had TEAC values of 809.00 ± 0.01 and 432.33 ± 0.01 μM, respectively. The clove bud and jasmine absolute essential oils showed DFRS abilities of 94.13% ± 0.01% and 78.62% ± 0.01%, respectively. Phenolic compounds of the clove bud, thyme borneol and jasmine absolute essential oils were eugenol (76.08%), thymol (14.36%) and carvacrol (12.33%), and eugenol (0.87%), respectively. The phenolic compounds in essential oils were positively correlated with the RP, BCB activity, TPC, TEAC, and DFRS ability. Copyright © 2017. Published by Elsevier B.V.

  5. In-depth investigation of enzymatic hydrolysis of biomass wastes based on three major components: Cellulose, hemicellulose and lignin.

    PubMed

    Lin, Lili; Yan, Rong; Liu, Yongqiang; Jiang, Wenju

    2010-11-01

    The artificial biomass based on three biomass components (cellulose, hemicellulose and lignin) were developed on the basis of a simplex-lattice approach. Together with a natural biomass sample, they were employed in enzymatic hydrolysis researches. Different enzyme combines of two commercial enzymes (ACCELLERASE 1500 and OPTIMASH BG) showed a potential to hydrolyze hemicellulose completely. Negligible interactions among the three components were observed, and the used enzyme ACCELLERASE 1500 was proven to be weak lignin-binding. On this basis, a multiple linear-regression equation was established for predicting the reducing sugar yield based on the component proportions in a biomass. The hemicellulose and cellulose in a biomass sample were found to have different contributions in staged hydrolysis at different time periods. Furthermore, the hydrolysis of rice straw was conducted to validate the computation approach through considerations of alkaline solution pretreatment and combined enzymes function, so as to understand better the nature of biomass hydrolysis, from the aspect of three biomass components.

  6. SRG3/mBAF155 stabilizes the SWI/SNF-like BAF complex by blocking CHFR mediated ubiquitination and degradation of its major components

    SciTech Connect

    Jung, Inkyung; Sohn, Dong H.; Choi, Jinwook; Kim, Joo Mi; Jeon, Shin; Seol, Jae Hong; Seong, Rho Hyun

    2012-02-17

    Highlights: Black-Right-Pointing-Pointer CHFR mediates the ubiquitination of the major components of the SWI/SNF complex. Black-Right-Pointing-Pointer CHFR mediated-ubiquitination induces the degradation of the major components. Black-Right-Pointing-Pointer SRG3 stabilizes the SWI/SNF-like BAF complex by blocking the CHFR activity. -- Abstract: The murine SWI/SNF-like BAF complex is an ATP-dependent chromatin remodeling complex that functions as a transcriptional regulator in cell proliferation, differentiation and development. The SWI/SNF-like BAF complex consists of several components including core subunits such as BRG1, BAF155/SRG3, BAF47/SNF5/INI1, and BAF170. We have previously shown that the interaction between SRG3/mBAF155 and other components of the complex stabilizes them by attenuating their proteasomal degradation. However, it has not been known how the major components of the SWI/SNF-like BAF complex such as BRG1, SNF5, and BAF60a are targeted for the ubiquitination and degradation, and how SRG3/mBAF155 protects them from the degradation process. Here we report that CHFR interacts with BRG1, SNF5, and BAF60a of the SWI/SNF-like BAF complex and ubiquitinates them to target for degradation through a proteasome-mediated pathway, and that SRG3/mBAF155 stabilizes these components by blocking their interaction with CHFR.

  7. Guidelines for Coaching Student Composers.

    ERIC Educational Resources Information Center

    Wilson, Dana

    2001-01-01

    Focuses on teaching students how to compose music. Addresses issues, such as how to get the students started and types of questions to ask students about their compositions. Discusses the musical elements involved in composition, such as melody, harmony, rhythm and meter, timbre, texture, and formal design. (CMK)

  8. Comparative Fluorescence Resonance Energy-Transfer Study in Pluronic Triblock Copolymer Micelle and Niosome Composed of Biological Component Cholesterol: An Investigation of Effect of Cholesterol and Sucrose on the FRET Parameters.

    PubMed

    Roy, Arpita; Kundu, Niloy; Banik, Debasis; Sarkar, Nilmoni

    2016-01-14

    The formation of pluronic triblock copolymer (F127)-cholesterol-based niosome and its interaction with sugar (sucrose) molecules have been investigated. The morphology of F127-cholesterol -based niosome in the presence of sucrose has been successfully demonstrated using dynamic light scattering (DLS) and transmission electron microscopic (TEM) techniques. The DLS profiles and TEM images clearly suggest that the size of the niosome aggregates increases significantly in the presence of sucrose. In addition to structural characterization, a detailed comparative fluorescence resonance energy transfer (FRET) study has been carried out in these F127-containing aggregates, involving coumarin 153 (C153) as donor (D) and rhodamine 6G (R6G) as an acceptor (A) to monitor the dynamic heterogeneity of the systems. Besides, time-resolved anisotropy and fluorescence correlation spectroscopy measurements have been carried out to monitor the rotational and lateral diffusion motion in these F127-cholesterol-based aggregates using C153 and R6G, respectively. During the course of FRET study, we have observed multiple time constants of FRET inside the F127-cholesterol-based niosomes in contrast with the F127 micelle. This corresponds to the presence of more than one preferential donor-acceptor (D-A) distance in niosomes than in F127 micelle. FRET has also been successfully used to probe the effect of sucrose on the morphology of F127-cholesterol-based niosome. In the presence of sucrose, the time constant of FRET further increases as the D-A distances increase in sucrose-decorated niosome. Finally, the excitation-wavelength-dependent FRET studies have indicated that as the excitation of donor molecules varies from 408 to 440 nm the contribution of the faster rise component of the acceptor enhances considerably, which clearly establishes the dynamics heterogeneity of both systems. Our findings also indicate that FRET is completely intravesicular in nature in these block copolymer

  9. The N-reductive system composed of mitochondrial amidoxime reducing component (mARC), cytochrome b5 (CYB5B) and cytochrome b5 reductase (CYB5R) is regulated by fasting and high fat diet in mice.

    PubMed

    Jakobs, Heyka H; Mikula, Michal; Havemeyer, Antje; Strzalkowska, Adriana; Borowa-Chmielak, Monika; Dzwonek, Artur; Gajewska, Marta; Hennig, Ewa E; Ostrowski, Jerzy; Clement, Bernd

    2014-01-01

    The mitochondrial amidoxime reducing component mARC is the fourth mammalian molybdenum enzyme. The protein is capable of reducing N-oxygenated structures, but requires cytochrome b5 and cytochrome b5 reductase for electron transfer to catalyze such reactions. It is well accepted that the enzyme is involved in N-reductive drug metabolism such as the activation of amidoxime prodrugs. However, the endogenous function of the protein is not fully understood. Among other functions, an involvement in lipogenesis is discussed. To study the potential involvement of the protein in energy metabolism, we tested whether the mARC protein and its partners are regulated due to fasting and high fat diet in mice. We used qRT-PCR for expression studies, Western Blot analysis to study protein levels and an N-reductive biotransformation assay to gain activity data. Indeed all proteins of the N-reductive system are regulated by fasting and its activity decreases. To study the potential impact of these changes on prodrug activation in vivo, another mice experiment was conducted. Model compound benzamidoxime was injected to mice that underwent fasting and the resulting metabolite of the N-reductive reaction, benzamidine, was determined. Albeit altered in vitro activity, no changes in the metabolite concentration in vivo were detectable and we can dispel concerns that fasting alters prodrug activation in animal models. With respect to high fat diet, changes in the mARC proteins occur that result in increased N-reductive activity. With this study we provide further evidence that the endogenous function of the mARC protein is linked with lipid metabolism.

  10. Rapid and quantitative determination of 10 major active components in Lonicera japonica Thunb. by ultrahigh pressure extraction-HPLC/DAD

    NASA Astrophysics Data System (ADS)

    Fan, Li; Lin, Changhu; Duan, Wenjuan; Wang, Xiao; Liu, Jianhua; Liu, Feng

    2015-01-01

    An ultrahigh pressure extraction (UPE)-high performance liquid chromatography (HPLC)/diode array detector (DAD) method was established to evaluate the quality of Lonicera japonica Thunb. Ten active components, including neochlorogenic acid, chlorogenic acid, 4-dicaffeoylquinic acid, caffeic acid, rutin, luteoloside, isochlorogenic acid B, isochlorogenic acid A, isochlorogenic acid C, and quercetin, were qualitatively evaluated and quantitatively determined. Scanning electron microscope images elucidated the bud surface microstructure and extraction mechanism. The optimal extraction conditions of the UPE were 60% methanol solution, 400 MPa of extraction pressure, 3 min of extraction time, and 1:30 (g/mL) solid:liquid ratio. Under the optimized conditions, the total extraction yield of 10 active components was 57.62 mg/g. All the components showed good linearity (r2 ≥ 0.9994) and recoveries. This method was successfully applied to quantify 10 components in 22 batches of L. japonica samples from different areas. Compared with heat reflux extraction and ultrasonic-assisted extraction, UPE can be considered as an alternative extraction technique for fast extraction of active ingredient from L. japonica.

  11. What is reflection? A conceptual analysis of major definitions and a proposal of a five-component model.

    PubMed

    Nguyen, Quoc Dinh; Fernandez, Nicolas; Karsenti, Thierry; Charlin, Bernard

    2014-12-01

    Although reflection is considered a significant component of medical education and practice, the literature does not provide a consensual definition or model for it. Because reflection has taken on multiple meanings, it remains difficult to operationalise. A standard definition and model are needed to improve the development of practical applications of reflection. This study was conducted in order to identify, explore and analyse the most influential conceptualisations of reflection, and to develop a new theory-informed and unified definition and model of reflection. A systematic review was conducted to identify the 15 most cited authors in papers on reflection published during the period from 2008 to 2012. The authors' definitions and models were extracted. An exploratory thematic analysis was carried out and identified seven initial categories. Categories were clustered and reworded to develop an integrative definition and model of reflection, which feature core components that define reflection and extrinsic elements that influence instances of reflection. Following our review and analysis, five core components of reflection and two extrinsic elements were identified as characteristics of the reflective thinking process. Reflection is defined as the process of engaging the self (S) in attentive, critical, exploratory and iterative (ACEI) interactions with one's thoughts and actions (TA), and their underlying conceptual frame (CF), with a view to changing them and a view on the change itself (VC). Our conceptual model consists of the defining core components, supplemented with the extrinsic elements that influence reflection. This article presents a new theory-informed, five-component definition and model of reflection. We believe these have advantages over previous models in terms of helping to guide the further study, learning, assessment and teaching of reflection. © 2014 John Wiley & Sons Ltd.

  12. A Taxonomy for Composing Effective Naval Teams. Final Report.

    ERIC Educational Resources Information Center

    Driskell, James E.; And Others

    Since teams perform a majority of mission-critical Navy tasks, a significant applied research problem is how to compose maximally effective task teams. Two problems have traditionally hindered the attainment of this goal: how to compose teams on bases other than ability or technical skill and how to classify team tasks, so that predictions can be…

  13. Effect of nonfat dry milk and major whey components on interleukin-6 and interleukin-8 production in human intestinal epithelial-like Caco-2 cells.

    PubMed

    Ustunol, Z; Wong, C

    2010-06-01

    Bovine nonfat dry milk (NDM) and major whey components (lactose, alpha-lactalbumin, and beta-lactoglobulin) were evaluated for their effects on IL-6 and IL-8 production in human intestinal-like Caco-2 cells unstimulated or stimulated with IL-1beta. All the whey components investigated and NDM induced IL-6 production by Caco-2 cells; the most significant increase was observed with beta-lactoglobulin. In the case of IL-1beta-stimulated cells, neither NDM nor the major whey components investigated contributed to the induction of IL-6 production after they were stimulated. Induction of IL-8 production by both alpha-lactalbumin and beta-lactoglobulin was higher than that by lactose and NDM; alpha-lactalbumin was a more potent inducer of IL-8 than beta-lactoglobulin and IL-1beta alone in both unstimulated and stimulated cells. In Caco-2 cells that were stimulated with IL1-beta, NDM and all the major whey components investigated had a synergistic effect on induction of IL-8 production, indicating that IL-8 induction was amplified by prior stimulation of cells by IL-1beta. This synergistic effect was not observed with IL-6. Our results suggest that immunomodulatory properties of milk components may be affected by other complex events in the gut.

  14. CYP3A4 inhibition by Psoralea corylifolia and its major components in human recombinant enzyme, differentiated human hepatoma HuH-7 and HepaRG cells.

    PubMed

    Liu, Yitong; Flynn, Thomas J

    2015-01-01

    Psoralea corylifolia (P. corylifolia) is a medicinal plant used primarily in herbal dietary supplements to treat skin diseases, such as vitiligo and psoriasis. Case reports of liver toxicity have recently emerged from its use, which often includes co-administration with other herbal products. In this study, CYP3A4 inhibition and hepatotoxicity of P. corylifolia and its major components were evaluated in human recombinant CYP3A4 enzyme, differentiated human hepatoma HuH-7 and HepaRG cells. LC/MS-TOF was used to identify the major components of P. corylifolia fruit methanol-water extract. P. corylifolia and its major bioactive components psoralen and isopsoralen were then incubated with human recombinant CYP3A4 (10 min) or differentiated HuH-7 and HepaRG cells (24 h) prior to CYP3A4 activity and cytotoxicity assays. P. corylifolia extract, psoralen, and isopsoralen concentration dependently inhibited CYP3A4 activity with different potency in the three in vitro systems. No cytotoxicity was observed at any concentration tested. In vitro CYP3A4 inhibition by P. corylifolia and its major components suggests potential drug-dietary supplement interactions that warrant further investigations in vivo.

  15. Chemosensory responses to the repellent nepeta essential oil and its major component nepetalactone by the yellow fever mosquito, aedes aegypti, a vector of zika virus

    USDA-ARS?s Scientific Manuscript database

    Nepeta essential oil (Neo) (catnip) and its major component, nepetalactone, have long been known to repel insects including mosquitoes. However, the neural mechanisms through which these repellents are detected by mosquitoes, including the yellow fever mosquito Aedes aegypti, an important vector of...

  16. Chemical profiling of the major components in natural waxes to elucidate their role in liquid oil structuring.

    PubMed

    Doan, Chi Diem; To, Chak Ming; De Vrieze, Mike; Lynen, Frederic; Danthine, Sabine; Brown, Allison; Dewettinck, Koen; Patel, Ashok R

    2017-01-01

    Elucidating the composition of waxes is of utmost importance to explain their behavior in liquid oil structuring. The chemical components (hydrocarbons - HCs, free fatty acids - FFAs, free fatty alcohols - FALs and wax esters - WEs) of natural waxes were analyzed using HPLC-ELSD and GC-MS followed by evaluation of their oil structuring properties. The gel strength, including the average storage modulus and oscillation yield stress, displayed a negative correlation with FALs and a positive correlation with HCs, FFAs and WEs. The components dictating the gel strength are HCs, FFAs and WEs in a descending order of importance. The consistency of the oleogels increased with the increasing amount of FFAs and HCs and the decreasing amount of WEs and FALs. The presence of more WEs results in a strong but brittle gel with a high initial flow yield stress. We believe these results might be useful in selecting the right waxes to combine in certain fat-based food products.

  17. Benzyl Isothiocyanate, a Major Component from the Roots of Salvadora Persica Is Highly Active against Gram-Negative Bacteria

    PubMed Central

    Sofrata, Abier; Santangelo, Ellen M.; Azeem, Muhammad; Borg-Karlson, Anna-Karin; Gustafsson, Anders; Pütsep, Katrin

    2011-01-01

    Plants produce a number of antimicrobial substances and the roots of the shrub Salvadora persica have been demonstrated to possess antimicrobial activity. Sticks from the roots of S. persica, Miswak sticks, have been used for centuries as a traditional method of cleaning teeth. Diverging reports on the chemical nature and antimicrobial repertoire of the chewing sticks from S. persica led us to explore its antibacterial properties against a panel of pathogenic or commensal bacteria and to identify the antibacterial component/s by methodical chemical characterization. S. persica root essential oil was prepared by steam distillation and solid-phase microextraction was used to sample volatiles released from fresh root. The active compound was identified by gas chromatography-mass spectrometry and antibacterial assays. The antibacterial compound was isolated using medium-pressure liquid chromatography. Transmission electron microscopy was used to visualize the effect on bacterial cells. The main antibacterial component of both S. persica root extracts and volatiles was benzyl isothiocyanate. Root extracts as well as commercial synthetic benzyl isothiocyanate exhibited rapid and strong bactericidal effect against oral pathogens involved in periodontal disease as well as against other Gram-negative bacteria, while Gram-positive bacteria mainly displayed growth inhibition or remained unaffected. The short exposure needed to obtain bactericidal effect implies that the chewing sticks and the essential oil may have a specific role in treatment of periodontal disease in reducing Gram-negative periodontal pathogens. Our results indicate the need for further investigation into the mechanism of the specific killing of Gram-negative bacteria by S. persica root stick extracts and its active component benzyl isothiocyanate. PMID:21829688

  18. Benzyl isothiocyanate, a major component from the roots of Salvadora persica is highly active against Gram-negative bacteria.

    PubMed

    Sofrata, Abier; Santangelo, Ellen M; Azeem, Muhammad; Borg-Karlson, Anna-Karin; Gustafsson, Anders; Pütsep, Katrin

    2011-01-01

    Plants produce a number of antimicrobial substances and the roots of the shrub Salvadora persica have been demonstrated to possess antimicrobial activity. Sticks from the roots of S. persica, Miswak sticks, have been used for centuries as a traditional method of cleaning teeth. Diverging reports on the chemical nature and antimicrobial repertoire of the chewing sticks from S. persica led us to explore its antibacterial properties against a panel of pathogenic or commensal bacteria and to identify the antibacterial component/s by methodical chemical characterization. S. persica root essential oil was prepared by steam distillation and solid-phase microextraction was used to sample volatiles released from fresh root. The active compound was identified by gas chromatography-mass spectrometry and antibacterial assays. The antibacterial compound was isolated using medium-pressure liquid chromatography. Transmission electron microscopy was used to visualize the effect on bacterial cells. The main antibacterial component of both S. persica root extracts and volatiles was benzyl isothiocyanate. Root extracts as well as commercial synthetic benzyl isothiocyanate exhibited rapid and strong bactericidal effect against oral pathogens involved in periodontal disease as well as against other Gram-negative bacteria, while Gram-positive bacteria mainly displayed growth inhibition or remained unaffected. The short exposure needed to obtain bactericidal effect implies that the chewing sticks and the essential oil may have a specific role in treatment of periodontal disease in reducing Gram-negative periodontal pathogens. Our results indicate the need for further investigation into the mechanism of the specific killing of Gram-negative bacteria by S. persica root stick extracts and its active component benzyl isothiocyanate.

  19. Seasonal Contribution of Mineral Dust and Otlher Major Components to Particulate Matter at Two Remote Sites in Central Asia

    EPA Science Inventory

    Dust storms are significant contributors to ambient levels of particulate matter (PM) in many areas of the world. Central Asia, an area that is relatively understudied in this regard, is anticipated to be affected by dust storms due to its proximity to several major deserts that ...

  20. Multiple leafminer species attracted to the major pheromone components of the citrus leafminer Phyllocnistis citrella (Lepidoptera: Gracillariidae)

    USDA-ARS?s Scientific Manuscript database

    The citrus leafminer, Phyllocnistis citrella Stainton, is a major pest of citrus throughout the world due to leafmining damage that reduces photosynthetic capacity of leaves and increases the incidence and severity of citrus canker disease. A lure comprised of two aldehyde compounds isolated from ph...

  1. Seasonal Contribution of Mineral Dust and Otlher Major Components to Particulate Matter at Two Remote Sites in Central Asia

    EPA Science Inventory

    Dust storms are significant contributors to ambient levels of particulate matter (PM) in many areas of the world. Central Asia, an area that is relatively understudied in this regard, is anticipated to be affected by dust storms due to its proximity to several major deserts that ...

  2. Gastroprotective activity of essential oil of the Syzygium aromaticum and its major component eugenol in different animal models.

    PubMed

    Santin, José Roberto; Lemos, Marivane; Klein-Júnior, Luiz Carlos; Machado, Isabel Daufenback; Costa, Philipe; de Oliveira, Ana Paula; Tilia, Crislaine; de Souza, Juliana Paula; de Sousa, João Paulo Barreto; Bastos, Jairo Kenupp; de Andrade, Sérgio Faloni

    2011-02-01

    Syzygium aromaticum, a medicinal plant commonly known as clove, is used to treat toothache, respiratory disorders, inflammation, and gastrointestinal disorders. From the flower buds of S. aromaticum, it is possible to obtain an essential oil comprised of a mixture of aliphatic and cyclic volatile terpenes and phenylpropanoids, being eugenol as the main component. The aims of this study were: (1) to extract the essential oil of the flower buds of S. aromaticum, (2) to identify and quantify the main component of the essential oil, and (3) to evaluate its antiulcer activity using different animal models. Assays were performed using the following protocols in rats: indomethacin-induced and ethanol/HCl-induced ulcer model. Both essential oils from S. aromaticum and eugenol displayed antiulcer activities in the rat models of indomethacin- and ethanol-induced ulcer. Studies focusing on the possible mechanisms of gastroprotection were also undertaken using the following experiments: evaluation of gastric secretion by the pylorus-ligated model, determination of mucus in gastric content, participation of nitric oxide (NO) and endogenous sulfhydryl in gastric protection. The results show that there was no significant effect on the volume of gastric juice and total acidity. However, the quantification of free gastric mucus showed that the clove oil and eugenol were capable of significantly enhancing mucus production. With regard to the NO and endogenous sulfhydryls, the results demonstrated that the gastroprotection induced by clove oil and eugenol are not related to the activities of the nitric oxide and endogenous sulfhydryls. No sign of toxicity was observed in the acute toxicity study. In conclusion, the results of this study show that essential oil of S. aromaticum, as well as its main component (eugenol), possesses antiulcer activity. The data suggest that the effectiveness of the essential oil and eugenol is based on its ability to stimulate the synthesis of mucus, an

  3. Integrated Lecture and Laboratory Chemistry Components of Science Education Program for Early and Middle Childhood Education Majors

    NASA Astrophysics Data System (ADS)

    Lunsford, S. K.

    2004-05-01

    Two new chemistry courses were developed for early childhood and middle childhood education majors. The results of a pre- and posttest in the courses indicate success in developing student content knowledge and ability to problem solve. In addition these courses are designed to develop preservice teachers' understanding of the National Science Education Standards and foster support for implementing these standards in their classrooms. These courses provide materials, resources, and guidance in implementing the standards in their future teaching careers.

  4. Is Cycloxygenase-2 (COX-2) a Major Component of the Mechanism Responsible for Microvascular Remodeling in the Brain?

    NASA Astrophysics Data System (ADS)

    LaManna, Joseph C.; Sun, Xiaoyan; Ivy, Andre D.; Ward, Nicole L.

    We have used a relatively simple model of hypoxia that triggers adaptive structural changes in the cerebral microvasculature to study the process of physiological angiogenesis. This model can be used to obtain mechanistic data for the processes that probably underlie the dynamic structural changes that occur in learning and the control of oxygen availability to the neurovascular unit. These mechanisms are broadly involved in a wide variety of pathophysiological processes. This is the vascular component to CNS functional plasticity, supporting learning and adaptation. The angiogenic process may wane with age, contributing to the decreasing ability to survive metabolic stress and the diminution of neuronal plasticity.

  5. Molecular evidence that deep-branching fungi are major fungal components in deep-sea methane cold-seep sediments.

    PubMed

    Nagahama, Takahiko; Takahashi, Eriko; Nagano, Yuriko; Abdel-Wahab, Mohamed A; Miyazaki, Masayuki

    2011-08-01

    The motile cells of chytrids were once believed to be relics from the time before the colonization of land by fungi. However, the majority of chytrids had not been found in marine but freshwater environments. We investigated fungal diversity by a fungal-specific PCR-based analysis of environmental DNA in deep-sea methane cold-seep sediments, identifying a total of 35 phylotypes, 12 of which were early diverging fungi (basal fungi, ex 'lower fungi'). The basal fungi occupied a major portion of fungal clones. These were phylogenetically placed into a deep-branching clade of fungi and the LKM11 clade that was a divergent group comprised of only environmental clones from aquatic environments. As suggested by Lara and colleagues, species of the endoparasitic genus Rozella, being recently considered of the earliest branching taxa of fungi, were nested within the LKM11 clade. In the remaining 23 phylotypes identified as the Dikarya, the majority of which were similar to those which appeared in previously deep-sea studies, but also highly novel lineages associated with Soil Clone Group I (SCGI), Entorrhiza sp. and the agaricomycetous fungi were recorded. The fungi of the Dikarya may play a role in the biodegradation of lignin and lignin-derived materials in deep-sea, because the characterized fungal species related to the frequent phylotypes within the Dikarya have been reported to possess an ability to degrade lignin.

  6. Rapid simultaneous determination of major isoflavones of Pueraria lobata and discriminative analysis of its geographical origins by principal component analysis.

    PubMed

    Zhao, Chenxi; Chan, Hoi-yan; Yuan, Dalin; Liang, Yizeng; Lau, Tsui-yan; Chau, Foo-Tim

    2011-01-01

    Isoflavones are main bioactive components of Pueraria lobata (Willd.) Ohwi. Puerarin has been used as the marker compound in herb quality evaluation in the Chinese Pharmacopoiea. However, it is also important to include the other isoflavones present in the herb, such as daidzin, daidzein, genistin and genistein, in the evaluation as they also contribute to the overall bioactivity of the herb. To develop a rapid and reliable method for simultaneous quantitation of isoflavones for P. lobata herb quality evluation. The chromatographic separation was performed on an Agilent rapid resolution liquid chromatographic system through gradient elution. The developed method for the quantification of puerarin, daidzin, daidzein, genistin and genistein was fully validated. When it was applied to analyse the extracts of P. lobata, baseline separation was obtained within 10 min. The amounts of puerarin, daidzin, daidzein and genistin varied greatly among the samples although their chromatographic fingerprints were similar to each other. The 19 samples studied were classified into three clusters (I-III) by principal component analysis based on the amounts of puerarin, daidzin, daidzein and genistin. The classification result can be related to herbal origins, but the classification outcome from the chromatographic fingerprinting similarity approach did not provide any geographical origin information. This shows that bioactive constituents can reflect the intrinsic quality of P. lobata more accurately. Copyright © 2011 John Wiley & Sons, Ltd.

  7. Rapidly evolving zona pellucida domain proteins are a major component of the vitelline envelope of abalone eggs.

    PubMed

    Aagaard, Jan E; Yi, Xianhua; MacCoss, Michael J; Swanson, Willie J

    2006-11-14

    Proteins harboring a zona pellucida (ZP) domain are prominent components of vertebrate egg coats. Although less well characterized, the egg coat of the non-vertebrate marine gastropod abalone (Haliotis spp.) is also known to contain a ZP domain protein, raising the possibility of a common molecular basis of metazoan egg coat structures. Egg coat proteins from vertebrate as well as non-vertebrate taxa have been shown to evolve under positive selection. Studied most extensively in the abalone system, coevolution between adaptively diverging egg coat and sperm proteins may contribute to the rapid development of reproductive isolation. Thus, identifying the pattern of evolution among egg coat proteins is important in understanding the role these genes may play in the speciation process. The purpose of the present study is to characterize the constituent proteins of the egg coat [vitelline envelope (VE)] of abalone eggs and to provide preliminary evidence regarding how selection has acted on VE proteins during abalone evolution. A proteomic approach is used to match tandem mass spectra of peptides from purified VE proteins with abalone ovary EST sequences, identifying 9 of 10 ZP domain proteins as components of the VE. Maximum likelihood models of codon evolution suggest positive selection has acted among a subset of amino acids for 6 of these genes. This work provides further evidence of the prominence of ZP proteins as constituents of the egg coat, as well as the prominent role of positive selection in diversification of these reproductive proteins.

  8. Rapidly evolving zona pellucida domain proteins are a major component of the vitelline envelope of abalone eggs

    PubMed Central

    Aagaard, Jan E.; Yi, Xianhua; MacCoss, Michael J.; Swanson, Willie J.

    2006-01-01

    Proteins harboring a zona pellucida (ZP) domain are prominent components of vertebrate egg coats. Although less well characterized, the egg coat of the non-vertebrate marine gastropod abalone (Haliotis spp.) is also known to contain a ZP domain protein, raising the possibility of a common molecular basis of metazoan egg coat structures. Egg coat proteins from vertebrate as well as non-vertebrate taxa have been shown to evolve under positive selection. Studied most extensively in the abalone system, coevolution between adaptively diverging egg coat and sperm proteins may contribute to the rapid development of reproductive isolation. Thus, identifying the pattern of evolution among egg coat proteins is important in understanding the role these genes may play in the speciation process. The purpose of the present study is to characterize the constituent proteins of the egg coat [vitelline envelope (VE)] of abalone eggs and to provide preliminary evidence regarding how selection has acted on VE proteins during abalone evolution. A proteomic approach is used to match tandem mass spectra of peptides from purified VE proteins with abalone ovary EST sequences, identifying 9 of 10 ZP domain proteins as components of the VE. Maximum likelihood models of codon evolution suggest positive selection has acted among a subset of amino acids for 6 of these genes. This work provides further evidence of the prominence of ZP proteins as constituents of the egg coat, as well as the prominent role of positive selection in diversification of these reproductive proteins. PMID:17085584

  9. Identification of a novel component leading to anti-tumor activity besides the major ingredient cordycepin in Cordyceps militaris extract.

    PubMed

    Wada, Takeharu; Sumardika, I Wayan; Saito, Shingo; Ruma, I Made Winarsa; Kondo, Eisaku; Shibukawa, Masami; Sakaguchi, Masakiyo

    2017-09-01

    In accordance with our previous study that was carried out to identify novel anti-tumor ingredients, chromatographic separation in combination with an anti-tumor activity assay was used for analysis of Cordyceps militaris extract in this study. Various modes of chromatography including reversed-phase, cation-exchange and anion-exchange were used to separate components of Cordyceps militaris, which showed various chemical properties. Anti-tumor activity of each fraction was assessed by a Hoechst staining-based apoptosis assay using malignant melanoma MeWo cells. By these repeated approaches through chromatographic segregation and cell biological assay, we finally succeeded in identifying the target substance from a certain fraction that included neutral hydrophilic components using a pre-column and post-column chlorine adduct ionization LC-APCI-MS method. The target substance was a mono-carbohydrate, xylitol, that induced apoptotic cell death in MeWo cells but not in normal human OUMS-24 fibroblasts. This is the first study showing that Cordyceps militaris extract contains a large amount of xylitol. Thus, our results will contribute greatly to uncovering the mysterious multifunctional herbal drug Cordyceps militaris as an anti-tumor agent. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Composing Models of Geographic Physical Processes

    NASA Astrophysics Data System (ADS)

    Hofer, Barbara; Frank, Andrew U.

    Processes are central for geographic information science; yet geographic information systems (GIS) lack capabilities to represent process related information. A prerequisite to including processes in GIS software is a general method to describe geographic processes independently of application disciplines. This paper presents such a method, namely a process description language. The vocabulary of the process description language is derived formally from mathematical models. Physical processes in geography can be described in two equivalent languages: partial differential equations or partial difference equations, where the latter can be shown graphically and used as a method for application specialists to enter their process models. The vocabulary of the process description language comprises components for describing the general behavior of prototypical geographic physical processes. These process components can be composed by basic models of geographic physical processes, which is shown by means of an example.

  11. Effect of homogenizer performance on accuracy and repeatability of mid-infrared predicted values for major milk components.

    PubMed

    Di Marzo, Larissa; Barbano, David M

    2016-12-01

    Our objective was to determine the effect of mid-infrared (MIR) homogenizer efficiency on accuracy and repeatability of Fourier transform MIR predicted fat, true protein, and anhydrous lactose determination given by traditional filter and partial least squares (PLS) prediction models. Five homogenizers with different homogenization performance based on laser light-scattering particle size analysis were used. Repeatability and accuracy were determined by conducting 17 sequential readings on milk homogenized externally to the instrument (i.e., control) and unhomogenized milk. Milk component predictions on externally homogenized milks were affected by variation in homogenizer performance, but the magnitude of effect were small (i.e., <0.025%) when milks were pumped through both efficient and inefficient homogenizers within a MIR milk analyzer. Variation in the in-line MIR homogenizer performance on unhomogenized milks had a much larger effect on accuracy of component testing than on repeatability. The increase of particle size distribution [d(0.9)] from 1.35 to 3.03μm (i.e., fat globule diameter above which 10% of the volume of fat is contained) due to poor homogenization affected fat tests the most; traditional filter based fat B (carbon hydrogen stretch; -0.165%), traditional filter-based fat A (carbonyl stretch; -0.074%), and fat PLS (-0.078%) at a d(0.9) of 3.03μm. Variation in homogenization efficiency also affected traditional filter-based true protein test (+0.012%), true protein PLS prediction (-0.107%), and traditional filter-based anhydrous lactose test (+0.027%) at a d(0.9) of 3.03μm. Effects of variation in homogenization on anhydrous lactose PLS predictions were small. The accuracy of both traditional filter models and PLS models were influenced by poor homogenization. The value of 1.7µm for a d(0.9) used by the USDA Federal Milk Market laboratories as a criterion to make the decision to replace the homogenizer in a MIR milk analyzer appears to be a

  12. Components of electroencephalographic responses to slaughter in halothane - anaesthetised calves : effects of cutting neck tissues compared with major blood vessels.

    PubMed

    Gibson, T J; Johnson, C B; Murrell, J C; Chambers, J P; Stafford, K J; Mellor, D J

    2009-04-01

    To identify whether cutting neck tissues or cutting major blood vessels initiates the mechanisms responsible for electroencephalographic (EEG) responses to slaughter by ventral-neck incision without prior stunning in halothane-anaesthetised calves. Calves were assigned to two groups, viz transection of neck tissues with intact blood circulation through the brain (n=10), or transection of the major blood vessels of the neck but not most other neck tissues (n=7). They were minimally anaesthetised with halothane, using an established anaesthesia protocol. The animals in the neck-tissue transection group had their carotid arteries and jugular veins exposed and cannulated proximal and distal to the proposed site of subsequent ventral-neck incision; this diverted blood flow through these vessels so that cerebral perfusion and drainage were preserved. In animals in the blood-vessel transection group, the carotid arteries and jugular veins were exposed bilaterally by surgical dissection. They were then transected without further damage to the remaining structures of the neck. Changes in the median frequency (F50), 95% spectral edge frequency (F95), total power of the EEG (Ptot), and arterial blood pressure were compared within each group before and after neck-tissue or blood-vessel transection, and between groups following treatments. Neck-tissue transection resulted in little overall change in the F50, an increase in the F95, and an initial increase in Ptot followed by a transient decrease and eventual return to pre-treatment values. There was between-animal variation in these EEG parameters. Transection of the major blood vessels of the neck resulted in a decrease in F50 in most animals; changes in F95 were highly variable, and there was a decrease in Ptot. The EEG responses seen following neck-tissue and blood-vessel transection were qualitatively distinct, and suggested that cutting neck tissues caused greater noxious sensory input than transection of only the major

  13. The amino-acid sequence of alpha A- and beta-chains from the major hemoglobin component of American flamingo (Phoenicopterus ruber ruber).

    PubMed

    Godovac-Zimmermann, J; Braunitzer, G

    1984-04-01

    The complete amino-acid sequence of alpha A- and beta-chains from the major hemoglobin component (HbA) of American Flamingo ( Phoenicopterus ruber ruber) is presented. The minor component (HbD) with alpha D-chains was detected in similar amounts (25%) as in chicken and pheasant hemoglobins. The comparison of American Flamingo and Greylag Goose (Anser anser) hemoglobins shows that alpha A-chains differ by 22 exchanges and beta-chains by only 4 exchanges. Two substitutions modify alpha 1 beta 1-contacts. Amino-acid replacements between American Flamingo and other bird hemoglobins are discussed.

  14. Biocontrol evaluation of extracts and a major component, clusianone, from Clusia fluminensis Planch. & Triana against Aedes aegypti

    PubMed Central

    Anholeti, Maria C; Duprat, Rodrigo C; Figueiredo, Maria R; Kaplan, Maria AC; Santos, Marcelo Guerra; Gonzalez, Marcelo S; Ratcliffe, Norman A; Feder, Denise; Paiva, Selma R; Mello, Cicero B

    2015-01-01

    Studies evaluated the effects of hexanic extracts from the fruits and flowers ofClusia fluminensis and the main component of the flower extract, a purified benzophenone (clusianone), against Aedes aegypti. The treatment of larvae with the crude fruit or flower extracts from C. fluminensis did not affect the survival ofAe. aegypti (50 mg/L), however, the flower extracts significantly delayed development of Ae. aegypti. In contrast, the clusianone (50 mg/L) isolate from the flower extract, representing 54.85% of this sample composition, showed a highly significant inhibition of survival, killing 93.3% of the larvae and completely blocking development of Ae. aegypti. The results showed, for the first time, high activity of clusianone against Ae. aegypti that both killed and inhibited mosquito development. Therefore, clusianone has potential for development as a biopesticide for controlling insect vectors of tropical diseases. Future work will elucidate the mode of action of clusianone isolated from C. fluminensis. PMID:26200711

  15. The sensitivity of fast muscle contractile function to the major components of the sarcomere Ca(2+)-cycling system.

    PubMed

    Golding, C; Kelly, K; Kinsey, S T; Locke, B R

    2016-04-01

    A reaction-diffusion model of a muscle sarcomere was developed to evaluate the sensitivity of force characteristics to diffusion and Ca(2+)-cycling components. The model compared well to experimental force measurements. Diffusion led to Ca(2+) gradients that enhanced maximal force and accelerated relaxation compared to when diffusion was infinitely fast. However, a modest increase in sarcomere length or radius led to a decrease in maximal force. Lowering the Ca(2+) release rate caused a lower maximal force, but increasing the rate led to only modest gains in maximal force while incurring much greater ATP costs associated with reuptake. Greater parvalbumin binding rates decreased maximal force but enhanced relaxation, and this effect was magnified when Ca(2+) uptake rates were lowered as may occur during fatigue. These results show a physiological set of parameters that lead to a functional sarcomere of known dimensions and contractile function, and the effects of parameter variation on muscle function.

  16. Adverse Effects of Hydroalcoholic Extracts and the Major Components in the Stems of Impatiens balsamina L. on Caenorhabditis elegans

    PubMed Central

    Zhuang, Zi-Heng; Hou, Bei-Wei; Shi, Bao-Jun; Shu, Cheng-Jie; Chen, Lei

    2017-01-01

    Impatiens balsamina L. (Balsaminaceae), an annual herb found throughout China, has been extensively used in traditional Chinese medicine (TCM). However, our knowledge regarding the adverse effects of I. balsamina in vivo is very limited. In this present study, the nematode Caenorhabditis elegans model was employed to fully assess the adverse effects of hydroalcoholic (EtOH 55%) extracts of I. balsamina stems (HAEIBS) in vivo. After exposure to 10 mg/mL HAEIBS, the major organism-level endpoints of C. elegans of percent survival, frequency of head thrash and body bends, and reproduction had decreased by 24%, 30%, and 25%, respectively. The lifespan of C. elegans was also greatly reduced after HAEIBS exposure compared to the controls. The active compounds in HAEIBS were separated using high speed countercurrent chromatograph (HSCCC) and characterized by high performance liquid chromatography (HPLC) and nuclear magnetic resonance (NMR). Two compounds, lawsone and 2-methoxy-1,4-naphthoquinone (MNQ), and their adverse effects were then more thoroughly detailed in this study. It was found that lawsone is the major toxin in HAEIBS with a higher toxicity than MNQ in terms of negative impact on C. elegans mortality, locomotion, reproduction, and lifespan. Our data also suggests that the C. elegans model may be useful for assessing the possible toxicity of other Chinese medicines, plant extracts, and/or compounds. PMID:28326124

  17. Major involvement of bacterial components in rheumatoid arthritis and its accompanying oxidative stress, systemic inflammation and hypercoagulability

    PubMed Central

    Akeredolu, Oore-Ofe; Soma, Prashilla; Kell, Douglas B

    2016-01-01

    We review the evidence that infectious agents, including those that become dormant within the host, have a major role to play in much of the etiology of rheumatoid arthritis and the inflammation that is its hallmark. This occurs in particular because they can produce cross-reactive (auto-)antigens, as well as potent inflammagens such as lipopolysaccharide that can themselves catalyze further inflammagenesis, including via β-amyloid formation. A series of observables coexist in many chronic, inflammatory diseases as well as rheumatoid arthritis. They include iron dysregulation, hypercoagulability, anomalous morphologies of host erythrocytes, and microparticle formation. Iron dysregulation may be responsible for the periodic regrowth and resuscitation of the dormant bacteria, with concomitant inflammagen production. The present systems biology analysis benefits from the philosophical idea of “coherence,” that reflects the principle that if a series of ostensibly unrelated findings are brought together into a self-consistent narrative, that narrative is thereby strengthened. As such, we provide a coherent and testable narrative for the major involvement of (often dormant) bacteria in rheumatoid arthritis. PMID:27889698

  18. Major involvement of bacterial components in rheumatoid arthritis and its accompanying oxidative stress, systemic inflammation and hypercoagulability.

    PubMed

    Pretorius, Etheresia; Akeredolu, Oore-Ofe; Soma, Prashilla; Kell, Douglas B

    2017-02-01

    We review the evidence that infectious agents, including those that become dormant within the host, have a major role to play in much of the etiology of rheumatoid arthritis and the inflammation that is its hallmark. This occurs in particular because they can produce cross-reactive (auto-)antigens, as well as potent inflammagens such as lipopolysaccharide that can themselves catalyze further inflammagenesis, including via β-amyloid formation. A series of observables coexist in many chronic, inflammatory diseases as well as rheumatoid arthritis. They include iron dysregulation, hypercoagulability, anomalous morphologies of host erythrocytes, and microparticle formation. Iron dysregulation may be responsible for the periodic regrowth and resuscitation of the dormant bacteria, with concomitant inflammagen production. The present systems biology analysis benefits from the philosophical idea of "coherence," that reflects the principle that if a series of ostensibly unrelated findings are brought together into a self-consistent narrative, that narrative is thereby strengthened. As such, we provide a coherent and testable narrative for the major involvement of (often dormant) bacteria in rheumatoid arthritis.

  19. Production of pinoresinol diglucoside, pinoresinol monoglucoside, and pinoresinol by Phomopsis sp. XP-8 using mung bean and its major components.

    PubMed

    Zhang, Yan; Shi, Junling; Gao, Zhenhong; Yangwu, Ruiming; Jiang, Huanshi; Che, Jinxin; Liu, Yanlin

    2015-06-01

    Phomopsis sp. XP-8 is an endophytic fungus that has the ability to produce pinoresinol diglucoside (PDG) in vitro and thus has potential application for the biosynthesis of PDG independent of plants. When cultivated in mung bean medium, PDG production was significantly improved and pinoresinol monoglucoside (PMG) and pinoresinol (Pin) were also found in the culture medium. In this experiment, starch, protein, and polysaccharides were isolated from mung beans and separately used as the sole substrate in order to explore the mechanism of fermentation and identify the major substrates that attributed to the biotransformation of PDG, PMG, and Pin. The production of PDG, PMG, and Pin was monitored using high-performance liquid chromatography (HPLC) and confirmed using HPLC-MS. Activities of related enzymes, including phenylalanine ammonia-lyase (PAL), trans-cinnamate 4-hydroxylase (C4H), and 4-coumarate-CoA ligase (4CL) were analyzed and tracked during the cultivation. The reaction system contained the compounds isolated from mung bean in the designed amount. Accumulation of phenylalanine, cinnamic acid, p-coumaric acid, PDG, PMG, and Pin and the activities of PAL, C4H, and 4CL were measured during the bioconversion. PMG was found only when mung bean polysaccharide was analyzed, while production of PDG and Pin were found when both polysaccharide and starch were analyzed. After examining the monosaccharide composition of the mung bean polysaccharide and the effect of the different monosaccharides had on the production of PMG, PDG, and Pin, galactose in mung bean polysaccharide proved to be the major factor that stimulates the production of PMG.

  20. Identification and differentiation of major components in three different "Sheng-ma" crude drug species by UPLC/Q-TOF-MS.

    PubMed

    Fan, Mengxue; Qin, Kunming; Ding, Fei; Huang, Yuting; Wang, Xiaoli; Cai, Baochang

    2017-03-01

    Cimicifugae Rhizoma (Sheng ma) is a Ranunculaceae herb belonging to a composite family and well known in China. has been widely used in traditional Chinese medicine. The Pharmacopoeia of the People׳s Republic of China contains three varieties (Cimicifuga dahurica (Turcz.), Cimicifuga foetida L. and Cimicifuga heracleifolia Kom.) which have been used clinically as "Sheng-ma". However, the chemical constituents of three components of "Sheng-ma" have never been documented. In this study, a rapid method for the analysis of the main components of "Sheng-ma" was developed using ultra-high performance liquid chromatography with quadrupole-time-of-flight mass spectrometry (UPLC/Q-TOF-MS). The present study reveals the major common and distinct chemical constituents of C. dahurica, C. foetida and C. heracleifolia and also reports principal component and statistical analyses of these results. The components were identified by comparing the retention time, accurate mass, mass spectrometric fragmentation characteristic ions and matching empirical molecular formula with that of the published compounds. A total of 32 common components and 8 markers for different "Sheng-ma" components were identified. These findings provide an important basis for the further study and clinical utilities of the three "Sheng-ma" varieties.

  1. Rapid and Sensitive Determination of Major Active Ingredients and Toxic Components in GinkgoBiloba Leaves Extract (EGb 761) by a Validated UPLC-MS-MS Method.

    PubMed

    Wang, Yao; Liu, Yuan; Wu, Qi; Yao, Xin; Cheng, Zongqi

    2017-01-08

    An accurate, precise and sensitive ultra-performance liquid chromatography tandem mass spectrometric (UPLC-MS-MS) method was developed for the determination of flavonoids, terpene lactones, together with ginkgolic acids in Ginkgo biloba leaves extract (EGb 761). This is the first report of the simultaneous analysis of major active ingredients and toxic components in EGb 761 using UPLC-MS-MS. This analysis afforded good linearity, precision, repeatability and accuracy. In addition, the content of those major bioactive components in EGb 761 prepared by different manufacturers of China was determined to establish the effectiveness of the method. The results indicated that the quantification analysis could be readily utilized as a quality control method for EGb 761 and its other related products using flavonoids, terpene lactones and ginkgolic acids as markers.

  2. Protocol for a systematic review of the clinical effectiveness of pre-hospital blood components compared to other resuscitative fluids in patients with major traumatic haemorrhage.

    PubMed

    Dretzke, Janine; Smith, Iain M; James, Robert H; Midwinter, Mark J

    2014-10-24

    There is growing interest in the use of blood components for pre-hospital resuscitation of patients with major traumatic haemorrhage. It has been speculated that early resuscitation with blood components may have benefits in terms of treating trauma-induced coagulopathy, which in turn may influence survival. The proposed systematic review will evaluate the evidence on the clinical effectiveness of pre-hospital blood components (red blood cells and/or plasma or whole blood), in both civilian and military settings, compared with other resuscitation strategies in patients with major traumatic haemorrhage. Standard systematic review methods aimed at minimising bias will be employed for study identification, selection and data extraction. General medical and specialist databases will be searched; the search strategy will combine terms for the population, intervention and setting. Studies will be selected for review if the population includes adult patients with major traumatic haemorrhage who receive blood components in a pre-hospital setting (civilian or military). Systematic reviews, randomised and non-randomised controlled trials and controlled observational studies will be included. Uncontrolled studies will be considered depending on the volume of controlled evidence. Quality assessment will be tailored to different study designs. Both patient related and surrogate outcomes will be considered. Synthesis is likely to be primarily narrative, but meta-analyses and subgroup analyses will be undertaken where clinical and methodological homogeneity exists. Given the increasing use by emergency services of blood components for pre-hospital resuscitation, this is a timely systematic review, which will attempt to clarify the evidence base for this practice. As far as the authors are aware, the proposed systematic review will be the first to address this topic. PROSPERO CRD42014013794.

  3. Effect of essential oils of Syzygium aromaticum and Cinnamomum zeylanicum and their major components on biofilm production in Staphylococcus aureus strains isolated from milk of cows with mastitis.

    PubMed

    Budri, P E; Silva, N C C; Bonsaglia, E C R; Fernandes Júnior, A; Araújo Júnior, J P; Doyama, J T; Gonçalves, J L; Santos, M V; Fitzgerald-Hughes, D; Rall, V L M

    2015-09-01

    Bovine mastitis is an inflammation of the mammary glands of cows and causes significant economic losses in dairy cattle. Staphylococcus aureus is one of the microorganisms most commonly isolated. Novel agents are required in agricultural industries to prevent the development of mastitis. The production of biofilm by Staph. aureus facilitates the adhesion of bacteria to solid surfaces and contributes to the transmission and maintenance of these bacteria. The effect of the essential oils of Syzygium aromaticum (clove; EOSA) and Cinnamomum zeylanicum (cinnamon; EOCZ) and their major components, eugenol and cinnamaldehyde, on Staph. aureus biofilm formation on different surfaces was investigated. The results showed a significant inhibition of biofilm production by EOSA on polystyrene and stainless steel surfaces (69.4 and 63.6%, respectively). However, its major component, eugenol, was less effective on polystyrene and stainless steel (52.8 and 19.6%, respectively). Both EOCZ and its major component, cinnamaldehyde, significantly reduced biofilm formation on polystyrene (74.7 and 69.6%, respectively) and on stainless steel surfaces (45.3 and 44.9%, respectively). These findings suggest that EOSA, EOCZ, and cinnamaldehyde may be considered for applications such as sanitization in the food industry. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Induction by lysophosphatidylcholine, a major phospholipid component of atherogenic lipoproteins, of human coronary artery smooth muscle cell migration.

    PubMed

    Kohno, M; Yokokawa, K; Yasunari, K; Minami, M; Kano, H; Hanehira, T; Yoshikawa, J

    1998-07-28

    The objectives of the present study were (1) to determine whether lysophosphatidylcholine (lyso-PC), a prominent component of oxidatively modified LDL, induces migration of human coronary artery smooth muscle cells (SMCs) and, if so, to clarify the mechanism, and (2) to investigate the possible interactions of lyso-PC and platelet-derived growth factor (PDGF)-BB, endothelin- (ET-1), adrenomedullin (AM), or vitamin E on SMC migration by the Boyden's chamber method. Lyso-PC induced SMC migration in a concentration-dependent manner between 10(-6) and 5 x 10(-5) mol/L. By contrast, phosphatidylcholine was without significant activity, and lysophosphatidylinositol and lysophosphatidylserine were much less effective than lyso-PC. Lyso-PC increased basic fibroblast growth factor (bFGF) production in a concentration-dependent manner between 10(-6) and 5 x 10(-5) mol/L in these cells. Furthermore, lyso-PC-induced SMC migration was inhibited by neutralizing antibody to bFGF but not by neutralizing antibody to transforming growth factor-beta1. Lyso-PC-induced migration was significantly enhanced by PDGF-BB or ET-1 but was clearly inhibited by human AM and vitamin E. These results indicate that (1) lyso-PC induces human coronary artery SMC migration at least in part through release of endogenous bFGF and (2) this lyso-PC-induced migration can be further induced by PDGF-BB and ET-1 and can be inhibited by human AM and vitamin E. Lyso-PC may recruit medial SMCs during the process of coronary atherosclerosis in part by releasing bFGF in concert with PDGF-BB or ET-1 in vascular tissues. This lyso-PC-induced SMC migration may be suppressed by AM and vitamin E under certain pathological conditions.

  5. Antihypertensive effect of passion fruit peel extract and its major bioactive components following acute supplementation in spontaneously hypertensive rats.

    PubMed

    Lewis, Brandon J; Herrlinger, Kelli A; Craig, Teresa A; Mehring-Franklin, Cynthia E; Defreitas, Zoraida; Hinojosa-Laborde, Carmen

    2013-07-01

    Extracts from leaves, peels or flowers of Passiflora are noted for their medicinal effects. Passiflora edulis peel extract (PFPE) has been proposed to lower blood pressure (BP); however, only indirect measurement techniques have been employed. To more accurately measure the effect of PFPE on hemodynamic parameters and determine the minimal effective dose, hemodynamic parameters were directly measured in spontaneously hypertensive rats (SHR) implanted with radiotelemeters. PFPE was given orally at 0, 2.5, 50 or 200 mg/kg body weight (BW) to determine the minimal effective dose. Once this dose was determined, the potential active components, edulilic acid (EA), anthocyanin fraction (AF) or γ-aminobutyric acid (GABA), were tested to determine which may contribute to the reductions in BP. The 50 mg PFPE/kg BW dose was the lowest dose that significantly reduced all hemodynamic parameters from baseline when compared to control. When the potential actives were provided at equivalent doses to those found in 50 mg PFPE/kg BW, the EA and AF significantly reduced all measured hemodynamic parameters from baseline when compared to control. GABA did not significantly affect any hemodynamic parameters compared to control and significantly increased heart rate. These direct measurements indicate that PFPE can decrease hemodynamic parameters in SHR and indicate that EA and AF are active compounds that contribute to the antihypertensive effects of PFPE supplementation. While these results are encouraging, detailed mechanistic studies are needed to determine the putative value of PFPE for blood pressure control in humans. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. The Transcript Profile of a Traditional Chinese Medicine, Atractylodes lancea, Revealing Its Sesquiterpenoid Biosynthesis of the Major Active Components

    PubMed Central

    Ahmed, Shakeel; Zhan, Chuansong; Yang, Yanyan; Wang, Xuekui; Yang, Tewu; Zhao, Zeying; Zhang, Qiyun; Li, Xiaohua; Hu, Xuebo

    2016-01-01

    Atractylodes lancea (Thunb.) DC., named “Cangzhu” in China, which belongs to the Asteraceae family. In some countries of Southeast Asia (China, Thailand, Korea, Japan etc.) its rhizome, commonly called rhizoma atractylodis, is used to treat many diseases as it contains a variety of sesquiterpenoids and other components of medicinal importance. Despite its medicinal value, the information of the sesquiterpenoid biosynthesis is largely unknown. In this study, we investigated the transcriptome analysis of different tissues of non-model plant A. lancea by using short read sequencing technology (Illumina). We found 62,352 high quality unigenes with an average sequence length of 913 bp in the transcripts of A. Lancea. Among these, 43,049 (69.04%), 30,264 (48.53%), 26,233 (42.07%), 17,881 (28.67%) and 29,057(46.60%) unigenes showed significant similarity (E-value<1e-5) to known proteins in Nr, KEGG, SWISS-PROT, GO, and COG databases, respectively. Of the total 62,352 unigenes, 43,049 (Nr Database) open reading frames were predicted. On the basis of different bioinformatics tools we identify all the enzymes that take part in the terpenoid biosynthesis as well as five different known sesquiterpenoids via cytosolic mevalonic acid (MVA) pathway and plastidal methylerythritol phosphate (MEP) pathways. In our study, 6, 864 Simple Sequence Repeats (SSRs) were also found as great potential markers in A. lancea. This transcriptomic resource of A. lancea provides a great contribution in advancement of research for this specific medicinal plant and more specifically for the gene mining of different classes of terpenoids and other chemical compounds that have medicinal as well as economic importance. PMID:26990438

  7. Computational screen for spliceosomal RNA genes aids in defining the phylogenetic distribution of major and minor spliceosomal components.

    PubMed

    Dávila López, Marcela; Rosenblad, Magnus Alm; Samuelsson, Tore

    2008-05-01

    The RNA molecules of the spliceosome are critical for specificity and catalysis during splicing of eukaryotic pre-mRNA. In order to examine the evolution and phylogenetic distribution of these RNAs, we analyzed 149 eukaryotic genomes representing a broad range of phylogenetic groups. RNAs were predicted using high-sensitivity local alignment methods and profile HMMs in combination with covariance models. The results provide the most comprehensive view so far of the phylogenetic distribution of spliceosomal RNAs. RNAs were predicted in many phylogenetic groups where these RNA were not previously reported. Examples are RNAs of the major (U2-type) spliceosome in all fungal lineages, in lower metazoa and many protozoa. We also identified the minor (U12-type) spliceosomal U11 and U6atac RNAs in Acanthamoeba castellanii, where U12 spliceosomal RNA as well as minor introns were reported recently. In addition, minor-spliceosome-specific RNAs were identified in a number of phylogenetic groups where previously such RNAs were not observed, including the nematode Trichinella spiralis, the slime mold Physarum polycephalum and the fungal lineages Zygomycota and Chytridiomycota. The detailed map of the distribution of the U12-type RNA genes supports an early origin of the minor spliceosome and points to a number of occasions during evolution where it was lost.

  8. Inhibitory effect of Rhus verniciflua Stokes extract on human aromatase activity; butin is its major bioactive component.

    PubMed

    Park, Myeong Hyeon; Kim, In Sook; Kim, Sun-A; Na, Chun-Soo; Hong, Cheol Yi; Dong, Mi-Sook; Yoo, Hye Hyun

    2014-04-01

    Rhus verniciflua Stokes has been used as a traditional herbal medicine in Asia. In this study, the effect of R. verniciflua extract on human aromatase (cytochrome P450 19, CYP19) activity was investigated to elucidate the mechanism for the effect of R. verniciflua extract on androgen hormone levels. Androstenedione was used as a substrate and incubated with R. verniciflua extract in cDNA-expressed CYP19 supersomes in the presence of NADPH, and estrone formation was measured using liquid chromatography-tandem mass spectrometry. R. verniciflua extract was assessed at concentrations of 10-1000 μg/mL. The resulting data showed that R. verniciflua extract inhibited CYP19-mediated estrone formation in a concentration-dependent manner with an IC50 value of 136 μg/mL. Subsequently, polyphenolic compounds from R. verniciflua extract were tested to identify the ingredients responsible for the aromatase inhibitory effects by R. verniciflua extract. As a result, butin showed aromatase inhibitory effect in a concentration-dependent manner with an IC50 value of 9.6 μM, whereas the inhibition by other compounds was negligible. These results suggest that R. verniciflua extract could modulate androgen hormone levels via the inhibition of CYP19 activity and butin is a major ingredient responsible for this activity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Computational screen for spliceosomal RNA genes aids in defining the phylogenetic distribution of major and minor spliceosomal components

    PubMed Central

    López, Marcela Dávila; Alm Rosenblad, Magnus; Samuelsson, Tore

    2008-01-01

    The RNA molecules of the spliceosome are critical for specificity and catalysis during splicing of eukaryotic pre-mRNA. In order to examine the evolution and phylogenetic distribution of these RNAs, we analyzed 149 eukaryotic genomes representing a broad range of phylogenetic groups. RNAs were predicted using high-sensitivity local alignment methods and profile HMMs in combination with covariance models. The results provide the most comprehensive view so far of the phylogenetic distribution of spliceosomal RNAs. RNAs were predicted in many phylogenetic groups where these RNA were not previously reported. Examples are RNAs of the major (U2-type) spliceosome in all fungal lineages, in lower metazoa and many protozoa. We also identified the minor (U12-type) spliceosomal U11 and U6atac RNAs in Acanthamoeba castellanii, where U12 spliceosomal RNA as well as minor introns were reported recently. In addition, minor-spliceosome-specific RNAs were identified in a number of phylogenetic groups where previously such RNAs were not observed, including the nematode Trichinella spiralis, the slime mold Physarum polycephalum and the fungal lineages Zygomycota and Chytridiomycota. The detailed map of the distribution of the U12-type RNA genes supports an early origin of the minor spliceosome and points to a number of occasions during evolution where it was lost. PMID:18390578

  10. CD34+ mesenchymal cells are a major component of the intestinal stem cells niche at homeostasis and after injury

    PubMed Central

    Stzepourginski, Igor; Nigro, Giulia; Jacob, Jean-Marie; Dulauroy, Sophie; Sansonetti, Philippe J.; Eberl, Gérard; Peduto, Lucie

    2017-01-01

    The intestinal epithelium is continuously renewed by intestinal epithelial stem cells (IESCs) positioned at the base of each crypt. Mesenchymal-derived factors are essential to maintain IESCs; however, the cellular composition and development of such mesenchymal niche remains unclear. Here, we identify pericryptal CD34+ Gp38+ αSMA– mesenchymal cells closely associated with Lgr5+ IESCs. We demonstrate that CD34+ Gp38+ cells are the major intestinal producers of the niche factors Wnt2b, Gremlin1, and R-spondin1, and are sufficient to promote maintenance of Lgr5+ IESCs in intestinal organoids, an effect mainly mediated by Gremlin1. CD34+ Gp38+ cells develop after birth in the intestinal submucosa and expand around the crypts during the third week of life in mice, independently of the microbiota. We further show that pericryptal CD34+gp38+ cells are rapidly activated by intestinal injury, up-regulating niche factors Gremlin1 and R-spondin1 as well as chemokines, proinflammatory cytokines, and growth factors with key roles in gut immunity and tissue repair, including IL-7, Ccl2, Ptgs2, and Amphiregulin. Our results indicate that CD34+ Gp38+ mesenchymal cells are programmed to develop in the intestine after birth to constitute a specialized microenvironment that maintains IESCs at homeostasis and contribute to intestinal inflammation and repair after injury. PMID:28074039

  11. Composing Music with Complex Networks

    NASA Astrophysics Data System (ADS)

    Liu, Xiaofan; Tse, Chi K.; Small, Michael

    In this paper we study the network structure in music and attempt to compose music artificially. Networks are constructed with nodes and edges corresponding to musical notes and their co-occurrences. We analyze sample compositions from Bach, Mozart, Chopin, as well as other types of music including Chinese pop music. We observe remarkably similar properties in all networks constructed from the selected compositions. Power-law exponents of degree distributions, mean degrees, clustering coefficients, mean geodesic distances, etc. are reported. With the network constructed, music can be created by using a biased random walk algorithm, which begins with a randomly chosen note and selects the subsequent notes according to a simple set of rules that compares the weights of the edges, weights of the nodes, and/or the degrees of nodes. The newly created music from complex networks will be played in the presentation.

  12. Organists and organ music composers.

    PubMed

    Foerch, Christian; Hennerici, Michael G

    2015-01-01

    Clinical case reports of patients with exceptional musical talent and education provide clues as to how the brain processes musical ability and aptitude. In this chapter, selected examples from famous and unknown organ players/composers are presented to demonstrate the complexity of modified musical performances as well as the capacities of the brain to preserve artistic abilities: both authors are active organists and academic neurologists with strong clinical experience, practice, and knowledge about the challenges to play such an outstanding instrument and share their interest to explore potentially instrument-related phenomena of brain modulation in specific transient or permanent impairments. We concentrate on the sites of lesions, suggested pathophysiology, separate positive (e.g., seizures, visual or auditory hallucinations, or synesthesia [an involuntary perception produced by stimulation of another sense]) and negative phenomena (e.g., amusia, aphasia, neglect, or sensory-motor deficits) and particularly address aspects of recent concepts of temporary and permanent network disorders.

  13. Gene Expression Analysis of Rice Seedling under Potassium Deprivation Reveals Major Changes in Metabolism and Signaling Components

    PubMed Central

    Shankar, Alka; Singh, Amarjeet; Kanwar, Poonam; Srivastava, Ashish Kumar; Pandey, Amita; Suprasanna, Penna; Kapoor, Sanjay; Pandey, Girdhar K.

    2013-01-01

    Plant nutrition is one of the important areas for improving the yield and quality in crops as well as non-crop plants. Potassium is an essential plant nutrient and is required in abundance for their proper growth and development. Potassium deficiency directly affects the plant growth and hence crop yield and production. Recently, potassium-dependent transcriptomic analysis has been performed in the model plant Arabidopsis, however in cereals and crop plants; such a transcriptome analysis has not been undertaken till date. In rice, the molecular mechanism for the regulation of potassium starvation responses has not been investigated in detail. Here, we present a combined physiological and whole genome transcriptomic study of rice seedlings exposed to a brief period of potassium deficiency then replenished with potassium. Our results reveal that the expressions of a diverse set of genes annotated with many distinct functions were altered under potassium deprivation. Our findings highlight altered expression patterns of potassium-responsive genes majorly involved in metabolic processes, stress responses, signaling pathways, transcriptional regulation, and transport of multiple molecules including K+. Interestingly, several genes responsive to low-potassium conditions show a reversal in expression upon resupply of potassium. The results of this study indicate that potassium deprivation leads to activation of multiple genes and gene networks, which may be acting in concert to sense the external potassium and mediate uptake, distribution and ultimately adaptation to low potassium conditions. The interplay of both upregulated and downregulated genes globally in response to potassium deprivation determines how plants cope with the stress of nutrient deficiency at different physiological as well as developmental stages of plants. PMID:23922980

  14. Activation of Latent TGF-β1 by Thrombospondin-1 is a Major Component of Wound Repair

    PubMed Central

    Nör, Jacques E.; DiPietro, Luisa; Murphy-Ullrich, Joanne E.; Hynes, Richard O.; Lawler, Jack; Polverini, Peter J.

    2011-01-01

    Purpose Thrombospondin 1 (TSP1) is a matrix glycoprotein that regulates cell adhesion, migration, and proliferation, and is a natural inhibitor of angiogenesis. Recent evidence suggests that TSP1 is a major physiologic activator of latent transforming growth factor-β1 (TGF-β1), and that TGF-β1 is important for wound healing. The purpose of this study was to examine whether excisional wound healing in TSP1-deficient mice is compromised as a result of deficient TGF-β1 activation. Materials and Methods Punch wounds were made on the dorsum of TSP1 deficient and wild-type mice and the area of granulation tissue, number of microvessels, and inflammatory cell infiltration was evaluated over a period of 28 days. Results TSP1 deficient mice showed impaired wound healing with persistent granulation tissue, decreased collagen content over time, and delayed arrival of macrophages compared to wild-type littermates. The number of microvessels in wounds of TSP1-deficient mice was approximately two-fold greater than in wild-type littermates 10 days after injury. Topical application of TSP1, or KRFK (a peptide derived from TSP1 that activates latent TGF-β1), to wounds of TSP1-deficient mice rescued wild-type patterns of wound repair and partially recovered local levels of TGF-β1 expression. Topical application of anti-TGF-β neutralizing antibody impaired the ability of KRFK to rescue normal patterns of wound neovascularization in TSP1-deficient mice. Conclusions These results demonstrate that TSP1 plays a key role in the orchestration of wound healing, and that TSP1-mediated activation of local TGF-β1 is an important step in this process. PMID:21822445

  15. Anti-Trichomonas vaginalis properties of the oil of Amomum tsao-ko and its major component, geraniol.

    PubMed

    Dai, Min; Peng, Cheng; Peng, Fu; Xie, Chengbin; Wang, Pinjia; Sun, Fenghui

    2016-01-01

    Trichomonosis, caused by the flagellate protozoan Trichomonas vaginalis, is the most common non-viral sexually transmitted disease (STD) and 5-nitroimidazole drugs are used for the treatment. However, a growing number of T. vaginalis isolates are resistant to these drugs, which make it becomes an urgent issue. The current study was designed to evaluate the anti-T. vaginalis activity of the essential oil from A. tsao-ko used in traditional Chinese medicine and as a spice and its main component, geraniol. The anti-T. vaginalis activities of A. tsao-ko essential oil and geraniol were evaluated by the minimum lethal concentration (MLC) and 50% inhibitory concentration (IC50) in vitro. The morphological changes of T. vaginalis were observed by transmission electron microscopy (TEM). Additionally, sub-MLC concentration treatment with sub-MLC A. tsao-ko essential oil and geraniol was also performed. This study shows that MLC/IC50 of A. tsao-ko essential oil was 44.97 µg/ml/22.49 µg/ml for T. vaginalis isolate Tv1, and 89.93 µg/ml/44.97 µg/ml for T. vaginalis isolate Tv2. Those of geraniol were 342.96 µg/ml/171.48 µg/ml, respectively. After A. tsao-ko essential oil or geraniol treatment, obvious similar morphological changes of T. vaginalis were observed by TEM: the nuclear membrane was damaged, nuclei were dissolved, and the chromatin was accumulated; in the cytoplasm, numerous vacuoles appeared, rough endoplasmic reticulum dilated, the number of ribosomes were reduced, organelles disintegrated, the cell membrane was partially damaged, with cytoplasmic leakage, and cell disintegration was observed. The action time did not increase the effect of A. tsao-ko essential oil or geraniol against T. vaginalis, as no significant difference was observed after sub-MLC concentration treatment for 1, 3, and 5 h with A. tsao-ko essential oil and geraniol. The study describes the first report on the activity and morphological changes of A. tsao-ko essential oil and

  16. Acaricidal activity of Origanum bilgeri P.H. Davis (Lamiaceae) essential oil and its major component, carvacrol against adults Rhipicephalus turanicus (Acari: Ixodidae).

    PubMed

    Koc, Samed; Oz, Emre; Cinbilgel, Ilker; Aydin, Levent; Cetin, Huseyin

    2013-03-31

    The acaricidal activity of an essential oil obtained from aerial parts of Origanum bilgeri P.H. Davis (Lamiaceae), an endemic species in Turkey, and its major constituents, carvacrol was evaluated against unfed adults Rhipicephalus turanicus Pomerantzev (Acari: Ixodidae) collected from Kepez, Antalya. The composition of the essential oil was analyzed by GC/MS. The major compound identified in the oil was carvacrol (93.02%). Generally, tick mortalities to the O. bilgeri distillate and carvacrol increased with concentrations. O. bilgeri oil produced >83% mortality at 48h at a concentration of 0.8% and mortality was higher than 63% at a carvacrol concentration of 0.4%. Our results have shown that O. bilgeri essential oil and its major component, carvacrol, may have potential as acaricidal agents against R. turanicus.

  17. Hair Regenerative Mechanisms of Red Ginseng Oil and Its Major Components in the Testosterone-Induced Delay of Anagen Entry in C57BL/6 Mice.

    PubMed

    Truong, Van-Long; Bak, Min Ji; Lee, Changook; Jun, Mira; Jeong, Woo-Sik

    2017-09-08

    Hair loss (alopecia) is a universal problem for numerous people in the world. The present study was conducted to investigate the effects of red ginseng oil (RGO) and its major components on hair re-growth using testosterone (TES)-induced delay of anagen entry in C57BL/6 mice and their mechanisms of action. Seven-week-old C57BL/6 mice were daily treated with TES for 1 h prior to topical application of 10% RGO, 1% linoleic acid (LA), 1% β-sitosterol (SITOS), or 1% bicyclo(10.1.0)tridec-1-ene (BICYCLO) once a day for 28 days. Hair regenerative capacity was significantly restored by treatment of RGO and its major compounds in the TES-treated mice. Histological analysis showed that RGO along with LA and SITOS but not BICYCLO promoted hair growth through early inducing anagen phase that was delayed by TES in mice. Treatment of mice with RGO, LA, or SITOS up-regulated Wnt/β-catenin and Shh/Gli pathways-mediated expression of genes such as β-catenin, Lef-1, Sonic hedgehog, Smoothened, Gli-1, Cyclin D1, and Cyclin E in the TES-treated mice. In addition, RGO and its major components reduced the protein level of TGF-β but enhanced the expression of anti-apoptotic protein Bcl-2. These results suggest that RGO is a potent novel therapeutic natural product for treatment of androgenic alopecia possibly through hair re-growth activity of its major components such as LA and SITOS.

  18. The single and synergistic effects of the major tea components caffeine, epigallocatechin-3-gallate and L-theanine on rat sperm viability.

    PubMed

    Dias, Tânia R; Alves, Marco G; Casal, Susana; Silva, Branca M; Oliveira, Pedro F

    2016-03-01

    Caffeine, epigallocatechin-3-gallate (EGCG) and L-theanine are the major components of tea (Camellia sinensis L.) and the main representatives of the classes of methylxanthines, catechins and free amino acids present in this beverage. There are many studies reporting tea's health benefits, however it is not clear if those effects are mediated by a single component or a synergistic action. This study aimed to evaluate the individual and synergistic effects of tea's major components on rat epididymal spermatozoa survival and oxidative profile during 3-day storage at room temperature (RT). For that, spermatozoa were incubated with caffeine (71 μg mL(-1)), EGCG (82 μg mL(-1)), or L-theanine (19 μg mL(-1)), alone or in combination. Spermatozoa viability was assessed by the eosin-nigrosin staining technique. The oxidative profile was established by evaluating the levels of carbonyl groups, protein nitration and lipid peroxidation. Supplementation of sperm storage medium with the three compounds together improved sperm viability, after 24, 48 and 72 h of incubation, relative to the control and the groups incubated with each component individually. However, at the end of the 72 h of incubation, there was an increase in protein oxidation in the group exposed to the three compounds, illustrating that the combined treatment triggers different alterations in sperm proteins during their maturational process in the epididymis. This study highlights the importance of the synergism between tea components for the beneficial effects usually attributed to this beverage, particularly in sperm storage at RT.

  19. Antimicrobial Activity and Toxicity of the Major Lipopeptide Components of Polymyxin B and Colistin: Last-line Antibiotics against Multidrug-Resistant Gram-negative Bacteria

    PubMed Central

    Roberts, Kade D.; Azad, Mohammad A. K.; Wang, Jiping; Horne, Andrew S; Thompson, Philip E.; Nation, Roger L.; Velkov, Tony; Li, Jian

    2016-01-01

    Polymyxin B and colistin are currently used as a ‘last-line’ treatment for multidrug-resistant Gram-negative bacteria. However very little is known about the pharmacological differences between polymyxin B1, polymyxin B2, colistin A, colistin B, the major cyclic lipopeptides components present in polymyxin B and colistin products. Here, we report on the in vitro and in vivo antimicrobial activity and toxicity of these major lipopeptide components. All four lipopeptides had comparable MICs (<0.125–4 mg/L) against a panel of clinical Gram-negative isolates. They also had comparable in vivo antimicrobial activity (Δlog10 CFU/mL >-3) and nephrotoxicity (mild to moderate histological damage) in mouse models. However, polymyxin B1 and colistin A showed significantly higher (> 3-fold) in vitro apoptotic effect on human kidney proximal tubular HK-2 cells than polymyxin B2 and colistin B, respectively. Compared to the commercial polymyxin and colistin products, the individual lipopeptide components had slightly more in vivo antimicrobial activity. Our results highlight the need to re-assess pharmacopoeial standards for polymyxins B and colistin and to standardize the composition of the different commercial products of polymyxin antibiotics. PMID:27525307

  20. Rapid simultaneous determination of twelve major components in Pien Tze Huang by ultra-performance liquid chromatography coupled with triple quadrupole mass spectrometry.

    PubMed

    Huang, Mingqing; Zhao, Haiyu; Xu, Wei; Chu, Kedan; Hong, Zhenfeng; Peng, Jun; Chen, Lidian

    2013-12-01

    An efficient method using ultra-performance LC coupled with triple quadrupole MS was developed for the rapid determination of 12 major active components in Pien Tze Huang (PZH), a well-known traditional Chinese formula. Chromatographic separation was achieved on a Waters XBridge BEH RP18 column (50 mm × 2.1 mm id, 1.7 μm) with a gradient mobile phase (A: 0.1% aqueous formic acid and B: acetonitrile with 0.1% formic acid) at a flow rate of 0.8 mL/min. The chromatographic peaks of 12 components were identified by comparing their retention time and MS data with the related reference compounds. Multiple-reaction monitoring was employed for the quantitative analysis. Ten batches of PZH were analyzed with a good linear regression relationship (r, 0.9987–0.9995), intraday precisions (RSD, 2.05–4.80%), interday precisions (RSD, 1.99–4.98%), repeatability (RSD, 2.21–4.20%), stability (RSD, 3.52–4.81%), and recovery (95.63–104.80%). By using this established method, the present study offered highly sensitive, specific, and speedy determination of 12 major components, which promoted the quality control investigation of PZH greatly.

  1. A novel approach to the rapid assignment of (13)C NMR spectra of major components of vegetable oils such as avocado, mango kernel and macadamia nut oils.

    PubMed

    Retief, Liezel; McKenzie, Jean M; Koch, Klaus R

    2009-09-01

    Assignment of (13)C nuclear magnetic resonance (NMR) spectra of major fatty acid components of South African produced vegetable oils was attempted using a method in which the vegetable oil was spiked with a standard triacylglycerol. This proved to be inadequate and therefore a new rapid and potentially generic graphical linear correlation method is proposed for assignment of the (13)C NMR spectra of major fatty acid components of apricot kernel, avocado pear, grapeseed, macadamia nut, mango kernel and marula vegetable oils. In this graphical correlation method, chemical shifts of fatty acids present in a known standard triacylglycerol is plotted against the corresponding chemical shifts of fatty acids present in the vegetable oils. This new approach (under carefully defined conditions and concentrations) was found especially useful for spectrally crowded regions where significant peak overlap occurs and was validated with the well-known (13)C NMR spectrum of olive oil which has been extensively reported in the literature. In this way, a full assignment of the (13)C{1H} NMR spectra of the vegetable oils, as well as tripalmitolein was readily achieved and the resonances belonging to the palmitoleic acid component of the triacylglycerols in the case of macadamia nut and avocado pear oil resonances were also assigned for the first time in the (13)C NMR spectra of these oils. Copyright (c) 2009 John Wiley & Sons, Ltd.

  2. Brucella ribosomal protein L7/L12 is a major component in the antigenicity of brucellin INRA for delayed-type hypersensitivity in brucella-sensitized guinea pigs.

    PubMed Central

    Bachrach, G; Banai, M; Bardenstein, S; Hoida, G; Genizi, A; Bercovier, H

    1994-01-01

    A delayed-type hypersensitivity (DTH) reaction in the course of brucellosis in humans and animals can be revealed by the brucellin INRA (Brucellergen) skin test. Brucellergen is composed of more than 20 proteins of different molecular weights. A 12-kDa protein eliciting DTH in Brucella melitensis Rev1-sensitized guinea pigs was found to be a significant component for the allergenic properties of Brucellergen. Sequencing of the gene encoding this protein identified it as the L7/L12 ribosomal protein. The L7/L12 gene of B. melitensis was amplified by PCR and subcloned in the Escherichia coli pQE30 plasmid. The resulting recombinant protein did not produce a DTH reaction in sensitized animals. It was used to raise specific antibodies in a rabbit. Affinity chromatography with these antibodies was used to isolate a single protein from Brucellergen and from B. melitensis cytosol preparations which produced a DTH reaction in guinea pigs sensitized with B. melitensis Rev1. N-terminal amino acid sequencing of the protein confirmed that it was the L7/L12 ribosomal protein. This is the first complete report on the involvement of a defined bacterial ribosomal protein in the DTH response of animals infected with intracellularly multiplying bacteria. Images PMID:7960115

  3. Sedative effects of the jasmine tea odor and (R)-(-)-linalool, one of its major odor components, on autonomic nerve activity and mood states.

    PubMed

    Kuroda, Kyoko; Inoue, Naohiko; Ito, Yuriko; Kubota, Kikue; Sugimoto, Akio; Kakuda, Takami; Fushiki, Tohru

    2005-10-01

    We investigated the effects of the odor of jasmine tea on autonomic nerve activity and mood states in a total of 24 healthy volunteers. We used the odor of jasmine tea at the lowest concentration that could be detected by each subject but that did not elicit any psychological effects. R-R intervals and the POMS test were measured before and after inhalation of the odors for 5 min. Both jasmine tea and lavender odors at perceived similar intensity caused significant decreases in heart rate and significant increases in spectral integrated values at high-frequency component in comparison with the control (P < 0.05). In the POMS tests, these odors produced calm and vigorous mood states. We also examined the effects of (R)-(-)-linalool, one of its major odor components, at the same concentration as in the tea, and (S)-(+)-linalool. Only (R)-(-)-linalool elicited a significant decrease in heart rate (P < 0.05) and an increase in high-frequency component in comparison with the controls, and produced calm and vigorous mood states. Thus, the low intensity of jasmine tea odor has sedative effects on both autonomic nerve activity and mood states, and (R)-(-)-linalool, one of its components, can mimic these effects.

  4. Glomerular Activity Patterns Evoked by Natural Odor Objects in the Rat Olfactory Bulb Are Related to Patterns Evoked by Major Odorant Components

    PubMed Central

    Johnson, Brett A.; Ong, Joan; Leon, Michael

    2014-01-01

    To determine how responses evoked by natural odorant mixtures compare to responses evoked by individual odorant chemicals, we mapped 2-deoxyglucose uptake during exposures to vapors arising from a variety of odor objects that may be important to rodents in the wild. We studied 21 distinct natural odor stimuli ranging from possible food sources such as fruits, vegetables, and meats to environmental odor objects such as grass, herbs, and tree leaves. The natural odor objects evoked robust and surprisingly focal patterns of 2-deoxyglucose uptake involving clusters of neighboring glomeruli, thereby resembling patterns evoked by pure chemicals. Overall, the patterns were significantly related to patterns evoked by monomolecular odorant components that had been studied previously. Object patterns also were significantly related to the molecular features present in the mixture components. Despite these overall relationships, there were individual examples of object patterns that were simpler than might have been predicted given the multiplicity of components present in the vapors. In these cases, the object patterns lacked certain responses evoked by their major odorant mixture components. These data suggest the possibility of mixture response interactions and provide a foundation for understanding the neural coding of natural odor stimuli. PMID:20187145

  5. Carcinoma ex pleomorphic adenoma of minor salivary glands with major epithelial-myoepithelial component: clinicopathologic and immunohistochemical study of 3 cases.

    PubMed

    Sedassari, Bruno Tavares; Dos Santos, Harim Tavares; Mariano, Fernanda Viviane; da Silva Lascane, Nelise Alexandre; Altemani, Albina; Sousa, Suzana

    2015-06-01

    In the present study, 3 cases of very rare intraoral carcinomas ex pleomorphic adenomas showing a striking differentiation of the malignant component towards epithelial-myoepithelial carcinoma were described. The tumors occurred in 2 men and 1 woman with median age of 56 years. Involved sites included palate and buccal mucosa. Two patients experienced local recurrences, of which one died of disease complications. In all cases, residual pleomorphic adenoma was present. The malignant component in all cases shared morphological aspects with epithelial-myoepithelial carcinoma. Those areas were characterized by eosinophilic duct-forming cells surrounded by layers of clear cells. The studied immunohistochemical markers highlighted a biphasic cell population. Duct-forming cells expressed pan-cytokeratin, cytokeratin 7, and focally cytokeratin 14, whereas the clear cell component strongly stained to cytokeratin 14, vimentin, and p63 but weakly stained to pan-cytokeratin and focally to α-smooth muscle actin, an immunophenotype compatible with both epithelial and myoepithelial differentiation. The Ki-67 proliferation index was up to 40% in malignant areas. Carcinoma ex pleomorphic adenomas of minor salivary glands with major epithelial-myoepithelial component are rare, locally aggressive, and potentially lethal tumors. The peculiar morphological and immunohistochemical aspects described may raise problems in diagnosis and classification of such cases, particularly in incisional biopsies.

  6. The effect of lemongrass oil and its major components on clinical isolate mastitis pathogens and their mechanisms of action on Staphylococcus aureus DMST 4745.

    PubMed

    Aiemsaard, Jareerat; Aiumlamai, Suneerat; Aromdee, Chantana; Taweechaisupapong, Suwimol; Khunkitti, Watcharee

    2011-12-01

    The aims of this study were to investigate the antibacterial activity of lemongrass oil (LG) and its major components which were citral, geraniol and myrcene, against four strains of clinically isolated bovine mastitis pathogens, including Staphylococcus aureus, Streptococcus agalactiae, Bacillus cereus and Escherichia coli by the broth microdilution method, as well as their activity on S. aureus biofilm formation. Attempts to clarify their mechanisms of action by investigation of the effects on intracellular material leakage and morphological changes of S. aureus DMST 4745 were also made. The results demonstrate that S. agalactiae and B. cereus are more susceptible to LG, citral and geraniol than S. aureus and E. coli. Moreover, they also inhibit S. aureus biofilm formation and exhibit effective killing activities on preformed biofilms. The LG appears to have multiple targets in the bacterial cell, depending on concentration used as well as the amount of its components. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Folk medicine Terminalia catappa and its major tannin component, punicalagin, are effective against bleomycin-induced genotoxicity in Chinese hamster ovary cells.

    PubMed

    Chen, P S; Li, J H; Liu, T Y; Lin, T C

    2000-05-01

    Terminalia catappa L. is a popular folk medicine for preventing hepatoma and treating hepatitis in Taiwan. In this paper, we examined the protective effects of T. catappa leaf water extract (TCE) and its major tannin component, punicalagin, on bleomycin-induced genotoxicity in cultured Chinese hamster ovary cells. Pre-treatment with TCE or punicalagin prevented bleomycin-induced hgprt gene mutations and DNA strand breaks. TCE and punicalagin suppressed the generation of bleomycin-induced intracellular free radicals, identified as superoxides and hydrogen peroxides. The effectiveness of TCE and punicalagin against bleomycin-induced genotoxicity could be, at least in part, due to their antioxidative potentials.

  8. Characterisation of major component leaching and buffering capacity of RDF incineration and gasification bottom ash in relation to reuse or disposal scenarios.

    PubMed

    Rocca, Stefania; van Zomeren, André; Costa, Giulia; Dijkstra, Joris J; Comans, Rob N J; Lombardi, Francesco

    2012-04-01

    Thermal treatment of refuse derived fuel (RDF) in waste-to-energy (WtE) plants is considered a promising solution to reduce waste volumes for disposal, while improving material and energy recovery from waste. Incineration is commonly applied for the energetic valorisation of RDF, although RDF gasification has also gained acceptance in recent years. In this study we focused on the environmental properties of bottom ash (BA) from an RDF incineration (RDF-I, operating temperature 850-1000°C) and a RDF gasification plant (RDF-G, operating temperature 1200-1400°C), by evaluating the total composition, mineralogy, buffering capacity, leaching behaviour (both at the material's own pH and as a function of pH) of both types of slag. In addition, buffering capacity results and pH-dependence leaching concentrations of major components obtained for both types of BA were analysed by geochemical modelling. Experimental results showed that the total content of major components for the two types of BA was fairly similar and possibly related to the characteristics of the RDF feedstock. However, significant differences in the contents of trace metals and salts were observed for the two BA samples as a result of the different operating conditions (i.e. temperature) adopted by the two RDF thermal treatment plants. Mineralogy analysis showed in fact that the RDF-I slag consisted of an assemblage of several crystalline phases while the RDF-G slag was mainly made up by amorphous glassy phases. The leached concentrations of major components (e.g. Ca, Si) at the natural pH of each type of slag did not reflect their total contents as a result of the partial solubility of the minerals in which these components were chemically bound. In addition, comparison of total contents with leached concentrations of minor elements (e.g. Pb, Cu) showed no obvious relationship for the two types of BA. According to the compliance leaching test results, the RDF-G BA would meet the limits of the Italian

  9. The major royal jelly proteins 8 and 9 (Api m 11) are glycosylated components of Apis mellifera venom with allergenic potential beyond carbohydrate-based reactivity.

    PubMed

    Blank, S; Bantleon, F I; McIntyre, M; Ollert, M; Spillner, E

    2012-06-01

    As hymenoptera venoms are one of the allergen sources causing the highest incidence of anaphylaxis and sometimes fatal consequences, the detailed characterization of all venom allergens is imperative for design of component-resolved diagnostic approaches and improved intervention strategies. Our aim was the immunochemical characterization of major royal jelly proteins (MRJP) 8 and 9, both components identified in honeybee venom (HBV) and putative allergens. Both MRJPs were recombinantly produced as soluble differentially glycosylated proteins providing a defined degree of reactivity to cross-reactive carbohydrate determinants (CCD) in insect cells. Allergen-specific IgE(sIgE) reactivity of HBV-allergic patients was analysed by ELISA and immunoblotting. MRJP8 and MRJP9 were identified as venom components by MS-based proteomic analyses. In a population of 47 HBV-allergic patients, reactivities with CCD-carrying MRJPs were in the range of 56% (61%), underlining the contribution of CCDs to allergen-binding. Beyond CCD-reactivity, 15% of patients showed sIgE reactivity with MRJP8 and 34% with MRJP9 respectively. These reactivities roughly in the range of Api m 2 render the MRJPs minor, but important allergens. The glycosylated MRJP8 and MRJP9 of HBV have IgE-sensitizing potential in HBV-allergic patients beyond CCD reactivity and have to be considered as allergens, which might be potentially important for a fraction of venom allergic patients. They are valuable tools to elucidate individual component-resolved reactivity profiles of venom allergic patients and to provide insights into the role of particular venom components. Due to their allergenic properties, MRJP8 and MRJP9 were designated as isoallergens Api m 11.0101 and Api m 11.0201 respectively. © 2012 Blackwell Publishing Ltd.

  10. Pharmacokinetic study of major bioactive components in rats after oral administration of extract of Ilex hainanensis by high-performance liquid chromatography/electrospray ionization mass spectrometry.

    PubMed

    Yang, Jie; Lv, Fang; Chen, Xiao-qing; Cui, Wei-xi; Chen, Li-hong; Wen, Xiao-dong; Wang, Qiang

    2013-04-15

    Ilex hainanensis Merr. is commonly used as a folk remedy for treating hypertension, dyslipidemia and inflammation in Traditional Chinese Medicine (TCMs) and it also has great potential to treat non-alcoholic fatty liver disease (NAFLD). Chlorogenic acid, kaempferol-7-O-β-d-glucoside, and ilexgenin A are three major bioactive components in I. hainanensis extract. In this study, a rapid, sensitive and convenient LC-MS method was developed for their simultaneous determination in the plasma of normal and NAFLD rats. The method was validated in terms of selectivity, linearity and sensitivity, and shows advantages in monitoring the pharmacokinetic behaviors of these three compounds. Results revealed the pharmacokinetic behaviors of chlorogenic acid, kaempferol-7-O-β-d-glucoside, and ilexgenin A could be significantly changed in NAFLD rats after oral administration of I. hainanensis extract compared with normal rats. The areas under the plasma concentration-time curve (AUC) and maximum plasma concentration (Cmax) of the three analytes were greatly decreased and the plasma clearance (CL) for kaempferol-7-O-β-d-glucoside, Ilexgenin A were greatly increased in NAFLD rats. Meanwhile, the mean residence time (MRT) of kaempferol-7-O-β-d-glucoside and Ilexgenin A were increased in the NAFLD rats. This is the first report on the determination of the major bioactive components in rat plasma after oral administration of I. hainanensis extract. These results provided a meaningful basis for evaluating the clinical application of this medicine.

  11. Synergism Effect of the Essential Oil from Ocimum basilicum var. Maria Bonita and Its Major Components with Fluconazole and Its Influence on Ergosterol Biosynthesis.

    PubMed

    Cardoso, Nathalia N R; Alviano, Celuta S; Blank, Arie F; Romanos, Maria Teresa V; Fonseca, Beatriz B; Rozental, Sonia; Rodrigues, Igor A; Alviano, Daniela S

    2016-01-01

    The aim of this study was to evaluate the activity of the EO and its major components of Ocimum basilicum var. Maria Bonita, a genetically improved cultivar, against the fluconazole sensitive and resistant strains of Candida albicans and Cryptococcus neoformans. Geraniol presented better results than the EO, with a low MIC (76 μg/mL against C. neoformans and 152 μg/mL against both Candida strains). The combination of EO, linalool, or geraniol with fluconazole enhanced their antifungal activity, especially against the resistant strain (MIC reduced to 156, 197, and 38 μg/mL, resp.). The ergosterol assay showed that subinhibitory concentrations of the substances were able to reduce the amount of sterol extracted. The substances tested were able to reduce the capsule size which suggests they have an important mechanism of action. Transmission electron microscopy demonstrated cell wall destruction of C. neoformans after treatment with subinhibitory concentrations. In C. albicans ultrastructure alterations such as irregularities in the membrane, presence of vesicles, and cell wall thickening were observed. The biofilm formation was inhibited in both C. albicans strains at MIC and twice MIC. These results provide further support for the use of O. basilicum EO and its major components as a potential source of antifungal agents.

  12. Synergism Effect of the Essential Oil from Ocimum basilicum var. Maria Bonita and Its Major Components with Fluconazole and Its Influence on Ergosterol Biosynthesis

    PubMed Central

    Cardoso, Nathalia N. R.; Alviano, Celuta S.; Blank, Arie F.; Romanos, Maria Teresa V.; Fonseca, Beatriz B.; Rozental, Sonia; Rodrigues, Igor A.; Alviano, Daniela S.

    2016-01-01

    The aim of this study was to evaluate the activity of the EO and its major components of Ocimum basilicum var. Maria Bonita, a genetically improved cultivar, against the fluconazole sensitive and resistant strains of Candida albicans and Cryptococcus neoformans. Geraniol presented better results than the EO, with a low MIC (76 μg/mL against C. neoformans and 152 μg/mL against both Candida strains). The combination of EO, linalool, or geraniol with fluconazole enhanced their antifungal activity, especially against the resistant strain (MIC reduced to 156, 197, and 38 μg/mL, resp.). The ergosterol assay showed that subinhibitory concentrations of the substances were able to reduce the amount of sterol extracted. The substances tested were able to reduce the capsule size which suggests they have an important mechanism of action. Transmission electron microscopy demonstrated cell wall destruction of C. neoformans after treatment with subinhibitory concentrations. In C. albicans ultrastructure alterations such as irregularities in the membrane, presence of vesicles, and cell wall thickening were observed. The biofilm formation was inhibited in both C. albicans strains at MIC and twice MIC. These results provide further support for the use of O. basilicum EO and its major components as a potential source of antifungal agents. PMID:27274752

  13. Nurturing the Careers of Australia's Future Composers

    ERIC Educational Resources Information Center

    Watson, Amanda; Forrest, David

    2008-01-01

    In 1994, the Australian Society for Music Education (ASME) initiated two related projects supporting and acknowledging composition in schools and offering the opportunity for secondary school-aged students to work with prominent Australian composers. These were the Young Composers' Project and the Composer-in-Residence Project. Both projects were…

  14. Sing the Songs of Women Composers.

    ERIC Educational Resources Information Center

    Allen, Sue Fay; Keenan-Takagi, Kathleen

    1992-01-01

    Presents an annotated listing of choral works by women composers. Suggests sources of information about women composers and their music. Discusses some contemporary women whose compositions are particularly appropriate for student voices. Concludes that the listed works will help place women composers in perspective for student choral groups. (SG)

  15. [The hemoglobin of adult Andean condors (Vultur gryphus, Cathartiformes). The amino acid sequence of the major (HbA) and minor component (HbD)].

    PubMed

    Bauer, H; Braunitzer, G; Oberthür, W; Kösters, J; Grimm, F

    1985-12-01

    The complete amino-acid sequence of the alpha A- and the beta-chains of the major component (HbA) and the alpha D- and the beta-chains of the minor component (HbD) of Andean Condor (Vultur gryphus) is presented. The minor component with the alpha D-chains is present in smaller amounts (17%) than in other birds (25%). The comparison with the corresponding chains of Greylag Goose (Anser anser) shows 17 different amino acids (17 nucleotides, only one-point mutations) in the alpha A-chains and 8 (8 nucleotides) in the beta-chains. The alpha D-chains differ from those of the pheasant (Phasanius cholchicus cholchicus) in 24 amino acids (27 nucl., 3 two-point mutations). Seven alpha 1 beta 1-, one alpha 1 beta 2-, three alpha 1 alpha 1-contacts and one beta 1 beta 1-contact are exchanged. The systematy of Cathartiformes, Ciconiiformes and Phoenicopteriformes is discussed, based on the amino-acid exchanges of all known adult hemoglobins of birds.

  16. Collision Tumor Composed of Meningioma and Cavernoma

    PubMed Central

    Weigel, Jens; Neher, Markus; Schrey, Michael; Wünsch, Peter H.; Steiner, Hans-Herbert

    2017-01-01

    A true collision tumor is a rare entity composed of two histologically distinct neoplasms coinciding in the same organ. This paper reports a unique case of cerebral collision tumor consisting of two benign components. On the first hand, meningioma which is usually a benign lesion arising from the meningothelial cell in the arachnoidal membrane. On the other, cerebral cavernoma which is a well-circumscribed, benign vascular hamartoma within the brain. To our knowledge, there is no previously documented case of cerebral collision tumor consisting of two benign components. A 56-year-old Caucasian male suffered in 2002 from an atypical meningioma WHO II° located in the left lateral ventricle. Three years after the tumor extirpation, the patient suffered from a hematoma in the fourth ventricle due to a recurrently haemorrhaged cavernoma. In 2008, a recurrence of the tumor in the left lateral ventricle was discovered. Additionally, another tumor located in the quadrigeminal lamina was detected. After surgical resection of the tumor in the left lateral ventricle, the pathological examination confirmed the diagnosis of a collision tumor consisting of components of a meningioma WHO II° and a cavernoma. Postoperatively, no adjuvant treatment was needed and no tumor recurrence is discovered up to the present. A possible explanation for the collision of those two different tumors may be migration of tumor cells mediated by the cerebrospinal fluid. After 5-years of follow-up, there is no sign of any tumor recurrence; therefore, surgical tumor removal without adjuvant therapy seems to be the treatment of choice. PMID:28061500

  17. Insecticidal Activity of the Leaf Essential Oil of Peperomia borbonensis Miq. (Piperaceae) and Its Major Components against the Melon Fly Bactrocera cucurbitae (Diptera: Tephritidae).

    PubMed

    Dorla, Emmanuelle; Gauvin-Bialecki, Anne; Deuscher, Zoé; Allibert, Agathe; Grondin, Isabelle; Deguine, Jean-Philippe; Laurent, Philippe

    2017-06-01

    The essential oil from the leaves of Peperomia borbonensis from Réunion Island was obtained by hydrodistillation and characterized using GC-FID, GC/MS and NMR. The main components were myristicin (39.5%) and elemicin (26.6%). The essential oil (EO) of Peperomia borbonensis and its major compounds (myristicin and elemicin), pure or in a mixture, were evaluated for their insecticidal activity against Bactrocera cucurbitae (Diptera: Tephritidae) using a filter paper impregnated bioassay. The concentrations necessary to kill 50% (LC50 ) and 90% (LC90 ) of the flies in three hours were determined. The LC50 value was 0.23 ± 0.009 mg/cm(2) and the LC90 value was 0.34 ± 0.015 mg/cm(2) for the EO. The median lethal time (LT50 ) was determined to compare the toxicity of EO and the major constituents. The EO was the most potent insecticide (LT50  = 98 ± 2 min), followed by the mixture of myristicin and elemicin (1.4:1) (LT50  = 127 ± 2 min) indicating that the efficiency of the EO is potentiated by minor compounds and emphasizing one of the major assets of EOs against pure molecules. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

  18. Real-time rendering method and performance evaluation of composable 3D lenses for interactive VR.

    PubMed

    Borst, Christoph W; Tiesel, Jan-Phillip; Best, Christopher M

    2010-01-01

    We present and evaluate a new approach for real-time rendering of composable 3D lenses for polygonal scenes. Such lenses, usually called "volumetric lenses," are an extension of 2D Magic Lenses to 3D volumes in which effects are applied to scene elements. Although the composition of 2D lenses is well known, 3D composition was long considered infeasible due to both geometric and semantic complexity. Nonetheless, for a scene with multiple interactive 3D lenses, the problem of intersecting lenses must be considered. Intersecting 3D lenses in meaningful ways supports new interfaces such as hierarchical 3D windows, 3D lenses for managing and composing visualization options, or interactive shader development by direct manipulation of lenses providing component effects. Our 3D volumetric lens approach differs from other approaches and is one of the first to address efficient composition of multiple lenses. It is well-suited to head-tracked VR environments because it requires no view-dependent generation of major data structures, allowing caching and reuse of full or partial results. A Composite Shader Factory module composes shader programs for rendering composite visual styles and geometry of intersection regions. Geometry is handled by Boolean combinations of region tests in fragment shaders, which allows both convex and nonconvex CSG volumes for lens shape. Efficiency is further addressed by a Region Analyzer module and by broad-phase culling. Finally, we consider the handling of order effects for composed 3D lenses.

  19. [Mental disease in two classical music composers].

    PubMed

    Rempelakos, L; Poulakou-Rebelakou, E; Ploumpidis, D

    2012-01-01

    A study οn two neglected classical music composers suffering a not syphilitic mental disease, is attempted here, syphilis of the central nervous system being frequent in that time. A brief overview on the psychiatric ailments of many great composers reveals suicide attempts and more or less severe depression following external events. The issue of a possible relationship between mental disease and (musical) creativity can be discussed, as mood swings and a certain tendency to melancholia are frequent features of a talented brain (a fact that can also be detected in their works). The first case presented here is Hans Rott from Austria, the beloved student of Anton Bruckner, who was considered to be at least equal to his famous classmate Gustav Mahler. The great expectations of his teacher and his friends suddenly came to an end, when he suffered a crisis of schizophrenia and was hospitalized in an insane asylum in Lower Austria. The tragic psychiatric adventure of the young musician lasted almost four years. He was diagnosed as a case of "hallucinatory insanity" and "persecution mania" by the medical staff, before dying of tuberculosis, aged only 26, and having completed only one symphony and several smaller works. His name came again on surface only a century after his death, when in 1989 his Symphony in E Major was discovered and premiered with great success, permitting to its creator a posthumous recognition, among Bruckner and Mahler. The second case of mental illness is that of the Armenian Komitas Vardapet. He was an orphan who grew up in theological schools and became a monk and later a priest, though he spent some years in Berlin in order to develop his musical skills. He is considered to be an authority of Armenian ecclesiastic music, introducing polyphony in the Armenian Church's music and collecting numerous traditional songs from all parts of Armenia. In 1915, during the Armenian genocide he was deported, tortured but finally saved, due to interventions

  20. Risk of metabolic syndrome and its components in people with schizophrenia and related psychotic disorders, bipolar disorder and major depressive disorder: a systematic review and meta-analysis.

    PubMed

    Vancampfort, Davy; Stubbs, Brendon; Mitchell, Alex J; De Hert, Marc; Wampers, Martien; Ward, Philip B; Rosenbaum, Simon; Correll, Christoph U

    2015-10-01

    Metabolic syndrome (MetS) and its components are highly predictive of cardiovascular diseases. The primary aim of this systematic review and meta-analysis was to assess the prevalence of MetS and its components in people with schizophrenia and related psychotic disorders, bipolar disorder and major depressive disorder, comparing subjects with different disorders and taking into account demographic variables and psychotropic medication use. The secondary aim was to compare the MetS prevalence in persons with any of the selected disorders versus matched general population controls. The pooled MetS prevalence in people with severe mental illness was 32.6% (95% CI: 30.8%-34.4%; N = 198; n = 52,678). Relative risk meta-analyses established that there was no significant difference in MetS prevalence in studies directly comparing schizophrenia versus bipolar disorder, and in those directly comparing bipolar disorder versus major depressive disorder. Only two studies directly compared people with schizophrenia and major depressive disorder, precluding meta-analytic calculations. Older age and a higher body mass index were significant moderators in the final demographic regression model (z = -3.6, p = 0.0003, r(2)  = 0.19). People treated with all individual antipsychotic medications had a significantly (p<0.001) higher MetS risk compared to antipsychotic-naïve participants. MetS risk was significantly higher with clozapine and olanzapine (except vs. clozapine) than other antipsychotics, and significantly lower with aripiprazole than other antipsychotics (except vs. amisulpride). Compared with matched general population controls, people with severe mental illness had a significantly increased risk for MetS (RR = 1.58; 95% CI: 1.35-1.86; p<0.001) and all its components, except for hypertension (p = 0.07). These data suggest that the risk for MetS is similarly elevated in the diagnostic subgroups of severe mental illness. Routine screening and

  1. Risk of metabolic syndrome and its components in people with schizophrenia and related psychotic disorders, bipolar disorder and major depressive disorder: a systematic review and meta-analysis

    PubMed Central

    Vancampfort, Davy; Stubbs, Brendon; Mitchell, Alex J; De Hert, Marc; Wampers, Martien; Ward, Philip B; Rosenbaum, Simon; Correll, Christoph U

    2015-01-01

    Metabolic syndrome (MetS) and its components are highly predictive of cardiovascular diseases. The primary aim of this systematic review and meta-analysis was to assess the prevalence of MetS and its components in people with schizophrenia and related psychotic disorders, bipolar disorder and major depressive disorder, comparing subjects with different disorders and taking into account demographic variables and psychotropic medication use. The secondary aim was to compare the MetS prevalence in persons with any of the selected disorders versus matched general population controls. The pooled MetS prevalence in people with severe mental illness was 32.6% (95% CI: 30.8%-34.4%; N = 198; n = 52,678). Relative risk meta-analyses established that there was no significant difference in MetS prevalence in studies directly comparing schizophrenia versus bipolar disorder, and in those directly comparing bipolar disorder versus major depressive disorder. Only two studies directly compared people with schizophrenia and major depressive disorder, precluding meta-analytic calculations. Older age and a higher body mass index were significant moderators in the final demographic regression model (z = −3.6, p = 0.0003, r2 = 0.19). People treated with all individual antipsychotic medications had a significantly (p<0.001) higher MetS risk compared to antipsychotic-naïve participants. MetS risk was significantly higher with clozapine and olanzapine (except vs. clozapine) than other antipsychotics, and significantly lower with aripiprazole than other antipsychotics (except vs. amisulpride). Compared with matched general population controls, people with severe mental illness had a significantly increased risk for MetS (RR = 1.58; 95% CI: 1.35-1.86; p<0.001) and all its components, except for hypertension (p = 0.07). These data suggest that the risk for MetS is similarly elevated in the diagnostic subgroups of severe mental illness. Routine screening and

  2. Synergistic Effect of Ferulic Acid and Z-Ligustilide, Major Components of A. sinensis, on Regulating Cold-Sensing Protein TRPM8 and TPRA1 In Vitro

    PubMed Central

    Pan, Yuwei; Zhao, Guoping; Cai, Zejian; Chen, Fengguo; Xu, Dandan; Huang, Si; Lan, Hai; Tong, Yi

    2016-01-01

    Angelica sinensis has been used to attenuate cold-induced cutaneous vasospasm syndrome, such as Raynaud's disease and frostbite, in China for many years. Ferulic acid (PubChem CID: 445858) and Z-ligustilide (PubChem CID: 529865), two major components extracted from Angelica sinensis, had been reported to inhibit vasoconstriction induced by vasoconstrictors. In this study, the pharmacological interaction in regulating cold-induced vascular smooth muscle cell contraction via cold-sensing protein TRPM8 and TRPA1 was analyzed between ferulic acid and Z-ligustilide. Pharmacological interaction on inhibiting [Ca2+]i influx evoked by TRPM8 agonist WS-12 or TRPA1 agonist ASP 7663 as well as cold-induced upregulation of TRPM8 was determined using isobolographic analysis. The isobolograms demonstrated that the combinations investigated in this study produced a synergistic interaction. Combination effect of two components in inhibiting RhoA activation and phosphorylation of MLC20 induced by WS-12 or ASP 7663 was also being quantified. These findings suggest that the therapeutic effect of Angelica sinensis on cold-induced vasospasm may be partially attributed to combinational effect, via TRPM8 and TPRA1 way, between ferulic acid and Z-ligustilide. PMID:27413384

  3. Protective effects of Mangifera indica L extract (Vimang), and its major component mangiferin, on iron-induced oxidative damage to rat serum and liver.

    PubMed

    Pardo-Andreu, Gilberto L; Barrios, Mariela Forrellat; Curti, Carlos; Hernández, Ivones; Merino, Nelson; Lemus, Yeny; Martínez, Ioanna; Riaño, Annia; Delgado, René

    2008-01-01

    In vivo preventive effects of a Mangifera indica L extract (Vimang) or its major component mangiferin on iron overload injury have been studied in rats given respectively, 50, 100, 250 mg kg(-1) body weight of Vimang, or 40 mg kg(-1) body weight of mangiferin, for 7 days prior to, and for 7 days following the administration of toxic amounts of iron-dextran. Both Vimang or mangiferin treatment prevented iron overload in serum as well as liver oxidative stress, decreased serum and liver lipid peroxidation, serum GPx activity, and increased serum and liver GSH, serum SOD and the animals overall antioxidant condition. Serum iron concentration was decreased although at higher doses, Vimang tended to increase it; percent tranferrin saturation, liver weight/body mass ratios, liver iron content was decreased. Treatment increased serum iron-binding capacity and decreased serum levels of aspartate-amine transferase (ASAT) and alanine-amine transferase (ALAT), as well as the number of abnormal Kupffer cells in iron-loaded livers. It is suggested that besides acting as antioxidants, Vimang extract or its mangiferin component decrease liver iron by increasing its excretion. Complementing earlier in vitro results from our group, it appears possible to support the hypothesis that Vimang and mangiferin present therapeutically useful effects in iron overload related diseases.

  4. Surface pressure measurements of human tears and individual tear film components indicate that proteins are major contributors to the surface pressure.

    PubMed

    Tragoulias, Sophia T; Anderton, Philip J; Dennis, Gary R; Miano, Fausto; Millar, Thomas J

    2005-03-01

    Tear film stability has been associated with a low surface tension (high surface pressure), which has been attributed to a variety of tear film components. In this study, we examined the contribution of various tear proteins, mucin, and meibomian lipids to the surface pressure of human tears. A Langmuir trough was used to measure and compare the surface activities of albumin, lipocalin, beta-lactoglobulin, lactoferrin, lysozyme, secretory IgA, mucin, meibomian lipid, and tears. All proteins exhibited surface activity. The surface pressure-area (Pi-A) profiles of most protein films at equilibrium surface pressure (Pieq) were sigmoidal and showed hysteresis between the expansion and compression phases of the cycle. Pieq of most proteins took 4-9 hours to occur. By contrast, the Pi-A profiles for meibomian lipid films were hyperbolic rather than sigmoidal and had little hysteresis, and Pieq was attained within 1 hour. The Pi-A profiles of mucin films showed mostly hyperbolic characteristics with small hysteresis. The Pi-A profiles of films of tears were sigmoidal, showed strong hysteresis, and reached Pieq at about 5 hours. Partitioning of the proteins and whole tears into the subphase also occurred. Comparison between the dynamic Pi-A profiles of tears and those of individual tear film components shows that tear film proteins not only are capable of surface activity but also are major contributors to the surface activity of the tear film.

  5. Beneficial effects of a medicinal herb, Cirsium japonicum var. maackii, extract and its major component, cirsimaritin on breast cancer metastasis in MDA-MB-231 breast cancer cells.

    PubMed

    Yeon Park, Jun; Young Kim, Hyun; Shibamoto, Takayuki; Su Jang, Tae; Cheon Lee, Sang; Suk Shim, Jae; Hahm, Dae-Hyun; Lee, Hae-Jeung; Lee, Sanghyun; Sung Kang, Ki

    2017-09-01

    The biological activities of the ethanol extract from Cirsium japonicum var. maackii (ICF-1) and its major component, polyphenol cirsimaritin, were investigated as part of the search for possible alternative drugs for breast cancer. Three in vitro cell-based assays were used: the cell proliferation assay, tube-formation assay, and Western blot analysis. Both the ICF-1 extract and cirsimaritin inhibited the viability of HUVECs in a dose-dependent manner. The inhibition achieved was 36.89% at a level of 200μg/ml by the ICF-1 extract and 62.04% at a level of 100μM by cirsimaritin. The ICF-1 extract and cirsimaritin reduced tube formation by 12.69% at level of 25μg/ml and 32.18% at the levels of 6.25μM, respectively. Cirsimaritin inhibited angiogenesis by downregulation of VEGF, p-Akt and p-ERK in MDA-MB-231 cells, suggesting that cirsimaritin is potentially useful as an anti-metastatic agent. The present study demonstrated that Cirsium japonicum extract and its active component cirsimaritin is an excellent candidate as an alternative anti-breast cancer drug. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Identifying Differences in the P600 Component of ERP-Signals between OCD Patients and Controls Employing a PNN-based Majority Vote Classification Scheme.

    PubMed

    Kalatzis, I; Piliouras, N; Glotsos, D; Ventouras, E; Papageorgiou, C; Rabavilas, A; Soldatos, C; Cavouras, D

    2005-01-01

    In the present study an attempt was made to focus in the differences between Obsessive-Compulsive Disorder (OCD) patients and healthy controls, as reflected by the P600 component of event-related potential (ERP) signals, to locate brain areas that may be related to Working Memory (WM) deficits. Neuropsychological research has yielded contradicting results regarding WM in OCD. Eighteen patients with OCD symptomatology and 20 normal controls (age and sex matched) were subjected to a computerized version of the digit span Wechsler test. EEG activity was recorded from 15 scalp electrodes (leads). A dedicated computer software was developed to read the ERP signals and to calculate features related to the ERP P600 component (500-800 ms). Nineteen features were generated, from each ERP-signal and each lead, and were employed in the design of the Probabilistic Neural Network (PNN) classifier. Highest single-lead precision (86.8%) was found at the Fp2 and C6 leads. When the output from all single-lead PNN classifiers fed a Majority Vote Engine (MVE), the system classified correctly all subjects, providing a powerful classification scheme. Findings indicated that OCD patients differed from normal controls at the prefrontal and temporo-central brain regions.

  7. 10-Hydroxy-2-decenoic Acid, the Major Lipid Component of Royal Jelly, Extends the Lifespan of Caenorhabditis elegans through Dietary Restriction and Target of Rapamycin Signaling.

    PubMed

    Honda, Yoko; Araki, Yoko; Hata, Taketoshi; Ichihara, Kenji; Ito, Masafumi; Tanaka, Masashi; Honda, Shuji

    2015-01-01

    Royal jelly (RJ) produced by honeybees has been reported to possess diverse health-beneficial properties and has been implicated to have a function in longevity across diverse species as well as honeybees. 10-Hydroxy-2-decenoic acid (10-HDA), the major lipid component of RJ produced by honeybees, was previously shown to increase the lifespan of Caenorhabditis elegans. The objective of this study is to elucidate signaling pathways that are involved in the lifespan extension by 10-HDA. 10-HDA further extended the lifespan of the daf-2 mutants, which exhibit long lifespan through reducing insulin-like signaling (ILS), indicating that 10-HDA extended lifespan independently of ILS. On the other hand, 10-HDA did not extend the lifespan of the eat-2 mutants, which show long lifespan through dietary restriction caused by a food-intake defect. This finding indicates that 10-HDA extends lifespan through dietary restriction signaling. We further found that 10-HDA did not extend the lifespan of the long-lived mutants in daf-15, which encodes Raptor, a target of rapamycin (TOR) components, indicating that 10-HDA shared some longevity control mechanisms with TOR signaling. Additionally, 10-HDA was found to confer tolerance against thermal and oxidative stress. 10-HDA increases longevity not through ILS but through dietary restriction and TOR signaling in C. elegans.

  8. Band 3 and ankyrin homologues are present in eye lens: evidence for all major erythrocyte membrane components in same non-erythroid cell.

    PubMed

    Allen, D P; Low, P S; Dola, A; Maisel, H

    1987-11-30

    Although immunological homologues of erythrocyte membrane proteins have been individually discovered in a wide variety of tissues and cultured cells, the major structural components of the membrane have not yet been demonstrated simultaneously in the same cell type. Thus, considerable uncertainty continues to exist concerning whether the red cell homologues form elements of a structure which is similar to or unique from the framework which supports the erythrocyte membrane. Because the red cell cytoskeletal proteins, spectrin, actin and band 4.1, have been previously found in the superficial cortex of the lens, we decided to determine whether the corresponding membrane anchoring components of band 3 and ankyrin also occur in this cell type. Using antiserum specific for band 3 and ankyrin, we report the existence of immunologically cross-reactive proteins of similar molecular weight. Because these anchoring proteins appear and disappear coordinately with the aforementioned cytoskeletal proteins during the intermediate stages of lens cell maturation, it is conceivable that an erythrocyte-like membrane structural organization may occur transiently in the eye lens.

  9. A single-component multidrug transporter of the major facilitator superfamily is part of a network that protects E scherichia coli from bile salt stress

    PubMed Central

    Paul, Stephanie; Alegre, Kamela O; Holdsworth, Scarlett R; Rice, Matthew; Brown, James A; McVeigh, Paul; Kelly, Sharon M; Law, Christopher J

    2014-01-01

    Resistance to high concentrations of bile salts in the human intestinal tract is vital for the survival of enteric bacteria such as E scherichia coli. Although the tripartite AcrAB–TolC efflux system plays a significant role in this resistance, it is purported that other efflux pumps must also be involved. We provide evidence from a comprehensive suite of experiments performed at two different pH values (7.2 and 6.0) that reflect pH conditions that E . coli may encounter in human gut that MdtM, a single-component multidrug resistance transporter of the major facilitator superfamily, functions in bile salt resistance in E . coli by catalysing secondary active transport of bile salts out of the cell cytoplasm. Furthermore, assays performed on a chromosomal ΔacrB mutant transformed with multicopy plasmid encoding MdtM suggested a functional synergism between the single-component MdtM transporter and the tripartite AcrAB–TolC system that results in a multiplicative effect on resistance. Substrate binding experiments performed on purified MdtM demonstrated that the transporter binds to cholate and deoxycholate with micromolar affinity, and transport assays performed on inverted vesicles confirmed the capacity of MdtM to catalyse electrogenic bile salt/H+ antiport. PMID:24684269

  10. Comparative Pharmacokinetics of three major bioactive components in rats after oral administration of Typhae Pollen-Trogopterus Feces drug pair before and after compatibility.

    PubMed

    Zeng, Huiting; Xue, Ping; Su, Shulan; Huang, Xiaochen; Shang, Erxin; Guo, Jianming; Qian, Dawei; Tang, Yuping; Duan, Jin-ao

    2016-01-20

    Typhae Pollen (TP) and Trogopterus Feces (TF) are well-known traditional medicine in china which widely used for thousands of years as drug pair called Shixiao San for treatment of blood stasis syndrome, specially shown great efficacy in gynecological disease. Typhaneoside, vanillic acid and p-coumaric acid are the main bioactive components of Typhae Pollen. This study was carried out for comparing the pharmacokinetic profile of these three major bioactive components in rats after oral administration of Typhae Pollen-Trogopterus Feces (TP-TF) drug pair before and after compatibility. A sensitive and rapid UPLC-TQ/MS method has been developed for simultaneous quantification of the three main bioactive compounds in blood at different time points after oral administration of Typhae Pollen (TP) and the combination with Trogopterus Feces (TF). There were significant differences of C(max), T(max), T(1/2) and AUC(0~t) for three bioactive compounds among the groups, for typhaneoside with the most highest plasma concentration of 370.86 ± 315.71 ng/mL and more longer T(max) in TP-TF co-decoction group (C(M)); for vanillic acid, TP-TF co-decoction group (C(M)) had a good absorption with C(max) (3870.99 ± 2527.99 ng/mL) and T(max) (1.47 ± 3.20 h); for p-coumaric acid, it had similar pharmacokinetic characteristics with vanillic acid. The three bioactive components in Typhae Pollen (TP) were simultaneously determined by UPLC-TQ/MS and had a good absorption in rat plasma after the combination with Trogopterus Feces (TF).

  11. [Effect of β-cyclodextrin inclusion complex on transport of major components of Xiangfu Siwu decoction essential oil in Caco-2 cell monolayer model].

    PubMed

    Xi, Jun-zuan; Qian, Da-wei; Duan, Jin-ao; Liu, Pei; Zhu, Yue; Zhu, Zhen-hua; Zhang, Li

    2015-08-01

    Although the essential oil of Xiangfu Siwu decoction (XFSWD) has strong pharmacological activity, its special physical and chemical properties restrict the clinical application and curative effect. In this paper, Xiangfu Siwu decoction essential oil (XFS-WO) was prepared by forming inclusion complex with β-cyclodextrin (β-CD). The present study is to investigate the effect of β-CD inclusion complex on the transport of major components of XFSWO using Caco-2 cell monolayer model, thus to research the effect of this formation on the absorption of drugs with low solubility and high permeability, which belong to class 2 in biopharmaceutics classification system. A sensitive and rapid UPLC-MS/MS method was developed for simultaneous quantification of senkyunolide A, 3-n-butylphthalide, Z-ligustilide, dehydrocostus lactone and α-cyperone, which are active compounds in XFSWO. The transport parameters were analyzed and compared in free oil and its β-CD inclusion complex. The result revealed that the formation of XFSWO/β-CD inclusion complex has significantly increased the transportation and absorption of major active ingredients than free oil. Accordingly, it can be speculated that cyclodextrin inclusion complex can improve bioavailability of poorly water-soluble drugs. Above all these mentioned researches, it provided foundation and basis for physiological disposition and pharmaceutical study of XFSWD.

  12. Mipartoxin-I, a novel three-finger toxin, is the major neurotoxic component in the venom of the redtail coral snake Micrurus mipartitus (Elapidae).

    PubMed

    Rey-Suárez, Paola; Floriano, Rafael Stuani; Rostelato-Ferreira, Sandro; Saldarriaga-Córdoba, Mónica; Núñez, Vitelbina; Rodrigues-Simioni, Léa; Lomonte, Bruno

    2012-10-01

    The major venom component of Micrurus mipartitus, a coral snake distributed from Nicaragua to northern South America, was characterized biochemically and functionally. This protein, named mipartoxin-I, is a novel member of the three-finger toxin superfamily, presenting the characteristic cysteine signature and amino acid sequence length of the short-chain, type-I, α-neurotoxins. Nevertheless, it varies considerably from related toxins, with a sequence identity not higher than 70% in a multiple alignment of 67 proteins within this family. Its observed molecular mass (7030.0) matches the value predicted by its amino acid sequence, indicating lack of post-translational modifications. Mipartoxin-I showed a potent lethal effect in mice (intraperitoneal median lethal dose: 0.06 μg/g body weight), and caused a clear neuromuscular blockade on both avian and mouse nerve-muscle preparations, presenting a post-synaptic action through the cholinergic nicotinic receptor. Since mipartoxin-I is the most abundant (28%) protein in M. mipartitus venom, it should play a major role in its toxicity, and therefore represents an important target for developing a therapeutic antivenom, which is very scarce or even unavailable in the regions where this snake inhabits. The structural information here provided might help in the preparation of a synthetic or recombinant immunogen to overcome the limited venom availability.

  13. Ani s 11-Like Protein Is a Pepsin- and Heat-Resistant Major Allergen of Anisakis spp. and a Valuable Tool for Anisakis Allergy Component-Resolved Diagnosis.

    PubMed

    Carballeda-Sangiao, Noelia; Rodríguez-Mahillo, Ana I; Careche, Mercedes; Navas, Alfonso; Caballero, Teresa; Dominguez-Ortega, Javier; Jurado-Palomo, Jesús; González-Muñoz, Miguel

    2016-01-01

    Anisakis simplex is a fish parasite responsible for gastrointestinal and allergic symptoms in humans. The Ani s 11-like protein has been proposed as an Anisakis allergen because its primary structure is similar to that of Ani s 11. The aims of this work were to analyse the frequency of detection of the Ani s 11-like protein and assess its diagnostic value. rAni s 11-like protein, rAni s 5 and rAni s 4 were expressed in Escherichia coli and rAni s 1 was produced in Pichia pastoris. Recombinant allergen detection patterns in 37 Anisakis-sensitised patients were determined. The stability to pepsin digestion and heat treatment of rAni s 11-like protein was also analysed by IgE immunoblotting. Ani s 11-like protein is a major allergen detected by 78% of Anisakis-allergic patients, and 13.5% of patients detect only the rAni s 11-like allergen. This allergen is heat stable because it retains its capability of binding IgE after boiling for 30 min and it is resistant to pepsin digestion for 120 min. These data indicate that the Ani s 11-like protein is a pepsin- and heat-resistant major allergen (Ani s 11.0201) of Anisakis spp. and a valuable tool for Anisakis allergy component-resolved diagnosis. © 2016 S. Karger AG, Basel.

  14. Catechins are not major components responsible for the beneficial effect of Camellia sinensis on the ovarian δ-ALA-D activity inhibited by cadmium.

    PubMed

    Soares, Melina Bucco; Izaguirry, Aryele Pinto; Vargas, Laura Musacchio; Mendez, Andreas Sebastian Loureiro; Spiazzi, Cristiano Chiapinotto; Santos, Francielli Weber

    2013-05-01

    Cadmium has been associated with a wide spectrum of deleterious effects on the reproductive tissues, including ovary. This investigation evaluated the protective role of Camellia sinensis (green, white and red teas) in the cadmium-induced inhibition of ovarian δ-aminolevulinate dehydratase (δ-ALA-D) activity in vitro and ex vivo. This study demonstrated that green and white teas restored the cow ovary δ-ALA-D activity inhibited by cadmium whereas red tea had no effect in vitro. In addition, green tea was able to restore enzyme activity inhibited after acute cadmium exposure in mice ovary. Teas infusions composition was assessed by HPLC in a quantitative assay for catechins, purine alkaloids and gallic acid as well as total polyphenol content. The greatest effect of green tea observed in vitro as well as the protective role presented in the ex vivo study could be attributed to the major content of phenols, but not catechins. In fact, catechins were not able to restore enzyme activity inhibited by cadmium, demonstrating that these compounds are not major components responsible for the beneficial effect of green tea observed in this study. This study demonstrated the helpful effect of green tea infusion in ameliorating a marker protein of cadmium intoxication in ovarian tissue. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. The composing process in technical communication

    NASA Technical Reports Server (NTRS)

    Masse, R. E.

    1981-01-01

    The theory and application of the composing process in technical communications is addressed. The composing process of engineers, some implications for composing research for the teaching and research of technical communication, and an interpretation of the processes as creative experience are also discussed. Two areas of technical communications summarized concern: the rhetorical features of technical communications, and the theoretical background for a process-based view, a problem-solving approach to technical writing.

  16. A Virtual Composer in Every Classroom

    ERIC Educational Resources Information Center

    Hoffman, Adria R.; Carter, Bruce A.

    2013-01-01

    Previous generations applauded grant-funded programs that brought living composers into the lives of K-12 music students. The current economic climate, however, limits opportunities similar to those enjoyed in the past. We designed a virtual composer-in-residence experience that uses technology to overcome the barriers of funding limitations and…

  17. Children Composing and the Tonal Idiom

    ERIC Educational Resources Information Center

    Roels, Johanna Maria; Van Petegem, Peter

    2016-01-01

    Existing studies have demonstrated how children compose, experiment and use their imagination within the conventions of the tonal idiom with functional harmony. However, one area of research that has hardly been explored is how tonality emerges in the compositions of children who compose by transforming their own non-musical ideas, such as their…

  18. Adolescents' Dialogic Composing with Mobile Phones

    ERIC Educational Resources Information Center

    Warner, Julie

    2016-01-01

    This 14-month study examined the phone-based composing practice of three adolescents. Given the centrality of mobile phones to youth culture, the researcher sought to create a description of the participants' composing practices with these devices. Focal participants were users of Twitter and Instagram, two social media platforms that are usually…

  19. A Virtual Composer in Every Classroom

    ERIC Educational Resources Information Center

    Hoffman, Adria R.; Carter, Bruce A.

    2013-01-01

    Previous generations applauded grant-funded programs that brought living composers into the lives of K-12 music students. The current economic climate, however, limits opportunities similar to those enjoyed in the past. We designed a virtual composer-in-residence experience that uses technology to overcome the barriers of funding limitations and…

  20. Adolescents' Dialogic Composing with Mobile Phones

    ERIC Educational Resources Information Center

    Warner, Julie

    2016-01-01

    This 14-month study examined the phone-based composing practice of three adolescents. Given the centrality of mobile phones to youth culture, the researcher sought to create a description of the participants' composing practices with these devices. Focal participants were users of Twitter and Instagram, two social media platforms that are usually…

  1. Dave Brubeck on Music Education and Composing.

    ERIC Educational Resources Information Center

    Ponick, F. S.

    2001-01-01

    Presents an interview with Dave Brubeck, a composer and performer in contemporary jazz. Covers topics such as how Brubeck introduced his sons to music, whether he differentiates between "popular" and "serious" music, suggestions for helping music teachers develop relationships with composers, and the role music education should have in schools.…

  2. Children Composing and the Tonal Idiom

    ERIC Educational Resources Information Center

    Roels, Johanna Maria; Van Petegem, Peter

    2016-01-01

    Existing studies have demonstrated how children compose, experiment and use their imagination within the conventions of the tonal idiom with functional harmony. However, one area of research that has hardly been explored is how tonality emerges in the compositions of children who compose by transforming their own non-musical ideas, such as their…

  3. A Composer Succeeds with Beginning Band.

    ERIC Educational Resources Information Center

    Hargis, Katherine

    1984-01-01

    Described is a "Composer in Residence" project in which a local choral songwriter participated in a semester-long music course for fourth and fifth graders. He visited the schools and composed an instrumental work which the students performed at a spring concert. (RM)

  4. America's Women Composers: Up from the Footnotes.

    ERIC Educational Resources Information Center

    Pool, Jeannie G.

    1979-01-01

    This article presents an overview on women composers in the United States from the eighteenth century to the present. It also lists women's musical organizations, selected references on women in music, and available recordings of works by American women composers. (SJL)

  5. Research on BOM based composable modeling method

    NASA Astrophysics Data System (ADS)

    Zhang, Mingxin; He, Qiang; Gong, Jianxing

    2013-03-01

    Composable modeling method has been a research hotpot in the area of Modeling and Simulation for a long time. In order to increase the reuse and interoperability of BOM based model, this paper put forward a composable modeling method based on BOM, studied on the basic theory of composable modeling method based on BOM, designed a general structure of the coupled model based on BOM, and traversed the structure of atomic and coupled model based on BOM. At last, the paper introduced the process of BOM based composable modeling and made a conclusion on composable modeling method based on BOM. From the prototype we developed and accumulative model stocks, we found this method could increase the reuse and interoperability of models.

  6. Major grass pollen allergens and components detected in a southern Chinese cohort of patients with allergic rhinitis and/or asthma.

    PubMed

    Luo, Wenting; Huang, Huimin; Zheng, Peiyan; Wei, Nili; Luo, Jiaying; Sun, Baoqing; Zeng, Guangqiao

    2016-10-01

    There is so far a paucity of data about allergen component-resolved diagnosis, and the prevalence of grass pollen allergen components in China, in contrast to those from western countries. Even in this country, allergies to grass pollen allergen components in the vast south are inadequately described. This study aimed to determine the major sensitizing grass pollens in Guangzhou, the largest city in Guangdong province of southern China. Included in this study were 258 patients having allergic rhinitis with or without asthma and 88 healthy controls. ImmunoCap100 was used to examine the serum samples for sIgE to Bermuda, Timothy, and Humulus scandens. Subjects who tested positive were further examined for sIgE to Bermuda antigen Cyn d 1, Timothy antigens Phl p 1/4/5/6/7/11/12, and CCD. The relationship of grass pollen allergy to specific antigen sensitization was assessed. As a result, 22.5% of patients with allergic rhinitis and/or asthma were positive for Bermuda-sIgE, 13.6% for Timothy-sIgE, and 7.0% for Humulus scandens-sIgE. These patients were more likely to be sensitized compared with controls (P<0.001). Of the Bermuda-sIgE positive patients, 53.4% were Cyn d 1 positive and 60.3% were Timothy-sIgE positive. Of the Timothy positive patients, 100% were positive for Phl p 4, 17.1% were positive for Phl p 1 and 8.6% tested positive for Phl p 5/6/7/11/12. Patients with high Bermuda-sIgE levels were more likely to be positive for other grasses. In 41.4% of Bermuda grass positive patients, CCD-sIgE was also positive. Sensitization to Phl p 4 was significantly correlated with CCD (rs=0.928).In summary, we found that these southern Chinese patients with allergic rhinitis and/or asthma tested positive for Bermuda, Timothy, and Humulus scandens IgE. A high Bermuda-sIgE level may predict sensitization to other grasses. Correlations between sensitization to CCD and grass pollen allergens suggested a likelihood of cross-reactivity. Further in vitro inhibition assays are

  7. Major repeat components covering one-third of the ginseng (Panax ginseng C.A. Meyer) genome and evidence for allotetraploidy.

    PubMed

    Choi, Hong-Il; Waminal, Nomar E; Park, Hye Mi; Kim, Nam-Hoon; Choi, Beom Soon; Park, Minkyu; Choi, Doil; Lim, Yong Pyo; Kwon, Soo-Jin; Park, Beom-Seok; Kim, Hyun Hee; Yang, Tae-Jin

    2014-03-01

    Ginseng (Panax ginseng) is a famous medicinal herb, but the composition and structure of its genome are largely unknown. Here we characterized the major repeat components and inspected their distribution in the ginseng genome. By analyzing three repeat-rich bacterial artificial chromosome (BAC) sequences from ginseng, we identified complex insertion patterns of 34 long terminal repeat retrotransposons (LTR-RTs) and 11 LTR-RT derivatives accounting for more than 80% of the BAC sequences. The LTR-RTs were classified into three Ty3/gypsy (PgDel, PgTat and PgAthila) and two Ty1/Copia (PgTork and PgOryco) families. Mapping of 30-Gbp Illumina whole-genome shotgun reads to the BAC sequences revealed that these five LTR-RT families occupy at least 34% of the ginseng genome. The Ty3/Gypsy families were predominant, comprising 74 and 33% of the BAC sequences and the genome, respectively. In particular, the PgDel family accounted for 29% of the genome and presumably played major roles in enlargement of the size of the ginseng genome. Fluorescence in situ hybridization (FISH) revealed that the PgDel1 elements are distributed throughout the chromosomes along dispersed heterochromatic regions except for ribosomal DNA blocks. The intensity of the PgDel2 FISH signals was biased toward 24 out of 48 chromosomes. Unique gene probes showed two pairs of signals with different locations, one pair in subtelomeric regions on PgDel2-rich chromosomes and the other in interstitial regions on PgDel2-poor chromosomes, demonstrating allotetraploidy in ginseng. Our findings promote understanding of the evolution of the ginseng genome and of that of related species in the Araliaceae.

  8. Major components of energy drinks (caffeine, taurine, and guarana) exert cytotoxic effects on human neuronal SH-SY5Y cells by decreasing reactive oxygen species production.

    PubMed

    Zeidán-Chuliá, Fares; Gelain, Daniel Pens; Kolling, Eduardo Antônio; Rybarczyk-Filho, José Luiz; Ambrosi, Priscilla; Terra, Silvia Resende; Pires, André Simões; da Rocha, João Batista Teixeira; Behr, Guilherme Antônio; Moreira, José Cláudio Fonseca

    2013-01-01

    To elucidate the morphological and biochemical in vitro effects exerted by caffeine, taurine, and guarana, alone or in combination, since they are major components in energy drinks (EDs). On human neuronal SH-SY5Y cells, caffeine (0.125-2 mg/mL), taurine (1-16 mg/mL), and guarana (3.125-50 mg/mL) showed concentration-dependent nonenzymatic antioxidant potential, decreased the basal levels of free radical generation, and reduced both superoxide dismutase (SOD) and catalase (CAT) activities, especially when combined together. However, guarana-treated cells developed signs of neurite degeneration in the form of swellings at various segments in a beaded or pearl chain-like appearance and fragmentation of such neurites at concentrations ranging from 12.5 to 50 mg/mL. Swellings, but not neuritic fragmentation, were detected when cells were treated with 0.5 mg/mL (or higher doses) of caffeine, concentrations that are present in EDs. Cells treated with guarana also showed qualitative signs of apoptosis, including membrane blebbing, cell shrinkage, and cleaved caspase-3 positivity. Flow cytometric analysis confirmed that cells treated with 12.5-50 mg/mL of guarana and its combinations with caffeine and/or taurine underwent apoptosis. Excessive removal of intracellular reactive oxygen species, to nonphysiological levels (or "antioxidative stress"), could be a cause of in vitro toxicity induced by these drugs.

  9. A conserved genetic module that encodes the major virion components in both the coliphage T4 and the marine cyanophage S-PM2

    PubMed Central

    Hambly, Emma; Tétart, Francoise; Desplats, Carine; Wilson, William H.; Krisch, Henry M.; Mann, Nicholas H.

    2001-01-01

    Sequence analysis of a 10-kb region of the genome of the marine cyanomyovirus S-PM2 reveals a homology to coliphage T4 that extends as a contiguous block from gene (g)18 to g23. The order of the S-PM2 genes in this region is similar to that of T4, but there are insertions and deletions of small ORFs of unknown function. In T4, g18 codes for the tail sheath, g19, the tail tube, g20, the head portal protein, g21, the prohead core protein, g22, a scaffolding protein, and g23, the major capsid protein. Thus, the entire module that determines the structural components of the phage head and contractile tail is conserved between T4 and this cyanophage. The significant differences in the morphology of these phages must reflect the considerable divergence of the amino acid sequence of their homologous virion proteins, which uniformly exceeds 50%. We suggest that their enormous diversity in the sea could be a result of genetic shuffling between disparate phages mediated by such commonly shared modules. These conserved sequences could facilitate genetic exchange by providing partially homologous substrates for recombination between otherwise divergent phage genomes. Such a mechanism would thus expand the pool of phage genes accessible by recombination to all those phages that share common modules. PMID:11553768

  10. Partial Activation and Inhibition of TRPV1 Channels by Evodiamine and Rutaecarpine, Two Major Components of the Fruits of Evodia rutaecarpa.

    PubMed

    Wang, Shenglan; Yamamoto, Satoshi; Kogure, Yoko; Zhang, Wensheng; Noguchi, Koichi; Dai, Yi

    2016-05-27

    Evodiamine (1) and rutaecarpine (2) are the two major components of Evodia rutaecarpa, which has long been used in traditional medicine for the treatment of many diseases. Using transient receptor potential vanilloid 1 (TRPV1)-expressing HEK293 cells and patch-clamp recording, the inhibitory actions of 1 and 2 against TRPV1 channels were investigated. The effects of these compounds against capsaicin- or proton-activated TRPV1 activities were evaluated. The results showed that, although 1 and 2 can activate TRPV1, the maximum response was 3.5- or 9-fold lower than that of capsaicin, respectively, suggesting partial agonism. In comparison to capsaicin, coadministration of 1 and capsaicin increased the half-maximal effective concentration (EC50) of capsaicin-activated TRPV1 currents as shown by a right shift in the dose-response curve, whereas coadministration of 1 with protons failed to inhibit the proton-induced current. Moreover, preadministration of 1, but not 2, inhibited both capsaicin- and proton-induced TRPV1 currents, which might involve channel desensitization. Taken together, 1 and 2 may share the same binding site with capsaicin and act as partial agonists (antagonists) of TRPV1. Evodiamine (1), but not rutaecarpine (2), can desensitize or competitively inhibit the activity of TRPV1.

  11. Antimicrobial action and anti-corrosion effect against sulfate reducing bacteria by lemongrass (Cymbopogon citratus) essential oil and its major component, the citral

    PubMed Central

    2013-01-01

    The anti-corrosion effect and the antimicrobial activity of lemongrass essential oil (LEO) against the planktonic and sessile growth of a sulfate reducing bacterium (SRB) were evaluated. Minimum inhibitory concentration (MIC) of LEO and its major component, the citral, was 0.17 mg ml-1. In addition, both LEO and citral showed an immediate killing effect against SRB in liquid medium, suggesting that citral is responsible for the antimicrobial activity of LEO against SRB. Transmission electron microscopy revealed that the MIC of LEO caused discernible cell membrane alterations and formed electron-dense inclusions. Neither biofilm formation nor corrosion was observed on carbon steel coupons after LEO treatment. LEO was effective for the control of the planktonic and sessile SRB growth and for the protection of carbon steel coupons against biocorrosion. The application of LEO as a potential biocide for SRB growth control in petroleum reservoirs and, consequently, for souring prevention, and/or as a coating protection against biocorrosion is of great interest for the petroleum industries. PMID:23938023

  12. Antimicrobial action and anti-corrosion effect against sulfate reducing bacteria by lemongrass (Cymbopogon citratus) essential oil and its major component, the citral.

    PubMed

    Korenblum, Elisa; Regina de Vasconcelos Goulart, Fátima; de Almeida Rodrigues, Igor; Abreu, Fernanda; Lins, Ulysses; Alves, Péricles Barreto; Blank, Arie Fitzgerald; Valoni, Erika; Sebastián, Gina V; Alviano, Daniela Sales; Alviano, Celuta Sales; Seldin, Lucy

    2013-08-10

    The anti-corrosion effect and the antimicrobial activity of lemongrass essential oil (LEO) against the planktonic and sessile growth of a sulfate reducing bacterium (SRB) were evaluated. Minimum inhibitory concentration (MIC) of LEO and its major component, the citral, was 0.17 mg ml-1. In addition, both LEO and citral showed an immediate killing effect against SRB in liquid medium, suggesting that citral is responsible for the antimicrobial activity of LEO against SRB. Transmission electron microscopy revealed that the MIC of LEO caused discernible cell membrane alterations and formed electron-dense inclusions. Neither biofilm formation nor corrosion was observed on carbon steel coupons after LEO treatment. LEO was effective for the control of the planktonic and sessile SRB growth and for the protection of carbon steel coupons against biocorrosion. The application of LEO as a potential biocide for SRB growth control in petroleum reservoirs and, consequently, for souring prevention, and/or as a coating protection against biocorrosion is of great interest for the petroleum industries.

  13. Chemosensory Responses to the Repellent Nepeta Essential Oil and Its Major Component Nepetalactone by Aedes aegypti (Diptera: Culicidae), a Vector of Zika Virus.

    PubMed

    Sparks, Jackson T; Bohbot, Jonathan D; Ristic, Mihailo; Mišic, Danijela; Skoric, Marijana; Mattoo, Autar; Dickens, Joseph C

    2017-04-12

    Nepeta essential oil (Neo; catnip) and its major component, nepetalactone, have long been known to repel insects including mosquitoes. However, the neural mechanisms through which these repellents are detected by mosquitoes, including the yellow fever mosquito Aedes aegypti (L.), an important vector of Zika virus, were poorly understood. Here we show that Neo volatiles activate olfactory receptor neurons within the basiconic sensilla on the maxillary palps of female Ae. aegypti. A gustatory receptor neuron sensitive to the feeding deterrent quinine and housed within sensilla on the labella of females was activated by both Neo and nepetalactone. Activity of a second gustatory receptor neuron sensitive to the feeding stimulant sucrose was suppressed by both repellents. Our results provide neural pathways for the reported spatial repellency and feeding deterrence of these repellents. A better understanding of the neural input through which female mosquitoes make decisions to feed will facilitate design of new repellents and management strategies involving their use. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by US Government employees and is in the public domain in the US.

  14. Three-dimensional components of selfhood in treatment-naive patients with major depressive disorder: A resting-state qEEG imaging study.

    PubMed

    Fingelkurts, Andrew A; Fingelkurts, Alexander A

    2017-02-28

    Based on previous studies implicating increased functional connectivity within the self-referential brain network in major depressive disorder (MDD), and considering the functional roles of three distinct modules of such brain net (responsible for three-dimensional components of Selfhood) together with the documented abnormalities of self-related processing in MDD, we tested the hypothesis that patients with depression would exhibit increased connectivity within each module of the self-referential brain network and that the strength of these connections would correlate positively with depression severity. Applying the electroencephalogram (EEG) operational synchrony analysis to extract three modules of the self-referential brain network in 12 medication-free depressive outpatients and 10 control subjects we have found an increase in the strength of EEG synchrony within all three modules in depressive patients (though non-significant for the right module). Furthermore, multiple regression analysis that used 3 factors (values of synchrony strength for all three modules) as input indicated that combined increase in the strength of synchrony in all three modules was positively associated with severity of depression. Taken together the findings of this study suggest that depression is primarily associated with hypersynchrony in all three modules of the brain self-referential network (the anterior module been responsible for "witnessing observation and first-person perspective", the left posterior module been responsible for "reflective agency and narration" and the right posterior module been responsible for "bodily representational-emotional agency"), thus contributing to excessive self-focus, rumination, and body tension.

  15. Quantitative relationship between functionally active telomerase and major telomerase components (hTERT and hTR) in acute leukaemia cells.

    PubMed

    Ohyashiki, J H; Hisatomi, H; Nagao, K; Honda, S; Takaku, T; Zhang, Y; Sashida, G; Ohyashiki, K

    2005-05-23

    Functionally active telomerase is affected at various steps including transcriptional and post-transcriptional levels of major telomerase components (hTR and human telomerase reverse transcriptase (hTERT)). We therefore developed a rapid and sensitive method to quantify hTERT and its splicing variants as well as the hTR by a Taqman real-time reverse transcriptase-polymerase chain reaction to determine whether their altered expression may contribute to telomere attrition in vivo or not. Fresh leukaemia cells obtained from 38 consecutive patients were used in this study. The enzymatic level of telomerase activity measured by TRAP assay was generally associated with the copy numbers of full-length hTERT+alpha+beta mRNA (P=0.0024), but did not correlate with hTR expression (P=0.6753). In spite of high copy numbers of full-length hTERT mRNA, telomerase activity was low in some cases correlating with low copy numbers of hTR, raising the possibility that alteration of the hTR : hTERT ratio may affect functionally active telomerase activity in vivo. The spliced nonactive hTERT mRNA tends to be lower in patients with high telomerase activity, suggesting that this epiphenomenon may play some role in telomerase regulation. An understanding of the complexities of telomerase gene regulation in biologically heterogeneous leukaemia cells may offer new therapeutic approaches to the treatment of acute leukaemia.

  16. Comparative pharmacokinetic and tissue distribution profiles of four major bioactive components in normal and hepatic fibrosis rats after oral administration of Fuzheng Huayu recipe.

    PubMed

    Yang, Tao; Liu, Shan; Wang, Chang-Hong; Tao, Yan-Yan; Zhou, Hua; Liu, Cheng-Hai

    2015-10-10

    Fuzheng Huayu recipe (FZHY) is a herbal product for the treatment of liver fibrosis approved by the Chinese State Food and Drug Administration (SFDA), but its pharmacokinetics and tissue distribution had not been investigated. In this study, the liver fibrotic model was induced with intraperitoneal injection of dimethylnitrosamine (DMN), and FZHY was given orally to the model and normal rats. The plasma pharmacokinetics and tissue distribution profiles of four major bioactive components from FZHY were analyzed in the normal and fibrotic rat groups using an ultrahigh performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) method. Results revealed that the bioavailabilities of danshensu (DSS), salvianolic acid B (SAB) and rosmarinic acid (ROS) in liver fibrotic rats increased 1.49, 3.31 and 2.37-fold, respectively, compared to normal rats. There was no obvious difference in the pharmacokinetics of amygdalin (AMY) between the normal and fibrotic rats. The tissue distribution of DSS, SAB, and AMY trended to be mostly in the kidney and lung. The distribution of DSS, SAB, and AMY in liver tissue of the model rats was significantly decreased compared to the normal rats. Significant differences in the pharmacokinetics and tissue distribution profiles of DSS, ROS, SAB and AMY were observed in rats with hepatic fibrosis after oral administration of FZHY. These results provide a meaningful basis for developing a clinical dosage regimen in the treatment of hepatic fibrosis by FZHY. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Principle component analysis combined with matrix-assisted laser desorption ionization mass spectrometry for rapid diagnosing the sera of patients with major depression.

    PubMed

    Huang, Tiao-Lai; Cho, Yi-Tzu; Su, Hong; Shiea, Jentaie

    2013-09-23

    Previously, we demonstrated that 6M HCl hydrolysis followed by matrix-assisted laser desorption/ionization (MALDI-TOF) mass spectrometry is a useful technique to detect potential protein biomarkers in the sera collected from major depression (MD) patients and from healthy controls. In this study, the effects of various organic acids in hydrolyzing proteins in serum were first examined. The organic matrixes commonly used in MALDI analysis were also examined for characterizing the hydrolyzed peptides. Finally, principle component analysis (PCA) was used to analyze the MALDI mass spectra of acid-hydrolyzed serum samples. It was found that 20% TFA and sinapinic acid were the optimal reagents for hydrolysis and MALDI matrix. Samples collected from MD patients and healthy controls were readily classified through PCA analysis. A receiver operating characteristic (ROC) curve based on the ratio of the intensities of the two fragment ions (m/z 8606 and 9287) indicated by PCA plot was also constructed. The area under the curve was 0.845; the sensitivity and specificity were both 80%. An analytical platform employing trifluoroacetic acid to hydrolyze serum proteins followed by MALDI-TOF/MS and PCA analysis was developed to rapidly differentiate the sera between MD patients and healthy controls. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Major 20th century changes of carbonaceous aerosol components (EC, WinOC, DOC, HULIS, carboxylic acids, and cellulose) derived from Alpine ice cores

    NASA Astrophysics Data System (ADS)

    Legrand, M.; Preunkert, S.; Schock, M.; Cerqueira, M.; Kasper-Giebl, A.; Afonso, J.; Pio, C.; GelencséR, A.; Dombrowski-Etchevers, I.

    2007-12-01

    An extended array of carbonaceous species including elemental carbon (EC), water insoluble organic carbon (WinOC) as well as dissolved organic carbon (DOC), humic-like substances (HULIS), and single organic compounds like carboxylic acids, levoglucosan, and cellulose was investigated for the first time in Alpine snow deposits. These investigations were done on selected discrete ice cores sections extracted from Mount Rosa and Mount Blanc glaciers covering the 20th century and extending back to previous centuries. Here we focus on major changes in summer ice layers. Among carbonaceous components, EC reveals an outstanding increase with a sharp summer increase after World War II. This result is discussed against available past EC emission inventories in Europe which are thought to be mainly driven by emissions from road transport and residential sector. The long-term trend of organic carbon (OC) aerosol preserved in ice, WinOC as well as water soluble organic carbon (WSOC), was successfully reconstructed using the suitable array of organic compounds we investigated in this study. It is shown that the level of OC preserved in ice has increased by a factor of 2 after 1950 likely as a result of the enhancement of the oxidative capacity of the atmosphere over the last decades producing more secondary organic atmospheric aerosol from biogenic gaseous precursors.

  19. Joint Composable Object Model and LVC Methodology

    NASA Technical Reports Server (NTRS)

    Rheinsmith, Richard; Wallace, Jeffrey; Bizub, Warren; Ceranowicz, Andy; Cutts, Dannie; Powell, Edward T.; Gustavson, Paul; Lutz, Robert; McCloud, Terrell

    2010-01-01

    Within the Department of Defense, multiple architectures are created to serve and fulfill one or several specific service or mission related LVC training goals. Multiple Object Models exist across and within those architectures and it is there that those disparate object models are a major source of interoperability problems when developing and constructing the training scenarios. The two most commonly used architectures are; HLA and TENA, with DIS and CTIA following close behind in terms of the number of users. Although these multiple architectures can share and exchange data the underlying meta-models for runtime data exchange are quite different, requiring gateways/translators to bridge between the different object model representations; while the Department of Defense's use of gateways are generally effective in performing these functions, as the LVC environment increases so too does the cost and complexity of these gateways. Coupled with the wide range of different object models across the various user communities we increase the propensity for run time errors, increased programmer stop gap measures during coordinated exercises, or failure of the system as a whole due to unknown or unforeseen incompatibilities. The Joint Composable Object Model (JCOM) project was established under an M&S Steering Committee (MSSC)-sponsored effort with oversight and control placed under the Joint Forces Command J7 Advanced Concepts Program Directorate. The purpose of this paper is to address the initial and the current progress that has been made in the following areas; the Conceptual Model Development Format, the Common Object Model, the Architecture Neutral Data Exchange Model (ANDEM), and the association methodology to allow the re-use of multiple architecture object models and the development of the prototype persistent reusable library.

  20. An immunodiagnostic assay for quantitation of specific IgE to the major pollen allergen component, Pas n 1, of the subtropical Bahia grass.

    PubMed

    Timbrell, Victoria L; Riebelt, Lindsay; Simmonds, Claire; Solley, Graham; Smith, William B; Mclean-Tooke, Andrew; van Nunen, Sheryl; Smith, Peter K; Upham, John W; Langguth, Daman; Davies, Janet M

    2014-01-01

    Pollens of the Panicoideae subfamily of grasses including Bahia (Paspalum notatum) are important allergen sources in subtropical regions of the world. An assay for specific IgE to the major molecular allergenic component, Pas n 1, of Bahia grass pollen (BaGP) would have immunodiagnostic utility for patients with pollen allergy in these regions. Biotinylated Pas n 1 purified from BaGP was coated onto streptavidin ImmunoCAPs. Subjects were assessed by clinical history of allergic rhinitis and skin prick test (SPT) to aeroallergens. Serum total, BaGP-specific and Pas n 1-specific IgE were measured. Pas n 1 IgE concentrations were highly correlated with BaGP SPT (r = 0.795, p < 0.0001) and BaGP IgE (r = 0.915, p < 0.0001). At 0.23 kU/l Pas n 1 IgE, the diagnostic sensitivity (92.4%) and specificity (93.1%) for the detection of BaGP allergy was high (area under receiver operator curve 0.960, p < 0.0001). The median concentrations of Pas n 1 IgE in non-atopic subjects (0.01 kU/l, n = 67) and those with other allergies (0.02 kU/l, n = 59) showed no inter-group difference, whilst grass pollen-allergic patients with allergic rhinitis showed elevated Pas n 1 IgE (6.71 kU/l, n = 182, p < 0.0001). The inter-assay coefficient of variation for the BaGP-allergic serum pool was 6.92%. Pas n 1 IgE appears to account for most of the BaGP-specific IgE. This molecular component immunoassay for Pas n 1 IgE has potential utility to improve the sensitivity and accuracy of diagnosis of BaGP allergy for patients in subtropical regions. © 2015 S. Karger AG, Basel.

  1. Sources of humic-like substances in the Pearl River Delta, China: positive matrix factorization analysis of PM2.5 major components and source markers

    NASA Astrophysics Data System (ADS)

    Kuang, B. Y.; Lin, P.; Huang, X. H. H.; Yu, J. Z.

    2015-02-01

    Humic-like substances (HULIS), the hydrophobic part of water-soluble organic carbon (WSOC), account for a significant fraction of PM2.5 mass. Their source studies are so far largely qualitative. In this study, HULIS and WSOC were determined in 100 PM2.5 samples collected in 2009 at an urban site (Guangzhou) and a suburban site (Nansha) in the Pearl River Delta in South China. The annual average concentration of HULIS was 4.83 and 4.71 μg m-3, constituting 8.5 and 10.2% of the PM2.5 mass, while HULIS-C (the carbon component of HULIS) contributed 48 and 57% of WSOC at the two sites, respectively. HULIS were found to correlate with biomass burning (BB) tracers (i.e., levoglucosan and K) and secondary species (e.g., SO42- and NH4+), suggesting its association with BB emissions and secondary formation processes. Sources of HULIS were investigated using positive matrix factorization analysis of PM2.5 chemical composition data, including major components and source markers. In addition to secondary formation process and BB emissions, residual oil combustion related to shipping was identified for the first time as a significant source of HULIS. Secondary formation process contributed the most, accounting for 49-82% of ambient HULIS at the two sites in different seasons. BB emissions contributed a seasonal average of 8-28%, with more contributions observed in the winter months (November-February) due to crop residue burning during harvest season. Residual oil combustion was revealed to be an important source at the suburban site in summer (44% of HULIS-C) due to its proximity to one of the ports and the shipping lane in the region. Vehicle emissions were found to contribute little to HULIS, but had contributions to the hydrophilic WSOC fraction. The contrast in contributions from different combustion sources to HULIS and hydrophilic WSOC suggests that primary sources of HULIS are linked to inefficient combustion. This source analysis suggests further study of HULIS be

  2. Inhibition of H+,K+ -ATPase by hinesol, a major component of So-jutsu, by interaction with enzyme in the E1 state.

    PubMed

    Satoh, K; Nagai, F; Kano, I

    2000-04-01

    Hinesol, a major component of the crude drug "So-jutsu" (Atractylodis Lanceae Rhizoma), strongly inhibited H+,K+-ATPase activity with a IC50 value of 5.8x10(-5) M. It also inhibited Na+,K+-ATPase, Mg2+-ATPase, Ca2+-ATPase, and H+-ATPase activities, although the inhibition rate was lower. No effects on alkaline or acid phosphatase activities were observed. The mechanism by which hinesol inhibited H+,K+-ATPase activity was studied in detail. The inhibition was uncompetitive with respect to ATP, and it increased as the Mg2+ concentration was raised, whereas it was not affected by the K+ concentration. The activity of K+-dependent p-nitrophenyl phosphatase (K+-pNPPase), a partial reaction of H+,K+-ATPase, was inhibited by hinesol noncompetitively with respect to pNPP (IC50 value of 1.6x10(-4) M), and competitively with respect to K+, whereas it was not affected by the Mg2+ concentration. These results suggest that hinesol is a relatively specific inhibitor of H+,K+-ATPase. It appears that hinesol reacts with enzyme in the E1 state in the presence of ATP and Mg2+ and forms the complex hinesol-H+ E1-ATP or hinesol x E1-P, blocking the conformational change to the E2 state. Furthermore, hinesol enhanced the inhibitory effect of omeprazole on H+,K+-ATPase, and the inhibitory site of hinesol was different from that of omeprazole. The effect of So-jutsu as an anti-gastric ulcer agent may be ascribed to the inhibitory effect of hinesol on H+,K+-ATPase activity.

  3. Single-cell analysis of thymocyte differentiation: identification of transcription factor interactions and a major stochastic component in αβ-lineage commitment.

    PubMed

    Boudil, Amine; Skhiri, Lamia; Candéias, Serge; Pasqualetto, Valérie; Legrand, Agnès; Bedora-Faure, Marie; Gautreau-Rolland, Laetitia; Rocha, Benedita; Ezine, Sophie

    2013-01-01

    T cell commitment and αβ/γδ lineage specification in the thymus involves interactions between many different genes. Characterization of these interactions thus requires a multiparameter analysis of individual thymocytes. We developed two efficient single-cell methods: (i) the quantitative evaluation of the co-expression levels of nine different genes, with a plating efficiency of 99-100% and a detection limit of 2 mRNA molecules/cell; and (ii) single-cell differentiation cultures, in the presence of OP9 cells transfected with the thymus Notch1 ligand DeltaL4. We show that during T cell commitment, Gata3 has a fundamental, dose-dependent role in maintaining Notch1 expression, with thymocytes becoming T-cell-committed when they co-express Notch1, Gata3 and Bc11b. Of the transcription factor expression patterns studied here, only that of Bcl11b was suggestive of a role in Pu1 down-regulation. Individual thymocytes became αβ/γδ lineage-committed at very different stages (from the TN2a stage onwards). However, 20% of TN3 cells are not αβ/γδ-lineage committed and TN4 cells comprise two main subpopulations with different degrees of maturity. The existence of a correlation between differentiation potential and expression of the pre-TCR showed that 83% of αβ-committed cells do not express the pre-TCR and revealed a major stochastic component in αβ-lineage specification.

  4. Single-Cell Analysis of Thymocyte Differentiation: Identification of Transcription Factor Interactions and a Major Stochastic Component in αβ-Lineage Commitment

    PubMed Central

    Boudil, Amine; Skhiri, Lamia; Candéias, Serge; Pasqualetto, Valérie; Legrand, Agnès; Bedora-Faure, Marie; Gautreau-Rolland, Laetitia; Rocha, Benedita; Ezine, Sophie

    2013-01-01

    T cell commitment and αβ/γδ lineage specification in the thymus involves interactions between many different genes. Characterization of these interactions thus requires a multiparameter analysis of individual thymocytes. We developed two efficient single-cell methods: (i) the quantitative evaluation of the co-expression levels of nine different genes, with a plating efficiency of 99–100% and a detection limit of 2 mRNA molecules/cell; and (ii) single-cell differentiation cultures, in the presence of OP9 cells transfected with the thymus Notch1 ligand DeltaL4. We show that during T cell commitment, Gata3 has a fundamental, dose-dependent role in maintaining Notch1 expression, with thymocytes becoming T-cell-committed when they co-express Notch1, Gata3 and Bc11b. Of the transcription factor expression patterns studied here, only that of Bcl11b was suggestive of a role in Pu1 down-regulation. Individual thymocytes became αβ/γδ lineage-committed at very different stages (from the TN2a stage onwards). However, 20% of TN3 cells are not αβ/γδ-lineage committed and TN4 cells comprise two main subpopulations with different degrees of maturity. The existence of a correlation between differentiation potential and expression of the pre-TCR showed that 83% of αβ-committed cells do not express the pre-TCR and revealed a major stochastic component in αβ-lineage specification. PMID:24098325

  5. The Pseudomonas aeruginosa CreBC Two-Component System Plays a Major Role in the Response to β-Lactams, Fitness, Biofilm Growth, and Global Regulation

    PubMed Central

    Zamorano, Laura; Juan, Carlos; Mulet, Xavier; Blázquez, Jesús

    2014-01-01

    Pseudomonas aeruginosa is a ubiquitous versatile environmental microorganism with a remarkable ability to grow under diverse environmental conditions. Moreover, P. aeruginosa is responsible for life-threatening infections in immunocompromised and cystic fibrosis patients, as the extraordinary capacity of this pathogen to develop antimicrobial resistance dramatically limits our therapeutic arsenal. Its large genome carries an outstanding number of genes belonging to regulatory systems, including multiple two-component sensor-regulator systems that modulate the response to the different environmental stimuli. Here, we show that one of two systems, designated CreBC (carbon source responsive) and BlrAB (β-lactam resistance), might be of particular relevance. We first identified the stimuli triggering the activation of the CreBC system, which specifically responds to penicillin-binding protein 4 (PBP4) inhibition by certain β-lactam antibiotics. Second, through an analysis of a large comprehensive collection of mutants, we demonstrate an intricate interconnection between the CreBC system, the peptidoglycan recycling pathway, and the expression of the concerning chromosomal β-lactamase AmpC. Third, we show that the CreBC system, and particularly its effector inner membrane protein CreD, plays a major role in bacterial fitness and biofilm development, especially in the presence of subinhibitory concentrations of β-lactams. Finally, global transcriptomics reveals broad regulatory functions of CreBC in basic physiological aspects, particularly anaerobic respiration, in both the presence and absence of antibiotics. Therefore, the CreBC system is envisaged as a potentially interesting target for improving the efficacy of β-lactams against P. aeruginosa infections. PMID:24936599

  6. Identification of candidates for interacting partners of the tail domain of DcNMCP1, a major component of the Daucus carota nuclear lamina-like structure.

    PubMed

    Mochizuki, Ryota; Tsugama, Daisuke; Yamazaki, Michihiro; Fujino, Kaien; Masuda, Kiyoshi

    2017-02-01

    NMCP/CRWN (NUCLEAR MATRIX CONSTITUENT PROTEIN/CROWDED NUCLEI) is a major component of a protein fibrous meshwork (lamina-like structure) on the plant inner nuclear membrane. NMCP/CRWN contributes to regulating nuclear shape and nuclear functions. An NMCP/CRWN protein in Daucus carota (DcNMCP1) is localized to the nuclear periphery in interphase cells, and surrounds chromosomes in cells in metaphase and anaphase. The N-terminal region and the C-terminal region of DcNMCP1 are both necessary for localizing DcNMCP1 to the nuclear periphery. Here candidate interacting partners of the amino acid position 975-1053 of DcNMCP1 (T975-1053), which is present in the C-terminal region and contains a conserved sequence that plays a role in localizing DcNMCP1 to the nuclear periphery, are screened for. Arabidopsis thaliana nuclear proteins were subjected to far-Western blotting with GST-fused T975-1053 as a probe, and signals were detected at the positions corresponding to ∼70, ∼40, and ∼18 kDa. These ∼70, ∼40, and ∼18 kDa nuclear proteins were identified by mass spectrometry, and subjected to a yeast 2-hybrid (Y2H) analysis with T975-1053 as bait. In this analysis, the ∼40 kDa protein ARP7, which is a nuclear actin-related protein possibly involved in regulating chromatin structures, was confirmed to interact with T975-1053. Independently of the far-Western blotting, a Y2H screen was performed using T975-1053 as bait. Targeted Y2H assays confirmed that 3 proteins identified in the screen, MYB3, SINAT1, and BIM1, interact with T975-1053. These proteins might have roles in NMCP/CRWN protein-mediated biologic processes.

  7. Insecticidal activity of essential oils from eleven Eucalyptus spp. and two hybrids: lethal and sublethal effects of their major components on Blattella germanica.

    PubMed

    Alzogaray, Raul A; Lucia, Alejandro; Zerba, Eduardo N; Masuh, Hector M

    2011-04-01

    The aim of the current study was to evaluate the fumigant activity of the essential oils from 11 species of the genus Eucalyptus and two of their hybrids on first instar of Blattella germanica L. The fumigant activity and repellence of the four major monoterpene components of these essential oils also were tested. Fumigant activity was evaluated by exposing nymphs to the vapors emitted by 50 microl of essential oil or monoterpene in a closed container. The lowest knockdown time 50% (KT50) values, expressed in minutes, were elicited by the essential oils of the Eucalyptus grandis X Eucalyptus tereticornis (57.9) hybrid, Eucalyptus sideroxylon A. Cunn (62.0), E. grandis X Eucalyptus camaldulensis (63.8) hybrid, Eucalyptus viminalis Labill (64.1), Eucalyptus dunnii Maiden (64.5), and Eucalyptus grandis (Hill) ex Maiden (68.7). The KT50 values for the remaining essential oils ranged between 74.5 (E. saligna Smith) and 161.4 min (E. tereticornis Smith). The essential oil from the hybrid E. grandis X E. tereticornis was 3.7 times less toxic than dichlorvos (positive control). The KT50 values of monoterpenes were 38.8 for alpha-pinene, 55.3 for 1,8-cineole, 175.6 for p-cymene, and 178.3 for gamma-terpinene. Alpha-pinene was 2.5 times less toxic than dichlorvos. There was a strong positive correlation between the fumigant activity of essential oils and their corresponding 1,8-cineole and alpha-pinene concentration. Repellency was quantified using a video tracking system. Two concentrations of monoterpenes were studied (7 and 70 microg/cm2). All compounds produced a light repellent effect but only when applied at 70 microg/cm2. In all cases, the repellent effect was less than that produced by the broad-spectrum insect repellent N,N-diethyl-3-methylbenzamide (positive control).

  8. The Pseudomonas aeruginosa CreBC two-component system plays a major role in the response to β-lactams, fitness, biofilm growth, and global regulation.

    PubMed

    Zamorano, Laura; Moyà, Bartolomé; Juan, Carlos; Mulet, Xavier; Blázquez, Jesús; Oliver, Antonio

    2014-09-01

    Pseudomonas aeruginosa is a ubiquitous versatile environmental microorganism with a remarkable ability to grow under diverse environmental conditions. Moreover, P. aeruginosa is responsible for life-threatening infections in immunocompromised and cystic fibrosis patients, as the extraordinary capacity of this pathogen to develop antimicrobial resistance dramatically limits our therapeutic arsenal. Its large genome carries an outstanding number of genes belonging to regulatory systems, including multiple two-component sensor-regulator systems that modulate the response to the different environmental stimuli. Here, we show that one of two systems, designated CreBC (carbon source responsive) and BlrAB (β-lactam resistance), might be of particular relevance. We first identified the stimuli triggering the activation of the CreBC system, which specifically responds to penicillin-binding protein 4 (PBP4) inhibition by certain β-lactam antibiotics. Second, through an analysis of a large comprehensive collection of mutants, we demonstrate an intricate interconnection between the CreBC system, the peptidoglycan recycling pathway, and the expression of the concerning chromosomal β-lactamase AmpC. Third, we show that the CreBC system, and particularly its effector inner membrane protein CreD, plays a major role in bacterial fitness and biofilm development, especially in the presence of subinhibitory concentrations of β-lactams. Finally, global transcriptomics reveals broad regulatory functions of CreBC in basic physiological aspects, particularly anaerobic respiration, in both the presence and absence of antibiotics. Therefore, the CreBC system is envisaged as a potentially interesting target for improving the efficacy of β-lactams against P. aeruginosa infections. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Acaricidal activity of oregano oil and its major component, carvacrol, thymol and p-cymene against Psoroptes cuniculi in vitro and in vivo.

    PubMed

    Shang, Xiaofei; Wang, Yu; Zhou, Xuzheng; Guo, Xiao; Dong, Shuwei; Wang, Dongsheng; Zhang, Jiyu; Pan, Hu; Zhang, Yu; Miao, Xiaolou

    2016-08-15

    Oregano oil possesses marked antioxidant and antimicrobial activity and is widely applied in animal husbandry. In the present study, we aimed to investigate the acaricidal activities of oregano oil and its major component, carvacrol, thymol and p-cymene against Psoroptes cuniculi in vitro and in vivo. The results revealed that oregano oil exhibited significant acaricidal effects against P. cuniculi that were dose- and time-dependent response. In in vitro test, concentrations of 0.05% and 0.02% (v/v) killed all of the mites within 1h and 6h, respectively. Moreover, 0.1mg/ml (w/v) carvacrol, 0.2mg/ml (w/v) thymol and 1% p-cymene (v/v) also possessed marked acaricidal activities, and compared with the control group, elicited mean mortalities of 84.00%, 96.00% and 66% at 24h, respectively. The median lethal times (LT50) against P. cuniculi of the concentrations of 0.02%, 0.01% and 0.005% (v/v) of oregano oil, thymol, carvacrol and p-cymene were 2.171h, 11.396h, 26.102h, and 4.424h, 8.957h and 15.201h, respectively. Meanwhile, twenty naturaly infested rabbits were used to four homogeneity groups: negative control (without treatment), positive control (treated with ivermectin), group treated with 1% of oregano oil and other group with 5% of oregano oil. All the treatments were topically. After the treatment of 1% and 5% oregano oil, the P. cuniculi were completely eliminated in the rabbits, and at the end of the test (day 20), the rabbits of all treatment groups exhibited favorable mental and physical statuses. These results indicated that oregano oil could be widely applied as a potential acaricidal agent in the treatment of animal acariasis in the future.

  10. Carnosic acid as a major bioactive component in rosemary extract ameliorates high-fat-diet-induced obesity and metabolic syndrome in mice.

    PubMed

    Zhao, Yantao; Sedighi, Rashin; Wang, Pei; Chen, Huadong; Zhu, Yingdong; Sang, Shengmin

    2015-05-20

    In this study, we investigated the preventive effects of carnosic acid (CA) as a major bioactive component in rosemary extract (RE) on high-fat-diet-induced obesity and metabolic syndrome in mice. The mice were given a low-fat diet, a high-fat diet or a high-fat diet supplemented with either 0.14% or 0.28% (w/w) CA-enriched RE (containing 80% CA, RE#1L and RE#1H), or 0.5% (w/w) RE (containing 45% CA, RE#2), for a period of 16 weeks. There was the same CA content in the RE#1H and RE#2 diets and half of this amount in the RE#1L diet. The dietary RE supplementation significantly reduced body weight gain, percent of fat, plasma ALT, AST, glucose, insulin levels, liver weight, liver triglyceride, and free fatty acid levels in comparison with the mice fed with a HF diet without RE treatment. RE administration also decreased the levels of plasma and liver malondialdehyde, advanced glycation end products (AGEs), and the liver expression of receptor for AGE (RAGE) in comparison with those for mice of the HF group. Histological analyses of liver samples showed decreased lipid accumulation in hepatocytes in mice administrated with RE in comparison with that of HF-diet-fed mice. Meanwhile, RE administration enhanced fecal lipid excretion to inhibit lipid absorption and increased the liver GSH/GSSG ratio to perform antioxidant activity compared with HF group. Our results demonstrate that rosemary is a promising dietary agent to reduce the risk of obesity and metabolic syndrome.

  11. Major Components of Energy Drinks (Caffeine, Taurine, and Guarana) Exert Cytotoxic Effects on Human Neuronal SH-SY5Y Cells by Decreasing Reactive Oxygen Species Production

    PubMed Central

    Zeidán-Chuliá, Fares; Kolling, Eduardo Antônio; Rybarczyk-Filho, José Luiz; Ambrosi, Priscilla; Resende Terra, Silvia; Pires, André Simões; da Rocha, João Batista Teixeira; Antônio Behr, Guilherme; Fonseca Moreira, José Cláudio

    2013-01-01

    Scope. To elucidate the morphological and biochemical in vitro effects exerted by caffeine, taurine, and guarana, alone or in combination, since they are major components in energy drinks (EDs). Methods and Results. On human neuronal SH-SY5Y cells, caffeine (0.125–2 mg/mL), taurine (1–16 mg/mL), and guarana (3.125–50 mg/mL) showed concentration-dependent nonenzymatic antioxidant potential, decreased the basal levels of free radical generation, and reduced both superoxide dismutase (SOD) and catalase (CAT) activities, especially when combined together. However, guarana-treated cells developed signs of neurite degeneration in the form of swellings at various segments in a beaded or pearl chain-like appearance and fragmentation of such neurites at concentrations ranging from 12.5 to 50 mg/mL. Swellings, but not neuritic fragmentation, were detected when cells were treated with 0.5 mg/mL (or higher doses) of caffeine, concentrations that are present in EDs. Cells treated with guarana also showed qualitative signs of apoptosis, including membrane blebbing, cell shrinkage, and cleaved caspase-3 positivity. Flow cytometric analysis confirmed that cells treated with 12.5–50 mg/mL of guarana and its combinations with caffeine and/or taurine underwent apoptosis. Conclusion. Excessive removal of intracellular reactive oxygen species, to nonphysiological levels (or “antioxidative stress”), could be a cause of in vitro toxicity induced by these drugs. PMID:23766861

  12. Tiliroside, the major component of Agrimonia pilosa Ledeb ethanol extract, inhibits MAPK/JNK/p38-mediated inflammation in lipopolysaccharide-activated RAW 264.7 macrophages

    PubMed Central

    JIN, XIN; SONG, SHIQING; WANG, JING; ZHANG, QINGZHEN; QIU, FENG; ZHAO, FENG

    2016-01-01

    In the present study, the in vivo anti-inflammatory activity of Agrimonia pilosa Ledeb (AP) ethanol extract was confirmed in experimental animal models, including xylene-induced ear edema in mice and carrageenan-induced paw edema in rats. Tiliroside, the major component of AP extract, was isolated and purified by high-performance liquid chromatography. The anti-inflammatory mechanism of tiliroside was then examined using lipopolysaccharide (LPS)-activated RAW 264.7 macrophage cells. An MTT assay was used to determine cytotoxicity and a Griess assay was used to determine nitric oxide (NO) production. Concentration levels of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) were determined by enzyme-linked immunosorbent assay. Protein expression levels of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), phosphorylated (p)-extracellular signal-regulated kinase (ERK) 1/2, p-c-Jun N-terminal kinases (JNK), p-p38 and inhibitor of κB-α were detected by western blot analysis. AP ethanol extract was revealed to inhibit xylene-induced ear edema in mice and carrageenan-induced paw edema in rats. Tiliroside significantly suppressed the overproduction of NO (P<0.01), but revealed no notable inhibition of the release of TNF-α and IL-6. In addition, tiliroside significantly downregulated the elevated expression levels of iNOS and COX-2 induced by LPS (P<0.01). The phosphorylation of JNK and p38 proteins were also significantly inhibited (P<0.01), however, tiliroside exhibited no obvious inhibition on the phosphorylation of ERK 1/2 and the degradation of IκB-α protein. In conclusion, the anti-inflammatory molecular mechanism of tiliroside may involve the downregulation of iNOS and COX-2 protein expression levels, and the inactivation of mitogen-activated protein kinase (MAPK)/JNK, in addition to the MAPK/p38 signaling pathway. PMID:27347085

  13. The rainbow effect on composing chaotic algorithmic music

    NASA Astrophysics Data System (ADS)

    Sotiropoulos, Vaggelis D.

    The effect of rainbow color sequence on composing chaotic algorithmic music is examined. The mathematical range of the chaotic algorithm is mapped onto musical notes whose sequence follows the sequence of the seven main rainbow colors and their in-between five auxiliary colors. Each musical note is identified with the frequency of a color by a frequency shift. As a result, for a single rainbow, the scale of the chaotic music comprises an ascending chromatic F major scale without the thirteenth note, followed by its corresponding descending chromatic scale, for a total of twenty four notes. For aesthetic purposes, a note can be placed in any octave at the composer's will. The effect of a double rainbow on composing chaotic music is also studied. It is known from nature that the outer bow has its color sequence reversed. Thus, in this case, the double rainbow musical scale comprises forty eight notes on a repeated reversed full chromatic F major scale without the thirteenth note in the ascent or the first note in the descent, resembling in shape the letter w. Colorless regions in the rainbow or dark (Alexander's bands) regions in a supernumerary rainbow are included in the musical range as rests. With the musical scale based on the described rainbow mapping, chaotic music is composed from an algorithm defined by a semi-elliptical first order iterative map. The minor axis of the ellipse is defined by the range of the mathematical pitch from 0 to 1 while the semi-major axis by that of the succeeding pitch from 0 to r/2; r is a free parameter that varies from 1 to 2 to be chosen by the composer. The lower limiting value of the free parameter r corresponds to a circle of radius 1/2 yielding steady state music whereas all the other values of r correspond to ellipses. Chaotic compositions result from r values between 1.95 and 2, the latter value yielding full chaos from an ellipse with its major axis double its minor axis. Fixed notes are obtained for all r's, i.e., notes

  14. Intestinal transport of 3,6'-disinapoylsucrose, a major active component of Polygala tenuifolia, using Caco-2 cell monolayer and in situ rat intestinal perfusion models.

    PubMed

    Chen, Ying; Liu, Xinmin; Pan, Ruile; Zhu, Xiaoxin; Steinmetz, André; Liao, Yonghong; Wang, Ning; Peng, Bo; Chang, Qi

    2013-10-01

    3,6'-Disinapoylsucrose is a major active component of the herb Polygala tenuifolia which has long been used for relieving tranquilization, uneasiness of the mind, and improving learning and memory. Our previous study found that 3,6'-disinapoylsucrose had a very low oral bioavailability. Its mechanisms of absorption in the small intestine have so far been unclear. In the present study, the absorption mechanisms of 3,6'-disinapoylsucrose were investigated by using the Caco-2 cell monolayer and in situ rat intestinal perfusion models. The 3,6'-disinapoylsucrose concentration was determined by an LC/MS/MS method. In a Caco-2 cell transport study, the results showed that 3,6'-disinapoylsucrose had very limited intestinal permeability with average apparent permeability coefficient values around (1.11-1.34) × 10(-7) cm/s from the apical (A) to the basolateral (B) side and (1.37-1.42) × 10(-7) cm/s from B to A, at concentrations of 5, 20, and 33 µM. No concentration dependence in the 3,6'-disinapoylsucrose transport was observed. The apparent permeability coefficient value of 3,6'-disinapoylsucrose (5 µM) from A to B greatly increased to 4.49 × 10(-7) and 1.81 × 10(-7) cm/s, respectively, when the cells were preincubated with EDTA (17 mM) and sodium caprate (5.14 mM). No significant effect on the 3,6'-disinapoylsucrose transport by the inhibitors including verapamil, cyclosporine A, and sodium azide was observed. Similar results were found in the small intestinal perfusion study. The apparent permeability coefficient value of 3,6'-disinapoylsucrose greatly increased from 3.97 × 10(-6) to 23.4 × 10(-6) and 20.0 × 10(-6) cm/s in the presence of EDTA (17 mM) and sodium caprate (5.14 mM), respectively, in perfusion buffer. An in vitro stability evaluation of 3,6'-disinapoylsucrose in the gastrointestinal tract showed that it was relatively stable both in the stomach and small intestine contents, while it was found to be more instable in the colon contents. All of the

  15. Music and emotion—a composer's perspective

    PubMed Central

    Douek, Joel

    2013-01-01

    This article takes an experiential and anecdotal look at the daily lives and work of film composers as creators of music. It endeavors to work backwards from what practitioners of the art and craft of music do instinctively or unconsciously, and try to shine a light on it as a conscious process. It examines the role of the film composer in his task to convey an often complex set of emotions, and communicate with an immediacy and universality that often sit outside of common language. Through the experiences of the author, as well as interviews with composer colleagues, this explores both concrete and abstract ways in which music can bring meaning and magic to words and images, and as an underscore to our daily lives. PMID:24348344

  16. The Composer's World from Sketch to Score. LinkUp! 1998-99 Teacher's Guide.

    ERIC Educational Resources Information Center

    Hall, Randy L., Ed.

    This guide helps teachers and students examine the questions "Who are composers?" and "How do they compose?" In addition to the musical component of the inquiry, the guide also explores the world of writers and how they write and visual artists and how they create. Materials in the guide encourage students to express their…

  17. Optical read/write memory system components

    NASA Technical Reports Server (NTRS)

    Kozma, A.

    1972-01-01

    The optical components of a breadboard holographic read/write memory system have been fabricated and the parameters specified of the major system components: (1) a laser system; (2) an x-y beam deflector; (3) a block data composer; (4) the read/write memory material; (5) an output detector array; and (6) the electronics to drive, synchronize, and control all system components. The objectives of the investigation were divided into three concurrent phases: (1) to supply and fabricate the major components according to the previously established specifications; (2) to prepare computer programs to simulate the entire holographic memory system so that a designer can balance the requirements on the various components; and (3) to conduct a development program to optimize the combined recording and reconstruction process of the high density holographic memory system.

  18. A Design for Composing and Extending Vehicle Models

    NASA Technical Reports Server (NTRS)

    Madden, Michael M.; Neuhaus, Jason R.

    2003-01-01

    The Systems Development Branch (SDB) at NASA Langley Research Center (LaRC) creates simulation software products for research. Each product consists of an aircraft model with experiment extensions. SDB treats its aircraft models as reusable components, upon which experiments can be built. SDB has evolved aircraft model design with the following goals: 1. Avoid polluting the aircraft model with experiment code. 2. Discourage the copy and tailor method of reuse. The current evolution of that architecture accomplishes these goals by reducing experiment creation to extend and compose. The architecture mechanizes the operational concerns of the model's subsystems and encapsulates them in an interface inherited by all subsystems. Generic operational code exercises the subsystems through the shared interface. An experiment is thus defined by the collection of subsystems that it creates ("compose"). Teams can modify the aircraft subsystems for the experiment using inheritance and polymorphism to create variants ("extend").

  19. Helping Students Understand the Composer's Job.

    ERIC Educational Resources Information Center

    Townsend, Karen

    1999-01-01

    Describes how the string orchestra students of Natchitoches Central High School in Natchitoches (Louisiana) and their director commissioned the composer Jody Nagel to write a composition dedicated to their ensemble in order to increase the students' understanding of composition. Discusses student reaction to the project and use of discipline-based…

  20. The Composer in the Liberal Arts College

    ERIC Educational Resources Information Center

    Schwartz, Elliott

    2011-01-01

    This essay explores the role of music composition within the curriculum of a typical small liberal arts college and the faculty composer's role(s) in facilitating the study of composition. The relationship between composition and campus performance is discussed, particularly in light of the increased emphasis on performance in formerly all-male…

  1. Take a Change with Aleatory Composing.

    ERIC Educational Resources Information Center

    Stambaugh, Laura

    2003-01-01

    Discusses how teachers can incorporate musical composition into their classrooms by teaching students about aleatory, or chance, music. Provides a definition of aleatory music and provides various composing techniques, focusing on aleatory music. Includes lesson plans using aleatory music, such as the "Mozart Model" for grades 4-12. (CMK)

  2. Enhancing Memory in Your Students: COMPOSE Yourself!

    ERIC Educational Resources Information Center

    Rotter, Kathleen M.

    2009-01-01

    The essence of teaching is, in fact, creating new memories for your students. The teacher's role is to help students store the correct information (memories) in ways that make recall and future access and use likely. Therefore, choosing techniques to enhance memory is possibly the most critical aspect of instructional design. COMPOSE is an acronym…

  3. Composing Networks: Writing Practices on Mobile Devices

    ERIC Educational Resources Information Center

    Swarts, Jason

    2016-01-01

    This article is an investigation of composing practices through which people create networks with mobile phones. By looking through the lens of actor-network theory, the author portrays the networking activity of mobile phone users as translation, what Latour describes as an infralanguage to which different disciplinary perspectives can be…

  4. Composing Networks: Writing Practices on Mobile Devices

    ERIC Educational Resources Information Center

    Swarts, Jason

    2016-01-01

    This article is an investigation of composing practices through which people create networks with mobile phones. By looking through the lens of actor-network theory, the author portrays the networking activity of mobile phone users as translation, what Latour describes as an infralanguage to which different disciplinary perspectives can be…

  5. Factors Important in Composing Legal Written Communication.

    ERIC Educational Resources Information Center

    West, Judy Ferguson

    To determine which factors were considered important in composing legal written documents, personal interviews were conducted with 111 Middle Tennessee Bar Association members, and questionnaires were mailed to 211 legal secretaries/paralegals. The self-administered questionnaires were completed and returned by 133 persons. Of those, 108 indicated…

  6. Composing Zen Haiku: Training to Make Sense.

    ERIC Educational Resources Information Center

    Holmes, Stewart W.

    1996-01-01

    Suggests that composing "haiku" requires a discipline in a person's thinking and emoting patterns similar to that of a general semantics system for training people to make sense. Describes how such haiku are written and gives some guidelines to help individuals create their own. (PA)

  7. The Composer's Blueprint: A Teacher's Guide.

    ERIC Educational Resources Information Center

    Trzcinski, Louis C.; Nelhybel, Vaclav

    This teacher's guide is designed to accompany two 15-minute color television programs dealing with the creative process involved in conceiving a composition. The programs are appropriate for junior high school string students and instrumental students in string methods courses at teacher training institutions. In the program, the composer explains…

  8. The Composer in the Liberal Arts College

    ERIC Educational Resources Information Center

    Schwartz, Elliott

    2011-01-01

    This essay explores the role of music composition within the curriculum of a typical small liberal arts college and the faculty composer's role(s) in facilitating the study of composition. The relationship between composition and campus performance is discussed, particularly in light of the increased emphasis on performance in formerly all-male…

  9. The Composing Processes of Mature Adults.

    ERIC Educational Resources Information Center

    Crabbe, Katharyn

    The study examined 41 students (24 male, 17 female) in a beginning writing course for adults. Data were collected by (1) taping four workshop sessions in which all students participated in small groups, (2) interviewing all the students, and (3) observing four students writing in the classroom. The adult writers composed in two models: the…

  10. Research on Composing: Points of Departure.

    ERIC Educational Resources Information Center

    Cooper, Charles R., Ed.; Odell, Lee, Ed.

    While the chapters of this book present a variety of perspectives, they share the common goal of redirecting and revitalizing research on written composition. The authors review research on written discourse and the composing process and raise questions regarding information and skills that teachers and researchers need to consider. The chapters…

  11. [The naphtha composing characteristics of geoherbs of Atractylodes lancea].

    PubMed

    Guo, Lan-ping; Liu, Jun-ying; Ji, Li; Huang, Lu-qi

    2002-11-01

    To find the chemical diversity and characteristics of A. lancea on two levels--individuals and populations, and to discover the chemical essentials for forming geoherbs. 47 rhizomes of A. lancea were collected in 7 populations, and 6 naphtha components (1. elemol, 2. hinesol, 3. beta-eudesmol, 4. atractylone, 5. atractylodin, 6. atractylenolid I) in the rhizomes were determined by GC-MS combination. Principal Component Analysis and Cluster Analysis were carried out by SPSS. Cluster Analysis of the 6 main components indicated that the chemical components of geoherbs were different from those of the non-geonerbs of A. lancea. Other analysis showed as follows: 1. The general oil of geoberbs were lower than that of non-geoherbs(P < 0.01), but components yielding more than 1% (% of the total oil) were more than non-geoherbs(P < 0.01); 2. Hinesol mixing beta-eudesmol was more in non-geoherbs, which atractylodin mixing atractylone was more in geoherbs(P < 0.001); 3. Principal Component Analysis implied that atractylone was the most important component to discriminate geoherbs and non-geoherbs of A. Lancea. The naphtha composing characteristics of geoherbs was the special proportionment sale, viz. atractylone: hinesol: beta-eudesmol: atractylodin being(0.70~2.00):(0.04~0.35):(0.09~0.40):1.

  12. Asymmetric wetting of patterned surfaces composed of intrinsically hysteretic materials.

    PubMed

    Anantharaju, Neeharika; Panchagnula, Mahesh V; Vedantam, Srikanth

    2009-07-07

    Wetting of chemically heterogeneous surfaces is modeled using a phase field theory. We focus on a chemically heterogeneous surface composed of squares of one component material embedded in another. Unlike previous studies where the component materials were characterized only by an equilibrium contact angle, in this paper each of the component materials is constitutively allowed to exhibit hysteresis. Using this approach, we investigate the effect of heterogeneity length scale on observed macroscopic behavior. Cassie theory is found to be applicable only in the limit of vanishing length scale. For surfaces with a finite heterogeneity length scale, the advancing and receding contact angles deviate from Cassie theory. We find that this deviation and its length scale dependence are asymmetric and depend on the wetting properties of the embedded material relative to the contiguous substrate.

  13. Structural materials and components

    NASA Technical Reports Server (NTRS)

    Gagliani, John (Inventor); Lee, Raymond (Inventor)

    1982-01-01

    High density structural (blocking) materials composed of a polyimide filled with glass microballoons. Structural components such as panels which have integral edgings and/or other parts made of the high density materials.

  14. Structural materials and components

    NASA Technical Reports Server (NTRS)

    Gagliani, John (Inventor); Lee, Raymond (Inventor)

    1983-01-01

    High density structural (blocking) materials composed of a polyimide filled with glass microballoons. Structural components such as panels which have integral edgings and/or other parts made of the high density materials.

  15. Structural materials and components

    NASA Technical Reports Server (NTRS)

    Gagliani, John (Inventor); Lee, Raymond (Inventor)

    1982-01-01

    High density structural (blocking) materials composed of a polyimide filled with glass microballoons and methods for making such materials. Structural components such as panels which have integral edgings and/or other parts made of the high density materials.

  16. A genetic pathway composed of Sox14 and Mical governs severing of dendrites during pruning

    PubMed Central

    Kirilly, Daniel; Gu, Ying; Huang, Yafen; Wu, Zhuhao; Bashirullah, Arash; Low, Boon Chuan; Kolodkin, Alex L; Wang, Hongyan; Yu, Fengwei

    2011-01-01

    Pruning that selectively eliminates neuronal processes is crucial for the refinement of neural circuits during development. In Drosophila, the class IV dendritic arborization neuron (ddaC) undergoes pruning to remove its larval dendrites during metamorphosis. We identified Sox14 as a transcription factor that was necessary and sufficient to mediate dendrite severing during pruning in response to ecdysone signaling. We found that Sox14 mediated dendrite pruning by directly regulating the expression of the target gene mical. mical encodes a large cytosolic protein with multiple domains that are known to associate with cytoskeletal components. mical mutants had marked severing defects during dendrite pruning that were similar to those of sox14 mutants. Overexpression of Mical could significantly rescue pruning defects in sox14 mutants, suggesting that Mical is a major downstream target of Sox14 during pruning. Thus, our findings indicate that a previously unknown pathway composed of Sox14 and its cytoskeletal target Mical governs dendrite severing. PMID:19881505

  17. Active magnetic compensation composed of shielding panels.

    PubMed

    Kato, K; Yamazaki, K; Sato, T; Haga, A; Okitsu, T; Muramatsu, K; Ueda, T; Kobayashi, K; Yoshizawa, M

    2004-11-30

    Magnetically shielded rooms (MSRs) with materials of high permeability and active shield systems have been used to shield magnetic noise for biomagnetic measurements up to now. However, these techniques have various disadvantages. Therefore, we have developed a new shielding system composed of shielding panels using an active compensation technique. In this study, we evaluated the shielding performance of several unit panels attached together. Numerical and experimental approaches indicated that the shielding factor of a cubic model composed of 24 panels was 17 for uniform fields, and 7 for disturbances due to car movement. Furthermore, the compensation space is larger than that of an ordinary active system using large coils rather than panels. Moreover, the new active compensation system has the important advantage that panels of any shape can be assembled for occasional use because the unit panels are small and light.

  18. System Composer: Technology for rapid system integration and remote collaboration

    SciTech Connect

    Davies, B.R.; Palmquist, R.D.

    1996-03-01

    Sandia National Laboratories has developed an approach to the design, evaluation, deployment and operation of intelligent systems which is called System Composer. This toolkit provides an infrastructure and architecture for robot and automation system users to readily integrate system components and share mechatronic, sensor, and information resources over networks. The technology described in this paper provides a framework for real-time collaboration between researchers, manufacturing entities, design entities, and others without regard to relative location. An overview of the toolkit including its elements and architecture is provided along with examples of its use.

  19. Human skin penetration of the major components of Australian tea tree oil applied in its pure form and as a 20% solution in vitro.

    PubMed

    Cross, Sheree E; Russell, Michael; Southwell, Ian; Roberts, Michael S

    2008-05-01

    The safety of topical application of Australian tea tree Oil (TTO) is confounded by a lack of transdermal penetration data, which adequately informs opinions and recommendations. In this study we applied TTO in its pure form and as a 20% solution in ethanol in vitro to human epidermal membranes from three different donors, mounted in horizontal Franz-type diffusion cells, using normal 'in use' dosing conditions (10 mg/cm2). In addition, we examined the effect of partially occluding the application site on the penetration of TTO components. Our data showed that only a small quantity of TTO components, 1.1-1.9% and 2-4% of the applied amount following application of a 20% TTO solution and pure TTO, respectively, penetrated into or through human epidermis. The largest TTO component penetrating the skin was terpinen-4-ol. Following partial occlusion of the application site, the penetration of terpinen-4-ol increased to approximately 7% of the applied TTO. Measurement of the rate of evaporation of tea tree oil from filter paper (7.4 mg/cm2) showed that 98% of the oil evaporated in 4 hours. Overall, it is apparent that the penetration of TTO components through human skin is limited.

  20. Is the Higgs boson composed of neutrinos?

    DOE PAGES

    Krog, Jens; Hill, Christopher T.

    2015-11-09

    We show that conventional Higgs compositeness conditions can be achieved by the running of large Higgs-Yukawa couplings involving right-handed neutrinos that become active at ~1013–1014 GeV. Together with a somewhat enhanced quartic coupling arising by a Higgs portal interaction to a dark matter sector, we can obtain a Higgs boson composed of neutrinos. Furthermore, this is a “next-to-minimal” dynamical electroweak symmetry breaking scheme.

  1. Concepts and Applications of Composable FORCEnet

    DTIC Science & Technology

    2005-12-01

    2080 WSEAS TRANS. on INFORMATION SCIENCE & APPLICATIONS Issue 12. Volume 2. December 2005 ISSN: 1790-0832 Concepts and Applications of Composable...STATEMENT A Approved for Public Release Distribution Unlimited 20060926075 WSEAS TRANS. on INFORMATION SCIENCE & APPLICATIONS Issue 12. Volume 2, December...information from one system or network to an- automatic insertion of content. The project team connects these data sources, views, and agents 2082 WSEAS

  2. Is the Higgs boson composed of neutrinos?

    SciTech Connect

    Krog, Jens; Hill, Christopher T.

    2015-11-09

    We show that conventional Higgs compositeness conditions can be achieved by the running of large Higgs-Yukawa couplings involving right-handed neutrinos that become active at ~1013–1014 GeV. Together with a somewhat enhanced quartic coupling arising by a Higgs portal interaction to a dark matter sector, we can obtain a Higgs boson composed of neutrinos. Furthermore, this is a “next-to-minimal” dynamical electroweak symmetry breaking scheme.

  3. Understanding low-lipid algae hydrothermal liquefaction characteristics and pathways through hydrothermal liquefaction of algal major components: crude polysaccharides, crude proteins and their binary mixtures.

    PubMed

    Yang, Wenchao; Li, Xianguo; Li, Zihui; Tong, Chenhong; Feng, Lijuan

    2015-11-01

    Crude polysaccharides and proteins extracted from algae were chosen as model materials to investigate the hydrothermal liquefaction (HTL) characteristics and pathways of low-lipid algae. Liquefaction behavior of the two individuals and their binary mixtures with different mass ratios were evaluated under different temperatures. Formation pathways of bio-oil from crude polysaccharides/proteins were proposed. Results showed that polysaccharides had a small contribution to bio-oil (<5%) and approximately 60% distributed in aqueous phase, while proteins played a crucial role on bio-oil formation (maximum 16.29%). Bio-oil from polysaccharides mainly contained cyclic ketones and phenols and from proteins composed of pyrazines, pyrroles and amines. Interaction between polysaccharides and proteins forming polycyclic nitrogenous compounds had a negative effect on bio-oil yield at 220 and 260°C. However, their further decomposition caused increase of bio-oil yield at 300°C. Mixture liquefaction obtained the highest higher heating value (HHV) of bio-oil and energy recovery than polysaccharides/proteins liquefaction at 300°C.

  4. Immunohistochemistry of ß 1,4-glucanase, the major enzymatic component of glassy-winged sharpshooter saliva, in probed grape petioles

    USDA-ARS?s Scientific Manuscript database

    The purpose of this project is to determine whether ß 1, 4-glucanase (EGase), the major enzyme in the saliva of glassy-winged sharpshooter (GWSS), co-localizes with the few ‘pioneer’ Xylella fastidiosa (Xf) cells that are inoculated into a plant by this vector. If it does, then this suggests that ve...

  5. Q&A: The AI composer

    NASA Astrophysics Data System (ADS)

    Spinney, Laura

    2017-09-01

    Computer scientist Luc Steels uses artificial intelligence to explore the origins and evolution of language. He is best known for his 1999-2001 Talking Heads Experiment, in which robots had to construct a language from scratch to communicate with each other. Now Steels, who works at the Free University of Brussels (VUB), has composed an opera based on the legend of Faust, with a twenty-first-century twist. He talks about Mozart as a nascent computer programmer, how music maps onto language, and the blurred boundaries of a digitized world.

  6. Simultaneous quantification of nine major active components in traditional Chinese prescription Mahuang decoction and the influence of herbal compatibility on their contents

    PubMed Central

    He, Yu; Zhu, Ying; Zhang, Ruping; Ge, Lijun; Wan, Haitong

    2014-01-01

    Background: Mahuang decoction (MHD), a famous classic traditional Chinese formula, has been extensively applied for treating cold, influenza, asthma, acute bronchitis, and other pulmonary diseases. However, the interaction among four drugs of MHD has not been clearly deciphered from the aspect of molecular composition. Objective: To assess the quality of MHD and explore the interplay among different prescription drugs. Materials and Methods: A reversed-phase high performance liquid chromatography (RP-HPLC) coupled with diode array detector (DAD) method for the simultaneous separation and determination of nine bioactive components was developed. A somatomedin A (SMA)-phenyl column (4.6 mm × 250 mm, 5 μm) was eluted by a gradient mobile phase contained acetonitrile and 0.05% formic acid-0.05% triethylamine aqueous solution. Four detection wavelengths (210, 252, 278, and 291 nm) were utilized for the quantitative analysis due to the different ultraviolet (UV) spectra of these compounds. Results: Satisfactory separation was obtained for all the components, and the assay was fully validated in respects of linearity, precision, stability, and accuracy. It was found that the calibration curves for all analytes showed good linearity (R2≥ 0.9991) within the test ranges. The relative standard deviations (RSDs) for intra- and interday repeatability were not more than 1.70 and 2.66%, respectively. The spike recoveries of nine components varied from 97.50 ± 1.69 to 99.27 ± 1.37%. Conclusion: The established method was successfully applied to analyze nine active compounds in decoction samples of various drug compatibilities of MHD. The variations of contents were obvious for different combinations, which hinted the mutual promotion or inhibition of componential dissolution among four herbs of MHD. PMID:24914312

  7. Leukodepleted blood components do not remove the potential for long-term transfusion-associated microchimerism in Australian major trauma patients

    PubMed Central

    Hirani, Rena; Balogh, Zsolt J; Lott, Natalie J; Hsu, Jeremy M; Irving, David O

    2014-01-01

    Despite the introduction of leukodepleted blood components, it has been shown that donor leukocyte engraftment (microchimerism) remains a long-term consequence of red blood cell (RBC) transfusion. The incidence of microchimerism may be affected by international disparities in blood processing methods or variations in transfusion practices. This study was conducted to determine the prevalence of microchimerism in Australian trauma patients. A secondary aim was to examine whether any patient complications correlated to the incidence of microchimerism. Australian trauma patients (n = 86) who had been transfused with red blood cell (RBC) units between 2000 and 2012 with an injury severity score (ISS) of greater than 15 were recruited. The prevalence of microchimerism was determined using genetic screening with a panel of insertion/deletion biallelic polymorphisms. The mean storage age of the transfused RBC units was 20 ± 8 days and the mean length of stay (LOS) in hospital was 40 ± 39 days. There were no significant associations in this study sample to bias for patient age, gender, number of transfused RBC units or ISS. Nine of the 55 (16.3%) patients transfused with non-leukodepleted blood components displayed an incidence of microchimerism. Of the 31 patients transfused with leukodepleted RBC units, 3 (9.6%) displayed an incidence of microchimerism. Therefore, despite the universal introduction of leukodepleted blood components in Australia, the prevalence of transfusion-associated microchimerism was found to be unchanged. Furthermore, half of the patients exhibiting microchimerism were recorded to have had splenic injury or required splenectomy at the time of transfusion. PMID:26252809

  8. Leukodepleted blood components do not remove the potential for long-term transfusion-associated microchimerism in Australian major trauma patients.

    PubMed

    Hirani, Rena; Balogh, Zsolt J; Lott, Natalie J; Hsu, Jeremy M; Irving, David O

    2014-01-01

    Despite the introduction of leukodepleted blood components, it has been shown that donor leukocyte engraftment (microchimerism) remains a long-term consequence of red blood cell (RBC) transfusion. The incidence of microchimerism may be affected by international disparities in blood processing methods or variations in transfusion practices. This study was conducted to determine the prevalence of microchimerism in Australian trauma patients. A secondary aim was to examine whether any patient complications correlated to the incidence of microchimerism. Australian trauma patients (n = 86) who had been transfused with red blood cell (RBC) units between 2000 and 2012 with an injury severity score (ISS) of greater than 15 were recruited. The prevalence of microchimerism was determined using genetic screening with a panel of insertion/deletion biallelic polymorphisms. The mean storage age of the transfused RBC units was 20 ± 8 days and the mean length of stay (LOS) in hospital was 40 ± 39 days. There were no significant associations in this study sample to bias for patient age, gender, number of transfused RBC units or ISS. Nine of the 55 (16.3%) patients transfused with non-leukodepleted blood components displayed an incidence of microchimerism. Of the 31 patients transfused with leukodepleted RBC units, 3 (9.6%) displayed an incidence of microchimerism. Therefore, despite the universal introduction of leukodepleted blood components in Australia, the prevalence of transfusion-associated microchimerism was found to be unchanged. Furthermore, half of the patients exhibiting microchimerism were recorded to have had splenic injury or required splenectomy at the time of transfusion.

  9. Epithermal neutron activation, radiometric, correlation and principal component analysis applied to the distribution of major and trace elements in some igneous and metamorphic rocks from Romania.

    PubMed

    Cristache, C I; Duliu, O G; Culicov, O A; Frontasyeva, M V; Ricman, C; Toma, M

    2009-05-01

    Six major (Na, Al, K, Ca, Ti, Fe) and 28 trace (Sc, Cr, V, Mn, Co, Zn, Cu, As, Br, Sr, Rb, Zr, Mo, Sn, Sb, Ba, Cs, La, Ce, Nd, Eu, Sm, Tb, Hf, Ta, W, Th and U) elements were determined by epithermal neutron activation analysis (ENAA) in nine Meridional Carpathian and Macin Mountains samples of igneous and metamorphic rocks. Correlation and principal factor analysis were used to interpret data while natural radionuclides radiometry shows a good correlation with ENAA results.

  10. [Deletion of spiramycin 3-O-acyltransferase gene from Streptomyces spiramyceticus F21 resulting in the production of spiramycin I as major component].

    PubMed

    Wu, Lin-Zhuan; Ma, Chun-Yan; Wang, Yi-Guang; Dai, Jian-Lu; Li, Jing-Yan; Xia, Huan-Zhang

    2007-07-01

    Spiramycin (SP) belongs to the 16-member macrolide antibiotics. It contains three components,namely SP I, SP II and SP III, which differ structurally in the acylation moieties on the C3 of the lactone. The SP I component contains a hydroxyl group at C3. SP II, and SP III are formed by further acetylation or propionylation of the C3 of SP I, by the same 3-O-acyltransferase (3-O-AT) . The study focused on simplifying spiramycin components. Theoretically, disruption/deletion of the 3-O-AT gene will reduce/stop the acylation of SP I to SP II and SP III. In this study, degenerated primers were designed according to the conserved regions of 3-O-acyltransferase, MdmB and AcyA in the medicamycin and carbomycin producers of S. mycarofaciens and S. thermotolerans, respectively, and an 878bp DNA fragment was amplified from the spiramycin-producer of S. spiramyceticus F21. Blast analysis of the 878bp DNA fragment suggested that it encoded the 3-O-acyltransferase (3-0-AT, sspA) gene for spiramycin biosynthesis. The flanking regions of this 878bp DNA fragment were then amplified by single-oligonucleotide-nested PCR, and a total of 4.3 kb DNA was obtained (3457nt among the 4.3kb fragment was sequenced, and deposited in GenBank DQ642742),covering the whole putative 3-O-acyltransferase gene, sspA. The sspA was then deleted from the S. spiramyceticus F21 genome by double cross-over homologous recombination, mediated by temperature-sensitive plasmid pKC1139. A comparison was done of the components of spiramycins produced by the sspA-deleted mutant strain with that of the parent strain by HPLC analysis, which showed that sspA-deleted mutant produced SP I (72%), SP II (18%), and SP III (9.6%), whereas parent strain produced SP I (7.8%), SP II (67%), and SP III (25%), respectively, demonstrating the role of ssp A in the acylation of SP I into SP II and SP III. The ssp A-deleted mutant strain obtained in this study may be used for the production of SP I, or may serve as a good starter

  11. Anti-herpes simplex virus effects of berberine from Coptidis rhizoma, a major component of a Chinese herbal medicine, Ching-Wei-San.

    PubMed

    Chin, Lengsu William; Cheng, Yu-Wen; Lin, Shih-Shen; Lai, Ya-Yun; Lin, Long-Yau; Chou, Ming-Yung; Chou, Ming-Chih; Yang, Chi-Chiang

    2010-12-01

    Berberine is an alkaloid extracted from Coptidis rhizome. Among the individual herbal components of a Chinese herb medicine, Ching-Wei-San, Coptidis Rhizoma has the most potent antimicrobial activity. By high-pressure liquid chromatography, the quantitative analysis of berberine from 6.25-mg/mL (w/v) Coptidis rhizome extract or 50.00-mg/mL (w/v) Ching-Wei-San was determined to be 0.26 mg/mL. To explore the potential use of Ching-Wei-San against herpes simplex virus (HSV) infection, the cytotoxicity, anti-HSV-1 and anti-HSV-2 activity in Vero cells were assayed. The selectivity index of berberine was about 1.2-1.5 times higher than that of Coptidis rhizome extract and Ching-Wei-San. Moreover, the antiviral activities correspond to the content of berberine in the aqueous solution. Berberine may interfere with the viral replication cycle after virus penetration and no later than the viral DNA synthesis step, and its activities were not affected by the preparation processes. Berberine, the natural plants that contain this component, including Coptidis rhizome, and Ching-Wei-San have all shown anti-HSV effects.

  12. Green tea and its major components ameliorate immune dysfunction in mice bearing Lewis lung carcinoma and treated with the carcinogen NNK.

    PubMed

    Zhu, M; Gong, Y; Yang, Z; Ge, G; Han, C; Chen, J

    1999-01-01

    The protective effects of tea and/or its components on dysfunction of immune functions during tumor growth and carcinogenesis in mice were studied using two experimental models: C57/BL6J mice transplanted with Lewis lung carcinoma (LLC) and Kunming mice treated with a single dose of 4-(methylnitrosamino-)-1-(3-pyridyl)-1-butanone (NNK). In C57/BL6J mice bearing LLC, the weight of the thymus decreased, the proportion of CD4(+)-positive T lymphocytes and the ratio of CD4+ to CD8+ decreased, luminol-enhanced chemiluminescence of white blood cells in peripheral blood stimulated by zymosan increased, and plaque-forming cells (PFC) decreased. However, in LLC-bearing mice given green tea as drinking water, all immune functions were improved, along with inhibition of tumor growth. In Kunming mice treated with NNK, during the four weeks of observation, their immunologic indicators, such as phagocytosis of macrophages in the abdominal cavity, luminol-enhanced chemiluminescence of white blood cells, plaque-forming cells, and delayed-type hypersensitivity, increased or decreased to various extents compared with normal controls. However, these changes were significantly prevented in the mice given green tea, mixed tea, or tea polyphenol as drinking water. In conclusion, tea and its components ameliorated immune dysfunction in mice bearing LLC or treated with the carcinogen NNK.

  13. Evaluation of embryotoxicity for major components of herbal extracts using the chick embryonic heart micromass and mouse D3 embryonic stem cell systems.

    PubMed

    Mohammed, Omar J; Latif, Muhammad Liaque; Pratten, Margaret K

    2016-01-01

    Herbal remedies are often used during the early stages of pregnancy, being considered 'harmless' and 'natural'. There are insufficient data regarding their potential embryotoxicity. The main components of selected herbs, including 6-gingerol from ginger, Ginkgolide A and Ginkgolide B from gingko biloba and Ginsenoside Rg1 from ginseng, have been investigated using chick embryonic heart micromass and Mouse D3 embryonic stem cells. The potential effects were evaluated via alteration in contractility, cell viability, and cell protein content. The myocytes in both systems were also demonstrated by immunocytochemistry using a specific cardiomyocyte marker (α-actinin). For 6-gingerol, Ginkgolide A, Ginkgolide B and Ginsenoside Rg1 in both methods, at moderate to high concentrations, there were alterations in the values for the endpoints. These data indicate that herbal remedies used in the first trimester of pregnancy might not be safe for fetal development.

  14. Soluble components of the flagellar export apparatus, FliI, FliJ, and FliH, do not deliver flagellin, the major filament protein, from the cytosol to the export gate.

    PubMed

    Sajó, Ráchel; Liliom, Károly; Muskotál, Adél; Klein, Agnes; Závodszky, Péter; Vonderviszt, Ferenc; Dobó, József

    2014-11-01

    Flagella, the locomotion organelles of bacteria, extend from the cytoplasm to the cell exterior. External flagellar proteins are synthesized in the cytoplasm and exported by the flagellar type III secretion system. Soluble components of the flagellar export apparatus, FliI, FliH, and FliJ, have been implicated to carry late export substrates in complex with their cognate chaperones from the cytoplasm to the export gate. The importance of the soluble components in the delivery of the three minor late substrates FlgK, FlgL (hook-filament junction) and FliD (filament-cap) has been convincingly demonstrated, but their role in the transport of the major filament component flagellin (FliC) is still unclear. We have used continuous ATPase activity measurements and quartz crystal microbalance (QCM) studies to characterize interactions between the soluble export components and flagellin or the FliC:FliS substrate-chaperone complex. As controls, interactions between soluble export component pairs were characterized providing Kd values. FliC or FliC:FliS did not influence the ATPase activity of FliI alone or in complex with FliH and/or FliJ suggesting lack of interaction in solution. Immobilized FliI, FliH, or FliJ did not interact with FliC or FliC:FliS detected by QCM. The lack of interaction in the fluid phase between FliC or FliC:FliS and the soluble export components, in particular with the ATPase FliI, suggests that cells use different mechanisms for the export of late minor substrates, and the major substrate, FliC. It seems that the abundantly produced flagellin does not require the assistance of the soluble export components to efficiently reach the export gate.

  15. Geochemistry of the Phlegraean Fields (Italy) proximal sources for major Mediterranean tephras: Implications for the dispersal of Plinian and co-ignimbritic components of explosive eruptions

    NASA Astrophysics Data System (ADS)

    Tomlinson, Emma L.; Arienzo, Ilenia; Civetta, Lucia; Wulf, Sabine; Smith, Victoria C.; Hardiman, Mark; Lane, Christine S.; Carandente, Antonio; Orsi, Giovanni; Rosi, Mauro; Müller, Wolfgang; Menzies, Martin A.

    2012-09-01

    Volcanic activity at Phlegraean Fields, Italy, produced several major marker tephras over a 50 ka period. The caldera forming eruptions of the Campanian Ignimbrite (CI) and Neapolitan Yellow Tuff (NYT) are of particular importance for tephrostratigraphy in Europe. Other key eruptions from this source include the Pomici Principali (PP) and the Tufi Biancastri eruptions. We combine analyses of fresh glasses from proximal locations (i.e., juvenile clasts in proximal flow and fall deposits) with data for key tephra layers from Lago Grande di Monticchio, 120 km to the east. The micron-beam major (EMPA) and trace (LA-ICP-MS) element glass dataset allows us to: (a) distinguish between tephra units produced from the Phlegraean Fields before and during the CI eruption (CI-series), and before and during the NYT and PP eruptions (NYT-series/PP); (b) discriminate between the CI and the geochemically similar Pre-CI pyroclastic deposits; (c) separate the NYT from Pre-NYT tephra units, although both major and trace elements do show significant overlap. The complex compositional overlap between Pre-NYT tephras may present a problem for tephra correlations in the 14-39 ka time window and may have resulted in incorrect proximal-distal and distal-distal correlations. The diagnostic chemical criteria detailed herein permits more accurate matching of distal tephras with their proximal equivalents and hence will improve chronostratigraphy of distal settings and give insight into tephra dispersal. We show that the dispersal of PP tephra was more limited than previously thought. The surge/fall (Lower Member) and subsequent pyroclastic density current (Upper Member) phases of the NYT eruption can be recognised in distal settings. Both the NYT Lower and Upper Members are found in distal localities to the east of the Phlegraean Fields, however the Lower Member is found in the absence of the Upper Member in locations to the far north of Phlegraean Fields. Chemical compositions of the Plinian

  16. Contact toxicity, feeding reduction, and repellency of essential oils from three plants from the ginger family (Zingiberaceae) and their major components against Sitophilus zeamais and Tribolium castaneum.

    PubMed

    Suthisut, Duangsamorn; Fields, Paul G; Chandrapatya, Angsumarn

    2011-08-01

    The essential oils from rhizomes of Alpinia conchigera Griff, Zingiber zerumbet Smitt, Curcuma zedoaria (Berg.) Roscoe; their major compounds (camphene, camphor, 1,8-cineole, alpha-humulene, isoborneol, alpha-pinene, beta-pinene and terpinen-4-ol); and synthetic essential oils comprised of mixtures of major pure compounds in the same ratios as the extracted essential oils were tested for contact, feeding reduction, and repellency against Sitophilus zeamais Motschulsky and Tribolium castaneum (Herbst) adults. Via topical applications, the three extracted oils had similar toxicity against S. zeamais (LD50 fiducial limits: 18-24 microg oil/mg insect). T. castaneum had similar sensitivity to all three oils (35-58 microg/mg), and it was less sensitive than S. zeamais. The LD50 values of synthetic A. conchigera and synthetic Z. zerumbet oils were similar to those of their corresponding extracted essential oils. The synthetic C. zedoaria oils showed lower contact toxicity than the extracted C. zedoaria oils to both insects. Sitophilus zeamais and T. castaneum were sensitive to terpinen-4-ol and isoborneol in contact toxicity tests. In antifeedant tests, the three extracted oils were able to decrease the consumption of flour disks, especially Z. zerumbet oils, whereas both insect species could feed on the flour disks treated with three synthetic essential oils. Only terpinen-4-ol deterred feeding in both insects. In repellency tests, A. conchigera oils at highest concentration repelled S. zeamais and T. castaneum. None of the synthetic essential oils repelled S. zeamais (315 microl/cm2) and T. castaneum (31 microl/cm2) Only terpinen-4-ol showed repellent activity against both insects.

  17. Influence of non-dietary factors on the prevalence of abdominal obesity as a major component of the metabolic syndrome among 17-18-year-old youth.

    PubMed

    Piotrowska, Ewa; Broniecka, Anna; Biernat, Jadwiga; Wyka, Joanna; Bronkowska, Monika

    2015-01-01

    Youth nutrition and their nutritional status are conditioned by many factors, some of the main ones being: economic, social, climatic, cultural, and psychological factors as well as nutritional knowledge. With the growing problem of overweight and obesity among children and young people, the incidence of the metabolic syndrome is also increasing. The aim of the study was to assess the impact of demographic, sociological and psychological factors on the incidence of obesity among 17-18-year-old adolescents from Wroclaw and vicinity as a major risk factor for the development of the metabolic syndrome. The study was conducted in three upper-secondary schools in Wroclaw, Poland. In the surveyed group (17-18 years old, n = 269) girls accounted for 59.5% and boys constituted 40.5%. Majority of young people were Wroclaw citizens (72.9%). Centile charts elaborated by the Children's Memorial Health Institute were adopted for the evaluation of anthropometric parameters. Evaluation of the impact of non-dietary factors on the manner of nutrition was carried out using own questionnaire. Based on the tests, abdominal obesity was determined among 34.5% of adolescents aged 17 years and among 65.5% of these aged 18 years. Obesity was more common in girls carrying genetic burden of the disease. Youth with the largest waist circumference most often declared to use slimming diets - 6.7%, and the lowest hunger sensation in stress - 3.4%. In addition, 30.5% of the adolescents with the smallest waist circumference and 11.5% with the largest waist circumference declared to be non-smoking. Occasional alcohol consumption was declared by 30.1% of young people with the smallest waist circumference, and 13.4% with the largest waist circumference. Youth with abdominal obesity significantly more likely than those with normal waist circumference applied slimming diets. Significant impact on the formation of abdominal obesity among girls had inherited disease burden.

  18. Pre-aged soil organic carbon as a major component of the Yellow River suspended load: Regional significance and global relevance

    NASA Astrophysics Data System (ADS)

    Tao, Shuqin; Eglinton, Timothy I.; Montluçon, Daniel B.; McIntyre, Cameron; Zhao, Meixun

    2015-03-01

    Large rivers connect the continents and the oceans, and corresponding material fluxes have a global impact on marine biogeochemistry. The Yellow River transports vast quantities of suspended sediments to the ocean, yet the nature of the particulate organic carbon (POC) carried by this system is not well known. The focus of this study is to characterize the sources, composition and age of suspended POC collected near the terminus of this river system, focusing on the abundance and carbon isotopic composition (13C and 14C) of specific biomarkers. The concentrations of vascular plant wax lipids (long-chain (≥C24) n-alkanes, n-fatty acids) and POC co-varied with total suspended solid (TSS) concentrations, indicating that both were controlled by the overall terrestrial sediment flux. POC exhibited relatively uniform δ13C values (-23.8 to -24.2‰), and old radiocarbon ages (4000-4640 yr). However, different biomarkers exhibited a wide range of 14C ages. Short-chain (C16, C18) fatty acid 14C ages were variable but generally the youngest organic components (from 502 yr to modern), suggesting they reflect recently biosynthesized material. Lignin phenol 14C ages were also variable and relatively young (1070 yr to modern), suggesting rapid export of carbon from terrestrial primary production. In contrast, long-chain plant wax lipids display relatively uniform and significantly older 14C ages (1500-1800 yr), likely reflecting inputs of pre-aged, mineral-associated soil OC from the Yellow River drainage basin. Even-carbon-numbered n-alkanes yielded the oldest 14C ages (up to 26 000 yr), revealing the presence of fossil (petrogenic) OC. Two isotopic mass balance approaches were explored to quantitively apportion different OC sources in Yellow River suspended sediments. Results indicate that the dominant component of POC (53-57%) is substantially pre-aged (1510-1770 yr), and likely sourced from the extensive loess-paleosol deposits outcropping within the drainage basin. Of

  19. Effect of low temperature on flavonoids, oxygen radical absorbance capacity values and major components of winter sweet spinach (Spinacia oleracea L.).

    PubMed

    Watanabe, Mitsuru; Ayugase, Jun

    2015-08-15

    Winter sweet treatment (WST) has been established for cultivating high-quality leafy vegetables during the winter. Although it is known that chilling stress during cold acclimation induces oxidative damage by reactive oxygen species in plant tissues, knowledge about changes in antioxidant activity and compounds during WST in spinach is superficial. We investigated changes in flavonoids, total ascorbic acid, carotenoids and hydrophilic oxygen radical absorbance capacity (H-ORAC) along with components in three spinach varieties during low-temperature treatment by exposure to cold air in winter. The H-ORAC values increased substantially together with total flavonoids and total ascorbic acid concentration. In addition, WST increased mono- and diglucosylated flavonoid derivatives with an ortho-dihydroxy (catechol) structure of lower molecular weight in spinach. These results suggest that WST contributes to the prevention of low-temperature-induced oxidative damage by increasing the level of antioxidant compounds, thereby improving antioxidant activity. Although sucrose concentrations were increased by WST, nitrate and oxalate concentrations did not increase in any variety. WST can contribute to the increase in antioxidant compounds such as flavonoids and ascorbic acids, antioxidant activity and sucrose without increasing in nitrate and oxalate of spinach. © 2014 Society of Chemical Industry.

  20. Quantitative proteomic analysis of Vietnamese krait venoms: Neurotoxins are the major components in Bungarus multicinctus and phospholipases A2 in Bungarus fasciatus.

    PubMed

    Ziganshin, Rustam H; Kovalchuk, Sergey I; Arapidi, Georgij P; Starkov, Vladislav G; Hoang, Anh Ngoc; Thi Nguyen, Thao Thanh; Nguyen, Khoa Cuu; Shoibonov, Batozhab B; Tsetlin, Victor I; Utkin, Yuri N

    2015-12-01

    Kraits are venomous snakes of genus Bungarus from family Elapidae. Krait venoms are generally neurotoxic, but toxicity strongly depends on the particular species and regional origin of snakes. We analyzed the proteomes of Vietnamese Bungarus multicinctus and Bungarus fasciatus venoms both qualitatively and quantitatively. It should be noted that no proteomic data for B. multicinctus venom existed so far. We have found that in this venom, almost half (45%) of the proteins by weight was represented by β-bungarotoxins, followed by three finger toxins (28%) and phospholipases A2 (16%), other proteins being present at the level of 1-3%. In B. fasciatus venom, phospholipase A2 was the main component (71%), followed by oxidase of l-amino acids (8%), acetylcholinesterase (5%) and metalloproteinases (4%). Unexpectedly, extremely low amount of three finger toxins (1%) was found in this venom. Interestingly, the presence of complement depleting factor was observed in both venoms. Although our data showed the presence of the same toxin families in Vietnamese krait venoms as those found earlier in the venoms of kraits from other geographic regions, their relative ratio is completely different. This concerns especially B. fasciatus venom with predominant content of phospholipases A2 and very low amount of three finger toxins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Impacts of daytime nitrous acid source on O3 budget and concentrations of O3 and major aerosol components in the coastal regions of China

    NASA Astrophysics Data System (ADS)

    Tang, Yu Jia; Xian Liu, Bao; Li, Yun Ting; Wang, Qin; Zhang, Da Wei; Zhang, Meng; Du, Hui

    2017-04-01

    37 field experiment data from 13 different field campaigns across the globe are used to express the unknown daytime HONO source (Punknown) as a function of NO2 mixing ratios and J(NO2): . Then the Punknown is added into the WRF-Chem model. Elevated daytime-mean Punknown values are found in the coastal regions of China, reaching 2.5 ppb h-1 in the Beijing-Tianjin-Heibei region, 2.0 ppb h-1 in the Yangtze River delta region, and 1.2 ppb h-1 in the Pearl River delta region. When the Punknown, HONO emissions and nighttime hydrolysis conversion of NO2 on aerosols are considered, daytime HONO is produced primarily via Punknown and the reaction of OH and NO, whereas, nighttime HONO is produced primarily via the nighttime hydrolysis conversion of NO2 on aerosols. Impacts of Punknown on O3 and major inorganic aerosols are evaluated in this study. Simulation results show that O3 budget and monthly/hourly mean concentrations of O3、NO3-、NH4+ and SO42- in the coastal regions of China are significantly increased when the Punknown is considered. Monthly daytime-mean of O3 production rates and loss rates are respectively increased by 0.80 2.95 ppb h-1 (30 115%) and 0.03 0.21 ppb h-1 (8 32%); monthly averaged daily maximum 8-h O3 concentrations is increased by 1.90 7.24 ppb (2 10%); daily maximum 1-h surface O3 concentrations is increased by 9.00 35.00 ppb in major cities; monthly mean concentrations of NO3-、NH4+ and SO42- are increased by 0.01 5.64 μg m-3 (1 23%)、0.14 1.28 μg m-3 (2 20%) and 0.72 2.54 μg m-3 (9 22%), respectively, in the coastal regions of China.

  2. Reassessment of the Listeria monocytogenes pan-genome reveals dynamic integration hotspots and mobile genetic elements as major components of the accessory genome

    PubMed Central

    2013-01-01

    Background Listeria monocytogenes is an important food-borne pathogen and model organism for host-pathogen interaction, thus representing an invaluable target considering research on the forces governing the evolution of such microbes. The diversity of this species has not been exhaustively explored yet, as previous efforts have focused on analyses of serotypes primarily implicated in human listeriosis. We conducted complete genome sequencing of 11 strains employing 454 GS FLX technology, thereby achieving full coverage of all serotypes including the first complete strains of serotypes 1/2b, 3c, 3b, 4c, 4d, and 4e. These were comparatively analyzed in conjunction with publicly available data and assessed for pathogenicity in the Galleria mellonella insect model. Results The species pan-genome of L. monocytogenes is highly stable but open, suggesting an ability to adapt to new niches by generating or including new genetic information. The majority of gene-scale differences represented by the accessory genome resulted from nine hyper variable hotspots, a similar number of different prophages, three transposons (Tn916, Tn554, IS3-like), and two mobilizable islands. Only a subset of strains showed CRISPR/Cas bacteriophage resistance systems of different subtypes, suggesting a supplementary function in maintenance of chromosomal stability. Multiple phylogenetic branches of the genus Listeria imply long common histories of strains of each lineage as revealed by a SNP-based core genome tree highlighting the impact of small mutations for the evolution of species L. monocytogenes. Frequent loss or truncation of genes described to be vital for virulence or pathogenicity was confirmed as a recurring pattern, especially for strains belonging to lineages III and II. New candidate genes implicated in virulence function were predicted based on functional domains and phylogenetic distribution. A comparative analysis of small regulatory RNA candidates supports observations of a

  3. An Ultra-Depleted Mantle Component in the Ontong Java Plateau Revealed by Major, Trace and Volatile Element Abundances in Olivine-Hosted Melt Inclusions

    NASA Astrophysics Data System (ADS)

    Jackson, M. G.; Cabral, R. A.; Rose-Koga, E. F.; Koga, K. T.; Price, A. A.; Hauri, E. H.; Michael, P. J.

    2014-12-01

    The Ontong Java Plateau (OJP) represents the most voluminous large igneous province (LIP) preserved in the geologic record. The most voluminous volcanic stages of the OJP—the Kroenke and Kwaimbaita stages, which dominate the accessible portions of the plateau—have relatively flat primitive mantle normalized rare earth element (REE) patterns, or spidergrams. With the exception of relatively small volumes of late-stage melts—referred to as the Singgalo stage—that are characterized by slightly enriched REE spidergrams, the volcanic stages that dominated the eruptive history of the OJP exhibit remarkably homogeneous, flat REE patterns. Here we isolate, for the first time, olivine-hosted melt inclusions from OJP. We show that the melt inclusions have two clear populations defined by having distinct trace element characteristics. The first population has relatively flat trace element patterns that are similar to that observed in whole rock lavas from the most voluminous volcanic stages (Kroenke and Kwaimbaita stages) recorded in the OJP. In contrast, a second group of melt inclusions, referred to as UDM (ultra-depleted melt) inclusions, exhibit strikingly depleted REE spidergrams; these trace element patterns are far more depleted than any previously reported lava from OJP. The UDM have unique trace element signatures that preclude an origin by assimilation of hydrothermally-altered oceanic crust or re-melting the depleted mantle source left over after melt extraction during construction of the OJP. We interpret the new UDM compositions to be the result of melting of a previously unrecognized ultra-depleted component hosted in the OJP mantle source.

  4. A Shift to Melted Sea Ice From Runoff as the Major Component of Chukchi Shelf Open Water Freshwater Fractions, 1993-2013

    NASA Astrophysics Data System (ADS)

    Cooper, L. W.; Frey, K. E.; Logvinova, C. L.; Biasatti, D. M.; Grebmeier, J. M.

    2014-12-01

    The freshwater fraction of water that is derived from melted sea ice has increased significantly on the Chukchi shelf relative to runoff within the past decade, based upon analysis of salinity and δ18O mixing lines from a number of research cruises from 1993-2013. The shift to summertime dominance of melted sea ice (freshwater end-member δ18O >-10 per mil) relative to runoff occurred within the past ten years with a transition primarily observed from runoff dominance to sea ice melt after 2004. This shift is localized to the Chukchi shelf and does not reflect large amounts of melted sea ice flowing north through Bering Strait, which still largely transports a freshwater component with runoff origins (freshwater end-member δ18O ~-20 per mil). These observations have implications for understanding high latitude shelf biogeochemical cycling as melted sea ice carries much lower fractions of dissolved organic carbon (DOC) than runoff, allowing for greater light penetration, including through melt ponds in sea ice, and potential changes in productivity. Lower alkalinity and buffering capacity in melted sea ice compared to runoff will also increase the vulnerability of shelf organisms to water column acidification. Melted sea ice, with low DOC relative to runoff can dominate the freshwater budget in Chukchi shelf waters even under apparently continuous ice coverage. The higher transmission of light through melted sea ice with low DOC may be in part responsible for recent reported under-ice blooms on the Chukchi shelf. Since these blooms occur in waters with the freshwater budget dominated by melted sea ice, they can reasonably interpreted as being part of a continuum with other ice melt-associated blooms and not independent of sea ice retreat and dissolution.

  5. Mono-Substituted Isopropylated Triaryl Phosphate, a Major Component of Firemaster 550, is an AHR Agonist that Exhibits AHR-Independent Cardiotoxicity in Zebrafish

    PubMed Central

    Gerlach, Cory V.; Das, Siba R.; Volz, David C.; Bisson, William H.; Kolluri, Siva K.; Tanguay, Robert L.

    2014-01-01

    Firemaster 550 (FM550) is an additive flame retardant mixture used within polyurethane foam and is increasingly found in house dust and the environment due to leaching. Despite the widespread use of FM550, very few studies have investigated the potential toxicity of its ingredients during early vertebrate development. In the current study, we sought to specifically investigate mono-substituted isopropylated triaryl phosphate (mITP), a component comprising approximately 32% of FM550, which has been shown to cause cardiotoxicity during zebrafish embryogenesis. Previous research showed that developmental defects are rescued using an aryl hydrocarbon receptor (AHR) antagonist (CH223191), suggesting that mITP-induced toxicity was AHR-dependent. As zebrafish have three known AHR isoforms, we used a functional AHR2 knockout line along with AHR1A-and AHR1B-specific morpholinos to determine which AHR isoform, if any, mediates mITP-induced cardiotoxicity. As in silico structural homology modeling predicted that mITP may bind favorably to both AHR2 and AHR1B isoforms, we evaluated AHR involvement in vivo by measuring CYP1A mRNA and protein expression following exposure to mITP in the presence or absence of CH223191 or AHR-specific morpholinos. Based on these studies, we found that mITP interacts with both AHR2 and AHR1B isoforms to induce CYP1A expression. However, while CH223191 blocked mITP-induced CYP1A induction and cardiotoxicity, knockdown of all three AHR isoforms failed to block mITP-induced cardiotoxicity in the absence of detectable CYP1A induction. Overall, these results suggest that, while mITP is an AHR agonist, mITP causes AHR-independent cardiotoxicity through a pathway that is also antagonized by CH223191. PMID:24865613

  6. Mono-substituted isopropylated triaryl phosphate, a major component of Firemaster 550, is an AHR agonist that exhibits AHR-independent cardiotoxicity in zebrafish.

    PubMed

    Gerlach, Cory V; Das, Siba R; Volz, David C; Bisson, William H; Kolluri, Siva K; Tanguay, Robert L

    2014-09-01

    Firemaster 550 (FM550) is an additive flame retardant mixture used within polyurethane foam and is increasingly found in house dust and the environment due to leaching. Despite the widespread use of FM550, very few studies have investigated the potential toxicity of its ingredients during early vertebrate development. In the current study, we sought to specifically investigate mono-substituted isopropylated triaryl phosphate (mITP), a component comprising approximately 32% of FM550, which has been shown to cause cardiotoxicity during zebrafish embryogenesis. Previous research showed that developmental defects are rescued using an aryl hydrocarbon receptor (AHR) antagonist (CH223191), suggesting that mITP-induced toxicity was AHR-dependent. As zebrafish have three known AHR isoforms, we used a functional AHR2 knockout line along with AHR1A- and AHR1B-specific morpholinos to determine which AHR isoform, if any, mediates mITP-induced cardiotoxicity. As in silico structural homology modeling predicted that mITP may bind favorably to both AHR2 and AHR1B isoforms, we evaluated AHR involvement in vivo by measuring CYP1A mRNA and protein expression following exposure to mITP in the presence or absence of CH223191 or AHR-specific morpholinos. Based on these studies, we found that mITP interacts with both AHR2 and AHR1B isoforms to induce CYP1A expression. However, while CH223191 blocked mITP-induced CYP1A induction and cardiotoxicity, knockdown of all three AHR isoforms failed to block mITP-induced cardiotoxicity in the absence of detectable CYP1A induction. Overall, these results suggest that, while mITP is an AHR agonist, mITP causes AHR-independent cardiotoxicity through a pathway that is also antagonized by CH223191.

  7. The chromosomal order of genes controlling the major histocompatibility complex, properdin factor B, and deficiency of the second component of complement.

    PubMed Central

    Raum, D; Glass, D; Carpenter, C B; Alper, C A; Schur, P H

    1976-01-01

    The relationship of the genes coding for HLA to those coding for properdin Factor B allotypes and for deficiency of the second component of complement (C2) was studied in families of patients with connective tissue disorders. Patients were selected because they were heterozygous or homozygous for C2 deficiency. 12 families with 15 matings informative for C2 deficiency were found. Of 57 informative meioses, two crossovers were noted between the C2 deficiency gene and the HLA-B gene, with a recombinant fraction of 0.035. A lod score of 13 was calculated for linkage between C2 deficiency and HLA-B at a maximum likelihood value of the recombinant fraction of 0.04. 18 families with 21 informative matings for both properdin Factor B allotype and HLA-B were found. Of 72 informative meioses, three recombinants were found, giving a recombinant fraction of 0.042. A lod score of 16 between HLA-B and Factor B allotypes was calculated at a maximum likelihood value of the recombinant fraction of 0.04. A crossover was shown to have occurred between genes for Factor B and HLA-D, in which HLA-D segregared with HLA-A and B. These studies suggest that the genes for Factor B and C2 deficiency are located outside those for HLA, that the order of genese is HLA-A, -B, -D, Factor B allotype, C2 deficiency, that the genes coding for C2 deficiency and Factor B allotypes are approximately 3--5 centimorgans from the HLA-A and HLA-B loci, and that the apparent lack of recombinants between the Factor B gene and C2 deficiency gene suggests that these two genes lie in close proximity to one another. PMID:993342

  8. CD40–CD40 Ligand Pathway Is a Major Component of Acute Neuroinflammation and Contributes to Long-term Cognitive Dysfunction after Sepsis

    PubMed Central

    Michels, Monique; Danieslki, Lucinéia Gainski; Vieira, Andriele; Florentino, Drielly; Dall’Igna, Dhébora; Galant, Letícia; Sonai, Beatriz; Vuolo, Francieli; Mina, Franciele; Pescador, Bruna; Dominguini, Diogo; Barichello, Tatiana; Quevedo, João; Dal-Pizzol, Felipe; Petronilho, Fabrícia

    2015-01-01

    Sepsis-associated encephalopathy (SAE) is associated with an increased rate of morbidity and mortality. It is not understood what the exact mechanism is for the brain dysfunction that occurs in septic patients, but brain inflammation and oxidative stress are a possible theory. Such events can occur through the alteration of molecules that perpetuate the inflammatory response. Thus, it is possible to postulate that CD40 may be involved in this process. The aim of this work is to evaluate the role of CD40–CD40L pathway activation in brain dysfunction associated with sepsis in an animal model. Microglia activation induces the upregulation of CD40–CD40L, both in vitro and in vivo. The inhibition of microglia activation decreases levels of CD40–CD40L in the brain and decreases brain inflammation, oxidative damage and blood brain barrier dysfunction. Despite this, anti-CD40 treatment does not improve mortality in this model. However, it is able to improve long-term cognitive impairment in sepsis survivors. In conclusion, there is a major involvement of the CD40–CD40L signaling pathway in long-term brain dysfunction in an animal model of sepsis. PMID:25822797

  9. Evidence of idiotypic modulation in the immune response to gp43, the major antigenic component of Paracoccidioides brasiliensis in both mice and humans

    PubMed Central

    Souza, A R; Gesztesi, J -L; Moraes, J Z; Cruz, C R B; Sato, J; Mariano, M; Lopes, J D

    1998-01-01

    Paracoccidioidomycosis (PCM) is a systemic mycosis endemic in Latin America, with a high prevalence in Brazil, Argentina, Colombia and Venezuela. The aetiologic agent of disease is a thermal dimorphic fungus, Paracoccidioides brasiliensis. A glycoprotein of 43 000 D (gp43) is the major antigen of P. brasiliensis. Antibodies directed to this antigen are detected in the sera of all patients with PCM. Gp43 binds to laminin, thus participating in adhesion, invasion and pathogenesis of the fungus. As the role of antibodies in PCM is not fully understood, we decided to investigate the outcome of mice immunization with three distinct anti-gp43 MoAbs (17c, 8a and 24a) coupled with keyhole limpet haemocyanin (KLH). Results show not only the expected presence of anti-Id (AB2) antibodies in the sera of these animals but also a spontaneous and increasing amount of anti-anti-Id (AB3) antibodies after the third course of immunization. Hybridomas producing both AB2 and AB3 MoAbs were obtained using spleen cells from mice immunized with MoAb 17c. AB3 MoAbs were also obtained with spleen cells of mice immunized with MoAbs 8a and 24a. It was also shown that human PCM patients' sera with high titres of anti-gp43 antibodies generate anti-Id antibodies. These data suggest that the immune response to P. brasiliensis can be spontaneously modulated by the idiotypic network. PMID:9764601

  10. Purification, Crystallization and Preliminary X-ray Characterization of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

    SciTech Connect

    Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H.; Fu, Tong-Jen

    2008-08-04

    The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

  11. Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

    PubMed

    Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen

    2008-07-09

    The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

  12. Syrtis Major Hemisphere

    NASA Image and Video Library

    1998-06-03

    This mosaic of Syrtis Major is composed of about 100 red- and violet- filter NASA's Viking Orbiter images, digitally mosaiced in an orthographic projection at a scale of 1 km/pixel. http://photojournal.jpl.nasa.gov/catalog/PIA00092

  13. Diurnal variations of carbonaceous components, major ions, and stable carbon and nitrogen isotope ratios in suburban aerosols from northern vicinity of Beijing

    NASA Astrophysics Data System (ADS)

    He, Nannan; Kawamura, Kimitaka; Kanaya, Yugo; Wang, Zifa

    2015-12-01

    We report diurnal variations of organic carbon (OC), elemental carbon (EC), water-soluble organic carbon (WSOC) and major ions as well as stable carbon and nitrogen isotope ratios (δ13C and δ15N) in ambient aerosols at a suburban site (Mangshan), 40 km north of Beijing, China. We found that aerosol chemical compositions were largely controlled by the air mass transport from Beijing in daytime with southerly winds and by relatively fresh air mass in nighttime from the northern forest areas with northerly winds. Higher concentrations of aerosol mass and total carbon were obtained in daytime. Further, higher OC/EC ratios were recorded in daytime (4.0 ± 1.7) than nighttime (3.2 ± 0.7), suggesting that OC is formed by photochemical oxidation of gaseous precursors in daytime. Contributions of WSOC to OC were slightly higher in daytime (38%) than nighttime (34%), possibly due to secondary formation of WSOC in daytime. We also found higher concentrations of Ca2+ in daytime, which was originated from the construction dust in Beijing area and transported to the sampling site. δ13C ranged from -25.3 to -21.2‰ (ave. -23.5 ± 0.9‰) in daytime and -29.0 to -21.4‰ (-24.0 ± 1.5‰) in nighttime, suggesting that Mangshan aerosols were more influenced by fossil fuel combustion products in daytime and by terrestrial C3 plants in nighttime. This study suggests that daytime air mass delivery from megacity Beijing largely influence the air quality at the receptor site in the north together with photochemical processing of organic aerosols during the atmospheric transport, whereas the Mangshan site is covered with relatively clean air masses at night.

  14. The major components of particles emitted during recycling of waste printed circuit boards in a typical e-waste workshop of South China

    NASA Astrophysics Data System (ADS)

    Bi, Xinhui; Simoneit, Bernd R. T.; Wang, ZhenZhen; Wang, Xinming; Sheng, Guoying; Fu, Jiamo

    2010-11-01

    Electronic waste from across the world is dismantled and disposed of in China. The low-tech recycling methods have caused severe air pollution. Air particle samples from a typical workshop of South China engaged in recycling waste printed circuit boards have been analyzed with respect to chemical constituents. This is the first report on the chemical composition of particulate matter (PM) emitted in an e-waste recycling workshop of South China. The results show that the composition of PM from this recycling process was totally different from other emission sources. Organic matter comprised 46.7-51.6% of the PM. The major organic constituents were organophosphates consisting mainly of triphenyl phosphate (TPP) and its methyl substituted compounds, methyl esters of hexadecanoic and octadecanoic acids, levoglucosan and bisphenol A. TPP and bisphenol A were present at 1-5 orders of magnitude higher than in other indoor and outdoor environments throughout the world, which implies that they might be used as potential markers for e-waste recycling. The elemental carbon, inorganic elements and ions had a minor contribution to the PM (<5% each). The inorganic elements were dominated by phosphorus and followed by crustal elements and metal elements Pb, Zn, Sn, and lesser Cu, Sb, Mn, Ni, Ba and Cd. The recycling of printed circuit boards was demonstrated as an important contributor of heavy metal contamination, particularly Cd, Pb and Ni, to the local environment. These findings suggest that this recycling method represents a strong source of PM associated with pollutants to the ambient atmosphere of an e-waste recycling locale.

  15. Tissue distribution of six major bio-active components after oral administration of Zhenqi Fuzheng capsules to rats using ultra-pressure liquid chromatography-tandem mass spectrometry.

    PubMed

    Liu, Xiao-hua; Zhu, Rui-juan; Hu, Fang; Guo, Long; Yang, Ying-lai; Feng, Shi-lan

    2015-04-01

    Radix Astragali (Huangqi in Chinese) and Fructus Ligustri Lucidi (Nvzhenzi in Chinese) (2:1, w/w) are combined in an herbal formulation called Zhenqi Fuzheng capsules (ZFCs) for use in China to improve immunity, promote the recovery of normal functions after surgical operations, and as the most important adjuvant therapy in cancer. In this study, the tissue distribution profiles of the six major bio-active constituents (calycosin-7-O-β-D-glucoside, ononin, calycosin, formononetin, astragaloside IV and astragaloside II) were examined after oral administration of ZFCs to rats. All six constituents in each tissue were detected simultaneously using UPLC-ESI-MS, and the concentration of each constituent per gram of each tissue was determined. Quantification was performed using low-energy collision tandem mass spectrometry (CID-MS/MS) in multiple reaction monitoring (MRM) scan mode for the following precursor ion→product ion transitions at m/z 447.21→285.30 for calycosin-7-O-β-D-glucoside, m/z 285.29→270.38 for calycosin, m/z 431→269 for ononin, m/z 269→237 for formononetin, m/z 807.40→627.50 for astragaloside IV, m/z 849.60→669.65 for astragaloside II and m/z 633.18→331.18 for the internal standard (hesperidin). The results showed that in general the tissue concentrations for all six constituents were in the following order: spleen>stomach>thymus>lung>liver>kidney>heart>testicle. The high levels in the spleen and thymus indicated that all six compounds accumulated in organs involved in the immune response, consistent with the immunity effects of ZFC. The high levels in the stomach were consistent with the oral administration of ZFC. This study was the first to compare the tissue distribution of calycosin-7-O-β-D-glucoside with that of calycosin or of ononin with that of formononetin in rats. It was also the first study to examine the tissue distribution of astragaloside II, calycosin and formononetin following oral administration of ZFC to rats.

  16. Effects and mechanisms of Shaofu-Zhuyu decoction and its major bioactive component for Cold - Stagnation and Blood - Stasis primary dysmenorrhea rats.

    PubMed

    Huang, Xiaochen; Su, Shulan; Duan, Jin-Ao; Sha, Xiuxiu; Zhu, Kavin Yue; Guo, Jianming; Yu, Li; Liu, Pei; Shang, Erxin; Qian, Dawei

    2016-06-20

    Traditional Chinese medicine (TCM) is used under the guidance of the theory of traditional Chinese medical sciences in clinical application. The Chinese herbal formula, Shaofu Zhuyu decoction (SFZYD), is considered as an effective prescription for treating Cold - Stagnation and Blood - Stasis (CSBS) primary dysmenorrhea. The previous studies showed the SFZYD exhibited significant anti-inflammation and analgesic effect. In this present study the metabolomics of CSBS primary dysmenorrhea diseased rats and the cytokine transcription in PHA stimulated-PBMC were investigated to explore the effects and mechanisms. Explore a valuable insight into the effects and mechanisms of SFZYD on Cold - Stagnation and Blood - Stasis primary dysmenorrhea rats. We established CSBS primary dysmenorrhea diseased rats according the clinical symptoms. A targeted tandem mass spectrometry (MS/MS)-based metabolomic platform was used to evaluate the metabolic profiling changes and the intervention effects by SFZYD. The PBMC cell was adopted to explore the mechanisms by analyzing the signaling pathway evaluated by expression of inflammatory cytokines, c-jun and c-fos and corresponding phosphorylation levels. Estradiol, oxytocin, progesterone, endothelin, β-endorphin and PGF2α were restored back to the normal level after the treatment of SFZYD. Total twenty-five metabolites (10 in plasma and 15 in urine), up-regulated or down-regulated, were identified. These identified biomarkers underpinning the metabolic pathway including pentose and glucuronate interconversions, steroid hormone biosynthesis, and glycerophospholipid metabolism are disturbed in model rats. Among these metabolites, twenty one potential biomarkers were regulated after SFZYD treated. The compound of paeoniflorin, a major bioactive compound in SFZYD, was proved to regulate the MAPK signaling pathway by inhibiting the expression of IL-1β, IL-2, IL-10, IL-12, TNFα, INFγ, c-jun and c-fos in PHA stimulated-PBMC. These findings

  17. Composing across Modes: A Comparative Analysis of Adolescents' Multimodal Composing Processes

    ERIC Educational Resources Information Center

    Smith, Blaine E.

    2017-01-01

    Although the shift from page to screen has dramatically redefined conceptions of writing, very little is known about how youth compose with multiple modes in digital environments. Integrating multimodality and multiliteracies theoretical frameworks, this comparative case study examined how urban twelfth-grade students collaboratively composed…

  18. Amyloid fibrils composed of hexameric peptides attenuate neuroinflammation.

    PubMed

    Kurnellas, Michael P; Adams, Chris M; Sobel, Raymond A; Steinman, Lawrence; Rothbard, Jonathan B

    2013-04-03

    The amyloid-forming proteins tau, αB crystallin, and amyloid P protein are all found in lesions of multiple sclerosis (MS). Our previous work established that amyloidogenic peptides from the small heat shock protein αB crystallin (HspB5) and from amyloid β fibrils, characteristic of Alzheimer's disease, were therapeutic in experimental autoimmune encephalomyelitis (EAE), reflecting aspects of the pathology of MS. To understand the molecular basis for the therapeutic effect, we showed a set of amyloidogenic peptides composed of six amino acids, including those from tau, amyloid β A4, major prion protein (PrP), HspB5, amylin, serum amyloid P, and insulin B chain, to be anti-inflammatory and capable of reducing serological levels of interleukin-6 and attenuating paralysis in EAE. The chaperone function of the fibrils correlates with the therapeutic outcome. Fibrils composed of tau 623-628 precipitated 49 plasma proteins, including apolipoprotein B-100, clusterin, transthyretin, and complement C3, supporting the hypothesis that the fibrils are active biological agents. Amyloid fibrils thus may provide benefit in MS and other neuroinflammatory disorders.

  19. [The use of honey in the simple and composed drugs at Rhazés].

    PubMed

    Katouzian-Safadi, Mehrnaz; Bonmatin, Jean-Marc

    2003-01-01

    Rāzī or Rhazès for Latin people is one of the great scientists of ninth century. He left major works in medicine, pharmacy and in alchemy. We examine here, the use of honey by this scientist as a simple drug and as one of the essential substances included in composed medicines. That leads us to examine the notion of simple and of composed in this physician and alchemist.

  20. Nursing: a major hospital cost component.

    PubMed Central

    Wilson, L; Prescott, P A; Aleksandrowicz, L

    1988-01-01

    Selected studies of nursing costs demonstrate a wide variation per patient-day and per patient stay within the same DRG. These differences could reflect either actual differences in nursing practice or methodological differences in calculating practice costs. We examined several alternative methods to find hospital nursing costs of the same group of patients. Measures of patient illness--AS-SCORE severity of illness, Relative Intensity (RIMs), MacLeod nursing intensity, and a per diem measure--were compared for variations in nursing cost. Various definitions of nursing cost itself also were compared using the same patients. Two approaches to defining nursing cost elements--by nursing unit and by hands-on patient care-are discussed. Several nursing cost studies reporting data for DRG 121 (myocardial infarction with complications and/or comorbidity) were compared with our data. The nursing care costs in several studies of these same patients varied from $706 to $1,778 per stay (a 60 percent difference); reasons for these cost differences are discussed. It is suggested that at least part of this variability reflects methodological differences. Cost data should be reported carefully to facilitate comparisons with the results of other studies. Efforts should begin toward designing nursing cost studies using comparable measures and cost-finding methodologies. PMID:3126163

  1. Sequoias, Mavericks, Open Doors...Composing Joan Tower

    ERIC Educational Resources Information Center

    Allsup, Randall Everett

    2011-01-01

    This essay interview with Joan Tower is a meditation on the importance of composing, understood as a process larger than the making of new sound combinations or musical scores, suggesting that the compositional act is self-educative and self-forming. Tower's musical life, one of teaching and learning, one of composing and self-composing, is an…

  2. Sequoias, Mavericks, Open Doors...Composing Joan Tower

    ERIC Educational Resources Information Center

    Allsup, Randall Everett

    2011-01-01

    This essay interview with Joan Tower is a meditation on the importance of composing, understood as a process larger than the making of new sound combinations or musical scores, suggesting that the compositional act is self-educative and self-forming. Tower's musical life, one of teaching and learning, one of composing and self-composing, is an…

  3. 16 CFR 301.20 - Fur products composed of pieces.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 16 Commercial Practices 1 2012-01-01 2012-01-01 false Fur products composed of pieces. 301.20... RULES AND REGULATIONS UNDER FUR PRODUCTS LABELING ACT Regulations § 301.20 Fur products composed of pieces. (a) Where fur products, or fur mats and plates, are composed in whole or in substantial part...

  4. 16 CFR 301.20 - Fur products composed of pieces.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Fur products composed of pieces. 301.20... RULES AND REGULATIONS UNDER FUR PRODUCTS LABELING ACT Regulations § 301.20 Fur products composed of pieces. (a) Where fur products, or fur mats and plates, are composed in whole or in substantial part...

  5. Comparative Climate Responses of Anthropogenic Greenhouse Gases, All Major Aerosol Components, Black Carbon, and Methane, Accounting for the Evolution of the Aerosol Mixing State and of Clouds/Precipitation from Multiple Aerosol Size Distributions

    NASA Astrophysics Data System (ADS)

    Jacobson, M. Z.

    2005-12-01

    Several modeling studies to date have simulated the global climate response of anthropogenic greenhouse gases and bulk (non-size-resolved) sulfate or generic aerosol particles together, but no study has examined the climate response of greenhouse gases simultaneously with all major size- and composition resolved aerosol particle components. Such a study is important for improving our understanding of the effects of anthropogenic pollutants on climate. Here, the GATOR-GCMOM model is used to study the global climate response of (a) all major greenhouse gases and size-resolved aerosol components, (b) all major greenhouse gases alone, (c) fossil-fuel soot (black carbon, primary organic matter, sulfuric acid, bisulfate, sulfate), and (d) methane. Aerosol components treated in all simulations included water, black carbon, primary organic carbon, secondary organic carbon, sulfuric acid, bisulfate, sulfate, nitrate, chloride, ammonium, sodium, hydrogen ion, soil dust, and pollen/spores. Fossil-fuel soot (FFS) was emitted into its own size distribution. All other components, including biofuel and biomass soot, sea-spray, soil dust, etc., were emitted into a second distribution (MIX). The FFS distribution grew by condensation of secondary organic matter and sulfuric acid, hydration of water, and dissolution of nitric acid, ammonia, and hydrochloric acid. It self-coagulated and heterocoagulated with the MIX distribution, which also grew by condensation, hydration, and dissolution. Treatment of separate distributions for FFS allowed FFS to evolve from an external mixture to an internal mixture. In both distributions, black carbon was treated as a core component for optical calculations. Both aerosol distributions served as CCN during explicit size-resolved cloud formation. The resulting clouds grew by coagulation and condensation, coagulated with interstitial aerosol particles, and fell to the surface as rain and snow, carrying aerosol constituents with them. Thus, cloud

  6. Composing, Analyzing and Validating Software Models

    NASA Technical Reports Server (NTRS)

    Sheldon, Frederick T.

    1998-01-01

    This research has been conducted at the Computational Sciences Division of the Information Sciences Directorate at Ames Research Center (Automated Software Engineering Grp). The principle work this summer has been to review and refine the agenda that were carried forward from last summer. Formal specifications provide good support for designing a functionally correct system, however they are weak at incorporating non-functional performance requirements (like reliability). Techniques which utilize stochastic Petri nets (SPNs) are good for evaluating the performance and reliability for a system, but they may be too abstract and cumbersome from the stand point of specifying and evaluating functional behavior. Therefore, one major objective of this research is to provide an integrated approach to assist the user in specifying both functionality (qualitative: mutual exclusion and synchronization) and performance requirements (quantitative: reliability and execution deadlines). In this way, the merits of a powerful modeling technique for performability analysis (using SPNs) can be combined with a well-defined formal specification language. In doing so, we can come closer to providing a formal approach to designing a functionally correct system that meets reliability and performance goals.

  7. Composing, Analyzing and Validating Software Models

    NASA Technical Reports Server (NTRS)

    Sheldon, Frederick T.

    1998-01-01

    This research has been conducted at the Computational Sciences Division of the Information Sciences Directorate at Ames Research Center (Automated Software Engineering Grp). The principle work this summer has been to review and refine the agenda that were carried forward from last summer. Formal specifications provide good support for designing a functionally correct system, however they are weak at incorporating non-functional performance requirements (like reliability). Techniques which utilize stochastic Petri nets (SPNs) are good for evaluating the performance and reliability for a system, but they may be too abstract and cumbersome from the stand point of specifying and evaluating functional behavior. Therefore, one major objective of this research is to provide an integrated approach to assist the user in specifying both functionality (qualitative: mutual exclusion and synchronization) and performance requirements (quantitative: reliability and execution deadlines). In this way, the merits of a powerful modeling technique for performability analysis (using SPNs) can be combined with a well-defined formal specification language. In doing so, we can come closer to providing a formal approach to designing a functionally correct system that meets reliability and performance goals.

  8. Popular Periodicals and Rhetoric & Composition Textbooks in the Nineteenth Century: A Cultural Conversation on Composing Oneself.

    ERIC Educational Resources Information Center

    Welsch, Kathleen A.

    In 19th century America, talk of manners and morals as integral components of American character filled a significant space in public discourse. Lessons on how to compose oneself properly and models of appropriate behavior abounded in the form of essays, stories, poetry, editorials, and travel literature. This conversation on character influenced…

  9. Hyperfrequency components

    NASA Astrophysics Data System (ADS)

    1994-09-01

    The document has a collection of 19 papers (11 on technologies, 8 on applications) by 26 authors and coauthors. Technological topics include: evolution from conventional HEMT's double heterojunction and planar types of pseudomorphic HEMT's; MMIC R&D and production aspects for very-low-noise, low-power, and very-low-noise, high-power applications; hyperfrequency CAD tools; parametric measurements of hyperfrequency components on plug-in cards for design and in-process testing uses; design of Class B power amplifiers and millimetric-wave, bigrid-transistor mixers, exemplifying combined use of three major types of physical simulation in electrical modeling of microwave components; FET's for power amplification at up to 110 GHz; production, characterization, and nonlinear applications of resonant tunnel diodes. Applications topics include: development of active modules for major European programs; tubes versus solid-state components in hyperfrequency applications; status and potentialities of national and international cooperative R&D on MMIC's and CAD of hyperfrequency circuitry; attainable performance levels in multifunction MMIC applications; state of the art relative of MESFET power amplifiers (Bands S, C, X, Ku); creating a hyperfrequency functions library, of parametrizable reference cells or macrocells; and design of a single-stage, low-noise, band-W amplifier toward development of a three-stage amplifier.

  10. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  11. Spatial Stories with Nomadic Narrators: Affect, Snapchat, and Feeling Embodiment in Youth Mobile Composing

    ERIC Educational Resources Information Center

    Wargo, Jon M.

    2015-01-01

    While the vast majority of scholarship on mobile media, social semiotics, and multimodality highlights work done "behind" the screen, few studies have considered the embodied processes of youth composing "with" and "through" mobile technology. This study, drawn from a larger critical qualitative connective…

  12. On architecting and composing engineering information services to enable smart manufacturing.

    PubMed

    Kulvatunyou, Boonserm Serm; Ivezic, Nenad; Srinivasan, Vijay

    2016-09-01

    Engineering information systems play an important role in the current era of digitization of manufacturing, which is a key component to enable smart manufacturing. Traditionally, these engineering information systems spanned the lifecycle of a product by providing interoperability of software subsystems through a combination of open and proprietary exchange of data. But research and development efforts are underway to replace this paradigm with engineering information services that can be composed dynamically to meet changing needs in the operation of smart manufacturing systems. This paper describes the opportunities and challenges in architecting such engineering information services and composing them to enable smarter manufacturing.

  13. On architecting and composing engineering information services to enable smart manufacturing

    PubMed Central

    Ivezic, Nenad; Srinivasan, Vijay

    2016-01-01

    Engineering information systems play an important role in the current era of digitization of manufacturing, which is a key component to enable smart manufacturing. Traditionally, these engineering information systems spanned the lifecycle of a product by providing interoperability of software subsystems through a combination of open and proprietary exchange of data. But research and development efforts are underway to replace this paradigm with engineering information services that can be composed dynamically to meet changing needs in the operation of smart manufacturing systems. This paper describes the opportunities and challenges in architecting such engineering information services and composing them to enable smarter manufacturing. PMID:27840595

  14. UPLC-Q-TOF/MS-based screening and identification of two major bioactive components and their metabolites in normal and CKD rat plasma, urine and feces after oral administration of Rehmannia glutinosa Libosch extract.

    PubMed

    Tao, Jin-hua; Zhao, Min; Wang, Dong-geng; Yang, Chi; Chen, Guang-tong; Zhao, Xi; Pu, Xu-lian; Jiang, Shu

    2015-09-15

    Rehmannia glutinosa is a widely used traditional Chinese medicine (TCM) in clinical practice to tackle chronic kidney disease for thousands of years. However, the in vivo metabolism of its two major bioactive components (catalpol and acteoside) remains unknown. In this paper, a highly sensitive, rapid and robust ultra-performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MS) with MetaboLynx™ software combined with mass defect filtering (MDF) method was established. This validated analysis method was successfully applied to investigate the in vivo metabolic profiles of R. glutinosa extract in normal and chronic kidney disease (CKD) rats. The results showed that a total of 17 metabolites of two parent compounds in normal rats in vivo were tentatively detected and identified according to the characteristics of their protonated ions and relevant literature. While 11 of the metabolites were observed in the CKD rat samples. These metabolites suggested that catalpol was firstly deglycosylated to its aglycone and subsequently to two main metabolites (M1 and M4) by conjugation and hydrogenation respectively and acteoside was mainly metabolized by O-glucuronide conjugation and O-sulphate conjugation. In conclusion, this study showed an insight into the metabolism of R. glutinosa extract in vivo and the proposed metabolic pathways of bioactive components might play a key role in further pharmacokinetic experiments evaluations. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Rapid and sensitive determination of major polyphenolic components in Euphoria longana Lam. seeds using matrix solid-phase dispersion extraction and UHPLC with hybrid linear ion trap triple quadrupole mass spectrometry.

    PubMed

    Rathore, Atul S; Sathiyanarayanan, L; Deshpande, Shreekant; Mahadik, Kakasaheb R

    2016-11-01

    A rapid and sensitive method for the extraction and determination of four major polyphenolic components in Euphoria longana Lam. seeds is presented for the first time based on matrix solid-phase dispersion extraction followed by ultra high performance liquid chromatography with hybrid triple quadrupole linear ion trap mass spectrometry. Matrix solid-phase dispersion method was designed for the extraction of Euphoria longana seed constituents and compared with microwave-assisted extraction and ultrasonic-assisted extraction methods. An Ultra high performance liquid chromatography with hybrid triple quadrupole linear ion-trap mass spectrometry method was developed for quantitative analysis in multiple-reaction monitoring mode in negative electrospray ionization. The chromatographic separation was accomplished using an ACQUITY UPLC BEH C18 (2.1 mm × 50 mm, 1.7 μm) column with gradient elution of 0.1% aqueous formic acid and 0.1% formic acid in acetonitrile. The developed method was validated with acceptable linearity (r(2) > 0.999), precision (RSD ≤ 2.22%) and recovery (RSD ≤ 2.35%). The results indicated that matrix solid-phase dispersion produced comparable extraction efficiency compared with other methods nevertheless was more convenient and time-saving with reduced requirements on sample and solvent volumes. The proposed method is rapid and sensitive in providing a promising alternative for extraction and comprehensive determination of active components for quality control of Euphoria longana products.

  16. Effect of a Vietnamese Cinnamomum cassia essential oil and its major component trans-cinnamaldehyde on the cell viability, membrane integrity, membrane fluidity, and proton motive force of Listeria innocua.

    PubMed

    Trinh, Nga-Thi-Thanh; Dumas, Emilie; Thanh, Mai Le; Degraeve, Pascal; Ben Amara, Chedia; Gharsallaoui, Adem; Oulahal, Nadia

    2015-04-01

    The antibacterial mechanism of a Cinnamomum cassia essential oil from Vietnam and of its main component (trans-cinnamaldehyde, 90% (m/m) of C. cassia essential oil) against a Listeria innocua strain was investigated to estimate their potential for food preservation. In the presence of C. cassia essential oil or trans-cinnamaldehyde at their minimal bactericidal concentration (2700 μg·mL(-1)), L. innocua cells fluoresced green after staining with Syto9® and propidium iodide, as observed by epifluorescence microscopy, suggesting that the perturbation of membrane did not cause large pore formation and cell lysis but may have introduced the presence of viable but nonculturable bacteria. Moreover, the fluidity, potential, and intracellular pH of the cytoplasmic membrane were perturbed in the presence of the essential oil or trans-cinnamaldehyde. However, these membrane perturbations were less severe in the presence of trans-cinnamaldehyde than in the presence of multicomponent C. cassia essential oil. This indicates that in addition to trans-cinnamaldehyde, other minor C. cassia essential oil components play a major role in its antibacterial activity against L. innocua cells.

  17. Coaxial nanocable composed by imogolite and carbon nanotubes

    SciTech Connect

    Ramírez, M.; González, R. I.; Munoz, F.; Valdivia, J. A.; Rogan, J.; Kiwi, M.

    2015-12-31

    The discovery and development of Carbon Nanotubes (CNTs) at the beginning of the 1990s has driven a major part of solid state research. The electronic properties of the CNTs have generated a large number of ideas, as building coaxial nanocables. In this work we propose a possible type of such nanocables, which is formed by three nanostructures: two conducting CNTs, where one of them is covered by an insulator (an inorganic oxide nanotube: the imogolite aluminosilicate). The theoretical calculations were carried out using the density functional tight-binding formalism, by means of the DFTB+ code. This formalism allows to calculate the band structure, which compares favorably with DFT calculations, but with a significantly lower computational cost. As a first step, we reproduce the calculations of already published results, where the formation of a nanocable composed by one CNT and the imogolite as an insulator. Afterwards, we simulate the band structure for the proposed structure to study the feasibility of the coaxial nanocable. Finally, using classical MD simulations, we study the possible mechanisms of formation of these nanocables.

  18. Fusion-component lifetime analysis

    SciTech Connect

    Mattas, R.F.

    1982-09-01

    A one-dimensional computer code has been developed to examine the lifetime of first-wall and impurity-control components. The code incorporates the operating and design parameters, the material characteristics, and the appropriate failure criteria for the individual components. The major emphasis of the modeling effort has been to calculate the temperature-stress-strain-radiation effects history of a component so that the synergystic effects between sputtering erosion, swelling, creep, fatigue, and crack growth can be examined. The general forms of the property equations are the same for all materials in order to provide the greatest flexibility for materials selection in the code. The individual coefficients within the equations are different for each material. The code is capable of determining the behavior of a plate, composed of either a single or dual material structure, that is either totally constrained or constrained from bending but not from expansion. The code has been utilized to analyze the first walls for FED/INTOR and DEMO and to analyze the limiter for FED/INTOR.

  19. How Composers Approach Teaching Composition: Strategies for Music Teachers

    ERIC Educational Resources Information Center

    Randles, Clint; Sullivan, Mark

    2013-01-01

    Composition pedagogy is explored from the perspective of a composer and a music teacher educator in this article. The primary goal is to help practicing music teachers develop strategies that will encourage students to create original music. The authors provide reflection about the process of helping students compose on the basis of personal…

  20. The Links between Handwriting and Composing for Y6 Children

    ERIC Educational Resources Information Center

    Medwell, Jane; Strand, Steve; Wray, David

    2009-01-01

    Although handwriting is often considered a matter of presentation, a substantial body of international research suggests that the role of handwriting in children's composing has been neglected. Automaticity in handwriting is now seen as of key importance in composing but this proposition is relatively untested in the UK and the assumption has been…

  1. Talking about Composing in Secondary School Music Lessons

    ERIC Educational Resources Information Center

    Major, Angela E.

    2007-01-01

    This paper reports an action research study of teacher and pupil talk about composing. Data were collected through video and audio recordings of composition lessons in a secondary school. Qualitative analysis of the data led to the development of a "typology of pupil talk about composing" which distinguishes between six main types:…

  2. Grammar for College Writing: A Sentence-Composing Approach

    ERIC Educational Resources Information Center

    Killgallon, Don; Killgallon, Jenny

    2010-01-01

    Across America, in thousands of classrooms, from elementary school to high school, the time-tested sentence-composing approach has given students tools to become better writers. Now the authors present a much anticipated sentence-composing grammar worktext for college writing. This book presents a new and easier way to understand grammar: (1) Noun…

  3. Composing in Public: The Ambient Audiences of a Writing Lab

    ERIC Educational Resources Information Center

    Hall, Matthew

    2015-01-01

    Although scholars have investigated the ways youths individually enact composing practices and the impact of audience on these practices, this study examines the impact of an audience physically present while composing in a shared, public space--an ambient audience. Blurring the line between traditional notions of audience and collaborator through…

  4. Grammar for College Writing: A Sentence-Composing Approach

    ERIC Educational Resources Information Center

    Killgallon, Don; Killgallon, Jenny

    2010-01-01

    Across America, in thousands of classrooms, from elementary school to high school, the time-tested sentence-composing approach has given students tools to become better writers. Now the authors present a much anticipated sentence-composing grammar worktext for college writing. This book presents a new and easier way to understand grammar: (1) Noun…

  5. Avoiding Common Security Flaws in Composed Service-Oriented Systems

    DTIC Science & Technology

    2012-06-01

    remain exposed to security attacks. Service Oriented Architecture ( SOA ) based systems are inherently composition-based. New functionality is ex...survivability of the composed system. Keywords: Service Oriented Architecture , Trustworthy system design, Information Assurance, Survivability I...Avoiding Common Security Flaws in Composed Service - Oriented Systems Michael Atighetchi, Partha Pal, Joseph Loyall Raytheon BBN Technologies

  6. Collaborative Composing in High School String Chamber Music Ensembles

    ERIC Educational Resources Information Center

    Hopkins, Michael T.

    2015-01-01

    The purpose of this study was to examine collaborative composing in high school string chamber music ensembles. Research questions included the following: (a) How do high school string instrumentalists in chamber music ensembles use verbal and musical forms of communication to collaboratively compose a piece of music? (b) How do selected variables…

  7. Collaborative Composing in High School String Chamber Music Ensembles

    ERIC Educational Resources Information Center

    Hopkins, Michael T.

    2015-01-01

    The purpose of this study was to examine collaborative composing in high school string chamber music ensembles. Research questions included the following: (a) How do high school string instrumentalists in chamber music ensembles use verbal and musical forms of communication to collaboratively compose a piece of music? (b) How do selected variables…

  8. Alexia Without Agraphia in a Composer. Technical Report No. 15.

    ERIC Educational Resources Information Center

    Judd, Tedd; And Others

    The case study of a 78-year-old music composer who had had a stroke revealed that he had a severe reading disturbance, a well-preserved writing ability, and no appreciable aphasia. He continued to read music and to compose. His text and music reading performance under different conditions suggested that this unusual dissociation (alexia without…

  9. The composing process of technical writers: A preliminary study

    NASA Technical Reports Server (NTRS)

    Mair, D.; Roundy, N.

    1981-01-01

    The assumption that technical writers compose as do other writers is tested. The literature on the composing process, not limited to the pure or applied sciences, was reviewed, yielding three areas of general agreement. The composing process (1) consists of several stages, (2) is reflexive, and (3) may be mastered by means of strategies. Data on the ways technical writers compose were collected, and findings were related to the three areas of agreement. Questionnaires and interviews surveying 70 writers were used. The disciplines represented by these writers included civil, chemical, agricultural, geological, mechanical, electrical, and petroleum engineering, chemistry, hydrology, geology, and biology. Those providing consulting services, or performing research. No technical editors or professional writers were surveyed, only technicians, engineers, and researchers whose jobs involved composing reports. Three pedagogical implications are included.

  10. Cell-mediated lympholysis of trinitrophenyl-modified autologous lymphocytes. Effector cell specificity to modified cell surface components controlled by H-2K and H-2D serological regions of the murine major histocompatibility complex

    PubMed Central

    1975-01-01

    Splenic lymphocytes from four C57BL/10 congenic resistant mouse strains were sensitized in vitro with trinitrophenyl (TNP)-modified autologous spleen cellsmthe effector cells generated were incubated with 51-Cr- labeled unmodified or TNP-modified spleen or tumor target cells, and the percentage of specific lympholysis determined. The results obtained using syngeneic-, congenic-, recombinante, and allogeneic-modified target cells indicated that TNP modification of the target cells was a necessary but insufficient requirement for lympholysis. Intra-H-2 homology either between modified stimulating cells and modified target cells or between responding lymphocytes and modified target cells was also important in the specificity for lysis. Homology at the K serological region or at K plus I-A in the B10.A and B10BR strains, and at either the D serological region or at some other region (possibly K) in the B10.D2 and C57BL/10 strains were shown to be necessary in order to detect lympholysis. Experiments using (B10itimes C57BL/10)F1 responding lymphocytes sensitized and assayed with TNP-modified parental cells indicated that the homology required for lympholysis was between modified stimulating and modified target cellsmthe possibility is raised that histocompatibility antigens may serve in the autologous system as cell surface components which are modified by viruses or autoimmune complexes to form cell-bound modified-self antigens, which are particularly suited for cell-mediated immune reactions. Evidence is presented suggesting that H-2-linked Ir genes are expressed in the TNP- modified autologous cytotoxic system. These findings imply that the major histocompatibility complex can be functionally involved both in the response potential to and in the formation of new antigenic determinants involving modified-self components. PMID:47900

  11. A strategy for the generation of specific human antibodies by directed evolution and phage display. An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom.

    PubMed

    Riaño-Umbarila, Lidia; Juárez-González, Victor Rivelino; Olamendi-Portugal, Timoteo; Ortíz-León, Mauricio; Possani, Lourival Domingos; Becerril, Baltazar

    2005-05-01

    This study describes the construction of a library of single-chain antibody fragments (scFvs) from a single human donor by individual amplification of all heavy and light variable domains (1.1 x 10(8) recombinants). The library was panned using the phage display technique, which allowed selection of specific scFvs (3F and C1) capable of recognizing Cn2, the major toxic component of Centruroides noxius scorpion venom. The scFv 3F was matured in vitro by three cycles of directed evolution. The use of stringent conditions in the third cycle allowed the selection of several improved clones. The best scFv obtained (6009F) was improved in terms of its affinity by 446-fold, from 183 nm (3F) to 410 pm. This scFv 6009F was able to neutralize 2 LD(50) of Cn2 toxin when a 1 : 10 molar ratio of toxin-to-antibody fragment was used. It was also able to neutralize 2 LD(50) of the whole venom. These results pave the way for the future generation of recombinant human antivenoms.

  12. Stroke, music, and creative output: Alfred Schnittke and other composers.

    PubMed

    Zagvazdin, Yuri

    2015-01-01

    Alfred Schnittke (1934-1998), a celebrated Russian composer of the twentieth century, suffered from several strokes which affected his left cerebral hemisphere. The disease, however, did not diminish his musical talent. Moreover, he stated that his illness in a way facilitated his work. The composer showed amazingly high productivity after his first and second injuries of the central nervous system. The main topic of this chapter is the effect of strokes on Schnittke's output, creativity, and style of music. A brief biography of the composer with the chronology of his brain hemorrhages is included. In addition, the influence of cerebrovascular lesions on creative potential of other prominent composers such as Benjamin Britten, Jean Langlais, Vissarion Shebalin, Igor Stravinsky, and Ira Randall Thompson is discussed.

  13. Composable IO: A Novel Resource Sharing Platform in Personal Clouds

    NASA Astrophysics Data System (ADS)

    Wu, Xiaoxin; Wang, Wei; Lin, Ben; Miao, Kai

    A fundamental goal for Cloud computing is to group resources to accomplish tasks that may require strong computing or communication capability. In this paper we design specific resource sharing technology under which IO peripherals can be shared among Cloud members. In particular, in a personal Cloud that is built up by a number of personal devices, IO peripherals at any device can be applied to support application running at another device. We call this IO sharing composable IO because it is equivalent to composing IOs from different devices for an application. We design composable USB and achieve pro-migration USB access, namely a migrated application running at the targeted host can still access the USB IO peripherals at the source host. This is supplementary to traditional VM migration under which application can only use resources from the device where the application runs. Experimental results show that through composable IO applications in personal Cloud can achieve much better user experience.

  14. Component for thermoelectric generator

    DOEpatents

    Purdy, David L.

    1977-01-01

    In a thermoelectric generator, a component comprises a ceramic insulator, having over limited areas thereof, each area corresponding to a terminal end of thermoelectric wires, a coating of a first metal which adheres to the insulator, and an electrical thermoelectric junction including a second metal which wets said first metal and adheres to said terminal ends but does not wet said insulator, and a cloth composed of electrically insulating threads interlaced with thermoelectric wires.

  15. Optimization of global model composed of radial basis functions using the term-ranking approach

    SciTech Connect

    Cai, Peng; Tao, Chao Liu, Xiao-Jun

    2014-03-15

    A term-ranking method is put forward to optimize the global model composed of radial basis functions to improve the predictability of the model. The effectiveness of the proposed method is examined by numerical simulation and experimental data. Numerical simulations indicate that this method can significantly lengthen the prediction time and decrease the Bayesian information criterion of the model. The application to real voice signal shows that the optimized global model can capture more predictable component in chaos-like voice data and simultaneously reduce the predictable component (periodic pitch) in the residual signal.

  16. Optimization of global model composed of radial basis functions using the term-ranking approach

    SciTech Connect

    Cai, Peng; Tao, Chao Liu, Xiao-Jun

    2014-03-15

    A term-ranking method is put forward to optimize the global model composed of radial basis functions to improve the predictability of the model. The effectiveness of the proposed method is examined by numerical simulation and experimental data. Numerical simulations indicate that this method can significantly lengthen the prediction time and decrease the Bayesian information criterion of the model. The application to real voice signal shows that the optimized global model can capture more predictable component in chaos-like voice data and simultaneously reduce the predictable component (periodic pitch) in the residual signal.

  17. Major Links.

    ERIC Educational Resources Information Center

    Henderson, Tona

    1995-01-01

    Provides electronic mail addresses for resources and discussion groups related to the following academic majors: art, biology, business, chemistry, computer science, economics, health sciences, history, literature, math, music, philosophy, political science, psychology, sociology, and theater. (AEF)

  18. Major Links.

    ERIC Educational Resources Information Center

    Henderson, Tona

    1995-01-01

    Provides electronic mail addresses for resources and discussion groups related to the following academic majors: art, biology, business, chemistry, computer science, economics, health sciences, history, literature, math, music, philosophy, political science, psychology, sociology, and theater. (AEF)

  19. The major acute-phase protein, serum amyloid P component, in mice is not involved in endogenous resistance against tumor necrosis factor alpha-induced lethal hepatitis, shock, and skin necrosis.

    PubMed

    Van Molle, W; Hochepied, T; Brouckaert, P; Libert, C

    2000-09-01

    The proinflammatory cytokine tumor necrosis factor alpha (TNF-alpha) induces lethal hepatitis when injected into D-(+)-galactosamine-sensitized mice on the one hand or systemic inflammatory response syndrome (SIRS) in normal mice on the other hand. We studied whether serum amyloid P component (SAP), the major acute-phase protein in mice, plays a protective role in both lethal models. For this purpose, we used SAP(0/0) mice generated by gene targeting. We studied the lethal response of SAP(0/0) or SAP(+/+) mice to both lethal triggers but found no differences in the sensitivity of both types of mice. We also investigated whether SAP is involved in establishing two types of endogenous protection: one using a single injection of interleukin-1beta (IL-1beta) for desensitization and clearly involving a liver protein, the other by tolerizing mice for 5 days using small doses of human TNF-alpha. Although after IL-1beta or after tolerization the SAP levels in the serum had risen fourfold in the control mice and not in the SAP(0/0) mice, the same extents of desensitization and tolerization were achieved. Finally, we observed that the induction of hemorrhagic necrosis in the skin of mice by two consecutive local injections with TNF-alpha was not altered in SAP(0/0) mice. We conclude that the presence or absence of SAP has no influence on the sensitivity of mice to TNF-alpha-induced hepatitis, SIRS, and hemorrhagic necrosis or on the endogenous protective mechanisms of desensitization or tolerization.

  20. Development of low cost pulmonary surfactants composed of a mixture of lipids or lipids-peptides using higher aliphatic alcohol or soy lecithin.

    PubMed

    Yukitake, Ko; Nakamura, Yoshihiro; Kawahara, Masato; Nakahara, Hiromichi; Shibata, Osamu; Lee, Sannamu

    2008-10-15

    The artificial pulmonary surfactant composition in the present study is characterized by a lipid mixture system composed of higher aliphatic alcohol, egg yolk phosphatidylcholine (egg PC), soy lecithin and higher aliphatic acid as the major components or a peptide-lipid mixture system composed of a combination of the lipid mixture system to which a peptide is added. Three peptides with amphiphilic surface-staying, membrane spanning, and both properties were designed and synthesized. The evaluation of pulmonary surfactant assay was performed by a hysteresis curve drawn upon the measurement for the surface tension-area curve with the Wilhelmy surface tensometer in vitro and the recovery of lung compliance for the pulmonary surfactant-deficient rat models in vivo. Lipid-mixture systems composed of octadecanol or soy lecithins containing no peptide were favorable hysteresis curves as compared with commercially available Surfacten, but were not prominent. The peptide-lipid mixture systems composed of a combination of the lipid mixture of alkyl alcohol or soy lecithin to which peptides designed were added were desirable hysteresis curves similar to Surfacten and amphiphilic Hel 13-5 peptide-lipids mixture systems were much more effective than the lipid mixture system. Particularly, the recovery of lung compliance treated with hydrogenated soy lecithin-fractionated soy lecithin PC70-palmitic acid-peptide Hel 13-5 (40:40:17.5:2.5, w/w) was comparable to that with Surfacten. Because the artificial pulmonary surfactant compositions of this study can be prepared at lower costs, they are useful for the treatment of respiratory distress syndrome and acute respiratory distress syndrome as well as for inflammatory pulmonary diseases, dyspnea caused by asthma, etc.

  1. Layout modification for library cell Alt-PSM composability

    NASA Astrophysics Data System (ADS)

    Cao, Ke; Hu, Jiang; Cheng, Mosong

    2004-05-01

    In sub-wavelength lithography, light field Alt-PSM (Alternating Phase Shifting Mask) is an essential technology for poly layer printability. In a standard cell based design, the problem of obtaining Alt-PSM compliance for an individual cell layout has been solved well [3]. However, placing Alt-PSM compliant cells together can not guarantee Alt-PSM compliance of the entire chip/block layout due to phase interactions among adjacent cells. A simple solution to this Alt-PSM composability problem is to wrap blank area around each cell, which is very inefficient on chip area usage. In this paper, we formulate the composability problem as a graph model and propose a polynomial time optimal algorithm to achieve Alt-PSM composability with the least impact on cell layout.

  2. Composed planar Hall effect sensors with dual-mode operation

    NASA Astrophysics Data System (ADS)

    Mor, Vladislav; Roy, Debangsu; Schultz, Moty; Klein, Lior

    2016-02-01

    We present a composed planar Hall effect sensor with two modes of operation: (a) an ON mode where the composed sensor responds to magnetic field excitations similarly to the response of a regular planar Hall effect sensor, and (b) an OFF mode where the response is negligible. The composed planar Hall effect sensor switches from the OFF mode to the ON mode when it is exposed to a magnetic field which exceeds a certain threshold determined by the sensor design. The features of this sensor make it useful as a switch triggered by magnetic field and as a sensing device with memory, as its mode of operation indicates exposure to a magnetic field larger than a certain threshold without the need to be activated during the exposure itself.

  3. Major depression.

    PubMed

    Bentley, Susan M; Pagalilauan, Genevieve L; Simpson, Scott A

    2014-09-01

    Major depression is a common, disabling condition seen frequently in primary care practices. Non-psychiatrist ambulatory providers are increasingly responsible for diagnosing, and primarily managing patients suffering from major depressive disorder (MDD). The goal of this review is to help primary care providers to understand the natural history of MDD, identify practical tools for screening, and a thoughtful approach to management. Clinically challenging topics like co-morbid conditions, treatment resistant depression and pharmacotherapy selection with consideration to side effects and medication interactions, are also covered.

  4. Fundamental Characteristics of Inflatable Structure Composed of Sealed Multi-Cells

    NASA Astrophysics Data System (ADS)

    Ishimura, Kosei; Higuchi, Ken

    Inflatable structure is an attractive candidate as ultra-light space structures with high packaging efficiency. They consist of flexible membrane and some components for the deployment. For such pneumatic structure with membrane, the damage of the membrane caused by space debris is one of serious problems for the utilization in space. To solve the problem, multi-cellular inflatable structures are proposed. Inflatable structures composed of multi-cells are robust against the damage of membrane. In this paper, a new type of inflatable cylinder which is composed of sealed multi-cells was investigated. Because deployment of the structure can be driven by the gas pressure of the sealed multi-cells, no complex components such as gas tanks and electric valves are required for the deployment. The fundamental characteristics of the deployment are investigated experimentally. As a result, it is shown that the inflatable cylinder composed of sealed multi-cells can achieve the deployment with simple hold-release mechanism even though some cells are damaged. Furthermore, by applying with inner bellows and outside constraint wires, the deployment sequence can be controlled and almost straight deployment can be realized.

  5. Syrtis Major

    NASA Image and Video Library

    2002-05-23

    This image from NASA Mars Odyssey spacecraft is from the region of Syrtis Major, which is dominated by a low-relief shield volcano and believed to be an area of vigorous aeolian activity with strong winds in the east-west direction.

  6. Major Andre

    ERIC Educational Resources Information Center

    Henisch, B. A.; Henisch, H. K.

    1976-01-01

    If most Revolutionary era people seem two-dimensional their lives simpler to understand than ours, it may be only that history, with the benefit of hindsight, clarifies. Examines a profile of Major John Andre, the British liaison officer in Benedict Arnold's plan to surrender West Point, as both hero and villain to show the complexity of early…

  7. Comparative tissue distribution profiles of five major bio-active components in normal and blood deficiency rats after oral administration of Danggui Buxue Decoction by UPLC-TQ/MS.

    PubMed

    Shi, Xuqin; Tang, Yuping; Zhu, Huaxu; Li, Weixia; Li, Zhenhao; Li, Wei; Duan, Jin-ao

    2014-01-01

    Astragali Radix (AR) and Angelicae Sinensis Radix (ASR) were frequently combined and used in China as herbal pair called as Danggui Buxue Decoction (DBD) for treatment of blood deficiency syndrome, such as women's ailments. This study is to investigate the tissue distribution profiles of five major bio-active constituents (ferulic acid, caffeic acid, calycosin-7-O-β-glucoside, ononin and astragaloside IV) in DBD after oral administration of DBD in blood deficiency rats, and to compare the difference between normal and blood deficiency rats. The blood deficiency rats were induced by bleeding from orbit at the dosages of 5.0mLkg(-1) every day, and the experimental period was 12 days. At the finally day of experimental period, both normal and blood deficiency rats were orally administrated with DBD, and then the tissues samples were collected at different time points. Ferulic acid, caffeic acid, calycosin-7-O-β-glucoside, ononin and astragaloside IV in different tissues were detected simultaneously by UPLC-TQ/MS, and the histograms were drawn. The results showed that the overall trend was CLiver>CKidney>CHeart>CSpleen>CLung, CC-30min>CM-30min>CM-60min>CC-5min>CM-5min>CC-60min>CM-240min>CC-240min. The contents of the detected compounds in liver were more than that in other tissues no matter in normal or blood deficiency rats. Compared to normal rats, partial contents of the compounds in blood deficiency rats' tissues at different time points had significant difference (P<0.05). This study was the first report about tissue distribution investigation in blood deficiency animals which is conducted by bleeding. And the results demonstrated that the five DBD components in normal and blood deficiency rats had obvious differences in some organs and time points, suggesting that the blood flow and perfusion rate of the organ were altered in blood deficiency animals. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. 3D-Membrane Stacks on Supported Membranes Composed of Diatom Lipids Induced by Long-Chain Polyamines.

    PubMed

    Gräb, Oliver; Abacilar, Maryna; Daus, Fabian; Geyer, Armin; Steinem, Claudia

    2016-10-04

    Long-chain polyamines (LCPAs) are intimately involved in the biomineralization process of diatoms taking place in silica deposition vesicles being acidic compartments surrounded by a lipid bilayer. Here, we addressed the question whether and how LCPAs interact with lipid membranes composed of glycerophospholipids and glyceroglycolipids mimicking the membranes of diatoms and higher plants. Solid supported lipid bilayers and monolayers containing the three major components that are unique in diatoms and higher plants, i.e., monogalactosyldiacylglycerol (MGDG), digalactosyldiacylglycerol (DGDG), and sulfoquinovosyldiacylglycerol (SQDG), were prepared by spreading small unilamellar vesicles. The integrity of the membranes was investigated by fluorescence microscopy and atomic force microscopy showing continuous flat bilayers and monolayers with small protrusions on top of the membrane. The addition of a synthetic polyamine composed of 13 amine groups separated by a propyl spacer (C3N13) results in flat but three-dimensional membrane stacks within minutes. The membrane stacks are connected with the underlying membrane as verified by fluorescence recovery after photobleaching experiments. Membrane stack formation was found to be independent of the lipid composition; i.e., neither glyceroglycolipids nor negatively charged lipids were required. However, the formation process was strongly dependent on the chain length of the polyamine. Whereas short polyamines such as the naturally occurring spermidine, spermine, and the synthetic polyamines C3N4 and C3N5 do not induce stack formation, those containing seven and more amine groups (C3N7, C3N13, and C3N18) do form membrane stacks. The observed stack formation might have implications for the stability and expansion of the silica deposition vesicle during valve and girdle band formation in diatoms.

  9. Bi-Component Droplet Combustion Experiment Designed

    NASA Technical Reports Server (NTRS)

    Dietrich, Daniel L.

    2002-01-01

    The combustion of liquid fuels is a major source of energy in the world today, and the majority of these fuels are burned in the form of a spray. The research at the NASA Glenn Research Center in droplet combustion has the overall goal of providing a better understanding of spray combustion by studying the smallest element in a spray, the single droplet. The Bi-Component Droplet Combustion Experiment (BCDCE) extends the work at Glenn from pure, or single-component, fuels to an idealized liquid fuel composed of two completely miscible components. The project is a collaborative effort between Glenn and Prof. B.D. Shaw of the University of California, Davis. The BCDCE project is planned to fly onboard the International Space Station in the Multi-User Droplet Combustion Apparatus. The unique feature of this experiment is that it will be the first droplet combustion experiment to perform a detailed characterization of the flow inside a liquid fuel droplet. The experiment will use a relatively new technique called Digital Particle Imaging Velocimetry (DPIV) to characterize the liquid flow. In this technique, very small (approx. 5-mm diameter) particles are dispersed throughout a liquid droplet. These particles are illuminated by a thin laser sheet. Images of the particle motion are recorded on a computer, which then tracks the motion of the particles to determine the flow characteristics.

  10. "Convince Me!" Valuing Multimodal Literacies and Composing Public Service Announcements

    ERIC Educational Resources Information Center

    Selfe, Richard J.; Selfe, Cynthia L.

    2008-01-01

    For some teachers, the increasing attention to digital and multimodal composing in English and Language Arts classrooms has brought into sharp relief the profession's investment in print as the primary means of expression. Although new forms of communication that combine words, still and moving images, and animation have begun to dominate digital…

  11. Composing with New Technology: Teacher Reflections on Learning Digital Video

    ERIC Educational Resources Information Center

    Bruce, David L.; Chiu, Ming Ming

    2015-01-01

    This study explores teachers' reflections on their learning to compose with new technologies in the context of teacher education and/or teacher professional development. English language arts (ELA) teachers (n = 240) in 15 courses learned to use digital video (DV), completed at least one DV group project, and responded to open-ended survey…

  12. Beyond the Enthymeme: Sorites, Critical Thinking, and the Composing Process.

    ERIC Educational Resources Information Center

    Hill, Carolyn

    A teacher presents a writing exercise designed to facilitate audience-directed, critical thinking during the process of composing, that starts students thinking in terms of sorites and enthymemes. Students first read a CIA manual, "Psychological Operations in Guerrilla Warfare," that instructs the Contra guerrillas in illegal acts and…

  13. Teaching Effective Communication Skills with ACE: Analyzing, Composing, & Evaluating

    ERIC Educational Resources Information Center

    Snyder, Lisa Gueldenzoph; Shwom, Barbara

    2011-01-01

    Most business communication classes teach students to use a writing process to compose effective documents. Students practice the process by applying it to various types of writing with various purposes-reports, presentations, bad news letters, persuasive memos, etc. However, unless students practice that process in other contexts outside of the…

  14. A Composer Teams with Student Lyricists to Make History Live.

    ERIC Educational Resources Information Center

    Lichtmann, Curtis; Lewis, Barbara

    1985-01-01

    The ballad is a primary medium for the reliving of historic events. Described is a joint music and social studies project in which junior high school students research historic events and write song lyrics. A composer gives a lesson on lyric writing, verse forms, and rhyme schemes. (RM)

  15. Composing the Career Portfolio and the Classed Subject

    ERIC Educational Resources Information Center

    Collin, Ross

    2012-01-01

    In this article, I consider how subjectivities are composed and assessed within the boundaries of a career-focused portfolio program. First, by examining how portfolio composition is taught in senior English courses, I identify the qualities of the subject position students are called to occupy. Next, I present discourse analyses of portfolio…

  16. Page composer to translate binary electrical data to optical form

    NASA Technical Reports Server (NTRS)

    Bailey, G. A.; Cosentino, L. S.

    1975-01-01

    Composer converts binary data to optical form for storage as hologram. Device consists of an array of deformable metal membranes controlled by MOSFET's. Device is fast, produces high contrast ratios, does not degrade with extended use, and can be addressed from diverse angles.

  17. Composing Styles as Predicted by Personality Style Testing.

    ERIC Educational Resources Information Center

    Polanski, Virginia G.

    To determine students' different but equally valid ways of dealing with the composing process, a college instructor developed a questionnaire assessing personality styles. The questionnaire distinguishes between (1) approaches to the writing process, (2) preferences for types of instruction, (3) preferences for types of writing and organizational…

  18. Beyond the Enthymeme: Sorites, Critical Thinking, and the Composing Process.

    ERIC Educational Resources Information Center

    Hill, Carolyn

    A teacher presents a writing exercise designed to facilitate audience-directed, critical thinking during the process of composing, that starts students thinking in terms of sorites and enthymemes. Students first read a CIA manual, "Psychological Operations in Guerrilla Warfare," that instructs the Contra guerrillas in illegal acts and…

  19. When Did Classic Composers Make Their Best Work?

    ERIC Educational Resources Information Center

    Franses, Philip Hans

    2016-01-01

    This Research Note shows that classic composers created their best works when they were at a similar age when creators in other domains did their best work, namely when they were at an age that represented around 60% of their life span. This finding is very similar to earlier results for painters and authors.

  20. Non-Logical Discourse: Key to the Composing Process?

    ERIC Educational Resources Information Center

    Poulsen, Richard C.

    One niche in which scholars have not looked for keys to the composing process is the sometimes illusory but vital area of nonlogical discourse, which includes fantasy, hallucination, dream, reverie, vision, trance, and meditation. Abundant evidence exists about the genesis, importance, and use of nonlogical discourse, but this evidence comes…

  1. Composing Cinquain Poems with Basic Parts of Speech.

    ERIC Educational Resources Information Center

    Gardner, Traci

    The writing program described in this lesson plan guides students in grades 3 through 8 in composing cinquain poems, a five-line form that uses the syllable count of two-four-six-eight-two. During the two 50-minute lessons, students will: describe the basic conventions of cinquain; interpret examples of cinquain; characterize the relationship…

  2. When Did Classic Composers Make Their Best Work?

    ERIC Educational Resources Information Center

    Franses, Philip Hans

    2016-01-01

    This Research Note shows that classic composers created their best works when they were at a similar age when creators in other domains did their best work, namely when they were at an age that represented around 60% of their life span. This finding is very similar to earlier results for painters and authors.

  3. Composing Songs for Teaching Science to College Students

    ERIC Educational Resources Information Center

    Yee Pinn Tsin, Isabel

    2015-01-01

    Recent studies have shown that songs may enhance learning as they function as mnemonic devices to increase memorability. In this research, songs based on the more difficult subtopics in Chemistry were composed, encompassing many formulas, equations and facts to be remembered. This technique of song composition can be used in any subject, any point…

  4. Teaching Effective Communication Skills with ACE: Analyzing, Composing, & Evaluating

    ERIC Educational Resources Information Center

    Snyder, Lisa Gueldenzoph; Shwom, Barbara

    2011-01-01

    Most business communication classes teach students to use a writing process to compose effective documents. Students practice the process by applying it to various types of writing with various purposes-reports, presentations, bad news letters, persuasive memos, etc. However, unless students practice that process in other contexts outside of the…

  5. "Composing Visual History: Using Powerpoint Slideshows to Explore Historical Narrative"

    ERIC Educational Resources Information Center

    Fehn, Bruce

    2007-01-01

    This article explores PowerPoint slideshow's capacities for introducing history teachers and students to the pictorial and digital turns for representing and narrating the past. Based upon this research, the author argues that image-dominated PowerPoint slideshow provides teachers and students with a unique and powerful tool for composing and…

  6. An Analysis of the Composing Processes of Three Black Adolescents.

    ERIC Educational Resources Information Center

    Fowler, Robert J.

    The study described in this paper was designed to compare the composing processes of three black adolescent females--a low, a moderate, and a high user of nonstandard dialect. After explaining the procedures used in selecting the subjects on the basis of their degree of usage of nonstandard dialect features, the paper describes the research…

  7. Preparing Performers and Composers for Effective Educational Work with Children

    ERIC Educational Resources Information Center

    Myers, David E.

    2005-01-01

    Music education programs stand to gain important benefits from the collaborative work of performing musicians with specialist music teachers and classroom teachers. To be effective, performers and composers must have their knowledge and skills for education cultivated within the context of their essential identities as musicians. Given…

  8. PSPTO_3380 and PSPTO_3381: A two-component system that influences the virulence of Pseudomonas syringae pv. tomato DC3000

    USDA-ARS?s Scientific Manuscript database

    A major factor in pathogenesis is the ability of the pathogen to respond and react to the host environment during the infection cycle. For bacteria, external stimuli are mainly sensed by two-component systems (TCS) composed of histidine kinases with external recognition domains and cytoplasmic respo...

  9. Composing Texts, Composing Lives.

    ERIC Educational Resources Information Center

    Perl, Sondra

    1994-01-01

    Using composition, reader response, critical, and feminist theories, a teacher demonstrates how adult students respond critically to literary texts and how teachers must critically analyze the texts of their teaching practice. Both students and teachers can use writing to bring their experiences to interpretation. (SK)

  10. Bactericidal Compounds Controlling Growth of the Plant Pathogen Pseudomonas syringae pv. actinidiae, Which Forms Biofilms Composed of a Novel Exopolysaccharide

    PubMed Central

    Ghods, Shirin; Sims, Ian M.; Moradali, M. Fata

    2015-01-01

    Pseudomonas syringae pv. actinidiae is the major cause of bacterial canker and is a severe threat to kiwifruit production worldwide. Many aspects of the disease caused by P. syringae pv. actinidiae, such as the pathogenicity-relevant formation of a biofilm composed of extracellular polymeric substances (EPSs), are still unknown. Here, a highly virulent strain of P. syringae pv. actinidiae, NZ V-13, was studied with respect to biofilm formation and architecture using a flow cell system combined with confocal laser scanning microscopy. The biofilm formed by P. syringae pv. actinidiae NZ V-13 was heterogeneous, consisting of a thin cellular base layer 5 μm thick and microcolonies with irregular structures. The major component of the EPSs produced by P. syringae pv. actinidiae NZ V-13 bacteria was isolated and identified to be an exopolysaccharide. Extensive compositional and structural analysis showed that rhamnose, fucose, and glucose were the major constituents, present at a ratio of 5:1.5:2. Experimental evidence that P. syringae pv. actinidiae NZ V-13 produces two polysaccharides, a branched α-d-rhamnan with side chains of terminal α-d-Fucf and an α-d-1,4-linked glucan, was obtained. The susceptibility of the cells in biofilms to kasugamycin and chlorine dioxide was assessed. About 64 and 73% of P. syringae pv. actinidiae NZ V-13 cells in biofilms were killed when kasugamycin and chlorine dioxide were used at 5 and 10 ppm, respectively. Kasugamycin inhibited the attachment of P. syringae pv. actinidiae NZ V-13 to solid surfaces at concentrations of 80 and 100 ppm. Kasugamycin was bacteriostatic against P. syringae pv. actinidiae NZ V-13 growth in the planktonic mode, with the MIC being 40 to 60 ppm and a bactericidal effect being found at 100 ppm. Here we studied the formation, architecture, and composition of P. syringae pv. actinidiae biofilms as well as used the biofilm as a model to assess the efficacies of bactericidal compounds. PMID:25841017

  11. Writers' Mental Representations of the Intended Audience and of the Rhetorical Purpose for Writing and the Strategies that They Employed when They Composed

    ERIC Educational Resources Information Center

    Wong, Albert T. Y.

    2005-01-01

    This paper studies the composing strategies employed by four advanced L2 writers when they wrote in an academic setting and the rhetorical context of composing, i.e. their mental representations of the intended audience and of the rhetorical purpose for writing. Four student-teachers majoring in English and attending a postgraduate teacher…

  12. Simvastatin-induced up-regulation of gap junctions composed of connexin 43 sensitize Leydig tumor cells to etoposide: an involvement of PKC pathway.

    PubMed

    Wang, Lingzhi; Fu, Yanni; Peng, Jianxin; Wu, Dengpan; Yu, Meiling; Xu, Chengfang; Wang, Qin; Tao, Liang

    2013-10-04

    Some of lipophilic statins have been reported to enhance toxicities induced by antineoplastic agents but the underling mechanism is unclear. The authors investigated the involvement of Cx43-mediated gap junction intercellular communication (GJIC) in the effect of simvastatin on the cellular toxicity induced by etoposide in this study. The results showed that a major component of the cytotoxicity of therapeutic levels of etoposide is mediated by gap junctions composed of connexin 43(Cx43) and simvastatin at the dosage which does not induce cytotoxicity enhances etoposide toxicity by increasing gap junction coupling. The augmentative effect of simvastatin on GJIC was related to the inhibition of PKC-mediated Cx43 phosphorylation at ser368 and subsequent enhancement of Cx43 membrane location induced by the agent. The present study suggests the possibility that upregulation of gap junctions may be utilized to increase the efficacy of anticancer chemotherapies. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  13. Modeling and Composing Scenario-Based Requirements with Aspects

    NASA Technical Reports Server (NTRS)

    Araujo, Joao; Whittle, Jon; Ki, Dae-Kyoo

    2004-01-01

    There has been significant recent interest, within the Aspect-Oriented Software Development (AOSD) community, in representing crosscutting concerns at various stages of the software lifecycle. However, most of these efforts have concentrated on the design and implementation phases. We focus in this paper on representing aspects during use case modeling. In particular, we focus on scenario-based requirements and show how to compose aspectual and non-aspectual scenarios so that they can be simulated as a whole. Non-aspectual scenarios are modeled as UML sequence diagram. Aspectual scenarios are modeled as Interaction Pattern Specifications (IPS). In order to simulate them, the scenarios are transformed into a set of executable state machines using an existing state machine synthesis algorithm. Previous work composed aspectual and non-aspectual scenarios at the sequence diagram level. In this paper, the composition is done at the state machine level.

  14. Syrtis Major Dune Field

    NASA Technical Reports Server (NTRS)

    2004-01-01

    20 December 2003

    This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows barchan sand dunes west of the Meroe Patera volcanic caldera in central Syrtis Major. The winds that shape these dunes blow from the right/upper right (northeast). The surface across which the dunes have traveled is probably composed of volcanic rocks; the dunes, too, may have volcanic materials, such as sand-sized grains of tephra-volcanic ash-in them. This October 2003 view is located near 7.4oN, 292.3oW, and covers an area 3 km (1.9 mi) wide. Sunlight illuminates the scene from the lower left.

  15. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 1 May 2002) The Science This image is from the region of Syrtis Major, which is dominated by a low-relief shield volcano. This area is believed to be an area of vigorous aeolian activity with strong winds in the east-west direction. The effects of these winds are observed as relatively bright streaks across the image, extending from topographic features such as craters. The brighter surface material probably indicates a smaller relative particle size in these areas, as finer particles have a higher albedo. The bright streaks seen off of craters are believed to have formed during dust storms. A raised crater rim can cause a reduction in the wind velocity directly behind it, which results in finer particles being preferentially deposited in this location. In the top half of the image, there is a large bright streak that crosses the entire image. There is no obvious topographic obstacle, therefore it is unclear whether it was formed in the same manner as described above. This image is located northwest of Nili Patera, a large caldera in Syrtis Major. Different flows from the caldera eruptions can be recognized as raised ridges, representing the edge of a flow lobe. The Story In the 17th century, Holland was in its Golden Age, a time of cultural greatness and immense political and economic influence in the world. In that time, lived a inquisitive person named Christian Huygens. As a boy, he loved to draw and to figure out problems in mathematics. As a man, he used these talents to make the first detailed drawings of the Martian surface - - only 50 years or so after Galileo first turned his telescope on Mars. Mars suddenly became something other than a small red dot in the sky. One of the drawings Huygens made was of a dark marking on the red planet's surface named Syrtis Major. Almost 350 years later, here we are with an orbiter that can show us this place in detail. Exploration lives! It's great we can study this area up close. In earlier periods of history

  16. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 1 May 2002) The Science This image is from the region of Syrtis Major, which is dominated by a low-relief shield volcano. This area is believed to be an area of vigorous aeolian activity with strong winds in the east-west direction. The effects of these winds are observed as relatively bright streaks across the image, extending from topographic features such as craters. The brighter surface material probably indicates a smaller relative particle size in these areas, as finer particles have a higher albedo. The bright streaks seen off of craters are believed to have formed during dust storms. A raised crater rim can cause a reduction in the wind velocity directly behind it, which results in finer particles being preferentially deposited in this location. In the top half of the image, there is a large bright streak that crosses the entire image. There is no obvious topographic obstacle, therefore it is unclear whether it was formed in the same manner as described above. This image is located northwest of Nili Patera, a large caldera in Syrtis Major. Different flows from the caldera eruptions can be recognized as raised ridges, representing the edge of a flow lobe. The Story In the 17th century, Holland was in its Golden Age, a time of cultural greatness and immense political and economic influence in the world. In that time, lived a inquisitive person named Christian Huygens. As a boy, he loved to draw and to figure out problems in mathematics. As a man, he used these talents to make the first detailed drawings of the Martian surface - - only 50 years or so after Galileo first turned his telescope on Mars. Mars suddenly became something other than a small red dot in the sky. One of the drawings Huygens made was of a dark marking on the red planet's surface named Syrtis Major. Almost 350 years later, here we are with an orbiter that can show us this place in detail. Exploration lives! It's great we can study this area up close. In earlier periods of history

  17. PLZT block data composers operated in differential phase mode

    NASA Technical Reports Server (NTRS)

    Drake, M. D.; Klingler, D. E.

    1973-01-01

    The use of a PLTZ block data composer as a matrix type phase modulator to record and process digital data by the differential phase mode in a holographic recording/processing system was investigated. The system has readout contrast ratios of between 10 and 15 to 1. The differential phase mode has the advantage that strain bias is not required and thickness and strain variations in the PLZT are cancelled out.

  18. 1. General view, outbuildings. The seed house composed of the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    1. General view, outbuildings. The seed house composed of the greenhouse, a storeroom (shed), a classroom (over a former ice pit), and a kitchen (over a cellar)-stands on the right. The barn roof is visible at center and the gift shop (former stable) stands on the left (Note the carved stone posts framing the gateway). - John Bartram House & Garden, Greenhouse, 54th Street & LIndbergh Boulevard, Philadelphia, Philadelphia County, PA

  19. A design study of a photorefractive page composer

    NASA Technical Reports Server (NTRS)

    1975-01-01

    A laboratory demonstration and preliminary system analysis of a page composer designed to have the dual advantages of low optical loss and small size, were reported. The current page composer is optically addressed and functions by virtue of optically induced refractive index changes in the active material. Laboratory demonstrations of the device were successfully performed using 10 x 10 bit and 128 x 128 bit data arrays. It was established that the only significant obstacle to the construction of a brass-board model working at megabit data rates is the lack of sensitivity of the photorefractive materials which were considered during the course of this study. Possible materials for future consideration are the photoplastics. While they have more than the required sensitivity, their stability and suitability for double exposure holography was not investigated. If a sufficiently sensitive material is found, then the photorefractive page composer could be built to perform in a highly efficient fashion which would result in a overall reduction of the size of the memory system and an easing of the requirements upon the sensitivity of the holographic recording material.

  20. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2002-01-01

    (Released 6 June 2002) The Science This image, located near the equator and 288W (72E), is near the southern edge of a low, broad volcanic feature called Syrtis Major. A close look at this image reveals a wrinkly texture that indicates a very rough surface that is associated with the lava flows that cover this region. On a larger scale, there are numerous bright streaks that trail topographic features such as craters. These bright streaks are in the wind shadows of the craters where dust that settles onto the surface is not as easily scoured away. It is important to note that these streaks are only bright in a relative sense to the surrounding image. Syrtis Major is one of the darkest regions on Mars and it is as dark as fresh basalt flows or dunes are on Earth. The Story Cool! It almost looks as if nature has 'painted' comets on the surface of Mars, using craters as comet cores and dust as streaky tails. Of course, that's just an illusion. As in many areas of Mars, the wind is behind the creation of such fantastic landforms. The natural phenomenon seen here gives this particular surface of Mars a very dynamic, fast-moving, almost luminous 'cosmic personality.' The bright, powdery-looking streaks of dust are in the 'wind shadows' of craters, where dust that settles onto the surface is not as easily scoured away. That's because the wind moves across the land in a particular direction, and a raised surface like the rim of a crater 'protects' dust from being completely blown away on the other side. The raised landforms basically act as a buffer. From the streaks seen above, you can tell the wind was blowing in a northeast to southwest direction. Why are the streaks so bright? Because they contrast with the really dark underlying terrain in this volcanic area of Mars. Syrtis Major is one of the darkest regions on Mars because it is made of basalt. Basalt is typically dark gray or black, and forms when a certain type of molten lava cools. The meaning of the word basalt

  1. Syrtis Major

    NASA Technical Reports Server (NTRS)

    2004-01-01

    [figure removed for brevity, see original site]

    Released 18 May 2004 This image of Syrtis Major was acquired August 20, 2002, during northern spring.

    The THEMIS VIS camera is capable of capturing color images of the martian surface using its five different color filters. In this mode of operation, the spatial resolution and coverage of the image must be reduced to accommodate the additional data volume produced from the use of multiple filters. To make a color image, three of the five filter images (each in grayscale) are selected. Each is contrast enhanced and then converted to a red, green, or blue intensity image. These three images are then combined to produce a full color, single image. Because the THEMIS color filters don't span the full range of colors seen by the human eye, a color THEMIS image does not represent true color. Also, because each single-filter image is contrast enhanced before inclusion in the three-color image, the apparent color variation of the scene is exaggerated. Nevertheless, the color variation that does appear is representative of some change in color, however subtle, in the actual scene. Note that the long edges of THEMIS color images typically contain color artifacts that do not represent surface variation.

    Image information: VIS instrument. Latitude 12.8, Longitude 79.5 East (280.5 West). 38 meter/pixel resolution.

    Note: this THEMIS visual image has not been radiometrically nor geometrically calibrated for this preliminary release. An empirical correction has been performed to remove instrumental effects. A linear shift has been applied in the cross-track and down-track direction to approximate spacecraft and planetary motion. Fully calibrated and geometrically projected images will be released through the Planetary Data System in accordance with Project policies at a later time.

    NASA's Jet Propulsion Laboratory manages the 2001 Mars Odyssey mission for NASA's Office of Space Science, Washington, D.C. The

  2. Photonic quantum well composed of photonic crystal and quasicrystal

    NASA Astrophysics Data System (ADS)

    Xu, Shaohui; Zhu, Yiping; Wang, Lianwei; Yang, Pingxiong; Chu, Paul K.

    2014-02-01

    A photonic quantum well structure composed of photonic crystal and Fibonacci quasicrystal is investigated by analyzing the transmission spectra and electric field distributions. The defect band in the photonic well can form confined quantized photonic states that can change in the band-gap of the photonic barriers by varying the thickness ratio of the two stacking layers. The number of confined states can be tuned by adjusting the period of the photonic well. The photons traverse the photonic quantum well by resonance tunneling and the coupling effect leads to the high transmission intensity of the confined photonic states.

  3. The clinician's guide to composing effective business plans.

    PubMed

    Ettinger, Alan B; Blondell, Catherine

    2011-01-01

    In today's challenging healthcare environment, clinicians need to understand the fundamentals of financial analysis, which are the underpinnings of their clinical programs, especially when seeking administrative support for new initiatives. The business plan for new clinical program initiatives is composed of diverse elements such as the mission statement, market and competitive analyses, operations plan, and financial analysis. Armed with a basic knowledge of financial analysis of clinical programs, as well as forward-looking analysis of an initiative's added value, the healthcare provider can work much more effectively with administration in developing or creating new healthcare program initiatives.

  4. Nonmetallic Arc Electrode Composed of Water and Ceramic

    NASA Astrophysics Data System (ADS)

    Deguchi, Mikio

    2008-09-01

    A novel nonmetallic arc electrode named the water-ceramic electrode, which is a combination of water and a ceramic component, is demonstrated. In the water-ceramic electrode, water and the ceramic component are exposed to the discharge space. The metal electrode is completely covered with water and is not exposed to the arc plasma. Under discharge, the ceramic component locally becomes incandescent, where the arc column terminates. The functions of the water and ceramic component are considered to be analogous to those of molten wax and the wick of a candle, respectively. The most remarkable feature of the water-ceramic electrode is that the ceramic component, which is a natural insulator and a representative heatproof material, becomes easily incandescent and locally melts with only an electric discharge.

  5. Component Based Electronic Voting Systems

    NASA Astrophysics Data System (ADS)

    Lundin, David

    An electronic voting system may be said to be composed of a number of components, each of which has a number of properties. One of the most attractive effects of this way of thinking is that each component may have an attached in-depth threat analysis and verification strategy. Furthermore, the need to include the full system when making changes to a component is minimised and a model at this level can be turned into a lower-level implementation model where changes can cascade to as few parts of the implementation as possible.

  6. Medical lighting composed of LED arrays for surgical operation

    NASA Astrophysics Data System (ADS)

    Shimada, Junichi; Kawakami, Yoichi; Fujita, Shigeo

    2001-05-01

    Everywhere in the world, the highest quality and quantity of lighting is required during the surgical operations. However, the surgical approach has had many types and various angles, common ceiling surgical halogen lighting system cannot provide an adequate amount of beams because the surgeons' heads hinder the illuminations from reaching the operation field. Here, we newly design surgical lighting system composed of white LEDs equipped on both sides of goggles, which controls the lighting beams to the gazing point. With this system, it is just needed for surgeons to wear light plastic goggles with high quality LEDs made by Nichia. In fact, we have succeeded in the first internal shunt operation in the left forearm using the surgical LED lighting system on 11th Sept 2000. The electrical power for the system was supplied from lithium-ion battery for 2 hours. Since the white LEDs used were composed of InGaN- blue-emitters and YAG-yellow-phosphors, the color rendering property was not sufficient in the reddish colors. Therefore, in the next approach, it is very important to develop the spectral distribution of white LED to render inherent color of raw flesh such as skin, blood, fat tissue and internal organs.

  7. Efficient Non-interactive Universally Composable String-Commitment Schemes

    NASA Astrophysics Data System (ADS)

    Nishimaki, Ryo; Fujisaki, Eiichiro; Tanaka, Keisuke

    The universal composability (UC) for commitment is a very strong security notion. It guarantees that commitment schemes remain secure even if they are composed with arbitrary protocols and polynomially many copies of the schemes are run concurrently. Several UC commitment schemes in the common reference string (CRS) model have been proposed, but, they are either interactive commitment or bit-commitment (not string-commitment) schemes. We propose new non-interactive string-commitment schemes that achieve UC security in the CRS model assuming the difficulty of the decisional Diffie-Hellman problem or the decisional composite residuosity problem, but our schemes are not reusable. The main building blocks of our constructions are all-but-one trapdoor functions (ABO-TDFs) introduced by Peikert and Waters in STOC 2008 to construct secure public-key encryption schemes. Our main idea is to use the homomorphic properties of the function indices of the all-but-one trapdoor functions and to extend the functions to probabilistic ones by using re-randomization of ciphertexts. This is a new application of ABO-TDFs.

  8. Surgical operation using lighting goggle composed of white LED arrays

    NASA Astrophysics Data System (ADS)

    Shimada, Junichi; Kawakami, Yoichi; Fujita, Shigeo

    2001-12-01

    Everywhere in the world, the highest quality and quantity of lighting is required during the surgical operations. However, the surgical approach has had many types and various angles, common ceiling surgical halogen lighting system cannot provide an adequate amount of beams because the surgeons' heads hinder the illuminations from reaching the operation field. Here, we newly design surgical lighting system composed of white LEDs equipped on both sides of goggles, which controls the lighting beams to the gazing point. With this system, it is just needed for surgeons to wear light plastic goggles with high quality LEDs made by Nichia. In fact, we have succeeded in the first internal shunt operation in the left forearm using the surgical LED lighting system on 11th Sept 2000. The electrical power for the system was supplied from lithium-ion battery for 2 hours. Since the white LEDs used were composed of InGaN-blue-emitters and YAG-yellow-phosphors, the color rendering property was not sufficient in the reddish colors. Therefore, in the next approach, it is very important to develop the spectral distribution of white LED to render inherent color of raw flesh such as skin, blood, fat tissue and internal organs. To improve the color rendering in red colors, some adjustments should be given in the fluorescents layers. Design of goggle is also very important for cutting into the real practical market of white LEDs.

  9. Domain-Specific Languages for Composing Signature Discovery Workflows

    SciTech Connect

    Jacob, Ferosh; Gray, Jeff; Wynne, Adam S.; Liu, Yan; Baker, Nathan A.

    2012-10-23

    Domain-agnostic signature discovery entails investigation across multiple scientific disciplines. The breadth and cross-disciplinary nature of this work requires that existing executables be integrated with new capabilities into workflows, representing a wide range of user tasks. An algorithm may be written in multiple programming languages for various hardware platforms, and so workflow composition requires integrating executables from any number of remote hosts. This raises an engineering issue on how to generate web service wrappers for these heterogeneous executables and to compose them into a scientific workflow environment (e.g., Taverna). In this paper, we introduce two simple Domain-Specific Languages (DSLs) to automate these processes. Our Service Description Language (SDL) describes key elements of a signature discovery service and automatically generates its implementation code. The Workflow Description Language (WDL) describes the pipeline of services and generates deployable artifacts for the Taverna workflow management system. We demonstrate our approach with a real-world workflow composed of services wrapping remote executables.

  10. A ribozyme composed of only two different nucleotides.

    PubMed

    Reader, John S; Joyce, Gerald F

    RNA molecules are thought to have been prominent in the early history of life on Earth because of their ability both to encode genetic information and to exhibit catalytic function. The modern genetic alphabet relies on two sets of complementary base pairs to store genetic information. However, owing to the chemical instability of cytosine, which readily deaminates to uracil, a primitive genetic system composed of the bases A, U, G and C may have been difficult to establish. It has been suggested that the first genetic material instead contained only a single base-pairing unit. Here we show that binary informational macromolecules, containing only two different nucleotide subunits, can act as catalysts. In vitro evolution was used to obtain ligase ribozymes composed of only 2,6-diaminopurine and uracil nucleotides, which catalyse the template-directed joining of two RNA molecules, one bearing a 5'-triphosphate and the other a 3'-hydroxyl. The active conformation of the fastest isolated ribozyme had a catalytic rate that was about 36,000-fold faster than the uncatalysed rate of reaction. This ribozyme is specific for the formation of biologically relevant 3',5'-phosphodiester linkages.

  11. Principal components analysis.

    PubMed

    Groth, Detlef; Hartmann, Stefanie; Klie, Sebastian; Selbig, Joachim

    2013-01-01

    Principal components analysis (PCA) is a standard tool in multivariate data analysis to reduce the number of dimensions, while retaining as much as possible of the data's variation. Instead of investigating thousands of original variables, the first few components containing the majority of the data's variation are explored. The visualization and statistical analysis of these new variables, the principal components, can help to find similarities and differences between samples. Important original variables that are the major contributors to the first few components can be discovered as well.This chapter seeks to deliver a conceptual understanding of PCA as well as a mathematical description. We describe how PCA can be used to analyze different datasets, and we include practical code examples. Possible shortcomings of the methodology and ways to overcome these problems are also discussed.

  12. [TRANSPORT OF OXYGEN DURING GEOMETRICAL RECONSTRUCTION OF THE LEFT VENTRICLE IN CONJUNCTION WITH CORONARY ARTERY BYPASS GRAFTING AND USING OF HIGH THORACIC EPIDURAL ANESTHESIA AS A MAJOR COMPONENT OF GENERAL ANAESTHESIA].

    PubMed

    Zatevahina, M V; Farzutdinov, A F; Rahimov, A A; Makrushin, I M; Kvachantiradze, G Y

    2015-01-01

    The purpose of the study is to examine the perioperative dynamics of strategic blood oxygen transport indicators: delivery (DO2), consumption (VO2), the coefficient of oxygen uptake (CUO2) and their composition, as well as the dynamics of blood lactate indicators in patients with ischaemic heart disease (IHD) who underwent surgery under cardiopulmonary bypass with high thoracic epidural anaesthesia (HTEA) as the main component of anesthesia. Research was conducted in 30 patients with a critical degree of operational risk, during the correction of post-infarction heart aneurysmn using the V. Dor method in combination with coronary artery bypass grafting. The strategic blood oxygen transport indicators (delivery, consumption and the oxygen uptake coefficient) showed a statistically significant decrease compared to the physiological norm and to the initial data at two points of the research: the intubation of the trachea and during cardiopulmonary bypass. The system components of oxygen were influenced at problematic stages by the dynamics of SvO2 (increase), AVD (decrease), hemodilution withe fall of the HIb- in the process of JR in the persence of superficial hypothermia. The maintenance of optimal CA in the context of HTEA, combined with a balanced volemic load and a minimized cardiotonic support ensured the stabilisation of strategic blood oxygen transport indicators aithe postperfusion stage and during the immediate postoperative period The article is dedicated to the study of strategic blood oxygen transport indicators and their components during the operation of geometric reconstruc-tion of the left ventricle combined with coronary artery-bypass using cardiopulmonary bypass and with high thoracic epidural anesthesia as the main component of general anaesthesia. The analysis has covered the stagewise delivery dynamics, consumption and the oxygen uptake coefficient at II stages of the operation and of the immediate postoperative period. The study has ident (fled

  13. Music and the Nature: Input of the Czech Composers

    NASA Astrophysics Data System (ADS)

    Nemec, Vaclav; Nemcova, Lidmila

    2014-05-01

    Extraordinary occasions for art of any kind - music, creative graphic and plastic arts, literature (classic, modern incl. science fiction), theatre, cinema, etc. - exist to harmonise individual personal interests with those of the humanity well-being and of the Nature and also to cultivate individual spirituality and the appropriate values. Arts can be applied as irreplaceable means for making any human being better, for improving his sense for solidarity and for increasing his ethical sensibility. An interest for the art should be cultivated already since the childhood. - How much of inspiration for numerous composers all over the world has been given by the Nature, how much of inspiration for people who by listening to such a music are increasing nobility of their behaviour as well as their friendly approach to the Nature. - Many classical music works have been written with a strong inspiration by the Nature itself from the past until today. The actual Year of the Czech Music gives the possibility to present the most famous Czech composers inspired by the Nature (selected examples only): Bedřich Smetana (1824 - 1884): At the sea shore - a concert etude for piano inspired by his stay in Göteborg (Sweden); Vltava (Moldau) - a symphonic poem from the cycle "My country" inspired by the river crossing Bohemia from the South to Prague; From the Bohemian woods and meadows - another symphonic poem from the same cycle. Antonín Dvořák (1841 - 1904): V přírodě (In the Nature) - a work for orchestra Leoš Janáček (1854 - 1928): Příhody li\\vsky Bystrou\\vsky (The Cunning Little Vixen) - an opera situated mostly in a forest. Josef Bohuslav Foerster (1859-1951): Velké širé rodné lány (Big large native fields) - a choir for men singers inspired by the nature in the region where the composer as a boy from Prague was visiting his grand-father. Vítězslav Novák (1870 - 1949): In Tatra mountains - a symphonic poem expressing the author's passion for the famous

  14. Structural relaxation in dense liquids composed of anisotropic particles.

    PubMed

    Shen, Tianqi; Schreck, Carl; Chakraborty, Bulbul; Freed, Denise E; O'Hern, Corey S

    2012-10-01

    We perform extensive molecular dynamics simulations of dense liquids composed of bidisperse dimer- and ellipse-shaped particles in two dimensions that interact via purely repulsive contact forces. We measure the structural relaxation times obtained from the long-time α decay of the self part of the intermediate scattering function for the translational and rotational degrees of freedom (DOF) as a function of packing fraction φ, temperature T, and aspect ratio α. We are able to collapse the packing-fraction and temperature-dependent structural relaxation times for disks, and dimers and ellipses over a wide range of α, onto a universal scaling function F(±)(|φ-φ(0)|,T,α), which is similar to that employed in previous studies of dense liquids composed of purely repulsive spherical particles in three dimensions. F(±) for both the translational and rotational DOF are characterized by the α-dependent scaling exponents μ and δ and packing fraction φ(0)(α) that signals the crossover in the scaling form F(±) from hard-particle dynamics to super-Arrhenius behavior for each aspect ratio. We find that the fragility of structural relaxation at φ(0), m(φ(0)), decreases monotonically with increasing aspect ratio for both ellipses and dimers. For α>α(p), where α(p) is the location of the peak in the packing fraction φ(J) at jamming onset, the rotational DOF are strongly coupled to the translational DOF, and the dynamic scaling exponents and φ(0) are similar for the rotational and translational DOF. For 1<α<α(p), the translational DOF become frozen at higher temperatures than the rotational DOF, and φ(0) for the rotational degrees of freedom increases above φ(J). Moreover, the results for the slow dynamics of dense liquids composed of dimer- and ellipse-shaped particles are qualitatively the same, despite the fact that zero-temperature static packings of dimers are isostatic, while static packings of ellipses are hypostatic. Thus, zero-temperature contact

  15. Holographic material composed by dichromated gelatin with vanilla

    NASA Astrophysics Data System (ADS)

    Olivares-Perez, Arturo; Ortiz-Gutierrez, Mauricio; Arroyo-Correa, Gabriel; Ibarra, Juan C.; Fuentes-Tapia, Israel

    2003-05-01

    Dichromate gelatins are well known as good holographic materials. Now by doping this material with synthetic vanilla, a change in the spectral amplitude response is obtained. Due that the maximum absorption spectra from the dichromate ammonium is localized in UV region at λ = 390. With vanilla, the maximum spectral response is similar, exception for its optical density, reducing the exposure factor the order of 2 times. An important property with this mixture is the high resistance to humidity of the ambient. We have recorded some diffraciotn gratings, using the argon laser λ = 488 nm, which show good diffraction (grooves). A characteristic of the developed process is its simply, only using solution composed of water and isopropyl alcohol, this process takes approximately one hour.

  16. COMPOSE-HPC: A Transformational Approach to Exascale

    SciTech Connect

    Bernholdt, David E; Allan, Benjamin A.; Armstrong, Robert C.; Chavarria-Miranda, Daniel; Dahlgren, Tamara L.; Elwasif, Wael R; Epperly, Tom; Foley, Samantha S; Hulette, Geoffrey C.; Krishnamoorthy, Sriram; Prantl, Adrian; Panyala, Ajay; Sottile, Matthew

    2012-04-01

    The goal of the COMPOSE-HPC project is to 'democratize' tools for automatic transformation of program source code so that it becomes tractable for the developers of scientific applications to create and use their own transformations reliably and safely. This paper describes our approach to this challenge, the creation of the KNOT tool chain, which includes tools for the creation of annotation languages to control the transformations (PAUL), to perform the transformations (ROTE), and optimization and code generation (BRAID), which can be used individually and in combination. We also provide examples of current and future uses of the KNOT tools, which include transforming code to use different programming models and environments, providing tests that can be used to detect errors in software or its execution, as well as composition of software written in different programming languages, or with different threading patterns.

  17. Lyapunov instability of fluids composed of rigid diatomic molecules

    NASA Astrophysics Data System (ADS)

    Borzsák, István; Posch, H. A.; Baranyai, András

    1996-04-01

    We study the Lyapunov instability of a two-dimensional fluid composed of rigid diatomic molecules, with two interaction sites each, and interacting with a Weeks-Chandler-Anderson site-site potential. We compute full spectra of Lyapunov exponents for such a molecular system. These exponents characterize the rate at which neighboring trajectories diverge or converge exponentially in phase space. Qualitative different degrees of freedom, such as rotation and translation, affect the Lyapunov spectrum differently. We study this phenomenon by systematically varying the molecular shape and the density. We define and evaluate ``rotation numbers'' measuring the time averaged modulus of the angular velocities for vectors connecting perturbed satellite trajectories with an unperturbed reference trajectory in phase space. For reasons of comparison, various time correlation functions for translation and rotation are computed. The relative dynamics of perturbed trajectories is also studied in certain subspaces of the phase space associated with center-of-mass and orientational molecular motion.

  18. Second-order planar gradiometer composed of concentric superconductive loops

    SciTech Connect

    Kuriki, S.; Isobe, Y.; Mizutani, Y.

    1987-01-15

    A planar gradiometer composed of three concentric superconductive loops is analyzed. The gradiometer performs the second derivative with a rotational symmetry in a form of partial/sup 2/B/sub z//partialr/sup 2/, where r/sup 2/ = x/sup 2/+y/sup 2/. In response to the biomagnetic field generated by a current dipole, an isoflux line distribution which resembles well the magnetic field distribution is obtained. The location and the strength of the current-dipole source can readily be estimated from the isoflux pattern. Reduction of the magnetic field noise from distant sources with respect to the signal of a near source is calculated to be comparable with that of conventional axial gradiometers.

  19. Exocytotic fusion pores are composed of both lipids and proteins

    PubMed Central

    Bao, Huan; Goldschen-Ohm, Marcel; Jeggle, Pia; Chanda, Baron; Edwardson, J Michael; Chapman, Edwin R

    2016-01-01

    During exocytosis, fusion pores form the first aqueous connection that allows escape of neurotransmitters and hormones from secretory vesicles. Although it is well established that SNARE proteins catalyze fusion, the structure and composition of fusion pores remain unknown. Here, we exploited the rigid framework and defined size of nanodiscs to interrogate the properties of reconstituted fusion pores, using the neurotransmitter glutamate as a content-mixing marker. Efficient Ca2+-stimulated bilayer fusion, and glutamate release, occurred with approximately two molecules of mouse synaptobrevin 2 reconstituted into ~6-nm nanodiscs. The transmembrane domains of SNARE proteins assumed distinct roles in lipid mixing versus content release and were exposed to polar solvent during fusion. Additionally, tryptophan substitutions at specific positions in these transmembrane domains decreased glutamate flux. Together, these findings indicate that the fusion pore is a hybrid structure composed of both lipids and proteins. PMID:26656855

  20. Competitive inhibition of human organic anion transporters 1 (SLC22A6), 3 (SLC22A8) and 4 (SLC22A11) by major components of the medicinal herb Salvia miltiorrhiza (Danshen).

    PubMed

    Wang, Li; Sweet, Douglas H

    2013-01-01

    When herbal products are used in combination therapy with drugs, alterations in pharmacokinetics, pharmacodynamics, and toxicity can result. Many active components of herbal products are organic anions, and human organic anion transporter 1 (hOAT1, SLC22A6), hOAT3 (SLC22A8), and hOAT4 (SLC22A11) have been identified as potential sites of drug-drug interactions. Therefore, we assessed the effects of lithospermic acid (LSA), rosmarinic acid (RMA), salvianolic acid A (SAA), salvianolic acid B (SAB), and tanshinol (TSL), components of the herbal medicine Danshen, on the function of these transporters. Kinetic analysis demonstrated a competitive mechanism of inhibition for all five. K(i) values (µM) were estimated as 20.8 ± 2.1 (LSA), 0.35 ± 0.06 (RMA), 5.6 ± 0.3 (SAA), 22.2 ± 1.9 (SAB), and 40.4 ± 12.9 (TSL) on hOAT1 and as 0.59 ± 0.26 (LSA), 0.55 ± 0.25 (RMA), 0.16 ± 0.03 (SAA), 19.8 ± 8.4 (SAB), and 8.6 ± 3.3 (TSL) on hOAT3. No significant inhibition of hOAT4 activity by TSL was observed. Using published human pharmacokinetic values, unbound C(max)/K(i) ratios were calculated as an indicator of in vivo drug-drug interaction potential. Analysis indicated a strong interaction potential for RMA and TSL on both hOAT1 and hOAT3 and for LSA on hOAT3. Thus, herb-drug interactions may occur in vivo in situations of co-administration of Danshen and clinical therapeutics known to be hOAT1/hOAT3 substrates.